AAV Capsid Variants and Their Use
By designing AAV capsid variants with specific amino acid sequences, such as [N1]-[N2]-[N3] including DWHR, the challenges of inefficient gene delivery to the CNS are addressed, achieving enhanced transduction efficiency and improved therapeutic potential.
Patent Information
- Application Number
- JP2024570430
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-12
- Filing Date
- 2023-06-01
- Publication Date
- 2025-06-19
AI Technical Summary
Current methods for delivering gene therapy to the adult central nervous system (CNS) are inefficient due to low transduction efficiency of natural AAV variants and neutralization by existing antibodies, limiting their clinical use.
Development of AAV capsid variants with enhanced tropism for CNS cells or tissues, specifically designed amino acid sequences such as [N1]-[N2]-[N3] that include positions like DWHR, to improve delivery efficiency and evade neutralizing antibodies.
The AAV capsid variants demonstrate improved tropism and transduction efficiency for CNS cells, enabling more effective gene delivery and potential treatment for neurological disorders.
Smart Images

Figure 2025518706000001 
Figure 2025518706000002 
Figure 2025518706000003
Abstract
Description
Technical Field
[0001] Related Applications This application claims priority to U.S. Provisional Application No. 63 / 348,154, filed Jun. 2, 2022, and U.S. Provisional Application No. 63 / 501,935, filed May 12, 2023, the entire contents of each of which are hereby incorporated by reference in their entirety.
[0002] Sequence Listing This application is electronically filed in XML format and includes a sequence listing that is hereby incorporated by reference in its entirety. The XML copy created on Mar. 21, 2023, is named V2071-1110PCT_SL.xml and is 1,725,870 bytes in size.
[0003] The present disclosure relates to compositions and methods for the preparation, use, and / or formulation of adeno-associated virus capsid proteins and variants thereof.
Background Art
[0004] Gene delivery to the adult central nervous system (CNS) remains a significant challenge in gene therapy. Engineered adeno-associated virus (AAV) capsids with improved brain tropism represent an attractive solution to the limitations of CNS delivery.
[0005] AAV-derived vectors are promising tools for clinical gene transfer due to their non-pathogenicity, their low immunogenic profile, their low integration rate into the host genome, and their long-term transgene expression in non-dividing cells. However, the transduction efficiency of AAV natural variants in specific organs is too low for clinical use, and capsid neutralization by existing neutralizing antibodies can potentially prevent treatment in the majority of patients. For these reasons, considerable efforts have been made to obtain capsid variants with improved properties. Of the many approaches tested so far, significant progress has resulted from the directed evolution of AAV capsids using in vitro or in vivo selection of capsid variants generated by capsid sequence randomization, using either error-prone PCR, shuffling of various parental serotypes, or insertion of fully randomized short peptides at defined positions.
[0006] Attempts to provide AAV capsids with improved properties, such as improved tropism to target cells or tissues upon systemic administration, have met with limited success. Accordingly, there is a need for improved methods of generating AAV capsids for delivery of a payload to a target cell or tissue, such as CNS cells or tissues, and for the resulting AAV capsids. SUMMARY OF THE INVENTION
[0007] The present disclosure relates, at least in part, to compositions and methods for the production and use of AAV capsid polypeptides, such as AAV capsid variants. In some embodiments, the AAV capsid variant has enhanced tropism for a tissue or cell, such as CNS tissue or CNS cells. The tropism can be useful for delivering a payload, such as the payload described herein, to a cell or tissue for the treatment of a disorder, such as a neurological or neurodegenerative disorder, a muscular or neuromuscular disorder, or a neuro-oncological disorder.
[0008] Accordingly, in one aspect, the present disclosure provides an AAV capsid variant comprising an amino acid sequence having the following formula: [N1]-[N2]-[N3] (SEQ ID NO: 4681), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), and (i) [N1] comprises positions X1, X2, X3, and X4, and position X4 is Q, K, E, S, P, R, N, H, or a conservative substitution thereof, and / or (ii) [N3] comprises positions X5, X6, and X7, and position X5 is I, V, T, M, S, N, L, F, or a conservative substitution thereof. In some embodiments, position X4 of [N1] is Q. In some embodiments, position X4 of [N1] is K. In some embodiments, position X5 of [N3] is I. In some embodiments, [N1] replaces positions 582-585 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, Q585). In some embodiments, [N1] corresponds to positions 582-585 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585). In some embodiments, [N1] is present at positions 582-585 numbered according to SEQ ID NO: 981. In some embodiments, X1 of [N1] numbered according to SEQ ID NO: 981 is present at position 582, X2 of [N1] is present at position 583, X3 of [N1] is present at position 584, and X4 of [N1] is present at position 585. In some embodiments, [N2] replaces positions 586-589 numbered according to SEQ ID NO: 138 (e.g., S586, A587, Q588, A589). In some embodiments, [N2] corresponds to positions 586-589 of SEQ ID NO: 981 (e.g., D586, W587, H588, and R589). In some embodiments, [N2] is present at positions 586-589 numbered according to SEQ ID NO: 981. In some embodiments, [N3] replaces positions 590-592 numbered according to SEQ ID NO: 138 (e.g., Q590, A591, Q592). In some embodiments, [N3] corresponds to positions 590-592 of SEQ ID NO: 981 (e.g., I590, A591, Q592).In some embodiments, [N3] numbered according to SEQ ID NO: 981 is present at positions 590 to 592. In some embodiments, X5 of [N3] numbered according to SEQ ID NO: 981 is present at position 590, X6 of [N3] is present at position 591, and X7 of [N3] is present at position 592. In some embodiments, [N1]-[N2] numbered according to SEQ ID NO: 981 is present at positions 582 to 589. In some embodiments, [N2]-[N3] numbered according to SEQ ID NO: 981 is present at positions 586 to 592. In some embodiments, [N1]-[N2]-[N3] numbered according to SEQ ID NO: 981 is present at positions 582 to 592.
[0009] In another aspect, the present disclosure provides an AAV capsid variant comprising an amino acid sequence having the following formula: [N1]-[N2]-[N3] (SEQ ID NO: 4683), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), and (i) [N1] comprises positions X1, X2, X3, and X4, and position X4 is Q, P, or a conservative substitution thereof, and / or (ii) [N3] comprises positions X5, X6, and X7, and position X5 is I, V, or a conservative substitution thereof. In some embodiments, position X4 of [N1] is Q. In some embodiments, position X5 of [N3] is I. In some embodiments, [N1] replaces positions 582-585 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, Q585). In some embodiments, [N1] corresponds to positions 582-585 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585). In some embodiments, [N1] is present at positions 582-585 numbered according to SEQ ID NO: 981. In some embodiments, X1 of [N1] numbered according to SEQ ID NO: 981 is present at position 582, X2 of [N1] is present at position 583, X3 of [N1] is present at position 584, and X4 of [N1] is present at position 585. In some embodiments, [N2] replaces positions 586-589 numbered according to SEQ ID NO: 138 (e.g., S586, A587, Q588, A589). In some embodiments, [N2] corresponds to positions 586-589 of SEQ ID NO: 981 (e.g., D586, W587, H588, and R589). In some embodiments, [N2] is present at positions 586-589 numbered according to SEQ ID NO: 981. In some embodiments, [N3] replaces positions 590-592 numbered according to SEQ ID NO: 138 (e.g., Q590, A591, Q592). In some embodiments, [N3] corresponds to positions 590-592 of SEQ ID NO: 981 (e.g., I590, A591, Q592). In some embodiments, [N3] is present at positions 590-592 numbered according to SEQ ID NO: 981.In some embodiments, X5 of [N3] numbered according to SEQ ID NO: 981 is present at position 590, X6 of [N3] is present at position 591, and X7 of [N3] is present at position 592. In some embodiments, [N1]-[N2] numbered according to SEQ ID NO: 981 are present at positions 582-589. In some embodiments, [N2]-[N3] numbered according to SEQ ID NO: 981 are present at positions 586-592. In some embodiments, [N1]-[N2]-[N3] numbered according to SEQ ID NO: 981 are present at positions 582-592.
[0010] In another aspect, the disclosure provides an AAV capsid variant comprising (a) an amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 contiguous amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16; (c) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16; or (d) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the amino acid sequence is present in Loop VIII. In some embodiments, the amino acid sequence replaces positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and / or V596) numbered according to SEQ ID NO: 138.
[0011] In yet another aspect, the present disclosure provides an AAV capsid variant comprising (a) an amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336; (c) an amino acid sequence comprising at least 1, 2, or 3 but 4 or fewer different amino acids relative to an amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336; or (d) an amino acid sequence comprising at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), relative to an amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. In some embodiments, the amino acid sequence is present in Loop VIII. In some embodiments, the amino acid sequence replaces positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and / or V596) numbered according to SEQ ID NO: 138.In some embodiments, the amino acid sequence replaces positions 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to SEQ ID NO: 138 (e.g., A581, T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and / or V596).
[0012] In yet another aspect, the disclosure provides a polynucleotide encoding an AAV capsid variant described herein. In some embodiments, the polynucleotide comprises (i) a nucleotide sequence that has at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions (e.g., conservative substitutions), but no more than 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the nucleotide sequence of SEQ ID NO: 942, (ii) a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7, but no more than 10, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942, or (iii) the nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).
[0013] In yet another aspect, the present disclosure provides an AAV capsid variant comprising an amino acid sequence comprising at least 3, 4, 5, 6, or 7 contiguous amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941), wherein (i) the 3 contiguous amino acids comprise TQD, (ii) the 4 contiguous amino acids comprise TQDW (SEQ ID NO: 4684), (iii) the 5 contiguous amino acids comprise TQDWH (SEQ ID NO: 4685), or (iv) the 6 contiguous amino acids comprise TQDWHR (SEQ ID NO: 4686), and the AAV capsid variant comprises (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 981, (b) a VP2 protein comprising the amino acid sequence from positions 138 to 736 of SEQ ID NO: 138 or positions 138 to 736 of SEQ ID NO: 981, (c) a VP3 protein comprising the amino acid sequence from positions 203 to 736 of SEQ ID NO: 138 or positions 203 to 736 of SEQ ID NO: 981, or (d) an amino acid sequence having at least 70% (e.g., at least about 75, 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity to any of the amino acid sequences in (a) - (c).
[0014] In yet another aspect, the present disclosure provides an AAV capsid variant comprising 1 or 2, but no more than 3 substitutions relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the AAV capsid variant comprises (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 981, (b) a VP2 protein comprising the amino acid sequence from positions 138 to 736 of SEQ ID NO: 138 or positions 138 to 736 of SEQ ID NO: 981, (c) a VP3 protein comprising the amino acid sequence from positions 203 to 736 of SEQ ID NO: 138 or positions 203 to 736 of SEQ ID NO: 981, or (d) an amino acid sequence having at least 70% (e.g., at least about 75, 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity to any of the amino acid sequences in (a) - (c).
