Modified U7 snRNA construct

JP2025518378A5Pending Publication Date: 2026-06-01UCL BUSINESS LTD +1

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
UCL BUSINESS LTD
Filing Date
2023-06-07
Publication Date
2026-06-01

AI Technical Summary

Technical Problem

There is a need for new therapeutic approaches to address diseases associated with TDP-43 depletion, particularly in amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), due to the inclusion of cryptic exons that lead to functional deficiencies in important disease-modifying genes.

Method used

A modified U7 snRNA construct is developed, comprising an antisense sequence that targets TDP-43-regulated cryptic exons and a binding domain for hnRNP proteins, which recruits endogenous hnRNP proteins to suppress the splicing of cryptic exons even in the absence of TDP-43.

Benefits of technology

The modified U7 snRNA construct effectively restores the functionality of genes containing TDP-43-regulated cryptic exons by suppressing their splicing, thereby addressing the functional deficiencies associated with TDP-43 depletion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000094_0000
    Figure 00000094_0000
  • Figure 00000094_0001
    Figure 00000094_0001
  • Figure 00000094_0002
    Figure 00000094_0002
Patent Text Reader

Abstract

(i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to a TDP-43-regulated cryptic exon sequence or its adjacent region, and (ii) a modified U7 snRNA construct having a sequence containing a binding domain for an hnRNP protein, more specifically the U7 smOPT construct, which is capable of changing the splicing of the TDP-43-regulated cryptic exon in cells, is described. Also described are vectors and pharmaceutical compositions containing the construct, and the construct for use in the treatment of diseases associated with TDP-43 dysfunction. Exemplary TDP-43-regulated cryptic exon sequences include the TDP-43-regulated cryptic exons in the UNC13A, STMN2, and INSR genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a modified U7 snRNA construct, and more particularly, to a U7 smOPT construct.

Background Art

[0002] Deficiency of nuclear TDP-43 is observed in a number of diseases or disorders, including more than 95% of all cases of amyotrophic lateral sclerosis (ALS) and tau-negative frontotemporal dementia (FTD). Deficiency of nuclear TDP-43 results in the inclusion of cryptic exons (CEs) that are followed by functional deficiencies of important disease-modifying genes, which is due to the absence of TDP-43 repression of these cryptic exons. TDP-43-regulated cryptic exons in both STMN2 and UNC13A have been mechanistically associated with ALS and FTD: STMN2 and UNC13A encode axonal and synaptic proteins, respectively, and are extremely important for normal nerve function. In both cases, deficiency of nuclear TDP-43 results in the incorporation of CEs during splicing, which results in depletion of full-length mRNA and reduced functional protein expression. Deficiency of nuclear TDP-43 also results in abnormal RNA processing, with STMN2 being most significantly affected. Its depletion results in impairment of axonal regeneration, which is alleviated when STMN2 levels are restored. With respect to UNC13A, human genetic evidence supports its influence in disease etiology: an intronic SNP in UNC13A is the second strongest risk factor for sporadic ALS, is associated with reduced patient survival, and has been shown to directly enhance cryptic exon inclusion.

[0003] TDP-43-regulated cryptic exons (CEs) are also known to affect a number of other transcripts with important neuronal functions. One such example is the ELAVL3 gene, which encodes a neuron-specific RNA-binding protein. The ELAVL3 CE gives rise to protein deficits reported in post-mortem neurons in ALS and causes changes in neurite maturation and maintenance. Similarly, TDP-43 deficiency induces the loss of CEs and a resulting loss of another neuron-specific RNA-binding protein, CELF5, the loss of which is known to cause motor neuron degeneration in model systems. CEs are also seen in INSR transcripts, resulting in their reduction, thereby emerging insulin signaling as an important pathway for neuronal health and maintenance. SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0004] Therefore, there is a need to further understand and, without limitation, generate new therapeutic approaches for reducing diseases associated with TDP pathologies, including neurodegeneration, particularly in ALS / FTD, due to TDP-43 depletion in disease. MEANS FOR SOLVING THE PROBLEMS

[0005] According to a first aspect of the present invention, the following sequences: (i) an antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to a TDP-43-regulated cryptic exon sequence or its flanking region, and (ii) a sequence containing a binding domain for an hnRNP protein A modified U7 snRNA construct is provided that includes, and is capable of modulating the splicing of a TDP-43 regulated cryptic exon in a cell. In some embodiments, the flanking regions described herein can be defined as 150 nucleotides upstream and downstream of the TDP-43 regulated cryptic exon. In some embodiments, the cryptic exon sequence or its flanking regions can be defined by a defined sequence (e.g., SEQ ID NO: 1, 2, 3, 4, 7, or 9) for a particular TDP-43 cryptic exon. In some embodiments, the sequence containing the binding domain for the hnRNP protein includes a binding domain for the hnRNP A or hnRNP H protein, as can be defined herein.

[0006] The antisense sequence directs the construct to the TDP-43 regulated cryptic exon sequence or its flanking regions, and the sequence containing the binding domain for the hnRNP is capable of recruiting hnRNP proteins in the cell, more particularly endogenous hnRNP proteins, to the pre-mRNA containing the cryptic exon. Importantly, the binding of the hnRNP protein functions to suppress the splicing of the cryptic exon even in the absence of TDP-43 binding or in cells depleted of TDP-43, whereby the cryptic exon is at least partially excluded from the mature RNA of the cellular transcript. This restores the functionality of genes containing the TDP-43 regulated cryptic exon, for example, in cells depleted of TDP-43. Thus, the constructs herein can be used to further investigate, understand, or treat diseases or disorders characterized by TDP-43 dysfunction or pathology.

[0007] According to a second aspect of the invention, a vector is provided that comprises or encodes the modified U7 snRNA construct of the first aspect. In some embodiments, the vector is a viral vector.

[0008] According to a third aspect of the present invention, there is provided a pharmaceutical composition comprising one or more of the constructs according to the first aspect and / or one or more of the vectors according to the second aspect.

[0009] According to a fourth aspect of the present invention, there is provided a construct of the first aspect, a vector of the second aspect or a pharmaceutical composition of the third aspect for use in therapy. Also disclosed herein is a construct of the first aspect, a vector of the second aspect or a pharmaceutical composition of the third aspect for use as a medicament, for use in the manufacture of a medicament, or for use in a method of treatment (e.g., of a neurodegenerative or muscular disease or disorder).

[0010] According to a fifth aspect of the present invention, there is provided a construct of the first aspect, a vector of the second aspect, or a pharmaceutical composition of the third aspect for use in the treatment of a disease characterized by TDP-43 dysfunction. In some embodiments, the disease is a neurodegenerative disease or a muscular disease. In some embodiments, the disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), inclusion body myositis or myopathy (IBM), Alzheimer's disease, FOSMNN (facio-onset sensory and motor neuronopathy), Perry syndrome, limbic-predominant age-related TDP-43 encephalopathy (LATE), or combinations thereof.

[0011] According to a sixth aspect of the present invention, there is provided a method of altering the splicing of a TDP-43-regulated cryptic exon, the method comprising delivering to a cell a construct of the first aspect, a vector of the second aspect, or a pharmaceutical composition of the third aspect, the method comprising contacting the construct with the cell to alter the splicing of the TDP-43-regulated cryptic exon in the cell.

[0012] According to a sixth aspect of the present invention, there is provided a composite vector comprising two or more of the constructs described herein or of the constructs of the first aspect of the present invention (i.e., in tandem or one downstream of the other, whereby the composite vector comprises at least two constructs each comprising one antisense sequence as defined herein and each comprising a sequence comprising a binding domain for an hnRNP protein as defined herein). In a preferred embodiment, the two or more modified U7 snRNA constructs are capable of binding to different TDP-43-regulated cryptic exons described herein (i.e., they are at least 90%, or at least 95%, or 100% complementary to the cryptic exons) and comprise different antisense sequences. In some embodiments, the composite vector can comprise three or more constructs as defined herein. In some embodiments, the composite construct comprises two or more antisense sequences that are complementary (i.e., at least 90% complementary, or at least 95% complementary, or 100% complementary) to two or more TDP-43-regulated cryptic exon sequences or adjacent regions thereof. In some embodiments, the TDP-43-regulated cryptic exon is selected from one of the TDP-43-regulated cryptic exons defined herein. In some embodiments, each antisense sequence is a sequence that is complementary (i.e., 90%, 95% or 100% complementary) to SEQ ID NO: 1, 2, 3, 4, 7, 9, or 448-453. In some embodiments, at least one of the antisense sequences, or each antisense sequence, is complementary to the TDP-43 binding region of the TDP-43-regulated cryptic exon, and preferably at this time, at least one of the antisense sequences, or each antisense sequence, is complementary (i.e., 90%, 95% or 100% complementary) to SEQ ID NO: 12, 23-26 or 32.In some embodiments, the composite vector comprises a construct as defined herein comprising an antisense sequence that is at least 90% complementary to the UNC13A TDP-43-regulated cryptic exon or an adjacent region thereof and a construct as defined herein comprising an antisense sequence that is at least 90% complementary to the STMN2 TDP-43-regulated cryptic exon or an adjacent region thereof. In some embodiments, the composite vector comprises a construct as defined herein comprising an antisense sequence that is at least 90% complementary to the UNC13A TDP-43-regulated cryptic exon or an adjacent region thereof and a construct as defined herein comprising an antisense sequence that is at least 90% (or 95% or 100%) complementary to the INSR TDP-43-regulated cryptic exon or an adjacent region thereof. In some embodiments, the composite vector comprises a construct as defined herein comprising an antisense sequence that is at least 90% (or 95% or 100%) complementary to the STMN2 TDP-43-regulated cryptic exon or an adjacent region thereof and a construct as defined herein comprising an antisense sequence that is at least 90% (or 95% or 100%) complementary to the INSR TDP-43-regulated cryptic exon or an adjacent region thereof. In some embodiments, the composite vector comprises a construct comprising an antisense sequence that is at least 90% (or 95% or 100%) complementary to the UNC13A TDP-43-regulated cryptic exon or an adjacent region thereof, a construct comprising an antisense sequence that is at least 90% (or 95% or 100%) complementary to the STMN2 TDP-43-regulated cryptic exon or an adjacent region thereof, and a construct comprising an antisense sequence that is at least 90% (or 95% or 100%) complementary to the INSR TDP-43-regulated cryptic exon or an adjacent region thereof.

[0013] In some embodiments, the composite vector comprises two or more constructs as defined herein, wherein two or more sequences comprising a binding domain for an hnRNP protein can follow any of the sequences as described herein. In some embodiments, two or more sequences comprising a binding domain for an hnRNP protein can be different or identical. In some embodiments, two or more sequences comprising a binding domain for an hnRNP protein can be a binding domain for an hnRNP A or hnRNP H protein, and in some instances, an hnRNP A protein.

[0014] In some embodiments, the composite vector comprises two or more promoter sequences, wherein the two or more promoter sequences are upstream of each construct. The promoter can be any promoter sequence used in the art. In some embodiments, each of the two or more promoter sequences is the same or different. In some embodiments, the composite vector comprises two or more 3' box sequences, wherein the two or more 3' box sequences are downstream of each construct. The 3' box sequences can be the same or different and can be any 3' box sequence used in the art.

[0015] In some embodiments, the composite vector comprises two or more U7 cassettes, wherein each cassette comprises a promoter, a modified U7 snRNA construct as defined herein, and a 3' box sequence, wherein the promoter is upstream of the modified U7 snRNA construct and the 3' box sequence is downstream of the modified U7 snRNA construct. In some embodiments, the composite vector comprises a stuffer sequence between each of the two or more U7 cassettes. The stuffer sequence functions to separate two promoters. The stuffer sequence can be any suitable stuffer sequence used in the art.

[0016] In some embodiments, the composite vector comprises at least (from upstream to downstream): a first promoter, a first modified U7 modified RNA construct as defined herein, a first 3' box sequence, a stuffer sequence, a second promoter, a second modified U7 modified RNA construct as defined herein, and a second 3' box sequence comprising.

[0017] The inventors have developed tools that can target TDP-43-regulated cryptic exons and alter their aberrant cryptic splicing in cells (e.g., upon depletion of TDP-43). Alteration of splicing means that the splicing of the cryptic exon is at least partially suppressed, which in turn means that the inclusion of the TDP-43-regulated cryptic exon in the mature RNA is at least partially prevented, resulting in the formation of a properly spliced mature RNA transcript that can be translated into a fully functional protein. Thus, this restores the production of the functional protein encoded by the gene containing the TDP-43-regulated cryptic exon.

[0018] There are a number of TDP-43-regulated cryptic exons that are abnormally spliced upon depletion of TDP-43 in the nucleus. TDP-43 depletion is associated with a number of diseases including neurodegenerative and muscular diseases such as ALS and FTD, as described in the background section of the present application. The TDP-43-regulated cryptic exons are characterized by any TDP-43 binding region either within or in the vicinity of the cryptic exon (i.e., in the flanking regions of the cryptic exon), and the TDP-43 binding region is typically UG-rich. During normal splicing (i.e., in healthy cells), the transcriptional repressor protein TDP-43 binds to the TDP-43 binding domain and suppresses the splicing of the cryptic exon; this has the effect that the cryptic exon is not included in the mature mRNA of the transcript and a functional protein is produced. However, depletion of TDP-43 from the cell nucleus means that the cryptic exon sequence is abnormally spliced; this has the effect that the cryptic exon is included in the mature mRNA of the transcript, which means that a functional protein is not produced.

[0019] The constructs, vectors, and pharmaceutical compositions disclosed herein can, importantly, be used to at least partially restore proper splicing, or in some instances substantially completely or completely restore proper splicing, in the absence of TDP-43. The U7 constructs disclosed herein contain both (i) an antisense sequence that directs the binding of the U7 snRNP to a target cryptic exon (i.e., present in the pre-mRNA) and (ii) an hnRNP binding sequence for the recruitment of endogenous hnRNP proteins. The tethering of hnRNP serves as an alternative to the loss of TDP-43 and enables at least partial abrogation of cryptic splicing events. This restores “normal” protein production that occurs in healthy cells (i.e., without dysfunctional TDP-43 depletion). Since hnRNP is ubiquitously expressed, this approach is particularly effective because the constructs can be used in all cells that express it. It is particularly surprising that the tethering and recruitment of hnRNP proteins can serve as an alternative to the loss of TDP-43 function in the suppression of almost completely cryptic exons. Such effects have been found to be more pronounced and most effective with endogenously highly expressed proteins such as hnRNP A1, and hnRNP H also shows good potency.

[0020] To the knowledge of the inventors, there is no modified U7 snRNA construct in the prior art that targets TDP-43-regulated cryptic exons, and it was not expected that mobilizing hnRNP A1 protein to TDP-43-regulated cryptic exons (i.e., in pre-mRNAs) using a U7 construct would be sufficient to rescue the loss of TDP-43 binding in TDP-43-depleted cells, assuming broad binding of TDP-43 in and across repressed cryptic exons. Other modified U7 constructs have been previously used in gene therapy, but such constructs have different targets and different mechanisms of action. Instead, prior art modified U7 snRNA constructs are not constructs used to rescue splicing of cryptic exons, much less TDP-43-regulated cryptic exons, but rather aim to target standard constitutive exons or constitutive exons that are selectively spliced due to mutations in DNA. The difference is that TDP-43-regulated cryptic exons are unconserved intronic sequences that are erroneously included in mature RNA in cells depleted of TDP-43. These are different from typical constitutive exons that are instead expected to be included in mature RNA. Thus, previous U7-modified constructs had different purposes for promoting exon inclusion and reducing gene expression of various genes. This is different from the constructs of the present invention that suppress splicing of cryptic exons to restore expression of TDP-43-regulated genes rather than the other way around. Prior art constructs also have completely different targets and thus completely different uses. Prior art constructs have not been used to correct TDP-43-regulated cryptic exons and rescue proper splicing of genes that are depleted in cells (e.g., due to TDP-43 pathology).

[0021] The constructs according to the present invention may be referred to as "dual-functional constructs". This "dual-functional" approach provides a modified U7 snRNA construct that includes both (i) an antisense sequence that binds to a TDP-43-regulated cryptic exon or an adjacent region thereof, and (ii) a binding sequence for an hnRNP protein to recruit endogenous hnRNPs. This has been demonstrated to be more effective than similar U7 snRNA constructs that contain only the antisense sequence (i.e., in the absence of the hnRNP-binding sequence, which may sometimes be referred to herein as a "single" target construct). The design and approach of the present invention also allows for greater flexibility since the antisense sequence need not be limited to targeting core splice elements (e.g., splice sites) for re-incorporating splicing suppression. Indeed, the exemplary constructs described herein have been found to effectively correct splicing despite containing antisense sequences that target different regions of the TDP-43-regulated cryptic exon. In some examples, the antisense sequence binds to the TDP-43-binding region of the TDP-43-regulated cryptic exon while correcting splicing. Since TDP-43 has a repressive role in healthy cells and prevents the splicing machinery from recognizing the cryptic exon, constructs that include an antisense sequence that targets the TDP-43-binding region function to provide steric hindrance within this region, which contributes to blocking cryptic splicing. In alternative examples, the antisense sequence binds to the splice site of the TDP-43-regulated cryptic exon while correcting splicing. Constructs that include an antisense sequence that targets the splice site mean that the splice site is masked and less available for splicing by the intracellular splicing machinery. Furthermore, it has also been demonstrated that proper splicing is restored when the antisense sequence binds to an exonic splicing enhancer located within the TDP-43-regulated cryptic exon (i.e., as identified by ESE finder 3.0). Since ESEs are motifs within cryptic exon sequences that promote or enhance splicing, blocking these motifs prevents cryptic splicing of the cryptic exon sequence.The inventors demonstrate that the constructs can target a wide range of different target sequences within the TDP-43 regulated cryptic exons and their adjacent regions while still being effective in correcting splicing. Furthermore, the inventors demonstrate that this approach can be used to effectively correct, at least in part, the splicing of various TDP-43 regulated cryptic exons.

[0022] There are also no previous examples of U7 constructs aimed at targeting and properly splicing TDP-43 regulated cryptic exons that contain both an antisense sequence targeting the TDP-43 regulated exon and a binding domain for an hnRNP protein. Importantly, unlike previous approaches, the binding domain for the hnRNP protein is not the same as the one that TDP-43 normally has in "healthy cells". Suppress The aim is to recruit hnRNP proteins to replace the function (e.g., in cells depleted of TDP-43). Previous U7 constructs have been described that combine antisense sequences with binding sequences for proteins, but they have been used against different gene targets. Additional U7 constructs in the prior art have a different purpose, namely to promote the inclusion of constitutive exons in the resulting mRNA (e.g., due to mutations in genes that alter splicing), rather than to suppress the inclusion of hidden exons, much less TDP-43-regulated hidden exons, in the resulting mRNA. Finally, in some instances, other U7 constructs in the art have instead been aimed at recruiting exonic splicing enhancers, such as SR proteins. SR proteins have an opposite effect to the recruitment of hnRNP proteins as described in the present invention, since hnRNP proteins have a rather repressive effect.

[0023] The main advantage of using the modified U7 snRNA approach is that the snRNP remains naturally in the nucleus where cryptic exon splicing occurs. This results in the localization of the antisense containing U7 snRNA in the cellular compartment where splicing needs to be corrected. The use of the antisense sequence in the snRNP also provides an enhancement of the stability of the resulting RNA-protein complex containing the pre-mRNA (i.e., containing the cryptic exon).

[0024] Another advantage is that the modified U7 snRNA can be packaged into vectors such as viral vectors that enable long-term production of gene therapy after a single injection. This allows cells to generate their own therapeutic molecules as a single-dose gene therapy and is thus improved when compared to the ASO approach. These constructs also provide a more stable therapeutic approach when compared to ASO targeting that is more sensitive to degradation. Small-scale delivery of the U7-expressing gene also enables their delivery in combination with other antisense or auxiliary gene constructs in a single viral vector or ITR cassette. Finally, the larger size of the modified U7 snRNA constructs when compared to the ASO approach has led to the hypothesis that in some cases it may be more effective in splicing correction due to steric effects; this is because the construct can also provide a more effective steric hindrance that contributes to the suppression of cryptic splicing events.

[0025] As aspects of the invention have been demonstrated to at least partially correct the splicing of the TDP-43-regulated cryptic exon, aspects of the invention can therefore be used to investigate the role of TDP-43 pathology and / or TDP-43 pathology in disease. For example, since TDP-43 clearance occurs in over 95% of ALS cases, this approach is applicable and beneficial to the majority of ALS patients.

[0026] The inventors have also uniquely demonstrated that vectors containing two or more of the constructs of the present invention (i.e., in tandem or sequentially with each other) suppress TDP-43 cryptic exon inclusion in various genes. Different from any prior approach, this composite construct can target and rescue splicing for multiple TDP-43-regulated cryptic exons in various genes. The composite construct showed similar suppression of three TDP-43-regulated exons, UNC13A, INSR, and STMN2, when compared to individual construct transfection. The results are unexpected considering that the composite construct contains multiple (and in some cases identical promoters), and are surprising in the context of promoter competition and promoter interference considering that three identical promoters were used to drive the expression of three different antisense sequences.

[0027] In some embodiments, the construct of the present invention can be used to correct the splicing of the TDP-43-regulated UNC13A cryptic exon. This cryptic exon has been found to cause UNC13A downregulation at the transcript and protein levels and is specifically detected in postmortem brain regions of patients affected by TDP-43 proteinopathies or dysfunctions, including both ALS and FTD. Furthermore, this cryptic exon has also been found to overlap with the disease-related variant rs12973192 previously identified in multiple genome-wide association studies related to ALS / FTD risk and disease malignancy. Thus, the UNC13A cryptic exon is associated with TDP pathology and disease malignancy. Therefore, correction of the splicing of the UNC13A gene can be used to further understand and / or treat ALS and FTD, as well as diseases associated with SNPs (e.g., rs12973192) in the UNC13A gene.

[0028] In some embodiments, the constructs of the invention can be used to correct the splicing of the TDP-43-regulated STMN2 cryptic exon 2a. This is important considering that the loss of nuclear TDP-43 results in the incorporation of this cryptic exon during splicing, which leads to the depletion of full-length mRNA and the reduction of functional protein expression. This effect is most prominent with respect to STMN2, where abnormal RNA processing leads to impaired axonal regeneration. Thus, correction of the splicing of the STMN2 gene can be used to further understand and / or treat diseases associated with TDP-43.

[0029] Embodiments of the invention are also used to correct the splicing of the TDP-43-regulated INSR cryptic exon (between INSR exons 6 and 7). INSR CE leads to the loss of a protein that normally functions as a receptor for insulin. Insulin signaling plays an important role in neuron maintenance, and restoration of INSR levels would contribute to the improvement of neuronal homeostasis.

