Compositions and methods for filling extracellular vesicles

Abstract

The present invention provides extracellular vesicles (EVs) filled with conjugates of an active agent with a hydrophilic compound such as a carbohydrate, methods for preparing and filling the EVs, compositions containing the EVs and their use, and conjugates of an active agent and a carbohydrate that can be filled into the EVs. In one embodiment, exosomes are filled with a conjugate of siRNA with glucose.

Description

Technical Field

[0001] The present invention relates to compositions and methods for filling extracellular vesicles with active molecules conjugated to hydrophilic compounds such as carbohydrates or derivatives thereof, the resulting extracellular vesicles, and compositions containing them, where the hydrophilic compound may itself be biologically active.

Background Art

[0002] Exosomes are membrane-bound extracellular vesicles (EVs) produced in the endosomal compartments of most eukaryotic cells. In multicellular organisms, exosomes and other EVs have been found in biological fluids including blood, urine, and cerebrospinal fluid. Importantly, exosomes have also been identified within the tissue matrix and named Matrix-Bound Nanovesicles (MBV). They are also released in vitro into their growth medium by cultured cells. Since the size of exosomes is restricted by the size of the parent MVB, exosomes are generally smaller than most other EVs, with a diameter of approximately 30 to 150 nanometers (nm), i.e., about the same size as many lipoproteins but much smaller than cells. Exosomes can enter cells naturally and easily and release their chemical contents inside cells, so they can function as excellent drug delivery tools for drugs that need to penetrate the cell membrane and accumulate inside cells. Exosomes have been shown to have many beneficial advantages. They can cross the BBB, have an affinity for inflamed tissues, and can accumulate in the inflamed area. Exosomes may be off-the-shelf products that do not require gene matching. Currently, there are many known methods for loading different compounds into exosomes, such as sonication, electroporation, transfection, incubation, extrusion, saponin-assisted loading, transgenesis, freeze-thaw cycles, heat shock, pH gradient methods, and hypotonic dialysis. In some of these methods, lipophilic compounds such as cholesterol can be used. However, these methods have several drawbacks, such as aggregation, false information, and damage to the membrane integrity of extracellular vesicles. Some of the above methods may affect the ability of target cells to take up exosomes such that the intracellular concentration of the required active ingredient is not sufficient.

[0003] International Publication No. WO 2021 / 030777 relates to EVs (e.g., exosomes) containing biologically active molecules covalently bound to extracellular vesicles via an anchor moiety, which may be useful as agents for the prevention or treatment of cancer or other diseases.

[0004] European Patent No. 3132044 relates to a method of loading oligonucleotide cargo into exosomes by incubating a population of exosomes with an oligonucleotide comprising one or more hydrophobic modifications for a period of time sufficient to enable the use of genetic manipulation of cells to load the oligonucleotide into the exosomes. Such genetic manipulation may alter the inherent biological characteristics of the cells themselves. Thus, minimal manipulation of the cells is preferred. Further, European Patent No. 3132044 describes exosomes loaded with a hydrophobic modified oligonucleotide cargo.

[0005] There is still an urgent need for further methods of loading oligonucleotides and other different types of desired active ingredients into EVs. SUMMARY OF THE INVENTION

[0006] The present invention discloses a composition and method for loading biologically active molecules into extracellular vesicles (EVs). To this end, the active molecule is chemically bound to a non-lipophilic compound that helps enrich EVs having the active molecule, thus obtaining EVs having a high concentration of the active molecule. It has unexpectedly been found that carbohydrates such as glucose and sucrose can not only penetrate into EVs, but also incorporate the active agent conjugated thereto. Furthermore, it has been found that by adding insulin to the medium during the loading process, it is possible to facilitate the loading of EVs by incorporation of the active agent conjugated with glucose.

[0007] In some cases, the non-lipophilic compound used to fill the EV with the active agent is the active agent itself. Thus, the present invention also provides an EV containing such a non-lipophilic active agent compound. These non-lipophilic compounds may be exogenous compounds and / or may be present in the EV at concentrations that do not occur naturally.

[0008] According to one aspect, the present invention provides an isolated extracellular vesicle comprising at least one exogenous cargo molecule or exogenous carbohydrate as an activator, wherein the exogenous cargo molecule comprises an activator chemically bound to a carbohydrate or a derivative thereof. According to one embodiment, the present invention provides an isolated extracellular vesicle comprising at least one exogenous carbohydrate as an activator. According to other embodiments, the present invention provides an isolated extracellular vesicle comprising an exogenous cargo molecule comprising an activator chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the activator in the cargo molecule is selected from small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids. According to some embodiments, the activator carbohydrate is an exogenous carbohydrate. According to some embodiments, the activator carbohydrate is present at a non-natural concentration. According to some embodiments, the activator is bound directly or via a linker to the carbohydrate or a derivative thereof. According to some embodiments, the linker is DBCO-C6-acid. According to some embodiments, the activator is chemically bound to the carbohydrate or a derivative thereof via a cleavable bond. According to some embodiments, the activator is covalently bound to the carbohydrate. According to some embodiments, the activator is a nucleic acid. According to some embodiments, the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA, and miRNA inhibitor. According to some embodiments, the oligonucleotide is siRNA. According to some embodiments, the present invention provides an isolated EV loaded with an exogenous cargo molecule comprising an siRNA molecule covalently bound to a carbohydrate such as glucose via a linker such as DBCO-C6-acid. According to some embodiments, the present invention provides an isolated EV loaded with an exogenous cargo molecule comprising an siRNA molecule covalently bound to a carbohydrate such as sucrose via a linker such as DBCO-C6-acid. According to some embodiments, the cargo molecule is present in the EV at a non-natural concentration, i.e., a concentration not found in nature.

[0009] According to another aspect, the present invention provides a method of loading exogenous cargo molecules into isolated extracellular vesicles (EVs), the method comprising incubating a population of EVs with cargo molecules comprising an activator chemically conjugated to a carbohydrate or a derivative thereof. According to some embodiments, the activator is directly conjugated or conjugated via a linker to the carbohydrate or a derivative thereof. According to some embodiments, the linker is 10-hydroxydecanoic acid. According to some embodiments, the linker is DBCO-C6-acid. According to some embodiments, the activator is selected from small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids. According to some embodiments, the activator carbohydrate is an exogenous carbohydrate and / or is present in the EVs at a non-natural concentration.

[0010] According to some embodiments, the method further comprises the use of a transfection reagent such as electroporation or a lipid transfection reagent. According to alternative embodiments, the method is performed in the absence of electroporation and in the absence of a transfection reagent.

[0011] According to some embodiments, the method is performed in the presence of insulin. According to some embodiments, the amount of loaded exogenous cargo molecules in the resulting EVs is at least 20% higher than that in the EVs loaded in the absence of insulin.

[0012] According to any one of the above aspects and embodiments, the EV is an exosome. According to some embodiments, EVs such as exosomes are derived from adherent cells expressing mesenchymal markers. According to some embodiments, the adherent cells expressing mesenchymal markers are mesenchymal stem cells (MSCs). According to some embodiments, the mesenchymal stem cells are human bone marrow mesenchymal stem cells.

[0013] According to some embodiments, the present invention provides isolated EVs that can be obtained by or have been obtained by the methods described herein.

[0014] According to another aspect, provided herein is a pharmaceutical composition comprising a population of isolated EVs of the present invention and a pharmaceutically acceptable excipient.

[0015] According to yet another aspect, provided herein is a method of delivering an active agent comprising exposing a mammal, organ, tissue, or target cell to the isolated EVs of the present invention.

[0016] According to another aspect, the present invention provides a method of treating or preventing a disease, medical condition, or disorder treatable by an active agent loaded into an EV, the method comprising administering to a subject in need thereof a therapeutically effective amount of the EVs described herein.

[0017] According to yet another aspect, the present invention provides an exogenous conjugate molecule comprising a nucleic acid chemically conjugated to a carbohydrate or a derivative thereof. According to some embodiments, the nucleic acid is an oligonucleotide. According to some embodiments, the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA, and miRNA inhibitors. According to some embodiments, the nucleic acid is directly or indirectly conjugated to the carbohydrate or a derivative thereof via a linker. According to some embodiments, the bond or linker is a cleavable bond or linker. According to some embodiments, the present invention provides siRNA conjugated to glucose. According to some embodiments, the present invention provides siRNA conjugated to sucrose.

[0018] According to any one of the above aspects and embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides, and the carbohydrate derivative is selected from sugars bound to amino acids, polyphenols, or lipids. According to some embodiments, the monosaccharide is selected from glucose, ribose, mannose, arabinose, galactose, and xylose, the disaccharide is selected from sucrose, lactose, and maltose, the trisaccharide is selected from maltotriose and raffinose, the sugar bound to an amino acid is D-ribose-L-cysteine, the sugar bound to a polyphenol is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, baicalin, and puerarin, and the sugar bound to a lipid is a cerebroside such as glucocerebroside.

Brief Description of the Drawings

[0019]

Figure 1

Figure 2

Figure 3

Figure 4A

Figure 4B

Figure 5

Figure 6

Figure 7A

Figure 7B

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

DETAILED DESCRIPTION OF THE INVENTION

[0020] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this invention pertains. In case of conflict, the patent specification, including definitions, will prevail.

[0021] The present invention provides extracellular vesicles (EVs) loaded with cargo molecules containing an active agent chemically bound to at least one carbohydrate or a derivative thereof. The present invention also provides extracellular vesicles (EVs) loaded with an exogenous carbohydrate as an active agent.

[0022] The present invention also provides a novel method for loading EV cargo molecules comprising a hydrophilic compound conjugated to an active agent. Non-limiting examples of hydrophilic compounds are carbohydrates or their conjugates. The method of loading cargo molecules into extracellular vesicles (EVs) involves incubating a population of EVs with a cargo molecule, i.e., an active agent chemically conjugated to at least one carbohydrate or a derivative thereof.

