Method for producing proteins, and protein production-enhanced aspergillus oryzae

Abstract

To produce a tasty high-protein food material simply and quickly anytime and anywhere from a nitrogen compound without requiring a large-sized device in order to significantly increase a production amount of proteins.SOLUTION: Provided are a method for producing proteins including a step of bringing Aspergillus oryzae, in which at least one nucleic acid derived from bacteria of the same genus and species as a host is introduced from outside the cell and a gdhA gene is highly expressed by at least one of the introduced nucleic acid, in contact with a nitrogen compound to perform solid culture, and a protein production-enhanced Aspergillus oryzae in which at least one nucleic acid derived from bacteria of the same genus and species as a host is introduced from outside the cell and a gdhA gene is highly expressed by at least one of the introduced nucleic acid, and / or a cultured product thereof.SELECTED DRAWING: Figure 4

Description

[Technical Field]

[0001] The present invention relates to a method for producing a protein and to an aspergillus oryzae having enhanced protein production. [Background technology]

[0002] With the rapid increase in the world population and economic growth in emerging countries, demand for meat and other proteins is expected to increase dramatically. The main sources of protein are grains and pulses, with 500 million tons of rice, 700 million tons of wheat, 1.1 billion tons of corn, and 300 million tons of soybeans produced annually, some of which is also used for meat production. Because the arable land area required for producing these agricultural products cannot be expanded in the short term, there are concerns about the occurrence of a "global protein crisis," in which it becomes difficult internationally to supply protein to meet demand.

[0003] In recent years, growing interest in the environmental impact of meat production and animal welfare has led to the development of edible insects and cultured meat as alternative protein sources. These methods produce protein from organic nitrogen sources such as amino acids, but because organic nitrogen sources are simply the breakdown and use of proteins produced by other organisms, technology to efficiently produce protein from inorganic nitrogen sources is essential to solving the social issue of global protein shortages.

[0004] Protein production from inorganic nitrogen sources requires the use of organisms capable of nitrogen assimilation, and the only available method is to use plants or microorganisms. Plant-based methods include the use of transgenic plants that accumulate high levels of amino acids, and a method for improving rice productivity by introducing the fungal gdhA gene into cultivated rice (Patent Documents 1 and 2, Non-Patent Document 1). Microorganism-based methods include the use of yeast bioproteins known as single-cell proteins (Patent Document 3, Non-Patent Document 2), the use of filamentous fungal bioproteins known as mycoproteins (Patent Documents 4 and 7, Non-Patent Documents 3-4), and methods for mass-producing proteins in koji mold by co-cultivation with a nitrogen source or self-cloning (Patent Documents 5, 6, 8, Non-Patent Documents 5-6).

[0005] Furthermore, research has been conducted on nitrogen metabolic regulation to understand the competitive ability of Dekkera bruxellensis in fermentation environments (Non-Patent Document 7), and analysis of amino acids remaining without being assimilated by koji mold during the koji-making process (Non-Patent Document 8), which may be applicable to protein production from inorganic nitrogen sources. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Laid-Open No. 2001-238556 [Patent Document 2] International Publication No. 2003 / 000041 [Patent Document 3] Japanese Patent Application Publication No. 2024-045697 [Patent Document 4] Special Publication No. 2002-510497 [Patent Document 5] Japanese Patent Application Publication No. 53-075080 [Patent Document 6] Japanese Patent Application Laid-Open No. 2013-158289 [Patent Document 7] Patent Publication No. 2021-040512 [Patent Document 8] Japanese Patent Application Publication No. 11-243965 [Non-patent literature]

[0007] [Non-Patent Document 1] Zhang H et al (2016), Plant Product Sci 19, 267-278 doi:10.1080 / 1343943X.2015.1133237 [Non-patent document 2] Yamada, Koichi (1974) Single Cell Protein and Food Issues, Journal of the Japanese Society of Food Science and Technology, Vol. 21, No. 4, 188-195 [Non-patent document 3] Mori, Katsumi et al. (1986) Protein enrichment of potato starch cake by solid-state culture, Food Research Institute Research Report No. 48, 15-20. [Non-patent document 4] Kinichiro Sakaguchi et al., Studies on protein synthesis by filamentous fungi (Part 1), Journal of the Agricultural Chemical Society of Japan 24, 77-79, 1950 [Non-Patent Document 5] Abe Hidenori et al., Protein production from potato starch cake by solid culture of koji mold, Takikawa Livestock Research Station Research Report, No. 25, 11-18, 1990 [Non-patent document 6] Abe Hidenori et al., Microbial protein production from potato starch cake using koji mold in a rotary solid state fermentation device, Research Report of the Hokkaido Prefectural Livestock Experiment Station No. 24, 25-27, 2001 [Non-Patent Document 7] de Barros Pita W et al (2013) Antonie van Leeuwenhoek 104:855-868. doi:10.1007 / s10482-013-9998-x [Non-patent document 8] Toshihiko Ito et al., Estimation of Amino Acid Content in Sake Koji and Amino Acid Production by Koji Mold, Journal of Sake Brewing, 108, 453-460, 2013 Summary of the Invention [Problem to be solved by the invention]

[0008] However, most of the microbial protein production that has been put into practical use to date has relied on large-scale culture equipment, but because culture equipment capable of stirring and aeration requires significant installation costs, it is difficult to develop equipment large enough to expand protein production on a global scale.

[0009] The present invention aims to produce delicious high-protein food materials from nitrogen compounds easily and quickly, anytime and anywhere, without the need for large-scale equipment, in order to significantly increase protein production. [Means for solving the problem]

[0010] Therefore, the present inventors investigated a process for producing proteins from nitrogenous compounds by applying the traditional koji-making method that has been practiced in Japan since ancient times.

