SIRPα-inhibiting macrophages and neutrophils and uses thereof

JP2025505559A5Pending Publication Date: 2026-02-16WISCONSIN ALUMNI RES FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024545823
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-02-04
Filing Date
2023-02-06
Publication Date
2026-02-16

Smart Images

  • Figure 00000028_0000
    Figure 00000028_0000
  • Figure 00000029_0000
    Figure 00000029_0000
  • Figure 00000029_0001
    Figure 00000029_0001
Patent Text Reader

Abstract

The present disclosure relates generally to methods for producing macrophages and neutrophils from SIRPα-inhibited pluripotent stem cells under serum-free and feeder-free conditions. The present disclosure further relates to SIRPα-inhibited macrophages and neutrophils and uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] (Statement regarding federally sponsored research) This invention was made with Government support under HL142665 and OD011106 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0002] (Related Applications) This application claims priority to U.S. Provisional Patent Application No. 63 / 306,830, filed February 2022, the disclosure of which is expressly incorporated herein by reference.

[0003] (INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ELECTRONICALLY) This application contains a sequence listing that has been submitted as an electronic text file named "21-1677-US_sequence_listing.xml" having a byte size of 7.62 kb and created on February 6, 2023. The information contained in this electronic file is incorporated herein by reference in its entirety.

[0004] The present disclosure relates generally to methods for producing macrophages and neutrophils from SIRPα-inhibited pluripotent stem cells under serum-free and feeder-free conditions. The present disclosure further relates to SIRPα-inhibited macrophages and neutrophils and uses thereof. [Background technology]

[0005] Current cancer immunotherapy focuses on targeting cancer-specific antigens by the use of chimeric antigen receptor (CAR) T cells or monoclonal antibodies (mAbs). There is an urgent need to develop novel immunotherapies that can treat patients with solid tumor cancer. Indiscriminately, solid tumors contain highly complex tumor microenvironments (TMEs) that evade the antitumor mechanisms of the innate and adaptive immune systems. The heterogeneous nature of tumors and their ability to shield from the immune system are the main reasons why current immunotherapies have been less successful in targeting solid tumors. CAR-T cells and mAbs rely primarily on the specificity of cancer antigens that limit their targeting ability to circulating cancer. Other mechanisms such as T cell elimination, hypoxic environment, and immunosuppressive myeloid cells create a hostile environment for the adaptive immune system to have any robust antitumor effects (Joyce & Fearon (2015) Science (New York, NY), 348 (6230), 74-80).

[0006] Macrophages are a diverse and active group of immune cells found throughout the body, either as tissue-resident macrophages (TR-Mac) or circulating monocyte-derived macrophages (MD-Mac) (Davies, et al., (2013) Nature Immunology, 14(10), 986-995). Developing from a common myeloid progenitor lineage, macrophages are natural antigen-presenting immune cells with a remarkable appetite for phagocytosis. Upon activation, macrophages polarize into pro-inflammatory Ml subtypes, or anti-inflammatory M2 subtypes with many other subtypes on the polarization spectrum (Kielbassa, et al., (2019) Frontiers in Immunology, 10:2215). Within the TME, tumor cells recruit macrophages through chemokine signaling, such as the CCL2 / CCR2 pathway, polarizing macrophages into a pathological pro-tumorigenic state called tumor-associated macrophages (TAM) (Chen, et al., (2019) Journal of Biomedical Science, 26(1), 78). By analyzing the role of macrophages in the TME, TAMs were found to primarily resemble M2 macrophages with increased anti-inflammatory and wound-healing signatures (Chanmee, et al., (2014) Cancers, 6(3), 1670-1690). TAMs produce many inhibitory factors, including TGF-beta, IL-10, Argl, IDO, and HIF-1alpha, which inhibit and deplete existing T cell populations within the TME (Zhu, et al., (2021) Journal of Cancer, 12(1), 54-64). Tumor cells within the TME evade the antitumor properties of macrophages by upregulating immunosuppressive signals, including "don't eat me" cellular receptors.CD47, one of the "don't eat me" receptors, was discovered by Weissman et al. as a mechanism by which both hematological cancer cells and solid tumor cells escape phagocytosis by TAMs (Chao, et al.,(2010)Cell, 142(5), 699-713; Majeti, et al.,(2009)Cell, 138(2), 286-299; Willingham, et al.,(2012)Proceedings of the National Academy of Sciences, 109(17), 6662-6667). This cell surface receptor on tumor cells is recognized by the myeloid specific receptor: signal regulatory protein alpha (SIRPα), which is abundantly expressed on macrophages, dendritic cells, and neutrophils. SIRPα is the ligand for the ubiquitously expressed "don't-eat-me" signal molecule CD47. SIRPα also promotes M2 polarization of tumor-associated macrophages. In physiological conditions, CD47 is ubiquitously expressed on normal, healthy cells as a marker of self, and red blood cells (RBCs) in particular express CD47 to prevent macrophages from phagocytosing red blood cells as they mature (Oldenborg, et al., (2000) Science (New York, NY), 288 (5473), 2051-2054; Oldenborg, et al., (2001) The Journal of Experimental Medicine, 193 (7), 855-862). Upon interaction of CD47 with SIRPα, a signal is transmitted to the immunoreceptor tyrosine-dependent inhibitory motif (ITIM) on the cytoplasmic tail of SIRPα. ITIMs recruit SHP-1 and SHP-2 domain-containing phosphatases that block myosin IIa and subsequent cytoskeletal rearrangements (Murata, et al., (2018) Cancer Science, 109(8), 2349-2357). Thus, CD47 / SIRPα activation specifically blocks phagocytosis from occurring in the presence of activating phagocytic stimuli.

[0007] Due to the widespread upregulation of CD47 across many solid tumor cancers, targeting this signaling pathway by knocking out SIRPα in macrophages to generate cellular immunotherapy has the potential for broad cancer treatment. In addition, macrophages have unique advantages for the use of cellular immunotherapy due to their access to the TME, phagocytic ability, and direct communication to the adaptive immune system via antigen presentation. Deriving macrophages from human donor peripheral blood mononuclear cells (PBMCs) is cumbersome and inefficient for genetic modification and clinical use. Thus, there is a need in the art for an efficient and cost-effective protocol. Summary of the Invention

[0008] Provided herein is a method for producing modified macrophages from pluripotent stem cells, the method comprising: (a) culturing human pluripotent stem cells in which the expression of signal transduction regulator protein alpha (SIRPα) is inhibited in a serum-free culture medium containing magnesium L-ascorbic acid-2-phosphate, sodium selenium, transferrin, insulin, NaHCO3, fibroblast growth factor 2 (FGF2), transforming growth factor beta 1 (TGFβ1), and a Rho kinase (ROCK) inhibitor under normoxic conditions for approximately 24 hours; (b) further culturing the human pluripotent stem cells of (a) in a serum-free culture medium containing bone morphogenetic protein 4 (BMP4), FGF2, activin A, an inhibitor of glycogen synthase 3 (GSK3), and a ROCK inhibitor under hypoxic conditions for about 48 hours to induce mesoderm formation; (c) further culturing the cultured cells of (b) for about 48 hours under hypoxic conditions in a serum-free culture medium containing FGF2, vascular endothelial growth factor (VEGF), and an inhibitor of TGFβ-mediated signaling to induce the formation of hemogenic endothelial cells; (d) further culturing the cultured cells of (c) in a serum-free culture medium containing FGF2, VEGF, stem cell factor (SCF), thrombopoietin (TPO), interleukin-6 (IL-6), and interleukin-3 (IL-3) under normoxic conditions for about 6 days, whereby the hemogenic endothelial cells differentiate into HPCs; (e) culturing the HPCs of (d) for about 6 days under normoxic conditions in a serum-free culture medium containing macrophage colony-stimulating factor (M-CSF), IL-3, and IL-6 to obtain bone marrow progenitor cells and monocyte cells; (f) further culturing the cultured cells of (e) in a serum-free culture medium containing M-CSF under normoxic conditions for about 4 days, whereby the cultured bone marrow progenitor cells and monocytes differentiate into a cell population comprising modified macrophages.

[0009] In certain embodiments, the inhibitor of TGFβ-mediated signal transduction is SB431542. In other certain embodiments, the inhibitor of GSK3 is lithium chloride (LiCl). In certain embodiments, the ROCK inhibitor used in the practice of the methods disclosed herein is Y-27632.

[0010] In certain embodiments, the pluripotent stem cells are induced pluripotent stem cells (iPSCs).

[0011] Advantageously, the expression of SIRPα is inhibited in human pluripotent stem cells by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.The specific gene editing method useful for carrying out these methods uses nuclease, including but not limited to meganuclease, zinc finger nuclease (ZFN), TAL effector nuclease (TALEN), Cas enzyme, and in particular uses Cas9 in embodiments.Advantageously, gene editing causes knockout of SIRPα expression.

[0012] Also provided herein are modified macrophages produced according to the disclosed methods.

[0013] Further provided herein is a method of producing modified macrophages from pluripotent stem cells, the method comprising: (a) transiently introducing exogenous ETV2 into human pluripotent stem cells in which SIRPα expression is inhibited, and culturing the ETV2-induced pluripotent stem cells in a serum-free culture medium containing FGF-2 to generate a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs); (b) culturing the ETV2-induced HEPs in a serum-free and xeno-free culture medium containing granulocyte-macrophage colony-stimulating factor (GM-CSF), FGF2, for a time sufficient to generate non-adherent bone marrow progenitor cells; (c) culturing the non-adherent bone marrow progenitor cells in a serum-free and xeno-free culture medium containing M-CSF, IL-6, and IL-3; (d) further culturing the cultured cells of (c) in a serum-free and xeno-free culture medium containing M-CSF for a period of time sufficient to differentiate the non-adherent bone marrow progenitor cells into modified macrophages.

[0014] In certain embodiments, step (a) of the method comprises culturing the ETV2-induced pluripotent stem cells for about 1-2 days, step (b) of the method comprises culturing the ETV2-induced HEPs for about 6-7 days, and steps (c) and (d) comprise culturing the bone marrow progenitor cells for about 9-10 days.

[0015] In certain embodiments, the serum-free and xeno-free culture medium of step (b) further comprises UM171.

[0016] In certain embodiments, the pluripotent stem cells are induced pluripotent stem cells (iPSCs).

[0017] Advantageously, the expression of SIRPα is inhibited in human pluripotent stem cells by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.The specific gene editing method useful for carrying out these methods uses nuclease, including but not limited to meganuclease, zinc finger nuclease (ZFN), TAL effector nuclease (TALEN), Cas enzyme, and in particular uses Cas9 in embodiments.Advantageously, gene editing causes knockout of SIRPα expression.

[0018] Also provided herein are modified macrophages produced according to these disclosed methods.

