RNAi constructs for inhibiting PNPLA3 expression and methods of use thereof

Abstract

The present disclosure relates to RNAi constructs, such as siRNAs, for reducing the expression of the PNPLA3 gene. Methods of using such RNAi constructs for treating or preventing liver diseases, such as non-alcoholic fatty liver disease (NAFLD), are also described. The present disclosure relates to compositions and methods for regulating the hepatic expression of patatin-like phospholipase domain-containing 3 (PNPLA3). In particular, the present disclosure relates to nucleic acid-based therapeutics for reducing PNPLA3 expression via RNA interference and methods of using such nucleic acid-based therapeutics to treat or prevent liver diseases, such as non-alcoholic fatty liver disease (NAFLD).

Description

[Technical field]

[0001] The present disclosure relates to compositions and methods for modulating hepatic expression of patatin-like phospholipase domain-containing 3 (PNPLA3), in particular to nucleic acid-based therapeutics for reducing PNPLA3 expression via RNA interference and methods of using such nucleic acid-based therapeutics to treat or prevent liver disease, such as non-alcoholic fatty liver disease (NAFLD).

[0002] Incorporation by Reference of Electronically Submitted Materials The nucleotide / amino acid sequence listing submitted contemporaneously herewith is incorporated by reference in its entirety and is identified as follows: One 1,930 kilobyte XML document entitled "A-2910-WO01-SEC.xml" created on March 20, 2023.

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 322,845, filed March 23, 2022. [Background technology]

[0004] Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease worldwide, encompassing a range of liver pathologies; its prevalence has doubled over the past two decades, and it is now estimated to affect approximately 20% of the world's population (Sattar et al. (2014) BMJ 349:g4596; Loomba and Sanyal (2013) Nature Reviews Gastroenterology & hepatology 10(11):686-690; Kim and Kim (2017) Clin Gastroenterol Hepatol 15(4):474-485; Petta et al. (2016) Dig Liver Dis 48(3):333-342). NAFLD begins with the accumulation of triglycerides in the liver and is defined by the presence of cytoplasmic lipid droplets in more than 5% of hepatocytes in individuals who 1) have no history of significant alcohol consumption, and 2) have excluded diagnoses of other types of liver disease (Zhu et al (2016) World J Gastroenterol 22(36):8226-33; Rinella (2015) JAMA 313(22):2263-73; Yki-Jarvinen (2016) Diabetologia 59(6):1104-11). In some individuals, the accumulation of ectopic fat in the liver, called steatosis, induces inflammation and hepatocellular injury, leading to a more advanced stage of the disease called nonalcoholic steatohepatitis (NASH) (Rinella, supra). As of 2015, it is estimated that 75-100 million Americans have NAFLD, with NASH accounting for approximately 10-30% of NAFLD diagnoses (Rinella, supra; Younossi et al (2016) Hepatology 64(5):1577-1586).

[0005] Patatin-like phospholipase domain-containing 3 (PNPLA3), previously known as adiponutrin (ADPN) and calcium-independent phospholipase A2-epsilon (iPLA(2)ε), is a type II transmembrane protein (Wilson et al (2006) J Lipid Res 47(9):1940-9; Jenkins et al (2004) J Biol Chem 279(47):48968-75). It was first identified in adipocytes as a membrane-bound, lipid-enriched protein induced during adipogenesis in mice, but is now known to be expressed in other tissues, including the liver (Wilson et al., supra; Baulande et al. (2001) J Biol Chem 276(36):33336-44; Moldes et al. (2006) Eur J Endocrinol 155(3):461-8; Faraj et al. (2006) J Endocrinol 191(2):427-35; Liu et al. (2004) J Clin Endocrinol Metab 89(6):2684-9; Lake et al. (2005) J Lipid Res 46(11):2477-87). In cell-free biochemical systems, recombinant PNPLA3 protein can exhibit either triacylglycerol lipase or transacylation activity (Jenkins et al., supra; Kumari et al. (2012) Cell Metab 15(5):691-702; He et al. (2010) J Biol Chem 285(9):6706-15). In hepatocytes, PNPLA3 is expressed in the endoplasmic reticulum and on lipid membranes and exhibits mainly triacylglycerol hydrolase activity (He et al., supra; Huang et al. (2010) Proc Natl Acad Sci USA 107(17):7892-7; Ruhanen et al. (2014) J Lipid Res 55(4):739-46; Pingitore et al. (2014) Biochim Biophys Acta 1841(4):574-80).Although PNPLA3 lacks a secretory signal, data indicate that it is secreted and can be found in human plasma as disulfide bond-dependent multimers (Winberg et al. (2014) Biochem Biophys Res Commun 446(4):1114-9).

[0006] Currently, NAFLD symptoms are managed by weight loss and treatment of any secondary symptoms, as there is no approved pharmacological treatment. Thus, there is a need for compositions and methods for treating NAFLD in affected individuals. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Sattar et al. (2014)BMJ 349:g4596 [Non-Patent Document 2] Loomba and Sanyal(2013)Nature Reviews Gastroenterology & hepatology 10(11):686-690 [Non-Patent Document 3] Kim and Kim(2017) Clin Gastroenterol Hepatol 15(4):474-485 [Non-Patent Document 4] Petta et al. (2016) Dig Liver Dis 48(3):333-342 [Non-Patent Document 5] Zhu et al (2016) World J Gastroenterol 22(36):8226-33 [Non-Patent Document 6] Rinella(2015)JAMA 313(22):2263-73 [Non-Patent Document 7] Yki-Jarvinen (2016) Diabetologia 59(6):1104-11 [Non-Patent Document 8] Younossi et al(2016)Hepatology 64(5):1577-1586

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

Non-licensed Document 17

Non-licensed Document 18

Non-licensed Document 19

Non-licensed Document 20

[0008] The present disclosure provides an RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region having a sequence complementary to a PNPLA3 mRNA sequence, such as a PNPLA3 mRNA sequence listed in Table 1, wherein the RNAi construct inhibits expression of PNPLA3. In certain embodiments, the RNAi construct comprises a region having at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from an antisense sequence selected from SEQ ID NOs: 565-1068 and 2329-3588. In some embodiments, the antisense strand hybridizes to a PNPLA3 mRNA sequence listed in Table 1.

[0009] In some embodiments, the sense strand of the RNAi construct described herein comprises a sequence sufficiently complementary to the sequence of the antisense strand to form a duplex region about 15 to about 30 base pairs in length. In these and other embodiments, the sense strand and the antisense strand are each about 15 to 30 nucleotides in length. In some embodiments, the RNAi construct comprises at least one blunt end. In other embodiments, the RNAi construct comprises at least one nucleotide overhang. Such a nucleotide overhang may comprise at least 1 to 6 unpaired nucleotides and may be located at the 3' end of the sense strand, the 3' end of the antisense strand, or the 3' ends of both the sense strand and the antisense strand. In certain embodiments, the RNAi construct comprises an overhang of two unpaired nucleotides at the 3' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the RNAi construct comprises an overhang of two unpaired nucleotides at the 3' end of the antisense strand and a blunt end at the 3' end of the sense strand / 5' end of the antisense strand.

[0010] The RNAi constructs of the present disclosure may include one or more modified nucleotides, including nucleotides with modifications to the ribose ring, nucleobase, or phosphodiester backbone. In some embodiments, the RNAi constructs include one or more 2'-modified nucleotides. Such 2'-modified nucleotides may include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNAs), glycol nucleic acids (GNAs), inverted bases (e.g., inverted adenosines), or combinations thereof. In a particular embodiment, the RNAi constructs include one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or combinations thereof. In some embodiments, all nucleotides of the sense and antisense strands of the RNAi construct are modified nucleotides.

[0011] In some embodiments, the RNAi construct comprises at least one backbone modification, such as a modified internucleotide or internucleoside bond. In certain embodiments, the RNAi construct described herein comprises at least one phosphorothioate internucleotide bond. In certain embodiments, the phosphorothioate internucleotide bond may be located at the 3'-end or 5'-end of the sense strand and / or the antisense strand.

[0012] In some embodiments, the antisense and / or sense strands of an RNAi construct of the present disclosure can comprise or consist of sequences from the antisense and sense sequences listed in Figures 1 or 2. In certain embodiments, an RNAi construct can comprise a duplex compound comprising an antisense strand and a sense strand, where the antisense strand comprises a sequence selected from SEQ ID NOs: 565-1068 and SEQ ID NOs: 2329-3588, and the sense strand comprises a sequence selected from SEQ ID NOs: 61-564 and SEQ ID NOs: 1069-2328.

[0013] The present disclosure also provides compositions comprising the aforementioned RNAi constructs and a pharma- ceutically acceptable carrier, excipient, or diluent, as well as methods for reducing expression of PNPLA3 in a patient in need thereof, comprising administering the aforementioned RNAi construct or composition to the patient. [Brief description of the drawings]

[0014] [Figure 1-1] 1 is a table listing unmodified and modified siRNA sequences directed against PNPLA3 tested in the in vitro experiments described in Example 2. All sequences are shown in 5'-3' orientation. [Figure 1-2] Same as above [Figure 1-3] Same as above [Figure 1-4] Same as above [Figure 1-5] Same as above [Figure 1-6] Same as above [Figure 1-7] Same as above [Figure 1-8] Same as above [Figure 1-9] Same as above [Figure 1-10] Same as above [Figure 1-11] Same as above [Figure 1-12] Same as above [Figure 1-13] Same as above [Figure 1-14] Same as above [Figure 1-15] Same as above [Figure 1-16] Same as above [Figure 1-17] Same as above [Figure 1-18] Same as above [Figure 1-19] Same as above [Figure 1-20] Same as above [Figure 1-21] Same as above [Figure 1-22] Same as above [Figure 1-23] Same as above [Figure 1-24] Same as above [Figure 1-25] Same as above [Figure 1-26] Same as above [Figure 1-27] Same as above [Figure 1-28] Same as above [Figure 1-29] Same as above [Figure 1-30] Same as above [Figure 1-31] Same as above [Figure 1-32] Same as above [Figure 1-33] Same as above [Figure 1-34] Same as above [Figure 1-35] Same as above [Figure 1-36] Same as above [Figure 1-37] Same as above [Figure 1-38] Same as above [Figure 1-39] Same as above [Figure 1-40] Same as above [Diagram 1-41] Same as above [Figure 1-42] Same as above [Figure 1-43] Same as above [Figure 1-44] Same as above [Figure 1-45] Same as above [Figure 1-46] Same as above [Figure 1-47] Same as above [Figure 1-48] Same as above [Figure 1-49] Same as above [Figure 1-50] Same as above [Figure 1-51] Same as above [Figure 1-52] Same as above [Figure 1-53] Same as above [Diagram 1-54] Same as above [Figure 1-55] Same as above [Diagram 1-56] Same as above [Diagram 1-57] Same as above [Diagram 1-58] Same as above [Diagram 1-59] Same as above [Figure 1-60] Same as above [Figure 1-61] Same as above [Figure 1-62] Same as above [Fig.1-63] Same as above [Fig.1-64] Same as above [Figure 1-65] Same as above [Figure 1-66] Same as above [Figure 1-67] Same as above [Figure 1-68] Same as above [Figure 1-69] Same as above [Figure 1-70] Same as above [Diagram 1-71] Same as above [Diagram 1-72] Same as above [Diagram 1-73] Same as above [Diagram 1-74] Same as above [Diagram 1-75] Same as above [Diagram 1-76] Same as above [Diagram 1-77] Same as above [Diagram 1-78] Same as above [Diagram 1-79] Same as above [Figure 1-80] Same as above [Fig.1-81] Same as above [Fig.1-82] Same as above [Fig.1-83] Same as above [Fig.1-84] Same as above [Fig.1-85] Same as above [Fig.1-86] Same as above [Fig.1-87] Same as above [Fig.1-88] Same as above [Fig.1-89] Same as above [Figure 1-90] Same as above [Figure 2-1] 1 is a table listing the unmodified and modified siRNA sequences directed against PNPLA3 tested in the in vivo studies described in Example 3. All sequences are shown in 5'-3' orientation. [Figure 2-2] Same as above [Figure 2-3] Same as above [Figure 2-4] Same as above [Figure 2-5] Same as above [Figure 2-6] Same as above [Diagram 2-7] Same as above [Figure 2-8] Same as above [Figure 2-9] Same as above [Figure 2-10] Same as above [Figure 2-11] Same as above [Figure 2-12] Same as above [Figure 2-13] Same as above [Figure 2-14] Same as above [Figure 2-15] Same as above [Figure 2-16] Same as above [Figure 2-17] Same as above [Figure 2-18] Same as above [Figure 2-19] Same as above [Figure 2-20] Same as above [Figure 2-21] Same as above [Figure 2-22] Same as above [Figure 2-23] Same as above [Figure 2-24] Same as above [Figure 2-25] Same as above [Figure 2-26] Same as above [Figure 2-27] Same as above [Figure 2-28] Same as above [Figure 2-29] Same as above [Figure 2-30] Same as above [Figure 2-31] Same as above [Figure 3-1] 1 is a table showing the results of siRNA inhibition of PNPLA3 in an AAV-based mouse model containing the complete human PNPLA3 coding sequence (CDS). [Figure 3-2] Same as above [Figure 3-3] Same as above [Diagram 3-4] Same as above [Figure 3-5] Same as above [Diagram 3-6] Same as above [Diagram 3-7] Same as above [Diagram 3-8] Same as above [Diagram 3-9] Same as above [Figure 3-10] Same as above [Figure 4-1] 1 is a table showing the results of siRNA inhibition of PNPLA3 in an AAV-based mouse model containing a portion of the 3' untranslated region (UTR) of human PNPLA3. [Figure 4-2] Same as above [Figure 4-3] Same as above [Figure 5-1] 1 is a table showing the results of siRNA inhibition of PNPLA3 in a homozygous hPNPLA3I148M knock-in (hPNPLA3I148MKI) mouse model. [Figure 5-2] Same as above DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] Nucleotide sequences in Figures 1-5 and elsewhere in this application are listed according to the following notation: A, U, G, and C = the corresponding ribonucleotides; dT = deoxythymidine; dA = deoxyadenosine; dC = deoxycytidine; dG = deoxyguanosine; invAb = inverted A base; invDT = inverted deoxythymidine; invDA = inverted deoxyadenosine; invDC = inverted deoxycytidine; invDG = inverted deoxyguanosine; a, u, g, and c = the corresponding 2'-O-methyl ribonucleotides; Af, Uf, Gf, and Cf = the corresponding 2'-deoxy-2'-fluoro ("2'-fluoro") ribonucleotides; Ab = abasic; MeO-I = 2' methoxyinosine; GNA = glycol nucleic acid; sGNA = glycol nucleic acid with a 3' phosphorothioate; LNA = locked nucleic acid. The insertion of an "s" in a sequence indicates that two adjacent nucleotides are linked by a phosphorothiodiester group (e.g., a phosphorothioate internucleotide linkage). Unless otherwise indicated, all other nucleotides are linked by 3'-5' phosphodiester groups.

[0016] The present disclosure is based in part on the design and creation of RNAi constructs that target the PNPLA3 gene in a non-sequence-specific manner and reduce the expression of PNPLA3 in liver cells.Non-sequence-specific inhibition of PNPLA3 expression is useful for treating or preventing conditions associated with PNPLA3 expression, including liver-related diseases such as simple fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis (irreversible advanced scarring of the liver) or PNPLA3-related obesity.

[0017] The present disclosure provides compositions and methods for regulating the expression of the patatin-like phospholipase domain-containing 3 (PNPLA3) gene. In some embodiments, the gene can be present in a subject, such as a cell or a mammal (e.g., a human). In some embodiments, the compositions of the present disclosure include an RNAi construct that targets the mRNA of PNPLA3 and reduces PNPLA3 expression in a cell or a mammal. Such RNAi constructs are useful for treating or preventing various forms of liver-related diseases, such as, for example, simple fatty liver (steatosis), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), cirrhosis (irreversible advanced scarring of the liver), or PNPLA3-associated obesity.

[0018] In 2008, a genome-wide association study (GWAS) searching for nonsynonymous sequence variations, or single nucleotide polymorphisms (SNPs), associated with NAFLD revealed that a variant in PNPLA3 (rs738409 [G] encoding I148M; which may be referred to as PNPLA3-rs738409, PNPLA3-ma or PNPLA3-minor allele) was significantly associated with hepatic fat content. Since this initial report, subsequent GWAS have confirmed that PNPLA3 rs738409 is a major genetic determinant of NAFLD that is significantly associated with 1) elevated levels of alanine transaminase (ALT), a serum biomarker of liver injury, 2) incidence, progression and severity of NAFLD, 3) both obese and lean individuals, and 4) all stages of NAFLD: steatosis, NASH, cirrhosis and hepatocellular carcinoma. The consensus of multiple GWAS shows that the association between PNPLA3 rs738409 and NAFLD is independent of age, sex, ethnicity, metabolic syndrome, body mass index, insulin resistance, and serum lipids. Furthermore, statistical analysis from multiple sources estimates that approximately 50% of NAFLD patients carry the PNPLA3 rs738409 mutation. Patients can be homozygous or heterozygous for the PNPLA3 rs738409 mutation. In addition, it has been found that patients with the PNPLA3 rs738409 mutation often also carry the rs738408 mutation, which is three base pairs away (Tian et al (2010) Nature Genetics 42:21-23). Thus, the patient may have a PNPLA3-rs738409 minor allele, a PNPLA3-rs738408 minor allele or a PNPLA3-rs738409-rs738408 double minor allele mutation (PNPLA3-dma).