[0030] Embodiments of the invention are also used to correct the splicing of other TDP-43-regulated cryptic exons, such as ELAVL3 CE, G3BP1 CE, AARS1 CE, CELF5 CE, CAMK2B CE, or UNC13B CE. Prevention of cryptic splicing and restoration of these proteins are considered therapeutically beneficial. In particular, ELAVL3 CE results in changes in neurite maturation and is involved in ALS, while CELF5 CE leads to motor neuron degeneration in model systems.

[0031] (i) An antisense sequence having 16-30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence and its adjacent region in UNC13A, preferably at least 90% complementary to SEQ ID NO: 1 or 2, and (ii) A sequence comprising a binding domain for an hnRNP protein Modified U7 snRNA constructs containing the same are also described herein.

[0032] In some embodiments, the antisense sequence is at least 90% complementary to SEQ ID NO: 3 or 4.

[0033] (i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence in STMN2 and its adjacent region, preferably at least 90% complementary to SEQ ID NO: 7, and (ii) A sequence comprising a binding domain for an hnRNP protein Modified U7 snRNA constructs containing the same are also described herein.

[0034] (i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence in INSR and its adjacent region, preferably at least 90% complementary to SEQ ID NO: 9, and (ii) A sequence comprising a binding domain for an hnRNP protein Modified U7 snRNA constructs containing the same are also described herein.

[0035] (i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to a TDP-43-regulated cryptic exon sequence or its adjacent region, where the adjacent region means 150 nucleotides upstream and downstream of the cryptic exon (or optionally 100 nucleotides upstream and downstream of the cryptic exon, or 75 nucleotides, or up to 50 nucleotides, or up to 25 nucleotides), and (ii) Modified U7 snRNA constructs containing a sequence comprising a binding domain for an hnRNP protein are also described herein.

[0036] (i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to the TDP-43-binding region of the TDP-43-regulated cryptic exon sequence and (ii) a sequence containing a binding domain for an hnRNP protein. Modified U7 snRNA constructs containing such sequences are also described herein.

[0037] (i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence or its adjacent region, and (ii) a sequence containing a binding domain for an hnRNP protein Modified U7 snRNA constructs containing a modified Sm motif containing such sequences are also described herein.

[0038] (i) An antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence or its adjacent region, and (ii) A sequence containing a binding domain for hnRNP A or hnRNP H Modified U7 snRNA constructs containing such sequences, which are capable of altering the splicing of TDP-43-regulated cryptic exons in cells, are also disclosed herein. In some embodiments, the adjacent regions described herein can be defined as 150 nucleotides upstream and downstream of the TDP-43-regulated cryptic exon. In some embodiments, the cryptic exon sequence or its adjacent region can be defined by a defined sequence (e.g., SEQ ID NO: 1, 2, 3, 4, 7, or 9) for a particular TDP-43 cryptic exon. The sequence containing the binding domain for hnRNP A or hnRNP H can be defined according to any of the definitions provided elsewhere herein.

[0039] Systems comprising a construct, vector, or pharmaceutical composition and cells, wherein the cells contain or express an hnRNP protein, are also disclosed herein. The cells can be as defined elsewhere herein.

[0040] With respect to any of the sequences disclosed herein, complementary sequences and reverse complementary sequences are also disclosed. Vectors or constructs containing complementary sequences to those disclosed herein that can be used to encode the constructs described herein are also disclosed herein.

Brief Description of the Drawings

[0041]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Figure 36

[0042] As used herein, the terms "treatment" and "treating" mean an approach for obtaining a benefit or desired result in a subject, including prophylactic and therapeutic benefits.

[0043] "Therapeutic benefit" means the eradication, improvement, or deceleration of progression of the underlying disease of the subject to be treated. The therapeutic benefit can also be achieved with the eradication or improvement of one or more of the physiological symptoms associated with the underlying disease, such that an improvement is observed in the subject even though the subject may still be suffering from the underlying disease.

[0044] "Preventive benefit" means delaying or eliminating the occurrence of a disease or condition, delaying or eliminating the onset of the symptoms of a disease or condition, decelerating, stopping, or reversing the progression of a disease or condition, or any combination thereof. In the context of the present invention, preventive benefits or effects can include the prevention of a condition or disease. A construct, vector, or pharmaceutical composition can be administered to a subject having a risk of developing a particular disease, or a subject reporting one or more of the physiological symptoms of the disease even if the disease has not been diagnosed.

[0045] The term "effective amount" or "therapeutically effective amount" means the amount of a construct, vector, or pharmaceutical composition required to produce an acceptable result of the therapy when determined by reducing the likelihood of a disease as measurable by clinical, biochemical, or other indicators well known to a person trained in the art. The therapeutically effective amount may vary depending on the condition, the severity of the condition, the subject, e.g., the weight and age of the subject, and the mode of administration, and can be readily determined by one of ordinary skill in the art.

[0046] The term "subject" means any suitable subject, including any animal such as a mammal. In the preferred embodiments described herein, the subject is a human.

[0047] The term "comprising" (and related terms such as "comprise" or "comprises" or "having" or "beginning with") includes embodiments that "consist of" or "consist essentially of" the recited features, for example, embodiments of any substance composition, composition, method, or process, etc. The terms "comprising" and "comprises" can be used interchangeably with "including".

[0048] As used herein, "capable of binding" means any nucleotide sequence that binds to a specified target region (e.g., a pre-mRNA containing a TDP-43-regulated cryptic exon). This can be defined as any nucleotide sequence that is substantially complementary (e.g., at least 90% complementary, or at least 95%) or complementary (e.g., 100% complementary) to at least a portion of the target sequence and / or splicing element and has the same number of nucleotides as the antisense sequence.

[0049] As used herein, "sequence identity" means the percentage of similarity between two nucleotide sequences of the same length.

[0050] As defined herein, "UNC13A" is the gene encoding the UNC13A protein. UNC13 proteins play important roles in neurotransmitter release at synapses.

[0051] As defined herein, "STMN2" is the gene encoding the stathmin 2 protein. This protein plays a regulatory role in neuron growth.

[0052] As defined herein, "INSR" is the gene encoding the insulin receptor, which is a member of the protein receptor tyrosine kinase family, and the binding of insulin or other ligands to this receptor activates the insulin signaling pathway.

[0053] As defined herein, "ELAVL3" means the gene encoding the neuron-specific protein ELAV-like RNA-binding protein 3.

[0054] As defined herein, "CELF5" means the gene encoding the CUGBP Elav-like family member 5 protein.

[0055] As defined herein, "TDP-43" means the TAR DNA-binding protein 43 (transactive response DNA-binding protein 43 kDa), a protein encoded by the TARDBP gene in humans. TDP-43 has been shown to bind to both DNA and RNA and to have multiple functions, particularly in transcriptional repression, pre-mRNA splicing, and translational regulation. Pathological TDP-43 can mean a TDP-43 protein associated with a disease state. Pathological TDP-43 can be an overphosphorylated form, ubiquitinated form, or cleaved form of TDP-43, a TDP-43 form with reduced solubility, or a misfolded form of TDP-43, a mutant form of TDP-43, or a TDP-43 with altered subcellular localization.

[0056] As described herein, a "construct" has its ordinary meaning in the art and means a synthetic nucleic acid sequence used to introduce genetic material into a target cell or tissue. A construct is not intended to be a completely naturally occurring nucleic acid sequence, i.e., as found in the genome of an organism (although the construct itself can contain components derived from naturally occurring sequences). A construct can have a maximum length, i.e., the construct can include less than 50,000 nucleotides, or less than 40,000 nucleotides, or less than 30,000 nucleotides, or less than 20,000 nucleotides, or in some examples less than 10,000 nucleotides or less than 5000 nucleotides, or less than 2500 nucleotides, or less than 2000 nucleotides.

[0057] As used herein, "U7 snRNA" refers to a modified variant of U7 small nuclear ribonucleoprotein (U7 snRNP) that can form a component of the small nuclear ribonucleoprotein complex. The unmodified or wild-type U7 snRNP is any U7 snRNP involved in the processing of replication-dependent histone pre-mRNA. The modified version of U7 snRNP refers to any U7 snRNA variant having a controlled change in the wild-type U7 snRNA such that it no longer participates in the processing of replication-dependent histone-dependent pre-mRNA. This is achieved by modifying the Sm-binding site of U7 snRNA (i.e., corresponding to SEQ ID NO: 353 AUUUGUCUAG in the wild-type) and the sequence in the wild-type or unmodified U7 snRNA that binds to the histone downstream element within the replication-dependent histone pre-mRNA (i.e., SEQ ID NO: 354 AAGUGUUACAGCUCUUUUAG). The modified U7 snRNA constructs described herein also contain a modified Sm sequence and, instead of the histone-binding sequence (SEQ ID NO: 354) in the unmodified or wild-type U7 snRNA, contain an antisense sequence that binds to a target sequence (e.g., a TDP-43-regulated cryptic exon or its flanking region). An example of a modified U7 snRNA containing a modified Sm sequence is U7 smOPT. As defined herein, "U7 smOPT" refers to a modified U7 snRNA as described above, but with the Sm sequence modified to SEQ ID NO: 355: AAUUUUUGGAG with respect to the same number of nucleotides.

[0058] As used herein, "nucleotide" describes a component of a nucleic acid sequence. A nucleotide contains a nucleobase (e.g., A, G, T, and C in DNA, or A, G, U, and C in RNA, although other nucleobases can be used) linked to a sugar (e.g., deoxyribose in DNA and ribose in RNA, although other sugars can be used). In DNA and RNA, the sugars are linked by a phosphodiester backbone to form a nucleic acid sequence, although other backbones can be used.

[0059] As used herein, "complementary" or "complementary to" means, for example, Watson-Crick base pairing in nucleic acids where A binds to U (or T or a modified variant thereof) and C binds to G (or a modified variant thereof).

[0060] As used herein, reverse complement in the context described herein means the complementary strand or antisense sequence of a sequence, shown from 5' (left) to 3' (right).

[0061] Cells having depletion of TDP-43 (e.g., nuclear depletion) as described herein may be referred to herein as "affected cells". Cells without depletion of TDP-43 (e.g., nuclear depletion) may be referred to herein as "healthy cells".

[0062] As used herein, "splicing" in the context defined herein means the process by which pre-mRNA is converted into mature mRNA, introns are removed, and exons are ligated together.

[0063] As used herein, "cryptic exon" in the context defined herein means a splicing variant that is incorporated into mature mRNA, particularly among the changes in the resulting mRNA, that introduces a frameshift or a stop codon. Cryptic exons are typically absent or have greatly reduced inclusion in the "normal" or "healthy" form of the mRNA and are normally skipped by the spliceosome but appear in abnormal forms. Cryptic exons may be referred to herein or elsewhere in the art by the aliases "CE", "cryptic", "cryptic event" or "cryptic splicing event". A cryptic exon means a sequence that is incorrectly incorporated into mature mRNA, defined by a cryptic acceptor splice site and a cryptic donor splice site.

[0064] When defined herein, an array that includes or is defined using "T" or thymine is intended to refer to "U" or uracil when referring to an RNA molecule, and an array defined using "U" or uracil is intended to refer to "T" when referring to a DNA molecule. An array that includes or is defined using "A", "G", "C", "T" or "U" is intended to encompass modified variants of nucleotides including nucleotides that include modified nucleobases and / or modified sugars. In some embodiments, the array includes only unmodified bases.

[0065] When defined herein, a "splicing factor" is a protein that is involved in splicing, i.e., the removal of introns from an mRNA where exons will be joined together.

[0066] When defined herein, a "splicing repressor" is a protein that is involved in the repression or prevention of splicing.

[0067] When defined herein, a splicing element is any part of a pre-mRNA that is involved in cryptic exon splicing. Splicing elements include splice sites (i.e., the splice acceptor site and / or the splice donor site that define a cryptic exon), exonic sequence enhancers (ESEs) (defined below), TDP-43 binding regions (or TDP-43 binding motifs) (both defined below), or other splicing regulatory elements (i.e., sites or sequences to which an RNA binding protein binds and promotes a splicing event).

[0068] As used herein, "exonic splicing enhancer" or "ESE" may mean an ESE identified by ESE finder 3.0 (http: / / krainer01.cshl.edu / cgi-bin / tools / ESE3 / esefinder.cgi?process=home).

[0069] In some embodiments, the ESE is a binding site for an SR protein, e.g., a binding site or binding motif for SRSF1, SRSF2, SRSF5, or SRSF6.

[0070] A splice site, as understood in the art, is the boundary between an intron sequence and an exon sequence. During splicing, the nucleotide sequence is cleaved at the splice site, i.e., the nucleotide sequence is cleaved at the boundary between the intron sequence and the exon sequence.

[0071] A splice acceptor site is a splicing site that exists between an intron and an exon, i.e., the splice site immediately upstream of the exonic sequence when the intron is upstream of the exonic sequence. A splice acceptor site is characterized by any splice site that contains the dinucleotide "AG" upstream of the splice site (i.e., at the end of the intron sequence upstream of the exon). A cryptic splice acceptor site is the splice acceptor site of a cryptic exon. The splice acceptor site and the cryptic splice acceptor site may be interchangeable with each other herein. The term splice acceptor site can be used interchangeably with the term "3-splice site" or "3-ss".

[0072] The splice donor site is a splicing site that exists between an exon and an intron, that is, an exonic sequence when the exon is upstream of the intron. The splice donor site is characterized by any splice site that contains the dinucleotide "GU" downstream of the splice site (i.e., the start of the intron sequence downstream of the exon). A cryptic splice donor site is the splice donor site of a cryptic exon. The splice donor site and the cryptic splice donor site may be interchangeable with each other herein. The term splice donor site can be used interchangeably with the terms "5-splice site" or "5-ss".

[0073] As used herein, "depletion of TDP-43" or "TDP-43 is depleted" can be defined as, when compared to the same type of healthy cells (or as the average of a population of healthy cells), at least 20% depletion of TDP-43 in cells, preferably in the nucleus, or 25% depletion, or preferably at least 50% depletion of TDP-43, as a cell or as the average of a population of cells. In some examples, the term "nuclear depletion of TDP-43" can be replaced by or is interchangeable with the term "absence of binding of TDP-43 to the TDP-43 binding region", and the term "without nuclear depletion of TDP-43" can be replaced by or is interchangeable with the term "presence of binding of TDP-43 to the TDP-43 binding region". Depletion of TDP-43 can be determined by standard methods such as Western blotting. In other embodiments, depletion can be determined by determining the presence of STMN2 alternative splicing events (i.e., the presence of STMN2 alternative exon 2a as defined herein) in cellular transcripts, which can be determined by RNA sequencing. Depletion of TDP-43 means depletion of "normal" or wild-type TDP-43 and can exclude pathological or mutant TDP-43. Pathological TDP-43 can be an over-phosphorylated, ubiquitinated or cleaved form of TDP-43, a TDP-43 form with reduced solubility, or a misfolded form of TDP-43, a mutant form of TDP-43, or a TDP-43 with altered cellular localization.

[0074] The term "RNA-seq" as referred to herein, which is known by the alias "RNA sequencing", refers to next-generation sequencing technology that can be used to analyze a cellular transcriptome and reveals the presence and amount of RNA in a sample.

[0075] As used herein, "able to change the splicing of a TDP-43-regulated cryptic exon" means a construct that modifies splicing by at least partially preventing the inclusion of a TDP-43-regulated cryptic exon in the mature mRNA of a cellular transcript (e.g., by binding to a pre-mRNA containing the TDP-43-regulated cryptic exon).

[0076] As used herein, "antisense oligonucleotide" or "ASO" has its ordinary meaning in the art and typically means an isolated (i.e., independent) synthetic single-stranded nucleic acid less than 30 nucleotides in length. ASOs are used in the art as therapeutic agents, for example, to target mRNA. An ASO binds complementarily ("antisense") through Watson-Crick base pairing to a defined portion of the nucleotide sequence of a pre-messenger ribonucleic acid (pre-mRNA) or mature mRNA ("sense") to alter mRNA function or splicing. The ASOs described herein are different from the modified U7 snRNA constructs described herein that instead incorporate an antisense sequence within a modified U7 snRNA construct, including, for example, a modified Sm sequence, more preferably a smOPT sequence.

[0077] Unless explicitly stated otherwise in the context, it is assumed that any embodiment described herein can be combined with any other embodiment described herein. Similarly, the features of any dependent claim (i.e., representing a preferred embodiment of the invention) can be readily combined with the features of any independent claim or other dependent claim or embodiment, unless the context clearly indicates otherwise.

[0078] Any genomic or chromosomal location described herein refers to a location on the human genome and related transcriptome (hg38).

[0079] When ranges are used herein, all combinations and subcombinations of the range and specific embodiments therein are intended to be included. The term "about" (about or ~) when referring to a number or numerical range means that the referenced number or numerical range is an approximation within the range of experimental variation (or within the range of statistical experimental error), and thus the number or numerical range can vary. Typical experimental variations can result from, for example, the changes and adjustments necessary in going from laboratory experiments to large-scale production settings.

[0080] As used in this specification and the appended claims, the singular forms "a", "an", and "the" are to be noted as including plural referents unless the context clearly indicates otherwise.

[0081] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Abbreviations used herein have their customary meaning within the scope of chemical and biological skills unless otherwise indicated.

[0082] Construct (i) an antisense sequence having 16 to 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence or its adjacent region, and (ii) a sequence containing a binding domain for an hnRNP protein A modified U7 snRNA construct comprising the above, which is capable of changing the splicing of the TDP-43-regulated cryptic exon in cells, is disclosed herein.

[0083] In some embodiments, the adjacent regions described herein can be defined as 150 nucleotides upstream and downstream of the TDP-43-regulated cryptic exon, or 100 nucleotides upstream and downstream of the TDP-43-regulated cryptic exon, or 50 nucleotides upstream and downstream of the TDP-43-regulated cryptic exon, or 25 nucleotides upstream and downstream of the TDP-43-regulated cryptic exon. In some embodiments, the cryptic exon sequence or its adjacent regions can be defined by a defined sequence (e.g., SEQ ID NO: 1, 2, 3, 4, 7 or 9) for a particular TDP-43 cryptic exon.

[0084] In some embodiments, the modified U7 snRNA construct includes a transcription start site at the beginning of the construct, for example, in the form of an A nucleotide.

[0085] In some embodiments, the modified U7 snRNA construct includes a sequence containing a binding domain for an hnRNP protein downstream of the transcription start site, preferably immediately downstream of the transcription start site.

[0086] In some embodiments (and in the examples described herein), the modified U7 snRNA construct includes an antisense sequence (i.e., at least 90% complementary to the TDP-43-regulated cryptic exon sequence or its adjacent regions) downstream of the transcription start site, preferably downstream of the transcription start site and the binding sequence for the hnRNP protein. In alternative embodiments, the modified U7 snRNA construct includes an antisense sequence (i.e., at least 90% complementary to the TDP-43-regulated cryptic exon sequence or its adjacent regions) immediately downstream of the transcription start site and preferably upstream of the sequence containing the binding domain for the hnRNP protein.

[0087] In some embodiments, the modified U7 snRNA construct comprises a modified Sm sequence (i.e., the modified U7 snRNA is a U7 smOPT construct). Preferably, the modified Sm sequence is downstream of both a sequence comprising a binding domain for an hnRNP protein and an antisense sequence that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence or its flanking region. In some embodiments, the U7 snRNA construct comprises a modified Sm sequence having at least 80% sequence identity (i.e., with respect to the same number of nucleotides), or at least 85% sequence identity, or at least 90% sequence identity, or at least 100% sequence identity to SEQ ID NO: 355: AAUUUUUGGAG. In a preferred embodiment, the modified U7 snRNA construct is a U7 smOPT construct. The U7 smOPT construct comprises a modified Sm sequence corresponding to SEQ ID NO: 355. In some embodiments, the modified U7 snRNA construct comprises a 3' hairpin sequence downstream of the modified Sm sequence. This can be any suitable hairpin sequence. In some embodiments, the 3' hairpin sequence has a sequence that is at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 100% identical to CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 356). The modified U7 snRNA construct does not comprise the wild-type Sm sequence (SEQ ID NO: 353).

[0088] The modified U7 snRNA construct does not comprise a binding sequence for the histone downstream element (HDE), i.e., the modified U7 snRNA construct does not comprise the sequence corresponding to SEQ ID NO: 354. In a preferred embodiment, the sequence comprising a binding domain for an hnRNP protein and an antisense sequence that is at least 90% complementary to the TDP-43-regulated cryptic exon and its flanking region is directly present in the modified U7 snRNA construct instead of the binding sequence for the histone downstream element in wild-type U7 snRNA.

[0089] In some examples, the modified U7 snRNA construct comprises a sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical to SEQ ID NO: 358, 360, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385 (i.e., with respect to UNC13A), SEQ ID NO: 390, 392, 394, 396, 398, 400, 402, 404, 406 (i.e., with respect to STMN2) and SEQ ID NO: 408, 410, 412, 414, 416, 418 (i.e., with respect to INSR). Sequence identity is compared to sequences having the same number of nucleotides.

[0090] Antisense sequence The constructs described herein comprise an antisense sequence that is at least 90% complementary to the TDP-43-regulated cryptic exon or the adjacent region thereof. In some embodiments, the antisense sequence is at least 91% complementary, or at least 92% complementary, or at least 93% complementary, or at least 94% complementary, or at least 95% complementary, or at least 96% complementary, or at least 97% complementary, or at least 98% complementary, or at least 99% complementary, or at least 100% complementary to the TDP-43-regulated cryptic exon or the adjacent region thereof. In some embodiments, the TDP-43-regulated cryptic exon or the adjacent region thereof can be defined by SEQ ID NO: 1, 2, 3, 4, 7 or 9 or SEQ ID NO: 448-453.

[0091] The adjacent region of a TDP-43-regulated cryptic exon can be defined as 150 nucleotides upstream and / or downstream of the cryptic exon (i.e., within the intronic region surrounding the cryptic exon sequence). In some embodiments, the adjacent region is 100 nucleotides upstream and / or downstream of the cryptic exon, or up to 75 nucleotides upstream and / or downstream of the cryptic exon, or up to 50 nucleotides upstream and / or downstream of the cryptic exon, or up to 30 nucleotides upstream and / or downstream of the cryptic exon, or 25 nucleotides upstream and / or downstream of the cryptic exon. In some embodiments, the antisense sequence can partially overlap with the cryptic exon sequence (i.e., the antisense sequence can bind to a portion of the cryptic exon sequence and a portion of its adjacent region). In some embodiments, the antisense sequence can bind to at least 5 nucleotides within the cryptic exon, or at least 10 nucleotides within the cryptic exon sequence, or at least 15 nucleotides. The cryptic exon sequence can be any of the cryptic exon sequences defined herein. In some embodiments, the antisense sequence can be capable of binding within the cryptic exon sequence. In some embodiments, the antisense sequence is at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, or 100% complementary to any one of SEQ ID NO: 5, 6 (short and long cryptic exons for UNC13A), SEQ ID NO: 8 (cryptic exon of STMN2) or SEQ ID NO: 10 (cryptic exon for INSR).