[0015] In yet another aspect, the present disclosure provides an AAV capsid variant comprising one, two, three, four, five, or all of the amino acids other than H at position 584 (e.g., T), other than S at position 586 (e.g., D), other than A at position 587 (e.g., W), other than Q at position 588 (e.g., H), other than A at position 589 (e.g., R), and / or other than Q at position 590 (e.g., I), numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises the amino acids other than H at position 584 (e.g., T), other than S at position 586 (e.g., D), other than A at position 587 (e.g., W), other than Q at position 588 (e.g., H), other than A at position 589 (e.g., R), and / or other than Q at position 590 (e.g., I), numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises one, two, three, four, five, or all of the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and / or I at position 590, numbered according to SEQ ID NO: 138 or 981. In some embodiments, the AAV capsid variant comprises the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 138 or 981.
[0016] In yet another aspect, the present disclosure provides a variant that comprises one, two, three, four, five, or all of the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and / or I at position 590, numbered according to SEQ ID NO: 138 or 981. In some embodiments, the AAV capsid variant comprises the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 138 or 981.
[0017] In yet another aspect, the present disclosure provides an AAV capsid variant comprising one, two, three, four, five, or all of the substitutions H584T, S586D, A587W, Q588H, A589R, and / or Q590I numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises the substitutions H584T, S586D, A587W, Q588H, A589R, and Q590I numbered according to SEQ ID NO: 138.
[0018] In yet another aspect, the present disclosure provides an AAV capsid variant comprising amino acid T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590 numbered according to SEQ ID NO: 138 or 981.
[0019] In another aspect, the present disclosure provides an AAV capsid variant comprising the substitutions H584T, S586D, A587W, Q588H, A589R, and Q590I numbered according to SEQ ID NO: 138.
[0020] In yet another aspect, the present disclosure provides an AAV capsid variant comprising the amino acid sequence at positions 203-736 of SEQ ID NO: 981, or at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) of the amino acid sequence thereof, wherein the AAV capsid variant comprises amino acid T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590 numbered according to SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises the amino acid sequence at positions 203-736 of SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises the amino acid sequence at positions 138-736 of SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 981.
[0021] In yet another aspect, the present disclosure provides an AAV capsid variant comprising the amino acid sequence of positions 138 to 736 of SEQ ID NO: 981, or at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) of the amino acid sequence thereof, wherein the AAV capsid variant comprises amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises the amino acid sequence of positions 138 to 736 of SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 981.
[0022] In yet another aspect, the present disclosure provides an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 981, or at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) of the amino acid sequence thereof, wherein the AAV capsid variant comprises amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises an amino acid sequence comprising 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 981. In some embodiments, the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 981.
[0023] In yet another aspect, the present disclosure provides an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 981.
[0024] In yet another aspect, the present disclosure provides an AAV capsid variant comprising the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence that is at least 95% identical thereto.
[0025] In yet another aspect, the present disclosure provides a peptide comprising: (a) an amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16; (c) an amino acid sequence that includes at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16; or (d) an amino acid sequence that includes at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16.
[0026] In another aspect, the present disclosure provides a peptide comprising: (a) an amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336; (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336; (c) an amino acid sequence comprising at least 1, 2, or 3 but 4 or fewer different amino acids relative to an amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336; or (d) an amino acid sequence comprising at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., replacements), relative to an amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336.
[0027] In yet another aspect, the present disclosure provides a peptide comprising (i) the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (ii) an amino acid sequence that contains at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (iii) an amino acid sequence that contains at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), or (iv) at least 3, 4, or 5 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941).
[0028] In yet another aspect, the present disclosure provides a peptide encoded by a nucleotide sequence that is (i) the nucleotide sequence of SEQ ID NO: 942 or is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or (ii) a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942, or (iii) a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, but 10 or fewer modifications, such as substitutions, relative to the nucleotide sequence of SEQ ID NO: 942.
[0029] In yet another aspect, the present disclosure provides a nucleotide sequence encoding a peptide, which is (i) the nucleotide sequence of SEQ ID NO: 942 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), (ii) a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7, but no more than 10, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942, or (iii) a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but no more than 10 modifications, e.g., substitutions, relative to the nucleotide sequence of SEQ ID NO: 942.
[0030] In yet another aspect, the present disclosure provides a polynucleotide encoding an AAV capsid variant, the polynucleotide comprising an amino acid sequence of any of the sequences provided in Table 1, 2A, 2B, 9, 14, 15, or 16; an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Table 1, 2A, 2B, 9, 14, 15, or 16; an amino acid sequence comprising at least 1, 2, or 3, but no more than 4, different amino acids relative to the amino acid sequence of any one of the sequences provided in Table 1, 2A, 2B, 9, 14, 15, or 16; or an amino acid sequence comprising at least 1, 2, or 3, but no more than 4, modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of the sequences provided in Table 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the amino acid sequences of (a), (b), (c), and / or (d) replace positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to the amino acid sequence of SEQ ID NO: 138 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and / or V596). In some embodiments, the amino acid sequences of (a), (b), (c), and / or (d) correspond to positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585, D586, W587, H588, R589, I590, A591, Q592, T593, G594, W595, and / or V596).
[0031] In yet another aspect, the disclosure provides a polynucleotide encoding an AAV capsid variant, wherein the AAV capsid variant comprises (i) the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (ii) an amino acid sequence that contains at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (iii) an amino acid sequence that contains at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), or (iv) at least 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941). In some embodiments, the amino acid sequence of (i), (ii), (iii), and / or (iv) replaces positions 584, 585, 586, 587, 588, 589, and / or 590 numbered according to the amino acid sequence of SEQ ID NO: 138 (e.g., H584, Q585, S586, A587, Q588, A589, and / or Q590). In some embodiments, the amino acid sequence of (i), (ii), (iii), and / or (iv) corresponds to positions 584, 585, 586, 587, 588, 589, and / or 590 of SEQ ID NO: 981 (e.g., T584, Q585, D586, W587, H588, R589, and / or I590).
[0032] In yet another aspect, the disclosure provides an AAV particle comprising an AAV capsid variant described herein. In some embodiments, the AAV particle comprises a nucleic acid sequence encoding a payload. In some embodiments, the AAV particle further comprises a viral genome comprising a promoter operably linked to a nucleic acid encoding a payload.
[0033] In yet another aspect, the present disclosure provides a method of producing AAV particles comprising an AAV capsid variant described herein. The method includes providing a host cell comprising a viral genome and incubating the host cell under conditions suitable for encapsulating the viral genome into an AAV capsid variant, such as an AAV capsid variant described herein, thereby producing AAV particles.
[0034] In yet another aspect, the present disclosure provides a method of delivering a payload to a cell or tissue (e.g., a CNS cell or CNS tissue). The method includes administering an effective amount of AAV particles comprising an AAV capsid variant described herein.
[0035] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a genetic disorder, such as a single-gene disorder or a polygenic disorder. The method includes administering to the subject an effective amount of AAV particles comprising an AAV capsid variant described herein.
[0036] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a neurological disorder, such as a neurodegenerative disorder. The method includes administering an effective amount of AAV particles comprising an AAV capsid variant described herein.
[0037] In yet another aspect, the present disclosure provides a method of treating a subject having or diagnosed with a neuro-oncological disorder. The method includes administering an effective amount of AAV particles comprising an AAV capsid variant described herein.
[0038] One of ordinary skill in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the embodiments recited below.