[0023] As shown in the examples, carbohydrates provide the ability to load EVs with an active agent conjugated to the carbohydrate, similar to cholesterol which is widely used for this purpose. Using carbohydrates, particularly sucrose and glucose, for the incorporation of active agents into EVs also enriches the glucose content in the EVs. This can be used, for example, to provide / supplement cells in tissues, particularly damaged (e.g., inflamed) tissues. Using sucrose provides more energy to the cells. Additionally, using sugars to load EVs does not affect the properties of the EV bilayer, in contrast to cholesterol which can increase membrane rigidity. Furthermore, this is true for sugars whose uptake into EVs occurs via channels. Moreover, it is possible to control the uptake process of an active agent conjugated to a sugar, for example, by using insulin with glucose.

[0024] According to one aspect, the present invention provides an isolated extracellular vesicle (EV) comprising at least one exogenous carbohydrate as an active agent.

[0025] According to another aspect, the present invention provides an isolated extracellular vesicle (EV) comprising a cargo molecule, the cargo molecule comprising an active agent chemically conjugated to a carbohydrate or a derivative thereof. In some embodiments, the cargo molecule is referred to as a conjugate.

[0026] According to some embodiments, cargo molecules are loaded onto EVs. Thus, according to some embodiments, the present invention provides isolated extracellular vesicles comprising at least one cargo molecule, wherein the cargo molecule comprises an active agent chemically bound to a carbohydrate or a derivative thereof. According to any one of the embodiments of the present invention, the cargo molecule is an exogenous molecule. Thus, according to some embodiments, the present invention provides isolated extracellular vesicles comprising an exogenous cargo molecule, wherein the exogenous cargo molecule comprises an active agent chemically bound to at least one carbohydrate or a derivative thereof.

[0027] According to some embodiments, the active agent is selected from small molecules, proteins, peptides, polypeptides, lipids, carbohydrates, and nucleic acids. According to some embodiments, the active agent is selected from small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids. According to some embodiments, the active agent is selected from small molecules, lipids, and nucleic acids.

[0028] According to some embodiments, the active agent carbohydrate is an exogenous carbohydrate.

[0029] The terms, definitions, and embodiments provided below refer to, apply to, and thereby encompass any one of the aspects of the present invention.

[0030] The term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) that is not normally present in a cell or vesicle, is derived from the outside, and is introduced into a recipient cell or vesicle.

[0031] The terms "extracellular vesicles" and "EVs" are used interchangeably herein and refer to vesicles derived from cells that contain a membrane surrounding an internal space. Generally, EVs range in diameter from 30 nm to 1500 nm, more frequently from 40 to 1200 nm, and can contain various cargo molecules that are present on the outer surface of the extracellular vesicle, within the internal space, and / or span the membrane. The cargo molecules can include nucleic acids, proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. The term EV also includes the terms "exosomes" and "microvesicles". The terms "exosomes" and "nanovesicles" are used interchangeably herein and refer to EVs having a size of 30 to 150 nm in diameter. According to some embodiments, the term "exosomes" refers to EVs having a size of 30 to 100 nm in diameter. The term "microvesicles" as used herein refers to EVs having a size of 100 to 1000 nm in diameter. Generally, EVs can contain at least a portion of the molecular content of the cells from which they originate, such as lipids, fatty acids, polypeptides, polynucleotides, proteins, and / or sugars.

[0032] EVs are derived from cells. The terms "derived from" and "originating from" are used interchangeably herein and refer to vesicles produced by or from a particular cell, cell type, or any population of cells. The terms "parent cell", "producer cell", and "original cell" as used herein include any cell from which the extracellular vesicles are derived. For example, a "parent cell" or "producer cell" includes a cell that functions as a source of extracellular vesicles. According to some embodiments, the cell is a eukaryotic cell.

[0033] Extracellular vesicles (EVs) can be obtained from living cells by any of several means, such as secretion, budding, or dispersion from living cells. EVs can be isolated from mesenchymal stem cells (MSCs), neural crest cells (NCCs), mesenchymal stem cell conditioned medium (MSC-CM), or neural crest cell conditioned medium. For example, EVs can be produced, exuded, released, or shed from living cells. When living cells are in cell culture, EVs can be secreted into the cell culture medium.

[0034] Examples of living cells from which EVs can be derived include adherent cells that express mesenchymal markers such as mesenchymal stem cells, oral mucosa stem cells or olfactory ensheathing cells, astrocytes, and neural crest cells. According to some embodiments, the EVs are derived from adherent cells that express mesenchymal markers. According to one embodiment, the adherent cells that express mesenchymal markers are selected from mesenchymal stem cells (MSCs), oral mucosa stem cells, and olfactory ensheathing cells. According to one embodiment, the cells are mesenchymal stem cells (MSCs).

[0035] The term "mesenchymal stem cell" refers to pluripotent stromal cells that can differentiate into various cell types well known in the art, including osteoblasts, chondrocytes, myocytes, adipocytes, osteocytes, fibroblasts, and stellate cells.

[0036] In their pluripotent state, mesenchymal stem cells typically express the following markers: CD105, CD166, CD29, CD90, and CD73, and do not express CD34, CD45, and CD133.

[0037] Mesenchymal stem cells can be isolated from various tissues including, but not limited to, bone marrow, adipose tissue, dental pulp, oral mucosa, peripheral blood, and amniotic fluid. According to some embodiments of the present invention, mesenchymal stem cells are isolated from bone marrow. According to some embodiments, mesenchymal stem cells are derived from a site selected from bone marrow, adipose tissue, umbilical cord, dental pulp, oral mucosa, peripheral blood, and amniotic fluid. According to some embodiments, EVs are derived from bone marrow-derived MSCs. According to other embodiments, EVs are derived from adipose tissue-derived MSCs. According to some such embodiments, EVs are selected from exosomes, microvesicles, and combinations thereof. According to some embodiments, the cells express CD105, CD166, CD29, CD90, and CD73 markers. According to further embodiments, the cells express CD105, CD166, CD29, CD90, and CD73 and do not express CD34, CD45, and CD133. According to some embodiments, the cells are selected from dental pulp stem cells (DPSC), stem cells from human exfoliated deciduous teeth (SHED), periodontal ligament stem cells (PDLSC), stem cells from apical papilla (SCAP), and dental follicle progenitor cells (DFPC).

[0038] According to some such embodiments, EVs contain or express at least a portion of the markers expressed by the cells from which the EVs are derived.

[0039] EVs may contain one or more proteins, oligonucleotides, or polynucleotides secreted by specific cell types, such as mesenchymal stem cells or neural crest cells. EVs may contain one or more proteins or polynucleotides present in mesenchymal stem cell conditioned medium (MSC-CM). In certain embodiments, EVs may contain miRNAs derived from MSCs or neural crest cells. For example, EVs may contain 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, or 70% or more of these proteins and / or polynucleotides. EVs may contain substantially about 75% of these proteins and / or polynucleotides. Proteins can be defined by reference to the gene products of a list of proteins or a list of genes.

[0040] EVs may have at least one property of mesenchymal stem cells. EVs may have biological properties or biological activities. EVs can have any of the biological activities of MSCs. The particles may, for example, have the therapeutic or restorative activities of MSCs.

[0041] Methods for isolating, purifying, and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, the methods disclosed in U.S. Patent No. 5,486,359 by Caplan and Haynesworth, and Jones E.A. et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0042] Mesenchymal stem cell cultures can be generated by diluting BM aspirate (usually 20 mL) with an equal volume of Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand Island, NY, USA), and layering the diluted cells onto approximately 10 mL of a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, NJ, USA). After centrifugation at 2,500×g for 30 minutes, the mononuclear cell layer is removed from the interface and suspended in HBSS. The cells are then centrifuged at 1500×g for 15 minutes and resuspended in complete medium (α-MEM without deoxyribonucleotides or ribonucleotides; GIBCO), 20% fetal calf serum (FCS) (Atlanta Biologicals, Norcross, GA) from a lot selected for rapid MSC growth, 100 units / ml penicillin (GIBCO), 100 μg / mL streptomycin (GIBCO), and 2 mM L-glutamine (GIBCO). The resuspended cells are seeded into approximately 25 mL of medium in a 10 cm culture dish (Corning Glass Works, Corning, NY) and incubated at 37°C in 5% humidified CO2. After 24 hours of culture, non-adherent cells are discarded and adherent cells are washed thoroughly twice with phosphate buffered saline (PBS). The medium is replaced with fresh complete medium every 3 or 4 days for approximately 14 days. The adherent cells are then harvested with 0.25% trypsin and 1 mM EDTA (trypsin / EDTA, GIBCO) at 37°C for 5 minutes, reseeded into 6 cm plates, and cultured for an additional 14 days. Next, the cells are trypsinized and counted using a cell counting device such as a hemocytometer (Hausser Scientific, Horsham, PA). The cultured cells are recovered by centrifugation and resuspended in 5% DMSO and 30% FCS at a concentration of 1 - 2×10 6 cells per mL. Approximately 1 mL aliquots are slowly frozen and stored in liquid nitrogen.

[0043] To increase the mesenchymal stem cell fraction, thaw the frozen cells at 37°C, dilute them in complete medium, recover by centrifugation, and remove DMSO. Resuspend the cells in complete medium and seed at a concentration of about 5,000 cells / cm 2 . After culturing for 24 hours, remove the non-adherent cells, collect the adherent cells using trypsin / EDTA, dissociate them by passing through a narrow Pasteur pipette, and re-seed preferably at a density of about 1.5 to about 3.0 cells / cm 2 . Under these conditions, MSC cultures can grow during about 50 population doublings and can increase about 2000-fold (Colter DC., et al., Proc Natl Acad Sci USA. 97, 3213-3218, 2000).

[0044] MSC cultures utilized by some embodiments of the present invention include three cell populations defined by their morphological characteristics: small non-granular cells (hereinafter referred to as RS-1), small granular cells (hereinafter referred to as RS-2 herein), and large moderately granular cells (hereinafter referred to as mature MSCs herein). The presence and concentration of such cells in culture can be assayed by identifying the presence or absence of various cell surface markers, for example, by using immunofluorescence, in situ hybridization, and activity assays.