[0092] The "TDP-43-regulated cryptic exon" defined herein is a cryptic exon whose splicing is suppressed by the binding of TDP-43 to a TDP-43 binding region near the cryptic exon. Thus, a TDP-43-regulated cryptic exon is characterized as being present in the mature mRNA of a gene when depletion of TDP-43 in cells is observed and / or in the absence of TDP-43 binding, or increasing compared to healthy cells, but being absent or decreasing in the mature mRNA of the gene when such depletion of TDP-43 is not observed. A TDP-43-regulated cryptic exon is further characterized by a cryptic exon that contains or is in the vicinity of a TDP-43 binding region (defined below), where the vicinity is defined as a region that is entirely within the cryptic exon sequence, partially overlapping, or within 150 nucleotides thereof. In some embodiments, the TDP-43 binding region encompasses at least a portion of the cryptic exon sequence and / or extends upstream or downstream of the cryptic exon sequence. In some embodiments, the TDP binding region (or at least a portion of the TDP-43 binding region) is within 150 nucleotides (i.e., upstream or downstream), or within 100 nucleotides, or within 50 nucleotides, or within 25 nucleotides, or within the cryptic exon of the cryptic exon. In some embodiments, the TDP-43 binding region is upstream of the cryptic exon sequence, within the cryptic exon sequence, downstream of the cryptic exon sequence, or any combination thereof. Such cryptic exons are well known in the art and can be readily identified in the art (e.g., by comparing the level of cryptic splicing in healthy or wild-type cells to cells in which TDP-43 is depleted (i.e., diseased cells or cells having a TDP-43 knockdown or TDP-43 knockout)). In some embodiments, the TDP-43 binding region contains or is a TDP-43 binding motif. The TDP-43 binding motif can be as described elsewhere herein.

[0093] In some embodiments, the TDP-43-regulated cryptic exon is a cryptic exon within the following genes: AARS1, AC002310.11, AC008676.3, AC022387.2, ACTL6B, ADARB1, ADCY1, ADGRL1, AGK, AHNAK, AKT3, AL035461.3, AL360181.3, AP000662.4, ARAP3, ARHGAP22, ARHGAP23, ATAD5, ATG4B, ATP5MG, ATP8A2, ATXN1, C2orf81, CAMK2B, CAMTA1, CCDC102B, CCDC33, CDHR2, CELF5, CEP290, CEP83, CHD8, CHFR, CRLS1, CTD-2162K18.4, CYFIP2, DACH2, DACT3-AS1, DAGLA, DELE1, DGKA, DLG5, DLGAP1, DNAJC12, DNMT3A, DOCK1, DPF1, DUXAP9, EIF2A, ELAVL3, EP400, EPB41L4A, EPS8L2, FADS2, FAM114A2, FAM156A, FIRRE, FKBP14-AS1, FRYL, G3BP1, GALNT12, GATA2, GPSM2, GREB1, GRIN2D, GSTCD, HAUS2, HDGFL2, ICA1, IGSF21, IK, IL15, INSR, INTS11, IQCE, IQCK, ISYNA1, ITGA7, ITPR3, KALRN, KCNQ2, KCNT1, KIAA1211, KIAA1217, KIF21A, KLC1, KNDC1, L3MBTL1, LINC01322, LINC01503, LINGO1, LRP1B, LRP8, LTBP2, MACROD1, MADD, MANBAL, MAP2K6, MBP, MC1R, MCM9, MED13L, MEIS2, MGAT5B, MIER3, MMAA, MRPL34, NBPF9, NIPSNAP3B, NTRK2, NUP188, PAOX, PATJ, PCDH11X, PDCD6, PDE2A, PHF2, PLEKHG2, PLEKHM2, PRUNE2, PTPN13, PTPN21, PUDP, PUS7L, RBMXL1, RFLNA, RHOQ, RP1-138B7.8, RP11-108K14.8, RP11-411B6.6, RP11-479O9.4, RP11-505D17.1, RP11-61L23.2, RP11-73M18.2, RP5-967N21.13, RSF1, SEC31B, SEPT7P2, SEPTIN6, SEPTIN7P2, SERGEF, SETD5, SGMS1, SIPA1L3, SLC24A3, SLC25A14, SLC2A11, SLC35G1, SLC41A2, SPATS2, SPIN1, STMN2, STRA6, STXBP5L, SYNE1, SYNJ2, SYT7, TAF6, TAFA2, TEX9, TGFB3, THUMPD3-AS1, TMEM175, TMEM189, TPRA1, TRAPPC12, TRIO, TRRAP, TTC39C-AS1, TTTY14, TXLNGY, UNC13A, USP10, WARS2, WASL, WDR19, WWOX, ZBTB18, ZCCHC4, ZFAT, ZNF202, ZNF236, ZNF382, ZNF420, ZNF423, ZNF429, ZNF527, ZNF571-AS1, ZNF583, ZNF598, ZNF81, ZNF814, ZNF826P, ZRANB3.

[0094] In some embodiments, the TDP-43-regulated cryptic exon is selected from the UNC13A cryptic exon, the TDP-43-regulated STMN2 cryptic exon or the TDP-43-regulated INSR cryptic exon, the TDP-43-regulated ELAVL3 cryptic exon, the TDP-43-regulated G3BP1 cryptic exon, the TDP-43-regulated AARS1 cryptic exon, the TDP-43-regulated CELF5 cryptic exon, the CAMK2B cryptic exon, or the UNC13B cryptic exon, and preferably at this time, the antisense sequence comprises a sequence that is at least 90%, or at least 95%, or at least 100% complementary to any one of SEQ ID NOs: 1, 2, 3, 4, 7, 9, 448 to 453.

[0095] In some examples described herein, the TDP-43-regulated cryptic exon is the TDP-43-regulated UNC13A cryptic exon, the TDP-43-regulated STMN2 cryptic exon, or the TDP-43-regulated INSR cryptic exon. In some examples, the antisense sequence comprises a sequence that is at least 90%, or at least 95%, or at least 100% complementary to any one of SEQ ID NOs: 1, 2, 3, 4, 7, or 9.

[0096] As defined herein, a TDP-43 binding region is defined as an array capable of binding to TDP-43. This term can be used interchangeably with the terms "TDP-43 binding domain" or "TDP-43 binding site", and can include an array containing a "TDP-43 binding motif". A TDP-43 binding region typically features or includes a "UG-rich" array or region. In some embodiments, a "UG"-rich region can be defined, and the TDP-43 binding region can include a region of at least 6 nucleotides, or preferably at least 10 nucleotides, or at least 20 nucleotides, with a statistically significant enrichment of UG dinucleotides and / or UGNNUG hexanucleotides, where N is A, U, C, or G. In some embodiments, the TDP-43 binding region includes a region of at least 6 nucleotides (e.g., 6 to 1000 nucleotides, or 6 to 150 nucleotides) with a statistically significant enrichment of UG dinucleotides and / or UGNNUG hexanucleotides, where N is A, U, C, or G, and the statistically significant enrichment is defined as a probability of less than 0.2% that a random array of nucleotides of equal length has an equal number of UG dinucleotides and / or UGNNUG hexanucleotides. In some embodiments, the statistically significant enrichment is 0.15% or less, or 0.1% or less, or 0.05% or less, or 0.01% or less, or 0.003% or less, or 0.001% or less, or 0.0003% or less, or 0.0001% or less, or 1×10 -5 or less, or 1×10 -6 or less, or 1×10 -7 or less, or 1×10 -8 or less, or 1×10 -9 or less, or 1×10 -10It is defined as the following probability. These definitions cover both short sequences or regions that are highly enriched with respect to UG and longer sequences that are broadly enriched with respect to UG, and both of them have been shown to be preferentially bound by TDP-43. In some embodiments, the TDP-43 binding region comprises a sequence enriched with UG dinucleotides. In some embodiments, the enrichment of UG dinucleotides can be described as a TDP binding motif and is defined as a sequence comprising at least 6 nucleotides having 100% UG dinucleotides (i.e., UGUGUG), or a sequence comprising one or more regions containing at least 6 nucleotides having 100% UG dinucleotides. In some embodiments, the enrichment of UG dinucleotides is defined as a sequence comprising at least 8 nucleotides (or one or more regions containing at least 8 nucleotides) having at least 80% UG dinucleotides, or at least 85%, or at least 90%, or at least 95%, or 100% UG dinucleotides. In some embodiments, the enrichment of UG dinucleotides is defined as a sequence comprising at least 10 nucleotides (or one or more regions containing at least 10 nucleotides) having at least 60% UG dinucleotides, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 100% UG dinucleotides. In some embodiments, the enrichment of UG dinucleotides is defined as a sequence comprising at least 15 nucleotides (or one or more regions containing at least 15 nucleotides) having at least 53% UG dinucleotides, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or 100% UG dinucleotides. In some embodiments, the TDP-43 binding region comprises a sequence containing at least one UGUGUG motif, or at least one UGUGUGUGUG motif.However, while TDP-43 can bind to a very diverse array of UG-rich sequences, the TDP-43 binding regions do not need to bind to pure UG repeats. This is due in part to the lack of protein contacts with some of the RNA residues within its binding footprint and in part to multivalent protein–protein interactions that enhance binding to large regions of UG-rich RNA. This means that in some embodiments, the TDP-43 binding regions may not require any "pure" UG repeats or motifs, such as the TDP-43 binding region in UNC13A. In some embodiments, the TDP-43 binding regions can be well-known, described annotated binding regions. For example, sequence features that promote TDP-43 binding are described in Lukavsky et al., 2013 (NSMB, 20, pages 1443–1449), which is incorporated herein by reference. The TDP-43 binding regions can be identified or previously identified by transcriptome mapping of TDP-43 to the human genome, as determined, for example, by immunoprecipitation, such as iCLIP (individual-nucleotide resolution UV Cross-Linking and Immunoprecipitation). In some embodiments, the antisense sequences can be selected to bind upstream or downstream of the TDP-43 motif, for example, within 40 nucleotides upstream or downstream of the TDP-43 motif, or within 20 nucleotides upstream or downstream of the TDP-43 motif. This can be beneficial because the constructs of the invention function by delivering the hnRNP proteins to where TDP-43 normally binds and, as a result, targeting adjacent regions of the TDP-43 motif.

[0097] The antisense sequences described herein can comprise or consist of 16 to 30 nucleotides. In some embodiments, the antisense sequence is 16 to 26 nucleotides, or 17 to 23 nucleotides, or 18 to 22 nucleotides. In some embodiments, the antisense sequence comprises or consists of 16 nucleotides, or 17 nucleotides, or 18 nucleotides, or 19 nucleotides, or 20 nucleotides, or 21 nucleotides, or 22 nucleotides, or 23 nucleotides, or 24 nucleotides, or 25 nucleotides, or 26 nucleotides, or 27 nucleotides, or 28 nucleotides, or 29 nucleotides or 30 nucleotides. In some embodiments, the antisense sequence comprises at least 16 nucleotides, or at least 17 nucleotides, or at least 18 nucleotides, or at least 19 nucleotides, or at least 20 nucleotides, or at least 21 nucleotides, or at least 22 nucleotides, or at least 23 nucleotides, or at least 24 nucleotides, or at least 25 nucleotides, or at least 26 nucleotides, or at least 27 nucleotides, or at least 28 nucleotides, or at least 29 nucleotides. In some embodiments, the antisense sequence comprises less than 30 nucleotides, or less than 29 nucleotides, or less than 28 nucleotides, or less than 27 nucleotides, or less than 26 nucleotides, or less than 25 nucleotides, or less than 24 nucleotides, or less than 23 nucleotides, or less than 22 nucleotides, or less than 21 nucleotides, or less than 20 nucleotides, or less than 19 nucleotides, or less than 18 nucleotides, or less than 17 nucleotides. It has been found that the longer the antisense sequence, the more efficiently the modified U7 snRNA construct binds and the more effective the construct is as a steric hindrance, however, this is accompanied by an increased tendency towards off-target binding.

[0098] In some embodiments, the construct can include more than one antisense sequence, for example, at least 90% complementary to the TDP-43-regulated cryptic exon or its adjacent region, or 95% complementary to the TDP-43-regulated cryptic exon or its adjacent region, or 100% complementary to the TDP-43-regulated cryptic exon or its adjacent region. These antisense sequences may be capable of binding to different splicing elements.

[0099] In some embodiments, the antisense sequence is capable of binding to a splicing element of the cryptic exon sequence (i.e., at least 90%, or at least 95%, or 100% complementary), and optionally, at this time, the antisense sequence is at least 90% complementary to one of SEQ ID NOs: 11-40 or 454-471.

[0100] In some embodiments, the antisense array can bind (i.e., at least partially) to a splicing element of a cryptic exon array, or two or more splicing elements of a cryptic exon array, and preferably at this time, one of the two or more splicing elements of the cryptic exon array is a TDP-43 binding region. In some embodiments, the antisense array may be capable of binding to a TDP-43 binding region and a splice site (e.g., a 5' splice site or a 3' splice site). In some embodiments, the antisense array may be capable of binding to a TDP-43 binding region and an ESE. In an example, for an antisense array targeting the UNC13A cryptic exon, the results are particularly good when the antisense array can bind to a TDP-43 binding sequence and a 5' splice site. In some embodiments, the splicing element is selected from a splice site, a TDP-43 binding region (e.g., a TDP-43 binding motif), or an exonic splicing enhancer. In some embodiments, the antisense array can bind at least partially to a splicing element of a cryptic exon array, but may also bind to an adjacent region upstream or downstream of the splicing element. The adjacent region can include 25 nucleotides upstream of the downstream of the splicing element, optionally 20 nucleotides upstream of the downstream of the splicing element, optionally 15 nucleotides upstream or downstream of the splicing element, or 10 nucleotides upstream or downstream of the splicing element, or 5 nucleotides upstream or downstream of the splicing element. In some embodiments (e.g., for some embodiments where the antisense array can bind to a TDP-43 binding region), the antisense array can bind completely to or within the splicing element (i.e., within the TDP-43 binding region, or completely overlapping with the ESE).

[0101] In some embodiments, a portion of the antisense array capable of binding to a splicing element is relatively close to the 3' end of the antisense array. In some embodiments, a portion of the antisense array capable of binding to a splicing element is within 7 nucleotides, or 6 nucleotides, or 5 nucleotides, or 4 nucleotides, or 3 nucleotides, or 2 nucleotides from the 3' end of the antisense array. In some embodiments, a portion of the antisense array capable of binding to a splicing element is relatively close to the 5' end of the antisense array. In some embodiments, a portion of the antisense array capable of binding to a splicing element is within 7 nucleotides, or 6 nucleotides, or 5 nucleotides, or 4 nucleotides, or 3 nucleotides, or 2 nucleotides from the 5' end of the antisense array.

[0102] In some embodiments, the splicing element is a splicing site (i.e., the antisense array is capable of binding to (i.e., overlapping with) the splice site of a cryptic exon, and more particularly at this time, the antisense array overlaps with at least 1 nucleotide upstream or downstream of the splice site). In some embodiments, the antisense array is capable of binding to at least 2 nucleotides, or at least 3 nucleotides, or at least 4 nucleotides, or at least 5 nucleotides, or at least 6 nucleotides, or at least 7 nucleotides, or at least 8 nucleotides upstream and / or downstream of the splice site.

[0103] In some embodiments, the antisense array is capable of binding to the splice site (i.e., and its adjacent region), and preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 11, 19, 20, 21, 22, 31, 454, 458, 460, 463, 467 or 469.

[0104] In some embodiments, the splicing element can be a 3'-splice site (i.e., a splice acceptor site). In some embodiments, the antisense sequence can bind to (i.e., overlap with) the "ag" dinucleotide upstream of the splice acceptor site.

[0105] In some embodiments, the splicing element can be a 5'-splice site (i.e., a splice donor site). In some embodiments, the antisense sequence can bind to (i.e., overlap with) the "gu" dinucleotide downstream of the splice donor site.

[0106] In some embodiments, the splicing element is a TDP-43 binding region, and the antisense sequence is capable of binding to at least a portion of the TDP-43 binding region. In some embodiments, the antisense sequence can bind to at least a portion of the TDP-43 binding region and its adjacent regions (i.e., 20 nucleotides upstream or downstream of the TDP-43 binding region, optionally 15 nucleotides upstream or downstream of the TDP-43 binding region, or 10 nucleotides upstream or downstream of the TDP-43 binding region, or 5 nucleotides upstream or downstream of the TDP-43 binding region as defined). In some embodiments, the antisense sequence can bind to at least 5 nucleotides, or at least 7 nucleotides, or at least 10 nucleotides, or at least 15 nucleotides of the TDP-43 binding region, or completely overlap with (i.e., be included within the scope of) the TDP-43 binding region. In some embodiments, the TDP-43 binding region comprises a sequence of at least 6 nucleotides, or preferably at least 10 nucleotides, with a statistically significant enrichment of UG dinucleotides and / or UGNNUG hexanucleotides, where N is A, U, C, or G, and the statistically significant enrichment is defined as a probability of less than 0.2% that a random sequence of nucleotides of equal length has an equal number of UG dinucleotides and / or UGNNUG hexanucleotides, or preferably, the statistically significant enrichment is defined as a probability of less than 0.05% that a random sequence of nucleotides of equal length has an equal number of UG dinucleotides and / or UGNNUG hexanucleotides. In other embodiments, the TDP-43 binding region can be as per any other definition as described herein. In some embodiments, the TDP-43 binding region can include or be a TDP-43 binding motif as described herein.In some embodiments, the TDP-43 binding region or the TDP-43 binding region and its adjacent regions are defined by SEQ ID NO: 12, 13, 23, 23, 24, 25, 26, 32, 33, 455, 456, 457, 459, 461, 462, 464, 465, 466, 468, 470 or 471, more preferably SEQ ID NO: 12, 13, 23, 23, 24, 25, 26, 32, 33.

[0107] In some embodiments, the antisense sequence can bind to one or more exonic splicing enhancers (ESEs) (i.e., and its adjacent regions) as defined by ESE finder 3.0, for example, using an SR protein matrix library. In some embodiments, when using ESE finder 3.0, the following thresholds are used when selecting the SR protein matrix library: SRSF1 - 1.956, SRSF2 - 2.383, SRSF5 - 2.67 and SRSF6 - 2.676. The ESEs defined by ESE finder 3.0 can be as described in the reference "An increased specificity score matrix for the prediction of SF2 / ASF-specific exonic splicing enhancers." Hum. Mol. Genet. 15(16): 2490-2508, which is incorporated herein by reference. The ESE can be an SR protein binding site, i.e., it can be selected from SRSF1, SRSF2, SRSF5 or SRSF6. In some embodiments, the ESE and its adjacent regions are defined by SEQ ID NO: 14, 15, 16, 17, 18, 27, 28, 29, 30, 34, 35, 36, 37, 38, 39 or 40.

[0108] In some embodiments, the ESE can be an SRSF1 binding site. In some embodiments, the SRSF1 binding site can comprise a motif selected from CACACGA, CACACGU, CACACGG, CAGACGA, CAGACGU, CAGACGG, CACAGGA, CACAGGU, CACAGGG, CAGAGGA, CAGAGGU, CAGAGGG, CGCACGA, CGCACGU, CGCACGG, CGGACGA, CGGACGU, CGGACGG, CGCAGGA, CGCAGGU, CGCAGGG, CGGAGGA, CGGAGGU, CGGAGGG, CUCACGA, CUCACGU, CUCACGG, CUGACGA, CUGACGU, CUGACGG, CUCAGGA, CUCAGGU, CUCAGGG, CUGAGGA, CUGAGGU, CUGAGGG, CACCCGA, CACCCGU, CACCCGG, CAGCCGA, CAGCCGU, CAGCCGG, CACCGGA, CACCGGU, CACCGGG, CAGCGGA, CAGCGGU, CAGCGGG, CGCCCGA, CGCCCGU, CGCCCGG, CGGCCGA, CGGCCGU, CGGCCGG, CGCCGGA, CGCCGGU, CGCCGGG, CGGCGGA, CGGCGGU, CGGCGGG, CUCCCGA, CUCCCGU, CUCCCGG, CUGCCGA, CUGCCGU, CUGCCGG, CUCCGGA, CUCCGGU, CUCCGGG, CUGCGGA, CUGCGGU, or CUGCGGG.

[0109] In some embodiments, the ESE can be an SRSF2 binding site. In some embodiments, the SRSF2 binding site can include a motif selected from GGWWNCWG, GAWWNCWG, GGWWNGWG, GAWWNGWG, where N is A, U, C, or G and W is U or A, or the SRSF2 binding site is GGCCNCUG, GACCNCUG, GGUCNCUG, GAUCNCUG, GGCUNCUG, GACUNCUG, GGUUNCUG, GAUUNCUG, GGCCNCUA, GACCNCUA, GGUCNCUA, GAUCNCUA, GGCUNCUA, GACUNCUA, GGUUNCUA, GAUUNCUA, GGCCNCCG, GACCNCCG, GGUCNCCG, GAUCNCCG, GGCUNCCG, GACUNCCG, GGUUNCCG, GAUUNCCG, GGCCNCCA, GACCNCCA, GGUCNCCA, GAUCNCCA, GGCUNCCA, GACUNCCA, GGUUNCCA, GAUUNCCA.

[0110] In some embodiments, the ESE can be an SRSF5 binding site. In some embodiments, the SRSF5 binding site can include a motif selected from UCWCWGG, CCWCWGG, UCWCWCG, CCWCWCG, UCWCWGC, CCWCWGC, UCWCWCC, CCWCWCC, UCWCWAG, CCWCWAG, UCWCWAG, CCWCWAG, UCWCWAC, CCWCWAC, UCWCWAC, CCWCWAC, where W is A or U.

[0111] In some embodiments, the ESE can be an SRSF6 binding site. In some embodiments, the SRSF6 binding site can include a motif selected from UGCGUC, CGCGUC, UACGUC, CACGUC, UGCAUC, CGCAUC, UACAUC, CACAUC, UGCGGC, CGCGGC, UACGGC, CACGGC, UGCAGC, CGCAGC, UACAGC, CACAGC, UGCGUA, CGCGUA, UACGUA, CACGUA, UGCAUA, CGCAUA, UACAUA, CACAUA, UGCGGA, CGCGGA, UACGGA, CACGGA, UGCAGA, CGCAGA, UACAGA, or CACAGA.