[0019] We developed a mouse model to explore PNPLA3 function in vivo. To date, no detectable metabolic phenotypes have been identified as a result of PNPLA3 deficiency or PNPLA3 overexpression. In contrast, expression of PNPLA3I148M in both transgenic and knock-in mice resulted in elevated hepatic triglyceride levels similar to NAFLD. Thus, combining the data from the in vivo mouse model indicates that expression of mutant PNPLA3I148M protein, but not overexpression of wild-type protein, is a driver of the disease phenotype. These findings, in addition to the high frequency of the minor allele in individuals affected with NAFLD and its potent association with the disease, highlight PNPLA3 rs738409 as a major therapeutic target for NAFLD.

[0020] RNA interference (RNAi) is a process that introduces foreign RNA into cells to cause specific degradation of the mRNA that codes for a targeted protein, thereby reducing the expression of the protein. Advances in both RNAi technology and delivery to the liver, as well as the increasing favorable outcomes of other RNAi-based therapies, suggest that RNAi is a compelling means to therapeutically treat NAFLD by directly targeting PNPLA3.

[0021] As used herein, the term "RNAi construct" refers to an agent that comprises an RNA molecule that can downregulate the expression of a target gene (e.g., PNPLA3) via an RNA interference mechanism when introduced into a cell. "RNA interference" is a process in which a nucleic acid molecule induces the cleavage and degradation of a target RNA molecule (e.g., a messenger RNA, i.e., an mRNA molecule) in a sequence-specific manner, for example, via the RNA-induced silencing complex (RISC) pathway. In some embodiments, an RNAi construct comprises a double-stranded RNA (dsRNA) molecule that comprises two antiparallel strands of consecutive nucleotides that are sufficiently complementary to each other to hybridize and form a duplex region. A double-stranded RNAi construct is sometimes referred to as an RNAi "trigger." The term "hybridize" or "hybridization" refers to the pairing of complementary polynucleotides, typically via hydrogen bonds (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonds) between complementary bases in two polynucleotides. The strand that contains a region having a sequence that is substantially complementary to a target sequence (e.g., a target mRNA) is referred to as the "antisense strand." "Sense strand" refers to the strand that contains a region that is substantially complementary to a region of the antisense strand. In some embodiments, the sense strand may contain a region that has substantially the same sequence as the target sequence.

[0022] In certain embodiments, the sense and antisense strands of a double-stranded RNA may be two separate molecules that hybridize to form a duplex region but are otherwise separate. Such double-stranded RNA molecules formed from two separate strands are referred to as "small interfering RNA" or "short interfering RNA" (siRNA). siRNAs are typically about 20-27 base pairs and are a class of non-coding double-stranded RNA molecules that are central to RNAi. Thus, in some embodiments, the RNAi constructs of the present disclosure include siRNA. In other embodiments, the RNAi constructs may be microRNAs (also known as "miRNAs" or "mature miRNAs"). miRNAs are small (approximately 18-24 nucleotides long) non-coding RNA molecules present in plants, animals, and some viruses. miRNAs are similar to siRNAs, but miRNAs are derived from hairpin mRNA structures. miRNAs regulate gene expression by base pairing to complementary regions of target mRNAs.

[0023] In some embodiments, the present disclosure provides an RNAi construct directed to PNPLA3. In some embodiments, the RNAi construct is an siRNA comprising a sense strand and an antisense strand, and the antisense strand comprises a region complementary to the mRNA sequence of PNPLA3. The region of the RNAi antisense strand can be complementary to any suitable region of the mRNA sequence of PNPLA3. For example, the antisense strand can comprise a region complementary to the coding region or 3' untranslated region (UTR) of the mRNA sequence of PNPLA3. Exemplary PNPLA3 target sequences within the coding region (reference sequence GenBank Accession No. NM_025225.2) and 3' UTR are listed in Table 1. The antisense strand of the RNAi construct desirably hybridizes to the mRNA sequence of PNPLA3 listed in Table 1.

[0024] [Table 1-1]

[0025] [Table 1-2]

[0026] [Table 1-3]

[0027] The disclosed RNAi constructs need not hybridize to a specific PNPLA3 SNP. In such an embodiment, the RNAi construct may bind to the 3'UTR of PNPLA3. As discussed above, non-sequence-specific PNPLA3 RNAi may have broader therapeutic applications for diseases associated with PNPLA3 expression, including, for example, simple fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis (irreversible advanced scarring of the liver), or PNPLA3-associated obesity. In some embodiments, the RNAi construct is an siRNA molecule containing any of the sequences described in FIG. 1 or 2 (e.g., an antisense strand comprising a sequence selected from SEQ ID NOs: 565-1068 and SEQ ID NOs: 2329-3588, and / or a sense strand comprising a sequence selected from SEQ ID NOs: 61-564 and SEQ ID NOs: 1069-2328).

[0028] Double-stranded RNAi molecules may include chemical modifications to ribonucleotides, including modifications to the ribose sugar, base, or backbone components of ribonucleotides, such as those described herein or known in the art. Any such modifications as used in double-stranded RNA molecules (e.g., siRNA, shRNA, etc.) are encompassed by the term "double-stranded RNA" for the purposes of this disclosure.

[0029] As used herein, a first sequence is "complementary" to a second sequence if, under certain conditions, such as physiological conditions, the polynucleotide comprising the first sequence can hybridize to the polynucleotide comprising the second sequence to form a duplex region. Other such conditions may include moderate or stringent hybridization conditions known to those skilled in the art. A first sequence is considered to be fully complementary (100% complementary) to a second sequence if the polynucleotide comprising the first sequence base pairs with the polynucleotide comprising the second sequence over the entire length of one or both nucleotide sequences without mismatches. A sequence is "substantially complementary" to a target sequence if it is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to the target sequence. Percent complementarity can be calculated by dividing the number of bases in a first sequence that are complementary to the bases at corresponding positions in a second sequence or target sequence by the total length of the first sequence. Also, if there are no more than 5, 4, 3, 2, or 1 mismatches throughout the entire 30 base pair duplex region when the two sequences hybridize, one sequence may be said to be substantially complementary to the other sequence. In general, if any nucleotide overhangs as defined herein exist, the sequence of such overhangs is not considered in determining the degree of complementarity between two sequences. As an example, a 21 nucleotide long sense strand and a 21 nucleotide long antisense strand that hybridize to form a 19 base pair duplex region with a 2 nucleotide overhang at the 3' end of each strand would be considered to be fully complementary as this term is used herein.

[0030] In some embodiments, the region of the antisense strand comprises a sequence that is completely complementary to a region of the target RNA sequence (e.g., PNPLA3 mRNA). In such embodiments, the sense strand may comprise a sequence that is completely complementary to the sequence of the antisense strand. In other such embodiments, the sense strand may comprise a sequence that is substantially complementary to the sequence of the antisense strand, such as a sequence that has 1, 2, 3, 4, or 5 mismatches in the duplex region formed by the sense strand and the antisense strand. In certain embodiments, it is preferred that any mismatches occur in the terminal region (e.g., within 6, 5, 4, 3, 2, or 1 nucleotide of the 5' and / or 3' end of the strand). In one embodiment, any mismatches in the duplex region formed by the sense strand and the antisense strand desirably occur within 6, 5, 4, 3, 2, or 1 nucleotide of the 5' end of the antisense strand.

[0031] When the two substantially complementary strands of dsRNA are composed of separate RNA molecules, the molecules do not have to be covalently linked, but can be. When the two strands are covalently linked by means other than an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5'-end of the other strand that form a duplex structure, the linking structure is called a "linker". The RNA strands may have the same or different number of nucleotides. The maximum number of base pairs in a duplex is the number of nucleotides of the shortest strand of dsRNA minus any overhangs present in the duplex. In addition to the duplex structure, RNAi may include one or more nucleotide overhangs.

[0032] In other embodiments, the sense and antisense strands that hybridize to form a duplex region may be part of a single RNA molecule, i.e., the sense and antisense strands are part of the self-complementary region of the single RNA molecule. In such cases, the single RNA molecule comprises a duplex region (also referred to as stem region) and a loop region. The 3' end of the sense strand is linked to the 5' end of the antisense strand by a flanking sequence of unpaired nucleotides to form the loop region. The loop region is typically long enough to allow the RNA molecule to refold on itself so that the antisense strand can base pair with the sense strand to form the duplex or stem region. The loop region may contain about 3 to about 25, about 5 to about 15, or about 8 to about 12 unpaired nucleotides. As described herein, such RNA molecules having at least a partially self-complementary region are referred to as "small hairpin RNAs" (shRNAs). In some embodiments, the loop region may contain at least 1, 2, 3, 4, 5, 10, 20, or 25 unpaired nucleotides. In other embodiments, the loop region may contain no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 unpaired nucleotides. In certain embodiments, the RNAi construct of the present disclosure comprises an shRNA. The length of the single at least partially self-complementary RNA molecule may be about 35 nucleotides to about 100 nucleotides, about 45 nucleotides to about 85 nucleotides, or about 50 to about 60 nucleotides, and may include a duplex region and a loop region, each having a length as recited herein.

[0033] In some embodiments, the RNAi construct of the present disclosure comprises a sense strand and an antisense strand, and the antisense strand comprises a region having a sequence substantially or completely complementary to a messenger RNA (mRNA) sequence of PNPLA3. As used herein, "mRNA sequence of PNPLA3" refers to any messenger RNA sequence, including splice variants, that encodes the PNPLA3 protein, including variants or isoforms of the PNPLA3 protein from any species (e.g., mouse, rat, non-human primate, human). The PNPLA3 protein is also known as adiponutrin (ADPN) and calcium-independent phospholipase A2-epsilon (iPLA(2)ε).

[0034] PNPLA3 mRNA sequence also includes transcript sequences expressed as its complementary DNA (cDNA) sequence. cDNA sequence refers to the sequence of the mRNA transcript expressed as DNA bases (e.g., guanine, adenine, thymine and cytosine) rather than RNA bases (e.g., guanine, adenine, uracil and cytosine). Thus, the antisense strand of the RNAi construct of the present disclosure can include a region having a substantially or completely complementary sequence to the target PNPLA3 mRNA sequence or PNPLA3 cDNA sequence. PNPLA3 mRNA or cDNA sequence can include, but is not limited to, any PNPLA3 mRNA or cDNA sequence, such as may be derived from NCBI reference sequence NM_025225.2.

[0035] The region of the antisense strand may be substantially or completely complementary to at least 15 consecutive nucleotides of the PNPLA3 mRNA sequence. In some embodiments, the target region of the PNPLA3 mRNA sequence to which the antisense strand comprises a region of complementarity may range from about 15 to about 30 consecutive nucleotides, about 16 to about 28 consecutive nucleotides, about 18 to about 26 consecutive nucleotides, about 17 to about 24 consecutive nucleotides, about 19 to about 25 consecutive nucleotides, about 19 to about 23 consecutive nucleotides, or about 19 to about 21 consecutive nucleotides. In certain embodiments, the region of the antisense strand comprising a sequence substantially or completely complementary to the PNPLA3 mRNA sequence comprises at least 15 consecutive nucleotides from an antisense sequence selected from SEQ ID NOs: 565 to 1068 and SEQ ID NOs: 2329 to 3588 in some embodiments (see FIG. 1 or 2). In other embodiments, the antisense sequence comprises at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides from an antisense sequence selected from SEQ ID NOs: 565-1068 and SEQ ID NOs: 2329-3588. In some embodiments, the sense and / or antisense sequence comprises at least 15 nucleotides with no more than 1, 2, or 3 nucleotide mismatches from a sequence listed in Figures 1 or 2.

[0036] The sense strand of an RNAi construct typically contains a sequence sufficiently complementary to that of the antisense strand such that the two strands hybridize under physiological conditions to form a duplex region. A "duplex region" refers to a region within two complementary or substantially complementary polynucleotides that base-pair with each other, either by Watson-Crick base pairing or other hydrogen bonding interactions, to create a duplex between the two polynucleotides. The duplex region of an RNAi construct should be of sufficient length to allow the RNAi construct to enter the RNA interference pathway, e.g., by binding of the Dicer enzyme and / or the RISC complex (discussed below). For example, in some embodiments, the duplex region is about 15 to about 30 base pairs in length. Other lengths of the double-stranded region within this range are also suitable, for example, about 15 to about 28 base pairs, about 15 to about 26 base pairs, about 15 to about 24 base pairs, about 15 to about 22 base pairs, about 17 to about 28 base pairs, about 17 to about 26 base pairs, about 17 to about 24 base pairs, about 17 to about 23 base pairs, about 17 to about 21 base pairs, about 19 to about 25 base pairs, about 19 to about 23 base pairs, about 20 to about 25 base pairs, or about 19 to about 21 base pairs. In one embodiment, the double-stranded region is about 17 to about 24 base pairs in length. In another embodiment, the double-stranded region is about 19 to about 21 base pairs in length.

[0037] In some embodiments, the siRNA constructs of the present disclosure contain a duplex region of about 18 to about 30 nucleotides that interacts with a target RNA sequence, e.g., a target mRNA sequence of PNPLA3, to induce cleavage of the target RNA. For example, the siRNA can contain a duplex region of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides that interact with a target mRNA sequence of PNPLA3. Without being bound by theory, long double-stranded RNA introduced into a cell can be degraded into siRNAs by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease III-like enzyme, processes dsRNA into short interfering RNAs of 19 to 23 base pairs with characteristic 2-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNA is then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to induce target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188).

[0038] For embodiments in which the sense and antisense strands are two separate molecules (e.g., siRNA RNAi constructs), the sense and antisense strands need not be the same length as the length of the duplex region. For example, one or both strands may be longer than the duplex region and may have one or more unpaired nucleotides or mismatches adjacent to the duplex region. Thus, in some embodiments, the RNAi construct comprises at least one nucleotide overhang. As used herein, a "nucleotide overhang" refers to an unpaired nucleotide at the end of a strand or a nucleotide that extends beyond the duplex region. A nucleotide overhang is typically generated when the 3' end of one strand extends beyond the 5' end of the other strand or the 5' end of one strand extends beyond the 3' end of the other strand. The length of a nucleotide overhang is generally 1-6 nucleotides, 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, 2-6 nucleotides, 2-5 nucleotides, or 2-4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5, or 6 nucleotides. In one particular embodiment, the nucleotide overhang comprises 1-4 nucleotides. In certain embodiments, the nucleotide overhang comprises 2 nucleotides. The nucleotides in the overhang can be ribonucleotides, deoxyribonucleotides, or modified nucleotides as described herein. In some embodiments, the overhang comprises a 5'-uridine uridine-3' (5'-UU-3') dinucleotide. In such embodiments, the UU dinucleotide may comprise a ribonucleotide or a modified nucleotide, such as a 2'-modified nucleotide. In other embodiments, the overhang comprises a 5'-deoxythymidine-deoxythymidine-3' (5'-dTdT-3') dinucleotide.

[0039] The nucleotide overhangs may be present at the 5'-end or 3'-end of one or both strands. For example, in one embodiment, the RNAi construct comprises a nucleotide overhang at the 5'-end and 3'-end of the antisense strand. In another embodiment, the RNAi construct comprises a nucleotide overhang at the 5'-end and 3'-end of the sense strand. In some embodiments, the RNAi construct comprises a nucleotide overhang at the 5'-end of the sense strand and the 5'-end of the antisense strand. In other embodiments, the RNAi construct comprises a nucleotide overhang at the 3'-end of the sense strand and the 3'-end of the antisense strand.

[0040] The RNAi construct may comprise a single nucleotide overhang at one end of the double-stranded RNA molecule and a blunt end at the other end. "Blunt end" means that the sense and antisense strands are fully base-paired at the ends of the molecule, with no unpaired nucleotides extending beyond the duplex region. In some embodiments, the RNAi construct comprises a nucleotide overhang at the 3' end of the sense strand and a blunt end at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the RNAi construct comprises a nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand and the 3' end of the sense strand. In certain embodiments, the RNAi construct comprises blunt ends at both ends of the double-stranded RNA molecule. In such embodiments, the sense and antisense strands have the same length, and the duplex region is the same length as the sense and antisense strands (i.e., the molecule is double-stranded over its entire length).

[0041] The sense strand and the antisense strand can each independently be of any suitable length, for example, about 15 to about 30 nucleotides, about 18 to about 28 nucleotides, about 19 to about 27 nucleotides, about 19 to about 25 nucleotides, about 19 to about 23 nucleotides, about 20 to about 25 nucleotides, or about 21 to about 23 nucleotides. In certain embodiments, the sense strand and the antisense strand are each about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides long. In some embodiments, the sense strand and the antisense strand form a duplex region that is the same length but shorter than the strands, such that the RNAi construct has a two nucleotide overhang. For example, in one embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand each 21 nucleotides long, (ii) a duplex region that is 19 base pairs long, and (iii) a nucleotide overhang of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In another embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand each 23 nucleotides long, (ii) a duplex region that is 21 base pairs long, and (iii) a nucleotide overhang of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the sense strand and the antisense strand have the same length and form a duplex region over their entire length such that there are no nucleotide overhangs at either end of the double-stranded molecule. In such an embodiment, the RNAi construct is blunt-ended and comprises (i) a sense strand and an antisense strand each 21 nucleotides long, and (ii) a duplex region that is 21 base pairs long. In another embodiment, the RNAi construct is blunt ended and comprises (i) sense and antisense strands, each of which is 23 nucleotides in length, and (ii) a duplex region that is 23 base pairs in length.

[0042] In other embodiments, the sense strand or antisense strand is longer than the other strand, and the two strands form a duplex region with a length equal to the length of the shorter strand, such that the RNAi construct comprises at least one nucleotide overhang.For example, in one embodiment, the RNAi construct comprises (i) a sense strand that is 19 nucleotides long, (ii) an antisense strand that is 21 nucleotides long, (iii) a duplex region that is 19 base pairs long, and (iv) a single nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand.In another embodiment, the RNAi construct comprises (i) a sense strand that is 21 nucleotides long, (ii) an antisense strand that is 23 nucleotides long, (iii) a duplex region that is 21 base pairs long, and (iv) a single nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand.