[0045] EVs can be produced or isolated by various methods. Such methods can include isolating EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0046] According to some embodiments, the EVs of the present invention are isolated EVs.

[0047] The EVs of the present invention are substantially spherical, and the terms "size", "particle size", "average particle size", and "particle diameter size" as used herein refer interchangeably to the diameter of the EVs or the longer diameter of the extracellular vesicles. The size of the EVs of the present invention can be determined using any known method for measuring particle size. A non-limiting example is nanoparticle-tracking analysis (NTA).

[0048] According to some embodiments, the EVs are exosomes. According to some embodiments, the EVs are microvesicles. According to further embodiments, the EVs are a combination of small vesicles and large vesicles.

[0049] According to any one of the above embodiments, the EVs are isolated. The EVs can be isolated from cells by standard isolation and washing protocols by differential centrifugation, size exclusion, or any other method for a particle isolation protocol from the culture medium.

[0050] As used herein, the terms "purify", "purified", "purifying", "isolate", "isolated", and "isolating" are used interchangeably and refer to the state (e.g., in multiple known or unknown amounts and / or concentrations) of a population of extracellular vesicles that has undergone one or more purification / isolation processes, such as selection of the desired extracellular vesicles, or removal or reduction of remaining biological products, and / or removal of unwanted extracellular vesicles, e.g., removal of EVs of a particular size. According to one embodiment, the ratio of the number of EVs to the number of remaining parental cells is at least 2, 3, 4, 5, 6, 8, or 10 times higher, or in certain advantageous embodiments, at least 50 times, 100 times, 1000 times, or 2000 times higher than in the initial material. In some advantageous embodiments, the term "isolated" may have a substantially cell-free or cell-free meaning and may thereby be substituted. According to some embodiments, extracellular vesicles, e.g., exosomes, are derived from adherent cells that express mesenchymal markers. According to some embodiments, the adherent cells that express mesenchymal markers are mesenchymal stem cells (MSCs).

[0051] The terms "cargo" and "payload" are used interchangeably herein and refer to therapeutic agents, diagnostic probes, peptides, nucleic acids, oligonucleotides, antisense oligonucleotides, plasmids, proteins, small molecules, radioactive substances, and conjugates, including, but not limited to, the group consisting of conjugates with carbohydrates, that are present within or on the membranes of EVs. The terms "cargo" and "conjugate" may be used interchangeably in some embodiments. The term "conjugate" refers to the association between molecules. The association can be direct or indirect. For example, a conjugate between a nucleic acid and a carbohydrate can be direct, e.g., by a covalent bond, or indirect, e.g., by a non-covalent bond (e.g., electrostatic interactions (e.g., ionic bond, hydrogen bond, halogen bond), van der Waals interactions (e.g., dipole-dipole, dipole-induced dipole, London dispersion), ring stacking (π-effect), hydrophobic interactions, etc.). The term also refers to an active agent chemically bonded to at least one carbohydrate or a derivative thereof. The term "chemically bonded" refers to both covalent and non-covalent bonds. According to some embodiments, the active agent is selected from small molecules, proteins, peptides, lipid polypeptides, carbohydrates, and nucleic acids. According to some embodiments, the active agent is a small molecule. According to some embodiments, the active agent is a protein. According to some embodiments, the active agent is a peptide. According to some embodiments, the active agent is a lipid polypeptide. According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the active agent is covalently bonded to a carbohydrate. According to other embodiments, the active agent is bonded to a carbohydrate via a non-covalent bond.

[0052] According to some embodiments, the active agent may be a pharmacological agent such as a small molecule, nucleic acid, peptide, carbohydrate, and protein. According to some embodiments, the active agent carbohydrate is an exogenous carbohydrate.

[0053] The terms "active agent", "pharmacological agent", and "active moiety" are used interchangeably herein and refer to an agent having biological activity, pharmacological effect, and / or therapeutic utility.

[0054] According to some embodiments, the pharmacological agent / active agent is an anti-cancer agent, a cell division inhibitor, a DNA or RNA intercalator, a splicing modulator, a tyrosine kinase inhibitor, a statin, an NSAID, an antibiotic, an antifungal agent, an antibacterial agent, an anti-inflammatory agent, an anti-fibrotic agent, an antihypertensive agent, an analgesic, an antipyretic, an appetite suppressant and weight loss inducer, a sedative, a sleep aid, an anticonvulsant, a hormone, a neurotransmitter, an aromatase inhibitor, an esterase inhibitor, an anticholinergic agent, an SSRI, a BKT inhibitor, a PPAR agonist, a HER inhibitor, an AKT inhibitor, a BCR-ABL inhibitor, a signal transduction inhibitor, an angiogenesis inhibitor, a synthetase inhibitor, an ALK inhibitor, a BRAF inhibitor, a MEK inhibitor, a PI3K inhibitor, a neprilysin inhibitor, a beta2-agonist, a CRTH2 antagonist, an FXR agonist, a BACE inhibitor, a sphingosine-1-phosphate receptor modulator, a MAPK inhibitor, a hedgehog signaling inhibitor, an MDM2 antagonist, an LSD1 inhibitor, a lactamase inhibitor, a TLR agonist, a TLR antagonist, an IDO inhibitor, an ERK inhibitor, a Chk1 inhibitor, a nucleic acid-based agent, e.g., an oligonucleotide, siRNA, shRNA, an antisense oligonucleotide, a splicing-switching oligonucleotide, mRNA, a peptide, a natural product, a polypeptide, a carbohydrate, and any combination thereof.

[0055] According to any one of the above embodiments and aspects, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides.

[0056] According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from glucose, fructose, ribose, arabinose, galactose, mannose, and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose.

[0057] According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose, and maltose. According to some embodiments, the disaccharide is sucrose.

[0058] According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose.

[0059] According to some embodiments, the carbohydrate is a tetrasaccharide.

[0060] According to some embodiments, the carbohydrate is an oligosaccharide.

[0061] According to some embodiments, the carbohydrate derivative is selected from conjugates of sugars with amino acids, polyphenols, or lipids.

[0062] According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate with an amino acid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate bound to an amino acid. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from -glucose, -mannose, ribose, -arabinose, -galactose, sucrose, and maltotriose. As used herein, the term "amino acid" refers to an organic compound containing both an amine functional group and a carboxylic acid functional group, which can be either a natural amino acid or a non-natural amino acid. The 22 natural amino acids are aspartic acid (Asp), tyrosine (Tyr), leucine (Leu), tryptophan (Trp), arginine (Arg), valine (Val), glutamic acid (Glu), methionine (Met), phenylalanine (Phe), serine (Ser), alanine (Ala), glutamine (Gln), glycine (Gly), proline (Pro), threonine (Thr), asparagine (Asn), lysine (Lys), histidine (His), isoleucine (Ile), cysteine (Cys), selenocysteine (Sec), and pyrrolysine (Pyl). According to some embodiments, the amino acid is L-cysteine. According to some embodiments, the carbohydrate derivative is D-ribose-L-cysteine.

[0063] According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate with a polyphenol. According to some embodiments, the carbohydrate derivative comprises a carbohydrate conjugated with a polyphenol. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to some embodiments, the polyphenol is selected from flavonoids and isoflavonoids. According to some embodiments, the conjugate of the sugar with the polyphenol is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, baicalin, and puerarin.

[0064] The compound (-)-epigallocatechin gallate 3'-O-α-D-glucoside has the structure of formula I.

[0065]

Chemical formula

[0066] According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate with a lipid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate conjugated with a lipid. According to some embodiments, the sugar is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose, and maltotriose. According to some embodiments, the lipid is selected from phospholipids, fatty acids, triglycerides, and amino alcohols such as serine and hydroxyproline.

[0067] According to some embodiments, the phospholipid is selected from phosphatidylcholine, polyenylphosphatidylcholine, phosphatidylinositol, phosphatidylglycerol, phosphatidylethanolamine, l-palmitoyl-2-oleoylphosphatidyl choline (POPC), sphingolipids, distearoyl, and any combination thereof. According to another embodiment, the liposome-forming lipid is a phospholipid. According to some embodiments, the amino alcohol is sphingosine. According to some embodiments, the glycosphingolipid is ganglioside. According to some embodiments, the carbohydrate derivative is a glycosphingolipid. According to some embodiments, the glycosphingolipid is cerebroside. According to some embodiments, the glycosphingolipid is glucocerebroside. According to some embodiments, cerebrosides such as glucocerebroside contain nervonic acid as the lipophilic chain.

[0068] According to some embodiments, the carbohydrate derivative does not contain cholesterol. According to some embodiments, the cargo molecule does not contain cholesterol.

[0069] According to some embodiments, the active agent is directly bound to the carbohydrate or its derivative.

[0070] According to any one of the aspects and embodiments, the carbohydrate is used as a filler, enhancer, or provider of the active agent.

[0071] According to some embodiments, the active agent is bound to the carbohydrate or its derivative via a linker. According to some embodiments, the linker is selected from hydrophilic, hydrophobic, and amphiphilic linkers. According to some embodiments, the linker is DBCO-C6-acid having CAS number 1425485-72-8.

[0072] According to some embodiments, the active agent is covalently bound to a carbohydrate or a derivative thereof via a cleavable bond or linker. According to some embodiments, the cleavage can be carried out via an enzymatic reaction. According to some embodiments, the cleavage can be carried out via a chemical reaction.

[0073] According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the active agent is an oligonucleotide. According to some embodiments, the active agent is a polynucleotide.

[0074] The term "nucleic acid" refers to a single-stranded or double-stranded sequence (polymer) of deoxyribonucleotides or ribonucleotides. Further, polynucleotides include variants of natural polynucleotides unless otherwise specified. According to one embodiment, the nucleic acid may be, but is not limited to, selected from the group consisting of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), and analogs thereof. This term encompasses DNA, RNA, single-stranded or double-stranded, and their chemical modifications.

[0075] As used herein, the term "polynucleotide" refers to a long nucleic acid containing more than 150 nucleotides.

[0076] The terms "nucleic acid" and "polynucleotide" are used interchangeably herein.