[0039] Enumeration of Embodiments 1. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising an amino acid sequence having the following formula: [N1]-[N2]-[N3] (SEQ ID NO: 4681), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), (i) [N1] comprises positions X1, X2, X3, and X4, wherein the amino acid at position X4 is Q, K, E, S, P, R, N, H, or a conservative substitution thereof, and / or (ii) [N3] comprises positions X5, X6, and X7, wherein the amino acid at position X5 is I, V, T, M, S, N, L, F, or a conservative substitution thereof, said AAV capsid variant. 2. The AAV capsid variant according to embodiment 1, numbered according to SEQ ID NO: 138 or 981 and comprising the amino acid Q at position 585. 3. The AAV capsid variant according to embodiment 1, numbered according to SEQ ID NO: 138 or 981 and comprising an amino acid other than Q at position 585. 4. The AAV capsid variant according to embodiment 1 or 3, numbered according to SEQ ID NO: 138 or 981 and comprising the amino acid K at position 585. 5. An amino acid other than T at position 582 (e.g., S, R, A, I, C, N, K, L, or Q), an amino acid other than N at position 583 (e.g., T, G, V, S, Y, K, I, H, D, or F), an amino acid other than H at position 584 (e.g., T, N, K, D, I, S, P, A, Y, E, V, L, M, R, Q, or C), and / or an amino acid other than Q at position 585 (e.g., K, E, S, P, R, N, H), including 1, 2, 3, or all of them, of the AAV capsid variant according to any one of embodiments 1 to 4, numbered according to SEQ ID NO: 138. 6. The AAV capsid variant according to any one of embodiments 1 to 5, wherein [N1] comprises positions X1, X2, X3, and X4, and the amino acid at position X4 is Q, K, E, S, P, R, N, or H. 7. The AAV capsid variant according to any one of embodiments 1 to 6, wherein the amino acid at position X4 is Q or K. 8. The AAV capsid variant according to any one of Embodiments 1, 2, or 5 to 7, wherein the X4 position is Q. 9. The AAV capsid variant according to any one of Embodiments 1 or 3 to 7, wherein the X4 position is K. 10. The AAV capsid variant according to any one of Embodiments 1 to 9, which is numbered according to SEQ ID NO: 138 and contains an amino acid other than H (for example, T) at position 584. 11. The AAV capsid variant according to any one of Embodiments 1 to 10, which is numbered according to SEQ ID NO: 138 or 981 and contains the amino acid T at position 584. 12. (i) The X1 position is T, S, R, A, I, C, N, K, L, or Q, (ii) The X2 position is N, T, G, V, S, Y, K, I, H, D, or F, and / or (iii) The X3 position is T, N, K, D, I, S, P, A, Y, E, V, L, M, R, H, Q, or C, the AAV capsid variant according to any one of Embodiments 1 to 11. 13. The AAV capsid variant according to any one of Embodiments 1 to 12, wherein [N1] contains TN, NT, NK, SN, TT, RN, TG, TV, ST, TS, TY, AN, TK, TI, IN, TH, TD, CN, NN, KN, LN, SG, TF, RT, SY, SS, QN, ND, NP, GK, TA, VK, NY, TE, SK, NI, YN, GT, TL, TM, YT, TR, NS, IT, NA, KT, GN, HT, DT, NE, NH, YI, HN, NQ, FS, NM, NL, SM, NC, VT, KQ, TQ, DQ, IQ, SQ, PS, KE, AQ, YQ, TP, EQ, VQ, LQ, MQ, KS, IE, RQ, IK, AK, PK, NR, HQ, QQ, or CQ. 14. An AAV capsid variant according to any one of Embodiments 1 to 13, wherein [N1] comprises TNT, TNK, TNN, SNN, SNK, SNT, TTN, TND, TTI, RNT, TTK, TTS, TTD, TNP, TTT, TGK, TTA, TVK, TNY, STK, TTE, TSK, TNI, TYN, STI, TTV, TGT, TTL, TTM, ANN, SNI, TKN, TYT, TTR, TNS, TST, TIT, INT, TNA, TKT, STN, ANT, RNN, TGN, TSN, THT, TDT, TNE, CNT, INN, NNN, KNN, LNN, TIN, TNH, STT, SNS, STS, TYI, SGT, THN, TNQ, RNI, TFS, RNS, TNM, RTT, KNT, TNL, TSM, SYT, TNC, SST, TVT, QNT, NTK, NNQ, NKQ, NNE, NTQ, NDQ, TIQ, TKQ, TSQ, TDQ, NPS, NKE, TTQ, GKQ, TAQ, VKQ, NYQ, NTP, TEQ, SKQ, NIQ, YNQ, TVQ, GTQ, NTR, TLQ, TMQ, KNQ, YTQ, NKS, NTE, NIE, TRQ, NSQ, YTK, NIK, NNK, NSK, ITK, NAK, KTK, GNQ, SNQ, HTK, D TK, NEQ, NPK, YTE, NNR, INQ, NHQ, YIQ, HNQ, ITQ, STQ, NSN, NQQ, NNP, ITE, NTN, FSQ, NNH, NMQ, NTS, NLQ, SMQ, NCQ, or VTQ. 15. [N1] is TNTQ (SEQ ID NO: 4688), TNTK (SEQ ID NO: 4689), TNNQ (SEQ ID NO: 4690), SNNQ (SEQ ID NO: 4691), TNKQ (SEQ ID NO: 4692), TNNE (SEQ ID NO: 4693), SNKQ (SEQ ID NO: 4694), SNTQ (SEQ ID NO: 4695), TTNQ (SEQ ID NO: 4696), TNDQ (SEQ ID NO: 4697), TTIQ (SEQ ID NO: 4698), RNTQ (SEQ ID NO: 4699), TTKQ (SEQ ID NO: 4700), TTSQ (SEQ ID NO: 4701), TTDQ (SEQ ID NO: 4702), TNPS (SEQ ID NO: 4703), TNKE (SEQ ID NO: 4704), TTTQ (SEQ ID NO: 4705), TGKQ (SEQ ID NO: 4706), TTAQ (SEQ ID NO: 4707), TVKQ (SEQ ID NO: 4708), TNYQ (SEQ ID NO: 4709), TNTP (SEQ ID NO: 4710), STKQ (SEQ ID NO: 4711), TTEQ (SEQ ID NO: 4712), TSKQ (SEQ ID NO: 4713), TNIQ (SEQ ID NO: 4714), TYNQ (SEQ ID NO: 4715), STIQ (SEQ ID NO: 4716), TTVQ (SEQ ID NO: 4717), TGTQ (SEQ ID NO: 4718), TNTR (SEQ ID NO: 4719), TTLQ (SEQ ID NO: 4720), TTMQ (SEQ ID NO: 4721), ANNQ (SEQ ID NO: 4722), SNIQ (SEQ ID NO: 4723), TKNQ (SEQ ID NO: 4724), TYTQ (SEQ ID NO: 4725), TNKS (SEQ ID NO: 4726), SNTE (SEQ ID NO: 4727), TNTE (SEQ ID NO: 4728), TNIE (SEQ ID NO: 4729), TTRQ (SEQ ID NO: 4730), TNSQ (SEQ ID NO: 4731), TYTK (SEQ ID NO: 4732), TTTK (SEQ ID NO: 4733), TNIK (SEQ ID NO: 4734), SNTK (SEQ ID NO: 4735), TNNK (SEQ ID NO: 4736), TNSK (SEQ ID NO: 4737), TSTK (SEQ ID NO: 4738), TITK (SEQ ID NO: 4739), INTK (SEQ ID NO: 4740), TNAK (SEQ ID NO: 4741), TKTK (SEQ ID NO: 4742), STNQ (SEQ ID NO: 4743), ANTK (SEQ ID NO: 4744), RNNQ (SEQ ID NO: 4745), TGNQ (SEQ ID NO: 4746), TSNQ (SEQ ID NO: 4747), THTK (SEQ ID NO: 4748), TDTK (SEQ ID NO: 4749), TNEQ (SEQ ID NO: 4750), CNTQ (SEQ ID NO: 4751), TNPK (SEQ ID NO: 4752), INNQ (SEQ ID NO: 4753),TYTE (SEQ ID NO: 4754), NNNQ (SEQ ID NO: 4755), KNNQ (SEQ ID NO: 4756), TNNR (SEQ ID NO: 4757), LNNQ (SEQ ID NO: 4758), TINQ (SEQ ID NO: 4759), TNHQ (SEQ ID NO: 4760), STTQ (SEQ ID NO: 4761), SNSQ (SEQ ID NO: 4762), STSQ (SEQ ID NO: 4763), TYIQ (SEQ ID NO: 4764), SGTQ (SEQ ID NO: 4765), THNQ (SEQ ID NO: 4766), TITQ (SEQ ID NO: 4767), TSTQ (SEQ ID NO: 4768), TNSN (SEQ ID NO: 4769), TNQQ (SEQ ID NO: 4770), RNIQ (SEQ ID NO: 4771), TNNP (SEQ ID NO: 4772), TITE (SEQ ID NO: 4773), TNTN (SEQ ID NO: 4774), TFSQ (SEQ ID NO: 4775), RNSQ (SEQ ID NO: 4776), INTQ (SEQ ID NO: 4777), RNTE (SEQ ID NO: 4778), TNNH (SEQ ID NO: 4779), TNMQ (SEQ ID NO: 4780), RTTQ (SEQ ID NO: 4781), SNIE (SEQ ID NO: 4782), TNTS (SEQ ID NO: 4783), KNTQ (SEQ ID NO: 4784), TNLQ (SEQ ID NO: 4785), TSMQ (SEQ ID NO: 4786), SYTQ (SEQ ID NO: 4787), TNCQ (SEQ ID NO: 4788), SSTQ (SEQ ID NO: 4789), TVTQ (SEQ ID NO: 4790), or QNTQ (SEQ ID NO: 4791), or an AAV capsid variant according to any one of Embodiments 1 to 14 including these. 16. An AAV capsid variant according to any one of Embodiments 1 to 15, wherein [N1] is TNTQ (SEQ ID NO: 4688) or includes the same. 17. An AAV capsid variant according to any one of Embodiments 1 to 15, wherein [N1] is TNTK (SEQ ID NO: 4689) or includes the same. 18. [N1]-[N2] is (i) TQDWHR (SEQ ID NO: 4686), TKDWHR (SEQ ID NO: 4792), NQDWHR (SEQ ID NO: 4793), KQDWHR (SEQ ID NO: 4794), NEDWHR (SEQ ID NO: 4795), DQDWHR (SEQ ID NO: 4796), IQDWHR (SEQ ID NO: 4797), SQDWHR (SEQ ID NO: 4798), PSDWHR (SEQ ID NO: 4799), KEDWHR (SEQ ID NO: 4800), AQDWHR (SEQ ID NO: 4801), YQDWHR (SEQ ID NO: 4802), TPDWHR (SEQ ID NO: 4803), EQDWHR (SEQ ID NO: 4804), VQDWHR (SEQ ID NO: 4805), TRDWHR (SEQ ID NO: 4806), LQDWHR (SEQ ID NO: 4807), MQDWHR (SEQ ID NO: 4808), KSDWHR (SEQ ID NO: 4809), TEDWHR (SEQ ID NO: 4810), IEDWHR (SEQ ID NO: 4811), RQDWHR (SEQ ID NO: 4812), IKDWHR (SEQ ID NO: 4813), NKDWHR (SEQ ID NO: 4814), SKDWHR (SEQ ID NO: 4815), AKDWHR (SEQ ID NO: 4816), PKDWHR (SEQ ID NO: 4817), NRDWHR (SEQ ID NO: 4818), HQDWHR (SEQ ID NO: 4819), SNDWHR (SEQ ID NO: 4820), QQDWHR (SEQ ID NO: 4821), NPDWHR (SEQ ID NO: 4822), TNDWHR (SEQ ID NO: 4823), NHDWHR (SEQ ID NO: 4824), TSDWHR (SEQ ID NO: 4825), or CQDWHR (SEQ ID NO: 4826), (ii) An amino acid sequence containing any part of the amino acid sequences in (i), for example, any 2, 3, 4, or 5 of them, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3 but 4 or less modifications, for example, substitutions (for example, conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An AAV capsid variant according to any one of Embodiments 1 to 17, which contains an amino acid sequence containing 1, 2, or 3 but 4 or less different amino acids with respect to any one of the amino acid sequences in (i). 