[0043] The antisense strand of the RNAi construct of the present disclosure may comprise any one of the sequences of the antisense sequences listed in FIG. 1 or FIG. 2 (e.g., any one of SEQ ID NOs: 565-816 or 2329-2958), or the sequence of nucleotides 1-21 of any of these antisense sequences. Each of the antisense sequences of SEQ ID NOs: 565-816 and 2329-2958 comprises a sequence of 20 or 21 consecutive nucleotides (the first 20 or 21 nucleotides counting from the 5' end) that is complementary to the mRNA sequence of PNPLA3, plus an optional 2 nucleotide overhang sequence. Thus, in some embodiments, the antisense strand comprises the sequence of nucleotides 1-20 or 1-21 of any one of SEQ ID NOs: 565-816 or 2329-2958.

[0044] Modified Nucleotides The RNAi construct of the present disclosure may include one or more modified nucleotides. "Modified nucleotide" refers to a nucleotide that has one or more chemical modifications to a nucleoside, nucleobase, pentose ring, or phosphate group. As used herein, modified nucleotide does not include ribonucleotides that contain adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate, and deoxyribonucleotides that contain deoxyadenosine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate, and deoxycytidine monophosphate. However, the RNAi construct may include a combination of modified nucleotides, ribonucleotides, and deoxyribonucleotides. The incorporation of modified nucleotides into one or both strands of a double-stranded RNA molecule can improve the in vivo stability of the RNA molecule, for example, by reducing the susceptibility of the molecule to nucleases and other degradative processes. The incorporation of modified nucleotides can also enhance the efficacy of the RNAi construct to reduce the expression of a target gene.

[0045] In certain embodiments, modified nucleotides have modifications of the ribose sugar. These sugar modifications can include modifications at the 2' and / or 5' positions of the pentose ring as well as bicyclic sugar modifications. A 2'-modified nucleotide refers to a nucleotide having a pentose ring with a substituent at the 2' position other than H or OH. Such 2' modifications include 2'-O-alkyl (e.g., O-C1-C10 or O-C1-C10 substituted alkyl), 2'-O-allyl (O-CH2CH=CH2), 2'-C-allyl, 2'-fluoro, 2'-O-methyl (OCH3), 2'-O-methoxyethyl (O-(CH2)2OCH3), 2'-OCF3, 2'-O(CH2)2SCH3, 2'-O-aminoalkyl, 2'-amino (e.g., NH 2 Modifications at the 5' position of the pentose ring include, but are not limited to, 5'-methyl (R or S), 5'-vinyl and 5'-methoxy.

[0046] "Bicyclic sugar modification" refers to a modification of a pentose ring in which two atoms of the ring are linked by a bridge to form a second ring, resulting in a bicyclic sugar structure. In some embodiments, a bicyclic sugar modification comprises a bridge between the 4' and 2' carbons of the pentose ring. Nucleotides containing a sugar moiety having a bicyclic sugar modification are referred to herein as bicyclic nucleic acids or BNAs. Exemplary bicyclic sugar modifications include α-L-methyleneoxy (4'-CH 2 -O-2') bicyclic nucleic acid (BNA); β-D-methyleneoxy (4'-CH 2 -O-2')BNA (also called locked nucleic acid or LNA); ethyleneoxy(4'-(CH 2 )2-O-2')BNA;aminooxy(4'-CH 2 -ON(R)-2')BNA;oxyamino(4'-CH 2 -N(R)-O-2')BNA; methyl(methyleneoxy)(4'-CH(CH 3 )-O-2')BNA (also called constrained ethyl or cEt); methylene-thio(4'-CH 2 -S-2')BNA; methylene-amino (4'-CH 2 -N(R)-2')BNA;Methyl carbocyclic (4'-CH 2 -CH(CH3)-2')BNA; Propylene Carbocyclic (4'-(CH 2 )3-2')BNA; and methoxy(ethyleneoxy)(4'-CH(CH 2 These and other sugar-modified nucleotides that can be incorporated into the RNAi constructs of the present disclosure include, but are not limited to, (OMe)-O-2') BNAs (also referred to as constrained MOEs or cMOEs). These and other sugar-modified nucleotides that can be incorporated into the RNAi constructs of the present disclosure are described, for example, in U.S. Pat. No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, 19:937-954 (2012).

[0047] In some embodiments, the RNAi construct comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNAs), or combinations thereof. In certain embodiments, the RNAi construct comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, or combinations thereof. In a particular embodiment, the RNAi construct comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or combinations thereof.

[0048] Both the sense strand and the antisense strand of the RNAi construct may contain one or more modified nucleotides. For example, in some embodiments, the sense strand contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In certain embodiments, all nucleotides in the sense strand are modified nucleotides. In some embodiments, the antisense strand contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In other embodiments, all nucleotides in the antisense strand are modified nucleotides. In certain other embodiments, all nucleotides in the sense strand and all nucleotides in the antisense strand are modified nucleotides. In these and other embodiments, the modified nucleotides may be 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or a combination thereof.

[0049] In some embodiments, all pyrimidine nucleotides preceding an adenosine nucleotide in the sense strand and / or antisense strand are modified nucleotides. For example, when the sequence 5'-CA-3' or 5'-UA-3' occurs in either strand, the cytidine and uridine nucleotides are modified nucleotides, preferably 2'-O-methyl modified nucleotides. In certain embodiments, all pyrimidine nucleotides in the sense strand are modified nucleotides (e.g., 2'-O-methyl modified nucleotides), and the 5' nucleotides of all sequences 5'-CA-3' or 5'-UA-3' present in the antisense strand are modified nucleotides (e.g., 2'-O-methyl modified nucleotides). In other embodiments, all nucleotides in the duplex region are modified nucleotides. In such embodiments, the modified nucleotides are preferably 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, or combinations thereof.

[0050] In embodiments in which the RNAi construct comprises a nucleotide overhang, the nucleotides in the overhang can be ribonucleotides, deoxyribonucleotides, or modified nucleotides. In one embodiment, the nucleotides in the overhang are deoxyribonucleotides, such as deoxythymidine. In another embodiment, the nucleotides in the overhang are modified nucleotides. For example, in some embodiments, the nucleotides in the overhang are 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, or combinations thereof.

[0051] The RNAi constructs of the present disclosure may also include one or more modified internucleotide linkages. As used herein, the term "modified internucleotide linkage" refers to a linkage between nucleotides other than the natural 3'-5' phosphodiester linkage. In some embodiments, the modified internucleotide linkage is a phosphorus-containing internucleotide linkage, such as a phosphotriester, an aminoalkyl phosphotriester, an alkyl phosphonate (e.g., methyl phosphonate, 3'-alkylene phosphonate), a phosphinate, a phosphoramidate (e.g., 3'-amino phosphoramidate and aminoalkyl phosphoramidate), a phosphorothioate (P=S), a chiral phosphorothioate, a phosphorodithioate, a thionophosphoramidate, a thionoalkyl phosphonate, a thionoalkyl phosphotriester and a boranophosphate. In one embodiment, the modified internucleotide linkage is a 2'-5' phosphodiester linkage. In other embodiments, the modified internucleotide linkage is a non-phosphorus-containing internucleotide linkage, and therefore may be referred to as a modified internucleoside linkage. Such non-phosphorus-containing bonds include morpholino bonds (formed in part from the sugar portion of nucleosides); siloxane bonds (-O-Si(H) 2 -O-; sulfide, sulfoxide, and sulfone bonds; formacetyl and thioformacetyl bonds; alkene-containing backbones; sulfamate backbones; methylenemethylimino (-CH 2 -N(CH 3 )-O-CH 2 -) and methylenehydrazino bonds; sulfonate and sulfonamide bonds; amide bonds; and N, O, S, and CH 2The modified internucleoside linkage may include, but is not limited to, other combinations of component parts. In one embodiment, the modified internucleoside linkage is a peptide-based linkage (e.g., aminoethylglycine) for creating peptide nucleic acid or PNA, such as those described in U.S. Patent No. 5,539,082, U.S. Patent No. 5,714,331, and U.S. Patent No. 5,719,262. Other suitable modified internucleotide and internucleoside linkages that can be used in the disclosed RNAi constructs are described in U.S. Patent Nos. 6,693,187 and 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, supra.

[0052] In certain embodiments, the RNAi construct comprises one or more phosphorothioate internucleotide linkages. The phosphorothioate internucleotide linkages may be present in the sense strand, the antisense strand, or both strands of the RNAi construct. For example, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In other embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In yet other embodiments, both strands comprise 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. The RNAi construct may comprise one or more phosphorothioate internucleotide linkages at the 3' end, the 5' end, or both the 3' end and the 5' end of the sense strand, the antisense strand, or both strands. For example, in certain embodiments, the RNAi construct comprises about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 3'-end of the sense strand, the antisense strand, or both strands. In other embodiments, the RNAi construct comprises about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 5'-end of the sense strand, the antisense strand, or both strands. In one embodiment, the RNAi construct comprises a single phosphorothioate internucleotide linkage at the 3'-end of the sense strand and a single phosphorothioate internucleotide linkage at the 3'-end of the antisense strand. In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at the 3'-end of the antisense strand (i.e., phosphorothioate internucleotide linkages at the first and second internucleotide linkages at the 3'-end of the antisense strand). In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at both the 3'-end and the 5'-end of the antisense strand. In yet another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at both the 3'-end and the 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide linkages at the 5'-end of the sense strand.In yet another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at both the 3'-end and 5'-end of the antisense strand, and two consecutive phosphorothioate internucleotide linkages at both the 3'-end and 5'-end of the sense strand (i.e., phosphorothioate internucleotide linkages at the first and second internucleotide linkages at both the 5'-end and 3'-end of the antisense strand, and phosphorothioate internucleotide linkages at the first and second internucleotide linkages at both the 5'-end and 3'-end of the sense strand). In any of the embodiments in which one or both strands comprise one or more phosphorothioate internucleotide linkages, the remaining internucleotide linkages in the strands may be natural 3'-5' phosphodiester linkages. For example, in some embodiments, each internucleotide linkage of the sense strand and the antisense strand is selected from phosphodiester and phosphorothioate, and at least one internucleotide linkage is phosphorothioate.

[0053] In embodiments where the RNAi construct comprises a nucleotide overhang, two or more of the unpaired nucleotides in the overhang can be linked by phosphorothioate internucleotide bonds.In certain embodiments, all of the unpaired nucleotides in the 3'-end nucleotide overhang of the antisense strand and / or the sense strand are linked by phosphorothioate internucleotide bonds.In other embodiments, all of the unpaired nucleotides in the 5'-end nucleotide overhang of the antisense strand and / or the sense strand are linked by phosphorothioate internucleotide bonds.In still other embodiments, all of the unpaired nucleotides in any nucleotide overhang are linked by phosphorothioate internucleotide bonds.

[0054] In certain embodiments, modified nucleotides incorporated into one or both strands of an RNAi construct of the present disclosure have a nucleobase (also referred to herein as a "base") modification. A "modified nucleobase" or "modified base" refers to a base other than the naturally occurring purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases may be synthetic or naturally occurring modifications and include the universal bases, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine (X), hypoxanthine (I), 2-aminoadenine, 6-methyladenine, 6-methylguanine and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6 ... These may include, but are not limited to, azo-uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thio, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.

[0055] In some embodiments, the modified base is a universal base. "Universal base" refers to a base analogue that indiscriminately base pairs with all natural bases in RNA and DNA without changing the double helix structure of the resulting double-stranded region. Universal bases are known to those skilled in the art and include, but are not limited to, inosine, C-phenyl, C-naphthyl, and other aromatic derivatives, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole.

[0056] Other suitable modified bases that can be incorporated into the disclosed RNAi constructs include, for example, those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 10:297-310, 2000 and Peacock et al., J.Org.Chern., 76:7295-7300 (2011). Those skilled in the art are well aware that guanine, cytosine, adenine, thymine and uracil can be replaced by other nucleobases, such as the above-mentioned modified nucleobases, without substantially changing the base pairing properties of the polynucleotide that contains the nucleotide with such substituted nucleobase.

[0057] In some embodiments, the 5' end of the sense strand, the antisense strand, or both the antisense strand and the sense strand of the disclosed RNAi construct comprises a phosphate moiety. As used herein, the term "phosphate moiety" refers to a terminal phosphate group, including unmodified phosphate (-OP=O)(OH)OH) and modified phosphate. Modified phosphate includes phosphates in which one or more of the O and OH groups are replaced with H, O, S, N(R) or alkyl, where R is H, an amino protecting group, or unsubstituted or substituted alkyl. Exemplary phosphate moieties include, but are not limited to, 5'-monophosphate; 5'-diphosphate; 5'-triphosphate; 5'-guanosine cap (7-methylated or unmethylated); 5'-adenosine cap or any other modified or unmodified nucleotide cap structure; 5'-monothiophosphate (phosphorothioate); 5'-monodithiophosphate (phosphorodithioate); 5'-α-thiotriphosphate; 5'-γ-thiotriphosphate; 5'-phosphoramidate; 5'-vinyl phosphate; 5'-alkylphosphonates (where "alkyl" can be methyl, ethyl, isopropyl, propyl, etc.); and 5'-alkyl ether phosphonates (where "alkyl ether" can be methoxymethyl, ethoxymethyl, etc.).

[0058] Modified nucleotides that can be incorporated into the RNAi constructs of the present disclosure can have two or more chemical modifications described herein. For example, modified nucleotides can have a modification to the ribose sugar and a modification to the nucleobase. By way of example, modified nucleotides can include a 2' sugar modification (e.g., 2'-fluoro or 2'-methyl) and can include a modified base (e.g., 5-methylcytosine or pseudouracil). In other embodiments, modified nucleotides can include a sugar modification combined with a modification to the 5' phosphate, which will generate a modified internucleotide or internucleoside linkage when the modified nucleotide is incorporated into a polynucleotide. For example, in some embodiments, modified nucleotides can include a sugar modification, such as a 2'-fluoro modification, a 2'-O-methyl modification, or a bicyclic sugar modification, and a 5' phosphorothioate group. Thus, in some embodiments, one or both strands of the RNAi constructs of the present disclosure include a combination of 2' modified nucleotides or BNAs and phosphorothioate internucleotide linkages. In certain embodiments, both the sense and antisense strands of the RNAi constructs of the present disclosure comprise a combination of 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, and phosphorothioate internucleotide linkages. Exemplary siRNA constructs comprising modified nucleotides and internucleotide linkages are shown in Figures 1 and 2.

[0059] The antisense strand of an RNAi construct of the present disclosure can comprise the sequence of any one of the modified antisense sequences listed in Figure 1 or Figure 2 (e.g., any one of SEQ ID NOs: 817-1068 or 2959-3588), or the sequence of nucleotides 1-21 of any of these antisense sequences. In some embodiments, the antisense strand comprises the sequence of nucleotides 1-20 or 1-21 of any one of SEQ ID NOs: 817-1068 or 2959-3588.

[0060] Function of RNAi constructs The disclosed RNAi constructs desirably reduce or inhibit the expression of PNPLA3 in cells, particularly liver cells. Thus, in one embodiment, the present disclosure provides a method for reducing PNPLA3 expression in cells by contacting the cells with any RNAi construct described herein. The cells can be in vitro or in vivo. PNPLA3 expression can be assessed by measuring the amount or level of PNPLA3 mRNA, PNPLA3 protein, or another biomarker associated with PNPLA3 expression. The reduction of PNPLA3 expression in cells or animals treated with the disclosed RNAi constructs can be determined compared to PNPLA3 expression in cells or animals not treated with the RNAi construct or treated with a control RNAi construct. For example, in some embodiments, the reduction of PNPLA3 expression is assessed by (a) measuring the amount or level of PNPLA3 mRNA in liver cells treated with an RNAi construct of the present disclosure, (b) measuring the amount or level of PNPLA3 mRNA in liver cells treated with a control RNAi construct (e.g., an RNAi construct directed to an RNA molecule not expressed in liver cells or an RNAi construct with a nonsense or scrambled sequence) or no construct, and (c) comparing the PNPLA3 mRNA level measured from the treated cells in (a) with the PNPLA3 mRNA level measured from the control cells in (b). Prior to comparison, the PNPLA3 mRNA levels in the treated and control cells can be normalized to RNA levels for a control gene (e.g., 18S ribosomal RNA). PNPLA3 mRNA levels can be measured by a variety of methods, including Northern blot analysis, nuclease protection assays, fluorescent in situ hybridization (FISH), reverse transcriptase (RT)-PCR, real-time RT-PCR, quantitative PCR, and the like.

[0061] In other embodiments, the reduction of PNPLA3 expression is evaluated by (a) measuring the amount or level of PNPLA3 protein in liver cells treated with the RNAi construct described herein, (b) measuring the amount or level of PNPLA3 protein in liver cells treated with a control RNAi construct (e.g., an RNAi construct directed to an RNA molecule not expressed in liver cells or an RNAi construct with a nonsense sequence or a scrambled sequence) or no construct, and (c) comparing the protein level of PNPLA3 measured from cells treated in (a) with the protein level of PNPLA3 measured from control cells in (b). PNPLA3 protein level can be measured using any suitable method known to those skilled in the art, including but not limited to Western blot, immunoassay (e.g., ELISA) and flow cytometry. Any suitable method of measuring PNPLA3 mRNA or protein can be used to evaluate the effectiveness of the RNAi construct described herein.