[0011] The present inventors discovered that protein production is possible by culturing koji mold in the presence of nitrogen compounds on grains, and that protein productivity can be further improved by using koji mold that highly expresses the gdhA gene through the extracellular introduction of nucleic acids derived from a microorganism of the same genus and species as the host.

[0012] The present invention provides the following [1] to

[10] . [1] A koji mold having enhanced protein production, and / or a culture thereof, into which at least one nucleic acid derived from a microorganism of the same genus and species as the host has been introduced from outside the cell, and in which at least one of the introduced nucleic acids highly expresses a glutamate dehydrogenase gene. [2] The koji mold having enhanced protein production according to [1], and / or a culture thereof, wherein the glutamate dehydrogenase gene comprises a polynucleotide sequence that has 70% or more identity to the amino acid sequence of SEQ ID NO: 2 and encodes an amino acid sequence having glutamate dehydrogenase activity. [3] The koji mold of [1] or [2], wherein the koji mold belongs to the genus Aspergillus, and / or a culture thereof for enhanced protein production. [4] A method for producing a protein, comprising a step of contacting a koji mold, into which at least one nucleic acid derived from a microorganism of the same genus and species as the host has been introduced from outside the cell, with a nitrogen compound and culturing the koji mold in a solid state, the koji mold causing high expression of a glutamate dehydrogenase gene by at least one of the introduced nucleic acids. [5] The method described in [4], wherein the glutamate dehydrogenase gene comprises a polynucleotide sequence that has 70% or more identity to the amino acid sequence of SEQ ID NO: 2 and encodes an amino acid sequence having glutamate dehydrogenase activity. [6] The method according to [4] or [5], wherein the nitrogen compound is one or more selected from the group consisting of ammonium salts, nitrates, ammonia, and urea. [7] The method according to any one of [4] to [6], wherein the culturing is carried out by further contacting the culture with grain. [8] The method according to [7], wherein the grain is rice. [9] A method for producing a food or feed composition, comprising the steps of producing a protein by the method according to any one of [4] to [8] and using the protein in the production of food or feed.

[10] A method for producing a protein, comprising the steps of extracellularly introducing at least one nucleic acid derived from a microorganism of the same genus and species as the host into a koji mold, and using at least one of the introduced nucleic acids to highly express a glutamate dehydrogenase gene to obtain a koji mold with enhanced protein production, and contacting the koji mold with enhanced protein production with a nitrogen compound and culturing it in a solid state. [Effects of the Invention]

[0013] According to the present invention, protein productivity using koji mold can be improved. The proteins produced by this invention can be used as new food and feed ingredients. Microorganisms improved by self-cloning do not fall under the category of genetic modification under the Cartagena Protocol, and therefore can be used in the environment in the same way as ordinary microorganisms. [Brief explanation of the drawings]

[0014] [Figure 1]FIG. 1 is a diagram showing the nucleotide sequence of the gdhA gene (Locus tag AO090023000923: SEQ ID NO: 1). [Figure 2] FIG. 2 shows the amino acid sequence (SEQ ID NO: 2) deduced from the base sequence of SEQ ID NO: 1. [Figure 3] FIG. 3 shows the nucleotide sequence of the DNA fragment containing the gdhA expression cassette prepared in Example 3. [Figure 4] FIG. 4 is a graph showing the analysis results of a culture obtained by culturing koji mold on rice to which an ammonium salt had been added. DETAILED DESCRIPTION OF THE INVENTION

[0015] The present invention relates to koji molds with enhanced protein production that overexpress a glutamate dehydrogenase gene, and / or cultures thereof, as well as a method for producing a protein, comprising contacting the koji molds with overexpression of the glutamate dehydrogenase gene with a nitrogenous compound and culturing them on a solid state. More specifically, the methods of the present invention use koji molds (hereinafter also referred to as koji molds with enhanced protein production) into which at least one nucleic acid derived from a microorganism of the same genus and species as the host has been introduced extracellularly, and in which the expression level of the glutamate dehydrogenase gene, more preferably the gdhA gene, has been increased by at least one of the introduced nucleic acids compared to that before introduction (wild-type strain). The expression level of the glutamate dehydrogenase gene can be measured by standard methods (e.g., real-time PCR, high-speed sequencer) or can be indirectly assessed by measuring the expression level of glutamate dehydrogenase protein (e.g., ELISA). For example, in the case of an evaluation method using ELISA, the expression level of glutamate dehydrogenase in the protein-enhanced koji mold is preferably increased by 10% or more, and more preferably by 20% or more, compared to the wild-type strain before the introduction of the nucleic acid to be expressed. The present invention enables efficient protein production compared to when a wild-type koji mold strain is used, by contacting the protein-enhanced koji mold with a nitrogen compound and culturing it on a solid state. The nucleic acid to be introduced is not particularly limited as long as it can highly express the gdhA gene, and examples include gdhA genes, promoters, transcription factors, and nucleic acids derived from other hosts and microorganisms of the same genus and species involved in the translation, modification, and regulation of the gdhA gene. The nucleic acid derived from a microorganism of the same genus and species introduced into a microorganism may be nucleic acid extracted directly from the microorganism, or may be artificially synthesized using techniques known in the field of genetic engineering, such as nucleic acid obtained by causing another microorganism (e.g., Escherichia coli) to produce nucleic acid derived from a microorganism of the same genus and species.