[0019] Further provided herein is a method of producing modified neutrophils from pluripotent stem cells, the method comprising: (a) transiently introducing exogenous ETV2 into human pluripotent stem cells in which SIRPα expression is inhibited, and culturing the ETV2-induced pluripotent stem cells in a serum-free culture medium containing FGF-2 to generate a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs); (b) culturing the ETV2-induced HEPs in a serum-free and xeno-free culture medium containing GM-CSF and FGF2 for a period of time sufficient to generate non-adherent bone marrow progenitor cells; (c) culturing the non-adherent bone marrow progenitor cells in a serum-free and xeno-free culture medium containing granulocyte-colony stimulating factor (G-CSF) and a retinoic acid receptor agonist for a period of time sufficient to differentiate the bone marrow progenitor cells into neutrophils.

[0020] In certain embodiments, the serum-free and xeno-free culture medium of step (b) further comprises UM171.In certain embodiments, the retinoic acid receptor agonist is AM580.

[0021] In certain embodiments, step (a) of the method comprises culturing the ETV2-induced pluripotent stem cells for about 1-2 days, step (b) of the method comprises culturing the ETV2-induced HEPs for about 6-7 days, and steps (c) and (d) comprise culturing the bone marrow progenitor cells for about 8-9 days.

[0022] Advantageously, the expression of SIRPα is inhibited in human pluripotent stem cells by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.The specific gene editing method useful for carrying out these methods uses nuclease, including but not limited to meganuclease, zinc finger nuclease (ZFN), TAL effector nuclease (TALEN), Cas enzyme, and in particular uses Cas9 in embodiments.Advantageously, gene editing causes knockout of SIRPα expression.

[0023] Also provided herein are modified neutrophils produced according to these disclosed methods.

[0024] Also provided herein are methods for treating cancer by administering a therapeutically effective amount of modified macrophages produced by the methods disclosed herein. In certain embodiments, these methods also include administering a tumor-specific antibody. Also provided herein are methods for treating cancer by administering a therapeutically effective amount of modified neutrophils produced by the methods disclosed herein.

[0025] In certain embodiments, the neutrophils produced by these methods are useful in the treatment of infections, particularly bacterial infections, and are particularly advantageous where the bacterial infection is a systemic infection.

[0026] These and other features, objects and advantages of the present invention will be better understood from the following description. In the description, reference is made to the accompanying drawings, which form a part of this specification, in which embodiments of the present invention are shown by way of example, and not by way of limitation. The description of the preferred embodiment is not intended to limit the present invention, but covers all modifications, equivalents and alternatives. Accordingly, reference should be made to the claims recited herein to interpret the scope of the present invention. [Brief description of the drawings]

[0027] [Figure 1] Figures 1A-1D show the generation of SIRPα-knockout (KO) induced pluripotent stem cells (iPSCs). Figure 1A is a schematic diagram of CRISPR / Cas9-driven knockout of the SIRPα gene at exon 3 using two sgRNAs. Figure 1B shows DNA extraction of genomic PCR on an agar gel for each clone. Specifically, nucleofection of hiPSCs was performed with sgRNAs and Cas9 protein. After several days, clones were selected and expanded. Figure 1C shows phase contrast images of WT and SIRPα-KO iPSCs. Figure 1D shows western blotting of cell lysates collected from WT and SIRPα-KO iPSCs differentiated into macrophages. [Diagram 2] Figures 2A-2E show hematopoietic differentiation of SIRPα-KO iPSCs. Figure 2A shows a 2D monolayer differentiation schematic for the generation of iPSC-macrophages. Figure 2B shows phase contrast microscopy images taken on days 6, 7, and 9 of differentiation, showing that suspension hematopoietic progenitor cells (HPs) arise from hemogenic endothelial cells. Figure 2C shows the number of HPs generated from a single iPSC, which was calculated by (number of live suspension cells generated on day 9 / number of iPSCs seeded on day -1). Student's t-tests were performed to calculate p-values ​​with alpha = 0.05. Figures 2D and 2E show suspension cells on day 9 that were collected and stained for flow cytometry analysis. Gates were drawn from FMO controls and correction was performed in FlowJo software using single-color controls with BD beads. [Diagram 3] Figures 3A-3F show SIRPα-KO iPSC bone marrow cells. Figure 3A shows cytospin and Wright-Giemsa staining of WT and SIRPα-KO iPSC bone marrow cells at day 15. Confocal microscopy images were taken. Figures 3B and 3C show WT and SIRPα-KO iPSC bone marrow cells at day 15 collected for flow cytometry for CD45, CD14, CD11b, CD16, and CD18. Cells were gated on single live cells using Ghost Dye 540 and FlowJo software. Populations were plotted and a two-way ANOVA was performed in Prism 9, which showed no significant differences between WT and SIRPα-KO (n=5). Figure 3D shows a schematic of M1 and M2 polarization. Figure 3E shows phase contrast images of M0 i-Mac, M1 i-Mac, and M2 i-Mac taken for morphology. Figure 3F shows unstained i-Macs (top), M0 i-Macs (second), Ml i-Macs (third), and M2 i-Macs (bottom) collected and analyzed by flow cytometry for CD14, CD263, CD206, CD86, CD80, and HLA-DR. Flow cytometry dot plots and histograms were generated in FlowJo 10. [Figure 4]Figures 4A-4G show that SIRPα-KO i-Macs have superior phagocytosis of CD47+ cancer cells. Figure 4A shows WT and SIRPα-KO i-Macs co-cultured with SKOV3 GFP+ cancer cells at effector-to-target ratios of 2:1, 4:1, and 8:1, while the number of SKOV3 cells remained the same. Cells were cultured with or without anti-HER2 monoclonal antibodies, and then cells were collected for flow cytometry analysis after 24 hours. The percentage (%) of phagocytosed SKOV3 cells was calculated by (number of GFP+CD45+ cells / number of total GFP+ cells) × 100. Flow plots represent two independent experiments. Figure 4B shows a graph made in Prism9 depicting the mean and standard error of the mean (SEM) of the % of phagocytosed SKOV3 cells after 24 hours of co-culture. Figure 4C shows fluorescent microscopy images performed 1 hour after co-culture to capture active phagocytosis, indicated by white arrows. White cells are SKOV3-GFP+ and grey cells are unstained SIRPα-KO i-Macs. Figure 4D shows a graph made with Prism9 depicting the mean and SEM of the % of phagocytosed WM266-4 cells after 6 hours of co-culture. Figure 4E shows a fluorescent microscopy image performed 1 hour after co-culture to capture active phagocytosis indicated by the white arrow. White cells are WM266-4 stained with Cell Trace Violet and grey cells are unstained SIRPα-KO i-Macs. Figures 4F and 4G show iMacs co-cultured with GFP-expressing SKOV-3 ovarian cancer for 6 hours and analyzed by flow cytometry using CD45 APC antibody. Figure 4F depicts the percentage of GFP+ cells consumed by iMacs through phagocytosis. Figure 4G depicts the percentage of actively phagocytosing iMacs out of the total pool of iMacs. For statistical analysis, a two-way ANOVA test was used to determine significance at alpha = 0.05. [Diagram 5]Figures 5A-5J show that SIRPα-KO i-Macs are cytotoxic to MCF7 cancer spheroids with anti-HER2 monoclonal antibodies. Figure 5A shows MCF7 spheroids co-cultured at 5x106 i-Macs / mL for 4 days. C / PI staining was performed after co-culture to assess live and dead cells. Dead cells are highlighted with white arrows. Figure 5B shows the number of dead cells per spheroid, counted manually under a microscope and graphed. Figures 5C-5E show the results when iMacs were co-cultured with GFP-Luc2+ SKOV-3 or WM266-4 cells for 24, 48, or 96 hours and analyzed on a SpectraMax plate reader to assess bioluminescence. Figure 5C depicts antibody-dependent cellular cytotoxicity (ADCC) of SKOV-3 cells at 48 hours. Figure 5D depicts the analysis at an effector-to-target ratio of only 10:1. Figure 5E depicts ADCC of WM266-4 cells at 48 hours. For statistical analysis, a two-way ANOVA test was used to determine significance at alpha = 0.05. Figure 5F-5J show results showing SIRPα-KO iMacs and wild-type (WT) iMacs cultured alone or co-cultured with SKOV-3 ovarian cancer for 48 hours and supernatants collected for a human inflammation 20-plex ProcartaPlex panel. Supernatants were tested in technical replicates and raw values ​​were generated on a MAGPIX xMAP instrument plotted against a standard curve. Figure 5F shows a heatmap depicting the normalized expression of 20 different cytokines across all groups (shown in Figures 5G-5J). Plots represent the mean concentrations (pg / mL) of IL-1 beta, IL-1 alpha, IFN-gamma, and TNF-alpha within the supernatant samples. [Figure 6]Figures 6A-6C show ETV2 mmRNA hematopoietic differentiation and macrophage generation. Figure 6A shows a schematic of ETV2 mmRNA differentiation from days 0 to 19. Figure 6B shows flow cytometry analysis of CD45, CD206, CD163, CD80, CD11b, and CD18 expression in macrophages generated from ETV2 mmRNA-transfected IISH2i-BM9 hiPSCs at day 19. Figure 6C is a representative image of a Wright-stained cytospin showing macrophage morphology. [Figure 7] Figure 7 shows CD47 expression on WM266-4. WM266-4 cancer cells were harvested and analyzed by flow cytometry using anti-human CD47-PE antibody. WM266-4 cells are the right histograms and unstained control is the left histograms. [Figure 8] FIG. 8 is a schematic diagram of the ETV2 mmRNA construct disclosed herein. [Figure 9] FIG. 9 is a schematic diagram of the method disclosed herein for the generation of wild-type and SIRPα− / − neutrophils in defined serum-free and feeder-free conditions using ETV2 mmRNA. [Figure 10] FIG. 10 shows representative phase contrast images demonstrating differences in morphology during blood endothelial cell development and neutrophil differentiation following transduction wild-type and SIRPα− / − hiPSCs with ETV2 mmRNA. [Figure 11] Figure 11 shows flow cytometry analysis of CD45 expression in myeloid progenitor cells generated from ETV2 mmRNA-transfected wild-type and SIRPα − / − hiPSCs at day 9. [Figure 12] Figures 12A-12H show flow cytometry analysis of CD45, CD16, and CD11b expression in generated wild-type and SIRPα- / - neutrophils. Figures 12G-12H show representative images of Wright's staining showing the morphology of wild-type and SIRPα- / - neutrophils. [Figure 13]FIG. 13 shows the results of an in vitro cytotoxicity assay of neutrophils generated from wild-type and SIRPα − / − hiPSCs. [Figure 14] FIG. 14A shows an analysis of phagocytosis of pHrodo Green E. coli particles by wild-type (WT) vs. SIRPα (SIRPα) neutrophils. Bar graphs are from three independent experiments showing fold change of cells from 37° C. incubation with phagocytosed acidified E. coli bioparticles. Bars show ±SEM. Differences between lines are statistically significant as determined by unpaired t-test (p=0.0385). FIG. 14B shows an analysis of a Candida auris planktonic yeast killing assay. Percentage of viable yeast was quantified relative to yeast without neutrophils. Neutrophil-only controls were subtracted from the values. Bar graphs show ±SEM from three independent experiments showing yeast viability. Differences compared to wild-type were not significant as determined by unpaired t-test (p=0.1755). FIG. 14C shows 123DHR ROS production from iPSC-neutrophils of cells treated with 50 ng / mL PMA. Graph bars show ±SEM from three independent experiments. Fold change was calculated from initial time to 2 hours incubation. Differences between wild type and SIRPα- / - (SIRPα) were not significant (p=0.2102) as determined by unpaired t-test. FIG. 14D shows quantification of chemotactic index and velocity of iPSC-neutrophils, showing significant differences in iPSC-neutrophils exposed to chemotactic fMLP. Graph bars show ±SEM from three independent experiments. P values ​​are 0.0312 for chemotactic index and <0.0001 for velocity (μm / min) as determined by unpaired t-test. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] The present disclosure relates generally to methods for producing macrophages and neutrophils from SIRPα-inhibited pluripotent stem cells under serum-free and feeder-free conditions. The present disclosure further relates to SIRPα-inhibited macrophages and neutrophils and uses thereof.