19. [N1]-[N2] is (i) NTQDWHR (SEQ ID NO: 4827), NTKDWHR (SEQ ID NO: 4828), NNQDWHR (SEQ ID NO: 4829), NKQDWHR (SEQ ID NO: 4830), NNEDWHR (SEQ ID NO: 4831), TNQDWHR (SEQ ID NO: 4832), NDQDWHR (SEQ ID NO: 4833), TIQDWHR (SEQ ID NO: 4834), TKQDWHR (SEQ ID NO: 4835), TSQDWHR (SEQ ID NO: 4836), TDQDWHR (SEQ ID NO: 4837), NPSDWHR (SEQ ID NO: 4838), NKEDWHR (SEQ ID NO: 4839), TTQDWHR (SEQ ID NO: 4840), GKQDWHR (SEQ ID NO: 4841), TAQDWHR (SEQ ID NO: 4842), VKQDWHR (SEQ ID NO: 4843), NYQDWHR (SEQ ID NO: 4844), NTPDWHR (SEQ ID NO: 4845), TEQDWHR (SEQ ID NO: 4846), SKQDWHR (SEQ ID NO: 4847), NIQDWHR (SEQ ID NO: 4848), YNQDWHR (SEQ ID NO: 4849), TVQDWHR (SEQ ID NO: 4850), GTQDWHR (SEQ ID NO: 4851), NTRDWHR (SEQ ID NO: 4852), TLQDWHR (SEQ ID NO: 4853), TMQDWHR (SEQ ID NO: 4854), KNQDWHR (SEQ ID NO: 4855), YTQDWHR (SEQ ID NO: 4856), NKSDWHR (SEQ ID NO: 4857), NTEDWHR (SEQ ID NO: 4858), NIEDWHR (SEQ ID NO: 4859), TRQDWHR (SEQ ID NO: 4860), NSQDWHR (SEQ ID NO: 4861), YTKDWHR (SEQ ID NO: 4862), TTKDWHR (SEQ ID NO: 4863), NIKDWHR (SEQ ID NO: 4864), NNKDWHR (SEQ ID NO: 4865), NSKDWHR (SEQ ID NO: 4866), STKDWHR (SEQ ID NO: 4867), ITKDWHR (SEQ ID NO: 4868), NAKDWHR (SEQ ID NO: 4869), KTKDWHR (SEQ ID NO: 4870), GNQDWHR (SEQ ID NO: 4871), SNQDWHR (SEQ ID NO: 4872), HTKDWHR (SEQ ID NO: 4873), DTKDWHR (SEQ ID NO: 4874), NEQDWHR (SEQ ID NO: 4875), NPKDWHR (SEQ ID NO: 4876), YTEDWHR (SEQ ID NO: 4877), NNRDWHR (SEQ ID NO: 4878), INQDWHR (SEQ ID NO: 4879), NHQDWHR (SEQ ID NO: 4880), YIQDWHR (SEQ ID NO: 4881),HNQDWHR (SEQ ID NO: 4882), ITQDWHR (SEQ ID NO: 4883), STQDWHR (SEQ ID NO: 4884), NSNDWHR (SEQ ID NO: 4885), NQQDWHR (SEQ ID NO: 4886), NNPDWHR (SEQ ID NO: 4887), ITEDWHR (SEQ ID NO: 4888), NTNDWHR (SEQ ID NO: 4889), FSQDWHR (SEQ ID NO: 4890), NNHDWHR (SEQ ID NO: 4891), NMQDWHR (SEQ ID NO: 4892), NTSDWHR (SEQ ID NO: 4893), NLQDWHR (SEQ ID NO: 4894), SMQDWHR (SEQ ID NO: 4895), NCQDWHR (SEQ ID NO: 4896), VTQDWHR (SEQ ID NO: 4897) (ii) An amino acid sequence containing any part of the amino acid sequence in (i), for example, any 2, 3, 4, 5, or 6 amino acids thereof, for example, consecutive amino acids (iii) An amino acid sequence containing 1, 2, or 3, but 4 or less modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An AAV capsid variant according to any one of Embodiments 1 to 18, comprising an amino acid sequence containing 1, 2, or 3, but 4 or less different amino acids with respect to any one of the amino acid sequences in (i). 20. [N1]-[N2] is (i) TNTQDWHR (SEQ ID NO: 4898), TNTKDWHR (SEQ ID NO: 4899), TNNQDWHR (SEQ ID NO: 4900), SNNQDWHR (SEQ ID NO: 4901), TNKQDWHR (SEQ ID NO: 4902), TNNEDWHR (SEQ ID NO: 4903), SNKQDWHR (SEQ ID NO: 4904), SNTQDWHR (SEQ ID NO: 4905), TTNQDWHR (SEQ ID NO: 4906), TNDQDWHR (SEQ ID NO: 4907), TTIQDWHR (SEQ ID NO: 4908), RNTQDWHR (SEQ ID NO: 4909), TTKQDWHR (SEQ ID NO: 4910), TTSQDWHR (SEQ ID NO: 4911), TTDQDWHR (SEQ ID NO: 4912), TNPSDWHR (SEQ ID NO: 4913), TNKEDWHR (SEQ ID NO: 4914), TTTQDWHR (SEQ ID NO: 4915), TGKQDWHR (SEQ ID NO: 4916), TTAQDWHR (SEQ ID NO: 4917), TVKQDWHR (SEQ ID NO: 4918), TNYQDWHR (SEQ ID NO: 4919), TNTPDWHR (SEQ ID NO: 4920), STKQDWHR (SEQ ID NO: 4921), TTEQDWHR (SEQ ID NO: 4922), TSKQDWHR (SEQ ID NO: 4923), TNIQDWHR (SEQ ID NO: 4924), TYNQDWHR (SEQ ID NO: 4925), STIQDWHR (SEQ ID NO: 4926), TTVQDWHR (SEQ ID NO: 4927), TGTQDWHR (SEQ ID NO: 4928), TNTRDWHR (SEQ ID NO: 4929), TTLQDWHR (SEQ ID NO: 4930), TTMQDWHR (SEQ ID NO: 4931), ANNQDWHR (SEQ ID NO: 4932), SNIQDWHR (SEQ ID NO: 4933), TKNQDWHR (SEQ ID NO: 4934), TYTQDWHR (SEQ ID NO: 4935), TNKSDWHR (SEQ ID NO: 4936), SNTEDWHR (SEQ ID NO: 4937), TNTEDWHR (SEQ ID NO: 4938), TNIEDWHR (SEQ ID NO: 4939), TTRQDWHR (SEQ ID NO: 4940), TNSQDWHR (SEQ ID NO: 4941), TYTKDWHR (SEQ ID NO: 4942), TTTKDWHR (SEQ ID NO: 4943), TNIKDWHR (SEQ ID NO: 4944), SNTKDWHR (SEQ ID NO: 4945), TNNKDWHR (SEQ ID NO: 4946), TNSKDWHR (SEQ ID NO: 4947), TSTKDWHR (SEQ ID NO: 4948), TITKDWHR (SEQ ID NO: 4949),INTKDWHR (Array Number 4950), TNAKDWHR (Array Number 4951), TKTKDWHR (Array Number 4952), STNQDWHR (Array Number 4953), ANTKDWHR (Array Number 4954), RNNQDWHR (Array Number 4955), TGNQDWHR (Array Number 4956), TSNQDWHR (Array Number 4957), THTKDWHR (Array Number 4958), TDTKDWHR (Array Number 4959), TNEQDWHR (Array Number 4960), CNTQDWHR (Array Number 4961), TNPKDWHR (Array Number 4962), INNQDWHR (Array Number 4963), TYTEDWHR (Array Number 4964), NNNQDWHR (Array Number 4965), KNNQDWHR (Array Number 4966), TNNRDWHR (Array Number 4967), LNNQDWHR (Array Number 4968), TINQDWHR (Array Number 4969), TNHQDWHR (Array Number 4970), STTQDWHR (Array Number 4971), SNSQDWHR (Array Number 4972), STSQDWHR (Array Number 4973), TYIQDWHR (Array Number 4974), SGTQDWHR (Array Number 4975), THNQDWHR (Array Number 4976), TITQDWHR (Array Number 4977), TSTQDWHR (Array Number 4978), TNSNDWHR (Array Number 4979), TNQQDWHR (Array Number 4980), RNIQDWHR (Array Number 4981), TNNPDWHR (Array Number 4982), TITEDWHR (Array Number 4983), TNTNDWHR (Array Number 4984), TFSQDWHR (Array Number 4985), RNSQDWHR (Array Number 4986), INTQDWHR (Array Number 4987), RNTEDWHR (Array Number 4988), TNNHDWHR (Array Number 4989), TNMQDWHR (Array Number 4990), RTTQDWHR (Array Number 4991), SNIEDWHR (Array Number 4992), TNTSDWHR (Array Number 4993), KNTQDWHR (Array Number 4994), TNLQDWHR (Array Number 4995), TSMQDWHR (Array Number 4996), SYTQDWHR (Array Number 4997), TNCQDWHR (Array Number 4998), SSTQDWHR (Array Number 4999), TVTQDWHR (Array Number 5000), or QNTQDWHR (Array Number 5001), (ii) An amino acid sequence containing any part of the amino acid sequence in (i), for example, any 2, 3, 4, 5, 6, or 7 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3, but no more than 4, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An amino acid sequence containing 1, 2, or 3, but no more than 4, different amino acids with respect to any one of the amino acid sequences in (i). The AAV capsid variant according to any one of Embodiments 1 to 19. 21. The AAV capsid variant according to any one of Embodiments 1 to 20, wherein [N1]-[N2] is TNTQDWHR (SEQ ID NO: 4898) or contains the same. 22. The AAV capsid variant according to any one of Embodiments 1 to 20, wherein [N1]-[N2] is TNTKDWHR (SEQ ID NO: 4899) or contains the same. 23. The AAV capsid variant according to any one of Embodiments 1 to 22, containing 1, 2, or all of an amino acid other than Q (e.g., I, V, T, M, S, N, L, or F) at position 590, an amino acid other than A (e.g., Y, P, N, S, T, G, E, V, W, F, Q) at position 591, and / or an amino acid other than Q (e.g., G, N, K, H, R, E, L, P, or M) at position 592, numbered according to SEQ ID NO: 138. 24. The AAV capsid variant according to any one of Embodiments 1 to 23, containing an amino acid other than Q (e.g., I, V, T, M, S, N, L, or F) at position 590, numbered according to SEQ ID NO: 138. 25. The AAV capsid variant according to any one of Embodiments 1 to 24, containing amino acid I at position 590, numbered according to SEQ ID NO: 138. 26. The AAV capsid variant according to any one of Embodiments 1 to 24, containing amino acid V at position 590, numbered according to SEQ ID NO: 138. 27. An AAV capsid variant according to any one of Embodiments 1 to 26, numbered according to SEQ ID NO: 138 or 981, and containing amino acid A at position 591 and / or amino acid Q at position 592. 28. An AAV capsid variant according to any one of Embodiments 1 to 27, wherein [N3] includes positions X5, X6, and X7, and the amino acid at position X5 is I, V, T, M, S, N, L, or F. 29. An AAV capsid variant according to any one of Embodiments 1 to 28, wherein the amino acid at position X5 is I or V. 30. An AAV capsid variant according to any one of Embodiments 1 to 25 or 27 to 29, wherein the amino acid at position X5 is I. 31. (i) The amino acid at position X6 is A, Y, P, N, S, T, G, E, V, W, F, or Q, and / or (ii) The amino acid at position X7 is Q, G, N, K, H, R, E, L, P, or M. An AAV capsid variant according to any one of Embodiments 1 to 30. 32. An AAV capsid variant according to any one of Embodiments 1 to 31, wherein [N3] includes IA, IY, VP, IN, VN, VY, VA, IS, IT, TA, MA, SA, IG, IE, IV, NA, LA, IP, FA, VS, VT, IW, IF, IQ, VQ, AQ, AG, YQ, PQ, AN, NQ, SG, SQ, TQ, GQ, EQ, AK, AH, AR, AE, AL, AP, TM, SM, WQ, FQ, QQ, FM, AM, or SN. 33. An AAV capsid variant according to any one of Embodiments 1 to 32, wherein [N3] is IAQ, IAG, IYQ, VPQ, IAN, INQ, VNQ, VYQ, VAN, ISG, ISQ, VAQ, ITQ, TAQ, MAQ, SAQ, IGQ, IEQ, IVQ, NAQ, LAQ, IAK, IAH, IPQ, IAR, IAE, IAL, IAP, FAQ, VSQ, VTM, ISM, IWQ, IFQ, IQQ, VQQ, IFM, IAM, or ISN, or includes them. 34. An AAV capsid variant according to any one of Embodiments 1 to 33, wherein [N3] is IAQ or includes it. 35. [N2]-[N3] is (i) DWHRIA (SEQ ID NO: 5002), DWHRIY (SEQ ID NO: 5003), DWHRVP (SEQ ID NO: 5004), DWHRIN (SEQ ID NO: 5005), DWHRVN (SEQ ID NO: 5006), DWHRVY (SEQ ID NO: 5007), DWHRVA (SEQ ID NO: 5008), DWHRIS (SEQ ID NO: 5009), DWHRIT (SEQ ID NO: 5010), DWHRTA (SEQ ID NO: 5011), DWHRMA (SEQ ID NO: 5012), DWHRSA (SEQ ID NO: 5013), DWHRIG (SEQ ID NO: 5014), DWHRIE (SEQ ID NO: 5015), DWHRIV (SEQ ID NO: 5016), DWHRNA (SEQ ID NO: 5017), DWHRLA (SEQ ID NO: 5018), DWHRIP (SEQ ID NO: 5019), DWHRFA (SEQ ID NO: 5020), DWHRVS (SEQ ID NO: 5021), DWHRVT (SEQ ID NO: 5022), DWHRIW (SEQ ID NO: 5023), DWHRIF (SEQ ID NO: 5024), DWHRIQ (SEQ ID NO: 5025), or DWHRVQ (SEQ ID NO: 5026); (ii) an amino acid sequence containing any part of the amino acid sequences in (i), for example, any 2, 3, 4, or 5 amino acids thereof, for example, consecutive amino acids, (iii) an amino acid sequence containing 1, 2, or 3 but 4 or less modifications, for example, substitutions (for example, conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) an amino acid sequence containing 1, 2, or 3 but 4 or less different amino acids with respect to any one of the amino acid sequences in (i), the AAV capsid variant according to any one of Embodiments 1 to 34. 