[0016] [Koji mold] The koji mold is preferably one that has been used to produce foods (e.g., fermented foods such as miso, soy sauce, mirin, vinegar, sake, awamori, shochu, and pickles), which can produce safe proteins and are useful for food and feed. Such koji molds are preferably those belonging to the genus Aspergillus, such as fungi such as Aspergillus oryzae, Aspergillus niger, Aspergillus luchuensis, Aspergillus luchuensis var kawachii, Aspergillus kawachii, Aspergillus sojae, Aspergillus tamari, Aspergillus awamori, Aspergillus glaucus, etc. Of these, the genus Aspergillus is preferred, and Aspergillus oryzae (e.g., Aspergillus oryzae strain RIB40) is preferred.

[0017] -gdhA gene- The gdhA gene encodes GdhA, a glutamate dehydrogenase. GdhA is a glutamate dehydrogenase that catalyzes the dehydrogenation reaction of α-ketoglutarate and ammonia in the TCA cycle to produce glutamate. The gdhA gene has been registered in Gene Bank (Locus tag AO090023000923), and examples thereof include the nucleotide sequence of SEQ ID NO: 1 (Figure 1). The amino acid sequence of SEQ ID NO: 2 can be deduced from the nucleotide sequence of SEQ ID NO: 1. The gdhA gene may contain a polynucleotide sequence that is 70% or more identical to the amino acid sequence of SEQ ID NO: 2 (Figure 2) and that encodes an amino acid sequence that has glutamate dehydrogenase activity equivalent to that of a protein having the amino acid sequence of SEQ ID NO: 2. Examples of such identities include 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, and 99.5% or more.

[0018] In the present invention, a protein-producing koji mold is used that highly expresses the gdhA gene described above by extracellularly introducing at least one nucleic acid derived from a microorganism of the same genus and species as the host. Examples of the introduced nucleic acid include the gdhA gene derived from a microorganism of the same genus and species as the host, a promoter that enhances expression of the gdhA gene, or a combination thereof. This allows for high expression of the gdhA gene in the koji mold, enabling efficient protein production. It is preferable to use a promoter derived from a microorganism of the same genus and species as the host. This eliminates the need for safety screening for genetic recombination, allowing the modified microorganism to be used for food or feed applications. The modification of a microorganism with a genomic region (e.g., promoter, coding region, 3' untranslated region) derived from a microorganism of the same genus and species is sometimes referred to as "self-cloning."

[0019] -Self-cloning- In this invention, self-cloning refers to changing the properties of a host (in recombinant DNA technology, this refers to a living cell into which DNA is transferred; the same applies hereinafter) using only the DNA of a microorganism that belongs to the same taxonomic species as the host. Safety reviews of genetically modified organisms for use as food or feed or for environmental release require the careful preparation of large amounts of experimental data, and the reviews take a long time, resulting in enormous costs. However, as indicated in the laws and regulations ((1) Procedures for Safety Review of Foods and Food Additives Produced Using Recombinant DNA Technology (Excerpt) (Ministry of Health and Welfare Notification No. 233 of 2000) https: / / www.mhlw.go.jp / file / 06-Seisakujouhou-11130500-Shokuhinanzenbu / 1_11.pdf, (2) Ministerial Ordinance on the Ingredient Standards for Feed and Feed Additives http: / / www.famic.go.jp / ffis / feed / hourei / sub1_seibunkikaku.html, (3) Enforcement Regulations of the Act on the Conservation and Sustainable Use of Biological Diversity through Regulations on the Use of Living Modified Organisms (Ministry of Finance, Ministry of Education, Culture, Sports, Science and Technology, Ministry of Health, Labour and Welfare, Ministry of Agriculture, Forestry and Fisheries, Ministry of Economy, Trade and Industry, and Ministry of the Environment Ordinance No. 1 of 2003) http: / / www.env.go.jp / press / files / jp / 108458.pdf), microorganisms improved by self-cloning can be used industrially without undergoing safety review for genetically modified organisms, and therefore do not require the costs of safety review. Furthermore, when genetically modified microorganisms are used industrially, they must be carefully sterilized after cultivation, which incurs significant costs.However, microorganisms improved by self-cloning can be treated as non-genetically modified microorganisms, and therefore do not require the cost of sterilization.

[0020] In the present invention, self-cloning is preferably used as a method for extracellularly introducing at least one nucleic acid derived from a microorganism of the same genus and species as the host into the koji mold. Examples of self-cloning include replacing or inserting the promoter region of the gdhA gene in the microbial genome with a promoter derived from a microorganism of the same genus and species as the host, replacing or inserting the gdhA gene derived from a microorganism of the same genus and species as the host into a promoter downstream region in the microbial genome, introducing a gene expression cassette (optionally linked to a selectable marker gene) that combines a promoter derived from a microorganism of the same genus and species as the host with a gdhA gene derived from a microorganism of the same genus and species as the host, or a combination thereof. Introduction of a gene expression cassette that combines a promoter derived from a microorganism of the same genus and species as the host with a gdhA gene derived from a microorganism of the same genus and species as the host is preferred. Examples of self-cloning methods include homologous recombination, genome editing (e.g., CRISPR-Cas9, TALEN), and vector introduction.

[0021] The promoter may be selected depending on the purpose. For example, a high-expression promoter, i.e., a promoter that produces a high level of expression, can be selected. The use of a high-expression promoter can improve the expression level of the gdhA gene. Other examples of promoters include promoters that are specifically expressed under specific conditions. This allows for strict control of the timing and conditions of gdhA gene expression and protein production. Specific examples of promoters include, but are not limited to, the TEF1 promoter; promoters of the α-amylase gene and glucoamylase gene (Hata Yoji et al., Jyokyo, 93, 12, 922-931, 1998; Minetoki Toshitaka, Chemistry and Biology, 38, 12, 831-838, 2000); promoters of the superoxide dismutase gene, cytochrome P-450 gene, catalase gene, ATPase gene, or histone gene (Japanese Patent No. 3792467); and an artificial promoter obtained by duplicating a nucleotide sequence called region III, which is naturally found in Aspergillus oryzae (Minetoki Toshitaka, Chemistry and Biology, 38, 12, 831-838, 2000).