[0029] All publications cited herein, including but not limited to patents and patent applications, are hereby incorporated by reference as if set forth in their entirety in this application.

[0030] As utilized in accordance with this disclosure, unless otherwise indicated, all technical and scientific terms shall be understood to have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular.

[0031] "Pluripotent stem cells" refer to cells that have the ability to differentiate into cells of all three germ layers. "Embryonic stem cells" or "ESCs" refer to a pluripotent cell or population of pluripotent cells derived from the inner cell mass of a blastocyst. See Thomson et al., (1998) Science 282:1145-1147.

[0032] "Induced pluripotent stem cells" or "iPS cells" refer to pluripotent cells or populations of pluripotent cells that may vary in terms of a particular set of potency determinants and in terms of the culture conditions used to isolate them, but are nevertheless substantially genetically identical to their respective differentiated somatic cells from which they originate, and exhibit similar properties to higher potency cells, such as ESCs.See, for example, Yu et al., (2007) Science 318:1917-1920.

[0033] "Hematopoietic precursor cell (HPC)" and "hematopoietic progenitor (HP)" refer to immature multipotent progenitor cells of the hematopoietic lineage. HPCs are characterized by surface expression of CD45, and occasionally CD34, and the ability to differentiate into myeloid and lymphoid progenitors, and terminally differentiated lymphoid and myeloid cells.

[0034] A "myeloid progenitor cell" is a cell that has the potential to differentiate into cell types of the myeloid lineage.

[0035] "Chemically defined culture," "fully defined, growth factor free culture conditions," and "fully defined conditions" indicate that the identity and amount of each medium component is known, and the identity and amount of the support surface is known.

[0036] "Xeno-free culture medium" refers to a medium that does not contain any components derived from animal sources, such as, for example, serum.

[0037] As used herein, "SIRPα knockout" or "SIRPα-KO" is intended to encompass any disruption or deletion of the SIRPα gene that results in dysfunction or non-function of the SIRPα protein with respect to binding to CD47 or other SIRPα binding partners and / or with respect to signal transduction in SIRPα expressing cells. This definition includes the insertion of an exogenous plasmid / gene within the SIRPα locus or deleting an entire portion or region of the SIRPα gene.

[0038] Methods for generating macrophages using a morphogen-driven differentiation system The methods provided herein include differentiating human pluripotent stem cells under conditions that promote differentiation of the pluripotent stem cells into hematopoietic progenitor cells and macrophages.

[0039] In some embodiments, provided herein is a method of producing modified macrophages from pluripotent stem cells, the method comprising: (a) culturing human pluripotent stem cells in which the expression of signal transduction regulator protein alpha (SIRPα) is inhibited in a serum-free culture medium containing magnesium L-ascorbic acid-2-phosphate, sodium selenium, transferrin, insulin, NaHCO3, fibroblast growth factor 2 (FGF2), transforming growth factor beta 1 (TGFβ1), and a Rho kinase (ROCK) inhibitor under normoxic conditions for approximately 24 hours; (b) further culturing the human pluripotent stem cells of (a) in a serum-free culture medium containing bone morphogenetic protein 4 (BMP4), FGF2, activin A, an inhibitor of glycogen synthase 3 (GSK3), and a ROCK inhibitor under hypoxic conditions for about 48 hours to induce mesoderm formation; (c) further culturing the cultured cells of (b) for about 48 hours under hypoxic conditions in a serum-free culture medium containing FGF2, vascular endothelial growth factor (VEGF), and an inhibitor of TGFβ-mediated signaling to induce the formation of hemogenic endothelial cells; (d) further culturing the cultured cells of (c) in a serum-free culture medium containing FGF2, VEGF, stem cell factor (SCF), thrombopoietin (TPO), interleukin-6 (IL-6), and interleukin-3 (IL-3) under normoxic conditions for about 6 days, whereby the hemogenic endothelial cells generate HPCs; and (e) culturing the HPCs of (d) for about 6 days under normoxic conditions in a serum-free culture medium containing macrophage colony-stimulating factor (M-CSF), IL-3, and IL-6 to generate bone marrow progenitor cells and monocytes; (f) further culturing the cultured cells of (e) in a serum-free culture medium containing M-CSF under normoxic conditions for about 4 days, whereby the cultured bone marrow progenitor cells and monocytes differentiate into a cell population comprising modified macrophages.

[0040] Suitable pluripotent cells for use herein include human embryonic stem cells (hESCs) and human induced pluripotent stem cells (iPS) cells.ESCs are commercially available from sources such as WiCell Laboratories (Madison, Wisconsin).In certain embodiments, the pluripotent stem cells are induced pluripotent stem cells.

[0041] The pluripotent stem cells used in the methods disclosed herein have inhibited expression of SIRPα. SIRPα is highly expressed in macrophages, dendritic cells, and neutrophils. SIRPα is a ligand for the ubiquitously expressed "don't-eat-me" signal molecule CD47. SIRPα also promotes M2 polarization of tumor-associated macrophages.

[0042] "SIRPα expression is inhibited" refers to the gene being suppressed or not being expressed in functional protein form. In certain embodiments, the expression of SIRPα is knocked out so that there is no expression of SIRPα. This inhibition or knockout can be obtained by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.

[0043] In certain embodiments, the gene editing method comprises the use of a nuclease selected from meganucleases, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), and Cas enzymes. In certain embodiments, the nuclease is a Cas9 enzyme.

[0044] In some embodiments, normoxic conditions refer to conditions in which oxygen is provided at or near standard atmospheric levels. In some embodiments, normoxic conditions refer to oxygen conditions of about 15% to about 20% oxygen (e.g., about 15%, 16%, 17%, 18%, 19%, 20% O2).

[0045] In some embodiments, hypoxic conditions refer to a level of environmental oxygen (e.g., cell culture incubator gas mixture) of about 3% O2 ​​to about 10% O2. In some embodiments, hypoxic conditions are about 5% O2.

[0046] In some embodiments, the cultures are "serum-free," which refers to cell culture material that does not contain serum obtained from animal or human (eg, fetal bovine) blood.

[0047] In some embodiments, the culture conditions are feeder-free, meaning that the culture does not use feeder cells, hi certain embodiments, the culture conditions are serum-free and feeder-free.

[0048] In certain embodiments, the methods disclosed herein include an attachment step that includes culturing human pluripotent stem cells in a culture medium under normoxic conditions (i.e., oxygen is provided at or near atmospheric pressure levels) for about 24 hours. In certain embodiments, the culture medium is E8-TeSR. "E8 culture medium" and "E8" are used interchangeably and refer to a chemically defined culture medium having the following defined components: DMEM / F12, L-ascorbic acid-2-phosphate magnesium, sodium selenium, and NaHCO3, transferrin, insulin, FGF2, TGFβ1.

[0049] In some embodiments, the culture medium used to culture hPSCs into HPCs and / or bone marrow progenitor cells into macrophages is "IF9S" medium, which is made up of IMDM / F12, Mg L-ascorbic acid 2-phosphate, and IFN-γ-phosphate. 2+ Contains salts, monothioglycerol, sodium selenite, polyvinyl alcohol, Glutamax™, non-essential amino acids (NEAAs), chemically defined lipid concentrate (Life Technologies, catalog number 1905031), holo-transferrin, insulin.

[0050] In certain embodiments, the culture medium comprises a Rho kinase (ROCK) inhibitor. Rock inhibitors are known in the art and include, but are not limited to, for example, Y27632 (commercially available from Stem Cell Technologies) and those described in Liao JK, Seto M, Noma K. Rho kinase (ROCK) inhibitors. J Cardiovasc Pharmacol. 2007; 50(1): 17-24 (the contents of which are incorporated by reference in their entirety).

[0051] In some embodiments, the inhibitor of TGFβ-mediated signaling is SB431542. In some embodiments, the inhibitor of GSK3 is lithium chloride (LiCl).

[0052] Also provided herein are populations of modified macrophages produced by the methods disclosed herein, which have inhibited expression of SIRPα as well as superior anti-tumor activity for therapeutic purposes.

[0053] Use of ETV2 modified mRNA differentiation system for macrophages and neutrophils The present disclosure also provides a method for efficiently producing macrophages and neutrophils from pluripotent stem cells using direct programming with transient expression of ETV2, for example, by addition of modified mRNA (mmRNA) of ETV2 to hiPSCs. First, hiPSCs are directly programmed into blood endothelial progenitor cells using ETV2 mmRNA with ETV2 transiently produced in the cells. Next, blood endothelial progenitor cells are differentiated into bone marrow progenitor cells in the presence of GM-CSF, FGF2, and optionally UM171 (the presence of UM171 in combination with GM-CSF and FGF2 increases the number of macrophage neutrophils produced by the method). Bone marrow progenitor cells, which are non-adherent, can be continuously harvested from the culture every 8-10 days for up to 30 days after ETV2 transfection. Finally, these bone marrow progenitor cells are then differentiated into macrophages or neutrophils. Methods for the production of macrophages and neutrophils from pluripotent stem cells using direct programming with transient expression of ETV2 are described in U.S. Publication No. 20200385676, the contents of which are incorporated by reference in their entirety.

[0054] In certain embodiments, disclosed herein is a method for producing modified macrophages from pluripotent stem cells, the method comprising: (a) transiently introducing exogenous ETV2 into human pluripotent stem cells in which SIRPα expression is inhibited, and culturing the ETV2-induced pluripotent stem cells in a serum-free and xeno-free culture medium containing FGF-2 to generate a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs); (b) culturing the ETV2-induced HEPs in a serum-free and xeno-free culture medium containing granulocyte-macrophage colony-stimulating factor (GM-CSF), FGF2, for a time sufficient to generate non-adherent bone marrow progenitor cells; (c) culturing the non-adherent bone marrow progenitor cells in a serum-free and xeno-free culture medium containing M-CSF, IL-6, and IL-3; (d) further culturing the cultured cells of (c) in a serum-free and xeno-free culture medium containing M-CSF for a period of time sufficient to differentiate the non-adherent bone marrow progenitor cells into modified macrophages.