36. [N2]-[N3] is (i) DWHRIAQ (SEQ ID NO: 5027), DWHRIAG (SEQ ID NO: 5028), DWHRIYQ (SEQ ID NO: 5029), DWHRVPQ (SEQ ID NO: 5030), DWHRIAN (SEQ ID NO: 5031), DWHRINQ (SEQ ID NO: 5032), DWHRVNQ (SEQ ID NO: 5033), DWHRVYQ (SEQ ID NO: 5034), DWHRVAN (SEQ ID NO: 5035), DWHRISG (SEQ ID NO: 5036), DWHRISQ (SEQ ID NO: 5037), DWHRVAQ (SEQ ID NO: 5038), DWHRITQ (SEQ ID NO: 5039), DWHRTAQ (SEQ ID NO: 5040), DWHRMAQ (SEQ ID NO: 5041), DWHRSAQ (SEQ ID NO: 5042), DWHRIGQ (SEQ ID NO: 5043), DWHRIEQ (SEQ ID NO: 5044), DWHRIVQ (SEQ ID NO: 5045), DWHRNAQ (SEQ ID NO: 5046), DWHRLAQ (SEQ ID NO: 5047), DWHRIAK (SEQ ID NO: 5048), DWHRIAH (SEQ ID NO: 5049), DWHRIPQ (SEQ ID NO: 5050), DWHRIAR (SEQ ID NO: 5051), DWHRIAE (SEQ ID NO: 5052), DWHRIAL (SEQ ID NO: 5053), DWHRIAP (SEQ ID NO: 5054), DWHRFAQ (SEQ ID NO: 5055), DWHRVSQ (SEQ ID NO: 5056), DWHRVTM (SEQ ID NO: 5057), DWHRISM (SEQ ID NO: 5058), DWHRIWQ (SEQ ID NO: 5059), DWHRIFQ (SEQ ID NO: 5060), DWHRIQQ (SEQ ID NO: 5061), DWHRVQQ (SEQ ID NO: 5062), DWHRIFM (SEQ ID NO: 5063), DWHRIAM (SEQ ID NO: 5064), or DWHRISN (SEQ ID NO: 5065); (ii) An amino acid sequence containing any part of the amino acid sequences in (i), for example, any 2, 3, 4, 5, or 6 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3, but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or An AAV capsid variant according to any one of Embodiments 1 to 35, comprising an amino acid sequence containing 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of the amino acid sequences in (iv)(i). 37. An AAV capsid variant according to any one of Embodiments 1 to 36, wherein [N2]-[N3] is DWHRIAQ (SEQ ID NO: 5027) or contains the same. 38. [N1]-[N2]-[N3] is (i) an amino acid sequence of any one of SEQ ID NOs: 343 to 538, (ii) an amino acid sequence containing any part of the amino acid sequence in (i), for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids thereof, for example, consecutive amino acids, (iii) an amino acid sequence containing 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (for example, conservative substitutions), insertions, or deletions, relative to any one of the amino acid sequences in (i), or (iv) an amino acid sequence containing 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of the amino acid sequences in (i). An AAV capsid variant according to any one of Embodiments 1 to 37. 39. An AAV capsid variant according to any one of Embodiments 1 to 38, wherein [N1]-[N2]-[N3] is TNTQDWHRIAQ (SEQ ID NO: 343) or contains the same. 40. An AAV capsid variant according to any one of Embodiments 1 to 38, wherein [N1]-[N2]-[N3] is TNTKDWHRIAQ (SEQ ID NO: 344) or contains the same. 41. An AAV capsid variant according to any one of Embodiments 1 to 40, comprising 1, 2, 3, or all of an amino acid other than T (e.g., S, N, P, A, or I) at position 593, an amino acid other than G (e.g., N, D, R, V, A, S, or Q) at position 594, an amino acid other than W (e.g., S, C, R, L, or G) at position 595, and / or an amino acid other than V (e.g., A, S, I, C, G, D, F, L, or T) at position 596, numbered according to SEQ ID NO: 138 or 981. 42. An AAV capsid variant according to any one of Embodiments 1 to 40, comprising amino acid T at position 593, amino acid G at position 594, amino acid W at position 595, and amino acid V at position 596, numbered according to SEQ ID NO: 138 or 981. 43. Further comprising [N4], wherein [N4] comprises positions X8, X9, X 10 , and X 11 , and (i) position X8 is T, S, N, P, A, or I, (ii) position X9 is G, N, D, R, V, A, S, or Q, (iii) position X 10 is W, S, C, R, L, or G, and / or (iv) position X 11 is V, A, S, I, C, G, D, F, L, or T, an AAV capsid variant according to any one of Embodiments 1 to 42. 44. An AAV capsid variant according to Embodiment 43, wherein [N4] comprises TG, TN, SN, NN, SG, PG, TD, AG, IG, NG, TR, TV, TA, TS, SV, TQ, WV, WA, WS, WI, WC, WG, CV, RV, LV, GV, WD, WF, WL, WT, GW, NW, GS, DW, GC, GR, GL, GG, RW, VW, AW, SW, or QW. 45. An AAV capsid variant according to embodiment 43 or 44, wherein [N4] comprises TGW, TNW, SNW, NNW, SGW, PGW, TGS, TDW, TGC, TGR, TGL, TGG, AGW, IGW, NGW, TRW, TVW, TAW, TSW, SVW, TQW, GWV, GWA, NWS, NWV, NWI, GWS, GWI, GWC, GWG, GSV, DWV, GCV, GRV, GLV, GGV, GWD, GWF, RWV, VWV, GWL, AWV, SWV, GWT, or QWV. 46. An AAV capsid variant according to any one of embodiments 43 - 45, wherein [N4] is TGWV (SEQ ID NO: 5066), TGWA (SEQ ID NO: 5067), TNWS (SEQ ID NO: 5068), SNWV (SEQ ID NO: 5069), TNWV (SEQ ID NO: 5070), TNWI (SEQ ID NO: 5071), NNWV (SEQ ID NO: 5072), TGWS (SEQ ID NO: 5073), TGWI (SEQ ID NO: 5074), TGWC (SEQ ID NO: 5075), TGWG (SEQ ID NO: 5076), SGWV (SEQ ID NO: 5077), PGWV (SEQ ID NO: 5078), TGSV (SEQ ID NO: 5079), TDWV (SEQ ID NO: 5080), TGCV (SEQ ID NO: 5081), TGRV (SEQ ID NO: 5082), TGLV (SEQ ID NO: 5083), TGGV (SEQ ID NO: 5084), AGWV (SEQ ID NO: 5085), IGWV (SEQ ID NO: 5086), TGWD (SEQ ID NO: 5087), NGWV (SEQ ID NO: 5088), TGWF (SEQ ID NO: 5089), TRWV (SEQ ID NO: 5090), TVWV (SEQ ID NO: 5091), TGWL (SEQ ID NO: 5092), TAWV (SEQ ID NO: 5093), TSWV (SEQ ID NO: 5094), TGWT (SEQ ID NO: 5095), SVWV (SEQ ID NO: 5096), TQWV (SEQ ID NO: 5097), or PGWG (SEQ ID NO: 5098), or comprises them. 47. An AAV capsid variant according to any one of embodiments 43 - 46, wherein [N4] is TGWV (SEQ ID NO: 5066) or comprises it. 48. [N1]-[N2]-[N3]-[N4] is (i) any one amino acid sequence among SEQ ID NOs: 201 to 245, 247 to 250, 253 to 255, 257 to 265, 268 to 274, 276 to 286, 288, 290 to 297, 299 to 303, 305 to 309, 311, 313 to 319, 323 to 328, 330 to 337, 339 to 342, 539 to 542, 544, 546, 547, 549 to 557, 559 to 589, 592, 593, 595, 596, 598, 599, 601 to 608, 610 to 614, 616 to 622, 625, 628, 630, 631, 633, 636, 638, 639 to 646, 649, 651 to 657, 667, 669, 670, 672, 673, 679 to 683, 685 to 690, 692, 693, 695, 697, 699 to 701, 703 to 705, 708 to 710, 712 to 717, 719 to 723, 728 to 731, 733 to 738, 740, or 742, (ii) any part of the amino acid sequence in (i), for example, an amino acid sequence containing any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, for example, a continuous amino acid sequence thereof, (iii) an amino acid sequence containing 1, 2, or 3 modifications, but 4 or less modifications, such as substitution (e.g., conservative substitution), insertion, or deletion, with respect to any of the amino acid sequences in (i), or (iv) an AAV capsid variant according to any one of Embodiments 43 to 47, comprising an amino acid sequence containing 1, 2, or 3 different amino acids, but 4 or less different amino acids, with respect to any one of the amino acid sequences in (i). 49. The AAV capsid variant according to any one of Embodiments 43 to 48, wherein [N1]-[N2]-[N3]-[N4] is TNTQDWHRIAQTGWV (SEQ ID NO: 201) or contains it. 50. The AAV capsid variant according to any one of Embodiments 43 to 48, wherein [N1]-[N2]-[N3]-[N4] is TNTKDWHRIAQTGWV (SEQ ID NO: 202) or contains it. 51. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising an amino acid sequence having the following formula: [N1]-[N2]-[N3] (SEQ ID NO: 4683), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), (i) [N1] comprises positions X1, X2, X3, and X4, wherein the X4 position is Q, P, or a conservative substitution thereof, and / or (ii) [N3] comprises positions X5, X6, and X7, wherein the X5 position is I, V, or a conservative substitution thereof, said AAV capsid variant. 52. The AAV capsid variant according to embodiment 51, numbered according to SEQ ID NO: 138 or 981, and comprising amino acid Q at position 585. 53. An amino acid other than T at position 582 (e.g., S), an amino acid other than N at position 583 (e.g., T, G, S, I, or V), an amino acid other than H at position 584 (e.g., N, I, S, A, V, or L), and / or an amino acid other than Q at position 585 (e.g., P), among which 1, 2, 3, or all are included, of the AAV capsid variant according to embodiment 51 or 52. 54. The AAV capsid variant according to any one of embodiments 51 to 53, wherein [N1] comprises positions X1, X2, X3, and X4, and the X4 position is Q or P. 55. The AAV capsid variant according to any one of embodiments 51, 52, or 54, wherein the X4 position is Q. 56. The AAV capsid variant according to any one of embodiments 51 to 55, numbered according to SEQ ID NO: 138, and comprising an amino acid other than H (e.g., T) at position 584. 57. The AAV capsid variant according to any one of embodiments 51 to 56, numbered according to SEQ ID NO: 138 or 981, and comprising amino acid T at position 584. 