[0022] The koji mold for enhanced protein production is preferably added to the system as a culture containing spores (seed koji). The seed koji can be prepared by a conventional method, for example, by culturing koji mold in a medium containing yeast extract or the like.

[0023] [Solid culture] The present invention includes a step of contacting the above-mentioned koji mold with a nitrogen compound and culturing it on a solid state, thereby improving the efficiency of protein production by the koji mold.

[0024] -Nitrogen compounds- As used herein, the term "nitrogen compound" refers to a compound containing a nitrogen atom. The nitrogen compound may be either an inorganic or organic nitrogen compound, provided that it can provide a nitrogen source during the cultivation of koji mold. However, inorganic nitrogen compounds are preferred. Examples of organic nitrogen compounds include urea. Examples of inorganic nitrogen compounds include ammonium salts of inorganic acids (but not including metal oxides), nitrates, and ammonia, with ammonium salts and nitrates of inorganic acids being more preferred. Examples of ammonium salts of inorganic acids include ammonium sulfate, ammonium nitrate, ammonium carbonate, ammonium bicarbonate, and ammonium chloride, with ammonium sulfate being preferred. Examples of nitrates (other than ammonium salts) include alkali metal salts of nitric acid such as sodium nitrate and potassium nitrate. The nitrogen compounds may be used alone or in combination of two or more.

[0025] -grain- It is more preferable that the solid culture is carried out by further contacting the protein-producing koji mold with grains.

[0026] The grain may be any grain material that can be used in the production of koji, including processed products such as ground grains and dried grains. Examples of grains include rice, barley, wheat, oats, corn, rye, pearl barley, sorghum, foxtail millet, barnyard millet, buckwheat, sorghum, triticale, and other cellulosic biomass, of which rice is preferred. Rice is classified into non-glutinous rice, glutinous rice, japonica, indica, and javanica (japanica) varieties, and any of these may be used.

[0027] Grains are usually added to the system as heated (steamed) grains, but heat treatment is not essential and unheated grains can also be used. In this specification, steamed grains refer to grains that have been steamed (usually treated at high temperature and / or high pressure in a water-absorbed state). When the grain is rice, steamed rice can be obtained by appropriately soaking the rice and then cooking it (for example, by heating it to a temperature above the gelatinization temperature (e.g., 80 to 120°C) and maintaining the temperature for 10 to 60 minutes). Steamed grains may also be so-called gelatinized grains obtained by rapid drying such steamed grains, or waste materials such as leftover food and starch-containing surplus food ingredients.

[0028] -Other ingredients- In solid culture, other components such as inorganic compounds other than the above-mentioned nitrogen compounds, water, vitamins, etc. may be added to the system as needed, and it is more preferable to add inorganic compounds other than the above-mentioned nitrogen compounds.

[0029] The inorganic compound other than the nitrogen compound may be a compound composed of an inorganic element other than nitrogen. Examples of such inorganic compounds include compounds containing atoms of alkaline earth metals (e.g., calcium, magnesium), iron, zinc, copper, alkali metals (e.g., sodium, potassium), phosphate, aluminum, molybdenum, etc., and compounds containing calcium, magnesium, iron, zinc, copper, phosphate, sodium, and molybdenum atoms are preferred, and compounds containing calcium and molybdenum atoms are more preferred. Inorganic salts may contain multiple inorganic elements in one compound, and the counter ion is not particularly limited.

[0030] Examples of calcium-containing compounds include calcium carbonate, calcium sulfate, and calcium chloride, with calcium carbonate being preferred.

[0031] Examples of compounds containing magnesium include magnesium sulfate, magnesium chloride, and magnesium carbonate, with magnesium sulfate being preferred.

[0032] Examples of iron-containing compounds include iron citrate, iron gluconate, iron sulfate, iron chloride, iron pyrophosphate, and iron oxide, with iron sulfate being preferred.

[0033] Examples of zinc salts include zinc sulfate, zinc chloride, zinc carbonate, zinc gluconate, and zinc acetate, with zinc sulfate being preferred.

[0034] Examples of copper-containing compounds include copper chloride, copper acetate, copper sulfate, copper carbonate, copper gluconate, copper chloride, and copper acetate, with copper sulfate being preferred.

[0035] Examples of compounds containing sodium include sodium borate, sodium sulfate, sodium chloride, sodium carbonate, sodium gluconate, and sodium acetate, with sodium borate being preferred.

[0036] Examples of compounds containing phosphoric acid include potassium phosphate, sodium phosphate, and magnesium phosphate, and may also be monohydrogen phosphate, dihydrogen phosphate, metaphosphate, or polyphosphate.

[0037] Examples of aluminum salts include aluminum sulfate, aluminum chloride, aluminum carbonate, and aluminum acetate.

[0038] An example of a compound containing molybdenum is ammonium molybdate.

[0039] The inorganic salts may be used alone or in combination of two or more, preferably in combination of two or more or three or more.

[0040] -Culture conditions- In the present invention, the solid culture is carried out by contacting the koji mold for enhanced protein production with the nitrogen compound described above, and more preferably by further contacting the koji mold with the grain described above. When the solid culture is carried out by contacting the koji mold with the grain, the grain may be prepared by adding the nitrogen compound described above and, if necessary, other components to the grain, and the solid medium may be used.