[0055] In certain embodiments, provided herein is a method for producing modified neutrophils from pluripotent stem cells, the method comprising: (a) transiently introducing exogenous ETV2 into human pluripotent stem cells in which SIRPα expression is inhibited, and culturing the ETV2-induced pluripotent stem cells in a serum-free and xeno-free culture medium containing FGF-2 to generate a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs); (b) culturing the ETV2-induced HEPs in a serum-free and xeno-free culture medium containing GM-CSF and FGF2 for a period of time sufficient to generate non-adherent bone marrow progenitor cells; (c) culturing the non-adherent bone marrow progenitor cells in a serum-free and xeno-free culture medium containing granulocyte-colony stimulating factor (G-CSF) and a retinoic acid receptor agonist for a period of time sufficient to differentiate the bone marrow progenitor cells into neutrophils.

[0056] Suitable pluripotent cells for use herein include human embryonic stem cells (hESCs) and human induced pluripotent stem cells (iPS) cells.ESCs are commercially available from sources such as WiCell Laboratories (Madison, Wisconsin).In certain embodiments, the pluripotent stem cells are induced pluripotent stem cells.

[0057] The pluripotent stem cells used in the methods disclosed herein have inhibited expression of SIRPα.

[0058] "SIRPα expression is inhibited" refers to the gene being suppressed or not being expressed in functional protein form. In certain embodiments, the expression of SIRPα is knocked out so that there is no expression of SIRPα. This inhibition or knockout can be obtained by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.

[0059] In certain embodiments, the gene editing method comprises the use of a nuclease selected from meganucleases, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), and Cas enzymes. In certain embodiments, the nuclease is a Cas9 enzyme.

[0060] ETV2 can be transiently introduced into PSCs by methods known in the art. Methods for transiently expressing ETV2 in PSCs are known in the art and include, but are not limited to, introducing a transient exogenous nucleic acid encoding a protein of interest (e.g., by plasmid expression vector transfection, or modified mRNA transfection), protein transduction, among others. In one embodiment, ETV-2 mmRNA (e.g., Accession No. NM_014209.2, SEQ ID NO: 4) is introduced into PSCs by a suitable method. Methods for transiently expressing ETV2 in PSCs are described in U.S. Patent No. 9,382,531, the contents of which are incorporated by reference in their entirety. Methods for introducing mmRNA into PSCs are known in the art and include, but are not limited to, the methods described in the Examples, for example, by transfection or electroporation. Methods for introducing mmRNA or DNA to transiently express ETV-2 protein are within the skill of the art and are not limited to those demonstrated in the Examples.

[0061] After initiating transient expression of ETV2 in hPSCs, the cells are cultured for a time sufficient to produce a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs). In certain embodiments, the sufficient time is a period of about 24 hours to about 4 days. In some embodiments, the sufficient time to produce a population of ETV2-induced blood endothelial progenitor cells comprises culturing the ETV2-induced cells for about 1 to 2 days. In some embodiments, the sufficient time to produce a population of ETV2-induced blood endothelial progenitor cells comprises culturing the ETV2-induced cells for about 3 to 8 days, such as about 4 days. For example, in some embodiments, the step of producing a population of ETV2-induced blood endothelial progenitor cells comprises culturing for 3 days, alternatively 4 days, alternatively 5 days, alternatively 6 days, alternatively 7 days, alternatively 8 days to produce ETV2-induced blood endothelial progenitor cells.

[0062] In some embodiments, the culture medium is "serum-free," which refers to cell culture materials that do not contain serum obtained from animal or human (e.g., fetal bovine) blood.

[0063] In some embodiments, the culture conditions are feeder-free, meaning that the culture conditions do not use feeder cells. In certain embodiments, the culture conditions are serum-free and feeder-free.

[0064] In certain embodiments, the methods disclosed herein use a maintenance culture medium to culture hPSCs after transfection with ETV2 mmRNA. In certain embodiments, the culture medium is E8-TeSR. "E8 culture medium" and "E8" are used interchangeably and refer to a chemically defined culture medium having the following defined components: DMEM / F12, L-ascorbic acid-2-phosphate magnesium, sodium selenium, and NaHCO3, transferrin, insulin, FGF2, TGFβ1 in a final volume of 200.

[0065] In some embodiments, the culture medium is a xeno-free cell culture medium. In some embodiments, the culture conditions are xeno-free, serum-free and feeder-free.

[0066] Suitable serum-free and xeno-free media for culturing ETV2-induced blood endothelial progenitor cells to produce non-adherent bone marrow progenitor cells are known in the art and include, but are not limited to, StemLine II (commercially available from Sigma Aldrich).

[0067] In some embodiments, the time sufficient to culture the ETV2-induced HEPs to produce non-adherent bone marrow progenitor cells is at least 4 days, e.g., at least 4-23 days. In some embodiments, the time sufficient to culture the ETV2-induced HEPs to produce non-adherent bone marrow progenitor cells is about 6-7 days.

[0068] In some embodiments, the methods disclosed herein include isolating non-adherent bone marrow cells from the culture. Suitable methods for isolating cells are known in the art. In one example, the non-adherent cells can be harvested from the culture, leaving the adherent cells behind. In some embodiments, the adherent cells isolated from the non-adherent bone marrow cells can be used in a method to produce macrophages.

[0069] For the production of macrophages, the method includes culturing bone marrow progenitor cells in a culture medium containing M-CSF, IL-6, IL-3, and further culturing the cultured cells with M-CSF for a time sufficient to differentiate the bone marrow progenitor cells into modified macrophages. Suitable times for differentiating bone marrow progenitor cells into modified macrophages include at least 9 days, such as at least 9-21 days. In some embodiments, suitable times for culturing bone marrow progenitor cells to differentiate into modified macrophages are about 9-10 days.

[0070] Suitable serum-free and xeno-free media for culturing and differentiating bone marrow progenitor cells into modified macrophages are known in the art and include, but are not limited to, StemLine II (commercially available from Sigma Aldrich).

[0071] For the production of neutrophils, the method includes culturing bone marrow progenitor cells in a culture medium containing granulocyte-colony stimulating factor (G-CSF) and a retinoic acid receptor agonist for a sufficient time to differentiate the bone marrow progenitor cells into modified neutrophils. In some embodiments, the retinoic acid receptor agonist is AM580.

[0072] Suitable times for differentiating bone marrow progenitor cells into modified neutrophils include at least 9 days, such as at least 9-21 days, in some embodiments, suitable times for culturing bone marrow progenitor cells to differentiate into modified macrophages are about 9-10 days.

[0073] Suitable serum-free and xeno-free media for culturing and differentiating bone marrow progenitor cells into modified neutrophils are known in the art and include, but are not limited to, StemSpan™ H3000 (StemCell Technologies).

[0074] Also provided herein are populations of modified macrophages produced by the methods disclosed herein, which have inhibited expression of SIRPα as well as superior anti-tumor activity for therapeutic purposes.

[0075] Also provided herein is a population of modified neutrophils produced by the methods disclosed herein. The modified neutrophils have inhibited SIRPα expression as well as antibacterial and antitumor activity, which is excellent for therapeutic purposes. While the methods disclosed herein include ordered, sequential events, the timing of the events may vary by at least 20%. For example, while a particular step may be disclosed in one embodiment as lasting one day, the events may last longer or shorter than one day. For example, a "day" may include a period of about 18 to about 30 hours. Represented periods that are periods of multiple days may be multiples of "day", e.g., 2 days may span a period of about 36 to about 60 hours. In another embodiment, the time variation may be less, e.g., day 2 is 48±3 hours from d0, day 4 is 96±3 hours from d0, and day 5 is 120±3 hours from d0.

[0076] Methods of using modified macrophages and neutrophils In certain embodiments, the SIRPα knockout macrophages and neutrophils disclosed herein are useful for treating or preventing various diseases, such as cancer or infectious diseases. In certain embodiments, provided herein is a method for treating cancer, comprising administering the SIRPα knockout macrophages disclosed herein. In certain embodiments, provided herein is a method for treating cancer, comprising administering the SIRPα knockout neutrophils disclosed herein. In some embodiments, the method comprises administering the SIRPα knockout macrophages disclosed herein together with a tumor-specific antibody.

[0077] In certain embodiments, provided herein is a method of treating an infectious disease comprising administering a SIRPα knockout neutrophil disclosed herein. In some embodiments, the infectious disease is a systemic infection.

[0078] The term "treatment" or "treating" as used herein refers to both therapeutic treatment and prophylactic or preventative measures. Subjects in need of treatment include those with cancer, as well as those prone to have cancer, or those in whom cancer should be prevented. In some embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of cancer. In other embodiments, subjects in need of treatment include those with infectious diseases, as well as those prone to have infection, or those in whom infection should be prevented. In certain embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of infectious diseases.

[0079] In some cases, the macrophages and neutrophils obtained according to the methods provided herein can be administered as a pharmaceutical composition comprising a therapeutically effective amount of the macrophages and neutrophils as a therapeutic agent (i.e., for therapeutic use).

[0080] As used herein, the term "pharmaceutical composition" or "therapeutic composition" refers to a compound or composition capable of inducing a desired therapeutic effect when properly administered to a subject. In some embodiments, the present disclosure provides a pharmaceutical composition comprising a pharma- ceutical acceptable carrier and a therapeutically effective amount of the macrophages or neutrophils of the present disclosure.

[0081] As used herein, the term "pharmacologically acceptable carrier" or "physiologically acceptable carrier" refers to one or more formulation materials suitable for achieving or enhancing delivery of the macrophages or neutrophils of the present disclosure.

[0082] The term "subject" is intended to include human and non-human animals, particularly mammals. In certain embodiments, the subject is a human patient.

[0083] The term "administration" or "administering" as used herein refers to providing, contacting, and / or delivering a compound(s) by any suitable route to achieve a desired effect. Administration may include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, intra-articular, intra-arterial, intrasynovial, intrasternal, intrathecal, intralesional, or intracranial injection), transdermal, topical, buccal, rectal, vaginal, nasal, ocular, inhalation, implant.

[0084] Without limiting the disclosure, several embodiments of the disclosure are described below for illustrative purposes. EXAMPLES

[0085] The following examples are illustrative of specific embodiments of the present disclosure and various uses thereof, they are provided for illustrative purposes only and should not be construed as limiting the scope of the disclosure in any way.

[0086] Example 1: Generation and characterization of SIRPα knockout macrophages material and method

[0087] Maintenance of hiPSCs hiPSCs were cultured on Matrigel-treated 6-well plates with mTeSR medium under normoxic conditions. Medium was changed daily until cells were grown to 60-70% confluency. Cells were dissociated into small clumps by treatment with EDTA and passaged 1:6 into new Matrigel-treated 6-well plates.