[0112] In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 42-352. In some embodiments, the antisense sequence comprises a nucleotide sequence having at least 16 and 30 nucleotides that is at least 90% complementary to the TDP-43 regulatory cryptic exon sequence, and the nucleotide sequence comprises a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 42-352. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0113] In some embodiments, the antisense sequence comprises a sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of SEQ ID NOs: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419, with respect to a sequence having the same number of nucleotides. In some embodiments, the antisense sequence comprises a sequence of at least 16 nucleotides (or 16 nucleotides) that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to at least a portion of any one of SEQ ID NOs: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419, that is, with respect to a sequence having the same number of nucleotides. In some embodiments, the antisense sequence comprises a 17-nucleotide sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to a 17-nucleotide sequence of any one of SEQ ID NOs: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419. In some embodiments, the antisense sequence comprises an 18-nucleotide sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to an 18-nucleotide sequence of any one of SEQ ID NOs: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419.In some embodiments, the antisense sequence comprises a 19-nucleotide sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of the 19-nucleotide sequences of SEQ ID NO: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419. In some embodiments, the antisense sequence comprises a 20-nucleotide sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of the 20-nucleotide sequences of SEQ ID NO: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419. In some embodiments, the antisense sequence comprises a 21-nucleotide sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of the 21-nucleotide sequences of SEQ ID NO: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419. In some embodiments, the antisense sequence comprises a 22-nucleotide sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of the 22-nucleotide sequences of SEQ ID NO: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417 or 419.

[0114] UNC13A In some embodiments, the TDP-43-regulated cryptic exon is the UNC13A cryptic exon. The TDP-43-regulated UNC13A cryptic exon is a cryptic exon between exons 20 and 21 in the human UNC13A gene. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 3 or SEQ ID NO: 4. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 5. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 6.

[0115] In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 103-260. In some embodiments, the antisense sequence comprises a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43 regulatory cryptic exon sequence, and at this time, the nucleotide sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 103-260. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0116] In some embodiments, the antisense sequence is capable of binding to the UNC13A splice site (i.e., and its adjacent region), and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22.

[0117] In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 19-22. In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 103-152.In some embodiments, the antisense array comprises a nucleotide sequence having 16 and 30 nucleotides that are at least 90% complementary to the TDP-43-regulated cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity with one or more of SEQ ID NOs: 103-152 and includes a 16-nucleotide portion. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0118] In some embodiments, the antisense sequence can bind to the UNC13A splice donor site (i.e., the 5' splice site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NOs: 21-22. In some embodiments, the antisense sequence can bind to one of the motifs GAUGG / G, AUGG / GU, UGG / GUG, GG / GUGA, G / GUGAG of the UNC13A cryptic exon and the adjacent region, where / represents the cryptic exon / intron boundary of the UNC13A cryptic exon. In some embodiments, the antisense sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 136-152 and includes at least a 16-nucleotide portion. In some embodiments, the antisense sequence includes a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 136-152 and includes a 16-nucleotide portion. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.In some embodiments, the antisense sequence is capable of binding to the UNC13A splice acceptor site (i.e., the 3'-splice site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 95% complementary, or at least 90% complementary, or at least 100% complementary to one of SEQ ID NO: 19 or SEQ ID NO: 20. In some embodiments, the antisense sequence is capable of binding to one of the motifs UCCAG / C, CCAG / CC, CAG / CCC, AG / CCCU, or G / CCCUA in the UNC13A cryptic exon and adjacent region, where / represents the intron / cryptic exon boundary of the UNC13A cryptic exon. In some embodiments, the antisense sequence is capable of binding to one of the motifs UCCAG / C, CCAG / CU, CAG / CUG, AG / CUGC, G / CUGCC in the UNC13A cryptic exon and adjacent region, where / represents the intron / cryptic exon boundary of the UNC13A cryptic exon. In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 103-135.In some embodiments, the antisense array comprises a nucleotide sequence having 16 and 30 nucleotides that are at least 90% complementary to the TDP-43 regulatory cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity with one or more of SEQ ID NOs: 103-135 and includes a 16-nucleotide portion. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0119] In some embodiments, the antisense sequence can bind at least partially to the TDP-43 binding region of the UNC13A cryptic exon, i.e., and / or its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NOs: 23, 24, 25 or 26, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 23, 24, 25 or 26.In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 153-260. In some embodiments, the antisense sequence comprises a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 153-260. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0120] In some embodiments, the antisense sequence can bind at least partially to an exonic sequence enhancer in the UNC13A cryptic exon defined by ESE finder 3.0 using an SR protein matrix library, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 27, 28, 29, or 30.

[0121] In some embodiments, the exonic array enhancer is an SRSF1 binding site, and the antisense array is capable of binding to the motif CUCAGGA within the UNC13A cryptic exon array (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 27. In some embodiments, the exonic array enhancer is an SRSF2 binding site, and the antisense array is capable of binding to the motif GUUUCCUG within the UNC13A cryptic exon array (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 28. In some embodiments, the exonic array enhancer is an SRSF5 binding site, and the antisense array is capable of binding to the motif ACUCAGG within the UNC13A cryptic exon array (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 28. In some embodiments, the exonic array enhancer is an SRSF6 binding site, and the antisense array is capable of binding to the motif UGUGUC within the UNC13A cryptic exon array (i.e., is complementary to it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 29. In some embodiments, the antisense array is capable of binding to both the SRSF5 binding site (ACUCAGG) and the SRSF1 binding site (CUCAGGA) in the UNC13A cryptic exon (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 28.

[0122] In some embodiments, the antisense sequence comprises a sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of SEQ ID NOs: 420, 362, 364, 366, 368, 370, 372, 374, 382, 384 with respect to a sequence having the same number of nucleotides.

[0123] STMN2 In some embodiments, the TDP-43-regulated cryptic exon is the STMN2 cryptic exon. The TDP-43-regulated STMN2 cryptic exon corresponds to exon 2a in the human STMN2 gene. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 7. In some embodiments, the TDP-43-regulated cryptic exon is the STMN2 cryptic exon. The TDP-43-regulated STMN2 cryptic exon corresponds to exon 2a in the human STMN2 gene. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 8.

[0124] In some embodiments, the antisense sequence is capable of binding to the STMN2 3' splice site (i.e., the splice acceptor site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 11. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 11, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 11, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 11, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 11, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 11, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 11, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 11. In some embodiments, the antisense sequence is capable of binding to one of the motifs UGCAG / G, GCAG / GA, CAG / GAC, AG / GACU or G / GACUC in the STMN2 hidden exon and adjacent region, where / represents the intron / hidden exon boundary of the STMN2 hidden exon.In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 42-59. In some embodiments, the antisense sequence comprises a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43 regulatory cryptic exon sequence, and at this time, the nucleotide sequence comprises a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 42-59. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0125] In some embodiments, the antisense sequence can bind at least partially to the TDP-43 binding region of the STMN2 cryptic exon, or the TDP-43 binding motif, i.e., and / or its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to either one of SEQ ID NO: 12 or 13.In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 60-102. In some embodiments, the antisense sequence comprises a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43 regulatory cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 60-102. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0126] In some embodiments, the antisense sequence can bind at least partially to the STMN2 cryptic exon defined by ESE finder 3.0, i.e., and exon-like sequence enhancer in its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 14, 15, 16, 17, or 18.

[0127] In some embodiments, the exonic array enhancer is an SRSF1 binding site, and the antisense array is capable of binding to the motif CAGAAGA within the STMN2 cryptic exon array (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 14. In some embodiments, the exonic array enhancer is an SRSF2 binding site, and the antisense array is capable of binding to the motif GGCUUGUG within the STMN2 cryptic exon array (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 15. In some embodiments, the exonic array enhancer is an SRSF5 binding site, and the antisense array is capable of binding to the motif UGACAAG within the STMN2 cryptic exon array (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 16. In some embodiments, the exonic array enhancer is an SRSF6 binding site, and the antisense array is capable of binding to the motif UGCGGC within the STMN2 cryptic exon array (i.e., is complementary to it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 15. In some embodiments, the antisense array is capable of binding to both the SRSF6 binding site (UGCGGC) and the SRSF2 binding site (GGCUUGUG) in the STMN2 cryptic exon (i.e., is complementary to or overlaps with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 15.

[0128] In some embodiments, the antisense sequence comprises a sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of SEQ ID NOs: 391, 393, 395, 397, 399, 401, 403, 405, 407 with respect to a sequence having the same number of nucleotides.

[0129] INSR In some embodiments, the TDP-43-regulated cryptic exon is the INSR cryptic exon. The TDP-43-regulated INSR cryptic exon is between exon 6 and exon 7 in the human INSR gene. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 9. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 10.

[0130] In some embodiments, the antisense array can bind to the INSR 3' splice site (i.e., the INSR splice acceptor site), i.e., and its adjacent region, and preferably at this time, the antisense array is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 31. In some embodiments, the antisense array is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 31, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 31, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 31, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 31, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 31, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 31, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 31. In some embodiments, the antisense array can bind to one of the motifs UAUAG / U, AUAG / UA, UAG / UAC, AG / UACC, G / UACCG in the INSR cryptic exon and adjacent region, where / represents the intron / cryptic exon boundary of the INSR cryptic exon.In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 261-277. In some embodiments, the antisense sequence comprises a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43-regulated cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 261-277. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0131] In some embodiments, the antisense sequence can bind at least partially to the TDP-43 binding region of the INSR cryptic exon, or the TDP-43 binding motif, i.e., and / or its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 32 or 33.In some embodiments, the antisense sequence comprises or consists of a 16-nucleotide portion having at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 278-352. In some embodiments, the antisense sequence comprises a nucleotide sequence having 16 and 30 nucleotides that is at least 90% complementary to the TDP-43 regulatory cryptic exon sequence, and at this time, the nucleotide sequence has at least 90% sequence identity, or at least 91% sequence identity, or at least 92% sequence identity, or at least 93% sequence identity, or at least 94% sequence identity, or at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity, or at least 100% sequence identity to one or more of SEQ ID NOs: 278-352. In some embodiments, the nucleotide sequence can consist of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0132] In some embodiments, the antisense sequence is capable of binding at least partially to an exonic sequence enhancer in the INSR cryptic exon defined by ESE finder 3.0, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40. In some embodiments, the antisense sequence is a 16-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40, or a 17-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40, an 18-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40, a 19-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40, or a 20-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40, a 21-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40, or a 22-nucleotide sequence that is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NOs: 34, 35, 36, 37, 38, 39 or 40.

[0133] In some embodiments, the exonic array enhancer is an SRSF1 binding site, and the antisense array is capable of binding to the motif GACACCT or CTGAAGA within the INSR cryptic exon array (i.e., being complementary to or overlapping with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 34 or 35. In some embodiments, the exonic array enhancer is an SRSF2 binding site, and the antisense array is capable of binding to the motif GAAUGAUG or GGCUGAUG within the INSR cryptic exon array (i.e., being complementary to or overlapping with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 36 or 37. In some embodiments, the exonic array enhancer is an SRSF5 binding site, and the antisense array is capable of binding to the motif AUACAAG within the INSR cryptic exon array (i.e., being complementary to or overlapping with it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to SEQ ID NO: 38. In some embodiments, the exonic array enhancer is an SRSF6 binding site, and the antisense array is capable of binding to the motif UACGGG or UGUGUA within the INSR cryptic exon array (i.e., being complementary to it), preferably at this time, the antisense array is at least 90% complementary, or at least 95% complementary, or at least 100% complementary to any one of SEQ ID NO: 39 or 40.

[0134] In some embodiments, the antisense sequence comprises a sequence that is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 95% identical or at least 100% identical to any one of SEQ ID NOs: 409, 411, 413, 415, 417, 419 with respect to a sequence having the same number of nucleotides.

[0135] Other TDP-43-regulated cryptic exons ELAVL3 In some embodiments, the TDP-43-regulated cryptic exon is an ELAVL3 cryptic exon. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 448.

[0136] In some embodiments, the antisense sequence is capable of binding to the ELALV3 3' splice site (i.e., the ELALV3 splice acceptor site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 454.

[0137] In some embodiments, the antisense sequence is capable of binding to the ELALV3 TDP-43 binding region, i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NOs: 455, 456 or 457.

[0138] G3BP1 In some embodiments, the TDP-43-regulated cryptic exon is a G3BP1 cryptic exon. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 449.

[0139] In some embodiments, the antisense sequence is capable of binding to the G3BP1 3' splice site (i.e., the G3BP1 splice acceptor site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 458.

[0140] In some embodiments, the antisense sequence is capable of binding to the G3BP1 TDP-43 binding region, i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 459.

[0141] AARS1 In some embodiments, the TDP-43-regulated cryptic exon is the AARS1 cryptic exon. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 450.

[0142] In some embodiments, the antisense sequence is capable of binding to the AARS1 3' splice site (i.e., the AARS1 splice acceptor site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 460.

[0143] In some embodiments, the antisense sequence is capable of binding to the AARS1 TDP-43 binding region, i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 461 or 462.

[0144] CELF5 In some embodiments, the TDP-43-regulated cryptic exon is the CELF5 cryptic exon. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 451.

[0145] In some embodiments, the antisense sequence is capable of binding to the CELF5 5' splice site (i.e., the CELF5 splice donor site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 463.

[0146] In some embodiments, the antisense sequence is capable of binding to the CELF5 TDP-43 binding region, i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 464, 465, or 466.

[0147] CAMK2B In some embodiments, the TDP-43-regulated cryptic exon is the CAMK2B cryptic exon. In some embodiments, the antisense sequence is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 452.

[0148] In some embodiments, the antisense sequence is capable of binding to the CAMK2B 5' splice site (i.e., the CAMK2B splice donor site), i.e., and its adjacent region, and preferably at this time, the antisense sequence is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 467.

[0149] In some embodiments, the antisense array can bind to the CAMK2B TDP-43 binding region, i.e., and its adjacent region, and preferably at this time, the antisense array is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 468.

[0150] UNC13B In some embodiments, the TDP-43-regulated cryptic exon is the UNC13B cryptic exon. In some embodiments, the antisense array is at least 90% complementary (or at least 95%, or at least 100% complementary) to SEQ ID NO: 453.

[0151] In some embodiments, the antisense array can bind to the UNC13B 5' splice site (i.e., the UNC13B splice donor site), i.e., and its adjacent region, and preferably at this time, the antisense array is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 469.

[0152] In some embodiments, the antisense array can bind to the UNC13B TDP-43 binding region, i.e., and its adjacent region, and preferably at this time, the antisense array is at least 90% complementary, or at least 90% complementary, or at least 100% complementary to SEQ ID NO: 470 or 471.

[0153] A sequence complementary to the binding domain for the hnRNP protein The constructs described herein include sequences containing a binding domain for the hnRNP protein. The term binding domain can be used interchangeably with hnRNP binding site, hnRNP binding sequence or hnRNP binding domain. The sequence containing the binding domain for the hnRNP protein may also be described herein as the hnRNP tail.

[0154] As defined herein and as is known in the art, hnRNP proteins are heterogeneous nuclear ribonucleoproteins. These are a family of RNA-binding proteins that participate in pre-mRNA processing. The definition of hnRNP proteins described herein is not intended to include or encompass the protein TDP-43.

[0155] In preferred embodiments, the hnRNP protein is an hnRNP protein that contains at least two RNA recognition motifs or quasi-RNA recognition motifs. In preferred embodiments, the hnRNP protein is a protein that is endogenously highly expressed in human cells, more particularly in the human cell nucleus. In some embodiments, being endogenously highly expressed means any protein having "high" protein expression or a "high" protein expression score in neurons and / or glial cells in any part of the brain as defined by the human protein atlas (i.e., https: / / www.proteinatlas.org / ). In some embodiments, the part of the brain can be selected from the basal ganglia, hippocampus, cerebellum, cerebral cortex, or combinations thereof. In some embodiments, the protein expression score in any part of the brain can be at least 100, or at least 150, or at least 200, or at least 250, or at least 300, or at least 350 nTPM in the brain, as determined according to the consensus dataset on the human protein atlas, where nTPM refers to the normalized transcript expression value per million.

[0156] In some embodiments, the hnRNP protein is not an hnRNP protein that must form a tetramer (e.g., hnRNP C) and / or an hnRNP that functions by binding on both sides of a cryptic exon to have an inhibitory effect on splicing.

[0157] In some embodiments, the hnRNP protein is selected from hnRNP A and hnRNP H proteins, and the sequences containing the binding domains each contain at least one binding motif for hnRNP A and hnRNP H, respectively. These have been found to more effectively modify splicing compared to other hnRNP proteins tested (e.g., hnRNP C or hnRNP L). In some embodiments, the hnRNP A protein is hnRNP A1 or hnRNP A2. In some examples, the hnRNP A protein is hnRNP A1. hnRNP A1 and hnRNP A2 are the most abundant hnRNPs with substantially the same function and play important roles in the regulation of gene expression at multiple levels.

[0158] In some embodiments, the sequence containing the binding domain for the hnRNP protein is about 8 to 24 nucleotides, preferably about 16 to 22 nucleotides, or about 20 nucleotides. In some embodiments, the binding sequence for the hnRNP protein contains at least 8, preferably at least 16 nucleotides, or at least 17 nucleotides (or 17 nucleotides), or at least 18 nucleotides (or 18 nucleotides), or at least 19 nucleotides (or 19 nucleotides), or at least 20 nucleotides (or 20 nucleotides). In some embodiments, the binding sequence contains one, two or three binding motifs for the hnRNP protein. Exemplary binding motifs are described below.

[0159] In some embodiments, the binding sequence is a binding sequence for hnRNP A (e.g., hnRNP A1 or hnRNP A2). The binding sequence for hnRNP A can be any sequence known in the art to bind to hnRNP A (e.g., hnRNP A1 or hnRNP A2) or can contain any motif. In some embodiments, the binding sequence for hnRNP A (e.g., hnRNP A1 or hnRNP A2) can be determined by immunoprecipitation of hnRNP A1 against the human transcriptome using, for example, CLIP.

[0160] In some embodiments, the binding sequence for the hnRNP A protein (e.g., hnRNP A1 or hnRNP A2) contains at least one or two motifs that include UAGGG. In some embodiments, the binding sequence for hnRNP A1 contains at least one motif that follows WUAGGGWS, where W is A or U and S is C or G, and preferably at this time, the binding sequence for hnRNP A1 contains at least two motifs that follow WUAGGGWS, where W is A or U and S is C or G. In some embodiments, the binding sequence for hnRNP A1 contains at least one or two motifs selected from UAGGG (more preferably UUAGGG, more preferably UAGGGU or UAGGGA, even more preferably UUAGGGUG), or ATAGGGA (more preferably ATAGGGAC). In some embodiments, the binding sequence is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 100% identical to SEQ ID NO: 361 or 389. In some embodiments, the binding sequence for hnRNP A2 contains at least one or two motifs selected from UAGGG, GGUAGUAG, or AGGAUAGA.

[0161] In some embodiments, the binding sequence is a binding sequence for hnRNP H. hnRNP H can include both hnRNP H1 and hnRNP H2. The binding sequence for hnRNP H can be any sequence or motif known in the art to bind to hnRNP H. In some embodiments, the binding sequence for hnRNP H can be determined by immunoprecipitation of hnRNP H against the human transcriptome using, for example, CLIP. In some embodiments, the binding sequence for hnRNP H includes one or two binding motifs including the motif GGGGA. In some embodiments, the binding sequence is at least 80% identical, or at least 85% identical, or at least 90% identical, or at least 100% identical to SEQ ID NO: 376 or 386.

[0162] Function of the construct The constructs described herein are capable of changing the splicing of the TDP-43-regulated cryptic exon. In other words, the constructs described herein are capable of modifying splicing and / or at least partially preventing the inclusion of the TDP-43-regulated cryptic exon in the mature RNA, thereby producing a functional protein.

[0163] The constructs described herein are configured to recruit hnRNP proteins, preferably endogenous hnRNP proteins when present in a cell. The cell can be a cell in which the TDP-43 protein is depleted (i.e., when compared to healthy or wild-type cells), more preferably a cell in which the TDP-43 protein in the nucleus is depleted. The recruitment of hnRNP proteins can at least partially compensate for the loss of TDP-43 in cells where TDP-43 is depleted, where the hnRNP recruitment of hnRNP proteins suppresses the splicing of TDP-43-regulated cryptic exons. In some embodiments, the antisense sequences can at least partially contribute to altering the splicing of TDP-43-regulated cryptic exons by sterically blocking or masking splicing elements.

[0164] In some embodiments, the constructs described herein completely rescue splicing (i.e., defined as 0% cryptic exons present in the mature mRNA product of the cell).

[0165] In some embodiments, the constructs described herein partially rescue splicing, i.e., less than 90% cryptic exons present in the mature mRNA product of the cell, or less than 80%, or less than 70%, or less than 60%, or less than 50%, or less than 40%, or less than 30%, or less than 20%, or less than 10%, or less than 5% as defined. This can be determined by RNA sequencing, RT-qPCR, or RT-PCR. Even a partial rescue of proper splicing can have some therapeutic benefit and can be used to further understand the role of cryptic exons in TDP-43 pathology.

[0166] As defined herein, the cell can be any suitable cell. In a preferred embodiment, the cell is a mammalian cell, more preferably a human cell. In a preferred embodiment, the cell has nuclear depletion of TDP-43. In some embodiments, the cell is a brain cell. In some embodiments, the cell is a neuron or a nerve cell. In some embodiments, the cell is a microglial cell or an astrocyte. In some embodiments, the cell is a muscle cell.

[0167] Vector Also described herein are vectors comprising or encoding a modified U7 snRNA construct as described herein. A vector encoding a modified U7 snRNA construct as described herein comprises a sequence that is the reverse complement of any of the modified U7 snRNA constructs described herein.

[0168] The vector typically includes a promoter upstream of the modified U7 snRNA construct sequence or upstream of the sequence encoding the construct, where the promoter is a UsnRNA promoter. In some examples described herein, the vector additionally includes, downstream of the U7 snRNA expression cassette, one additional expression cassette consisting of a CMV promoter, a blasticidin S deaminase cDNA, and an SV40 polyadenylation signal. This enables the selection of cells that have taken up the vector.

[0169] The vectors described herein also include a 3' box sequence downstream of the construct sequence or the sequence encoding the construct. Any suitable 3' box sequence can be used. In some examples, the vector includes a 3' box sequence having at least 80% sequence identity, or at least 85%, or at least 90%, or at least 95%, or at least 100% sequence identity to SEQ ID NO: 357.

[0170] In some embodiments, the vector comprises an expression cassette, e.g., an inverted terminal repeat (ITR) cassette. In such a system, the vector comprises an array encoding the constructs described herein and one or more inverted terminal repeat (ITR) sequences adjacent to the construct array. In some embodiments, the vector is a viral vector. The viral vector can be a human viral vector or a non-human viral vector (e.g., a primate vector). In some embodiments, the vector is a viral vector such as an adeno-associated (AAV) vector, a retroviral vector, a lentiviral vector, or an adenoviral vector. The viral vector can be an RNA vector or a DNA vector.