[0041] The amount of nitrogen compounds used is usually 0.1% by weight or more, preferably 0.5% by weight or more, and more preferably 1% by weight or more, based on the weight of the medium. The upper limit is usually 5% by weight or less, preferably 2% by weight or less, and more preferably 1.5% by weight or less. Therefore, the amount of nitrogen compounds used is usually 0.1 to 5% by weight, preferably 0.5 to 2% by weight, and more preferably 1 to 1.5% by weight, based on the weight of the medium. The weight of the medium refers to the total amount of the above-mentioned nitrogen compounds, the solid medium described below, other components, and koji mold, and the same applies hereinafter.

[0042] The amount of grain used (dry weight) is usually 20% by weight or more, preferably 30% by weight or more, and more preferably 35% by weight or more, based on the weight of the medium. The upper limit is usually 70% by weight or less, preferably 60% by weight or less, and more preferably 55% by weight or less. Therefore, the amount of grain used (dry weight) is usually 20 to 70% by weight, preferably 30 to 60% by weight, and more preferably 35 to 55% by weight, based on the weight of the medium.

[0043] The amount of inorganic salts other than nitrogen compounds used is not particularly limited, and may be adjusted to an amount suitable for culturing the microorganism depending on the type of inorganic salt used, for example, typically 0.01 to 5% by weight, preferably 0.1 to 2% by weight, more preferably 0.5 to 1% by weight, based on the weight of the medium.

[0044] When a compound containing a calcium atom is added to the medium as an inorganic compound other than a nitrogen compound, the amount used is usually 0.01 to 5 wt %, preferably 0.1 to 2 wt %, and more preferably 0.5 to 1 wt %, relative to the weight of the medium.

[0045] When a compound containing a magnesium atom is added to the culture medium as an inorganic compound other than a nitrogen compound, the amount used is usually 0.001 to 0.5% by weight, preferably 0.01 to 0.1% by weight, and more preferably 0.02 to 0.05% by weight.

[0046] When a compound containing an iron atom is added to the medium as an inorganic compound other than nitrogen compounds, the amount used is usually 0.00005 to 0.01% by weight, preferably 0.0001 to 0.005% by weight, and more preferably 0.0005 to 0.001% by weight.

[0047] When a compound containing a zinc salt atom is added to the culture medium as an inorganic compound other than a nitrogen compound, the amount used is usually 0.000001 to 0.0005% by weight, preferably 0.000005 to 0.0001% by weight, and more preferably 0.00001 to 0.00005% by weight.

[0048] When a compound containing a copper salt atom is added to the culture medium as an inorganic compound other than a nitrogen compound, the amount used is usually 0.000001 to 0.0005% by weight, preferably 0.000005 to 0.0001% by weight, and more preferably 0.00001 to 0.00005% by weight.

[0049] When a compound containing a sodium salt atom is added to the culture medium as an inorganic compound other than a nitrogen compound, the amount used is usually 0.0000005 to 0.00005 wt %, preferably 0.000001 to 0.00005 wt %, and more preferably 0.000005 to 0.00001 wt %.

[0050] When a compound containing a molybdenum atom is added to the culture medium as an inorganic compound salt other than nitrogen compounds, the amount used is usually 0.000001 to 0.000005% by weight, preferably 0.000002 to 0.000004% by weight, and more preferably 0.0000025 to 0.000003% by weight.

[0051] When water is added to the medium as another component, the amount used is usually 20% by weight or more, preferably 40% by weight or more, and more preferably 50% by weight or more, based on the weight of the medium. The upper limit is usually 80% by weight or less, preferably 70% by weight or less, and more preferably 60% by weight or less. Therefore, the amount of water used is usually 20 to 80% by weight, preferably 40 to 70% by weight, and more preferably 50 to 60% by weight, based on the weight of the medium.

[0052] Cultivation is preferably carried out with the culture exposed to air. The culture temperature is usually room temperature, for example, 10 to 40°C, preferably 20 to 37°C. The culture period is usually 1 day or more, preferably 2 days or more, and more preferably 3 days or more. The upper limit of the culture period is not particularly limited, as long as the culture is continued until no nitrogen source remains, but may be, for example, 10 days or less, 8 days or less, 7 days or less, or 6 days or less. The pH during culture is usually near neutral (e.g., 4 to 10) and tends to decrease as the culture progresses. The culture may be terminated when the pH reaches less than 4. The culture period can be adjusted by adding nitrogen compounds. Specifically, the culture period can be shortened by adding a smaller amount of nitrogen compound while still satisfying the above-mentioned range of added amounts during the cultivation of koji mold for enhanced protein production. Alternatively, protein production can be continued by adding a new nitrogen compound within the above-mentioned range of added amounts during the cultivation of koji mold for enhanced protein production when no nitrogen compound remains or when the pH during culture falls below 4.

[0053] After culturing, a culture product with a high protein content can be obtained. The proteins contained in the culture product include proteins produced by the koji mold from nitrogen compounds and proteins derived from the koji mold. The protein-containing culture product can be recovered as is, or as an extract or purified product by subjecting it to extraction and / or purification treatment (e.g., filtration, centrifugation).

[0054] [Koji mold with enhanced protein production and / or its culture] The above-mentioned koji mold with enhanced protein production and a culture of the koji mold with enhanced protein production obtained by the above-mentioned method are rich in protein. That is, the koji mold with enhanced protein production, which is obtained by extracellularly introducing nucleic acids derived from a microorganism of the same genus and species as the host and which highly expresses the gdhA gene, can efficiently produce protein in the presence of inorganic salts using nitrogen compounds as a nitrogen source. Therefore, the koji mold with enhanced protein production and its culture contain a large amount of protein compared to wild-type strains.