[0062] In some embodiments, the method for evaluating the expression level of PNPLA3 is carried out in vitro in cells that naturally express PNPLA3 (e.g., liver cells) or cells engineered to express PNPLA3. In certain embodiments, the method is carried out in vitro in liver cells. Suitable liver cells include, but are not limited to, primary liver cells (e.g., human, non-human primate, or rodent liver cells), HepAD38 cells, HuH-6 cells, HuH-7 cells, HuH-5-2 cells, BNLCL2 cells, Hep3B cells, or HepG2 cells. In one embodiment, the liver cells are Hep3B cells. In another embodiment, the liver cells are HepG2 cells.

[0063] In other embodiments, the method for evaluating the expression level of PNPLA3 is carried out in vivo.For example, RNAi construct and any control RNAi construct can be administered to animals (e.g., rodents or non-human primates), and the mRNA or protein level of PNPLA3 can be evaluated in liver tissue taken from treated animals.Alternatively or in addition, biomarkers or functional phenotypes associated with PNPLA3 expression can be evaluated in treated animals.

[0064] In certain embodiments, the expression of PNPLA3 is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% in liver cells by the RNAi constructs described herein. In some embodiments, the expression of PNPLA3 is reduced by at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% in liver cells by the RNAi constructs described herein. In other embodiments, the expression of PNPLA3 is reduced by at least about 90% in liver cells by the RNAi constructs described herein, for example, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. The percent reduction in the expression of PNPLA3 can be measured by any of the methods described herein or other methods known in the art. For example, in certain embodiments, the RNAi constructs described herein inhibit at least 60% of PNPLA3 expression at 5 nM in Hep3B cells (containing wild-type PNPLA3) in vitro. In related embodiments, the RNAi constructs described herein inhibit at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% of PNPLA3 expression at 5 nM in Hep3B cells in vitro. In other embodiments, the RNAi constructs described herein inhibit at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of PNPLA3 expression at 5 nM in Hep3B cells in vitro. In certain embodiments, the RNAi constructs described herein inhibit at least 60% of PNPLA3 expression at 5 nM in HepG2 cells (containing wild-type PNPLA3) in vitro.In related embodiments, the RNAi constructs described herein inhibit at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% of PNPLA3 expression in HepG2 cells in vitro at 5 nM. In other embodiments, the RNAi constructs described herein inhibit at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of PNPLA3 expression in HepG2 cells in vitro at 5 nM. Reduction of PNPLA3 can be measured using a variety of techniques, including, for example, RNA FISH or droplet digital PCR (see, for example, Kamitaki et al., Digital PCR. Methods in Molecular Biology, 1768:401-422 (2018). doi:10.1007 / 978-1-4939-7778-9_23).

[0065] In some embodiments, the IC 50 The IC value is calculated to evaluate the efficacy of the RNAi constructs described herein for inhibiting PNPLA3 expression in liver cells. 50 The "IC value" is the dose / concentration required to achieve 50% inhibition of a biological or biochemical function. The IC of any substance or antagonist 50 The IC value can be determined in any assay by constructing a dose-response curve and testing the effect of various concentrations of a substance or antagonist on expression levels or functional activity. The IC value of a given antagonist or substance can be determined by determining the concentration required to inhibit half of the maximum biological response or native expression level. 50IC values ​​can be calculated for any RNAi construct by determining the concentration of RNAi construct required to inhibit half of the native expression level of PNPLA3 in liver cells (e.g., the expression level of PNPLA3 in control liver cells) in any assay, such as an immunoassay, an RNA FISH assay, or a droplet digital PCR assay. 50 The RNAi constructs described herein have IC values ​​of less than about 40 nM. 50 (e.g., less than about 35 nM, 30 nM, 25 nM, 20 nM, 15 nM, 10 nM, 5 nM, or 1 nM). For example, the disclosed RNAi constructs can have an IC of about 0.001 nM to about 40 nM, about 0.001 nM to about 30 nM, about 0.001 nM to about 20 nM, about 0.001 nM to about 10 nM, about 0.001 nM to about 5 nM, about 0.001 nM to about 1 nM, about 0.1 nM to about 10 nM, about 0.1 nM to about 5 nM, or about 0.1 nM to about 1 nM. 50 can inhibit PNPLA3 expression in liver cells.

[0066] The RNAi constructs described herein can be easily produced using techniques known in the art, such as, for example, conventional solid-phase nucleic acid synthesis. The polynucleotides of the RNAi constructs can be constructed using standard nucleotide or nucleoside precursors (e.g., phosphoramidites) on a suitable nucleic acid synthesizer. Automated nucleic acid synthesizers are commercially available from several vendors, including the DNA / RNA synthesizer from Applied Biosystems (Foster City, CA), the MerMade synthesizer from BioAutomation (Irving, TX), and the OligoPilot synthesizer from GE Healthcare Life Sciences (Pittsburgh, PA).

[0067] Oligonucleotides can be synthesized via phosphoramidite chemistry using 2' silyl protecting groups with acid-labile dimethoxytrityl (DMT) at the 5' position of the ribonucleoside. Final deprotection conditions are known not to significantly degrade the RNA product. All syntheses can be performed on large, medium, or small scale with any automated or manual synthesizer. Syntheses can also be performed in multiple well plates, columns, or glass slides.

[0068] 2'-O-silyl groups can be removed by exposure to fluoride ions, which can include any source of fluoride ions, such as salts containing fluoride ions paired with inorganic counterions, such as cesium fluoride and potassium fluoride, or salts containing fluoride ions paired with organic counterions, such as tetraalkylammonium fluoride. Crown ether catalysts can be utilized in combination with inorganic fluorides in the deprotection reaction. Exemplary fluoride ion sources include, but are not limited to, tetrabutylammonium fluoride or amine hydrofluorides (e.g., combining triethylamine with aqueous HF in a dipolar aprotic solvent, such as dimethylformamide).

[0069] The choice of protecting groups used for the phosphite triesters and phosphotriesters can modify the stability of the triesters towards fluoride: methyl protection of the phosphotriester or phosphite triester can stabilize the bond towards fluoride ion and improve process yields.

[0070] Because ribonucleosides have a reactive 2' hydroxyl substituent, it may be desirable to protect the reactive 2' position in the RNA with a protecting group that is orthogonal to the 5'-O-dimethoxytrityl protecting group, e.g., one that is stable to acid treatment. Silyl protecting groups meet this requirement and can be easily removed in a final fluoride deprotection step, thereby minimizing RNA degradation.

[0071] Tetrazole catalysts can be used in standard phosphoramidite coupling reactions. Exemplary catalysts include, for example, tetrazole, S-ethyl-tetrazole, benzylthiotetrazole, and p-nitrophenyltetrazole.

[0072] Further methods of synthesizing the RNAi constructs described herein will be apparent to those skilled in the art. In addition, various synthetic steps may be carried out in an alternative order or sequence to obtain the desired compound. Other synthetic chemical transformations, protecting groups (e.g., for hydroxyl, amino, etc. present in bases) and protecting group techniques (protection and deprotection) useful in synthesizing the RNAi constructs described herein are known in the art, and include those described in R.Larock, Comprehensive Organic Transformations, VCH Publishers (1989); TWGreene and PGMWuts, Protective Groups in Organic Synthesis, 2d.Ed., John Wiley and Sons (1991); L.Fieser and M.Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L.Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof. Custom synthesis of RNAi constructs is also available from several commercial vendors, including Dharmacon, Inc. (Lafayette, Colo.), AxoLabs GmbH (Kulmbach, Germany), and Ambion, Inc. (Foster City, Calif.).

[0073] The RNAi constructs described herein may include a ligand. As used herein, "ligand" refers to any compound or molecule that can directly or indirectly interact with another compound or molecule. The interaction between another compound or molecule and a ligand may trigger a biological response (e.g., trigger a signal transduction cascade, induce receptor-mediated endocytosis), or may simply be a physical association. A ligand may modify one or more properties of the double-stranded RNA molecule that it binds to, such as the pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, intracellular uptake, charge and / or clearance properties of the RNA molecule.

[0074] The ligand may include a serum protein (e.g., human serum albumin, low density lipoprotein, globulin), a cholesterol moiety, a vitamin (e.g., biotin, vitamin E, vitamin B12), a folate moiety, a steroid, a bile acid (e.g., cholic acid), a fatty acid (e.g., palmitic acid, myristic acid), a carbohydrate (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), a glycoside, a phospholipid, or an antibody or binding fragment thereof (e.g., a whole antibody or binding fragment that targets an RNAi construct to a specific cell type such as a liver cell). Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (e.g., TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl groups, hexadecan ... Examples of suitable glycerols include glycerol, borneol, menthol, 1,3-propanediol, heptadecyl groups, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenoic acid, dimethoxytrityl or phenoxazine, peptides (e.g., antennapedia peptide, Tat peptide, RGD peptide), alkylating agents, polymers (e.g., polyethylene glycol (PEG), e.g., PEG-40K), polyamino acids, and polyamines (e.g., spermine, spermidine).

[0075] In certain embodiments, the ligand has endosome destabilizing properties. The endosome destabilizing ligand promotes the lysis of endosomes and / or the transport of the RNAi constructs described herein or components thereof from endosomes to the cytoplasm of cells. The endosome destabilizing ligand can be a polycationic peptide or peptidomimetic that exhibits pH-dependent membrane activity and fusogenicity. In one embodiment, the endosome destabilizing ligand adopts its active conformation at endosomal pH. The "active" conformation is a conformation in which the endosome destabilizing ligand promotes the lysis of endosomes and / or the transport of the RNAi constructs described herein or components thereof from endosomes to the cytoplasm of cells. Exemplary endosome destabilizing ligands include GALA peptides (Subbarao et al., Biochemistry, Vol. 26:2964-2972, 1987), EALA peptides (Vogel et al., J. Am. Chern. Soc., Vol. 118:1581-1586, 1996) and their derivatives (Turk et al., Biochem. Biophys. Acta, Vol. 1559:56-68, 2002). In one embodiment, the endosome destabilizing component may contain chemical groups (e.g., amino acids) that undergo a change in charge or protonation in response to a change in pH. The endosome destabilizing component may be linear or branched.

[0076] In some embodiments, the ligand comprises a lipid or other hydrophobic molecule. In one embodiment, the ligand comprises a cholesterol moiety or other steroid. Cholesterol-conjugated oligonucleotides have been reported to be more active than their non-conjugated counterparts (Manoharan, Antisense Nucleic Acid Drug Development, Vol. 12: 103-228, 2002). Ligands comprising cholesterol moieties and other lipids for conjugation to nucleic acid molecules are also described in U.S. Pat. Nos. 7,851,615; 7,745,608; and 7,833,992. In another embodiment, the ligand may comprise a folate moiety. Polynucleotides conjugated to a folate moiety may be taken up into cells via receptor-mediated endocytosis pathways. Such folate-polynucleotide conjugates are described, for example, in U.S. Pat. No. 8,188,247.

[0077] Given that PNPLA3 is expressed in liver cells (e.g., hepatocytes), in certain embodiments, it is desirable to specifically deliver the RNAi construct to liver cells. In some embodiments, the RNAi construct can be specifically targeted to the liver by employing a ligand that binds to or interacts with a protein expressed on the surface of liver cells. For example, in certain embodiments, the ligand can include one or more antigen binding proteins (e.g., antibodies or binding fragments thereof (e.g., Fab, scFv)) that specifically bind to a receptor expressed on hepatocytes.

[0078] In certain embodiments, the ligand comprises a carbohydrate. "Carbohydrate" refers to a compound composed of one or more monosaccharide units (which may be linear, branched, or cyclic) having at least six carbon atoms with an oxygen, nitrogen, or sulfur atom bonded to each carbon atom. Carbohydrates include, but are not limited to, sugars (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides, such as starch, glycogen, cellulose, and polysaccharide gums. In some embodiments, the carbohydrate incorporated into the ligand is a monosaccharide selected from pentose, hexose, or heptose, as well as disaccharides and trisaccharides containing such monosaccharide units. In other embodiments, the carbohydrate incorporated into the ligand is an amino sugar, such as galactosamine, glucosamine, N-acetylgalactosamine, and N-acetylglucosamine.

[0079] In some embodiments, the ligand comprises a hexose or hexosamine. The hexose may be selected from glucose, galactose, mannose, fucose, or fructose. The hexosamine may be selected from fructosamine, galactosamine, glucosamine, or mannosamine. In certain embodiments, the ligand comprises glucose, galactose, galactosamine, or glucosamine. In one embodiment, the ligand comprises glucose, glucosamine, or N-acetylglucosamine. In another embodiment, the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine. In certain embodiments, the ligand comprises N-acetyl-galactosamine. Ligands comprising glucose, galactose, and N-acetyl-galactosamine (GalNAc) are particularly effective in targeting compounds to liver cells (see, e.g., D'Souza and Devarajan, J. Control Release, Vol. 203:126-139, 2015). Examples of GalNAc or galactose-containing ligands that can be incorporated into the RNAi constructs described herein are described in U.S. Pat. Nos. 7,491,805; 8,106,022; and 8,877,917; U.S. Patent Application Publication No. 2003 / 0130186; and WO 2013 / 166155.

[0080] In certain embodiments, the ligand comprises a multivalent carbohydrate moiety. As used herein, a "multivalent carbohydrate moiety" refers to a moiety that comprises two or more carbohydrate units that can independently bind or interact with other molecules. For example, a multivalent carbohydrate moiety comprises two or more binding domains composed of carbohydrates that can bind to two or more different molecules, or to two or more different sites on the same molecule. The valency of the carbohydrate moiety indicates the number of individual binding domains within the carbohydrate moiety. For example, the terms "monovalent," "bivalent," "trivalent," and "tetravalent" with respect to a carbohydrate moiety refer to a carbohydrate moiety having one, two, three, and four binding domains, respectively. A multivalent carbohydrate moiety can comprise a multivalent lactose moiety, a multivalent galactose moiety, a multivalent glucose moiety, a multivalent N-acetyl-galactosamine moiety, a multivalent N-acetyl-glucosamine moiety, a multivalent mannose moiety, or a multivalent fucose moiety. In some embodiments, the ligand comprises a multivalent galactose moiety. In other embodiments, the ligand comprises a multivalent N-acetyl-galactosamine moiety. In these and other embodiments, the multivalent carbohydrate moiety is bivalent, trivalent, or tetravalent. In such embodiments, the polyvalent carbohydrate moiety can be biantennary or triantennary. In a particular embodiment, the polyvalent N-acetyl-galactosamine moiety is trivalent or tetravalent. In another particular embodiment, the polyvalent galactose moiety is trivalent or tetravalent. Exemplary trivalent and tetravalent GalNAc-containing ligands for incorporation into RNAi constructs are detailed below.

[0081] The ligand may be directly or indirectly bound or conjugated to the RNA molecule of the RNAi construct. For example, in some embodiments, the ligand is directly covalently bound to the sense or antisense strand of the RNAi construct. In other embodiments, the ligand is covalently bound to the sense or antisense strand of the RNAi construct via a linker. The ligand may be bound to the nucleobase, sugar moiety, or internucleotide bond of the polynucleotide (e.g., sense or antisense strand) of the RNAi construct described herein. Conjugation or binding to a purine nucleobase or derivative thereof may occur at any position, including endocyclic and exocyclic atoms. In certain embodiments, the 2-, 6-, 7-, or 8-position of the purine nucleobase is bound to the ligand. Conjugation or binding to a pyrimidine nucleobase or derivative thereof may also occur at any position. In some embodiments, the 2-, 5-, and 6-position of the pyrimidine nucleobase may be bound to the ligand. Conjugation or binding to the sugar moiety of the nucleotide may occur at any carbon atom. Exemplary carbon atoms of the sugar moiety that can be attached to the ligand include the 2', 3' and 5' carbon atoms. In basic residues and the like, the 1' position can also be attached to the ligand. Internucleotide linkages can also support the attachment of ligands. In the case of phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, etc.), the ligand can be attached directly to the phosphorus atom or to an O atom, N atom or S atom that is attached to the phosphorus atom. In amine- or amide-containing internucleoside linkages (e.g., PNA), the ligand can be attached to the nitrogen atom or adjacent carbon atom of the amine or amide.

[0082] In certain embodiments, the ligand may be attached to the 3' or 5' end of either the sense strand or the antisense strand. In certain embodiments, the ligand is covalently attached to the 5' end of the sense strand. In other embodiments, the ligand is covalently attached to the 3' end of the sense strand. For example, in some embodiments, the ligand is attached to the 3' terminal nucleotide of the sense strand. In certain such embodiments, the ligand is attached at the 3' position of the 3' terminal nucleotide of the sense strand. In alternative embodiments, the ligand is attached near the 3' end of the sense strand but before one or more terminal nucleotides (i.e., before 1, 2, 3 or 4 terminal nucleotides). In some embodiments, the ligand is attached at the 2' position of the sugar of the 3' terminal nucleotide of the sense strand.

[0083] In certain embodiments, the ligand is attached to the sense or antisense strand via a linker. A "linker" is an atom or group of atoms that covalently attaches the ligand to the polynucleotide component of the RNAi construct. The linker can be about 1 to about 30 atoms long, about 2 to about 28 atoms long, about 3 to about 26 atoms long, about 4 to about 24 atoms long, about 6 to about 20 atoms long, about 7 to about 20 atoms long, about 8 to about 20 atoms long, about 8 to about 18 atoms long, about 10 to about 18 atoms long, and about 12 to about 18 atoms long. In some embodiments, the linker can include a bifunctional linking moiety, which generally includes an alkyl moiety having two functional groups. One of the functional groups is selected to bind to a compound of interest (e.g., the sense or antisense strand of the RNAi construct) and the other is selected to bind substantially to any selected group, such as the ligand, as described herein. In certain embodiments, the linker comprises a chain structure or oligomer of repeating units such as ethylene glycol units or amino acid units. Examples of functional groups typically used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups, and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturation (e.g., double or triple bonds), and the like.