[0171] Pharmaceutical composition Also disclosed herein are pharmaceutical compositions comprising one or more of the modified U7 snRNA constructs disclosed herein and / or one or more of the vectors disclosed herein. In some embodiments, the pharmaceutical composition comprises two or more modified U7 snRNA constructs or vectors as defined herein. The two or more constructs or vectors can be capable of binding to the same or different TDP-43-regulated cryptic exons. The two or more constructs or vectors can comprise different sequences including different antisense sequences and / or hnRNP-binding domains. In some embodiments, the different antisense sequences can be capable of binding to different splicing elements.

[0172] The pharmaceutical composition can further comprise a pharmaceutical excipient.

[0173] Therapy and medicine The modified U7 snRNA constructs of the present disclosure, the vectors of the present disclosure, or the pharmaceutical compositions of the present disclosure can be for use in therapy (i.e., as a therapeutic agent for treating a disease). The therapeutic use of the constructs of the present disclosure can involve a change in the splicing of an endogenously present pre-RNA to at least partially prevent the inclusion of a TDP-43-regulated cryptic exon in the mature RNA of a cellular transcript. Since the absence of the TDP-43-regulated cryptic exon in the mature RNA transcript leads to the production of a fully functional protein, this provides protection from the disease.

[0174] The modified U7 snRNA constructs of the present disclosure, the vectors of the present disclosure, or the pharmaceutical compositions of the present disclosure are for use, for example, in therapy, for use as a medicament, or can be used as a medicament.

[0175] The modified U7 snRNA constructs of the present disclosure, the vectors of the present disclosure, or the pharmaceutical compositions of the present disclosure can be for use in the treatment of diseases associated with TDP-43 pathology or dysfunction. In some embodiments, the disease is a neurodegenerative disease or a neuromuscular disease. In an embodiment, the neurodegenerative disorder is associated with reduced nuclear TDP-43. In an embodiment, the neurodegenerative disorder is caused by mislocalization of TDP-43 between the nucleus and the cytoplasm. In an embodiment, the neurodegenerative disorder is associated with TDP-43 pathology (e.g., pathological TDP-43).

[0176] In embodiments, a construct, vector, or pharmaceutical composition for a method of use or treatment includes a step of first diagnosing a subject having a neurodegenerative disorder associated with TDP-43 pathology. In embodiments, this is determined using a biomarker of TDP-43 pathology. In embodiments, this can be determined by genetics, e.g., gene mutations. In embodiments, TDP-43 pathology associated with ALS can be determined if FUS and SOD1 mutations are not found in the subject. In embodiments, TDP-43 pathology associated with FTD can be determined if C9orf72 or PGRN mutations are not found in the subject. In embodiments, a biomarker of TDP-43 pathology includes mutant TDP-43. In some embodiments, TDP-43 pathology can be determined by TDP-43 phosphorylation. In some embodiments, TDP-43 pathology can be determined by the expression of the STMN2 cryptic exon that can be determined by RNA-seq. In embodiments, a construct, vector, or pharmaceutical composition for a method of use or treatment includes a step of first identifying in the subject whether or not the subject carries an SNP variant associated with rs12973192 and / or rs12608932 prior to the method of treatment. This can be determined by genomics.

[0177] In embodiments, the disorder (i.e., neurodegenerative disorder) can be selected from ALS, frontotemporal dementia, Alzheimer's disease, inclusion body myositis / myopathy (IBM), FOSMNN (faciobrachial sensory and motor neuronopathy), Perry syndrome, limbic-predominant age-related TDP-43 encephalopathy (LATE), or combinations thereof.

[0178] In an embodiment, the neurodegenerative disorder is ALS (amyotrophic lateral sclerosis). ALS is a chronic and fatal motor neuron disease (MND), and may be alternatively referred to as MND, Charcot's disease, or Lou Gehrig's disease. In some embodiments, ALS can be ALS that is familial ALS or sporadic (idiopathic) ALS. Familial ALS (FALS) is ALS that is inherited in a family and accounts for about 10% of ALS cases. Sporadic ALS is non-familial ALS. In an embodiment, ALS can be not ALS-FUS and ALS-SOD1, which are genetically defined forms of ALS. The constructs, vectors, or pharmaceutical compositions for the uses or treatment methods described herein can improve one or more symptoms associated with ALS. Symptoms of ALS include fasciculations (muscle twitches); muscle spasms; stiff and rigid muscles (spasticity), muscle weakness, slurred and nasal speech, and difficulty chewing or swallowing. ALS results in progressive deterioration of muscle function and often ultimately leads to death due to respiratory failure. In an embodiment, the TDP-43-regulated cryptic exon is the UNC13A TDP-43-regulated cryptic exon, and the neurodegenerative disorder is ALS. In another embodiment, the TDP-43-regulated cryptic exon is the STMN2 TDP-43-regulated cryptic exon, and the neurodegenerative disorder is ALS.

[0179] In an embodiment, the neurodegenerative disorder is frontotemporal dementia (FTD). Frontotemporal dementia is a type of dementia that affects the frontal and temporal lobes of the brain. The constructs, vectors, or pharmaceutical compositions for the uses or treatment methods described herein can improve one or more symptoms associated with FTD. Symptoms of FTD include changes in personality and behavior, language problems, problems with mental ability, memory problems, and physical problems (e.g., difficulties with movement). FTD can be characterized by frontotemporal lobar degeneration (FTLD). FTLD can be FTLD-TDP, which is associated with TDP-43 pathology. This can be characterized by ubiquitin- and TDP-43-positive, tau-negative, FUS-negative inclusions. FTLD-TDP can be of type A, B, C, or D. Type A is a type of FTLD-TDP that exhibits small neurites and intracytoplasmic inclusions in the upper (superficial) cortical layer. Intranuclear rod-shaped inclusions may also be seen, but the number is relatively small. Type B is a type of FTLD-TDP that exhibits neuronal and glial intracytoplasmic inclusions in both the upper (superficial) and lower (deep) cortical layers, as well as in lower motor neurons. Intranuclear inclusions may be absent or relatively few in number. Type B can be associated with ALS and C9ORF92 mutations. Type C is a type of FTLD-TDP that exhibits long neurite profiles found in the superficial cortical layer. Intracytoplasmic, intranuclear, or glial intracytoplasmic inclusions may be relatively few in number or absent. FTLD-TDP is often associated with semantic dementia. Type D is a type of FTLD-TDP that exhibits intranuclear inclusions and dystrophic neurites. Inclusions may not be seen in the granular cell layer of the hippocampus. Type D may be associated with VCP mutations. In an embodiment, FTLD can be not of the FTLD-FUS type or the FTLD-tau type. In an embodiment, the TDP-43 regulatory cryptic exon is the UNC13A TDP-43 regulatory cryptic exon, and the neurodegenerative disorder is FTD.In another embodiment, the TDP-43-regulated cryptic exon is the STMN2 TDP-43-regulated cryptic exon, and the neurodegenerative disorder is FTD.

[0180] Also disclosed herein is a method of treating a disease associated with TDP-43 dysfunction (e.g., a neurodegenerative disorder or a myopathy), comprising administering to a subject in need thereof a therapeutically effective amount of a construct, vector, or pharmaceutical composition disclosed herein.

[0181] The constructs, vectors, or pharmaceutical compositions described herein for use or in a method of treatment can be used to prevent and / or restore the loss of functionality of a particular protein regulated by TDP-43 splicing. In some embodiments, the constructs, vectors, or pharmaceutical compositions described herein for use or in a method of treatment can be used to prevent and / or restore the loss of functionality of a gene comprising a TDP-43-regulated cryptic exon. This can be any of the genes described herein, such as UNC13A, STMN2, or INSR.

[0182] The constructs, vectors, or pharmaceutical compositions as described herein for use or when used as a medicament or in a method of treatment can be administered to any suitable subject. In a preferred embodiment, the subject is human. In an embodiment, the subject carries an SNP variant associated with rs12973192 and / or rs12608932. The human subject can be of any suitable age, e.g., an infant (less than 1 year old), a pediatric subject (less than 18 years old) including adolescence (inclusively 10 - 18 years old), or an adult (over 18 years old) including an elderly subject (over 65 years old).

[0183] The constructs, vectors, or pharmaceutical compositions as described herein for use or when used as a medicament or in a method of treatment can be administered using any suitable mode of administration.

[0184] Method of Use The present disclosure provides methods for the use of the constructs, vectors, and pharmaceutical compositions of the present disclosure. These methods can be in vivo or in vitro methods.

[0185] Constructs, vectors, and pharmaceutical compositions (pharmaceutical compositions re) can be used to regulate gene expression at multiple levels. Some aspects of the present disclosure provide methods for the regulation of gene expression in cells, including the step of administering a construct, vector, or pharmaceutical composition described herein to a cell. In some embodiments, gene expression is regulated at the transcriptional level, or post-transcriptional level, or translational level, or post-translational level.

[0186] A method of altering the splicing of a TDP-43-regulated cryptic exon, comprising the step of delivering to a cell a construct described herein, a vector described herein, or a pharmaceutical composition described herein, wherein the method comprises contacting the construct with the cell to alter the splicing of the TDP-43-regulated cryptic exon, is disclosed herein.

[0187] A method of altering the splicing of an UNC13A cryptic exon, comprising the step of delivering to a cell a construct described herein, a vector described herein, or a pharmaceutical composition described herein, each comprising an antisense sequence that is at least 90% complementary to SEQ ID NO: 1 or 2, wherein the method comprises contacting the construct with the cell to alter the splicing of the UNC13A cryptic exon, is disclosed herein. In some embodiments, the antisense sequence is at least 90% complementary to SEQ ID NO: 3 or 4.

[0188] A method of altering the splicing of STMN2 cryptic exon 2a, comprising delivering to a cell a construct described herein, a vector described herein, or a pharmaceutical composition described herein, each comprising an antisense sequence that is at least 90% complementary to SEQ ID NO: 7, the method comprising contacting the construct with the cell to alter the splicing of STMN2 cryptic exon 2a, is disclosed herein.

[0189] A method of altering the splicing of an INSR cryptic exon, comprising delivering to a cell a construct described herein, a vector described herein, or a pharmaceutical composition described herein, each comprising an antisense sequence that is at least 90% complementary to SEQ ID NO: 9, the method comprising contacting the construct with the cell to alter the splicing of INSR cryptic exon 2a, is disclosed herein.

[0190] A method of preventing the inclusion of a TDP-43-regulated cryptic exon in the mature mRNA of a cellular transcript, comprising delivering to a cell a construct described herein, a vector described herein, or a pharmaceutical composition described herein, the method comprising contacting the construct with the cell to prevent the inclusion of the TDP-43-regulated cryptic exon in the mature mRNA of the cellular transcript, is disclosed herein.

[0191] Composite vector According to a sixth aspect of the present invention, there is provided a composite vector comprising two or more of the constructs described herein or of the constructs of the first aspect of the present invention (i.e., in tandem or one downstream of the other, whereby the composite vector comprises at least two constructs each comprising one antisense sequence as defined herein and each comprising a sequence comprising a binding domain for an hnRNP protein as defined herein). In a preferred embodiment, the two or more modified U7 snRNA constructs are capable of binding to different TDP-43-regulated cryptic exons described herein (i.e., at least 90%, or at least 95%, or 100% complementary thereto) and comprise different antisense sequences. In some embodiments, the composite vector can comprise three or more constructs as defined herein. In some embodiments, the composite construct comprises two or more antisense sequences that are complementary (i.e., at least 90% complementary, or at least 95% complementary, or 100% complementary) to two or more TDP-43-regulated cryptic exon sequences or adjacent regions thereof. In some embodiments, the TDP-43-regulated cryptic exon is selected from one of the TDP-43-regulated cryptic exons defined herein. In some embodiments, each antisense sequence is a sequence that is complementary (i.e., 90%, 95% or 100% complementary) to SEQ ID NO: 1, 2, 3, 4, 7, 9, or 448-453. In some embodiments, at least one of the antisense sequences, or each antisense sequence, is complementary to the TDP-43 binding region of the TDP-43-regulated cryptic exon, and preferably at this time, at least one of the antisense sequences, or each antisense sequence, is complementary (i.e., 90%, 95% or 100% complementary) to SEQ ID NO: 12, 23-26 or 32.In some embodiments, the composite vector comprises a construct as defined herein that includes an antisense sequence that is at least 90% complementary to the UNC13A TDP-43-regulated cryptic exon or an adjacent region thereof and a construct as defined herein that includes an antisense sequence that is at least 90% complementary to the STMN2 TDP-43-regulated cryptic exon or an adjacent region thereof. In some embodiments, the composite vector comprises a construct as defined herein that includes an antisense sequence that is at least 90% complementary to the UNC13A TDP-43-regulated cryptic exon or an adjacent region thereof and a construct as defined herein that includes an antisense sequence that is at least 90% (or 95% or 100%) complementary to the INSR TDP-43-regulated cryptic exon or an adjacent region thereof. In some embodiments, the composite vector comprises a construct as defined herein that includes an antisense sequence that is at least 90% (or 95% or 100%) complementary to the STMN2 TDP-43-regulated cryptic exon or an adjacent region thereof and a construct as defined herein that includes an antisense sequence that is at least 90% (or 95% or 100%) complementary to the INSR TDP-43-regulated cryptic exon or an adjacent region thereof. In some embodiments, the composite vector comprises a construct that includes an antisense sequence that is at least 90% (or 95% or 100%) complementary to the UNC13A TDP-43-regulated cryptic exon or an adjacent region thereof, a construct that includes an antisense sequence that is at least 90% (or 95% or 100%) complementary to the STMN2 TDP-43-regulated cryptic exon or an adjacent region thereof, and a construct that includes an antisense sequence that is at least 90% (or 95% or 100%) complementary to the INSR TDP-43-regulated cryptic exon or an adjacent region thereof.

[0192] In some embodiments, the composite vector comprises two or more constructs as defined herein, wherein two or more sequences comprising a binding domain for an hnRNP protein can follow any of the sequences as described herein. In some embodiments, two or more sequences comprising a binding domain for an hnRNP protein can be different or identical. In some embodiments, two or more sequences comprising a binding domain for an hnRNP protein can be a binding domain for an hnRNP A or hnRNP H protein, and in some instances, an hnRNP A protein.

[0193] In some embodiments, the composite vector comprises two or more promoter sequences, wherein the two or more promoter sequences are upstream of each construct. The promoter can be any promoter sequence used in the art. In some embodiments, each of the two or more promoter sequences is the same or different. In some embodiments, the composite vector comprises two or more 3' box sequences, wherein the two or more 3' box sequences are downstream of each construct. The 3' box sequences can be the same or different and can be any 3' box sequence used in the art.

[0194] In some embodiments, the composite vector comprises two or more U7 cassettes, wherein each cassette comprises a promoter, a modified U7 snRNA construct as defined herein, and a 3' box sequence, wherein the promoter is upstream of the modified U7 snRNA construct and the 3' box sequence is downstream of the modified U7 snRNA construct. In some embodiments, the composite vector comprises a stuffer sequence between each of the two or more U7 cassettes. The stuffer sequence functions to separate two promoters. The stuffer sequence can be any suitable stuffer sequence used in the art.

[0195] In some embodiments, the composite vector comprises, at least (from upstream to downstream): The first promoter, a first modified U7 modified RNA construct as defined herein, a first 3' box sequence, a stuffer sequence, a second promoter, a second modified U7 modified RNA construct as defined herein, and a second 3' box sequence comprising.

Example

[0196] All of the modified U7 snRNA constructs described in the examples are U7 smOPT constructs designed to target the TDP-43-regulated cryptic exon sequence to restore proper splicing in TDP-43 depleted cells. The U7 smOPT construct comprises (i) a binding sequence for hnRNP, (ii) an antisense sequence designed to target the TDP-43-regulated cryptic exon and its flanking region, and (iii) a modified Sm sequence (e.g., the smOPT sequence).

[0197] UNC13A One such TDP-43-regulated cryptic exon is in the gene UNC13A and is located between exons 20 and 21. SEQ ID NO: 1 shows a portion of the UNC13A transcribed pre-mRNA intronic sequence comprising the cryptic exon sequence and its flanking region of the TDP-43 binding region near the cryptic exon as determined by iCliP. The relatively short cryptic exon sequence is italicized and the relatively long cryptic exon sequence is underlined. Lowercase bases indicate bases immediately adjacent to the splice donor site (gu) and splice acceptor site (ag). ESE targets identified by ESE finder 3.0 are shown in bold.

[0198]

Drawing

[0199] The ESE target corresponds to the binding site for SR proteins, and these motifs are as follows: SRSF5 (ACUCAGG), SRSF1 (CUCAGGA), SRSF6 (UGUGUC), and SRSF2 (GUUUCCUG).

[0200] SEQ ID NO: 1 is reproduced again below. Here, the SNPs are located at positions rs12973192 (i.e., within the UNC13A CE sequence) and rs12608932 (i.e., within the intronic region), are underlined, and the TDP-43 binding region is shown in bold (i.e., as determined by iCLIP data).

[0201]

Chemical formula

[0202] The splice sites are defined as follows: the long hidden acceptor is the phosphodiester bond between chr19:17,642,591 and 17,642,592; the short hidden acceptor is the phosphodiester bond between chr19:17,642,541 and 17,642,542, and the hidden donor is the phosphodiester bond between chr19:17,642,413 and 17,642,414.

[0203] SEQ ID NO: 1 includes the minor or major allele of the SNP (i.e., the risk variant) at rs12973192 and / or rs12608932, and thus SEQ ID NO: 1 also includes sequences containing the SNP at these positions (e.g., G at rs12973192 is replaced by C as defined by SEQ ID NO: 2).

[0204] SEQ ID NO: 3 shows a relatively short portion of the UNC13A transcribed pre-mRNA intronic sequence, including the hidden exon sequence and its adjacent regions.

[0205]

Chemical formula

[0206] SEQ ID NO: 3 encompasses the minor or major allele of the SNP (i.e., the risk variant) at rs12973192 and / or rs12608932, and thus SEQ ID NO: 3 also encompasses the sequence in which G at rs12973192 is replaced by C. This is defined by SEQ ID NO: 4.

[0207] SEQ ID NO: 5 corresponds to the relatively short transcribed UNC13A cryptic exon sequence, UNC13A mRNA - coding chr19:17642414~17,642,541.

[0208] SEQ ID NO: 5 has the following sequence:

[0209]

Chem.

[0210] SEQ ID NO: 5 encompasses the minor allele, or the major allele of the SNP (i.e., the risk variant) at rs12973192, and thus SEQ ID NO: 5 also encompasses the sequence in which G at rs12973192 is replaced by C.

[0211] SEQ ID NO: 6 corresponds to the relatively long UNC13A cryptic exon sequence in the transcribed UNC13A mRNA - coding chr19:17642414~17642591.

[0212] SEQ ID NO: 6 has the following sequence:

[0213]

Chem.

[0214] SEQ ID NO:6 can include the risk variant (i.e., the minor allele) of the SNP at rs12973192, or the major allele, and thus SEQ ID NO:6 also includes the sequence in which G at rs12973192 is replaced by C.

[0215] STMN2 Another TDP-43-regulated cryptic exon is within the gene STMN2 and corresponds to exon 2a of the STMN2 gene.

[0216] SEQ ID NO:7 shows a portion of the STMN2 transcribed pre-mRNA intronic sequence and a portion of the cryptic exon sequence 2a. Lowercase bases indicate bases immediately adjacent to the splice acceptor site (ag). The polyA site is indicated by underlining. ESE targets identified by ESE finder 3.0 are shown in bold. The TDP-43 binding motif is shown underlined.

[0217]

Chemical formula

[0218] ESE targets in the STMN2 cryptic exon and its adjacent region correspond to binding sites for SRSF1 (CAGAAGA), SRSF2 (GGCUUGUG), SRSF5 (UGACAAG), and SRSF6 (UGCGGC).

[0219] SEQ ID NO:8 shows the STMN2 cryptic exon 2a. It has a genomic location. chr8:79,616,822~79,617,048

[0220]

Chemical formula

[0221] INSR Array number 9 shows a part of the INSR transcribed pre-mRNA intronic sequence containing a hidden exon corresponding to the genomic position chr19, complement: 7169720 - 716983. Lowercase bases indicate the bases immediately adjacent to the splice acceptor site (ag). ESE targets identified by ESE finder 3.0 are shown in bold. The TDP-43 binding motif is underlined.

[0222]

Chem.

[0223] The ESE targets correspond to the binding sites for SRSF1 (GACACCT and CTGAAGA), SRSF2 (GAAUGAUG and GGCUGAUG), SRSF5 (AUACAAG) and SRSF6 (UACGGG and UGUGUA).

[0224] Array number 10 shows the INSR hidden exon.

[0225]

Chem.

[0226] ELALV3 Array number 448 shows a part of the ELAVL3 transcribed pre-mRNA intronic sequence containing a hidden exon corresponding to the genomic position chr19, complement: 11463496 - 11463662.

[0227] Lowercase bases indicate the bases immediately adjacent to the splice acceptor site (ag). The TDP-43 binding region is underlined.

[0228]

Chem.

[0229] G3BP1 Sequence number 449 shows a part of the intronic sequence of the G3BP1 transcribed pre-mRNA containing a hidden exon corresponding to the genomic position chr5, complement: 151787765 - 151787794.

[0230] Lowercase bases indicate the bases immediately adjacent to the splice acceptor site (ag). The TDP-43 binding region is underlined.

[0231]

Chemical formula

[0232] AARS1 Sequence number 450 shows a part of the intronic sequence of the AARS1 transcribed pre-mRNA containing a hidden exon corresponding to the genomic position chr16, complement: 70272796 - 70272882.

[0233] Lowercase bases indicate the bases immediately adjacent to the splice acceptor site (ag). The TDP-43 binding region is underlined.

[0234]

Chemical formula

[0235] CELF5 Sequence number 451 shows a part of the intronic sequence of the CELF5 transcribed pre-mRNA containing a hidden exon corresponding to the genomic position chr19, complement: 3278209 - 3278316.

[0236] Lowercase bases indicate the bases immediately adjacent to the splice donor site (gu). The TDP-43 binding region is underlined.

[0237]

Chemical formula

[0238] CAMK2B SEQ ID NO: 452 shows a portion of a CAMK2B transcribed pre-mRNA intronic sequence containing a cryptic exon corresponding to genomic positions chr7, complement: 44258490-44258514.

[0239] Lowercase bases indicate bases immediately adjacent to the splice donor site (gu). The TDP-43 binding region is underlined.

[0240]

Chemical formula

[0241] UNC13B SEQ ID NO: 453 shows a portion of an UNC13B transcribed pre-mRNA intronic sequence containing a cryptic exon corresponding to genomic positions chr9, complement: 35,364,545-35,364,567. Lowercase bases indicate bases immediately adjacent to the splice donor site (gu). The TDP-43 binding region is underlined.