[0077] As used herein, the term "oligonucleotide" refers to a short single-stranded or double-stranded sequence of nucleic acid such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or mimetics thereof, which typically has 150 or fewer nucleotides.

[0078] According to some embodiments, the oligonucleotide comprises 2 to 150, 10 to 100, or 15 to 50 nucleotides.

[0079] According to some embodiments, the nucleic acid is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA, and miRNA inhibitors. According to some embodiments, the nucleic acid is siRNA. According to some embodiments, the nucleic acid is shRNA.

[0080] According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, the cargo molecule comprising a nucleic acid molecule chemically linked to a carbohydrate or a derivative thereof. According to some embodiments, the cargo molecule is an exogenous molecule. According to some embodiments, the nucleic acid molecule is siRNA. According to some embodiments, the nucleic acid molecule is shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate via a linker. According to some embodiments, the linker is DBCO-C6-acid. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 3' end. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its antisense strand. According to some embodiments, the isolated extracellular vesicle comprises the cargo molecule shown in FIG. 4. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising siRNA chemically linked to a carbohydrate or a derivative thereof. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound, for example, via a linker, to the 3' of the sense strand. According to some embodiments, the bond is a cleavable bond. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising a cargo molecule, the cargo molecule comprising an siRNA molecule covalently bound to glucose, optionally via a DBCO-C6-acid linker.According to some embodiments, the present invention provides isolated extracellular vesicles comprising cargo molecules, which optionally comprise siRNA molecules covalently linked to sucrose via a DBCO-C6-acid linker. According to some embodiments, the present invention provides isolated extracellular vesicles comprising cargo molecules, which optionally comprise siRNA molecules covalently linked to arabinose via a DBCO-C6-acid linker.

[0081] According to some embodiments, about 20% to about 100% of the EVs comprise the cargo molecules of the present invention. According to some embodiments, the cargo molecules are exogenous. According to some embodiments, about 25% to about 95%, about 30% to about 90%, about 35% to about 85%, about 40% to about 80%, about 45% to about 75%, about 50% to about 70%, or about 55% to about 65% of the EVs comprise the cargo molecules of the present invention.

[0082] In another aspect, the present invention provides a method of loading cargo molecules into isolated extracellular vesicles (EVs), which includes incubating a population of EVs with cargo molecules comprising an agent chemically conjugated to a carbohydrate or a derivative thereof.

[0083] According to some embodiments, the agent is selected from small molecules, proteins, peptides, polypeptides, lipids, carbohydrates, and nucleic acids. According to some embodiments, the agent is selected from small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids. According to some embodiments, the agent is selected from small molecules, lipids, carbohydrates, and nucleic acids.

[0084] According to some embodiments, the EVs are exosomes. According to some embodiments, the EVs are microvesicles. According to further embodiments, the EVs are a combination of small vesicles and large vesicles.

[0085] According to any one of the above embodiments, EVs are isolated. EVs can be isolated from cells by standard isolation and washing protocols by, for example, fractionation centrifugation, size exclusion, or any other method for particle isolation protocols from the culture medium.

[0086] According to any one of the above embodiments and aspects, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides.

[0087] In some embodiments, the carbohydrate is a monosaccharide. In some embodiments, the monosaccharide is selected from glucose, fructose, ribose, arabinose, galactose, mannose, and xylose. In some embodiments, the monosaccharide is glucose. In some embodiments, the monosaccharide is fructose. In some embodiments, the monosaccharide is arabinose.

[0088] In some embodiments, the carbohydrate is a disaccharide. In some embodiments, the disaccharide is selected from sucrose, lactose, and maltose. In some embodiments, the disaccharide is sucrose.

[0089] In some embodiments, the carbohydrate is a trisaccharide. In some embodiments, the trisaccharide is selected from maltotriose and raffinose.

[0090] In some embodiments, the carbohydrate is a tetrasaccharide.

[0091] In some embodiments, the carbohydrate is an oligosaccharide.

[0092] In some embodiments, the carbohydrate derivative is selected from conjugates of sugars with amino acids, polyphenols, or lipids. The carbohydrate derivative is as described in any one of the above embodiments.

[0093] According to some embodiments, the active agent is directly bonded to the carbohydrate or its derivative.

[0094] According to some embodiments, the active agent is bonded to the carbohydrate or its derivative via a linker. According to some embodiments, the linker is selected from hydrophilic, hydrophobic, and amphiphilic linkers. According to some embodiments, the linker is 10-hydroxydecanoic acid.

[0095] According to some embodiments, the active agent is a nucleic acid. According to some embodiments, the nucleic acid is an oligonucleotide. According to some embodiments, the nucleic acid is selected from RNA, RNAi, siRNA, shRNA, saRNA, miRNA, and miRNA inhibitors. According to some embodiments, the nucleic acid is siRNA. According to some embodiments, the nucleic acid is shRNA.

[0096] According to some embodiments, the method for preparing EVs of the present invention comprises incubating a population of EVs with a cargo molecule comprising a nucleic acid selected from siRNA, shRNA, saRNA, miRNA, RNAi, or mRNA bound to a carbohydrate or a derivative thereof selected from glucose, ribose, arabinose, galactose, mannose, sucrose, maltotriose, (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, isoquercetin, baicalin, puerarin, cerebroside, and glucocerebroside. According to some embodiments, the method for preparing EVs of the present invention comprises incubating a population of EVs with a cargo molecule, the cargo molecule comprising a nucleic acid molecule chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the cargo molecule is an exogenous molecule. According to some embodiments, the nucleic acid molecule is siRNA. According to some embodiments, the nucleic acid molecule is shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate via a linker. According to some embodiments, the linker is DBCO-C6-acid. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 3` end. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its antisense strand. According to some embodiments, the isolated extracellular vesicles contain the cargo molecule shown in FIG. 4.

[0097] According to some embodiments, the present invention provides a method for preparing isolated extracellular vesicles filled with siRNA, which includes incubating siRNA chemically bound to a carbohydrate or its derivative with isolated EVs. According to some embodiments, the siRNA or shRNA includes the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA includes the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound to the 3' of the sense strand, for example, via a linker. According to some embodiments, the linker is DBCO-C6-acid. According to some embodiments, the bond is a cleavable bond. According to some of the above embodiments, the EVs are derived from adherent cells expressing mesenchymal markers. According to some of the above embodiments, the adherent cells expressing mesenchymal markers are mesenchymal stem cells (MSCs). According to some of the above embodiments, the mesenchymal stem cells are human bone marrow mesenchymal stem cells. According to some of the above embodiments, the EVs are exosomes.

[0098] According to some embodiments, about 20% to about 100% of the resulting EVs contain the cargo molecules of the present invention. According to some embodiments, the cargo molecules are exogenous. According to some embodiments, about 25% to about 95%, about 30% to about 90%, about 35% to about 85%, about 40% to about 80%, about 45% to about 75%, about 50% to about 70%, or about 55% to about 65% of the EVs contain the cargo molecules of the present invention. According to some embodiments, about 20% to about 100%, about 25% to about 95%, about 30% to about 90%, about 35% to about 85%, about 40% to about 80%, about 45% to about 75%, about 50% to about 70%, or about 55% to about 65% of the EVs are filled with the cargo molecules of the present invention.

[0099] According to some embodiments, the method of the present invention further includes using a transfection reagent such as electroporation or a lipid transfection reagent.

[0100] According to an alternative embodiment, the method of the present invention is performed in the absence of electroporation and transfection reagents.

[0101] According to some embodiments, loading cargo molecules into EVs is performed / executed in the presence of insulin or a derivative thereof. According to some embodiments, the insulin is selected from insulin aspart, insulin glulisine, insulin lispro, regular insulin, NPH insulin, insulin detemir, insulin glargine, insulin degludec, and mixtures thereof. According to some embodiments, the insulin is rapid-acting, intermediate-acting, or long-acting insulin. According to some embodiments, the insulin is present at a concentration of 1 to 1000 nM. According to some embodiments, the insulin is present at a concentration of 1 to 1000 U / mL. According to some embodiments, the insulin is present at a concentration of 10 to 1000 U / mL. According to some embodiments, the insulin is present at a concentration of 20 to 800 U / mL, 30 to 700 U / mL, 40 to 600 U / mL, 50 to 500 U / mL, 60 to 400 U / mL, 70 to 300 U / mL, 80 to 200 U / mL, 90 to 150 U / mL, 80 to 150 U / mL, 70 to 120 U / mL, or 80 to 120 U / mL. According to some embodiments, the insulin is present at a concentration of 0.1 to 1000 U / mL. According to some embodiments, the insulin is present at a concentration of 0.1 to 100 U / mL or 0.5 to 50 U / mL. The insulin may be present throughout the entire loading time (incubation of EVs with cargo molecules) or any portion of that time.

[0102] According to some embodiments, insulin significantly increases the uptake of the cargo molecules of the present invention by EVs as compared to EVs filled without insulin. This is particularly important for cargo molecules containing active molecules conjugated to glucose. According to some embodiments, insulin increases the uptake of cargo molecules into EVs by at least 10% as compared to corresponding conditions without (lacking or devoid of) insulin. According to some embodiments, insulin increases the uptake of cargo molecules into EVs by at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%, or at least 100% as compared to corresponding conditions without insulin. According to some embodiments, insulin increases the uptake of the cargo molecules of the present invention into EVs by 10% to 60% as compared to corresponding conditions without insulin in the buffer during filling. According to some embodiments, insulin increases the uptake of cargo molecules into EVs by 15 to 55%, 20 to 50%, 25 to 45%, 30 to 50%, 30 to 55%, 35 to 50%, or 35 to 45% as compared to corresponding conditions without insulin. According to some embodiments, the cargo molecules contain an active agent covalently conjugated to glucose. According to some embodiments, the amount of cargo molecules in the resulting EVs is 10 to 60%, 15 to 55%, 20 to 50%, 25 to 45%, 30 to 50%, 30 to 55%, 35 to 50%, or 35 to 45% more than that in EVs filled without insulin. According to some embodiments, the amount of cargo molecules in the resulting EVs is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%, or at least 100% higher than that in EVs filled without insulin.The terms "substantially lacking," "essentially lacking," "lacking," "does not include," and "does not comprise" may be used interchangeably and refer to a composition that does not contain, incorporate, or include a particular component. For example, the composition contains less than 0.1% by weight, less than 0.01% by weight, or less than 0.001% by weight of the component. According to some of the above embodiments, the EV is derived from adherent cells expressing a mesenchymal marker. According to some of the above embodiments, the adherent cells expressing a mesenchymal marker are mesenchymal stem cells (MSCs). According to some of the above embodiments, the mesenchymal stem cells are human bone marrow mesenchymal stem cells. According to some of the above embodiments, the EV is an exosome.