58. (i) The X1 position is T or S, (ii) The X2 position is N, T, G, S, I, or V, and / or (iii) The AAV capsid variant according to any one of Embodiments 51 to 57, wherein the X3 position is T, N, I, S, A, V, or L. 59. The AAV capsid variant according to any one of Embodiments 51 to 58, wherein [N1] includes TN, TT, TG, ST, TS, TI, TV, TQ, NQ, IQ, SQ, AQ, VQ, TP, LQ, NT, TA, NI, GT, IT, NN, TL, NS, or VT. 60. The AAV capsid variant according to any one of Embodiments 51 to 59, wherein [N1] includes TNT, TTN, TTI, TTS, TTT, TTA, TNI, TTV, TGT, STT, TST, TIT, TNN, TTL, TNS, TVT, NTQ, TNQ, TIQ, TSQ, TTQ, TAQ, NIQ, TVQ, GTQ, STQ, ITQ, NTP, NNQ, TLQ, NSQ, or VTQ. 61. The AAV capsid variant according to any one of Embodiments 51 to 60, wherein [N1] is TNTQ (SEQ ID NO: 4688), TTNQ (SEQ ID NO: 4696), TTIQ (SEQ ID NO: 4698), TTSQ (SEQ ID NO: 4701), TTTQ (SEQ ID NO: 4705), TTAQ (SEQ ID NO: 4707), TNIQ (SEQ ID NO: 4714), TTVQ (SEQ ID NO: 4717), TGTQ (SEQ ID NO: 4718), STTQ (SEQ ID NO: 4761), TSTQ (SEQ ID NO: 4768), TITQ (SEQ ID NO: 4767), TNTP (SEQ ID NO: 4710), TNNQ (SEQ ID NO: 4690), TTLQ (SEQ ID NO: 4720), TNSQ (SEQ ID NO: 4731), or TVTQ (SEQ ID NO: 4790), or includes them. 62. The AAV capsid variant according to any one of Embodiments 51 to 61, wherein [N1] is TNTQ (SEQ ID NO: 4688) or includes it. 63. [N1]-[N2] is (i) TQDWHR (SEQ ID NO: 4686), NQDWHR (SEQ ID NO: 4793), IQDWHR (SEQ ID NO: 4797), SQDWHR (SEQ ID NO: 4798), AQDWHR (SEQ ID NO: 4801), VQDWHR (SEQ ID NO: 4805), TPDWHR (SEQ ID NO: 4803), or LQDWHR (SEQ ID NO: 4807), (ii) An amino acid sequence containing any part of the amino acid sequence in (i), for example, any 2, 3, 4, or 5 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3, but 4 or less modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An AAV capsid variant according to any one of Embodiments 51 to 62, which contains an amino acid sequence containing 1, 2, or 3, but 4 or less different amino acids, with respect to any one of the amino acid sequences in (i). 64. [N1]-[N2] is (i) NTQDWHR (SEQ ID NO: 4827), TNQDWHR (SEQ ID NO: 4832), TIQDWHR (SEQ ID NO: 4834), TSQDWHR (SEQ ID NO: 4836), TTQDWHR (SEQ ID NO: 4840), TAQDWHR (SEQ ID NO: 4842), NIQDWHR (SEQ ID NO: 4848), TVQDWHR (SEQ ID NO: 4850), GTQDWHR (SEQ ID NO: 4851), STQDWHR (SEQ ID NO: 4884), ITQDWHR (SEQ ID NO: 4883), NTPDWHR (SEQ ID NO: 4845), NNQDWHR (SEQ ID NO: 4829), TLQDWHR (SEQ ID NO: 4853), NSQDWHR (SEQ ID NO: 4861), VTQDWHR (SEQ ID NO: 4897), (ii) An amino acid sequence containing any part of the amino acid sequence in (i), for example, any 2, 3, 4, 5, or 6 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3, but 4 or less modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An AAV capsid variant according to any one of Embodiments 51 to 63, which contains an amino acid sequence containing 1, 2, or 3, but 4 or less different amino acids, with respect to any one of the amino acid sequences in (i). 65. [N1]-[N2] is (i) TNTQDWHR (SEQ ID NO: 4898), TTNQDWHR (SEQ ID NO: 4906), TTIQDWHR (SEQ ID NO: 4908), TTSQDWHR (SEQ ID NO: 4911), TTTQDWHR (SEQ ID NO: 4915), TTAQDWHR (SEQ ID NO: 4917), TNIQDWHR (SEQ ID NO: 4924), TTVQDWHR (SEQ ID NO: 4927), TGTQDWHR (SEQ ID NO: 4928), STTQDWHR (SEQ ID NO: 4971), TSTQDWHR (SEQ ID NO: 4978), TITQDWHR (SEQ ID NO: 4977), TNTPDWHR (SEQ ID NO: 4920), TNNQDWHR (SEQ ID NO: 4900), TTLQDWHR (SEQ ID NO: 4930), TNSQDWHR (SEQ ID NO: 4941), TVTQDWHR (SEQ ID NO: 5000), (ii) An amino acid sequence containing any part of the amino acid sequences in (i), for example, any 2, 3, 4, 5, 6, or 7 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3, but 4 or less modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An amino acid sequence containing 1, 2, or 3, but 4 or less different amino acids with respect to any one of the amino acid sequences in (i), or an AAV capsid variant according to any one of Embodiments 51 to 64 containing them. 66. An AAV capsid variant according to any one of Embodiments 51 to 65, wherein [N1]-[N2] is TNTQDWHR (SEQ ID NO: 4898) or contains it. 67. An AAV capsid variant according to any one of Embodiments 51 to 66, containing 1, 2, or all of an amino acid other than Q (e.g., I or V) at position 590, an amino acid other than A (e.g., P, S, Y, or N) at position 591, and / or an amino acid other than Q (e.g., G or N) at position 592, numbered according to SEQ ID NO: 138. 68. An AAV capsid variant according to any one of embodiments 51 to 67, numbered according to SEQ ID NO: 138 and containing an amino acid other than Q (e.g., I or V) at position 590. 69. An AAV capsid variant according to any one of embodiments 51 to 68, numbered according to SEQ ID NO: 138 and containing amino acid I at position 590. 70. An AAV capsid variant according to any one of embodiments 51 to 68, numbered according to SEQ ID NO: 138 and containing amino acid V at position 590. 71. An AAV capsid variant according to any one of embodiments 51 to 70, numbered according to SEQ ID NO: 138 or 981 and containing amino acid A at position 591 and / or amino acid Q at position 592. 72. An AAV capsid variant according to any one of embodiments 51 to 71, wherein [N3] includes positions X5, X6, and X7, and position X5 is I or V. 73. An AAV capsid variant according to any one of embodiments 51 to 72, wherein position X5 is I. 74. (i) position X6 is A, P, S, Y, or N, and / or (ii) position X7 is Q, G, or N, an AAV capsid variant according to any one of embodiments 51 to 73. 75. An AAV capsid variant according to any one of embodiments 51 to 74, wherein [N3] includes IA, VP, VA, VS, IY, IN, IS, AQ, AG, PQ, SQ, AN, YQ, or NQ. 76. An AAV capsid variant according to any one of embodiments 51 to 75, wherein [N3] is IAQ, IAG, VPQ, VAQ, VSQ, IAN, IYQ, INQ, or ISQ, or includes them. 77. An AAV capsid variant according to any one of embodiments 51 to 76, wherein [N3] is IAQ or includes it. 78. [N2]-[N3] is (i) DWHRIA (SEQ ID NO: 5002), DWHRVP (SEQ ID NO: 5004), DWHRVA (SEQ ID NO: 5008), DWHRVS (SEQ ID NO: 5021), DWHRIY (SEQ ID NO: 5003), DWHRIN (SEQ ID NO: 5005), or DWHRIS (SEQ ID NO: 5009), (ii) An amino acid sequence containing any part of the amino acid sequences in (i), for example, any 2, 3, 4, or 5 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An AAV capsid variant according to any one of Embodiments 51 to 77, which contains an amino acid sequence containing 1, 2, or 3 but 4 or fewer different amino acids with respect to any one of the amino acid sequences in (i). 79. [N2]-[N3] is (i) DWHRIAQ (SEQ ID NO: 5027), DWHRIAG (SEQ ID NO: 5028), DWHRVPQ (SEQ ID NO: 5030), DWHRVAQ (SEQ ID NO: 5038), DWHRVSQ (SEQ ID NO: 5056), DWHRIAN (SEQ ID NO: 5031), DWHRIYQ (SEQ ID NO: 5029), DWHRINQ (SEQ ID NO: 5032), or DWHRISQ (SEQ ID NO: 5037), (ii) An amino acid sequence containing any part of the amino acid sequences in (i), for example, any 2, 3, 4, 5, or 6 amino acids thereof, for example, consecutive amino acids, (iii) An amino acid sequence containing 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) An AAV capsid variant according to any one of Embodiments 51 to 78, which is an amino acid sequence containing 1, 2, or 3 but 4 or fewer different amino acids with respect to any one of the amino acid sequences in (i), or contains them. 80. The AAV capsid variant according to any one of Embodiments 51 to 79, wherein [N2]-[N3] is DWHRIAQ (SEQ ID NO: 5027) or includes the same. 81. [N1]-[N2]-[N3] is (i) any one of the amino acid sequences of SEQ ID NOs: 343, 350, 352, 355, 359, 361, 364, 367, 370, 371, 373, 374, 376, 377, 378, 381, 395, 420, 454, 457, 460, 464, 481, 482, 488, 493, 494, 516, 525, 536, (ii) an amino acid sequence including any part of the amino acid sequences in (i), for example, any 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids thereof, for example, consecutive amino acids, (iii) an amino acid sequence including modifications of 1, 2, or 3 but 4 or less, for example, substitutions (for example, conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) an amino acid sequence including 1, 2, or 3 but 4 or less different amino acids with respect to any one of the amino acid sequences in (i), or the AAV capsid variant according to any one of Embodiments 51 to 80 including the same. 82. The AAV capsid variant according to any one of Embodiments 51 to 81, wherein [N1]-[N2]-[N3] is TNTQDWHRIAQ (SEQ ID NO: 343) or includes the same. 83. The AAV capsid variant according to any one of Embodiments 51 to 82, numbered according to SEQ ID NO: 138 or 981 and including amino acid W at position 595. 84. The AAV capsid variant according to any one of Embodiments 51 to 83, including 1, 2, or all of the amino acids other than T (for example, S or N) at position 593, the amino acids other than G (for example, N) at position 594, and / or the amino acids other than V (for example, A, I, or S) at position 596, numbered according to SEQ ID NO: 138 or 981. 85. (i) Numbered according to SEQ ID NO: 138 or 981, with amino acid T at position 593, amino acid G at position 594, amino acid W at position 595, and amino acid V at position 596, (ii) Numbered according to SEQ ID NO: 138 or 981, with amino acid T at position 593, amino acid G at position 594, amino acid W at position 595, and amino acid A at position 596, (iii) Numbered according to SEQ ID NO: 138 or 981, with amino acid S at position 593, amino acid N at position 594, amino acid W at position 595, and amino acid V at position 596, (iv) Numbered according to SEQ ID NO: 138 or 981, with amino acid N at position 593, amino acid N at position 594, amino acid W at position 595, and amino acid V at position 596, (v) Numbered according to SEQ ID NO: 138 or 981, with amino acid T at position 593, amino acid G at position 594, amino acid W at position 595, and amino acid I at position 596, or (vi) Numbered according to SEQ ID NO: 138 or 981, with amino acid T at position 593, amino acid G at position 594, amino acid W at position 595, and amino acid S at position 596, the AAV capsid variant according to any one of Embodiments 51 to 84. 86. The AAV capsid variant according to any one of Embodiments 51 to 85, comprising amino acid T at position 593, amino acid G at position 594, amino acid W at position 595, and amino acid V numbered according to SEQ ID NO: 138 or 981. 