[0055] The formulation of the culture of koji mold for enhanced protein production is not particularly limited, and may be any of a solid (e.g., powder, pellets, granules, chunks, minced meat), liquid, etc. The molding method for these formulations can be conventional.

[0056] [Application] The protein obtained by the present invention or a culture of the koji mold with enhanced protein production of the present invention can be used as a raw material or additive for foods and feeds. For example, it can be used as a substitute for meat (livestock meat, fish meat). Specifically, it can be added when processing meat products (e.g., ham, sausages, and minced meat), and can be used together with meat during cooking or as a meat substitute by appropriately seasoning and shaping it to resemble the shape of meat. Furthermore, the protein obtained by the present invention or a culture of the koji mold with enhanced protein production of the present invention is lower in calories than meat, and is therefore expected to be used as a so-called diet food or a food for treating or preventing lifestyle-related diseases such as obesity and metabolic syndrome. [Example]

[0057] The present invention will be described in more detail below using examples, although the technical scope of the present invention is not limited to these examples.

[0058] [Example 1] Selection of glutamate dehydrogenase gene from Aspergillus oryzae As a representative strain of koji mold, we used the Aspergillus oryzae RIB40 strain (NBRC100959 strain). Many RIB40 genomes are registered in GenBank. From this information, we hypothesized that the glutamate dehydrogenase gene (locus tag AO090023000923) (SEQ ID NO: 1: Figure 1) is the glutamate dehydrogenase gene involved in protein production. Hereafter, this gene will be referred to as gdhA. The amino acid sequence deduced from the nucleotide sequence of SEQ ID NO: 1 is shown in SEQ ID NO: 2 (Figure 2).

[0059] [Example 2] Preparation of vector for transformation of Aspergillus oryzae (Preparation of pUC19 vector purified fragment) The vector used in the transformation experiments of Aspergillus oryzae was pUC19 (Takara Bio Inc.). pUC19 was cleaved with the restriction enzyme SbfI (New England BioLabs Japan). The cleaved fragment was electrophoresed on an agarose gel, and the DNA fragment was excised from the gel and purified using a QIAEX II Gel extraction kit. This was used as the pUC19 vector purified fragment.

[0060] (Preparation of purified pyrithiamine resistance marker gene fragment) In the transformation of Aspergillus microorganisms, a pyrithiamine resistance marker gene is frequently used as a selectable marker gene. PCR was performed using the commercially available vector pPTRI (Takara Bio Inc.), which contains the pyrithiamine resistance marker gene, as a template with primers consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4 (SEQ ID NOS: 3: ggggatcctctagagtcgaccTGCAGGACTCTTCCTTTTTCAATGGGCA; SEQ ID NOS: 4: attacgccaagcttgcatgcctgcaGGCGCGCCTGCATGTGGATTACGAGCTAA). The PCR solution was electrophoresed on an agarose gel, and the DNA fragment was excised and purified using a QIAEX II Gel Extraction Kit. This DNA fragment was used as the purified pyrithiamine resistance marker gene fragment.

[0061] (Creation of the Aspergillus oryzae transformation vector pUC19-ptrA) The purified pUC19 vector fragment and the purified pyrithiamine resistance marker gene fragment were mixed with Gibson Assembly Master mix (New England BioLabs Japan, Inc.) and incubated at 50°C for 60 minutes. This reaction mixture was then mixed with E. coli for transformation (NEB 5-alpha Competent E. coli (High Efficiency); New England BioLabs Japan, Inc.) and transformed according to the manufacturer's instructions. The transformed E. coli was cultured on LB agar medium containing ampicillin for approximately 18 hours to obtain grown colonies. DNA extracted from these colonies was used as a PCR template to confirm the insertion of the pyrithiamine resistance marker gene into the pUC19 vector. The colonies were then cultured in LB liquid medium, and vector DNA was purified from the resulting E. coli cells using a QIAprep Spin Miniprep Kit (Qiagen, Inc.). This vector was designated pUC19-ptrA.

[0062] [Example 3] Preparation of a DNA fragment containing a gdhA expression cassette (Preparation of pUC19-ptrA vector purified fragment) The pUC19-ptrA vector was digested with the restriction enzyme AscI (New England BioLabs Japan). The digested fragment was electrophoresed on an agarose gel, and the DNA fragment was excised from the gel and purified using a QIAEX II Gel extraction kit. This was designated the pUC19-ptrA vector purified fragment.

[0063] (Preparation of Aspergillus culture medium and RIB40 strain genomic DNA) YPD medium (YPD liquid medium) was prepared by dissolving 1% yeast extract (powder; Difco Laboratories), 2% peptone (Difco Laboratories), and 2% D-glucose (Wako Pure Chemical Industries) in purified water. The RIB40 strain was cultured in YPD liquid medium in a plastic tube, and genomic DNA was extracted from the resulting cells. Genomic DNA was extracted using ISOPLANT (Nippon Gene Co., Ltd.).

[0064] (Preparation of purified tef1 promoter fragment) PCR was performed using the genomic DNA of the RIB40 strain as a template and primers consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 (SEQ ID NO: 5: CGTTAGCTCGTAATCCACATGCAGGtctagatagcgagagtaaaaaaaaaaaaaga; SEQ ID NO: 6: tttgaaggtggtgcgaactt) to amplify the tef1 promoter to obtain a PCR fragment. This fragment was electrophoresed on agarose gel, and the DNA fragment was excised from the gel and purified using a QIAEX II Gel extraction kit. This DNA fragment was used as the purified tef1 promoter fragment.