[0103] According to another aspect, the present invention provides an EV that can be obtained by the method of the present invention described in any one of the above embodiments or an EV obtained thereby. According to some embodiments, the EV contains cargo molecules loaded by the method of the present invention. According to some of the above embodiments, the EV is derived from adherent cells expressing a mesenchymal marker. According to some of the above embodiments, the adherent cells expressing a mesenchymal marker are mesenchymal stem cells (MSCs). According to some of the above embodiments, the mesenchymal stem cells are human bone marrow mesenchymal stem cells. According to some of the above embodiments, the EV is an exosome.

[0104] According to yet another aspect, the present invention provides a composition comprising, for example, an EV of the present invention loaded with cargo molecules and a carrier. According to some embodiments, the EV can be obtained by or can be obtained by the method of the present invention.

[0105] As used herein, the term "carrier" refers to any class of compounds or compositions useful for facilitating the storage, stability, administration, cell targeting, and / or delivery of a topical composition, and includes, but is not limited to, suitable vehicles, skin conditioning agents, skin protectants, diluents, emollients, solvents, excipients, pH adjusters, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, defoaming agents, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, mono-, di-, and tri-glycerides and their derivatives, waxes, oils, and water.

[0106] According to some embodiments, the composition is a pharmaceutical composition and the carrier is a pharmaceutically acceptable carrier.

[0107] Thus, according to some embodiments, the present invention provides a pharmaceutical composition comprising a population of EVs according to any one of the above embodiments and aspects, and a pharmaceutically acceptable carrier. According to some embodiments, the present invention provides a pharmaceutical composition comprising a population of EVs obtained by or obtainable by the method of the present invention, and a pharmaceutically acceptable carrier.

[0108] As used herein, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to any solvent, dispersion medium, preservative, antioxidant, coating, isotonic and absorption delaying agent, surfactant, filler, disintegrant, binder, diluent, lubricant, flow promoter, pH adjuster, buffer, enhancer, wetting agent, solubilizer, surfactant, antioxidant, etc. that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may also contain other active compounds that provide auxiliary, additional, or enhanced therapeutic functions. The solid carrier or excipient can be, for example, lactose, starch or talc, or the liquid carrier can be, for example, water, fatty oil, or liquid paraffin, etc.

[0109] Other carriers or excipients that can be used include animal or plant proteins such as gelatin, dextrin, and soybean, wheat, and tobacco seed proteins; gums such as acacia, guar, agar, and xanthan; polysaccharides; alginates; carboxymethylcellulose; carrageenan; dextran; pectin; synthetic polymers such as polyvinylpyrrolidone; polypeptide / protein or polysaccharide complexes such as gelatin-acacia complexes; sugars such as mannitol, dextrose, galactose, trehalose; cyclic sugars such as cyclodextrin; inorganic salts such as sodium phosphate, sodium chloride, and aluminum silicate; and amino acids having 2 to 12 carbon atoms and derivatives thereof, such as, but not limited to, materials derived from glycine, alanine, aspartic acid, glutamic acid, hydroxyproline, isoleucine, leucine, and phenylalanine, but are not limited thereto. Each possibility represents an individual embodiment of the present invention.

[0110] Solutions or suspensions for parenteral, intradermal, or subcutaneous application typically contain the following components: a sterile diluent such as water for injection, physiological saline, fixed oil, polyethylene glycol, glycerin, propylene glycol (or other synthetic solvents), an antibacterial agent (e.g., benzyl alcohol, methylparaben), an antioxidant (e.g., ascorbic acid, sodium bisulfite), a chelating agent (e.g., ethylenediaminetetraacetic acid), a buffer (e.g., acetic acid, citric acid, phosphoric acid), and an isotonicity agent (e.g., sodium chloride, dextrose). The pH can be adjusted with an acid or a base such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be placed in ampoules, disposable syringes, or multiple-dose glass or plastic vials.

[0111] Pharmaceutical compositions suitable for parenteral administration include, but are not limited to, aqueous and non-aqueous sterile injectable solutions or suspensions that can contain antioxidants, buffers, bacteriostats, and solutes that render the composition substantially isotonic with the blood of the intended recipient. Such compositions can also contain, for example, water, alcohol, polyols, glycerin, and vegetable oils. Immediate injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Such compositions preferably contain a therapeutically effective amount of a compound of the present invention and / or another therapeutic agent, together with a suitable amount of a carrier, to provide a form suitable for proper administration to a subject.

[0112] According to some embodiments, the pharmaceutical composition of the present invention comprises a population of EVs comprising cargo molecules, the cargo molecules comprising nucleic acid molecules chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the cargo molecules are exogenous molecules. According to some embodiments, the nucleic acid molecule is siRNA. According to some embodiments, the nucleic acid molecule is shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate via a linker. According to some embodiments, the linker is DBCO-C6-acid. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 3` end. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its antisense strand. According to some embodiments, the isolated extracellular vesicles comprise the cargo molecules shown in Figure 4. According to some embodiments, the present invention provides isolated extracellular vesicles comprising siRNA chemically bound to a carbohydrate or a derivative thereof. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound, for example, via a linker, to the 3' of the sense strand. According to some embodiments, the bond is a cleavable bond. According to some of the above embodiments, the EVs are derived from adherent cells expressing a mesenchymal marker. According to some of the above embodiments, the adherent cells expressing a mesenchymal marker are mesenchymal stem cells (MSCs). According to some of the above embodiments, the mesenchymal stem cells are human bone marrow mesenchymal stem cells.According to some of the above embodiments, the EV is an exosome. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated extracellular vesicles containing cargo molecules, the cargo molecules optionally comprising siRNA molecules covalently bound to glucose via a DBCO-C6-acid linker. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated extracellular vesicles containing cargo molecules, the cargo molecules optionally comprising siRNA molecules covalently bound to sucrose via a DBCO-C6-acid linker. According to some embodiments, the present invention provides isolated extracellular vesicles containing cargo molecules, the cargo molecules optionally comprising siRNA molecules covalently bound to arabinose via a DBCO-C6-acid linker.

[0113] According to some embodiments, the pharmaceutical composition is for use in the treatment and / or prevention of a disease, disorder, or condition treatable with an active agent encapsulated in the EV. It is clear that the use depends on and is adapted according to the molecule encapsulated in the EV. Thus, a pharmaceutical composition comprising EVs loaded with siRNA that inhibits the expression of the Phosphatase and tensin homolog (PTEN) protein is for use in the treatment of neurodegenerative diseases, neuronal disorders, neuronal injury, CNS injury, neuronal injury or damage, such as spinal cord injury (SCI), or any disease or condition in which a reduction in PTEN protein expression is required.

[0114] The term "treating" a condition or patient refers to taking measures to obtain a beneficial or desired result, including a clinical result. Beneficial or desired clinical results include, but are not limited to, improving, inhibiting, substantially inhibiting, delaying, or reversing the progression of a disease, condition, or disorder; substantially improving or alleviating the clinical or aesthetic symptoms of a condition; substantially preventing the onset of clinical or aesthetic symptoms of a disease, condition, or disorder; and protecting from adverse or bothersome symptoms. Treating further refers to achieving one or more of the following: (a) reducing the severity of a disorder, (b) limiting the onset of symptoms characteristic of the disorder being treated, (c) limiting the worsening of symptoms characteristic of the disorder being treated, (d) limiting the recurrence of a disorder in a patient who has previously had the disorder, and / or (e) limiting the recurrence of symptoms in a patient who was previously asymptomatic with respect to the disorder.

[0115] As used herein, the term "preventing," when used in connection with a condition, refers to the administration of a composition that reduces the frequency of symptoms of a medical condition or delays the onset thereof in a subject as compared to a subject not given the composition.

[0116] The pharmaceutical composition of the present invention can be administered using any known method. The terms "administer" or "administration" of a substance, compound, or agent to a subject can be carried out using one of various methods known to those skilled in the art. For example, the compound or agent can be administered intranasally (e.g., by inhalation), intrathecal (within the spinal canal, or intrathecal), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, intravitreally, sublingually, orally (by ingestion), intracranially, and transdermally (by absorption, e.g., through a skin conduit). The compound or agent can also be appropriately introduced by a rechargeable polymer device or a biodegradable polymer device or other devices, such as patches and pumps, or formulations, resulting in sustained release, slow release, or controlled release of the compound or agent. Administration can also be carried out, for example, once, multiple times, and / or over one or more extended periods. According to some embodiments, the composition is administered once, twice, three times, four times, five times, or six times a day. According to other embodiments, the composition is administered once, twice, three times, four times, five times, or six times a month. In some embodiments, administration includes both direct administration, including self-administration, and indirect administration, including the act of prescribing a drug. For example, as used herein, a physician who instructs a patient to self-administer a drug or to administer the drug to another person and / or provides a prescription for the drug to the patient administers the drug to the patient. According to one embodiment, the pharmaceutical composition of the present invention is administered intranasally. According to another embodiment, the pharmaceutical composition of the present invention is administered intralesionally. According to another embodiment, the pharmaceutical composition of the present invention is administered near a damaged or injured area. According to one embodiment, the pharmaceutical composition is administered orally. According to one embodiment, the pharmaceutical composition is administered intranasally. According to some embodiments, the pharmaceutical composition is administered topically. According to some embodiments, the pharmaceutical composition is administered systemically.