[0242]

Chemical formula

[0243] Exemplary target sequences for splicing elements in TDP-43-regulated cryptic exons The following sequences containing the target sequences. The antisense sequences used in the constructs of the present invention can include sequences that are at least 90%, or at least 95%, or at least 100% complementary to these target sequences.

[0244]

Table 1

[0245] Exemplary antisense sequences for splicing elements in a TDP-43-regulated cryptic exon Exemplary antisense sequences targeting the STMN2 3' splice site / splice acceptor site

[0246] [Table 2]

[0247] Exemplary antisense sequences targeting the STMN2 TDP-43 binding region and / or its adjacent region

[0248] [Table 3] TIFF2025518378000026.tif115164

[0249] Exemplary antisense sequences targeting the first UNC13A 3' splice site / splice acceptor site

[0250] [Table 4]

[0251] Exemplary antisense sequences targeting the second UNC13A 3' splice site / splice acceptor site

[0252] [Table 5] TIFF2025518378000029.tif47165

[0253] Exemplary antisense sequences targeting the UNC13A 5' splice site / splice donor site

[0254] [Table 6]

[0255] Exemplary antisense sequences targeting the UNC13A TDP-43 binding region and / or its adjacent region

[0256] [Table 7] TIFF2025518378000032.tif248163TIFF2025518378000033.tif122164

[0257] Exemplary antisense sequences targeting the INSR 3' splice site / splice acceptor site

[0258] [Table 8]

[0259] Exemplary antisense sequences targeting the INSR TDP-43 binding region and / or its adjacent region

[0260] [Table 9] TIFF2025518378000036.tif250165TIFF2025518378000037.tif40164

[0261] Exemplary U7 smOPT sequences Example 1: UNC13A bifunctional construct Exemplary U7 SmOPT bifunctional constructs designed to target the TDP-43-regulated cryptic exon of UNC13A contained the following U7 smOPT snRNA sequences: SEQ ID NO: 358

[0262]

Chem.

[0263] The U7 SmOPT core expression cassette containing the above snRNA sequence was generated by gene synthesis and cloned into pUC-Simple (General Biosystems) or pMK vector (GeneArt, Life technologies), followed by a CMV promoter driving the f1 origin and blasticidin resistance cDNA, followed by an SV40 polyadenylation signal: The complete U7 SmOPT cassette for Example 1 is as follows (SEQ ID NO: 359):

[0264]

Chem.

[0265] This contains the following components: Mouse U7 promoter (which initiates transcription; only UsnRNA promoters can drive the expression of U snRNAs, but a promoter with a different sequence than the following exemplary sequence can be used - SEQ ID NO: 41

[0266]

Chem.

[0267] Transcription start site A (immediately before the underlined section, shown highlighted above) hnRNP A1 binding sequence Sequence number 361 UAUGAUAGGGACUUAGGGUG Antisense sequence Sequence number 420 UUCAUCUGUUCAAUCAUUCAUUC Modified Sm sequence Sequence number 355 AAUUUUUGGAG 3' hairpin Sequence number 356 CAGGUUUUCUGACUUCGGUCGGAAAACCCCU 3' box (for 3' end formation of snRNA) Sequence number 357 GUCUACAAUGAAAG

[0268] The antisense sequence and the hnRNP binding sequence replace the 5' end of unmodified (i.e., endogenous or wild-type) U7 snRNA that contacts the histone downstream element of replication-dependent histone pre-mRNA through complementary base pairing.

[0269] The antisense sequence enables the binding of the construct to the TDP-43-regulated exon, while the presence of the binding domain for hnRNP A1 is designed to recruit endogenous hnRNP A1 in cells and suppress the splicing of the cryptic exon sequence, fulfilling the role of TDP-43 to prevent its inclusion in the mature mRNA product of UNC13A.

[0270] Other alternative examples regarding the bifunctional U7 smOPT construct targeting the UNC13A cryptic exon are described below. The same expression cassette was described above, but differed from Example 1 in terms of the properties of either the hnRNP tail / binding sequence and / or the antisense sequence.

[0271] Example 1B: This construct similarly contains a different antisense sequence (shown in bold) designed to target the TDP-43 binding region for the UNC13A cryptic exon, and the same hnRNP A1 binding sequence as for Example 1 (shown in italics).

[0272]

Table 10

[0273] Example 1C: This construct similarly contains a different antisense sequence (shown in bold) designed to target the TDP-43 binding domain for the UNC13A cryptic exon, and the same hnRNP A1 binding sequence (shown in italics) as for Example 1.

[0274]

Table 11

[0275] Example 1D: This construct similarly contains a different antisense sequence (shown in bold) designed to target the TDP-43 binding domain for the UNC13A cryptic exon, and the same hnRNP A1 binding sequence (shown in italics) as for Example 1.

[0276]

Table 12

[0277] Example 1E: This construct similarly contains a different antisense sequence (shown in bold) designed to target the TDP-43 binding domain for the UNC13A cryptic exon, and the same hnRNP A1 binding sequence (shown in italics) as for Example 1.

[0278]

Table 13

[0279] Example 1F: This construct also contains different antisense sequences (shown in bold) designed to target the TDP-43 binding domain for the UNC13A cryptic exon, and the same hnRNP A1 binding sequence (shown in italics) as for Example 1.

[0280]

Table 14

[0281] Example 1G: This construct also contains different antisense sequences (shown in bold) designed to target the TDP-43 binding domain for the UNC13A cryptic exon, and the same hnRNP A1 binding sequence (shown in italics) as for Example 1.

[0282]

Table 15

[0283] Example 1H: This construct contains different antisense sequences (shown in bold) designed to target the ESEs within the UNC13A cryptic exon, and the same hnRNP A1 binding sequence (shown in italics) as for Example 1.

[0284]

Table 16

[0285] Example 1I: This construct contains the same antisense sequence (shown in bold) as in Example 1 designed to target the TDP-43 binding domain for the UNC13A cryptic exon, but contains a different exemplary hnRNP H binding sequence instead.

[0286]

Table 17

[0287] Example 1L: This construct contains the same antisense sequence (shown in bold) as Example 1 for targeting the TDP-43 binding domain related to the UNC13A cryptic exon, but instead contains a different exemplary hnRNP C binding sequence (shown in italics).

[0288] [Table 18] TIFF2025518378000052.tif19161

[0289] Example 1M: This construct contains the same antisense sequence (shown in bold) as Example 1 for targeting the TDP-43 binding domain related to the UNC13A cryptic exon, but instead contains a different exemplary hnRNP L binding sequence (shown in italics).

[0290] [Table 19]

[0291] Example 1N: This construct contains a different antisense sequence (shown in bold) for targeting the 3' splice site related to UNC13A, but contains the same hnRNP A1 binding sequence as Example 1.

[0292] [Table 20]

[0293] Example 1O: This construct contains a different antisense sequence (shown in bold) for targeting the 5' splice site related to UNC13A, but contains the same hnRNP A1 binding sequence as Example 1. This sequence also overlaps with and targets the TDP-43 binding sequence.

[0294] [Table 21] TIFF2025518378000056.tif25161

[0295] Example 1P: This construct contains the same antisense sequence (shown in bold) as Example 1 for targeting the TDP-43 binding domain related to the UNC13A cryptic exon, but contains a different exemplary hnRNP H binding sequence (shown in italics).

[0296]

Table 22

[0297] Example 1Q: This construct contains the same antisense sequence (shown in bold) as for targeting the TDP-43 binding domain related to the UNC13A cryptic exon, but contains a different exemplary hnRNP A1 binding sequence (shown in italics).

[0298]

Table 23

[0299] Example 1R: This Comparison Example construct contains an antisense sequence designed to target the 5' splice site of the UNC13A cryptic exon and the TDP-43 binding sequence, but does not contain an hnRNP A1 binding sequence. The antisense sequence is shown in bold. This contains the same antisense sequence as Example 1O.

[0300]

Table 24

[0301] Example 2: STMN2 bifunctional construct An exemplary U7 SmOPT bifunctional construct designed to target the TDP-43-regulated cryptic exon of STMN2 (corresponding to exon 2a) contained the following U7 smOPT snRNA sequence: This included the antisense sequence SEQ ID NO: 391 AUGCUCACACAGAGAGCCAAAUUC (underlined above) designed to target the TDP-43 binding domain for the UNC13A cryptic exon.

[0302] The construct also contained an exemplary hnRNP A1 binding sequence (SEQ ID NO: 361, italicized above).

[0303] Other alternative examples for bifunctional U7 smOPT constructs targeting the STMN2 2a cryptic exon are described below.

[0304] Example 2B: This construct contained a different antisense sequence (shown in bold) designed to target the TDP-43 binding domain for the STMN2 cryptic exon, and an hnRNP A1 binding sequence (shown in italics).

[0305] [Table 25]

[0306] Example 2C: This construct contained a different antisense sequence (shown in bold) designed to target the TDP-43 binding domain for the STMN2 cryptic exon, and an hnRNP A1 binding sequence (shown in italics).

[0307] [Table 26] TIFF2025518378000062.tif26161

[0308] Example 2D: This construct contains different antisense sequences (shown in bold) designed to target the TDP-43 binding domain for the STMN2 hidden exon, and an hnRNP A1 binding sequence (shown in italics).

[0309] [Table 27]

[0310] Example 2E: This construct contains different antisense sequences (shown in bold) designed to target the TDP-43 binding domain for the STMN2 hidden exon, and an hnRNP A1 binding sequence (shown in italics).

[0311] [Table 28]

[0312] Example 2F: This construct contains different antisense sequences (shown in bold) designed to target the TDP-43 binding domain for the STMN2 hidden exon, and an hnRNP A1 binding sequence (shown in italics).

[0313] [Table 29] TIFF2025518378000066.tif26161

[0314] Example 2G: This construct contains different antisense sequences (shown in bold) designed to target the TDP-43 binding domain for the STMN2 hidden exon, and an hnRNP A1 binding sequence (shown in italics).

[0315] [Table 30]

[0316] Example 2H: This construct contains different antisense sequences (shown in bold) designed to target the ESE within the STMN2 cryptic exon, and an hnRNP A1 binding sequence (shown in italics).

[0317]

Table 31

[0318] Example 2I: This construct contains different antisense sequences (shown in bold) designed to target the 3' splice site of the STMN2 cryptic exon, and an hnRNP A1 binding sequence (shown in italics).

[0319]

Table 32

[0320] Example 2J: This Comparison Example construct contains an antisense sequence designed to target the 3' splice site of the STMN2 cryptic exon, but does not contain an hnRNP A1 binding sequence. The antisense sequence is shown in bold.

[0321]

Table 33

[0322] Example 3: INSR bifunctional construct The following U7 smOPT snRNA sequences were also designed to target the INSR TDP-43-regulated cryptic exon. Each sequence contains an antisense sequence (shown in bold) targeting the TDP-43 binding region or its adjacent region, and a binding sequence for hnRNP A1 (SEQ ID NO: 361, shown in italics).

[0323]

Table 34

[0324] Composite U7 vector construct example A composite U7 vector construct was designed that included a U7 construct cassette corresponding to Example 1O targeting UNC13A, a U7 construct cassette corresponding to Example 2C targeting STMN2, and a U7 construct cassette corresponding to Example 3C targeting INSR, separated by a stuffer sequence (shown in bold below).

[0325]

Table 35

[0326] Results and discussion "Dual-functional" U7 smOPT targeting the UNC13A cryptic exon The exemplary construct of the present invention (corresponding to Example 1) was found to almost perfectly rescue UNC13A splicing in electroporated SH-SY5Y cells with TDP-43 knockdown. As described above, the exemplary construct included an antisense sequence targeting the UNC13A cryptic exon within the TDP-43 binding region (i.e., as determined by iCLIP data) upstream of the UNC13A 5' donor splice site, while additionally containing a high-affinity binding site for the splicing repressor hnRNP A1.

[0327] More specifically, SH-SY5Y cells with doxycycline-inducible TDP-43 knockdown were electroporated with either the U7 SmOPT control plasmid or the UNC13A bifunctional U7 SmOPT construct in the presence of TDP-43 shRNA. TDP-43 knockdown resulted in the emergence of cryptic splicing of UNC13A. This was almost completely rescued by the expression of the bifunctional U7 SmOPT construct. Figure 2 (upper panel) shows the almost complete disappearance of the band corresponding to cryptic splicing and the emergence of a relatively strong band corresponding to the properly spliced mature mRNA product.

[0328] Figure 3 alternatively shows the rescue of splicing in TDP-43 knockdown SK-N-DZ cells transfected with the UNC13A minigene and the construct of Example 1 of the present invention. This was demonstrated using RT-PCR. Here again, Figure 3 shows the almost complete disappearance of the band corresponding to cryptic splicing and the emergence of a relatively strong band corresponding to the properly spliced mature mRNA product for cells treated with the bifunctional U7 construct of the present invention.

[0329] Figure 4 shows the quantification of properly spliced mature RNA (leftmost bar), mature RNA containing the short UNC13A cryptic exon (central bar), and mature RNA containing the long UNC13A cryptic exon (rightmost bar) in TDP-43 knockdown SK-N-DZ cells. This demonstrates that in TDP-43-depleted cells treated with the construct of the present invention, all or almost all of the mature mRNA products are properly spliced.

[0330] Figure 5 shows splicing rescue by RT-PCR of SH-SY5Y cells with TDP-43 knockdown, which contain mature RNA derived from endogenous UNC13A and were electroporated with the construct of Example 1 of the present invention. Figure 6 shows the differential splicing of properly spliced mature RNA (leftmost bar), mature RNA containing the short UNC13A cryptic exon (central bar), and mature RNA containing the long UNC13A cryptic exon (rightmost bar) in these cells. This demonstrates that in TDP-43-depleted cells treated with the construct of the present invention, most of the mature mRNA products are properly spliced.

[0331] Additional examples (Examples 1B - 1G) with different antisense sequences targeting the TDP-43 binding region were next tested, along with Example 1, to examine whether they could also rescue UNC13A cryptic exon splicing. This experiment was conducted by focusing on the splicing of the UNC13A minigene in 293T cells with TDP-43-inducible knockdown. Figure 7A demonstrates that all of the constructs tested rescued splicing when calculated by obtaining the ratio of cryptic exon-containing RNA to properly spliced RNA, normalized to GAPDH mRNA, compared to control-treated TDP-43 knockdown in 293T cells. Although certain sequences were found to be more effective than others in correcting splicing, this figure demonstrates that the rescue effect is not restricted to the targeting of specific sequences. Interestingly, the efficiency of cryptic exon suppression appears to correlate with proximity to the TDP-43 motif, and Example 1G is the most efficient in suppressing cryptic exon inclusion.

[0332] The efficiency of bifunctional constructs targeting different splicing elements was also tested. More specifically, Example 1H that alternatively targets different parts of the UNC13A cryptic exon and its adjacent regions at the 3' splice site. This construct was also shown to effectively rescue splicing (see Figure 7B).

[0333] Bifunctional U7 smOPT targeting the STMN2 2a cryptic exon Treatment of TDP-43-depleted SH-SY5Y cells (i.e., treated with TDP-43 shRNA) with an exemplary U7 smOPT bifunctional construct of the invention corresponding to Example 2 was also found to result in partial rescue of proper splicing of the STMN2 cryptic exon. This suggests that the constructs of the invention and the methods described herein can be used to target different TDP-43-regulated cryptic exons.

[0334] Rescue of splicing at STMN2 is demonstrated in Figure 8, in which bands corresponding to properly spliced mature mRNA STMN2 products are observed in cells treated with the U7 smOPT construct of the invention, but not for the U7 control. Figure 9 shows differential splicing of properly spliced mature RNA (left bar) compared to mature RNA containing the STMN2 cryptic exon when compared to no treatment, Dox, or the U7 control. TDP-43 knockdown completely abolishes properly spliced and thus functional STMN2, essentially resulting in a complete KO. Rescue of proper splicing up to over 20% represents a strong improvement with a potentially strong functional benefit.

[0335] To examine whether STMN2 2a cryptic exon splicing could be rescued, additional examples (Examples 2B - 2G) with different antisense sequences targeting the TDP-43 binding site were tested along with Example 2. The experiment was conducted by focusing on the splicing of the STMN2 minigene in 293T cells with TDP-43-inducible knockdown. Figure 10A demonstrates that all of the constructs tested rescued splicing when calculated by obtaining the ratio of cryptic exon-containing RNA to properly spliced RNA compared to control-treated TDP-43 knockdown, normalized to GAPDH.

[0336] The efficiency of bifunctional constructs targeting different antisense sites to the TDP-43 binding site was also tested using the same setup. More specifically, Example 2H, which alternatively targets different parts of the STMN2 cryptic exon and its adjacent region at the ESE site (as identified using ESE finder 3.0). This was also shown to effectively rescue splicing (see Figure 10B).

[0337] Bifunctional U7 smOPT targeting the INSR cryptic exon Next, it was also demonstrated that the U7 smOPT construct could also be used to rescue the splicing of a third TDP-43-regulated cryptic exon corresponding to the TDP-43-regulated cryptic exon in the INSR gene. Figure 11 shows RT-PCR in SK-N-DZ cells with TDP-43 knockdown and transfected with the INSR minigene using the constructs of the examples of the present invention. When compared to the control, the constructs of the examples substantially eliminated the incorrect "cryptic" splicing, as demonstrated by a relatively strong band corresponding to the properly spliced mature mRNA product.

[0338] Figure 36 further shows the ratio of included cryptic exons to the total RT-qPCR levels of INSRa in cells treated with Example 3D targeting the 3' splice site. The data are shown relative to the ratio in 293T-2xTDP-shRNA cells transfected with an INSRa minigene, normalized to GAPDH mRNA, and containing a non-targeting control (U7 control) under TDP-43 knockdown.

[0339] Testing of U7 smOPT constructs with different hnRNP sequences for different hnRNP proteins Next, preliminary studies were performed to determine whether the constructs can be used to recruit any suitable hnRNP protein and / or whether the recruitment of a specific hnRNP protein is important. Bifunctional constructs similar to Example 1, containing different sequences for hnRNP-binding proteins (i.e., according to Examples 1L-1M), hnRNP H, hnRNP C, and hnRNP L were tested. The experiments were performed by focusing on the splicing of the UNC13A minigene in 293T cells with TDP-43-inducible knockdown.

[0340] The construct containing the binding sequence for hnRNP A1 (i.e., Example 1) was found to be the most effective in rescuing splicing. This may reflect the relatively high levels of endogenous hnRNP A1 in the cells. hnRNP H (Example 1L) was also found to be effective in rescuing splicing, but less so than hnRNP A1. Furthermore, constructs containing binding sequences for hnRNP C and hnRNP L showed partial rescue of splicing and were improved when compared to the U7 smOPT control. However, these hnRNP proteins were less effective when compared to hnRNP A1 and hnRNP H. This may reflect the relatively low levels of hnRNP L and the requirement for hnRNP C to form a tetramer and bind to both sides of the exon to induce exon skipping.

[0341] Comparison with a U7 smOPT construct lacking an hnRNP-binding tail Next, a "bifunctional" U7 smOPT construct according to the present invention (i.e., containing both a sequence containing an hnRNP-binding sequence and an antisense sequence complementary to UNC13A) was compared with a similar U7 smOPT construct containing the same antisense sequence targeting the UNC13A cryptic exon but lacking the hnRNP-binding tail / sequence. The experiment was conducted by focusing on the splicing of the UNC13A minigene in 293T cells with TDP-43-inducible knockdown. As can be seen from FIGS. 12A and 12B, the "bifunctional" construct of the present invention was significantly more effective than those containing only the antisense sequence. This indicates that endogenous hnRNP proteins are actively recruited to the pre-mRNA to restore proper splicing and are fulfilling the role of TDP-43.

[0342] Further exemplification Minigene data Comparison between the two-functional construct and the single-functional construct of the present invention (i.e., the bifunctional construct has an antisense sequence for the TDP-43-regulated cryptic exon And containing a binding sequence for the hnRNP protein, while the comparative "monofunctional" U7 construct contains an antisense sequence for the TDP-43-regulated cryptic exon but does not contain a binding sequence for the nRNP protein None case).

[0343] STMN2 Figure 16 shows the ratio of the RT-qPCR levels of properly spliced STMN2 mRNA from the bifunctional approach compared to the ratios obtained using a comparative monofunctional approach that targets either the TDP-43 binding site (BS) or the putative ESE (ESE). The data are shown relative to the ratios in 293T-2xTDP-shRNA cells transfected with the STMN2 minigene, normalized to GDPDH mRNA, and a non-targeting control (U7 control) under TDP-43 knockdown. It is demonstrated that the bifunctional construct of the present invention more effectively reduces C.E. / properness than the monofunctional approach when targeting the TDP-43 binding sequence. This provides further evidence that the bifunctional approach is more effective than the monofunctional approach when targeting both TDP-43 binding sites.

[0344] UNC13A Figure 17 shows the ratio of the RT-qPCR levels of properly spliced UNC13A mRNA from the bifunctional approach of the present invention compared to the ratios obtained using a comparative monofunctional approach that targets either the TDP-43 binding site (BS) or the 3'-splice site (3'ss). It is demonstrated that the bifunctional construct of the present invention more effectively reduces C.E. / properness than the monofunctional approach when targeting the TDP-43 binding sequence and the 3'-splice site. This provides further evidence that the bifunctional approach is more effective than the monofunctional approach when attempting to rescue the splicing of TDP-43-regulated CEs.

[0345] Comparison of the bifunctional U7 construct targeting the TDP-43 binding sequence with other splice elements Figure 18 shows the ratio of included cryptic exons to the correctly spliced RT-qPCR levels of UNC13A mRNA, comparing a bifunctional approach targeting the TDP-43 binding site (TDP-43 BS, Example 1, 1B, 1C, 1D, 1E, 1F, or 1G) or the 5' splice site / TDP-43 BS (5'ss / TDP-43 BS, Example 1O) with an approach targeting the 3' splice site (3'ss, Example 1H). The data are shown relative to the ratio in 293T-2xTDP-shRNA cells transfected with the UNC13A minigene, normalized to GDPDH mRNA, and a non-targeting control (U7 control) under TDP-43 knockdown. The graph demonstrates that constructs targeting the TDP-43 binding site are more effective than constructs targeting the 3' splice site. Notably, constructs targeting the TDP-43 binding site overlapping with the 5' splice site (Example 1O) were found to be particularly effective.