[0088] Generation of SIRPα knockout iPSCs hiPSCs were grown on Matrigel-coated plates in mTeSR1 medium to 60-70% confluency and isolated in single cell suspension by treatment with TrypLE. Cas9 protein and sgRNA (gRNAl: GUGCUCCUUUCCAGGAGUGG (SEQ ID NO:1) and gRNA2: ACUUAAACUCCACGUCAUCG (SEQ ID NO:2)) were diluted in Stem Cell Nucleofector Solution 2 and incubated on ice for 20 min. 10 5 Cells were diluted in Cas9 / sgRNA solution and immediately placed in a cuvette for electroporation using a Lonza Nucleofector 2b device at setting A-23. Cells were serially diluted into 6-well Matrigel-coated plates in mTeSR medium supplemented with lx CloneR (STEMCELL Technologies). After 10–14 days, colonies formed from single cells were isolated and grown in separate wells of a 24-well plate. After clones were 60–70% confluent, cells were collected by EDTA-PBS dissociation for cryopreservation and to isolate DNA extracts for genomic PCR. Each clone was genotyped using SIRPα primers: αAATCTTAACACCTTGTACAGCCCCA (SEQ ID NO: 5) and AGTGCCTGCTCCAGACTTAAA (SEQ ID NO: 6).

[0089] hiPSC hematopoietic differentiation The day before differentiation, single cell suspensions of hiPSCs were obtained by TrypLE treatment of 60–80% confluent iPSCs. Washed single cells were cultured at 3000 cells / cm in TeSR-E8 medium containing 10 uM Rho kinase inhibitor (Y-27632 Tocris). 2The hiPSCs were seeded at a density of 1000 μg / ml onto collagen IV-treated 6-well plates and placed in a normoxic incubator. From day 0 onwards, defined IF9S medium was used. To initiate differentiation towards early mesoderm, on day 0, hiPSCs were treated with BMP4 (50 ng / mL), FGF2 (50 ng / mL), activin A (15 ng / mL), LiCl (2 mM), and 10 uM of Rho kinase inhibitor (Y-27632 Tocris) and placed under hypoxic conditions (5% oxygen) for 48 h. To continue differentiation towards vascular endoderm, a complete medium change was performed on day 2, and the cells were treated with FGF2 (50 ng / mL), VEGF (50 ng / mL), and SB431542 (5 uM) and placed under hypoxic conditions for an additional 48 h. On days 4 and 6, cells were treated with FGF2 (50 ng / mL), VEGF (50 ng / mL), SCF (50 ng / mL), TPO (50 ng / mL), IL3 (10 ng / mL), and IL6 (50 ng / mL) and continued differentiation into hemogenic endothelial cells and hematopoietic progenitor cells (HP) under normoxic conditions until day 9. On day 9, floating hematopoietic progenitor cells (HP) / hematopoietic precursor cells (HPC) were collected for flow cytometry analysis or further differentiation.

[0090] hiPSC-macrophage generation For macrophage generation, IF9S medium and normoxic conditions were used throughout. To initiate myelopoiesis, day 9 suspension hematopoietic progenitor cells were cultured at 1 × 10 5 Cells were seeded onto ultra-low attachment (ULA) 6-well plates (Corning Costar) at a density of 10 ... 5Cells were seeded at a density of 1000 cells / well for 96 hours. On day 19, macrophages were harvested by vigorous pipetting to dissociate adherent cells that were used for analysis and experiments.

[0091] mmRNA synthesis and transfection Human ETV2 transcript variant 1 (NM_014209.3) was cloned into the 5'-MCS-1β construct as previously described (Suknuntha et al., 2018, Stem Cell Rev. 14, 525-534). To generate an IVT template with a 180-A tract, a reverse primer containing 180 T base pairs and a forward primer ATCGGTGCGGGCCTCTTCGCTA (SEQ ID NO: 3) containing a T7 promoter were used in the PCR reaction. All PCR reactions were performed using Phusion (Thermo Fisher Scientific). mmRNA was synthesized using the MEGAscript T7 kit (Ambion, Austin, TX) with a custom ribonucleoside cocktail consisting of 3'-0-Me-m7G(5')ppp(5')G ARCA cap analog, pseudouridine triphosphate (TriLink BioTechnologies, San Diego, CA), ATP, guanosine triphosphate, and cytidine triphosphate. Synthesis reactions were set up according to the manufacturer's instructions. Reactions were incubated at 37 °C for 2 h and treated with DNAse. RNA was purified using PureLink RNA Mini Kit (Thermo Fisher Scientific) and adjusted to a working concentration of 100 ng / μL with RNase-free water before storage at -80 °C. Undifferentiated hiPSCs were transfected using TransIT-mRNA reagent in E8 medium containing ROCK inhibitor (Suknuntha et al., 2018, Stem Cell Rev. 14, 525-534). Briefly, for transfection, single cell suspensions were prepared using HyQtase (Thermo Fisher Scientific). A total of 2 × 10 hiPSCs in 1 mL of complete E8 medium containing 10 μM ROCK inhibitor (STEMCELL Technologies) were transfected per well for transfection. 5Cells were seeded onto collagen IV-coated 6-well plates. After 30–60 min, a mixture of 200 ng of ETV2:TransIT-mRNA (Minis Bio, Madison, WI) was added to each well according to the manufacturer's instructions.

[0092] ETV2-mmRNA generation of macrophages from hiPSCs The day after transfection (day 1), the medium was changed with 1 mL of Stemline II (Sigma) supplemented with 20 ng / mL human FGF2 (PeproTech). On day 2, 1 mL of the same medium was added. On day 3, the medium was changed and 1 mL of Stemline II supplemented with FGF2 (20 ng / mL), GM-CSF (25 ng / mL) (PeproTech), and UM171 (50 nM, Xcess Biosciences) was added. This medium was added daily until day 8. On day 9, the floating cells were gently harvested and used for macrophage differentiation. To induce specification to the monocyte / macrophage lineage, 1 × 10 cells were cultured in ultra-low attachment 6-well plates. 5 Suspension cells were cultured in Stemline II supplemented with M-CSF (80 ng / mL, Amgen), IL6 (50 ng / mL, Amgen), IL3 (10 ng / mL, Amgen) at a cell / well density of 1000 x 1000 cells / well. After 3 days, 2 mL of the same medium containing all components and cytokines was added on top of the existing culture. On day 15, cells were transferred to 6-well plates containing Stemline II supplemented with M-CSF (80 ng / mL, Amgen) for 4 days to induce macrophage differentiation. On day 19, macrophages were gently harvested and filtered through a 70 μM mesh (Falcon, Life Sciences) before analysis.

[0093] result Generation of SIRPα-knockout iPS cell lines To develop SIRPα-knockout iPS cell lines, exon 3 of the SIRPα gene was targeted with two adjacent sgRNAs. The CD47-binding region of SIRPα is located in exon 3, making it an ideal target for functional SIRPα protein knockout (Figure 1A). After electroporation and clonal selection, four independent SIRPα-KO clones were genotyped by PCR and expanded for further use (Figure 1B). The morphology of SIRPα-KO iPSC clones 1 and 4 resembled WT iPSCs by forming adherent colonies on Matrigel-coated plates (Figure 1B), suggesting that there were no off-target effects occurring at the level of pluripotency. To verify SIRPα knockout, WT and SIRPα-KO1 iPSCs were differentiated into iPSC-macrophages (i-Macs) and whole cell lysates were collected for immunoblotting. Due to the lack of SIRPα expression on stem cells, WT iPSCs were used as a negative control. SIRPα protein was absent in SIRPα-KO i-Macs compared to WT i-Macs, demonstrating successful knockout of SIRPα.

[0094] Hematopoietic differentiation of SIRPα-KO iPSCs Previously, serum-free, xeno-free, component-defined methods were developed for in vitro hematopoietic differentiation that utilize morphogen-driven formation of hemogenic endothelial cells (Uenishi et al., 2014, Stem Cell Reports, 3: 1073-1084). These methods allow the generation of multipotent hematopoietic progenitors (HPs) with lymphoid and myeloid potential by day 9. By adapting a protocol using similar myeloid hematopoietic-driving cytokines disclosed in Cao et al., 2019, Stem Cell Reports, 12: 1282-1297, we generated SIRPα-KO iPSC-macrophages (i-Macs) under serum-free conditions in 19 days (Figure 2A).

[0095] The generation of hemogenic endothelial cells (HE) was observed in SIRPα-KO iPSC-HE with morphology similar to WT iPSC-HE (Figure 2B). An endothelial-to-hematopoietic cell transition was observed on days 5–6 of hematopoietic differentiation, when round floating hematopoietic progenitor cells (HP) arise from adherent hemogenic endothelial cells, saturating the culture plate by day 9 (Figure 2B). The number of HPs generated from a single iPSC, or the yield of iPSC-to-HP, was found to be unaffected by knockout of SIRPα (Figure 2C). To further investigate the phenotype of SIRPα-KO iPSC-HP, flow cytometry analysis of floating cells was performed. The CD43+ population of SIRPα-KO iPSC-HP was approximately 93%, indicating that the floating cells on day 9 were a nearly pure population of hematopoietic progenitor cells. Upon further investigation, the CD43+ subpopulation of SIRPα-KO iPSC-HPs showed the same distribution of lineage markers CD235a / 41a and CD45 as WT iPSC-HPs (Figure 2D). Collectively, these findings indicate that genetic knockout of SIRPα in iPSCs does not affect the specification towards hemogenic endothelial cells or the generation of multipotent hematopoietic progenitor cells.

[0096] SIRPα iPSC-macrophage differentiation To generate macrophages from SIRPα-KO iPSC-HPs, floating progenitor cells on day 9 were collected and resuspended in IF9S medium with M-CSF, IL-3, and IL-6. They were then cultured at 1 × 10 5The cells were seeded onto ultra-low attachment 6-well plates at a density of 1000 cells / well and placed in a normoxic incubator for 72 h. Medium was replenished on day 12, and bone marrow cells formed in clumps until day 15. Because myelopoiesis is essential for the generation of macrophages, analysis of heterozygous SIRPα-KO iPSC-bone marrow cells on day 15 is important to understand the myeloid potential of the cells. Morphology of SIRPα-KO iPSC-bone marrow cells indicated that the population was not purely iPSC-monocytes, but rather a mixture of myeloid progenitors, granulocytes, and macrophages (Figure 3A). These findings suggest that in vitro hematopoiesis does not give rise to a pure peripheral blood mononuclear cell (PBMC) stage as seen in adults, but rather gives rise to a heterozygous mixture of myeloid progenitors that differentiate into macrophages at various time points (Figure 3A).