[0084] Linkers that can be used to attach a ligand to the sense or antisense strand of the RNAi constructs described herein include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 6-aminohexanoic acid, substituted C 1 ~C 10 Alkyl, substituted or unsubstituted C 2 ~C 10 Alkenyl or substituted or unsubstituted C 2 ~C 10 Preferred substituents for such linkers include, but are not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0085] In certain embodiments, the linker is cleavable. The cleavable linker is sufficiently stable outside the cell, but is cleaved upon entering the target cell, releasing the two moieties that the linker holds together. In some embodiments, the cleavable linker is cleaved at least 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least 100 times faster in the target cell or under a first reference condition (e.g., which can be selected to mimic or correspond to intracellular conditions) than in the subject's blood or under a second reference condition (e.g., which can be selected to mimic or correspond to conditions found in blood or serum).

[0086] Cleavable linkers are sensitive to cleavage agents, such as pH, redox potential, or the presence of degradable molecules. Generally, cleavage agents are found to be more prevalent or at higher levels or activity inside cells than in serum or blood. Examples of such degradable agents include redox agents that are selected for a specific substrate or have no substrate specificity, such as oxidases or reductases, or reducing agents such as mercaptans that are present inside cells and can degrade redox cleavable linkers by reduction; esterases; agents that can generate endosomes or acidic environments, such as those that result in a pH of 5 or less; enzymes that can hydrolyze or degrade acid cleavable linkers by acting as general acids, peptidases (which can be substrate specific), and phosphatases.

[0087] The cleavable linker may contain a moiety that is sensitive to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH, ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers have a cleavable group that is cleaved at a preferred pH, thereby releasing the RNA molecule from the ligand to the interior of the cell or into a desired compartment of the cell.

[0088] The linker may contain a cleavable group that can be cleaved by a specific enzyme. The type of cleavable group incorporated into the linker may depend on the cell to be targeted. For example, a liver targeting ligand may be linked to an RNA molecule via a linker that contains an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterases. Other types of cells that are rich in esterases include lung, renal cortex and testis cells. When targeting cells that are rich in peptidases, such as liver cells and synovial cells, a linker containing a peptide bond may be used.

[0089] In general, the suitability of a candidate cleavable linker can be evaluated by testing the ability (or conditions) of a degrading agent to cleave the candidate linker. It is also desirable to test the candidate cleavable linker for its ability to resist cleavage when in blood or in contact with other non-target tissues. Thus, the relative susceptibility to cleavage can be determined between a first condition selected to exhibit cleavage in target cells and a second condition selected to exhibit cleavage in other tissues or body fluids, such as blood or serum. Evaluation can be performed in a cell-free system, cells, cell cultures, organs or tissue cultures, or in whole animals. It may be useful to perform initial evaluations in cell-free or culture conditions and confirm with further evaluations in whole animals. In some embodiments, useful candidate linkers are cleaved at least 2-fold, 4-fold, 10-fold, 20-fold, 50-fold, 70-fold or 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0090] In other embodiments, a redox cleavable linker is utilized. A redox cleavable linker is cleaved when reduced or oxidized. One example of a reductively cleavable group is a disulfide linking group (-SS-). To determine whether a candidate cleavable linker is a suitable "reductively cleavable linker" or suitable for use with, for example, a particular RNAi construct and a particular ligand, one or more methods described herein can be used. For example, a candidate linker can be evaluated by incubation with dithiothreitol (DTT) or other reducing agent known in the art that mimics the cleavage rate that would be observed in a cell, for example, a target cell. A candidate linker can also be evaluated under conditions selected to mimic blood or serum conditions. In certain embodiments, a candidate linker is cleaved in blood at a maximum of 10%. In other embodiments, useful linker candidates are degraded at least 2, 4, 10, 20, 50, 70, or 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or under in vitro conditions selected to mimic extracellular conditions).

[0091] In yet another embodiment, the phosphate-based cleavable linker is cleaved by an agent that degrades or hydrolyzes the phosphate group. Examples of agents that hydrolyze the phosphate group in a cell include enzymes such as intracellular phosphatases. Examples of phosphate-based cleavable groups are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S-, -OP(S)(Rk)-S-. Particular embodiments include -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S-. Another particular embodiment is -OP(O)(OH)-O-. These linker candidates can be evaluated using methods similar to those described above.

[0092] In other embodiments, the linker may include an acid-cleavable group, which is a group that is cleaved under acidic conditions. In some embodiments, the acid-cleavable group is cleaved in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, 5.5, 5.0 or less) or by an agent such as an enzyme that can act as a general acid. Within a cell, certain low pH organelles such as endosomes and lysosomes can provide a cleavage environment for the acid-cleavable group. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups may have the general formula -C=NN-, C(O)O, or -OC(O). A particular embodiment is where the carbon attached to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group, such as dimethyl, pentyl, or t-butyl. These candidates can be evaluated using methods similar to those described above.

[0093] In other embodiments, the linker may include an ester-based cleavable group that is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable groups have the general formula -C(O)O- or -OC(O)-. These linker candidates can be evaluated using methods similar to those described above.

[0094] In further embodiments, the linker may include a peptidic cleavable group that is cleaved by enzymes such as peptidases and proteases in cells. Peptidic cleavable groups are peptide bonds formed between amino acids to give rise to oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptidic cleavable groups do not include amide groups (-C(O)NH-). Amide groups can be formed between any alkylene, alkenylene, or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to give rise to peptides and proteins. Peptidic cleavable groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to give rise to peptides and proteins, and do not include the entire amide functionality. Peptidic cleavable linking groups have the general formula -NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.

[0095] Other types of linkers suitable for attaching a ligand to the sense or antisense strand in the RNAi constructs described herein are known in the art and can include, for example, the linkers described in U.S. Pat. Nos. 7,723,509; 8,017,762; 8,828,956; 8,877,917; and 9,181,551.

[0096] In certain embodiments, the ligand covalently attached to the sense or antisense strand of an RNAi construct described herein comprises a GalNAc moiety, e.g., a multivalent GalNAc moiety. In some embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 3'-end of the sense strand. In other embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 5'-end of the sense strand. In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 3'-end of the sense strand. In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 5'-end of the sense strand.

[0097] In some embodiments, the RNAi constructs described herein can be delivered to a cell or tissue of interest by administering a vector that encodes and controls the intracellular expression of the RNAi construct. A "vector" (also referred to herein as an "expression vector") is a composition of matter that can be used to deliver a nucleic acid of interest to the interior of a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides bound to ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes an autonomously replicating plasmid or virus. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, and the like. A vector may replicate in a living cell or may be synthetically produced.

[0098] Generally, vectors for expressing the RNAi constructs described herein will include one or more promoters operably linked to the sequence encoding the RNAi construct. The phrases "operably linked", "operably linked" or "under transcriptional control" may be used interchangeably herein to indicate when a promoter is in the correct position and orientation relative to a polynucleotide sequence to control the initiation of transcription by RNA polymerase and the expression of the polynucleotide sequence. A "promoter" refers to a sequence that is recognized by or introduced into the synthetic machinery of a cell and is required to initiate transcription of a particular gene sequence. Suitable promoters include, but are not limited to, RNA pol I, pol II, HI, or U6 RNA pol III, and viral promoters (e.g., human cytomegalovirus (CMV) immediate early gene promoter, SV40 early promoter, and Rous sarcoma virus long terminal repeat). In some embodiments, HI or U6 RNA pol III promoters are utilized. The promoter may be a tissue-specific promoter or an inducible promoter. Of particular interest are liver-specific promoters, such as promoter sequences from the human α1-antitrypsin gene, albumin gene, hemopexin gene, and hepatic lipase gene. Inducible promoters include, for example, promoters regulated by ecdysone, estrogen, progesterone, tetracycline, and isopropyl-PD1-thiogalactopyranoside (IPTG).

[0099] When the RNAi construct comprises siRNA, the two separate strands (sense and antisense strands) can be expressed from a single vector or two separate vectors. For example, in some embodiments, the sequence encoding the sense strand is operably linked to the promoter of a first vector, and the sequence encoding the antisense strand is operably linked to the promoter of a second vector. In such embodiments, the first and second vectors are introduced simultaneously into a target cell, for example, by infection or transfection, so that the sense and antisense strands are transcribed and hybridize in the cell to form an siRNA molecule. In another embodiment, the sense and antisense strands are transcribed from two separate promoters located in a single vector. In such embodiments, the sequence encoding the sense strand may be operably linked to a first promoter, and the sequence encoding the antisense strand may be operably linked to a second promoter, and the first and second promoters are located in a single vector. In one embodiment, the vector comprises a first promoter operably linked to a sequence encoding an siRNA molecule and a second promoter operably linked in the opposite orientation to the same sequence, such that transcription of the sequence from the first promoter results in synthesis of the sense strand of the siRNA molecule and transcription of the sequence from the second promoter results in synthesis of the antisense strand of the siRNA molecule.

[0100] When the RNAi construct comprises an shRNA, a sequence encoding a single at least partially self-complementary RNA molecule is operably linked to a promoter that produces a single transcript. In some embodiments, the sequence encoding the shRNA comprises an inverted repeat connected by a linker polynucleotide sequence, producing the stem and loop structure of the shRNA after transcription.

[0101] In some embodiments, the vector encoding the RNAi construct described herein is a viral vector.Various viral vector systems suitable for expressing the RNAi construct described herein include, but are not limited to, adenovirus vector, retrovirus vector (e.g., lentivirus vector, Maloney murine leukemia virus), adeno-associated virus vector; herpes simplex virus vector; SV40 vector; polyomavirus vector; papillomavirus vector; picornavirus vector; and poxvirus vector (e.g., vaccinia virus).In certain embodiments, the viral vector is a retrovirus vector (e.g., lentivirus vector).

[0102] Various vectors suitable for use in the present disclosure, methods for inserting nucleic acid sequences encoding siRNA or shRNA molecules into the vectors, and methods for delivering the vectors to cells of interest are known in the art (e.g., Dornburg, Gene Therap., Vol. 2:301-310, 1995; Eglitis, Biotechniques, Vol. 6:608-614, 1988; Miller, HumGene Therap., Vol. 1:5-14, 1990; Anderson, Nature, Vol. 392:25-30, 1998; Rubinson DA et al., Nat. Genet., Vol. 33:401-406, 2003; Brummelkamp et al., Science, Vol. 296:550-553, 2002; Brummelkamp et al., Cancer Cell,Vol.2:243-247,2002;Lee et al.,Nat Biotechnol,Vol.20:500-505,2002;Miyagishi et al.,Nat Biotechnol,Vol.20:497-500,2002;Paddison et al.,GenesDev,Vol.16:948-958,2002;Paul et al. (See Sui et al., Proc Natl Acad Sci USA, Vol. 99:5515-5520, 2002; and Yu et al., Proc Natl Acad Sci USA, Vol. 99:6047-6052, 2002).

[0103] composition The present disclosure also provides compositions and formulations comprising the RNAi constructs described herein and pharma- ceutically acceptable carriers, excipients, or diluents. Such compositions and formulations are useful for reducing the expression of PNPLA3 in subjects in need thereof. When clinical use is envisaged, pharmaceutical compositions and formulations are prepared in a form suitable for intended use. In general, this involves preparing compositions that are substantially free of pyrogens as well as other impurities that may be harmful to humans or animals.

[0104] The phrase "pharmacologically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans. As used herein, "pharmacologically acceptable carriers, excipients, or diluents" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, and absorption delaying agents that are acceptable for use in formulating pharmaceuticals, such as pharmaceuticals suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Any conventional media or agent is contemplated for use in therapeutic compositions, except insofar as it is incompatible with the RNAi constructs described herein. Supplementary active ingredients may also be incorporated into the compositions, provided that they do not inactivate the vector or RNAi construct of the composition.

[0105] Compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the type and extent of the disease or disorder to be treated, and the dose to be administered. In some embodiments, the pharmaceutical composition is formulated based on the intended delivery route. For example, in certain embodiments, the pharmaceutical composition is formulated for parenteral delivery. Parenteral delivery forms include intravenous, intraarterial, subcutaneous, intrathecal, intraperitoneal, and intramuscular injection or infusion. In one embodiment, the pharmaceutical composition is formulated for intravenous delivery. In such embodiments, the pharmaceutical composition may include a lipid-based delivery vehicle. In another embodiment, the pharmaceutical composition is formulated for subcutaneous delivery. In such embodiments, the pharmaceutical composition may include a targeting ligand (e.g., a GalNAc-containing ligand described herein).

[0106] In some embodiments, the pharmaceutical composition comprises an effective amount of the RNAi construct described herein. An "effective amount" is an amount sufficient to produce a beneficial or desired clinical outcome. In some embodiments, an effective amount is an amount sufficient to reduce PNPLA3 expression in liver cells of a subject. In some embodiments, an effective amount may be an amount sufficient to only partially reduce PNPLA3 expression, for example to a level equivalent to the expression of a wild-type PNPLA3 allele in a human heterozygote. It has been reported that heterozygous human carriers of a loss-of-function PNPLA3 variant allele have lower serum levels of non-HDL cholesterol and a lower risk of coronary artery disease and myocardial infarction compared to non-carriers (Nioi et al., New England Journal of Medicine, Vol. 374(22): 2131-2141, 2016). Thus, without being bound by theory, it is believed that a partial reduction in PNPLA3 expression may be sufficient to achieve beneficial reduction in serum non-HDL cholesterol and reduced risk of coronary artery disease and myocardial infarction.

[0107] An effective amount of the RNAi construct may be about 0.01 mg / kg body weight to about 100 mg / kg body weight, about 0.05 mg / kg body weight to about 75 mg / kg body weight, about 0.1 mg / kg body weight to about 50 mg / kg body weight, about 1 mg / kg to about 30 mg / kg body weight, about 2.5 mg / kg body weight to about 20 mg / kg body weight, or about 5 mg / kg body weight to about 15 mg / kg body weight. In certain embodiments, a single effective amount of the RNAi construct may be about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, or about 10 mg / kg. A pharmaceutical composition comprising an effective amount of the RNAi construct may be administered weekly, biweekly, monthly, quarterly, or semi-annually. Determining the exact dosage and frequency of administration that will be effective may be based on several factors, including the size, age, and sex of the patient, the type of disorder being treated (e.g., myocardial infarction, heart failure, coronary artery disease, hypercholesterolemia), the particular RNAi construct used, and the route of administration. Effective dosages and in vivo half-life estimates for any particular RNAi construct described herein can be confirmed using conventional methods and / or testing in appropriate animal models.

[0108] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes, may be used as delivery vehicles for the RNAi constructs described herein or vectors encoding such constructs. Commercially available fat emulsions suitable for delivery of the nucleic acids described herein include INTRALIPIDI, LIPOSYN, LIPOSYN II, LIPOSYN III, NUTRILIPID, and other similar fat emulsions. A preferred colloidal system for use as a delivery vehicle in vivo is a liposome (i.e., an artificial membrane vesicle). The RNAi constructs described herein may be encapsulated in liposomes, such as cationic liposomes. Alternatively, the RNAi constructs may be complexed to lipids, such as cationic lipids. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), and dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine), anionic (e.g., dimyristoylphosphatidylglycerol (DMPG)), and cationic (e.g., dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidylethanolamine (DOTMA)). The preparation and use of such colloidal dispersions is well known in the art. Exemplary formulations are also disclosed, for example, in U.S. Pat. Nos. 5,783,565; 5,837,533; 5,981,505; 6,127,170; 6,217,900; 6,379,965; 6,383,512; 6,747,014; 7,202,227; and WO 03 / 093449.

[0109] In some embodiments, the RNAi construct is fully encapsulated in a lipid formulation to form, for example, SPLP, pSPLP, SNALP, or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle that includes plasmid DNA encapsulated in lipid vesicles. SNALP and SPLP typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALP and SPLP are highly useful for systemic administration because they exhibit long circulation life after intravenous injection and accumulate at distal sites (e.g., sites physically distant from the site of administration). SPLP includes "pSPLP" that includes an encapsulated condensing agent-nucleic acid complex as described in WO 00 / 03683. The nucleic acid-lipid particles typically have an average diameter of about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, or about 70 nm to about 90 nm, and are substantially non-toxic. In addition, it is desirable that the nucleic acid present in the nucleic acid-lipid particles is resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Pat. No. 5,976,567, U.S. Pat. No. 5,981,501, U.S. Pat. No. 6,534,484, U.S. Pat. No. 6,586,410, U.S. Pat. No. 6,815,432, and WO 96 / 40964.

[0110] Pharmaceutical compositions suitable for injection include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that they are easily syringable. Preparations must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Suitable solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating (such as lecithin), by maintaining the required particle size (in the case of dispersions), and / or by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, isotonic agents (for example, sugars or sodium chloride) can be included in the composition. Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents which delay absorption, for example, aluminum monostearate and gelatin.

[0111] Sterile injectable solution can be prepared by incorporating an appropriate amount of RNAi construct (alone or complexed with ligand) into a solvent with any other components (such as above) as necessary, followed by filtration sterilization.Generally, dispersion is prepared by incorporating various sterilized active components into a sterile vehicle that contains a basic dispersion medium and other desired components.In the case of sterile powder for preparing sterile injectable solution, suitable preparation methods include vacuum drying and freeze-drying techniques, which can obtain powder of active component and any additional desired components from the solution that has been previously sterilized and filtered.

[0112] The compositions provided herein can be formulated in neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with free amino groups) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Also, salts formed with free carboxyl groups can be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxide) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).