[0346] Figure 19 shows the ratio of included cryptic exons to the correctly spliced RT-qPCR levels of STMN2 mRNA, comparing a bifunctional approach targeting the TDP-43 binding site (TDP-43 BS, Examples 2B - 2G) with an approach targeting a putative ESE (Example 2H). The data are shown relative to the ratio in 293T-2xTDP-shRNA cells transfected with the STMN2 minigene, normalized to GDPDH mRNA, and a non-targeting control (U7 control) under TDP-43 knockdown. The graph demonstrates that constructs targeting the TDP-43 binding site are generally more effective than constructs targeting the exon splicing enhancer in STMN2 CE (Example 2H).

[0347] Data regarding the endogenous test in SH-SY5Y cells Figures 20 and 21 show that STMN2 levels are rescued using the constructs of the invention that target the STMN2 cryptic exon in SH-SY5Y cells. The data further demonstrate that the bifunctional approach is more effective than the monofunctional approach in rescuing proper STMN2 mRNA and protein, as is revealed by comparing the constructs of Example 2C with those of Comparative Example 2J.

[0348] Similarly, Figures 22 and 23 show that UNC13A levels are rescued using the constructs of the invention that target the UNC13A cryptic exon in SH-SY5Y cells. The data further demonstrate that the bifunctional approach is more effective in rescuing UNC13A at the protein level, as is revealed by comparing the bifunctional construct of Example 1O with a comparative monofunctional construct (Example 1R) lacking the hnRNP A1 binding sequence.

[0349] Figures 24 and 25 show that Example 3B, a bifunctional construct that targets the INSR cryptic exon, can also partially rescue and suppress TDP-43-regulated INSRa cryptic exon inclusion in SH-SY5Y cells.

[0350] i3Neuron data Successful RNA and protein rescue was also demonstrated in i3Neurons using the U7 constructs of the present disclosure to correct the mis-splicing of the TDP-43-regulated cryptic exons UNC13A, STMN2, and INSR. Human iPSC-derived cortical neurons (i3Neurons) expressing the U7 constructs of the present disclosure were cultured. TDP-43 knockdown was achieved by treating the cells with Halo-Protac (300 nM). On day 11, RNA and protein were harvested.

[0351] The upper part of FIG. 26 shows that RT-PCR analysis of UNC13A splicing between exons 19 and 22 demonstrates rescue of splicing according to Example 1O. The lower part of FIG. 26 shows a Western blot of UNC13A levels after treatment using Example 1O. Also shown is a comparative U7 construct (Example 1R) that contains an antisense sequence targeting the 5' splice site but does not contain an hnRNP binding sequence. Rescue of splicing is more effective using a bifunctional construct than a comparative monofunctional construct.

[0352] The upper part of FIG. 27 shows that three-primer RT-PCR analysis of STMN2 splicing between exons 1 and 2 demonstrates rescue of splicing according to Example 2C. The lower part of FIG. 27 shows Western blot analysis of STMN2 levels after treatment using Example 2C. Also shown is a comparative U7 construct (Example 2J) that contains an antisense sequence targeting the 3' splice site but does not contain an hnRNP binding sequence. Rescue of splicing is more effective using a bifunctional construct than a comparative monofunctional construct.

[0353] FIG. 28 shows RNA-protein rescue of INSR mis-splicing using the INSR-targeting construct of the present invention (Example 3B). The upper part of FIG. 28 shows that RT-PCR analysis of INSR splicing between exons 6 and 7 demonstrates rescue of splicing by the U7 bifunctional construct. The lower part of FIG. 28 shows Western blot analysis of INSR levels after treatment using the U7 bifunctional construct, showing rescue of the INSR protein.

[0354] Rescue of the reduced neurite outgrowth phenotype in i3Neurons was also demonstrated using the disclosed constructs targeting STMN2 (Example 2C). FIGS. 29-33 show that neurite outgrowth in i3Neurons is impaired by TDP-43 depletion and rescued by the STMN2-targeting U7 constructs of the present disclosure. Three days after neuronal induction medium, human iPSC-derived cortical neurons (i3Neurons) expressing a non-targeting control U7 construct and the constructs of the examples of the present disclosure (Example 2C) were plated in 96-well plates in parallel with wild-type i3Neurons. TDP-43 knockdown was achieved in the control U7 and the constructs of the examples of the present disclosure by treating the cells with Halo-Protac (300 nM) starting on day 1 of the induction medium. With 8 technical replicates for each condition, i3Neurons were imaged longitudinally over several days using an IncuCyte (Sartorius) imaging and analysis system. Experiments were also performed to determine neurite outgrowth and calculate cell body area. Five independent differentiations were performed and plotted on separate graphs shown in FIGS. 29-34. The neurite length normalized to the cell body area was reduced in TDP-43-depleted i3Neurons expressing control U7 but rescued in cells expressing the STMN2-targeting construct of the present disclosure (i.e., corresponding to Example 2C).

[0355] Composite construct vector Designed an exemplary "multiple" construct vector that tandemly contains three separate constructs targeting three different TDP-43-regulated exons: UNC13A, STMN2, and INSR. This construct is referred to herein as "3x-U7SmOPT" or "U7 composite". Figure 34 shows the ratio of included cryptic exons to properly spliced levels or total RT-qPCR levels of STMN2 (A), UNC13A (B), and INSR (C) mRNA in 293T-2xTDP-shRNA cells transfected with the STMN2 mini-gene and UNC13A mini-gene during transfection with a non-targeting control (uninduced and U7 control) or pMA-3x-U7SmOPT (3x-tU7SmOPT). The 3x-tU7SmOPT construct contains three U7s in tandem (Example 2C, Example 1O, and Example 3D) and is compared to the CE / optimal ratio obtained during transfection using the individual constructs corresponding to Example 2C, Example 1O, and Example 3D alone. Data are represented as mean ± SD compared to the ratio in the non-targeting control and analyzed using ordinary one-way ANOVA with Tukey's multiple comparison test ( * p < 0.05, ** p < 0.01, *** p < 0.001, ****p < 0.0001). Figure 35 shows the RNA rescue of STMN2 and INSR mis-splicing using the U7 complex construct vector in SH-SY5Y neurons. TDP-43-inducible shRNA knockdown SH-SY5Y cells were left untreated or treated with doxycycline at 0.025 μg / mL for 5 days. Subsequently, the cells were electroporated with 2 μg of the U7 DNA construct using the Ingenio electroporation kit (Mirus) with the A-023 setting on the Amaxa II Nucleofector (Lonza). Subsequently, the cells were left untreated or treated with 1 μg / mL doxycycline for an additional 5 days prior to RNA extraction on day 10. RT-PCR analysis of STMN2, INSR, and UNC13A splicing showed rescue of splicing of all three genes using the triple U7 construct. The positive control demonstrated good electroporation efficiency. PCR products were resolved using the TapeStation 4200 (Agilent). The complex construct vector showed similar repression of the three TDP-43-regulated exons, UNC13A, INSR, and STMN2, when compared to individual construct transfection.

[0356] Conclusion Importantly, it has been demonstrated that normal splicing in TDP-43 depleted cells can be effectively restored or rescued by replacing the native antisense sequence of modified U7 snRNA (U7 SmOPT) with a construct that contains both (i) an antisense sequence targeting a TDP-43-regulated cryptic exon and (ii) a binding sequence for an alternative hnRNP splicing repressor. This has been demonstrated for (i) a number of TDP-43-regulated cryptic exons including those related to UNC13A, STMN2 and INSR, (ii) a wide range of antisense sequences targeting different splicing elements, and (iii) constructs that recruit different hnRNP proteins. In particular, constructs that recruit hnRNP A1 and hnRNP H, and more particularly hnRNP A1, have been found to be the most effective.

[0357] The bifunctional approach allows the TDP-43 cryptic exon sequence to be targeted using an antisense sequence while recruiting endogenous hnRNPs to the cryptic site. The recruitment of hnRNP proteins achieves the inhibitory role of TDP-43 in the cell and leads to proper splicing. This approach has been demonstrated to be more effective (e.g., when compared to a monofunctional approach) and more robust in correcting splicing than an approach that simply targets a cryptic exon or its splicing element. The inventors have also found that a construct containing an antisense sequence targeting a TDP-43 binding site can be more effective than a construct containing an antisense sequence targeting other splice elements, and that the efficiency is further improved when sequences containing a TDP-43 binding site as well as other splice elements (e.g., splice sites) are targeted.

[0358] Since ASO is sensitive to degradation, the constructs of the present invention are also improved over alternative gene therapy approaches such as antisense oligonucleotides. As a result, the ASO approach would be less suitable as a therapy as it requires repeated delivery into the intrathecal space and its distribution within the CNS is suboptimal. In contrast, the U7 smOPT snRNA constructs can be delivered in vivo by vectorization, thereby obviating the need for continuous oligo injections.

[0359] Accordingly, the present invention can be used to further investigate and understand the role of TDP-43-regulated cryptic exons in diseases and can provide promising therapeutic agents for diseases associated with TDP-43 pathology.

[0360] The inventors have also uniquely demonstrated a composite vector approach that includes two or more of the constructs of the present invention (i.e., in tandem). Unlike any prior approach, this composite construct vector targets different cryptic exons in different genes. Considering that the composite construct contains multiple identical promoters, the results are unexpected. This approach would not be expected to obtain such similar efficiencies due to promoter competition and promoter interference. Indeed, from previous literature, multiple promoters on one plasmid would be expected to have different results than multiple plasmids each having one promoter. While transcriptional interference can be prevented by cloning in different orientations, this is not possible with three promoters and one set of promoters at convergent positions would result in conceivable transcriptional interference.

[0361] Further advantages of the present invention are summarized in the description of the invention section.

[0362] Materials and Methods Cloning of U7 Constructs Targeting Cryptic Exons The U7 SmOPT expression cassette containing an antisense sequence against the histone downstream element was ordered as gene synthesis in either pUC Simple (General Biosystems) or pMK (GeneArt, Life Technologies). To generate constructs targeting cryptic exons, these constructs were digested with StuI and HindIII (New England Biolabs). A DNA strand with 15 bp overhangs upstream and downstream of the StuI and HindIII cleavage sites, containing the U7 SmOPT sequence with the hnRNP binding sequence and the antisense sequence, was designed as follows and cloned into the StuI- and HindIII-digested U7SmOPT plasmid using InFusion Snap Assembly EcoDry master mix (Takara) according to the manufacturer's instructions.

[0363] Design principle of the strand cloned into the StuI-HindIII digested U7 SmOPT cassette: The 15 bp overhangs required for the InFusion Snap Assembly reaction are underlined, and the StuI and HindIII sites are shown in bold. x = hnRNP tail (e.g., SEQ ID NO: 361 UAUGAUAGGGACUUAGGGUG), y = antisense sequence (e.g., SEQ ID NO: 420 UUCAUCUGUUCAAUCAUUCAUUC), and the SmOPT sequence is shown in italics.

[0364]

Chemical formula

[0365] UNC13A and STMN mini genes The UNC13A minigene is described in Brown A.-L. et al, Nature, volume 603, pages 131-137 (2022). The STMN2 minigene was generated by gene synthesis. A fragment containing exon 1 and the first 300 bp of the intronic sequence and the subsequent 300 bp intron 1 sequence preceding the hidden exon 2a followed by a 200 bp intronic sequence and the subsequent 200 bp intronic sequence preceding exon 2 followed by a 200 bp intronic sequence, and the subsequent 200 bp intronic sequence preceding exon 3 was synthesized by GeneArt (Life Technologies). This fragment was cloned between the BamHI and XhoI sites of pcDNA3.1(+).

[0366] Generation of inducible TDP-43 knockdown 293T cells 293T cells were cultured in DMEM / F12 medium (Gibco) containing 10% tetracycline-free FBS and 1% penicillin / streptomycin. Inducible 293T TDP-43 knockdown cells were generated by transfecting 80% confluent cells in wells of a 6-well plate with AAVS1-SA-puro-EF1-hspCas9 (System Biosciences) (SEQ ID NO: 388 ggggccactagggacaggat) targeting the AAVS1 locus at a 1:3 ratio and pAAVS1-puro 2x TDP-43 shRNA. pAAVS1-puro 2x TDP-43 shRNA was generated by cloning a gene-synthesized fragment containing two tet operators with a 7SK / H1 hybrid promoter expressing one type of TDP-43 shRNA (target 1: SEQ ID NO: 446 GAGACTTGGTGGTGCATAA, target 2: SEQ ID NO: 422 GGAGAGGACTTGATCATTA) into the BstB1 and SalI sites of pAAV-Puro_siKD (Bertero A., et al. Current Protocols in Stem Cell Biology, 44, 5C.4.1-5C.4.48. doi: 10.1002 / cpsc.45). Twenty-four hours after transfection, the cells were split into T150 plates and subjected to selection with 0.75 μg / mL puromycin (Gibco) for 7 days, followed by selection with 1.5 μg / mL puromycin for 4 days. Single colonies were picked up and expanded. Inducible TDP-43 knockdown clones were identified by qRT-PCR.Cells were induced with 1 μg / mL doxycycline for 2 days, followed by RNA isolation using the Direct-zol RNA Miniprep Plus kit (Zymo Research), and qRT-PCR was performed using RotorGene Q (Qiagen) with a total volume of 20 μL, 40 ng of cDNA, and 0.6 μM f.c. primers sybr TDP-43 fwd: SEQ ID NO: 423 AACCGAACAGGACCTGAAAGAG and sybr TDP-43 rev: SEQ ID NO: 424 CAGTCACACCATCGTCCATCTATC and sybr beta-actin fwd: SEQ ID NO: 425 TCCATCATGAAGTGTGACGT and sybr beta-actin rev: SEQ ID NO: 447 TACTCCTGCTTGCTGATCCAC using Mesa Green qPCR master mix (Eurogentec) according to the manufacturer's instructions to evaluate the TDP-43 mRNA levels by comparing the induced and uninduced cells, thereby verifying the TDP-43 knockdown.

[0367] Testing of the U7SmOPT construct against the UNC13A and STMN2 mini-genes in TDP-43 inducible knockdown 293T cells To examine the efficiency of U7 constructs on cryptic exon splicing related to STMN2 and UNC13A, 80% confluent 293T-2xTDP-shRNA cells in 6-well plates were transfected with 200 ng of STMN2 or UNC13A mini gene and 1800 ng of U7SmOPT-CMV-BSD plasmid using Mirus TransIT-LT1 (Mirus Bio) according to the manufacturer's instructions. Twenty-four hours after transfection, the cells were split 1:1 and induced with 1 μg / mL doxycycline (Sigma Aldrich). Cells were harvested 72 hours after transfection and RNA was isolated using the Absolutely RNA Miniprep kit (Agilent technologies) according to the manufacturer's instructions. RNA was reverse transcribed to cDNA using the High Capacity RNA-to-cDNA kit (Applied Biosystems). The ratio of the cryptic levels to the properly spliced levels of TDP-43 mRNA as well as STMN2 and UNC13A was determined on a Rotor-Gene Q using the rapid cycling mode with 40 ng of cDNA, 0.3 μM f.c. primers according to the manufacturer's instructions: hTDP-43 qPCR f: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 426), hTDP-43 qPCR r: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 427), GADPH fwd: CCAGAACATCATCCCTGCCT (SEQ ID NO: 428), GAPDH rev: SEQ ID NO: 429 GGTCAGGTCCACCACTGACA, UNC13A Corr f: SEQ ID NO: 430 ACCTGTCTGCATGAGAACCT, UNC13A Cryptic f: SEQ ID NO: 431 ATGGATGGAGAGATGGAACCT, UNC13A r: SEQ ID NO: 432 GGGCTGTCTCATCGTAGTAAAC, STMN2 Corr f: SEQ ID NO: 433 GCTAAAACAGCAATGGCCTAC, STMN2 Corr r: SEQ ID NO: 434 TTGCTTCACTTCCATATCATCG, STMN2 Cryptic f: SEQ ID NO: 435 GCTAAAACAGCAATGGGACTC, STMN2 Cryptic r: SEQ ID NO: 436 GCAGGCTGTCTGTCTCTCTC along with 20 μL final volume of PowerUp TM SYBR TM Green Master Mix (ThermoFisher) was used for evaluation by RT-qPCR.

[0368] INSR minigene The INSR minigene was generated via PCR of the desired genomic region containing exon 6, intron 6 containing cryptic exon 6a, and exon 7 using Q5 polymerase, followed by Gibson assembly into a suitable linearized vector containing the CMV promoter and the SV40 polyA signal.

[0369] Generation of inducible TDP-43 knockdown in SH-SY5Y and SK-N-DZ cells SH-SY5Y and SK-N-DZ cells were transduced with SmartVector lentivirus (V3IHSHEG_6494503) containing a doxycycline-inducible shRNA cassette against TDP-43. The transduced cells were selected using puromycin (1 μg / mL) for 1 week.

[0370] Testing of the U7SmOPT construct against UNC13A and INSR minigene in TDP-43-inducible knockdown SK-N-DZ cells TDP-43 inducible knockdown SK-N-DZ cells were left untreated or treated with 1 μg / mL doxycycline for 3 days. Subsequently, cells were transfected using Lipofectamine 3000 (Thermofisher Scientific) with a total of 1 μg of DNA at a ratio of 1:3 mini-gene:U7smOPT, and then left untreated or treated with doxycycline for an additional 3 days prior to RNA extraction on day 6. Reverse transcription was performed using RervertAid (Thermo Scientific), and cDNA was amplified by PCR using mini-gene specific primers 5'-TCCTCACTCTCTGACGAGG-3' (SEQ ID NO: 437) and 5'-CATGGCGGTCGACCTAG-3' (SEQ ID NO: 438) for the UNC13A mini-gene, and primers 5'-TACCATCCACTCGACACACC-3' (SEQ ID NO: 439) and 5'-AGTCAGTCAAGCTAGCAGAGG-3' (SEQ ID NO: 440) for the INSR mini-gene. PCR products were resolved on a TapeStation 4200 (Agilent) and bands were quantified using TapeStation Systems software v3.2 (Agilent).

[0371] Testing of U7SmOPT constructs for rescue of endogenous UNC13A and STMN2 in TDP-43 inducible knockdown SH-SY5Y cells TDP-43-inducible knockdown SH-SY5Y cells were left untreated or treated with 0.025 μg / mL doxycycline for 5 days. Subsequently, the cells were electroporated with 2 μg of U7SmOPT DNA using the Ingenio Electroporation Kit (Mirus) with the A-023 setting on the Amaxa II Nucleofector (Lonza). Subsequently, the cells were left untreated or treated with doxycycline for an additional 5 days with PBS washes the day after electroporation, prior to RNA extraction on day 10. Reverse transcription was performed using RervertAid (Thermo Scientific), and cDNA was amplified by PCR using primers 5'-GACATCAAATCCCGCGTGAA-3' (SEQ ID NO: 441) and 5'-CATTGATGTTGGCGAGCAGG-3' (SEQ ID NO: 442) for UNC13A, and primers 5'-GCTCTCTCCGCTGCTGTAG-3' (SEQ ID NO: 443), 5'-CGAGGTTCCGGGTAAAAGCA-3' (SEQ ID NO: 444), and 5'-CTGTCTCTCTCTCTCGCACA-3' (SEQ ID NO: 445) for STMN2. The PCR products were resolved on a TapeStation 4200 (Agilent), and the bands were quantified using TapeStation Systems software v3.2 (Agilent).

[0372] pLVX-EF1a-mCherryT2A-BSD-U7smOPT Cloning and Virus Generation For the endogenous assay in SH-SY5Y cells, the U7smOPT strand was cloned into the ClaI site of the pLVX-EF1a-mCherry T2A-BSD vector. The pLVX-EF1a-mCherry T2A-BSD was generated by cloning a gene-synthesized strand containing the mCherry T2A-BSD ORF between the EcoRI and MluI sites of pLVx-EF1a-IRES-Puro (Clonetech Laboratories, Takara Bio) using In-Fusion Snap Assembly EcoDry (Takara Bio) according to the manufacturer's instructions. The U7smOPT strand was PCR amplified from their respective U7smOPT-CMV-BSD constructs with an additional 15 bp overhang using CloneAmp HiFi PCR (Clonetech Laboratories, Takara Bio) according to the manufacturer's instructions, using 0.3 μM primers LV inf pLVX Cla f: AGATCCAGTTTATCGATACCAACATAGGAGCTGTGATTGG (SEQ ID NO: 475) and LV inf pLVX Cla r: ATGAATTACTCATCGGCGAGAAAGGAAGGGAAGAAAGC (SEQ ID NO: 476) and 100 ng of template plasmid. This was then cloned into the pLVX-EF1a-mCherryT2A-BSD backbone digested with Cla1 (New England BioLabs) using In-Fusion Snap Assembly EcoDry (Takara Bio) according to the manufacturer's instructions.

[0373] 21 μg of cloned pLVX-EF1a-mCherryT2A-BSD-U7smOPT and 30 μL of Trans-Lentiviral Packaging Mix (Dharmacon) were transfected into >80% confluent HEK293T cells (Takara Bio) cultured in a T-150 flask using DMEM / F12 medium (Gibco) containing 10% tetracycline-free FBS and 1% penicillin / streptomycin according to the manufacturer's instructions using Lipofectamine 2000 (Invitrogen). The medium was changed 24 hours after transfection, 35 mL of the supernatant was collected, filtered using a 0.45 μm SFCA filter (Thermo Scientific), and then LentiX Concentrator (1:4, Takara Bio) was added over a period of 2 days. Subsequently, the mixture was incubated overnight at 4°C, centrifuged at 1,500 × g for 45 minutes at 4°C, resuspended in a total of 2 mL of PBS, aliquoted, and then 2 rapidly frozen in LN 7 and stored at -70°C. Prior to aliquot freezing, the viral titer was estimated to be at least 1 × 10

[0374]

Chemical formula

[0375] Generation of the i3Neuron-halo strain A human iPSC cell line with doxycycline-inducible expression of NGN2 was obtained from Michael Ward, NIH (Tian et al., 2019) and maintained according to the published protocol (Fernandopulle et al., 2018). Using CRISPR-Cas12 genome editing, the endogenous copy of Tardbp was tagged with HaloTag. iPSCs were nucleofected using the 4D-Nucleofector (Amaxa) with the P3 Primary Cell 4D-Nucleofector Kit (Amaxa, V4XP-3024). 1 million cells were nucleofected with a ribonucleoprotein complex formed from 5 mL of Tardbp-targeting crRNA (Integrated DNA Technologies, 100 mM), 20 mg of recombinant Cas12a (IDT, 10001272), and 10 mg of homologous recombination repair template (Addgene plasmid 178131). Cells were plated on Geltrex (ThermoFisher Scientific, A1413202)-coated dishes in E8 Flex medium (ThermoFisher Scientific, A2858501) containing 1× RevitaCell (ThermoFisher Scientific, A2644501) and 1 mM HDR enhancer V2 (Integrated DNA Technologies) and maintained in a 32 °C, 5% CO 2 incubator for 24 hours. After 24 hours, the medium was exchanged for the cells to E8 Flex without RevitaCell or HDR enhancer, and the cells were maintained in a 37 °C, 5% CO 2 incubator. iPSCs were expanded and single cells were plated into Geltrex-coated 96-well plates. Genomic DNA was recovered from single cell colonies and their genotypes were determined by PCR amplification using primers Halo_Geno_For1 and Halo_Geno_Rev1 and subsequent analysis using agarose gel electrophoresis.