87. Further comprising [N4], wherein [N4] comprises positions X8, X9, X 10 , and X 11 , and the position X 10 is W, the AAV capsid variant according to any one of Embodiments 51 to 86. 88. (i) The position X8 is T, S, or N, (ii) The position X9 is G or N, and / or (iv) The position X 11 is V, A, I, or S, the AAV capsid variant according to Embodiment 87. 89. The AAV capsid variant according to embodiment 87 or 88, wherein [N4] comprises TG, SN, NN, WV, WA, WI, WS, GW, or NW. 90. The AAV capsid variant according to any one of embodiments 87 to 89, wherein [N4] comprises TGW, SNW, NNW, GWV, GWA, NWV, GWI, or GWS. 91. The AAV capsid variant according to any one of embodiments 87 to 90, wherein [N4] is TGWV (SEQ ID NO: 5066), TGWA (SEQ ID NO: 5067), SNWV (SEQ ID NO: 5069), NNWV (SEQ ID NO: 5072), TGWI (SEQ ID NO: 5074), or TGWS (SEQ ID NO: 5073), or comprises them. 92. The AAV capsid variant according to any one of embodiments 87 to 91, wherein [N4] is TGWV (SEQ ID NO: 5066) or comprises it. 93. [N1]-[N2]-[N3]-[N4] is (i) any one amino acid sequence of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, (ii) any part of the amino acid sequence in (i), for example, any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids, for example, an amino acid sequence containing their consecutive amino acids, (iii) an amino acid sequence containing 1, 2, or 3 but 4 or less modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to any of the amino acid sequences in (i), or (iv) an amino acid sequence containing 1, 2, or 3 but 4 or less different amino acids with respect to any one of the amino acid sequences in (i), or comprises them, the AAV capsid variant according to any one of embodiments 87 to 92. The AAV capsid variant according to any one of embodiments 87 to 93, wherein [N1]-[N2]-[N3]-[N4] is TNTQDWHRIAQTGWV (SEQ ID NO: 201) or contains the same. The AAV capsid variant according to any one of embodiments 1 to 94, wherein [N1]-[N2]-[N3] is present in Loop VIII, and optionally, Loop VIII is numbered according to SEQ ID NO: 138 or 981 and contains positions 580 to 599. The AAV capsid variant according to any one of embodiments 43 to 50 or 87 to 95, wherein [N4] is present in Loop VIII, and optionally, Loop VIII is numbered according to SEQ ID NO: 138 or 981 and contains positions 580 to 599. The AAV capsid variant according to any one of embodiments 1 to 96, wherein [N1] replaces positions 582 to 585 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, Q585). The AAV capsid variant according to any one of embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, or 85 to 97, wherein [N1] corresponds to positions 582 to 585 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585). The AAV capsid variant according to any one of embodiments 1 to 98, wherein [N1] is present at positions 582 to 585 numbered according to SEQ ID NO: 138 or 981. The AAV capsid variant according to any one of embodiments 1 to 99, wherein [N1] corresponds to positions 582 to 585 of SEQ ID NO: 138 (e.g., T582, N583, T584, Q585). The AAV capsid variant according to any one of embodiments 1 to 100, wherein [N2] replaces positions 586 to 589 numbered according to the amino acid sequence of SEQ ID NO: 138 (e.g., S586, A587, Q588, A589). 102. The [N2] is an AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101, corresponding to positions 586 to 589 of SEQ ID NO: 981 (for example, D586, W587, H588, R589). 103. The [N2] is an AAV capsid variant according to any one of Embodiments 1 to 102, present at positions 586 to 589, numbered according to SEQ ID NO: 138 or 981. 104. The [N1]-[N2] is an AAV capsid variant according to any one of Embodiments 1 to 103, replacing positions 582 to 589, numbered according to SEQ ID NO: 138 (for example, T582, N583, H584, Q585, S586, A587, Q588, A589). 105. The [N1]-[N2] is an AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 104, corresponding to positions 582 to 589 of SEQ ID NO: 981 (for example, T582, N583, T584, Q585, D586, W587, H588, R589). 106. The [N1]-[N2] is an AAV capsid variant according to any one of Embodiments 1 to 105, present at positions 582 to 589, numbered according to SEQ ID NO: 138 or 981. 107. The [N3] is an AAV capsid variant according to any one of Embodiments 1 to 106, replacing positions 590 to 592 with respect to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138 (for example, Q590, A591, and Q592). 108. The [N3] is an AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 107, corresponding to positions 590 to 592 of SEQ ID NO: 981 (for example, I590, A591, and Q592). 109. The AAV capsid variant according to any one of Embodiments 1 to 108, wherein [N3] is located at positions 590 to 592 and numbered according to SEQ ID NO: 138 or 981. 110. The AAV capsid variant according to any one of Embodiments 1 to 109, wherein [N2]-[N3] replaces positions 586 to 592 (for example, S586, A587, Q588, A589, Q590, A591, and Q592) and is numbered according to SEQ ID NO: 138. 111. The AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 110, wherein [N2]-[N3] corresponds to positions 586 to 592 of SEQ ID NO: 981 (for example, D586, W587, H588, R589, I590, A591, and Q592). 112. The AAV capsid variant according to any one of Embodiments 1 to 111, wherein [N2]-[N3] is located at positions 586 to 592 and numbered according to SEQ ID NO: 138 or 981. 113. The AAV capsid variant according to any one of Embodiments 1 to 112, wherein [N1]-[N2]-[N3] replaces positions 582 to 592 (for example, T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592) and is numbered according to SEQ ID NO: 138. 114. The AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 113, wherein [N1]-[N2]-[N3] corresponds to positions 582 to 592 of SEQ ID NO: 981 (for example, T582, N583, T584, Q585, D586, W587, H588, R589, I590, A591, Q592). 115. The AAV capsid variant according to any one of Embodiments 1 to 114, wherein [N1]-[N2]-[N3] is located at positions 582 to 592 and numbered according to SEQ ID NO: 138 or 981. 116. An AAV capsid variant according to any one of embodiments 43-50 or 87-115, wherein [N4] replaces positions 593-596 (e.g., T593, G594, W595, and V596) numbered according to SEQ ID NO: 138. 117. An AAV capsid variant according to any one of embodiments 43-49 or 87-115, wherein [N4] corresponds to positions 593-596 of SEQ ID NO: 138 or 981 (e.g., T593, G594, W595, and V596). 118. An AAV capsid variant according to any one of embodiments 43-50 or 87-117, wherein [N4] is present at positions 593-596 numbered according to SEQ ID NO: 138 or 981. 119. An AAV capsid variant according to any one of embodiments 43-50 or 87-118, wherein [N2]-[N3]-[N4] replaces positions 586-596 (e.g., S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and V596) with respect to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 120. An AAV capsid variant according to any one of embodiments 43-49 or 87-119, wherein [N2]-[N3]-[N4] corresponds to positions 586-596 of SEQ ID NO: 981 (e.g., D586, W587, H588, R589, I590, A591, Q592, T593, G594, W595, and V596). 121. An AAV capsid variant according to any one of embodiments 43-50 or 87-120, wherein [N2]-[N3]-[N4] is present at positions 586-596 numbered according to SEQ ID NO: 138 or 981. 122. An AAV capsid variant according to any one of embodiments 43-50 or 87-121, wherein [N1]-[N2]-[N3]-[N4] replaces positions 582-596 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and V596) with respect to a reference sequence numbered according to the amino acid sequence of SEQ ID NO: 138. 123. The [N1]-[N2]-[N3]-[N4] corresponds to positions 582 to 596 of SEQ ID NO: 981 (for example, T582, N583, T584, Q585, D586, W587, H588, R589, I590, A591, Q592, T593, G594, W595, and V596), and is an AAV capsid variant described in any one of Embodiments 43 to 49 or 87 to 122. 124. The [N1]-[N2]-[N3]-[N4] is numbered according to the amino acid sequence of SEQ ID NO: 138 or 981 and is present at positions 582 to 596, and is an AAV capsid variant described in any one of Embodiments 43 to 50 or 87 to 123. 125. The [N2] is present immediately after the [N1], and is an AAV capsid variant described in any one of Embodiments 1 to 124. 126. The [N3] is present immediately after the [N2], and is an AAV capsid variant described in any one of Embodiments 1 to 125. 127. The [N3] is present immediately after the [N4], and is an AAV capsid variant described in any one of Embodiments 43 to 50 or 87 to 126. 128. An AAV capsid variant containing [N1]-[N2]-[N3] from the N-terminus to the C-terminus, and is an AAV capsid variant described in any one of Embodiments 1 to 127. 129. An AAV capsid variant containing [N1]-[N2]-[N3]-[N4] from the N-terminus to the C-terminus, and is an AAV capsid variant described in any one of Embodiments 43 to 50 or 87 to 128. 130. An AAV capsid variant (for example, an AAV9 capsid variant), wherein (a) the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, (b) an amino acid sequence containing at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, or (c) An amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, or (d) The AAV capsid variant comprising an amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. 