[0097] The SIRPα-KO iPSC-bone marrow cells at day 15 were further investigated through flow cytometry analysis. The CD45+ population of SIRPα-KO iPSC-bone marrow cells was approximately 90%, indicating that at this time point, the cells were committed to the blood lineage (Figure 3B and Figure 3C). The CD45+ subpopulation was analyzed for macrophage markers: CD14, CD11b, CD16, and the pan-myeloid marker CD18. The CD14+CD11b+CD16+ population of SIRPα-KO iPSC-bone marrow cells was approximately 40%, indicating that at day 15 of differentiation, approximately 40% of the cells were committed to macrophages, which is also seen in the morphology of the larger foamy cytoplasmic cells in the stained samples indicated by the arrows (Figure 3A, Figure 3B, and Figure 3C). The SIRPα-KO iPSC-bone marrow cells resembled the same morphology and myeloid markers as the WT iPSC-bone marrow cells, suggesting that knocking out SIRPα did not affect myelogenesis.

[0098] SIRPα-KO i-Macs polarize in response to stimuli Macrophages have great diversity and adaptability depending on the environment in which they exist. Based on the cues they receive from the environment, macrophages have the ability to polarize into a number of phenotypes that differ in function and morphology. Classically activated macrophages, or M1 macrophages (M1-Mac), are stimulated by pro-inflammatory cytokines secreted by pathogens and from other immune cells during infection. They have pro-inflammatory and anti-tumorigenic capabilities and highly express the markers CD80, CD86, and the antigen-presenting mechanism HLA-DR. Alternatively activated macrophages, or M2 macrophages (M2-Mac), are stimulated by an immunosuppressive environment, as well as the cytokines IL-4, IL-10, and TGF-beta. M2-Mac highly express the markers CD163 and CD206, are involved in wound healing and tissue regeneration, and are therefore anti-inflammatory. In the context of the TME, immunosuppressive signaling changes the TAM phenotype towards an M2, pro-tumorigenic state.

[0099] To test the adaptability and response to stimuli, day 19 SIRPα-KO i-Mac 19 cells were polarized for 48 h to M1 and M2 phenotypes by adding IFN-y+LPS and IL-4, respectively (Figure 3D). The morphology of WT and SIRPα-KO i-Macs was visibly altered after the polarization period, in particular M1-polarized i-Macs adhered to the bottom of the plate in tight clumps, whereas M2-polarized i-Macs were mostly floating and showed only a few elongated adherent cells (Figure 3E). By utilizing flow cytometry analysis, the cell surface expression of M1 markers CD86 and CD80, as well as M2 markers CD163 and CD206, of i-Macs was analyzed after polarization. Strikingly, M2-polarized WT and SIRPα-KO iMacs had the highest expression of M1 marker CD86, without upregulation of M2 marker CD163 (Figure 3F). This finding suggests that hiPSC-macrophages may have a more pro-inflammatory phenotype, even when stimulated with IL-4. This may be advantageous for clinical use of SIRPα-KO i-Macs against solid tumors, as SIRPα-KO i-Macs may be resistant to the immunosuppressive environment containing IL-4 in the TME. However, there was an expected increase in expression of CD206, as well as downregulation of CD14 and CD80 in M2 SIRPα-KO i-Macs (Figure 3F). M1-polarized SIRPα-KO i-Macs upregulated CD14 and CD80 expression compared to both MO and M2 phenotypes. Most interestingly, M1 polarization increased HLA-DR expression on i-Macs, implying that SIRPα-KO i-Macs have an antigen-presenting mechanism and the ability to communicate with the adaptive immune system (Figure 3F). This suggests that in the TME, activated SIRPα-KO i-Macs may have the potential to present phagocytosed tumor antigens to nearby T cells.Overall, these data show that SIRPα-KO i-Macs up- and / or down-regulate the same cell surface markers as WT i-Macs in response to M1 and M2 polarization, establishing that knocking out SIRPα does not affect macrophage fitness or response to stimuli.

[0100] SIRPα-KO i-Macs have superior anti-tumorigenic properties against CD47+ cancer cells The most important quality of the SIRPα-KO i-Mac to evaluate is its ability to phagocytose cancer and its overall antitumor properties. CD47 is overexpressed in many solid tumor cancers, including ovarian, pancreatic, breast, lung, and melanoma, and subsequently blocks macrophage phagocytosis. One would expect to see increased phagocytosis by the SIRPα-KO i-Mac against CD47-expressing cancer cells. However, simply knocking out SIRPα should not initiate nonspecific phagocytosis, since CD47 / SIRPα signaling blocks only the activating signal. Therefore, therapeutic monoclonal antibodies (mAbs) were used to direct the SIRPα-KO i-Mac to phagocytose cancer cells. Fc receptors on macrophages bind mAbs that target specific cancer antigens and stimulate antibody-dependent cellular phagocytosis (ADCP), resulting in tumor cell death.

[0101] CD47 overexpression has previously been shown to predict poor patient prognosis and promote cancer cell invasion in high-grade serous ovarian cancer, and is expressed on the ovarian cancer cell line SKOV-3 (Li, et al., American Journal of Translational Research, 9(6), 2901-2910). In an in vitro cancer challenge, SKOV-3 GFP+ ovarian cancer cells were cultured with WT or SIRPα-KO i-Macs at various effector-to-target ratios (E:T) with or without anti-HER2 for 24 hours. Without the addition of anti-HER2, both WT and SIRPα-KO i-Macs phagocytosed only up to 3-4% of cancer cells at an effector-to-target ratio of 8:1 (Figure 4A and Figure 4B). When anti-HER2 was added to the 24-hour co-cultures, SIRPα-KO i-Macs phagocytosed approximately 25%, 35%, and 42% of SKOV-3 cells at effector-to-target ratios of 2:1, 4:1, and 8:1, respectively, significantly more than WT i-Macs phagocytosed with anti-HER2 across all ratios (Figure 4A and Figure 4B). SIRPα-KO i-Macs visibly attached to SKOV-3 GFP+ cells upon addition of anti-HER2 mAh, as seen by the white arrows in Figure 4C. Even at only an effector-to-target ratio of 2:1, SIRPα-KO i-Macs phagocytosed nearly three times as many as WT i-Macs with antibody.

[0102] To test phagocytic capacity across multiple cancers, GD2-expressing WM266-4 melanoma cancer cells stained with CellTrace Violet were co-cultured with i-Macs with or without anti-GD2 Chl4.18 mAh. Similar results of enhanced phagocytosis by SIRPα-KO i-Macs were expected because WM266-4 highly expresses CD47 (Figure 7). Flow cytometry was performed to quantitate double positive CellTrace Violet+CD14+ phagocytic macrophages. After only 6 hours, SIRPα-KO i-Macs+anti-GD2 had phagocytosed approximately 80% of WM266-4 cells at an effector-to-target ratio of 8:1, significantly more than WT i-Macs with or without anti-GD2 (Figure 4D and Figure 4E). These findings indicate that SIRPα-KO i-Macs have superior phagocytosis of multiple CD47-expressing cancers with the addition of cancer-specific therapeutic monoclonal antibodies.

[0103] To capture a smaller time window of antibody-dependent phagocytosis (ADCP), HER2-expressing SKOV-3 GFP+ ovarian cancer cells were cultured with wild-type (WT) or SIRPα-KO iMacs with or without anti-HER2 monoclonal antibody for a total of 6 hours. As seen in the 24 hour assay, without the addition of anti-HER2, both WT and SIRPα-KO iMacs phagocytosed little to no cancer cells at all effector-to-target ratios (E:T), suggesting the safety of SIRPα-KO iMacs against healthy CD47+ cells (Figure 4F). However, when anti-HER2 was added, SIRPα-KO iMacs phagocytosed SKOV-3 cells at a significantly higher rate than WT (Figure 4F). In addition, at only a 1:1 E:T ratio, SIRPα-KO iMacs had a significantly higher percentage of active phagocytes than WT upon addition of anti-HER2, with 13.6% ± 0.60 SIRPα-KO iMacs phagocytosing compared to only 4.77% ± 0.41 in WT iMacs (Figure 4G). These data suggested that knocking out SIRPα in iMacs, in contrast to WT iMacs, led to a greater percentage of macrophages engaging in phagocytosis upon exposure to SKOV-3 cancer and anti-HER2 mAh, leading to a higher percentage of SKOV-3 cells being depleted by antibody-dependent phagocytosis in just 6 hours.

[0104] Macrophages also have the capacity for cytotoxicity through antibody-dependent cellular cytotoxicity (ADCC), an attractive quality for cancer immunotherapy. When SIRPα-KO i-Macs + anti-HER2 mAb were co-cultured with HER2+CD47+MCF7 breast cancer spheroids for 4 days, there were significantly more dead cells in the MCF7 cancer spheroids than in their wild-type (WT) counterparts, as indicated by the white arrows (Figure 5A and Figure 5B). There was little or no cytotoxicity to cancer cells without anti-HER2 monoclonal antibodies in either SIRPα-KO or WT i-Macs (Figure 5A and Figure 5B). These preliminary data suggested that CD47 / SIRPα signaling not only blocked phagocytosis activation signals, but also blocked all antibody-dependent anti-tumorigenic properties from macrophages. Taken together, these findings suggested that the novel SIRPα-KO i-Macs are attractive candidates for clinical treatment of solid tumors and could be used as inducers in combination with therapeutic monoclonal antibodies.

[0105] The current in vitro antibody-dependent phagocytosis assay only considers GFP+ cells within CD45+ iMacs during flow cytometry analysis, ignoring all cancer cells killed or destroyed by mechanisms other than phagocytosis. To assess in vitro ADCC, iMacs were co-cultured with a fixed number of luciferase-expressing SKOV-3 cells across various E:T ratios and time points using a SpectraMax plate reader, which served to quantify the viability of SKOV-3 cells. The percentage of cytotoxicity was calculated by the following formula: 100×(baseline tumor growth−experimental value) / (baseline−maximum lysis control). In these experiments, SIRPα-KO iMacs were significantly better at killing SKOV-3 cells under any condition with the addition of anti-HER2 compared to wild-type (WT) iMacs + anti-HER2 (Figure 5C and Figure 5D). After 96 hours of co-culture, SIRPα-KO iMacs killed 93% ± 1.47 SKOV-3 cells at 96 hours compared to 27.3% ± 8.73 for SIRPα-KO iMacs, which killed nearly 100% of the ovarian cancers (Figure 5D). This data also shows that within the in vitro assay, SIRPα-KO iMacs with anti-HER2 mAb were able to overcome the inherent growth of ovarian cancer over 96 hours seen when SIRPα-KO or WT iMacs were co-cultured with SKOV-3 without antibody, shown as negative % cytotoxicity in Figure 5D.