[0065] (Preparation of purified gdhA / 3' untranslated region fragment) Next, PCR was performed using the genomic DNA of the RIB40 strain as a template and primers consisting of the nucleotide sequences of SEQ ID NOs: 7 and 8 (SEQ ID NO: 7: ctacaaagttcgcaccaccttcaaaatgtccaaccttcccattgagcccga; SEQ ID NO: 8: tacgccaagcttgcatgcctgcaGGCGCGCCaatcatgtaattttgctcgcttgat) to amplify the gdhA / 3' untranslated region to obtain a PCR fragment. This fragment was electrophoresed on agarose gel, and the DNA fragment was excised from the gel and purified using a QIAEX II Gel extraction kit. This DNA fragment was used as the gdhA / 3' untranslated region purified fragment.

[0066] (Creation of a DNA fragment containing the gdhA expression cassette) The purified pUC19-ptrA vector fragment, the purified tef1 promoter fragment, and the purified gdhA / 3' untranslated region fragment were mixed with Gibson Assembly Master mix (New England BioLabs Japan) and incubated at 50°C for 60 minutes. This reaction mixture was mixed with E. coli for transformation (NEB 5-alpha Competent E. coli (High Efficiency); New England BioLabs Japan), and transformation was performed according to the manufacturer's instructions.

[0067] The transformed E. coli was cultured on LB agar medium containing ampicillin for approximately 18 hours to obtain grown colonies. DNA extracted from these colonies was used as a PCR template to confirm that an expression cassette consisting of the tef1 promoter, gdhA, and its 3' untranslated region had been inserted into the pUC19-ptrA vector. These colonies were cultured in LB liquid medium, and the vector DNA was purified from the resulting E. coli cells using a QIAprep Spin Miniprep Kit (Qiagen). The sequence of the expression cassette consisting of the tef1 promoter, gdhA, and its 3' untranslated region introduced into this vector DNA was confirmed to be the desired sequence by nucleotide sequence analysis and PCR. Furthermore, a DNA fragment containing the expression cassette consisting of the pyrithiamine resistance marker gene, the tef1 promoter, gdhA, and its 3' untranslated region was digested with the restriction enzyme SbfI (New England BioLabs Japan) and purified. The nucleotide sequence of the DNA fragment containing the expression cassette is SEQ ID NO: 9 (Figure 3).

[0068] The tef1 promoter, gdhA, and 3'-untranslated region contained in SEQ ID NO:9 were each subjected to a homology search with the genomic DNA of Aspergillus oryzae using BLAST. As a result, all components were found to be completely identical to registered nucleotide sequences derived from Aspergillus oryzae, confirming that they were all derived from Aspergillus oryzae. The pyrithiamine-resistant marker gene contained in SEQ ID NO:9 was obtained from a pyrithiamine-resistant mutant strain of Aspergillus oryzae (Japanese Patent Application Laid-Open No. 2000-308491), and was confirmed to be a nucleotide sequence derived from Aspergillus oryzae.

[0069] [Example 4] Introduction of gdhA expression cassette into the genome of Aspergillus genus microorganism (Composition of medium for Aspergillus microorganisms) Czapek-Dox (CD) medium was prepared at pH 6.5 and contained 6.0 g sodium nitrate, 0.52 g potassium chloride, 1.52 g potassium dihydrogen phosphate, 10 g glucose, 0.49 g magnesium sulfate heptahydrate, 0.001 g ferrous sulfate heptahydrate, 0.0088 g zinc sulfate heptahydrate, 0.0004 g copper sulfate pentahydrate, 0.0001 g sodium tetraborate decahydrate, and 0.00005 g hexaammonium heptamolybdate tetrahydrate per liter of purified water. CD agar was prepared by adding 20 g agar per liter of CD medium. Pyrithiamine-containing CD agar was also prepared by adding pyrithiamine to CD agar at a final concentration of 0.1 μg / ml.

[0070] (Creation of gdhA self-cloning strains of Aspergillus spp.) Protoplasts of the host strain RIB40 were prepared according to the pPTRI (Takara Bio Inc.) manual, and the purified DNA fragment containing the expression cassette described in Example 3 was introduced into the RIB40 strain. The RIB40 strain containing the introduced DNA fragment was cultured on pyrithiamine-containing CD agar medium, and colonies that showed growth were cultured on YPD medium. The cultured cells were then harvested by centrifugation, and genomic DNA was extracted using an ISOPLANT. PCR confirmed that the expression cassette containing the pyrithiamine resistance gene, tef1 promoter, gdhA, and its 3' untranslated region had been incorporated into the genome. Because the nucleotide sequences comprising the introduced DNA were all derived from the same Aspergillus oryzae as the host, this genetic modification can be considered self-cloning. The resulting transformed strain was designated the "gdhA self-cloning strain."

[0071] [Example 5] Preparation of Koji mold spore suspension The wild-type Aspergillus oryzae RIB40 strain was cultured on CD agar medium, and the gdhA self-cloning strain was cultured on pyrithiamine-containing CD agar medium for 4 to 6 days. Spores formed on the medium were collected with a sterile cotton swab and suspended in a solution containing 1 g of Tween 80 and 4 g of sodium chloride per liter to prepare a spore suspension. The spore suspension was diluted appropriately and placed in a plastic cuvette. The optical density at 600 nm (OD600) was measured using a spectrophotometer, and the spore concentration was adjusted based on the results to obtain an OD600 of approximately 10. For each strain, a spore suspension of the Aspergillus oryzae wild-type strain and a spore suspension of the gdhA self-cloning strain were prepared.