[0117] According to another aspect, the present invention provides a method for delivering an active agent, which includes exposing a mammal, organ, tissue, or target cell to an EV of the present invention containing a cargo molecule of the present invention containing the active agent, e.g., an EV obtained or obtainable by the method of the present invention.

[0118] According to yet another aspect, the present invention provides a method of treating a disease, medical condition, or disorder treatable by an active agent, the method comprising administering to a subject in need thereof an EV of the present invention comprising a cargo molecule comprising a therapeutically effective amount of an active agent conjugated to a carbohydrate, as described in any one of the above embodiments.

[0119] According to another aspect, the present invention provides a conjugate molecule comprising an exogenous nucleic acid chemically conjugated to a carbohydrate or a derivative thereof. All terms and embodiments defined above apply equally herein and are incorporated. According to some embodiments, the conjugate molecule lacks cholesterol.

[0120] According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides, and the carbohydrate derivative is selected from sugars conjugated to amino acids, polyphenols, or lipids.

[0121] According to one embodiment, the monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose, fructose, and xylose, and the disaccharide is selected from sucrose, lactose, and maltose. According to one embodiment, the trisaccharide is selected from maltotriose and raffinose. According to some embodiments, the sugar conjugated to an amino acid residue is ribose-cysteine. According to some embodiments, the sugar conjugated to a polyphenol is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, baicalin, and puerarin. According to some embodiments, the sugar conjugated to a lipid is cerebroside. According to some embodiments, the cerebroside is glucocerebroside.

[0122] According to some embodiments, the nucleic acid is directly or via a linker bound to a carbohydrate or a derivative thereof. Any linker, such as those defined above, can be used. According to some embodiments, the nucleic acid is an oligonucleotide.

[0123] According to some embodiments, the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, miRNA, miRNA inhibitor, and short activating RNA (saRNA). Thus, according to some embodiments, the present invention provides a conjugate comprising an oligonucleotide selected from RNA, RNAi, siRNA, shRNA, miRNA, and miRNA inhibitor chemically conjugated to a carbohydrate or a derivative thereof. According to some embodiments, the nucleic acid molecule is siRNA. According to some embodiments, the nucleic acid molecule is shRNA. According to some embodiments, the carbohydrate is glucose. According to some embodiments, the carbohydrate is sucrose. According to some embodiments, the carbohydrate is fructose. According to some embodiments, the carbohydrate is arabinose. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate. According to some embodiments, the nucleic acid is covalently bound to the carbohydrate via a linker. According to some embodiments, the linker is a DBCO-C6-acid linker. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 5' end. According to some embodiments, the nucleic acid is a nucleic acid and the carbohydrate is bound to its 3' end. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its sense strand. According to some embodiments, the nucleic acid is siRNA and the carbohydrate is bound to its antisense strand. According to some embodiments, the cargo molecule has the structure shown in FIG. 4. According to some embodiments, the present invention provides an isolated extracellular vesicle comprising siRNA chemically conjugated to a carbohydrate or a derivative thereof. According to some embodiments, the siRNA or shRNA comprises the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 1) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 2). According to some embodiments, the siRNA comprises the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 2, and the carbohydrate is bound, for example, via a linker, to the 3' of the sense strand. According to some embodiments, the bond is a cleavable bond.According to some embodiments, the active agent is covalently bound to a carbohydrate or a derivative thereof via a cleavable bond or linker. According to some embodiments, the cleavage can be effected via an enzymatic reaction. According to some embodiments, the cleavage can be effected via a chemical reaction. According to some embodiments, the present invention provides an exogenous siRNA molecule optionally covalently bound to glucose via a DBCO-C6-acid linker. According to some embodiments, the present invention provides an exogenous siRNA molecule optionally covalently bound to sucrose via a DBCO-C6-acid linker. According to some embodiments, the present invention provides an exogenous siRNA molecule optionally covalently bound to arabinose via a DBCO-C6-acid linker.

[0124] The terms "a", "an", and "the" are used interchangeably herein and mean one or more.

[0125] The term "and / or" is used to indicate that one or both of the stated cases may occur; for example, A and / or B includes (A and B) as well as (A or B).

[0126] The term "or" as used herein indicates alternatives that can be combined where appropriate. That is, the term "or" includes each of the recited alternatives separately as well as combinations thereof where the combinations are not mutually exclusive.

[0127] The terms "comprising", "comprise(s)", "include(s)", "having", "has", and "contain(s)" are used interchangeably herein and have the meaning of "consisting at least in part of". When interpreting each description herein that includes the term "comprising", other features or features starting with this term may also be present. Related terms such as "comprise" and "comprises" are interpreted similarly. The terms "have", "has", "having", and "comprising" may also encompass the meanings of "consisting of" and "consisting essentially of" and may be replaced by these terms. The term "consisting of" excludes components, steps, or procedures not specifically described or enumerated. The term "consisting essentially of" means that a composition or component may contain additional ingredients, but only if the additional ingredients do not substantially change the basic and novel features of the composition or method according to the claim.

[0128] Although the present invention has been generally described thus far, these are provided by way of example and will be more readily understood with reference to the following examples, which are not intended to limit the present invention.

Examples

[0129] Example 1. The filling protocol is for each of three different concentrations of sugar, sugar derivative, sugar derivative-siRNA conjugate, and sugar-siRNA conjugate, and 10 6 ~10 8Co-incubation with exosomes at 25 °C and 37 °C for 2 and 4 hours with and without insulin. The sugars and sugar derivatives tested were glucose, ribose, arabinose, galactose, sucrose, mannose, maltotriose, (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, isoquercetin, baicalin, puerarin, cerebroside, and glucocerebroside. All possibilities are tested in triplicate. After incubation, the exosomes are separated from the medium and washed twice. The loaded exosomes are used to quantify the sugars, sugar derivatives, sugar-siRNA conjugates, and siRNA concentrations within the exosomes, as well as for subsequent related in vitro experiments.

[0130] Test the sugars / sugar derivatives, sugar / sugar derivative-siRNA conjugates, and siRNA concentrations within the exosomes using at least two different analytical methods (e.g., using fluorescent labeling, ELISA, WB, PCR, LC-MS / MS).

[0131] Then, incubate the exosomes filled with the most successful cargo molecules containing the sugars / sugar derivatives and sugars / sugar derivatives conjugated to siRNA (which achieved the highest concentration within the exosomes) with cells to demonstrate the suppression and inhibition of the relevant genes and proteins.

[0132] To determine the efficiency of sugars / sugar derivatives, sugar / sugar derivative-siRNA conjugates for exosome loading, perform the following procedure.

[0133] Each of three different concentrations of sugars, sugar derivatives, sugar derivative-siRNA conjugates, and sugar-siRNA conjugates, along with 10 6 ~10 8After the filling protocol of co-incubation with exosomes at 25 °C and 37 °C for 2 hours and 4 hours, cy-3 labeled siRNA will be added to each sample to determine the filling efficiency. The exosomes are labeled with a fluorescent dye (as carboxyfluorescein succinimidyl ester - CFSE green dye) for exosome membrane staining. Thus, the cell membrane will be stained with CFSE green dye and the siRNA cargo will be stained with Cy3 / FAM red label. Using Cytoflex / Nanosight or other nanoparticle tracking analysis (NTA) techniques, we will be able to look at the filled exosomes and determine the filling efficiency for each condition.

[0134] Furthermore, the labeled filled exosomes for each condition are added to cells. The cells are observed under a confocal microscope to determine the proper phagocytosis of exosomes by the cells.

[0135] Next, to evaluate the efficient suppression and inhibition of the siRNA-targeted gene by the siRNA loaded in exosomes, the cells are incubated with the filled exosomes from all the above-mentioned conditions for 24 - 72 hours, harvested, and tested at the RNA and protein levels. For the evaluation of gene expression in cells, RNA is extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's protocol. cDNA is prepared using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). Real-time quantitative PCR is performed on a QuantStudio 12K Flex real-time PCR system using primers specific for the target gene. The ΔΔCt method is used to determine the relative expression levels, where the gene of interest will be normalized against GAPDH expression.

[0136] For the evaluation of protein expression, cells are incubated with filled exosomes from all of the above conditions for 24 to 72 hours, harvested, and lysed. The lysate is tested for protein expression using either Western blot analysis or / and ELISA using an antibody specific for the target protein.

[0137] Example 2 Four different sugars (three monosaccharides and one disaccharide (glucose, mannose, galactose, and sucrose)) were incubated with extracellular vesicles derived from BM-MSC and, after incubation, separated by UHPLC using a special sugar column: Phenomenex (Luna Omega) Agilent 1290 Infinity II combined with 1260 Infinity ELSD.

[0138] Materials and Methods · Glucose working solution - concentration of 1000 PPM (about 1 mg / mL) · Sucrose working solution - concentration of 1000 PPM (about 1 mg / mL) · Arabinose working solution - concentration of 1000 PPM (about 1 mg / mL) · Galactose working solution - concentration of 1000 PPM (about 1 mg / mL) · Approximately 10 7 EVs (measured by Nanosight NS300) at a concentration of particles / μl were added to each of the four different sugar solutions in a volume of 10 μl. · The volume was made up to 100 μl using DDW. · The solutions were incubated at room temperature for 30 minutes with shaking.

[0139] HPLC Parameters for Different Sugar Separation Separation was performed by UHPLC using a special sugar column: Phenomenex (Luna Omega) Agilent 1290 Infinity II combined with 1260 Infinity ELSD.

[0140] Phase Preparation: · Water (A) · Solvent mixture (B): Acetonitrile (90%). Isopropanol (5%), Water (5%)

[0141] The initial concentrations of the phases were 5% (A) and 95% (B).

[0142] During the run, the concentrations were gradually changed to 10% (A) and 90% (B).

[0143] The chromatographs of each sugar, EV, and sugar with EV were analyzed and compared, and the absorption level of sugar into EV was calculated. The fractions of unbound sugar are summarized in Table 1.