[0106] To test the cytotoxicity of SIRPα KO iMacs across multiple cancer types, GD2+GD3+WM266-4 melanoma cancer cells were co-cultured with iMacs with or without anti-GD3 mAh for 48 hours. With the addition of anti-GD3, SIRPα-KO iMacs were significantly more cytotoxic than WT iMacs at a 10:1 ratio, and unlike the other iMac groups, showed a steady increase in cytotoxicity across all ratios (Figure 5E). Instead, WT iMacs showed "negative" cytotoxicity, representing proliferation from baseline of WM266-4 melanoma cells. These data demonstrated the tumor-promoting qualities of WT iMacs that SIRPα-KO iMacs do not possess. To conclude the in vitro ADCC assay, SIRPα KO iMacs were challenged with 3D MCF-7 spheroids, a low HER2-expressing breast cancer cell line. After 4 days of co-culture, SIRPα-KO iMacs with anti-HER2 killed a greater number of tumor cells within the spheroids than WT + anti-HER2, supporting that SIRPα-KO iMacs have an increased ability to invade and kill cancer cells within the 3D TME structure, even against tumors with low antigen expression (Figure 5A-B). This spheroid model was particularly useful because it is both quantitative and spatially qualitative. These results demonstrated that in vitro SIRPα-KO iMacs had superior antibody-dependent antitumor activity, including phagocytosis and cytotoxicity against SKOV-3, WM266-4, and MCF-7 solid tumor cancer cell lines, enhancing the efficacy of FDA-approved monoclonal antibody therapy.

[0107] Macrophages within the tumor microenvironment are involved in promoting solid tumor growth, metastasis, and survival through numerous mechanisms including direct cell-cell signaling, cytokine signaling (Chen et al., 2019, Journal of Biomedical Science 26: 78; Chanmee et al., 2014, Cancers 6: 1670-1690; and Zhu et al., 2021, Journal of Cancer 12: 54-64). Many anti-inflammatory cytokines and factors expressed by macrophages, such as TGF-beta, IL-10, Argl, IDO, and HIF-1alpha, have been associated with solid tumor progression. Due to a myriad of anti-inflammatory cytokine expression, pro-inflammatory cytokines that promote immune cell activation to an anti-tumorigenic state are suppressed or overwhelmed. SIRPα and CD47 signaling between tumor-associated macrophages within the tumor microenvironment has not been fully evaluated in the context of cytokine signaling pathways. To assess whether SIRPα-KO iMacs have the same cytokine signaling as WT iMacs in response to tumors, iMacs and SKOV-3 ovarian cancer cells were co-cultured together for 48 hours and 20 different cytokines were assessed by multiplex assay (Figure 5F). Surprisingly, SIRPα-KO iMacs were found to upregulate many pro-inflammatory cytokines in the presence of anti-HER2 mAh and SKOV-3 tumors compared to WT iMacs. Specifically, IL-1 alpha, IL-1 beta, IFN-gamma, and TNF-alpha were all upregulated in the SIRPα-KO iMac + anti-HER2 treatment group (Figure 5G-5J, respectively). These data suggested that SIRPα may play a larger role in the macrophage-tumor axis than simply directing cells to block phagocytosis. Another possibility is that in the absence of SIRPα, macrophages are more readily engaged in antibody-dependent tumor killing or phagocytosis and then have changes in the cytokines released in the environment.These results demonstrated increased expression of pro-inflammatory cytokines in the SIRPα-KO iMac+anti-HER2 group compared with WT+anti-HER2, further supporting enhanced antibody-dependent function within SIRPα-KO iMacs.

[0108] Example 2: Generation and characterization of SIRPα knockout neutrophils material and method

[0109] cell culture Wild-type bone marrow-derived IISH2i-BM9 hiPSCs (Hu et al., 2011, eBlood 117: el09-el 19) were obtained from WiCell (Madison, WI). Human induced pluripotent stem cells (hiPSCs) with knockout SIRPα gene were generated using CRISPR / Cas9 technology. Wild-type and SIRPα - / - hiPSCs were cultured on Matrigel-coated tissue culture plates in E8 medium (STEMCELL Technologies).

[0110] mmRNA synthesis and transfection Human ETV2 transcript variant 1 (NM_014209.3) was cloned into the 5'-MCS-1β construct as previously described (Suknuntha et al., 2018, Stem Cell Rev. 14, 525-534). To generate an IVT template with a 180-A tract, a reverse primer containing 180 T base pairs and a forward primer ATCGGTGCGGGCCTCTTCGCTA (SEQ ID NO: 3) containing a T7 promoter were used in the PCR reaction. All PCR reactions were performed using Phusion (Thermo Fisher Scientific). mmRNA was synthesized using the MEGAscript T7 kit (Ambion, Austin, TX) with a custom ribonucleoside cocktail consisting of 3'-0-Me-m7G(5')ppp(5')G ARCA cap analog, pseudouridine triphosphate (TriLink BioTechnologies, San Diego, CA), ATP, guanosine triphosphate, and cytidine triphosphate. The synthesis reaction was set up according to the manufacturer's instructions. The reaction was incubated at 37°C for 2 hours and treated with DNAse. RNA was purified using PureLink RNA Mini Kit (Thermo Fisher Scientific) and adjusted to a working concentration of 100ng / μL with RNase-free water before storing at -80°C. Undifferentiated hiPSCs were transfected using TransIT-mRNA reagent in E8 medium containing ROCK inhibitor (Suknuntha et al., 2018, Stem Cell Rev. 14: 525-534). Briefly, for transfection, single cell suspensions were prepared using HyQtase (Thermo Fisher Scientific). A total of 2 × 105 cells in 1 mL of complete E8 medium containing 10 μM ROCK inhibitor (STEMCELL Technologies) were seeded into collagen IV-coated 6-well plates per well for transfection. After 30–60 min, a mixture of 200 ng of ETV2:TransIT-mRNA (Minis Bio, Madison, WI) was added to each well according to the manufacturer's instructions.

[0111] Feeder-free, xeno-free, and serum-free generation of neutrophils from hiPSCs The day after transfection (day 1), the medium was changed with 1 mL of Stemline II (Sigma) supplemented with 20 ng / mL human FGF2 (PeproTech). On day 2, 1 mL of the same medium was added. On day 3, the medium was changed and 1 mL of Stemline II supplemented with FGF2 (20 ng / mL), GM-CSF (25 ng / mL) (PeproTech), and UM171 (50 nM, Xcess Biosciences) was added. This medium was added daily until day 8. On day 9, the floating cells were gently harvested and used for terminal neutrophil differentiation. After the first collection of floating cells, 2 mL of Stemline II supplemented with FGF2, GM-CSF, and UM171 was added to the remaining adherent cells. To induce neutrophil terminal differentiation, 5 × 10 cells were cultured in StemSpanH300 medium (STEMCELL Technologies) supplemented with GlutaMAX 100X (Thermo Fisher Scientific), ExCyte 0.2% (Merck Millipore), human G-CSF (150 ng / mL, Amgen), Am580 retinoic acid agonist 2.5 μM (Sigma-Aldrich), and gentamicin (l,000x) (Life Technologies). 5 Suspension cells were cultured at a density of 10000 cells / mL. After 4 days, 2 mL of the same medium containing all components and cytokines was added on top of the existing culture. Mature neutrophils were gently harvested from the supernatant after 8 days of culture, leaving behind adherent macrophages, and filtered through a 70 μM mesh (Falcon, Life Sciences) before analysis.

[0112] Flow cytometry 5 x 10 cells to analyze cell surface markers 5Cells were stained in fluorescence-activated cell sorting buffer with appropriate antibodies (Table 1). Live cell populations were analyzed using Ghost Dye (Tonbo Biosciences, San Diego, CA). Cells were analyzed using a MACS Quant Analyzer 10 (Miltenyi Biotec, San Diego, CA) or Thermo Fisher Scientific FlowJo software (Tree Star, Ashland, OR).

[0113] [Table 1]

[0114] Wright-Giemsa staining To evaluate the morphology of cells within colonies, cells were fixed onto glass slides using a Cytospin centrifuge (Cytospin 2, Thermo Shandon), stained with Wright-Giemsa solution (Sigma-Aldrich), and then observed under a light microscope (Olympus, Tokyo).

[0115] In vitro cytotoxicity assay WM266-4 LUC2 GFP, CHLA-20_AAVS1-AkaLuc-EGFP, SK-BR3 LUC2 GFP, and SKOV3 LUC2 GFP cells were maintained in tumor-specific medium (Sigma-Aldrich) containing 80% MCDB-153, 20% Leibovitz's L-15, 1.68 mM CaCl2, and 2% FBS. To access cytotoxicity, hiPSC-derived wild-type and SIRPα were used. - / -Neutrophils or SIRPα-KO neutrophils or macrophages were incubated with target tumor cells (2,000 cells / well) for 4 hours at 37°C at effector:target (E:T) ratios of 1:1, 2:1, 5:1, 10:1 in a final volume of 200 μL in 96-well plates. Target cells were used for maximum lysis with Pierce™ IP lysis buffer (ThermoFisher). VivoGlo™ luciferin substrate (100ug / well, Promega) was added and luminescence was measured immediately after 5 minutes of incubation. Specific cell lysis was measured by % of cell lysis = 100 x {(spontaneous relative light units (RLU)-test RLU) / (spontaneous RLU-maximum killing RLU)}.

[0116] Candida auris planktonic yeast killing assay Wild type and SIRPα - / - Neutrophils were seeded at 1:1 MOI for 6 hours. hiPSC-neutrophils were then lysed with ddH2O+lOOug / mL DNase 1 solution for 1 hour. PrestoBlue (metabolic assay) reagent was then added and fluorescence was measured at 560 / 590 nm after 2 hours of incubation at 37c / 5% CO2. The percentage of viable yeast was quantified relative to yeast without neutrophils. Neutrophil-only controls were subtracted from the values. Bar graphs show ±SEM from three independent experiments showing yeast viability. Differences compared to wild type were not significant (p=0.1755) as determined by unpaired t-test.

[0117] Phagocytosis Phagocytosis was assessed using pHrodo Green E. coli BioParticles Conjugate (Invitrogen) according to the manufacturer's revised protocol. pHrodo Green E. coli beads were resuspended in 2 mL of PBS and sonicated three times in a sonicator (20% amplitude, 20 sec on / 10 sec off). Beads (100 μL) per assay were opsonized by mixing with opsonization reagent in a 1:1 ratio and incubated for 1 h at 37°C. Beads were washed three times with mHBSS buffer by centrifugation at 1,500 RCF for 15 min at 4°C, followed by a final resuspension in mHBSS buffer. Beads were used immediately or stored at 4°C for several days. Wild-type and SIRPα - / - Neutrophils (5×10 5 ) were resuspended in 100 μL of opsonized bead solution and incubated at 37°C or on ice for 1 h. Phagocytosis was stopped by placing all samples on ice. Analysis was performed using a Thermo Fisher Scientific Attune cytometer for fluorescent particles (509 / 533). Propidium iodide was used to gate cells based on granulocyte populations, single cells, and live cells.