[0376] Tardbp crRNA: SEQ ID NO: 478 / AlTR1 / rUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArUrGrGrArArArArGrUrArArArArGrArUrGrUrCrUrGrArArU / AlTR2 / Halo_Geno_For1: 5'-CTGGCGAGGCATCACATTTT-3' (SEQ ID NO: 479) Halo_Geno_Rev1: 5'-CGTTCTCATCTTCGGTTACCC-3' (SEQ ID NO: 480)

[0377] Generation of iPSC lines with stable expression of U7 To achieve stable expression of the U7 construct, the construct was delivered into iPSCs by lentiviral transduction. 50 mL of concentrated virus was delivered into 250,000 iPSCs in suspension in E8 Flex medium (ThermoFisher Scientific, A2858501) containing 10 mg / mL polybrene (hexadimethrine bromide, Sigma, H9268), and placed into one well of a 12-well plate after dissociation with Accutase. The cells were plated and cultured overnight. The next morning, the cells were washed with PBS and the medium was replaced with E8 Flex. Two days after lentiviral delivery, the cells were selected with 10 mg / mL blasticidin (Sigma, SBR000221ML) for 48 hours. Subsequently, the iPSCs were expanded and proliferated 1 - 2 days before initiating neural differentiation. The transduction efficiency was confirmed using a fluorescent marker.

[0378] iPSC-derived i3Neuron differentiation and culture The WTC11 human iPSCs used in this study were previously genetically engineered to express mouse or human neurogenin-2 (NGN2) under a doxycycline-inducible promoter, as well as enzymatically inactive Cas9 (+ / - CAG-dCas9-BFP-KRAB) (Fernandopulle et al., 2018). These were integrated at the AAVS1 safe harbor and the CLYBL promoter safe harbor, respectively.

[0379] To initiate neural differentiation, 2.5 million iPSCs per 10-cm plate were single-cell plated on day 0 using Accutase and replated on a Geltrex-coated tissue culture dish in N2 differentiation medium containing KnockOut DMEM / F12 medium (Life Technologies, catalog number 12660012) supplemented with N2 supplement (Life Technologies, catalog number 17502048), 1× GlutaMAX (ThermoFisher Scientific, catalog number 35050061), 1× MEM non-essential amino acids (NEAA) (ThermoFisher Scientific, catalog number 11140050), 10 mM ROCK inhibitor (Y-27632; Selleckchem, catalog number S1049), and 2 mg / mL doxycycline (Clontech, catalog number 631311). During this stage, the medium was changed daily.

[0380] On the third day, the prenuronal cells were plated onto dishes freshly coated overnight with 100 μg / mL poly-D-lysine (Sigma, P7886) and overnight with 10 μg / mL laminin (Thermo, catalog number 23017015) in either 96-well plates (12,500 - 25,000 cells per well) for IncuCyte experiments or 12-well dishes (500,000 cells per well) for RNA and protein extraction in BrainPhys medium (Stemcell Technologies, catalog number 05790) supplemented with i3Neuron culture medium: 1× B27 Plus supplement (ThermoFisher Scientific, catalog number A3582801), 10 ng / mL BDNF (PeproTech, catalog number 450-02), 10 ng / mL NT-3 (PeproTech, catalog number 450-03), 1 mg / mL mouse laminin (Sigma, catalog number L2020-1MG), and 2 mg / mL doxycycline (Clontech, catalog number 631311). On the day of plating, 1× RevitaCell (Thermo, catalog number A2644501) was added to the medium. Twenty-four hours after plating, the medium was completely replaced to remove RevitaCell. Subsequently, the i3Neurons were fed twice a week by replacing half of the medium.

[0381] RNA Extraction and RT-PCR On day 11 for i3Neurons and on day 10 for SH-SY5Y cells, RNA was extracted using the RNeasy kit (Qiagen), or on day 7 after the start of differentiation for i3Neurons using the Direct-zol RNA miniprep kit (Zymo Research, R2052) according to the manufacturer's protocol including the on-column DNA digestion step. RNA concentration was measured by Nanodrop, and 500 - 1,000 ng of RNA was used for reverse transcription. First strand cDNA synthesis was performed using RevertAid (Thermo, K1622) with random hexamer primers according to the manufacturer's protocol including all optional steps. cDNA was amplified by PCR using the primers as described above (SEQ ID NOs: 441 - 445) for UNC13A and STMN2, and the following primers: INSR for: 5'-AACGACATTGCCCTGAAGAC-3' (SEQ ID NO: 481), INSR rev: 5'-CCAGTACGGCTCCCATCT-3' (SEQ ID NO: 482). PCR products were resolved on a TapeStation 4200 (Agilent).

[0382] Western blot The i3Neurons were directly lysed on day 11 in sample loading buffer (Thermo, NP0008). The lysate was heated with 100 mM DTT at 95 °C for 5 minutes. The lysate was passed through QIAshredder (Qiagen) to shear DNA. The lysate was resolved on a 4–12% Bis-Tris gel (Thermo) and transferred to a 0.45 μm PVDF (Millipore) membrane. After blocking with 5% milk, the blot was probed with antibodies (Rb anti-UNC13A (Synaptic Systems, 126 103) 1:2,000; Rb anti-STMN2 (ProteinTech, 10586-1-AP) 1:1,000; Rb anti-INSR-α (Cell Signaling Technology, #74118 clone D3U7I) 1:1,000; Rb anti-INSR-β (Cell Signaling Technology, #3025 clone 4B8) 1:1,000; rat anti-tubulin (Millipore, MAB1864 clone YL1 / 2) 1:5,000, mouse anti-TDP-43 (abcam, ab104223 clone 3H8) 1:5,000) overnight at 4 °C. After washing, the blot was probed with HRP-conjugated secondary antibodies (goat anti-rabbit HRP (Bio-Rad, 1706515) 1:10,000; goat anti-mouse HRP (Bio-Rad, 1706516) 1:10,000; rabbit anti-rat HRP (Dako, P0450) 1:10,000) and developed using a chemiluminescent substrate (Merck Millipore, WBKLS0500) on a ChemiDoc imaging system (Bio-Rad).

[0383] Generation of inducible TDP-43 knockdown in SH-SY5Y neurons SH-SY5Y cells were transduced with a SmartVector lentivirus (V3IHSHEG_6494503) containing a doxycycline-inducible shRNA cassette against TDP-43. The transduced cells were selected using puromycin (1 μg / mL) for 1 week.

[0384] Testing of a composite triple U7 construct for rescue of endogenous UNC13A, STMN2, and INSR splicing in SH-SY5Y cells with inducible TDP-43 knockdown TDP-43-inducible knockdown SH-SY5Y cells were left untreated or treated with doxycycline 0.025 μg / mL for 5 days. Subsequently, the cells were electroporated using an Ingenio electroporation kit (Mirus) with 2 μg of the composite triple U7 construct and a non-targeting U7 control using an A-023 setting on an Amaxa II nucleofector (Lonza). A UNC13A-targeting U7 bifunctional construct known to successfully rescue splicing was included as an experimental condition to demonstrate electroporation efficiency. Subsequently, the cells were left untreated or treated with doxycycline for an additional 5 days using 1 μg / mL doxycycline prior to RNA extraction on day 10.

[0385] Neurite outgrowth experiment in i3Neurons Three days after induction medium, i3Neurons stably expressing non-targeting control U7 constructs and STMN2-targeting bifunctional U7 constructs were plated in i3Neuron culture medium containing RevitaCell in 96-well plates coated with poly-D-lysine and laminin as previously described, in parallel with wild-type i3Neurons. For each condition, two cell densities were plated (12,500 and 25,000 cells), and each density was plated in 8 wells, which served as 8 technical replicates per condition. TDP-43 knockdown was achieved in control U7 and STMN2 bifunctional U7 conditions by treating the cells with Halo-Protac3 (Promega, GA3110, 300 nM) starting on day 1 of induction medium. Subsequently, the 96-well plates were placed in an IncuCyte (Sartorius) vertical imaging and analysis system over several days. The IncuCyte instrument was initially set to acquire 4 images per well every 2 hours, after which the frequency was increased to every 6 hours. Twenty-four hours after plating, a complete medium change was performed to remove RevitaCell. Subsequently, a half-medium change was performed twice a week. Cell body area and neurite outgrowth were calculated for each condition using cell body and neurite masks, respectively. Neurite length was normalized to cell body area and plotted against time. Five independent differentiations were performed, and data from each differentiation were plotted on separate graphs.

[0386] Endogenous testing of U7smOPT in TDP-43-inducible knockdown SH-SY5Y cells Approximately 2.5 million induced TDP-43 knockdown SH-SY5Y cells in 5 mL of DMEM / F12 medium (Gibco) supplemented with 10% FBS without tetracycline, 1% penicillin / streptomycin, and 4 μg / mL polybrene (Santa Cruz) in a T-25 flask were transduced with 100 μL of lentivirus over 24 hours. Stable clones were selected using 2 μg / mL blasticidin (Gibco) for 4 days, followed by selection with 1 μg / mL puromycin (Gibco) for 2 days to reselect stable clones expressing the TDP-43 shRNA cassette. Two T-25 flasks, one for protein and one for RNA isolation, were seeded for each strain, and the next day, TDP-43 knockdown was induced by 0.1 μg / mL doxycycline for 5 days and another 5 days with 1 μg / mL doxycycline.

[0387] Western blot Total protein was recovered using cold lysis buffer [Pierce RIPA buffer (Thermo Scientific), 2× Halt protease inhibitor cocktail 100× (Thermo Scientific) 1:50, 2 M MnSO 4 (1:500), Cyanase nuclease (1:1000, SERVA)], followed by addition of an equal volume of 2× LDL [50% NuPage LDS sample buffer (Invitrogen) and 50% DTT], and then the samples were denatured at 70 °C for 10 minutes. Equal amounts of the denatured protein lysates were run on a NuPage 4–12% Bis-Tris gel (Invitrogen) for STMN2 and a NuPage 3–8% Tris acetate gel (Invitrogen) for UNC13A and INSRa. Subsequently, the gels were transferred to a nitrocellulose membrane (Invitrogen), and SuperSignal was used according to the manufacturer's instructions to enhance protein bands TMIt was incubated in the antigen pretreatment solution from the Western Blot Enhancer Kit (Thermo Scientific). After blocking with fish serum blocking buffer (Thermo Scientific), the membrane was diluted in the primary antibody diluent from the Western Blot Enhancer Kit (Thermo Scientific) with mouse monoclonal GAPDH (1:1000, Santa Cruz), rabbit polyclonal STMN2 antibody (1:1000, Proteintech), mouse monoclonal STMN2 (1:500, R&D Systems), rabbit polyclonal Munc13-1 antibody (1:1000, Synaptic Systems) or rabbit monoclonal INSRa antibody (1:1000, Cell Signaling Technology) and incubated overnight at 4°C. Next, the membrane was washed with 1×TBST, incubated with donkey anti-rabbit and anti-mouse secondary antibodies (1:10,000, Li-Cor) for 2 hours at room temperature and washed again. Finally, the membrane was imaged using an Odyssey CLx imaging system (Li-Cor), and the protein bands were quantified using Image Studio Lite (Li-Cor) by analyzing the pixel density, and the protein levels were normalized to GAPDH. TM It was incubated in the primary antibody diluent from the Western Blot Enhancer Kit (Thermo Scientific) with mouse monoclonal GAPDH (1:1000, Santa Cruz), rabbit polyclonal STMN2 antibody (1:1000, Proteintech), mouse monoclonal STMN2 (1:500, R&D Systems), rabbit polyclonal Munc13-1 antibody (1:1000, Synaptic Systems) or rabbit monoclonal INSRa antibody (1:1000, Cell Signaling Technology) and incubated overnight at 4°C. Next, the membrane was washed with 1×TBST, incubated with donkey anti-rabbit and anti-mouse secondary antibodies (1:10,000, Li-Cor) for 2 hours at room temperature and washed again. Finally, the membrane was imaged using an Odyssey CLx imaging system (Li-Cor), and the protein bands were quantified using Image Studio Lite (Li-Cor) by analyzing the pixel density, and the protein levels were normalized to GAPDH.

[0388] RT-qPCR RNA was extracted from SH-SY5Y cells using the Absolutely RNA Miniprep Kit (Agilent technologies) according to the manufacturer's protocol, and first-strand cDNA synthesis was performed using the High-capcity RNA-to-cDNA Kit (Applied Biosystems) or the LunaScript RT SuperMix Kit (New England BioLabs). The ratio of the hidden level to the properly spliced level of STMN2 and UNC13A, the ratio of the hidden level to the total level of INSR, and the TDP-43 mRNA level normalized to GAPDH were determined on a Rotor-Gene Q using the rapid cycling mode according to the manufacturer's instructions, with the primers described above (SEQ ID NOs: 426-436) for GAPDH, UNC13A, STMN2, and hTDP-43, and the following primers for INSR: Total INSR f: TGGGACCGCTTTACGCTTC (SEQ ID NO: 483), total INSR r: GAGACTGGCTGACTCGTTGAC (SEQ ID NO: 484), CE INSR f: CTCTGGGACTGGAGCAAAC (SEQ ID NO: 485), CE INSR r: CATCCCGTATCCGGTAAGG (SEQ ID NO: 486) Using 40 ng of cDNA, 0.3 μM f.c., and a final volume of 20 μL of PowerUp TM SYBR TM Green Master Mix (ThermoFisher), the samples were evaluated by RT-qPCR.

[0389] Testing of the composite 3x-U7SmOPT vector construct against the STMN2 and UNC13a mini-genes in TDP-43-inducible knockdown 293T cells The pMA-3x-U7smOPT vector containing three types of U7 cassettes for STMN2, UNC13a, and INSR was ordered as gene synthesis. To examine the efficiency of the 3x-U7 construct for cryptic exon splicing regarding STMN2 and UNC13A, 80% confluent 293T-2xTDP-shRNA cells in 6-well plates were transfected with 200 ng of STMN2 mini-gene and 200 ng of UNC13A mini-gene, as well as 1800 ng of pMA-3x-U7smOPT plasmid using Mirus TransIT-LT1 (Mirus Bio) according to the manufacturer's instructions. Twenty-four hours after transfection, the cells were split 1:1 and induced with 1 μg / mL doxycycline (Sigma Aldrich). Seventy-two hours after transfection, the cells were harvested and RNA was isolated using the Absolutely RNA Miniprep kit (Agilent technologies) according to the manufacturer's instructions. The RNA was reverse-transcribed into cDNA using the LunaScript RT SuperMix kit (New England BioLabs). The ratio of the cryptic levels to the properly spliced levels of TDP-43 mRNA and STMN2 and UNC13A, as well as the ratio of the cryptic levels to the total levels of INSRa, were evaluated by RT-qPCR using the primers (SEQ ID NOs: 426 - 436) outlined above for GAPDH, UNC13A, STMN2, and hTDP-43, and SEQ ID NOs: 483 - 486 for INSR, with 40 ng of cDNA, 0.3 μM f.c. and a final volume of 20 μL of PowerUp TM SYBR TM Green Master Mix (ThermoFisher).

Claims

1. The following array: (i) an antisense sequence having 16 to 30 nucleotides that are at least 90% complementary to the TDP-43 regulatory hidden exon sequence or its adjacent region, and (ii) A sequence containing a binding domain to the hnRNP protein A modified U7 snRNA construct comprising the above, which is capable of altering the splicing of TDP-43 regulatory hidden exons in cells.

2. The modified U7 snRNA construct according to Claim 1, wherein the hidden exon sequence is present in one of the following genes: UNC13A, STMN2, INSR, ELAVL3, G3BP1, AARS1, CELF5, CAMK2B, or UNC13B, and optionally the hidden exon sequence is present in UNC13A, STMN2, or INSR.

3. A modified U7 snRNA construct according to claim 1 or 2, which is a U7 smOPT construct.

4. A modified U7 snRNA construct according to claim 1 or 2, wherein the antisense sequence is 100% complementary to the TDP-43 regulatory hidden exon sequence or its adjacent region.

5. A modified U7 snRNA construct according to claim 1 or 2, wherein the binding domain is for hnRNP A or hnRNP H protein.

6. A modified U7 snRNA construct according to claim 1 or 2, wherein the hnRNP protein is hnRNP A1, and preferably the sequence containing the binding domain to the hnRNP A1 protein contains at least one motif corresponding to WUAGGGWS, where W is A or U and S is G or C, and preferably hnRNP A1 contains two motifs corresponding to WUAGGGWS, and optionally the sequence containing the binding domain to the hnRNP A1 protein has at least 80% sequence identity to SEQ ID NO:

361.

7. A modified U7 snRNA construct according to claim 1 or 2, wherein the antisense sequence is 16 to 26 nucleotides, more preferably 17 to 23 nucleotides, and more preferably 18 to 22 nucleotides.

8. A modified U7 snRNA construct according to claim 1 or 2, wherein the antisense sequence is capable of binding to the splicing element of the hidden exon sequence, and optionally the antisense sequence is at least 90% complementary to one of sequence numbers 11-40.

9. A modified U7 snRNA construct according to claim 1 or 2, wherein the antisense sequence is capable of binding to the TDP-43 binding region of the TDP-43 regulatory hidden exon sequence.

10. A modified U7 snRNA construct according to claim 1 or 2, wherein the TDP-43 binding domain is a sequence of at least 6 nucleotides, preferably at least 10 nucleotides, with statistically significant enrichment of UG dinucleotides and / or UGNNUG hexanucleotides, where N is A, U, C, or G, and statistically significant enrichment is defined as a probability of less than 0.2% that a random sequence of nucleotides of equal length comprises an equal number of UG dinucleotides and / or UGNNUG hexanucleotides, or preferably, a probability of less than 0.05% that a random sequence of nucleotides of equal length comprises an equal number of UG dinucleotides and / or UGNNUG hexanucleotides.

11. A modified U7 snRNA construct according to claim 1 or 2, wherein the antisense sequence is capable of binding to a splice donor site of a hidden exon sequence, a splice acceptor site of a hidden exon sequence, or one or more exonic splicing enhancers (ESEs) of a hidden exon sequence as defined by ESE finder 3.

0.

12. A modified U7 snRNA construct according to claim 1 or 2, wherein the TDP-43 regulatory hidden exon sequence is the UNC13A hidden exon, and the antisense sequence is at least 90% complementary to SEQ ID NO: 1 or 2, and optionally at least 90% complementary to SEQ ID NO: 3 or 4.

13. A modified U7 snRNA construct according to claim 12, wherein the antisense sequence is capable of binding to the TDP-43 binding region and / or adjacent region of the UNC13A hidden exon, and is preferably at least 90% complementary to any one of sequence numbers 23-26.

14. The antisense array is (i) It is possible to bind to the splice site of the UNC13A hidden exon, preferably to any one of SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21 or 22, or (ii) Capable of binding to one or more exonial splice enhancers (ESEs) in a UNC13A hidden exon or its adjacent region as defined by ESE finder 3.0, and preferably at least 90% complementary to one of SEQ ID NOs: 27, SEQ ID NOs: 28, or SEQ ID NOs:

29. A modified U7 snRNA construct according to claim 12.

15. The modified U7 snRNA construct according to claim 1 or 2, wherein the TDP-43 regulatory hidden exon sequence is the STMN2 hidden exon, and preferably the antisense sequence is at least 90% complementary to SEQ ID NO:

7.

16. The modified U7 snRNA construct according to claim 15, wherein the antisense sequence is capable of binding to the TDP-43 binding region and / or adjacent region of the STMN2 hidden exon, and preferably the antisense sequence is at least 90% complementary to SEQ ID NO:

12.

17. The antisense array is (a) Capable of binding to the 3'-splice site of the STMN2 hidden exon, preferably at least 90% complementary to SEQ ID NO: 11, or (b) Capable of binding to one or more exonic splice enhancers (ESEs) in the STMN2 hidden exon or its adjacent region as defined by ESE finder 3.0, and preferably at least 90% complementary to any one of SEQ ID NOs: 14-16. A modified U7 snRNA construct according to claim 15.

18. The modified U7 snRNA construct according to claim 1 or 2, wherein the TDP-43 regulatory hidden exon sequence is an INSR hidden exon, and preferably the antisense sequence is at least 90% complementary to SEQ ID NO:

9.

19. The antisense array is (a) Capable of binding to the TDP-43 binding region and / or adjacent region of the INSR hidden exon, preferably at least 90% complementary to SEQ ID NO: 32, or (b) Capable of binding to the 3'-splice site of the INSR hidden exon, preferably at least 90% complementary to SEQ ID NO: 31, or (c) Capable of binding to one or more exonial splice enhancers (ESEs) in an INSR hidden exon or its adjacent region, preferably at least 90% complementary to any one of SEQ ID NOs: 34-40. A modified U7 snRNA construct according to claim 18.

20. A modified U7 snRNA construct according to claim 1 or 2, wherein the antisense sequence is a 16-nucleotide sequence having at least 90% sequence identity with SEQ ID NOs. 42-352, and / or the antisense sequence comprises at least 16-nucleotide sequences having at least 90% sequence identity with at least a portion of SEQ ID NOs. 420, 362, 364, 366, 368, 370, 372, 374, 382, ​​384, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, or 419 with respect to the same number of nucleotides.

21. A vector comprising or encoding a modified U7 snRNA construct according to claim 1 or 2, preferably a viral vector.

22. A composite vector comprising two or more modified U7 snRNA constructs according to claim 1 or 2, wherein the two or more modified U7 snRNA constructs comprise different antisense sequences capable of binding to different TDP-43 regulatory hidden exons.

23. A pharmaceutical composition comprising one or more of the structures described in claim 1 or 2.

24. A pharmaceutical composition according to claim 23 for use in therapy.

25. A pharmaceutical composition according to claim 23 for use in the treatment of a disease characterized by TDP-43 dysfunction, wherein the disease is preferably a neurodegenerative disease or a muscular disease, and optionally the disease is selected from amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), Alzheimer's disease, inclusion body myositis / myopathy (IBM), FOSMNN (facial-onset sensorimotor neuropathy), Perry syndrome, limbic-dominant age-related TDP-43 encephalopathy (LATE), or a combination thereof.

26. A composition for use in a method for altering the splicing of TDP-43 regulatory hidden exons, the composition comprising the construct described in claim 1 or 2, the method comprising the steps of delivering the construct to a cell and bringing the construct into contact with the cell to alter the splicing of TDP-43 regulatory hidden exons.