[0113] For parenteral administration in aqueous solution, for example, the solution is generally suitably buffered and the liquid diluent is first made isotonic, for example, with sufficient saline or glucose. Such aqueous solution can be used, for example, for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. It is desirable to use a sterile aqueous medium, as known to those skilled in the art. By way of illustration, a single dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion, or injected at the proposed infusion site (see, for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). For human administration, the preparation must meet the standards of sterility, pyrogenicity, general safety, and purity required by FDA standards. In certain embodiments, the pharmaceutical composition described herein comprises or consists of a sterile saline solution and an RNAi construct described herein. In other embodiments, the pharmaceutical compositions described herein comprise or consist of an RNAi construct described herein and sterile water (e.g., water for injection, WFI). In yet other embodiments, the pharmaceutical compositions described herein comprise or consist of an RNAi construct described herein and phosphate buffered saline (PBS).

[0114] In some embodiments, the pharmaceutical composition is packaged or stored in a device for administration.Devices for injection formulations include, but are not limited to, injection ports, pre-filled syringes, automatic injection devices, injection pumps, wearable syringes, and injection pens.Devices for aerosolized formulations or powder formulations include, but are not limited to, inhalers, insufflators, inhalers, etc.Therefore, the present disclosure includes administration devices that comprise the pharmaceutical compositions described herein for treating or preventing one or more of the disorders described herein.

[0115] Methods for inhibiting PNPLA3 expression The present disclosure also provides a method for inhibiting the expression of PNPLA3 gene in a cell. The method includes contacting the cell with an RNAi construct, for example, a double-stranded RNAi construct, in an amount effective to inhibit the expression of PNPLA3 in the cell, thereby inhibiting the expression of PNPLA3 in the cell. Contacting the cell with an RNAi construct, for example, a double-stranded RNAi construct, can be performed in vitro or in vivo. Contacting the cell with an RNAi construct in vivo includes contacting a cell or a group of cells in a subject, for example, a human subject, with the RNAi construct. The combination of in vitro and in vivo methods of contacting the cell is also within the scope of the present disclosure.

[0116] The present disclosure provides methods for reducing or inhibiting expression of PNPLA3 in a subject in need thereof, and for treating or preventing a condition, disease, or disorder associated with PNPLA3 expression or activity. "Condition, disease, or disorder associated with PNPLA3 expression" refers to a condition, disease, or disorder in which the expression level of PNPLA3 is altered or elevated expression levels of PNPLA3 are associated with an increased risk of developing the condition, disease, or disorder.

[0117] Contacting cells can be direct or indirect, as discussed above.Furthermore, contacting cells can be achieved through targeting ligand, including any ligand described herein or known in the art.In a preferred embodiment, targeting ligand is a carbohydrate moiety, for example, GalNAc3 ligand, or any other ligand that guides RNAi construct to the site of interest.

[0118] In one embodiment, contacting a cell with an RNAi includes "introducing" or "delivering an RNAi to a cell" by facilitating or causing uptake or absorption into the cell. The uptake or uptake of the RNAi can occur by unassisted diffusive or active cellular processes, or by auxiliary agents or devices. For example, for in vivo introduction, the RNAi can be injected into a tissue site or administered systemically. In vitro introduction into a cell can be achieved using methods known in the art, such as electroporation and lipofection. Further methods are described herein below and / or known in the art.

[0119] As used herein, the term "inhibit" is used interchangeably with "reduce," "silencing," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0120] The phrase "inhibiting expression of PNPLA3" is intended to refer to the inhibition of expression of any PNPLA3 gene (such as, for example, a mouse PNPLA3 gene, a rat PNPLA3 gene, a monkey PNPLA3 gene, or a human PNPLA3 gene) and variants or mutants of the PNPLA3 gene. Thus, the PNPLA3 gene may be a wild-type PNPLA3 gene, a mutant PNPLA3 gene (such as a mutant PNPLA3 gene that causes amyloid deposition), or a transgenic PNPLA3 gene in the context of a genetically engineered cell, cell population, or organism.

[0121] "Inhibiting the expression of the PNPLA3 gene" includes any level of inhibition of the PNPLA3 gene, for example, suppressing at least a portion of the expression of the PNPLA3 gene. The expression of the PNPLA3 gene can be evaluated based on the level or change in the level of any variable associated with the expression of the PNPLA3 gene, such as, for example, the PNPLA3 mRNA level, the PNPLA3 protein level, or the number or extent of amyloid deposits. The level can be evaluated, for example, in an individual cell or a group of cells, including a sample derived from a subject.

[0122] Inhibition can be assessed by a reduction in the absolute or relative level of one or more variables associated with PNPLA3 expression compared to a control level, which can be any type of control level used in the art, such as, for example, a baseline level before administration, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (e.g., a buffer only control or an inactive drug control). In some embodiments, expression of the PNPLA3 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0123] Inhibition of expression of the PNPLA3 gene may be evidenced by a decrease in the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which the PNPLA3 gene is transcribed and which has been treated (e.g., by contacting the cell with an RNAi construct described herein, or by administering an RNAi construct described herein to a subject in which the cell is or was present) such that expression of the PNPLA3 gene is inhibited, compared to a second cell or group of cells (control cells) that is substantially identical to the first cell or group of cells but has not been similarly treated. Inhibition may be assessed by expressing the mRNA level in the treated cells as a percentage of the mRNA level in the control cells using the following formula:

number

[0124] Alternatively, inhibition of expression of the PNPLA3 gene may be assessed in terms of a decrease in a parameter functionally related to PNPLA3 gene expression, such as PNPLA3 protein expression or Hedgehog pathway protein activity. PNPLA3 gene silencing may be determined in any cell that expresses PNPLA3 endogenously or recombinantly by any assay known in the art.

[0125] Inhibition of the expression of PNPLA3 protein can be demonstrated by a reduction in the level of PNPLA3 protein expressed by a cell or cell group (e.g., the level of protein expressed in a sample obtained from a subject).As explained above, to assess the suppression of mRNA, inhibition of protein expression levels in treated cells or cell groups can also be expressed as a percentage of the level of protein in control cells or cell groups.

[0126] The control cell or cell group that can be used to evaluate the inhibition of the expression of PNPLA3 gene includes the cell or cell group that has not yet been contacted with the RNAi construct described herein.For example, the control cell or cell group can be obtained from an individual subject (e.g., human subject or animal subject) before the subject is treated with the RNAi construct.

[0127] The level of PNPLA3 mRNA expressed by a cell or group of cells, or the level of circulating PNPLA3 mRNA, can be determined using any method known in the art for assessing mRNA expression, such as the methods described above. In some embodiments, the expression level of PNPLA3 in a sample is determined by detecting a transcribed polynucleotide, such as, for example, the mRNA of the PNPLA3 gene, or a portion thereof. In this regard, for example, RNA can be extracted from cells using RNA extraction techniques, including, for example, the use of acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kit (Qiagen) or PAXgene (PreAnalytix, Switzerland). Exemplary assay formats that utilize ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res., 12:7035), Northern blotting, in situ hybridization, and microarray analysis. Circulating PNPLA3 mRNA can be detected using the methods described in WO 2012 / 177906.

[0128] In one embodiment, the level of expression of PNPLA3 is determined using a nucleic acid probe. The term "probe" as used herein refers to any molecule that can selectively bind to a specific PNPLA3 sequence. Probes can be synthesized by those skilled in the art or derived from appropriate biological preparations. Probes may be specially designed to be labeled. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

[0129] The isolated mRNA can be used in hybridization or amplification assays, including, but not limited to, Southern or Northern analysis, polymerase chain reaction (PCR) analysis, and probe arrays. One method for determining mRNA levels includes contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize with the mRNA of PNPLA3. In one embodiment, the mRNA is immobilized on a solid surface and contacted with the probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe is immobilized on a solid surface, for example in an Affymetrix gene chip array, and the mRNA is contacted with the probe. Those skilled in the art can easily adapt known mRNA detection methods for use in determining the level of PNPLA3 mRNA.

[0130] Alternative methods for determining the expression level of PNPLA3 in a sample include, for example, RT-PCR (see, e.g., U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcription amplification systems (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-beta replicase (Lizardi et al. (1988) Bio / Technology 6:1197), rolling circle replication (Lizardi et al. (1989) Bio / Technology 6:1197), and the like. al, supra; and U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, for example, includes the process of nucleic acid amplification of mRNA in a sample and / or reverse transcriptase, followed by detection of the amplified molecules using techniques well known to those skilled in the art. These detection schemes are useful for detecting nucleic acid molecules, especially when they are present in very low numbers. In some aspects of the present disclosure, the expression level of PNPLA3 can be determined by quantitative fluorogenic RT-PCR (i.e., TAQMAN™ system). The expression level of PNPLA3 mRNA can be monitored using membrane blots (such as those used in hybridization analysis such as Northern, Southern, dot, etc.) or microwells, sample tubes, gels, beads or fibers (or any solid support containing bound nucleic acid) (see, for example, U.S. Pat. Nos. 5,445,934; 5,677,195; 5,770,722; 5,744,305; and 5,874,219). Determining the expression level of PNPLA3 can also include the use of nucleic acid probes in solution. In certain embodiments, the level of mRNA expression is evaluated using branched DNA (bDNA) assay or real-time PCR (qPCR).

[0131] The level of PNPLA3 protein expression can be determined using any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), high diffusion chromatography, liquid or gel precipitin reaction, absorption spectroscopy, colorimetric assay, spectrophotometric assay, flow cytometry, immunodiffusion (one-way or two-way), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, electrochemiluminescence assay, etc.

[0132] In some embodiments, the effectiveness of the methods described herein can be monitored by detecting or monitoring a reduction in symptoms of PNPLA3 disease, such as reduced edematous swelling of the extremities, face, larynx, upper airway, abdomen, trunk, and genitals, prodrome, laryngeal edema, non-pruritic rash, nausea, vomiting, or abdominal pain. These symptoms can be assessed in vitro or in vivo using any method known in the art.

[0133] In some aspects, the RNAi construct or a composition comprising the RNAi construct is administered to a subject so that the RNAi construct is delivered to a specific site in the subject. Inhibition of the expression of PNPLA3 can be assessed using measurement of the level or change in the level of PNPLA3 mRNA or PNPLA3 protein in a sample derived from a body fluid or tissue from a specific site in the subject. In some embodiments, the RNAi construct can be delivered to a site such as the liver, choroid plexus, retina, and pancreas. The site can be a small unit or subgroup of cells derived from any one of the aforementioned sites. The site can also include cells expressing a specific type of receptor.

[0134] Methods for Treating or Preventing PNPLA3-Related Disorders The present disclosure provides therapeutic and prophylactic methods comprising administering to a subject having or prone to developing a PNPLA3-related disease, disorder and / or condition, an RNAi construct, a composition (e.g., pharmaceutical composition) comprising an RNAi construct, or a vector comprising an RNAi construct as described herein. Non-limiting examples of PNPLA3-related diseases include, for example, fatty liver (steatosis), non-alcoholic steatohepatitis (NASH), cirrhosis, accumulation of fat in the liver, inflammation of the liver, hepatocyte necrosis, liver fibrosis, obesity, and non-alcoholic fatty liver disease (NAFLD). In one embodiment, the PNPLA3-related disease is NAFLD. In another embodiment, the PNPLA3-related disease is NASH. In another embodiment, the PNPLA3-related disease is fatty liver (steatosis). In another embodiment, the PNPLA3-related disease is insulin resistance. In another embodiment, the PNPLA3-related disease is not insulin resistance.

[0135] In certain embodiments, the present disclosure provides a method for reducing the expression of PNPLA3 in a patient in need thereof, comprising administering any of the RNAi constructs described herein to the patient.As used herein, the term "patient" refers to a mammal, including human, and can be used interchangeably with the term "subject".Desirably, the expression level of PNPLA3 in the liver cells of the patient is reduced after administration of the RNAi construct, compared with the PNPLA3 expression level of the patient who does not receive the RNAi construct.

[0136] The methods described herein are useful for treating subjects with PNPLA3-related diseases, such as subjects who would benefit from reducing PNPLA3 gene expression and / or PNPLA3 protein production.In one aspect, the present disclosure provides a method for reducing the level of patatin-like phospholipase domain-containing 3 (PNPLA3) gene expression in a subject with non-alcoholic fatty liver disease (NAFLD).In another aspect, the present disclosure provides a method for reducing the level of PNPLA3 protein in a subject with NAFLD.The present disclosure also provides a method for reducing the level of Hedgehog pathway activity in a subject suffering from NAFLD.

[0137] The therapeutic methods (and uses) described herein include administering to a subject, e.g., a human, a therapeutically effective amount of the disclosed RNAi constructs that target the PNPLA3 gene, pharmaceutical compositions comprising the RNAi constructs, or vectors comprising the RNAi constructs.

[0138] In one aspect, the present disclosure provides a method for preventing at least one symptom of a subject with NAFLD, such as the presence of elevated Hedgehog signaling pathway, fatigue, weakness, weight loss, loss of appetite, nausea, abdominal pain, spider veins, yellowing of skin and eyes (jaundice), itching, water accumulation and swelling of legs (edema), abdominal distension (ascites), and mental confusion.The method includes administering a prophylactically effective amount of an RNAi construct, such as a dsRNA, a pharmaceutical composition comprising an RNAi construct, or a vector encoding an RNAi construct, to a subject, thereby preventing at least one symptom in a subject with a disorder that benefits from reducing PNPLA3 gene expression.A "prophylactically effective amount" refers to an amount effective at the dosage and duration required to achieve a desired prophylactic result (e.g., prevention of disease onset).

[0139] In another aspect, the present disclosure provides the use of a therapeutically effective amount of the RNAi construct described herein for treating a subject, for example, a subject that will benefit from reducing and / or inhibiting PNPLA3 gene expression.In a further aspect, the present disclosure provides the use of the RNAi construct, for example dsRNA, that targets the PNPLA3 gene, or the pharmaceutical composition that comprises the RNAi construct that targets the PNPLA3 gene, in the manufacture of a medicament for treating a subject, for example, a subject that will benefit from reducing and / or inhibiting PNPLA3 gene expression and / or PNPLA3 protein production, for example, a subject with a disorder that will benefit from reducing PNPLA3 gene expression, such as a PNPLA3-related disease.

[0140] The present disclosure provides the use of RNAi constructs, for example dsRNA, for preventing at least one symptom in the subject suffering from the disorder that will benefit from the reduction and / or inhibition of PNPLA3 gene expression and / or PNPLA3 protein production.For example, the present disclosure provides the use of the RNAi constructs described herein, the composition comprising it, and the vector comprising it in the treatment of NAFLD.

[0141] In a further aspect, the present invention provides use of the disclosed RNAi construct, a composition comprising the same, or a vector comprising the same in the manufacture of a medicament for preventing at least one symptom in a subject suffering from a disorder that would benefit from reducing and / or inhibiting PNPLA3 gene expression and / or PNPLA3 protein production, such as a PNPLA3-associated disease.

[0142] In one embodiment, an RNAi construct targeting PNPLA3 is used to reduce or eliminate expression of the PNPLA3 gene in cells, tissues, blood, or other tissue or bodily fluid of a subject when the RNAi construct is administered to the subject, e.g., by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 104%, 105%, 106%, , 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more reduced PNPLA3-related disease, e.g., nonalcoholic fatty liver disease (NAFLD).

[0143] The methods and uses provided herein include administering a composition described herein such that expression of the target PNPLA3 gene is reduced for any suitable time, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or about 80 hours. In one embodiment, expression of the target PNPLA3 gene is reduced for an extended period of time, for example, at least about 2, 3, 4, 5, 6, 7 days or more, for example, about 1 week, 2 weeks, 3 weeks, or about 4 weeks or more.

[0144] Administration of RNAi constructs according to the methods and uses described herein may result in a reduction in the severity, signs, symptoms, and / or markers of PNPLA3-related diseases, such as NAFLD, in patients with such diseases or disorders. "Reduction" in this context means a statistically significant reduction in such levels. The reduction may be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or about 100%. The efficacy of disease treatment or prevention may be assessed, for example, by measuring disease progression, disease remission, disease symptom severity, pain reduction, quality of life, the dose of a drug required to maintain therapeutic efficacy, the level of a disease marker, or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of a person skilled in the art to observe the effectiveness of treatment or prevention by measuring any one of these parameters or any combination of these parameters. For example, the effectiveness of treatment of NAFLD can be evaluated by, for example, regular monitoring of NAFLD symptoms, liver fat level, or expression of downstream genes. Comparison of the first reading with the subsequent reading provides the physician with an indication of whether the treatment is effective. It is well within the ability of a person skilled in the art to observe the effectiveness of treatment or prevention by measuring any one of these parameters or any combination of these parameters. In relation to the administration of RNAi targeting PNPLA3 or pharmaceutical composition thereof, "effective against" PNPLA3-related disease indicates that administration in a clinically relevant manner will bring about beneficial effects, such as symptom improvement, cure, disease reduction, life extension, improvement in quality of life, or other effects generally recognized as favorable by physicians familiar with the treatment of NAFLD and / or PNPLA3-related disease and related causes, in at least a statistically significant proportion of patients.

[0145] The therapeutic or prophylactic effect is evident when there is a statistically significant improvement in one or more parameters of the disease state, or when otherwise expected symptoms do not worsen or develop.As an example, a favorable change of at least 10%, preferably at least 20%, 30%, 40%, 50% or more of the measurable parameters of the disease may indicate an effective treatment.The efficacy of a given RNAi drug or a formulation of this drug can also be determined using an experimental animal model for a given disease known in the art.When using an experimental animal model, the efficacy of the treatment is demonstrated when a statistically significant reduction in markers or symptoms is observed.