[0072] [Example 6] Protein production from ammonium salts by solid culture of Aspergillus oryzae 100 mg of dried cooked rice (Alpha Foods) was placed in a 2 mL plastic tube and sterilized at 100°C for at least 1 hour. Ammonium salt, various inorganic salts, and a spore suspension were added to the dried cooked rice in the plastic tube as shown in Table 1. After thorough mixing, the mixture was incubated at 30°C for 4 days (triplicate experiments were performed for the wild-type Aspergillus oryzae strain and the gdhA self-cloning strain). One stainless steel bead was added to the plastic tube, followed by 500 μL of water. The sample was then allowed to absorb water. The sample was then disrupted using a bead disrupter (FastPrep FP100A, MP-Biomedicals) by repeating the disruption process at level 4 for 30 seconds four times. The sample was then diluted with 1000 μL of water and vortexed to obtain the disrupted sample solution.

[0073] The protein concentration of the sample lysate was measured as follows. Bovine serum albumin solutions at 1, 2, 5, and 10 mg / mL were used as standard solutions for protein concentration measurement. Water was used as a blank. 50 μL of the sample lysate, standard solution, or blank water was placed in a plastic tube, 400 μL of 1N NaOH was added, and the tube was vortexed. After heating at 100°C for 3 minutes, the tube was neutralized with 200 μL of 2N HCl, vortexed, and centrifuged at 15,000 rpm for 40 seconds. A 96-well plate was prepared, and 10 μL of the supernatant was added to each well. 200 μL of Quickstart Bradford reagent (Bio-Rad) was then added. After allowing to stand for 5 minutes, the absorbance at 595 nm was measured using a microplate reader (Multiskan GO, Thermo Fisher Scientific). Protein concentrations were calculated from a calibration curve prepared using the standard solution and blank water.

[0074] The ammonia concentration of the sample lysate was measured as follows. The sample lysate was centrifuged at 15,000 rpm for 40 seconds to obtain the supernatant. In addition to the supernatant, a 0.1% aqueous solution of ammonium carbonate was used as a standard. Water was used as a blank. A 96-well plate was prepared, and 80 μL of Reagent 1 from E-kit Liquid Ammonia (JK International) was added to each well. 4 μL of the supernatant, standard solution, or blank water was added to each well and mixed with a pipette. After leaving the plate at room temperature for 1 minute, the absorbance at 340 nm was measured, and the result was designated Measurement 1. Next, 20 μL of Reagent 2 from E-kit Liquid Ammonia was added to each solution in the 96-well plate and mixed with a pipette. After leaving the plate at room temperature for at least 15 minutes, the absorbance at 340 nm was measured, and the result was designated Measurement 2. The difference between the results of Measurement 1 and Measurement 2 was calculated for the supernatant, standard solution, and blank water. A calibration curve was then created from the results of the standard solution and blank water, and the ammonia concentration in the sample disruption solution was calculated.

[0075] The results of measuring protein and ammonia (average values ​​of triplicate samples) are shown in Figures 4A and 4B, respectively. As shown in Figure 4A, protein production was significantly higher in the gdhA self-cloning strain compared to the wild-type strain. Furthermore, as shown in Figure 4B, ammonium ion consumption was significantly higher in the gdhA self-cloning strain compared to the wild-type strain (residual ammonia concentration was significantly reduced), a result corresponding to the increase in protein production. These results suggest that protein productivity from ammonium salts can be increased by overexpressing the glutamate dehydrogenase gene gdhA of Aspergillus oryzae through self-cloning.

[0076] [Table 1]

Claims

1. A koji mold having enhanced protein production, and / or a culture thereof, into which at least one nucleic acid derived from a microorganism of the same genus and species as the host has been introduced from outside the cell, and in which at least one of the introduced nucleic acids highly expresses a glutamate dehydrogenase gene.

2. 2. The protein-producing koji mold according to claim 1, and / or a culture thereof, wherein the glutamate dehydrogenase gene comprises a polynucleotide sequence encoding an amino acid sequence having 70% or more identity to the amino acid sequence of SEQ ID NO: 2 and having glutamate dehydrogenase activity.

3. 3. The koji mold for enhanced protein production according to claim 1 or 2, and / or a culture thereof, wherein the koji mold belongs to the genus Aspergillus.

4. At least one nucleic acid derived from a microorganism of the same genus and species as the host is introduced from outside the host cell, and the koji mold in which glutamate dehydrogenase gene is highly expressed by at least one of the introduced nucleic acids is contacted with a nitrogen compound and cultured on a solid state. Methods for producing proteins.

5. 5. The method of claim 4, wherein the glutamate dehydrogenase gene comprises a polynucleotide sequence that has 70% or more identity to the amino acid sequence of SEQ ID NO: 2 and encodes an amino acid sequence that has glutamate dehydrogenase activity.

6. 6. The method according to claim 4, wherein the nitrogen compound is at least one selected from the group consisting of ammonium salts, nitrates, ammonia, and urea.

7. The method according to claim 4 or 5, wherein the culturing is carried out in contact with grain.

8. The method of claim 7, wherein the grain is rice.

9. A method for producing a food or feed composition, comprising the steps of producing a protein by the method according to claim 4 or 5 and using the protein in the production of food or feed.

10. A step of extracellularly introducing at least one nucleic acid derived from a microorganism of the same genus and species as the host into the koji mold, and highly expressing a glutamate dehydrogenase gene by the at least one introduced nucleic acid to obtain a koji mold with enhanced protein production; The method comprises a step of contacting a protein-producing koji mold with a nitrogen compound and solid-state culturing the koji mold. Methods for producing proteins.

Images