[0144]

Table 1

[0145] In this experiment, the inventors tested the interaction of four different sugars at a fixed concentration (1000 ppm) and a fixed concentration of exosomes 10 7 particles / μl. The results show that up to 80% of each sugar was absorbed into / onto MSC-derived EVs under these conditions.

[0146] In a similar setup, additional sugars: ribose, mannose, lactose, maltose, maltotriose, and raffinose are tested.

[0147] Example 3. Quantitative measurement of glucose absorption efficacy for BM MSC-derived EVs Experimental objective: The objective of this experiment was to quantitatively measure the glucose absorption efficacy into BM MSC-derived EVs and to develop QC and QA analytical methods for quantifying glucose conjugate molecules as EV filling reagents.

[0148] Experimental plan: This experiment was based on the previous results obtained in Example 2, which showed high absorption efficacy of four different sugars (glucose, sucrose, mannose, and galactose) against BM MSC-derived EVs. Here, glucose as a filling reagent for EVs and the determination of its absorption curve were focused on.

[0149] Working protocol · Glucose working solution - Concentration of 1000 PPM · 10 μl of EVs was added to solutions with different glucose concentrations (determined by Nanosight NS300) at a concentration of approximately 10 7 particles / μl (see Table 2). · The volume was made up to 100 μl using DDW. · The solution was incubated at room temperature for 30 minutes with shaking.

[0150]

Table 2

[0151] HPLC parameters for glucose separation Separation was performed by UHPLC using a special sugar column: Phenomenex (Luna Omega) Agilent 1290 Infinity II combined with 1260 Infinity ELSD.

[0152] Phase preparation: · Water (A) · Solvent mixture (B): Acetonitrile (90%). Isopropanol (5%), water (5%)

[0153] The initial concentration of the phases was 5% (A) and 95% (B).

[0154] During operation, the concentration was gradually changed to 10% (A) and 90% (B).

[0155] The integration of the chromatograph under different glucose concentration (PPM) conditions and different controls was calculated to determine the amount of glucose absorbed.

[0156] Calibration curve. As a first step, the inventors verified that glucose concentrations between 250 PPM and 1000 PPM were within the linear range of detection. A calibration curve was created, showing that this was the case with R 2 = 0.9932. Furthermore, the absorption of glucose into exosomes was measured. The results are shown in Table 3.

[0157] Absorption curve

[0158]

Table 3

[0159] The absorption capacity of glucose into EV (UHPLC, Agilent) was approximately 40% for a glucose concentration of 250 PPM.

[0160] Example 4: Quantitative measurement of sucrose absorption efficacy for BM MSC-derived EVs Experimental objective: The objective of this experiment was to measure the sucrose absorption effectiveness into BM MSC EVs in quantitative measurements, develop an analytical method for quantifying the loading of sucrose conjugate molecules into exosomes, and demonstrate that conjugating the molecule with glucose is an efficient method for loading the necessary molecules into EVs. Different sucrose concentrations were used to measure the absorption effectiveness of the disaccharide (compared to monosaccharides).

[0161] Experimental plan: This experiment was based on previous results showing high absorption effectiveness of four different monosaccharides (glucose, sucrose, arabinose, galactose) for MSC EVs. In this experiment, the inventors focused on sucrose as a loading reagent for EVs and defined its absorption curve.

[0162] Operation protocol · A sucrose solution was prepared at a concentration of 1000 PPM. · 10 μl of exosomes were added to solutions with different sucrose concentrations at a concentration of approximately 10 7 particles / μl [protein 3.01 μg / μl] (see the following table). · The solution was incubated at room temperature for 0.5 hours while shaking. · The working concentrations are summarized in Table 4.

[0163]

Table 4

[0164] HPLC parameters for sucrose separation Separation was performed by UHPLC using a Phenomenex (Luna Omega) Agilent 1290 Infinity II combined with a special sugar column: 1260 Infinity ELSD.

[0165] Phase preparation: · Water (A) · Solvent mixture (B): Acetonitrile (90%), isopropanol (5%), water (5%)

[0166] The initial concentration of the phases is 5% (A) and 95% (B).

[0167] During operation, the concentration is gradually changed to 10% (A) and 90% (B).

[0168] Results First, similar to the case of glucose, the inventors constructed a calibration plot and verified that the sucrose concentration range of 250 - 1500 PPM is within the linear detection range. The results are summarized in Table 5.

[0169]

Table 5

[0170] Sucrose at different concentrations shows a linear curve. This regulation is important for demonstrating the calibration of the system.

[0171] EV verification To verify EV before the absorption test, only EV was tested by UHPLC. The chromatograms shown below confirm their validity (Figure 1).

[0172] Analysis of the sucrose absorption curve The results of the absorption of sucrose on EV are shown in Table 5 and Figure 2.

[0173] [Table 6]

[0174] Summary and conclusion: Overall, the results show an absorption curve with an upper absorbance of approximately 500 ppm sucrose.

[0175] Example 5 The siRNA used in this experiment is anti-PTEN-siRNA1962 conjugated with a sugar, more specifically glucose. The siRNA sequence is described below.

[0176] [Table 7]

[0177] The HPLC analysis of the siRNA is shown in Figure 3. A schematic diagram of such a conjugate is shown in Figure 4A, and a more specific conjugate with glucose is shown in Figure 4B.

[0178] In other examples of the present invention, the siRNA is conjugated with other sugars: sucrose, arabinose, mannose, galactose, ribose, lactose, maltose, maltotriose, and raffinose.

[0179] Example 6 As a next step, it was tested whether the conjugation of siRNA with glucose affects the efficacy of siRNA. It was carried out using normal transfection of cells (by using Lipofectamine) with the conjugate as described in Example 5.

[0180] Transfection: Grow HEK293 to a confluence density of 90%. One day before transfection, seed 20K cells / well into a 96-well plate containing 100 μl of growth medium per well. Perform the transfection in triplicate. Mix siRNA with transfection medium (serum-free T medium - growth medium) according to the manufacturer's protocol. Gently mix Lipofectamine™ RNAiMAX before use and then dilute as described above. Mix gently. Combine the diluted RNAi duplex with the diluted Lipofectamine™ RNAiMAX. Mix gently and incubate at room temperature for 5 - 20 minutes.

[0181] Replace the medium for all wells so that they are transfected with 100 μl of growth medium.

[0182] Add the RNAi duplex-Lipofectamine™ RNAiMAX complex to the cells in each well. Mix gently by rocking the plate back and forth. Incubate the cells at 37°C for 24 hours. After 24 hours, replace the medium (100 μl medium / well) for all samples and image the cells under a fluorescence microscope to record the transfection efficiency (pic / calculation). After 72 hours, the cells are ready to be harvested for RNA purification.

[0183] Gene expression: RNA was isolated using the RNeasy Mini Kit according to the manufacturer's instructions. cDNA was prepared from 500 ng of RNA using the cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions.

[0184] RNA levels were evaluated using the designed Taqman probe. The relative expression of the target gene (PTEN) compared to GAPDH as a normalization gene was calculated using the delta Ct method. The expression levels were normalized to cells that were not transfected.

[0185] The results are shown in Figure 5, indicating that the conjugation of siRNA with glucose does not affect the activity of siRNA. In the figure: NUR001 is anti-PTEN siRNA, the conjugate of cholesterol with the competitor-loaded siRNA, and NurExo-Load is the conjugate of glucose with the siRNA described in Example 4. As is clear from the figure, glucose conjugated to siRNA does not affect the efficiency of siRNA to knockdown PTEN expression after transfection of HEK293 cells.

[0186] Example 7. The purpose of the experiment was to determine the loading efficiency of siRNA molecules into EVs and the percentage of EVs loaded with siRNA conjugated to sugar. siRNAs conjugated to glucose (as in Example 5) and cholesterol were compared. EVs derived from bone marrow MSCs were stained with a lipophilic dye (protocol EV staining) and loaded with fluorescently labeled siRNA conjugates. A 35 nm qEV single column (Izon) was used for the purification of EVs. Samples were eluted with filtered PBS (0.02 μm). The collected fractions were then transferred to an Amicon ultrafiltration filter tube with a 30 kDa cut-off, and then the volume was adjusted to 500 μl with PBS (0.02 μm). To concentrate the EVs, the tube was centrifuged at 14,000×g for 10 minutes at room temperature. To obtain maximum recovery of the concentrate, the Amicon ultrafiltration filter tube was then inverted into a new collection tube and centrifuged at 1000×g for 5 minutes at room temperature. The fractions were then observed and analyzed under a high-resolution microscope (data not shown). Figure 6 shows the effectiveness of loading of siRNA conjugated to glucose compared to the same siRNA conjugated to cholesterol. As can be seen from the figure, the loading effectiveness is approximately 60%, which is the same as that of loading with cholesterol conjugate.

[0187] In a similar arrangement, siRNAs conjugated to other sugars: sucrose, arabinose, galactose ribose, mannose, lactose, maltose, maltotriose, and raffinose are tested.

[0188] Example 8. In this example, the ability of EVs loaded with glucose-conjugated or cholesterol-conjugated siRNA to enter cells was tested. For this purpose, the loaded EVs were incubated with human progenitor cells.

[0189] Method: ReN cells were grown to a confluence density of 80 - 90%. One day before EV treatment, 10K cells / well were seeded into a Matrigel-coated 96-well plate containing 100 μl of growth medium. On the day of the experiment, the medium was changed.

[0190] The EVs were thawed and processed. 1. The EVs were stained with a membrane marker (DiD) filled with Ellap5-cholesterol-Cy3. 2. The EVs were stained with a membrane marker (DiD) filled with Ellap5-glucose-Cy3.

[0191] 7 μL of each sample was added in triplicate to each well. The cells were incubated at 37 °C for 24 hours.

[0192] The next day, the cells were washed once with PBS and Hoechst staining was performed. Images were obtained using a super-resolution microscope (Light Sheet, Zeiss Z7).

[0193] As seen in FIGS. 7A and 7B, EVs filled with glucose conjugate or cholesterol conjugate siRNA were similarly uploaded by the cells.