[0146] The subject may be administered any therapeutically effective amount of the RNAi construct. Exemplary therapeutically effective amounts of the RNAi construct include 0.01 mg / kg, 0.02 mg / kg, 0.03 mg / kg, 0.04 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.3 mg / kg, 0.35 mg / kg, 0.4 mg / kg, 0.45 mg / kg, 0.5 mg / kg, 0.55 mg / kg, 0.6mg / kg, 0.65mg / kg, 0.7mg / kg, 0.75mg / kg, 0.8mg / kg, 0.85mg / kg, 0.9mg / kg, 0.95mg / kg, 1.0mg / kg, 1 .1mg / kg, 1.2mg / kg, 1.3mg / kg, 1.4mg / kg, 1.5mg / kg, 1.6mg / kg, 1.7mg / kg, 1.8mg / kg, 1.9mg / kg, 2.0mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3. 0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / k g, 4.0mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9 mg / kg, 5.0mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg dsRNA, 5.9mg / kg, 6.0mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7.0mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / k g, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8.0mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.These include, but are not limited to, 9mg / kg, 9.0mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 9.0mg / kg, 10mg / kg, 15mg / kg, 20mg / kg, 25mg / kg, 30mg / kg, 35mg / kg, 40mg / kg, 45mg / kg, or about 50mg / kg. In one embodiment, a subject may be administered 0.5mg / kg of an RNAi construct. Values ​​and ranges intermediate to the recited values ​​are also included in the present disclosure.

[0147] Administration of an RNAi construct, or a composition comprising the same, can, for example, increase the presence of PNPLA3 protein levels in a patient's cells, tissues, blood, urine, or other compartment by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 108%, 109%, 109%, 109%, %, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more.

[0148] Prior to administration of the full dose of RNAi, the patient may be administered a smaller dose, such as a 5% infusion, and monitored for adverse effects, such as allergic reactions, hi another example, the patient may be observed for undesirable immunostimulatory effects, such as increased cytokine (e.g., TNF-alpha or INF-alpha) levels.

[0149] Due to the inhibitory effect on PNPLA3 expression, the composition according to the present disclosure or a pharmaceutical composition prepared therefrom can improve the quality of life.

[0150] The RNAi described herein may be administered in a "naked" form, in which modified or unmodified RNAi constructs are directly suspended in aqueous or suitable buffer solutions as "free RNAi". Free RNAi is administered in the absence of pharmaceutical compositions. Free RNAi may be in a suitable buffer solution. The buffer solution may include acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolality of the buffer solution containing RNAi may be adjusted to be suitable for administration to a subject.

[0151] Alternatively, the RNAi described herein can be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.

[0152] Subjects that would benefit from reducing and / or inhibiting PNPLA3 gene expression are those who have non-alcoholic fatty liver disease (NAFLD) and / or a PNPLA3-related disease or disorder as described herein.

[0153] Treatment of subjects that would benefit from reducing and / or inhibiting PNPLA3 gene expression includes therapeutic and prophylactic treatments.

[0154] The present disclosure further provides methods and uses of RNAi constructs or pharmaceutical compositions thereof for treating subjects who would benefit from reducing and / or inhibiting PNPLA3 gene expression, e.g., subjects having a PNPLA3-related disease, e.g., in combination with known pharmaceuticals and / or known therapies, e.g., those currently utilized to treat these disorders, along with other pharmaceuticals and / or therapies.

[0155] For example, in certain embodiments, the RNAi that targets PNPLA3 gene is administered in combination with, for example, the drug that is useful for treating PNPLA3-related disease.For example, the additional therapeutic agent and treatment that is suitable for treating the subject that will benefit from the reduction of PNPLA3 expression, for example, the subject that has PNPLA3-related disease, include the RNAi construct that targets different parts of PNPLA3 gene, the therapeutic agent and / or treatment for treating PNPLA3-related disease, or any combination of the above.

[0156] In certain embodiments, the first RNAi construct that targets PNPLA3 gene is administered in combination with the second RNAi construct that targets a different part of PNPLA3 gene.For example, the first RNAi construct may comprise a first sense strand and a first antisense strand that form a double-stranded region, and substantially all of the nucleotides of the first sense strand and substantially all of the nucleotides of the first antisense strand are modified nucleotides, and the first sense strand is conjugated to a ligand that is linked to its 3' end, and the ligand is one or more GalNAc derivatives that are linked via a bivalent or trivalent branched linker; and the second RNAi construct comprises a second sense strand and a second antisense strand that form a double-stranded region, and substantially all of the nucleotides of the second sense strand and substantially all of the nucleotides of the second antisense strand are modified nucleotides, and the second sense strand is conjugated to a ligand that is linked to its 3' end, and the ligand is one or more GalNAc derivatives that are linked via a bivalent or trivalent branched linker. In one embodiment, all of the nucleotides of the first and second sense strands and / or all of the nucleotides of the first and second antisense strands comprise a modification. The modified nucleotides can be any one or combination of the modified nucleotides described herein.

[0157] In other embodiments, the first RNAi construct targeting the PNPLA3 gene is administered in combination with the second RNAi construct targeting a gene different from the PNPLA3 gene. For example, the RNAi construct targeting the PNPLA3 gene may be administered in combination with the RNAi construct targeting the SCAP gene. SCAP (SREBP cleavage activating protein) is the only known regulator of the SREBP family of transcription factors. The SREBP (sterol response element binding protein) family plays an important role in regulating de novo lipogenesis and triglyceride (TG) accumulation in the liver. The first RNAi construct targeting the PNPLA3 gene and the second RNAi construct targeting a different gene, for example, the SCAP gene, may be administered as part of the same pharmaceutical composition. Alternatively, the first RNAi construct targeting the PNPLA3 gene and the second RNAi construct targeting a different gene, for example, the SCAP gene, may be administered as part of different pharmaceutical compositions.

[0158] The RNAi construct and additional therapeutic agent and / or treatment may be administered simultaneously and / or in the same combination, e.g., parenterally, or the additional therapeutic agent may be administered as part of a separate composition or separately, and / or by other methods known in the art or described herein.

[0159] The present disclosure also provides a method of using an RNAi construct and / or a composition comprising an RNAi construct to reduce and / or inhibit PNPLA3 expression (gene or protein expression) in a cell. In yet another aspect, the present disclosure provides a use of an RNAi and / or a composition comprising an RNAi for the manufacture of a medicament for reducing and / or inhibiting PNPLA3 gene expression in a cell. In yet another aspect, the present disclosure provides a composition comprising an RNAi as described herein and / or an RNAi construct as described herein for use in reducing and / or inhibiting PNPLA3 protein production in a cell. In yet another aspect, the present disclosure provides a use of an RNAi construct and / or a composition comprising an RNAi construct for the manufacture of a medicament for reducing and / or inhibiting PNPLA3 protein production in a cell. The method and use include contacting a cell with an RNAi construct, such as dsRNA, and maintaining the cell for a sufficient time to obtain degradation of the mRNA transcript of the PNPLA3 gene, thereby inhibiting the expression of the PNPLA3 gene or inhibiting PNPLA3 protein production in the cell. Reduction of gene expression can be assessed by any method known in the art or described herein for determining mRNA or protein levels.

[0160] In the methods and uses described herein, the cells may be contacted in vitro or in vivo, i.e., the cells may be outside the subject (e.g., in cell culture) or within the subject. The cells suitable for treatment using the methods described herein may be any cell that expresses the PNPLA3 gene, such as a cell from a subject with NAFLD, or a cell that contains an expression vector that contains the PNPLA3 gene or a portion of the PNPLA3 gene. Suitable cells for use in the methods of the present disclosure include, for example, mammalian cells, such as primate cells (human cells or non-human primate cells, such as monkey cells or chimpanzee cells), non-primate cells (such as cow cells, pig cells, camel cells, llama cells, horse cells, goat cells, rabbit cells, sheep cells, hamster cells, guinea pig cells, cat cells, dog cells, rat cells, mouse cells, lion cells, tiger cells, bear cells or buffalo cells), avian cells (e.g., duck cells or goose cells) or whale cells. In one embodiment, the cell is a human cell.

[0161] PNPLA3 gene expression is at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 108%, 109%, 109%, 109%, 109%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% inhibition.

[0162] PNPLA3 protein production is at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 109%, 108%. The expression level may be inhibited by 1%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100%.

[0163] The in vivo method and use described herein may comprise administering to a subject a composition containing an RNAi construct, the RNAi construct comprising a nucleotide sequence complementary to at least a portion of the RNA transcript of the PNPLA3 gene of the subject.When the organism to be treated is a human, the composition may be administered by any means known in the art, including but not limited to subcutaneous, intravenous, oral, intraperitoneal or intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (spray), nasal, parenteral routes including rectal, and topical (including buccal and sublingual) administration.In certain embodiments, the composition is administered by subcutaneous or intravenous infusion or injection.In one embodiment, the composition is administered by subcutaneous injection.

[0164] In some embodiments, administration is by depot injection. Depot injection can consistently release RNAi constructs over a long period of time. Thus, depot injection can reduce the frequency of administration required to obtain desired effect, for example, desired inhibition of PNPLA3, or therapeutic or prophylactic effect. Depot injection can also provide more consistent serum concentration. Depot injection can include subcutaneous injection or intramuscular injection. In some embodiments, depot injection is subcutaneous injection.

[0165] In some embodiments, administration is via a pump. The pump can be an external pump or a surgically implanted pump. In certain embodiments, the pump is an osmotic pump that is subcutaneously implanted. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial or epidural infusion. In a preferred embodiment, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers RNAi to a subject.

[0166] The mode of administration can be selected based on whether local or systemic treatment is desired and based on the area to be treated. The route and site of administration can be selected to enhance targeting.

[0167] The method and use include administering to a mammal, for example, a human, a composition comprising an RNAi construct, for example, an siRNA targeting the PNPLA3 gene in a cell of the mammal, and maintaining the mammal for a sufficient time to obtain degradation of the mRNA transcript of the PNPLA3 gene, thereby inhibiting the expression of the PNPLA3 gene in the mammal. The reduction of gene expression and / or protein expression can be evaluated in a sample obtained from a subject administered the RNAi construct by any method known in the art or described herein. In one embodiment, a tissue sample serves as tissue material for monitoring the reduction of the PNPLA3 gene and / or protein expression. In another embodiment, a blood sample serves as tissue material for monitoring the reduction of the PNPLA3 gene and / or protein expression.

[0168] In some embodiments, validation of RISC-mediated cleavage of a target mRNA (e.g., PNPLA3 mRNA) in vivo following administration of an RNAi construct can be assessed by performing 5'-RACE or modifications of protocols known in the art (Lasham A et al., (2010) Nucleic Acid Res., 38(3)p-el9; and Zimmermann et al. (2006) Nature 441:111-4).

[0169] It is understood that all ribonucleic acid sequences disclosed herein can be converted to deoxyribonucleic acid sequences by substituting uracil bases in the sequence with thymine bases.Similarly, all deoxyribonucleic acid sequences disclosed herein can be converted to ribonucleic acid sequences by substituting uracil bases in the sequence with thymine bases.Deoxyribonucleic acid sequences, ribonucleic acid sequences, and sequences containing mixtures of deoxyribonucleotides and ribonucleotides of all sequences disclosed herein are encompassed by the present disclosure.

[0170] In addition, any nucleic acid sequence disclosed herein may be modified by any combination of chemical modifications. Those skilled in the art will readily understand that in certain cases, such designations of "RNA" or "DNA" to describe modified polynucleotides are arbitrary. For example, a polynucleotide that includes nucleotides with 2'-OH substituents on the ribose sugar and thymine bases may be described as a DNA molecule with modified sugars (2'-OH as opposed to the natural 2'-H of DNA) or an RNA molecule with modified bases (thymine (methylated uracil) as opposed to the natural uracil of RNA).

[0171] Thus, the nucleic acid sequences provided herein, including but not limited to those set forth in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleic acid bases. As a further example, and not by way of limitation, a polynucleotide having the sequence "ATCGATCG" encompasses any polynucleotide having such a sequence, including but not limited to such compounds including RNA bases, whether modified or unmodified, such as those having the sequence "AUCGAUCG", as well as those with some DNA and RNA bases such as "AUCGATCG", and polynucleotides with other modified bases such as "ATmeCGAUCG", in which meC denotes a cytosine base with a methyl group at the 5-position.

[0172] The following examples, including the experiments conducted and results achieved, are provided for illustrative purposes only and should not be construed as limiting the scope of the appended claims. EXAMPLES

[0173] All animal studies described herein were approved by Amgen's Institutional Animal Care and Use Committee (IACUC) and were maintained in accordance with the Guide for the Care and Use of Laboratory Animals, 8th Edition (National Research Council (US)), Committee for Update of the Guide for the Care and Use of Laboratory Animals, Institute for Laboratory Animal Research (US) and National Academies Press (US) (2011) Guide for the care and use of laboratory animals. 8th Ed., National Academies Press, Washington, DC. Mice were housed singly in an air-conditioned space at 22 ± 2 °C with a 12-h light; 12-h dark cycle (0600-1800 h). Animals were fed a regular chow diet (Envigo, 2920X, or diets specified otherwise) and water (reverse osmosis purified) ad libitum through an automated watering system unless otherwise indicated. At termination, blood was collected by cardiac puncture under deep anesthesia and animals were then euthanized by secondary physical methods in accordance with Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) guidelines.

[0174] Example 1: Selection, design and synthesis of modified PNPLA3 siRNA molecules Identification and selection of optimal sequences for therapeutic siRNA molecules targeting patatin-like phospholipase domain-containing 3 (PNPLA3) was confirmed using bioinformatics analysis of the human PNPLA3 transcript (GenBank Accession No. NM_025225.2). Bioinformatics analysis identified over 450 suitable human / cynomolgus triggers throughout the PNPLA3 transcript and revealed approximately 4,500 bp of extended 3'UTR that have yet to be explored. Table 1 lists the PNPLA3 mRNA target sequences identified as having therapeutic properties.

[0175] Over 600 siRNA molecules directed against the sequences listed in Table 1 were synthesized and these sequences were modified to contain a single chemical modification that improved the potency and in vivo stability of the PNPLA3 siRNA sequences. The sense and antisense sequences for each of the unmodified and modified PNPLA3 siRNAs are shown in Figures 1 and 2.

[0176] A panel of 194 siRNA molecules (or "triggers") selective for human and cynomolgus monkey (human / cyno) PNPLA3 spanning the coding regions (CDRs) and annotated 3'UTRs was created, along with an additional 162 human / cyno triggers and 64 human / marmoset triggers targeting the extended 3'UTR. Human-only triggers targeting the coding region were also created.

[0177] Example 2: Efficacy of selected PNPLA3 siRNA molecules in an RNA FISH assay The siRNA molecules synthesized in Example 1 with a single modification pattern (shown in FIG. 1 ) showed IC 50and screened in a fluorescence in situ hybridization assay targeting ribonucleic acid molecules (RNA FISH) to determine maximum activity values. HepG2 cells (purchased from ATCC) were cultured in minimal essential medium EMEM (ATCC) supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% penicillin-streptomycin (PS, Corning).

[0178] siRNA transfection was performed as follows: 1 mL of test siRNA and 4 mL of plain EMEM were added to a PDL-coated CellCarrier-384 Ultra assay plate (PerkinElmer) by Bravo automated liquid handling (Agilent). 5 mL of Lipofectamine RNAiMAX (Thermo Fisher Scientific) pre-diluted in EMEM (specifically, 0.06 mL of RNAiMAX in 5 mL of EMEM) was then dispensed into the assay plate by a Multidrop Combi reagent dispenser (Thermo Fisher Scientific). After 20 min incubation of the siRNA / RNAiMAX mixture at room temperature (RT), 30 mL of HepG2 cells (2000 cells per well) in EMEM supplemented with 10% FBS and 1% PS were added to the transfection complex using the Multidrop Combi reagent dispenser. The assay plate was incubated for 20 min at RT before being placed in an incubator. The cells were then incubated at 37°C and 5% CO 2 The mixture was incubated at RT for 72 hours.

[0179] RNA FISH assays were performed using the Affymetrix QUANTIGENE® View RNA HC Screening Assay Kit (QVP0011), the Affymetrix View HC Signal Amplification Kit 3-plex (QVP0213), and the Affymetrix gene-specific probes: human PNPLA3 (VA6-20279-01) and human PPIB (VA1-10148-01) according to the manufacturer's protocol using an in-house built automated FISH assay platform for liquid handling.

[0180] Briefly, cells were fixed in 4% formaldehyde (Thermo Fisher Scientific) for 15 min at RT, permeabilized with detergent for 3 min at RT, followed by treatment with protease solution for 10 min at RT. Incubation of the PNPLA3 and PPIB probe pairs was carried out for 3 h, while preamplifier, amplifier, and labeling probes were carried out for 1 h each. All hybridization steps were carried out at 40°C in a Cytomat 2 C-LIN automated incubator (Thermo Fisher Scientific). After the hybridization reaction, cells were stained with Hoechst and CellMask Blue (Thermo Fisher Scientific) for 30 min.

[0181] All plates were imaged on an Opera Phenix high content screening system (PerkinElmer) using the UV channel for Hoechst 33342 and Cell Mask Blue, the 488 channel for the PPIB probe, and the 647 channel for the PNPLA3 probe.

[0182] Images were analyzed using a Columbus Image Data Storage and Analysis System (PerkinElmer) to obtain the average number of spots per cell. Spot numbers were normalized using high (containing phosphate-buffered saline, Corning) and low (no target probe pair) control wells. Normalized values ​​were plotted against total siRNA concentration and data were fitted to a four-parameter sigmoidal model in Genedata Screener (Genedata) to obtain IC 50 and maximum activity was obtained. Results for all siRNAs generated are shown in Table 2. Results for a panel of 194 human / cyno siRNA molecules bridging the PNPLA3 CDRs and annotated 3'UTR are shown in Table 3. Results for 162 human / cyno siRNA molecules targeting the extended 3'UTR are shown in Table 4, and results for a panel of 64 human / marmoset siRNA molecules are shown in Table 5.