[0118] Measurement of reactive oxygen species production in neutrophils Planktonic wild type and SIRPΑ - / -neutrophils (10 5 ) were seeded into each well of a black 96-well plate on 10 μg / mL fibrinogen with 100 μL mHBSS buffer in the presence of 10 ng / mL dihydrorhodamine 123. Cells were incubated for 30 min at 37°C / 5% CO2. PMA was added to a final concentration of 50 ng / mL or solvent control DMSO was added to samples. A time course was used to determine optimal reactive oxygen species production. Fluorescence measurements of samples were performed in triplicate or quadruplicate on a Victor3 V plate reader (Ex / Em 500 / 536).

[0119] Chemotaxis assay Chemotaxis was assessed using a microfluidic device. Briefly, polydimethylsiloxane devices were plasma treated and attached to glass coverslips. Devices were coated with 10 μg / mL fibrinogen (Sigma) in PBS for 30 min at 37 °C and 5% CO2. Devices were blocked with 2% BSA-PBS for 30 min at 37 °C and 5% CO2 to block nonspecific binding, then washed twice with mHBSS. Wild-type and SIRPα - / - Neutrophils were stained with calcein AM (Molecular Probes) in PBS for 10 min at room temperature and then resuspended in modified Hank's balanced salt solution (mHBSS). - / - Neutrophils were seeded at 5 × 106 / mL and allowed to adhere for 30 min before the addition of chemoattractant. Either 1 μM fMLP (Sigma) or 11.25 μM IL-8 (R&D Systems) was loaded into the device. Cells were imaged every 30 s for 45–90 min on a Nikon Eclipse TE300 inverted fluorescent microscope with a 10x objective and automated stage using MetaMorph software (Molecular Devices). Automated cell tracking analysis was performed using JEX software to calculate chemotaxis index and velocity. Human Inflammation 20-Plex ProcartaPlex Panel

[0120] SIRPα-KO iMacs and wild-type (WT) iMacs were cultured alone or co-cultured with SKOV-3 ovarian cancer and anti-HER2 monoclonal antibody for 48 hours. Supernatants were collected for Human Inflammation 20-plex ProcartaPlex Panel (ThermoFisher). Supernatants were tested in technical replicates and raw values ​​were generated on a MAGPIX xMAP instrument plotted against a standard curve.

[0121] result form Wild type and SIRPα - / -Transfection of ETV2 mmRNA into single cells of hiPSCs resulted in the formation of typical endothelial cell morphology within 24 hours (Figure 10). During the differentiation process, the cells changed their morphology and formed floating myeloid progenitor cells (Figure 10). After terminal differentiation, neutrophils were identified by Wright-Giemsa staining (Figure 12).

[0122] Cell surface markers In wild-type and SIRPΑ^ cells, myeloid progenitors expressed the CD45 surface marker at day 9 (Figure 11). Expression of CD11b and CD16 on terminally differentiated neutrophils demonstrated the ETV2 mmRNA-induced granulocytic differentiation program (Figure 12).

[0123] Functional evaluation Functional characterization of neutrophils was performed using cytotoxicity assays (Figure 13), phagocytosis, and migration assays (Figure 14). Compared to wild-type neutrophils, SIRPα - / - Neutrophils exhibited excellent motility and phagocytosis of bacterial particles and tumor cells.

[0124] Quantification ETV2 mmRNA induction, 10 6 1.7 x 10 wild-type hiPSCs 7 Neutrophils, 10 6 SIRPΑ - / - 3 × 10 hiPSCs 7 neutrophils were produced within 3 weeks.

[0125] Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above description, but rather as set forth in the appended claims. Those skilled in the art will appreciate that various changes and modifications can be made to the present specification without departing from the spirit or scope of the present invention, as defined in the following claims.

Claims

1. 1. A method for producing modified macrophages from pluripotent stem cells, comprising: (a) L-ascorbic acid-2-phosphate magnesium, sodium selenium, transferrin, insulin, NaHCO 3 Culturing human pluripotent stem cells in which the expression of signal-regulatory protein alpha (SIRPα) is inhibited in a serum-free culture medium containing fibroblast growth factor 2 (FGF2), transforming growth factor beta 1 (TGFβ1), and a Rho kinase (ROCK) inhibitor under normoxic conditions for approximately 24 hours; (b) further culturing the human pluripotent stem cells of (a) in a serum-free culture medium containing bone morphogenetic protein 4 (BMP4), FGF2, activin A, an inhibitor of glycogen synthase 3 (GSK3), and a ROCK inhibitor under hypoxic conditions for about 48 hours to induce mesoderm formation; (c) further culturing the cultured cells of (b) for about 48 hours under hypoxic conditions in a serum-free culture medium containing FGF2, vascular endothelial growth factor (VEGF), and an inhibitor of TGFβ-mediated signaling to induce hemogenic endothelial cell formation; (d) further culturing the cultured cells of (c) in a serum-free culture medium containing FGF2, VEGF, stem cell factor (SCF), thrombopoietin (TPO), interleukin-6 (IL-6), and interleukin-3 (IL-3) under normoxic conditions for about 6 days, wherein the hemogenic endothelial cells differentiate into HPCs; (e) culturing the HPCs of (d) in a serum-free culture medium containing macrophage colony-stimulating factor (M-CSF), IL-3, and IL-6 under normoxic conditions for about 6 days to obtain bone marrow progenitor cells and monocytic cells; (f) further culturing the cultured cells of (e) in a serum-free culture medium containing M-CSF under normoxic conditions for about 4 days, whereby the cultured bone marrow progenitor cells and monocytes differentiate into a cell population comprising modified macrophages.

2. 2. The method of claim 1, wherein the inhibitor of TGFβ-mediated signaling is SB431542.

3. 2. The method of claim 1, wherein the inhibitor of GSK3 is lithium chloride (LiCl).

4. The method of claim 1, wherein the ROCK inhibitor is Y-27632.

5. 2. The method of claim 1, wherein the expression of SIRPα is inhibited in the human pluripotent stem cells by genetic mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.

6. The method described in claim 5, wherein the gene editing method includes the use of a nuclease selected from a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), and a Cas enzyme.

7. 6. The method of claim 5, wherein the gene editing results in knockout of SIRPα expression.

8. 7. The method of claim 6, wherein the nuclease is a Cas9 enzyme.

9. The method of claim 1 , wherein the pluripotent stem cells are induced pluripotent stem cells.

10. A population of modified macrophages produced by the method of claim 1.

11. 1. A method for producing modified macrophages from pluripotent stem cells, comprising: (a) transiently introducing exogenous ETV2 into human pluripotent stem cells in which SIRPα expression has been inhibited, and culturing the ETV2-induced pluripotent stem cells in a serum-free culture medium containing FGF-2 to produce a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs); (b) culturing the ETV2-derived HEPs in a serum-free and xeno-free culture medium containing granulocyte-macrophage colony-stimulating factor (GM-CSF) and FGF2 for a time sufficient to produce non-adherent bone marrow progenitor cells; (c) culturing the non-adherent bone marrow progenitor cells in a serum-free and xeno-free culture medium containing M-CSF, IL-6, and IL-3; (d) further culturing the cultured cells of (c) in a serum-free and xeno-free culture medium containing M-CSF for a time sufficient to differentiate the non-adherent bone marrow progenitor cells into modified macrophages.

12. 12. The method of claim 11, wherein the serum-free and xeno-free culture medium of (b) further comprises UM171.

13. 12. The method of claim 11, wherein the expression of SIRPα is inhibited in the human pluripotent stem cells by genetic mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.

14. 14. The method of claim 13, wherein the gene editing results in knockout of SIRPα expression.

15. The method described in claim 13, wherein the gene editing method includes the use of a nuclease selected from a meganuclease, a ZFN, a TALEN, and a Cas enzyme.

16. 16. The method of claim 15, wherein the nuclease is a Cas9 enzyme.

17. The method comprises: step (a) comprises culturing the ETV2-induced pluripotent stem cells for about 1 to 2 days; step (b) comprises culturing the ETV2-induced HEPs for about 6 to 7 days; and step (c) and step (d) comprise culturing the bone marrow progenitor cells for about 9 to 10 days; The method of claim 11 , comprising one or more of:

18. The method of claim 11 , wherein the pluripotent stem cells are induced pluripotent stem cells.

19. A population of modified macrophages produced by the method of claim 11.

20. 1. A method for producing modified neutrophils from pluripotent stem cells, comprising: (a) transiently introducing exogenous ETV2 into human pluripotent stem cells in which SIRPα expression has been inhibited, and culturing the ETV2-induced pluripotent stem cells in a serum-free culture medium containing FGF-2 to produce a population of ETV2-induced blood endothelial progenitor cells (ETV2-induced HEPs); (b) culturing the ETV2-derived HEPs in a serum-free and xeno-free culture medium containing GM-CSF and FGF2 for a time sufficient to produce non-adherent bone marrow progenitor cells; (c) culturing the non-adherent bone marrow progenitor cells in a serum-free and xeno-free culture medium containing granulocyte-colony stimulating factor (G-CSF) and a retinoic acid receptor agonist for a period of time sufficient to differentiate the non-adherent bone marrow progenitor cells into neutrophils.

21. 21. The method of claim 20, wherein the serum-free and xeno-free culture medium of (b) further comprises UM171.

22. 21. The method of claim 20, wherein the expression of SIRPα is inhibited in the human pluripotent stem cells by genetic mutation, RNA-mediated inhibition, RNA editing, DNA gene editing, or base editing.

23. 21. The method of claim 20, wherein the gene editing results in knockout of SIRPα expression.

24. The method described in claim 22, wherein the gene editing method includes the use of a nuclease selected from a meganuclease, a ZFN, a TALEN, and a Cas enzyme.

25. 23. The method of claim 22, wherein the nuclease is a Cas9 enzyme.

26. 21. The method of claim 20, wherein the retinoic acid receptor agonist is AM580.

27. The method comprises: step (a) comprises culturing the ETV2-induced pluripotent stem cells for about 1 to 2 days; step (b) comprises culturing the ETV2-induced HPCs for about 6 to 7 days; and steps (c) and (d) comprise culturing the bone marrow progenitor cells for about 8 to 9 days; 21. The method of claim 20, comprising one or more of:

28. 21. The method of claim 20, wherein the pluripotent stem cells are induced pluripotent stem cells.

29. 21. A population of modified neutrophils produced by the method of claim 20.

30. 20. A pharmaceutical composition for use in the treatment of cancer, comprising the modified macrophage of claim 10 or claim 18.

31. 31. The pharmaceutical composition of claim 30, which is administered in combination with a tumor-specific antibody.

32. 30. A pharmaceutical composition comprising the modified neutrophils of claim 29 for use in the treatment of cancer.

33. 30. A pharmaceutical composition comprising the modified neutrophils of claim 29 for use in the treatment of a bacterial infection.

34. 34. The pharmaceutical composition of claim 33, wherein the bacterial infection is a systemic infection.

35. Use of the modified macrophage described in claim 10 or claim 18 in the manufacture of a medicament for treating cancer.

36. Use of the modified neutrophils described in claim 29 in the manufacture of a medicament for treating cancer.

37. Use of the modified neutrophils described in claim 29 in the manufacture of a medicament for treating a bacterial infection.