[0194] In a similar setup, test siRNAs conjugated with other sugars: sucrose, arabinose, galactose, ribose, mannose, lactose, maltose, maltotriose, and raffinose are tested.

[0195] Example 9. Loading of EVs in the presence of insulin Experiment I Exosomes (200 μl of PBS; 10 8(5 nmol of siRNA conjugated with glucose, along with 0.1 U of insulin added to the above-mentioned 200 μl) are incubated at 37 °C for 4 hours. Next, the exosomes are washed by Amicon filtration or ultracentrifugation (100,000×G, 2 hours) and resuspended in 200 μl of physiological saline for further characterization. These results are compared with the control condition, i.e., the condition without adding insulin. After adding the filled exosomes to the cells, the comparison is made based on the expression of the silenced gene (i.e., PTEN) by RT-qPCR and Western blot of the target gene in the cells.

[0196] Experiment II (20 μl of 10 8 exosomes (particles / μl) are incubated at room temperature (or 37 °C) for 2 - 4 hours together with 5 nmol of siRNA (the above-mentioned reagent) conjugated with glucose or something else and cy3 / FAM as a fluorescent label, and 10 μg of insulin. Next, the exosomes are washed by Amicon filtration or ultracentrifugation (100,000 G, 2 hours) and resuspended in 200 μl of physiological saline for characterization. These results are compared with the control condition of exosomes incubated with siRNA conjugated with glucose without insulin. The output is the fluorescence analysis of exosomes using Nanosight / Cytoflex or a high-resolution microscope.

[0197] Experiment III Extracellular vesicles (EVs) obtained from bone marrow mesenchymal stem cells (MSCs) (1×10 10Particles / mL) were pre-incubated at 37°C for 20 minutes with insulin (100 U / mL) diluted 1:6000, and then mixed with glucose (CTRL) as 2-NBDG (0.1 mM) (Invitrogen catalog number N13195) at 37°C for 1 hour. Subsequently, EVs were labeled with 1,1-dioctadecyl-3,3,3,3-tetramethylindodicarbocyanine (DiD). To remove small particles containing dye aggregates, EVs were eluted through an Izon column. The EV suspension was visualized using a super-resolution microscope, and the fluorescence signal was measured using IMARIS software. Values are expressed as mean ± standard error of the mean (SEM).

[0198] The results are shown in Table 8. It can be seen that the presence of insulin significantly increases glucose uptake into EVs by approximately 40%.

[0199] Similar experiments were performed using sugars such as sucrose, arabinose, galactose, ribose, mannose, lactose, maltose, maltotriose, and raffinose.

[0200] Example 10. Treatment of Complete Spinal Cord Injury with siPTEN-Glucose-Loaded EVs In this experiment, rats with complete spinal cord injury were treated intranasally using siPTEN-glucose-loaded EVs.

[0201] Surgery and treatment administration were performed as described by Guo et al, 2019 ACS Nano 2019 13(9), 10015-10028 DOI: 10.1021 / acsnano.9b01892.

[0202] To evaluate the neuroprotective ability of ExoPTEN treatment, complete Rats with SCI were divided into four groups (4 rats per group at the start of the experiment): (1) no treatment, (2) PTEN-siRNA treatment, (3) exosomes only, and (4) ExoPTEN. The treatments were administered intranasally and started 2 - 3 hours after injury.

[0203] The results of the experiment indicate that intranasal ExoPTEN treatment improves motor, sensory, and reflex recovery, as well as health, in injured rats. The results of in vivo studies of spinal cord injury (complete transection) in rats after intranasal ExoPTEN treatment only are shown in Figures 9 - 12. In the figures, ExoPTEN is an EV derived from bone marrow MSCs filled with siRNA_1962 conjugated with glucose, and siPTEN refers to siRNA_1962. Sequence: commercially available anti-PTEN siRNA conjugated with cholesterol and filled in POC exosomes, and control - saline, with antisense UUCUGUUUGUGGAAGAACUC (SEQ ID NO: 3) and sense GAGUUCUUCCACAAACAGAA (SEQ ID NO: 4).

[0204] This study showed the following. · In the ExoPTEN treatment group, including 4 rats that received intranasal administration of ExoPTEN, 75% of the rats responded to the treatment, regained hind limb reflexes, recovered some motor function, showed no signs of self-harm (an indicator of stress), and recovered sensory control. · In the groups treated with exosomes only and therapeutic PTEN siRNA molecules only, 25% of the 4 rats in each group experienced recovery of hind limb reflexes, motor function, and sensory control, but showed no signs of stress-related self-harm. · In the control group of 6 rats treated with non-therapeutic saline, no sensory, reflex recovery, or motor rehabilitation was shown. All rats in this group showed self-harming behavior and a higher level of stress.

[0205] In addition, MRI analysis of the spinal cord of rats clearly showed the presence of tissue regeneration caudal to the central part of the T10 injury in treated rats compared to control (saline) rats.

[0206] Although the present invention has been described above in this specification as its preferred embodiments, it can be modified without departing from the spirit and nature of the present invention as defined in the appended claims.

Claims

1. An isolated extracellular vesicle (EV) comprising an exogenous cargo molecule, wherein the exogenous cargo molecule comprises an activator chemically bound to at least one carbohydrate or a derivative thereof, and the activator is selected from small molecules, proteins, peptides, polypeptides, lipids, and nucleic acids.

2. The isolated EV according to claim 1, wherein the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides, or the carbohydrate derivative is selected from amino acids, polyphenols, or lipid-bound sugars.

3. The isolated EV according to claim 2, wherein the monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose, and xylose; the disaccharide is selected from sucrose, lactose, and maltose; the trisaccharide is selected from maltotriose and raffinose; the sugar bound to an amino acid is D-ribose-L-cysteine; the sugar bound to a polyphenol is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, baicalin, and puerarin; the sugar bound to a lipid is a cerebroside such as glucocerebroside; and optionally the activator is bound to the carbohydrate via a linker.

4. The isolated EV according to any one of claims 1 to 3, wherein the activator is a nucleic acid.

5. The isolated EV according to claim 4, wherein the nucleic acid is an oligonucleotide, and the oligonucleotide is optionally selected from RNA, RNAi, siRNA, shRNA, miRNA, and short activated RNA (saRNA).

6. The isolated EV according to claim 1, wherein the activator is covalently bonded to a carbohydrate or a derivative thereof via a cleavable bond.

7. A method for loading cargo molecules into isolated extracellular vesicles (EVs), comprising incubating a group of EVs with carbohydrate molecules as activators, or with cargo molecules containing an activator chemically bound to at least one carbohydrate or a derivative thereof, wherein the activator is selected from small molecules, proteins, peptides, lipids, polypeptides, and nucleic acids.

8. The method according to claim 7, wherein the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides, the carbohydrate derivative is selected from amino acids, polyphenols, and lipids bound to the carbohydrate, and optionally the activator is bound to the carbohydrate via a linker.

9. (i) The monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose, and xylose. (ii) The disaccharide is selected from sucrose, lactose, and maltose. (iii) The trisaccharide is maltotriose, or (iv) The derivative containing a sugar bound to an amino acid is derived from D-ribose-L-cysteine. (v) The derivative containing a sugar bound to a polyphenol is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, baicalin, puerarin, flavonoids, and isoflavonoids, or (vi) The derivative containing a sugar bound to a lipid is a cerebroside, and optionally the cerebroside is a glucocerebroside. The method according to claim 8.

10. characterized by at least one of the following: (i) The linker is DBCO-C6-acid, (ii) The activator molecule is a nucleic acid. (iii) The nucleic acid is an oligonucleotide, and the oligonucleotide is optionally selected from RNA, RNAi, siRNA, shRNA, saRNA, and miRNA inhibitors. (iv) The method is carried out in the presence of insulin, and optionally the amount of filled exogenous cargo molecules in the resulting EV is at least 20% higher than that of an EV filled in the absence of insulin. (v) The EV is an exosome, or (vi) The extracellular vesicles are derived from adherent cells expressing a mesenchymal marker, and the adherent cells expressing the mesenchymal marker are optionally mesenchymal stem cells (MSCs). The method according to claim 7.

11. The method according to claim 7, wherein the activator molecule is a nucleic acid bound to a carbohydrate selected from glucose and sucrose.

12. The method according to claim 7, wherein the method includes electroporation or the use of a transfection reagent such as a lipid transfection reagent, or the method is carried out in the absence of electroporation and in the absence of a transfection reagent.

13. Isolated EVs that can be obtained or obtained by the method described in any one of claims 7 to 12.

14. A pharmaceutical composition comprising a group of isolated EVs containing an exogenous cargo molecule containing the activator described in claim 1, and a pharmaceutically acceptable carrier and / or excipient.

15. An exogenous conjugate molecule comprising a nucleic acid covalently bonded to at least one carbohydrate or its derivative.

16. The conjugate molecule according to claim 15, wherein the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides, the carbohydrate derivative is selected from amino acids, polyphenols, or lipid-bound sugars, optionally the monosaccharide is selected from glucose, ribose, arabinose, galactose, mannose, and xylose, the disaccharide is selected from sucrose, lactose, and maltose, the trisaccharide is selected from maltotriose and lactose, the amino acid-bound sugar is D-ribose-L-cysteine, the polyphenol-bound sugar is selected from (-)-epigallocatechin gallate 3'-O-α-D-glucoside, isoquercitrin, baicalin, and puerarin, and the lipid-bound sugar is a cerebroside such as glucocerebroside.

17. characterized by at least one of the following: (i) The nucleic acid is bound to the carbohydrate via a linker, an optionally cleavable linker, or (ii) The nucleic acid is an oligonucleotide, The conjugate molecule according to claim 15.

18. The conjugate molecule according to claim 17, wherein the oligonucleotide is selected from RNA, RNAi, siRNA, shRNA, miRNA, and saRNA.

19. The conjugate molecule according to claim 17, wherein the oligonucleotide is siRNA.

20. The conjugate molecule according to claim 19, wherein the conjugate comprises siRNA bound to a carbohydrate selected from glucose and sucrose.

Images