[0183] PNPLA3 knockdown provides the percentage of knockdown compared to control. Negative values ​​indicate a reduction in PNPLA3 levels. 22 siRNA triggers achieved >75% mRNA knockdown. In comparison, a small number of allele-specific siRNAs directed to PNPLA3 I148M (described in WO2020 / 123508) reduce PNPLA3 mRNA expression by approximately 81%. The top 48 triggers were synthesized as GalNAc-siRNA conjugates.

[0184] [Table 2-1]

[0185] [Table 2-2]

[0186] [Table 2-3]

[0187]

Table 2-4

[0188]

Table 2-5

[0189]

Table 2-6

[0190]

Table 2-7

[0191]

Table 2-8

[0192]

Table 2-9

[0193]

Table 2-10

[0194]

Table 2-11

[0195]

Table 2-12

[0196]

Table 2-13

[0197]

Table 2-14

[0198]

Table 2-15

[0199]

Table 2-16

[0200]

Table 3-1

[0201]

Table 3-2

[0202]

Table 3-3

[0203]

Table 3-4

[0204]

Table 3-5

[0205]

Table 4-1

[0206]

Table 4-2

[0207] [Table 4-3]

[0208] [Table 4-4]

[0209] [Table 5-1]

[0210] [Table 5-2]

[0211] [Table 5-3]

[0212] Example 3: Efficacy screening of selected PNPLA3 siRNA molecules in an AAV-based mouse model containing the human PNPLA3 sequence Adeno-associated adenovirus (AAV; serotype AAVDJ8; endotoxin-free, prepared in-house by Amgen) diluted in phosphate-buffered saline (Thermo Fisher Scientific, 14190-136) was administered at 1 × 10 per animal. 12 The viral particles were administered into the tail vein of C57BL / 6NCrl male or female mice (Charles River Laboratories Inc.) to drive expression of the human PNPLA3 sequence in the liver. Four AAV constructs were designed from the ENST00000216180.7 PNPLA3 transcript for in vivo screening; one was designed to encode the PNPLA3 rs738409-rs738408Three AAV constructs contained full-length coding sequences for the AAV-CDS and three were enhanced green fluorescent protein (eGFP) reporter constructs containing a stretch of 3' untranslated region (nucleotides (nt) 1620-3410 (AAV-A), nt 3310-5100 (AAV-B), and nt 5000-6689 (AAV-C)). Each AAV construct also contained a benchmark sequence for comparing siRNA-mediated knockdown efficacy across AAVs and studies.

[0213] The GalNAc-conjugated siRNA shown in Figure 2 is PNPLA3 rs738409-rs738408, AAV-A, AAV-B or AAV-C. Figure 2 also shows unmodified versions of these siRNA sequences. Two weeks after AAV injection, mice (generally 8-12 weeks old and n=3-4 per group) were treated with a single dose of siRNA by subcutaneous injection at 0.5, 1.0, or 3.0 milligrams per kilogram of animal diluted in phosphate-buffered saline (Thermo Fisher Scientific, 14190-136). Twenty-eight days after siRNA injection, animals were euthanized and livers were harvested from animals and snap frozen in liquid nitrogen. A portion of the liver was processed for purified RNA using a QIACube Classic instrument (Qiagen, 9001292) and RNeasy Mini kit (Qiagen, 74106) according to the manufacturer's instructions. Samples were analyzed using a NanoDrop™ 8000 spectrophotometer (Thermo Scientific, ND-8000-GL). RNA was treated with RQ1 RNase-free DNase (Promega, M6101) and prepared for real-time qPCR using the TAQMAN™ RNA-to-CT™ 1-Step Kit (Applied Biosystems, 4392656). Real-time qPCR was performed on a QuantStudio real-time PCR instrument.Results showed that the GFP-binding domains of human PNPLA3 (Invitrogen, hs00228747_m1), GFP1 (IDT custom assay: forward primer: CTATGTGCAGGAGAGAACCATC (sense; SEQ ID NO: 3589), reverse primer: GCCCTTCAGCTCGATTCTATT (antisense; SEQ ID NO: 3590), probe: 5'-6FAM-TACAAGACCCGCGCTGAAGTCAAG TAMRA-3' (sense; SEQ ID NO: 3591)), GFP2 (IDT custom assay: forward primer: TCATCTGCACCACTGGAAAG (sense; SEQ ID NO: 3592), reverse primer: CTGCTTCATATGGTCTGGGTATC (antisense; SEQ ID NO: 3593), probe: 5'-6FAM CCAACACTGGTCACTACCCTCACC Polyadenylation of TAMRA-3' (sense; SEQ ID NO: 3594) and / or bovine growth hormone (BghpA, included in each AAV construct; IDT custom assay: forward: 5'-GCCAGCCATCTGTTGT-3' (SEQ ID NO: 3595), reverse: 5'-GGAGTGGCACCTTCCA-3' (SEQ ID NO: 3596), probe: 5'-6FAM-TCCCCCGTGCCTTCCTTGACC TAMRA-3' (SEQ ID NO: 3597) gene expression and normalized to mouse TATA-binding protein (Tbp) (IDT, Hex Mm.PT.39a.22214839). Figures are shown as relative percent knockdown of human PNPLA3, GFP, and / or BghpA mRNA expression normalized to mouse Tbp compared to vehicle-treated control animals. For some groups, another portion of flash-frozen liver was incubated with 1xHALT™ protease and phosphatase inhibitor cocktail (Thermo The tissue was homogenized in Pierce IP buffer (Thermo Scientific, 87787) containing 100 mM NaCl (Millipore, 78441) to produce 50 mg tissue / ml lysis buffer. Protein concentration was determined using a DIRECT DETECT™ infrared spectrometer (Millipore).GFP protein analysis was performed on a PEGY SUE™ Simple Western System (Protein Simple, 004-800) using a 12-230 kDa PEGGY SUE or SALLY SUE separation module (Protein Simple, SM-S001), or a WES™ Simple Western System (Protein Simple, 004-600) using a 12-230 kDa Jess or Wes separation module, 8x25 capillary cartridge (Protein Simple, SM-W004). All β-actin protein detection was performed using the WES™ Simple Western System and components. The results of these experiments are shown in Figure 3 (AAV-CDS) and Figure 4 (AAV-A, AAV-B, and AAV-C).

[0214] To assess the relative percent knockdown of endogenous levels of human PNPLA3 transcripts by PNPLA3 siRNA molecules, homozygous hPNPLA3 I148M Knock-in (hPNPLA3 I148M A mouse model was used (developed by Amgen; colony maintained at Charles River Laboratories, Inc.). In this model, the wild-type mouse Pnpla3 gene was transfected with the human PNPLA3 I148M The full-length coding region of the gene was replaced, while the mouse transcriptionally regulated promoter region was utilized to drive expression.

[0215] Typically, single-housed male hPNPLA3 mice aged 8-10 weeks were I148MKI mice were maintained on an ad libitum standard chow diet until the start of the study, at which point they were converted to a modified rodent obese diet supplemented with hydrogenated vegetable oil, added fructose, and enriched with 0.2% cholesterol (Envigo, TD.190883 or TD.200212; the latter is an irradiated version of the former). After 2 weeks on the diet, body weights were recorded and mice were randomized into groups of 5-6 mice based on uniform body weight distribution. Mice were subcutaneously injected with a single dose of PNPLA3 siRNA molecules at 1 or 3 mg / kg animal diluted in phosphate buffered saline (Thermo Fisher Scientific, 14190-136) or saline alone. After 28 days of treatment, mice were euthanized and livers were harvested from animals and snap frozen in liquid nitrogen. Part of the liver was processed for purified RNA and for some groups, part was processed for protein analysis.

[0216] Due to the relatively low endogenous expression of PNPLA3 transcripts, mRNA analysis from KI mouse liver was prepared as described but analyzed by processing with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) and run on the QIAcuity Eight Platform Digital PCR System (Qiagen, 911056), which is more sensitive than conventional qPCR.

[0217] For targeted measurements of hPNPLA3 protein, approximately 100-200 mg of frozen liver tissue from each mouse was independently homogenized in chilled PIERCE™ IP lysis buffer (Thermo Fisher, 87787). Samples were treated with 1X PIERCE™ protease inhibitor tablets (Thermo Fisher, A32963) and BENZONASE® nuclease (Millipore-Sigma, E1014). Human PNPLA3 protein (peptide: VSDGENVLVSDFR (sequence number 3598); New England Peptide) was captured using immunoaffinity (IA) technology and anti-human PNPLA3 mAb (developed by Amgen Inc.), trypsin-digested on beads, and analyzed by liquid chromatography with tandem mass spectrometry (LC-MS / MS; Thermo Fisher, Orbitrap FUSION™ LUMOS™ TRIBRID™ mass spectrometer). Using reagent-free LC MS / MS, mouse glyceraldehyde 3-phosphate dehydrogenase (mGAPDH; peptide: LISWYDNEYGYSNR (sequence number 3599); New England Peptide), a housekeeping protein, was measured in liver tissue collected from each animal. Peptide signals across all samples were determined using LC-MS data analysis software, ANALYST® (SCIEX, v1.6.2). The results of the knock-in experiment are shown in FIG. 5.

[0218] The siRNA triggers that clustered within certain regions of the PNPLA3 coding sequence and demonstrated efficacy in vivo were selected for further investigation. Two selected siRNA molecules ("PNPLA3-T704_M1282_3G3-5'" (duplex No. 43806-1) and "PNPLA3-T706-g.1g>a_M867_3G3-5'" (duplex No. 41321-1) in Figure 5) selectively target both human and cynomolgus PNPLA3 mRNA, while the other two selected siRNA molecules ("PNPLA3(human only)-T1234_M867_3G3-5'" (duplex No. 52317-1) and "PNPLA3(human only)-T1240_M867_3G3-5'" (duplex No. 52307-1) in Figure 5) target only human PNPLA3 mRNA. The sequences of the sense and antisense strands of each of the selected siRNA molecules are listed in Table 6.

[0219] [Table 6]

[0220] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. However, the citation of a reference herein should not be construed as an admission that such reference is prior art to the present invention. To the extent that any definitions or terms provided in a reference incorporated by reference differ from the terms and discussion provided herein, the terms and definitions shall control.

[0221] The foregoing specification is believed to be sufficient to enable one skilled in the art to practice the present invention. The foregoing description and examples detail certain preferred embodiments of the present invention and set forth the best mode contemplated by the inventors. However, no matter how detailed the foregoing is, it will be understood that the present invention may be practiced in many ways and should be construed in accordance with the appended claims and their equivalents.

Claims

1. An RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region complementary to a patatin-like phospholipase domain-containing 3 (PNPLA3) mRNA sequence containing any one of SEQ ID NOs. 1 to 60, and the RNAi construct inhibits the expression of PNPLA3.

2. The RNAi construct according to claim 1, comprising a region having at least 15 consecutive nucleotides that differ from an antisense sequence selected from SEQ ID NOs. 565-1068 and SEQ ID NOs. 2329-3588 by three or fewer nucleotides.

3. The RNAi construct according to claim 1, wherein the antisense strand hybridizes to a PNPLA3 mRNA sequence containing any one of sequence numbers 1 to 60.

4. The RNAi construct according to claim 1, wherein the sense strand includes a sequence sufficiently complementary to the sequence of the antisense strand in order to form a double-stranded region of about 15 to about 30 base pairs in length.

5. The RNAi construct according to claim 4, wherein the double-stranded region is approximately 17 to approximately 24 base pairs long.

6. The RNAi construct according to claim 4, wherein the double-stranded region is approximately 19 to approximately 21 base pairs long.

7. The RNAi construct according to claim 6, wherein the double-stranded region is 19 base pairs long.

8. The RNAi construct according to claim 6, wherein the double-stranded region is 20 base pairs long.

9. The RNAi construct according to claim 6, wherein the double-stranded region is 21 base pairs long.

10. The RNAi construct according to claim 1, wherein the sense strand and the antisense strand are each about 15 to about 30 nucleotides in length.

11. The RNAi construct according to claim 10, wherein the sense strand and the antisense strand are each about 19 to about 27 nucleotides in length.

12. The RNAi construct according to claim 10, wherein the sense strand and the antisense strand are each about 20 to about 25 nucleotides in length.

13. The RNAi construct according to claim 12, wherein the sense strand and the antisense strand are each about 20 to about 23 nucleotides in length.

14. The RNAi construct according to claim 1, comprising at least one blunt end.

15. The RNAi construct according to claim 1, comprising at least one nucleotide overhang of 1 to 4 unpaired nucleotides.

16. The RNAi construct according to claim 15, wherein the nucleotide overhang has two unpaired nucleotides.

17. The RNAi construct according to claim 16, wherein the RNAi construct includes a nucleotide overhang at the 3' end of the sense strand, the 3' end of the antisense strand, or at the 3' ends of both the sense strand and the antisense strand.

18. The RNAi construct according to claim 17, wherein the nucleotide overhang comprises a 5'-UU-3' dinucleotide or a 5'-dTdT-3' dinucleotide.

19. The RNAi construct according to claim 1, wherein the RNAi construct comprises at least one modified nucleotide.

20. The RNAi construct according to claim 19, wherein the modified nucleotide is a 2'-modified nucleotide.

21. The RNAi construct according to claim 19, wherein the modified nucleotide is a 2'-fluoromodified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-O-allyl modified nucleotide, a bicyclic nucleic acid (BNA), a glycol nucleic acid, an inverted base, or a combination thereof.

22. The RNAi construct according to claim 21, wherein the modified nucleotide is a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-fluoro modified nucleotide, or a combination thereof.

23. The RNAi construct according to claim 19, wherein all of the nucleotides in the sense strand and the antisense strand are modified nucleotides.

24. The RNAi construct according to claim 23, wherein the modified nucleotide is a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, or a combination thereof.

25. The RNAi construct according to claim 1, comprising at least one phosphorothioate nucleotide interbonding.

26. The RNAi construct according to claim 25, wherein the RNAi construct includes two consecutive phosphorothioate nucleotide interbonds at the 3' end of the antisense strand.

27. The RNAi construct according to claim 25, wherein the RNAi construct includes two consecutive phosphorothioate nucleotide bonds at both the 3' and 5' ends of the antisense strand, and includes two consecutive phosphorothioate nucleotide bonds at the 5' end of the sense strand.

28. The RNAi construct according to claim 1, wherein the antisense strand includes a sequence selected from SEQ ID NOs. 565 to 1068 and SEQ ID NOs. 2329 to 3588.

29. The RNAi construct according to claim 28, wherein the sense strand includes a sequence selected from SEQ ID NOs. 61 to 564 and SEQ ID NOs. 1069 to 2328.

30. The RNAi construct according to claim 1, wherein the RNAi construct is a double-stranded compound comprising an antisense strand and a sense strand, the antisense strand comprises a sequence selected from SEQ ID NOs. 565 to 1068 and SEQ ID NOs. 2329 to 3588, and the sense strand comprises a sequence selected from SEQ ID NOs. 61 to 564 and SEQ ID NOs. 1069 to 2328.

31. a. An antisense strand containing Sequence ID No. 594 and a sense strand containing Sequence ID No. 90; b. An antisense strand containing Sequence ID No. 846 and a sense strand containing Sequence ID No. 342; c. An antisense strand containing Sequence ID No. 655 and a sense strand containing Sequence ID No. 151; d. An antisense strand containing Sequence ID 907 and a sense strand containing Sequence ID 403; e. An antisense strand containing Sequence ID No. 757 and a sense strand containing Sequence ID No. 253; f. An antisense strand containing Sequence ID No. 1009 and a sense strand containing Sequence ID No. 505; g. An antisense strand containing SEQ ID NO: 767 and a sense strand containing SEQ ID NO: 263; or h. Antisense strand containing Sequence ID 1019 and sense strand containing Sequence ID 515 The RNAi construct according to claim 30, comprising:

32. The RNAi construct according to any one of claims 1 to 31, wherein the RNAi construct reduces the expression level of PNPLA3 in liver cells after incubation with the RNAi construct compared to the expression level of PNPLA3 in liver cells incubated with a control RNAi construct.

33. The RNAi construct according to claim 32, wherein the liver cells are Hep3B cells or HepG2 cells.

34. The RNAi construct according to claim 33, wherein the RNAi construct inhibits at least 60% of PNPLA3 expression at 5 nM in in vitro Hep3B cells.

35. The RNAi construct according to claim 33, wherein the RNAi construct inhibits at least 60% of PNPLA3 expression at 5 nM in in vitro HepG2 cells.

36. The RNAi construct has an IC of less than approximately 1 nM. ５０ The RNAi construct according to claim 33, which inhibits PNPLA3 expression in Hep3B cells.

37. The RNAi construct has an IC of less than approximately 1 nM. ５０ The RNAi construct according to claim 33, which inhibits PNPLA3 expression in HepG2 cells.

38. The RNAi construct according to claim 1, further comprising ligands that bind to one or more proteins expressed on the surface of liver cells.

39. A composition comprising an RNAi construct according to any one of claims 1 to 31 and a pharmaceutically acceptable carrier, excipient, or diluent.

40. A composition for use in reducing PNPLA3 expression in patients in need, comprising an RNAi construct according to any one of claims 1 to 31.

41. The composition according to claim 40, wherein the expression level of PNPLA3 in hepatocytes is reduced in a patient after administration of the composition compared to the PNPLA3 expression level in a patient who has not received the composition.

42. The composition according to claim 40, wherein the patient suffers from non-alcoholic fatty liver disease (NAFLD).

43. The composition according to claim 42, wherein the patient suffers from non-alcoholic steatohepatitis (NASH).

44. A composition for use in the treatment of NAFLD, comprising an RNAi construct according to any one of claims 1 to 31.

Images