131. An AAV capsid variant (e.g., an AAV9 capsid variant), (a) The amino acid sequence of any one of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, (b) An amino acid sequence containing at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, (c) An amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, or The AAV capsid variant comprising an amino acid sequence having at least 1, 2, or 3, but 4 or less modifications, such as substitutions (e.g., conservative substitutions), with respect to any one of the amino acid sequences of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. 132. The AAV capsid variant according to embodiment 130 or 131, wherein the AAV capsid variant does not contain at least 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids from TNHQSAQAQ (SEQ ID NO: 5100), and optionally, TNHQSAQAQ (SEQ ID NO: 5100) corresponds to positions 582 - 592 of SEQ ID NO: 138. 133. The AAV capsid variant according to any one of embodiments 130 - 132, wherein the AAV capsid variant does not contain TNH, TNHQ (SEQ ID NO: 4760), TNHQS (SEQ ID NO: 5101), TNHQSA (SEQ ID NO: 5102), TNHQSAQ (SEQ ID NO: 5103), TNHQSAQA (SEQ ID NO: 5104), TNHQSAQAQ (SEQ ID NO: 5100), NHQ, NHQS (SEQ ID NO: 5105), NHQSA (SEQ ID NO: 5106), NHQSAQ (SEQ ID NO: 5107), NHQSAQA (SEQ ID NO: 5108), NHQSAQAQ (SEQ ID NO: 5109), HQS, HQSA (SEQ ID NO: 5110), HQSAQ (SEQ ID NO: 5111), HQSAQA (SEQ ID NO: 5112), HQSAQAQ (SEQ ID NO: 5113), QSA, QSAQ (SEQ ID NO: 5114), QSAQA (SEQ ID NO: 5115), QSAQAQ (SEQ ID NO: 5116), SAQA (SEQ ID NO: 5117), or SAQAQ (SEQ ID NO: 5118). An AAV capsid variant according to any one of embodiments 130 to 124, comprising an amino acid sequence containing at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201, 205 to 209, 211 to 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 to 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. An AAV capsid variant according to any one of embodiments 130 to 134, wherein three consecutive amino acids contain TQD. An AAV capsid variant according to any one of embodiments 130 to 135, wherein four consecutive amino acids contain TQDW (SEQ ID NO: 4684). An AAV capsid variant according to any one of embodiments 130 to 136, wherein five consecutive amino acids contain TQDWH (SEQ ID NO: 4685). An AAV capsid variant according to any one of embodiments 130 to 137, wherein six consecutive amino acids contain TQDWHR (SEQ ID NO: 4686). An AAV capsid variant according to embodiments 130 to 138, wherein seven consecutive amino acids contain TQDWHRI (SEQ ID NO: 941). An AAV capsid variant according to any one of embodiments 130 to 134, wherein three consecutive amino acids contain TNT. An AAV capsid variant according to any one of embodiments 130 to 134 or 140, wherein four consecutive amino acids contain TNTQ (SEQ ID NO: 4688). An AAV capsid variant according to any one of embodiments 130 to 134, 140, or 141, wherein five consecutive amino acids contain TNTQD (SEQ ID NO: 5119). An AAV capsid variant according to any one of embodiments 130 to 134 or 140 to 142, wherein six consecutive amino acids contain TNTQDW (SEQ ID NO: 5120). 144. The AAV capsid variant according to any one of embodiments 130 - 134 or 140 - 143, wherein 144.7 consecutive amino acids contain TNTQDWH (SEQ ID NO: 5121). 145. The AAV capsid variant according to any one of embodiments 130 - 134 or 140 - 144, wherein 145.8 consecutive amino acids contain TNTQDWHR (SEQ ID NO: 4898). 146. The AAV capsid variant according to any one of embodiments 130 - 134 or 140 - 145, wherein 146.9 consecutive amino acids contain TNTQDWHRI (SEQ ID NO: 746). 147. The AAV capsid variant according to any one of embodiments 130 - 146, comprising an amino acid sequence having at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), with respect to any one of the amino acid sequences of SEQ ID NO: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. 148. The AAV capsid variant according to any one of embodiments 130 - 147, comprising an amino acid sequence having at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), with respect to the amino acid sequence of TQDWHRI (SEQ ID NO: 941). 149. The AAV capsid variant according to any one of embodiments 130 - 147, comprising an amino acid sequence having at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), with respect to the amino acid sequence of TNTQDWHRI (SEQ ID NO: 746). 150. The AAV capsid variant according to any one of embodiments 130 - 149, comprising an amino acid sequence having at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), with respect to the amino acid sequence of ATNTQDWHRIAQT (SEQ ID NO: 744). An AAV capsid variant according to any one of embodiments 130 to 150, comprising an amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of the amino acid sequences of SEQ ID NOs: 201, 205 to 209, 211 to 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 to 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. An AAV capsid variant according to any one of embodiments 130 to 149 or 151, comprising an amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941). An AAV capsid variant according to any one of embodiments 130 to 149, 151, or 152, comprising an amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of TNTQDWHRI (SEQ ID NO: 746). An AAV capsid variant according to any one of embodiments 130 to 153, comprising an amino acid sequence containing at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of ATNTQDWHRIAQT (SEQ ID NO: 744). An AAV capsid variant according to any one of embodiments 1 to 154, comprising any one of the amino acid sequences of SEQ ID NOs: 201, 205 to 209, 211 to 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 to 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. An AAV capsid variant according to any one of embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 155, comprising the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and optionally, replacing positions 584 to 590 numbered according to SEQ ID NO: 138. An AAV capsid variant according to any one of embodiments 1-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, or 101-156, comprising the amino acid sequence of 157.TQDWHRI (SEQ ID NO: 941), and optionally, wherein the amino acid sequence corresponds to positions 584-590 of SEQ ID NO: 981. An AAV capsid variant according to any one of embodiments 1-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, or 101-149, 151-153, or 155-157, comprising the nucleotide sequence of SEQ ID NO: 942, a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but 10 or fewer modifications, e.g., substitutions, to the nucleotide sequence of SEQ ID NO: 942, or an amino acid sequence encoded by a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides to the nucleotide sequence of SEQ ID NO: 942. An AAV capsid variant according to any one of embodiments 1-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, or 101-158, comprising the nucleotide sequence of SEQ ID NO: 747, a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but 10 or fewer modifications, e.g., substitutions, to the nucleotide sequence of SEQ ID NO: 747, or an amino acid sequence encoded by a nucleotide sequence comprising at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides to the nucleotide sequence of SEQ ID NO: 747. 160. The nucleotide sequence encoding the capsid variant includes the nucleotide sequence of SEQ ID NO: 942, a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, relative to the nucleotide sequence of SEQ ID NO: 942, but including 10 or fewer modifications, such as substitutions, or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942, and is included in any one of Embodiments 1-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, or 101-149, 151-153, or 155-158 of the AAV capsid variant. 161. The nucleotide sequence encoding the capsid variant includes the nucleotide sequence of SEQ ID NO: 747, a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, relative to the nucleotide sequence of SEQ ID NO: 747, but including 10 or fewer modifications, such as substitutions, or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 747, and includes the amino acid sequence encoded by the nucleotide sequence, and is included in any one of Embodiments 1-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, or 101-160 of the AAV capsid variant. 162. The amino acid sequence is present in Loop VIII, and optionally, Loop VIII is numbered according to SEQ ID NO: 138 or 981 and includes positions 580-599, and is included in any one of Embodiments 130-161 of the AAV capsid variant. 163. The amino acid sequence replaces positions 584, 585, 586, 587, 588, 589, and / or 590 (e.g., H584, Q585, S586, A587, Q588, A589, and / or Q590) numbered according to the amino acid sequence of SEQ ID NO: 138, and is included in any one of Embodiments 130-153 of the AAV capsid variant. 164. The AAV capsid variant according to any one of Embodiments 130 to 163, wherein the amino acid sequence is present at positions 584, 585, 586, 587, 588, 589, and / or 590 numbered according to the amino acid sequence of SEQ ID NO: 138 or 981. 165. The AAV capsid variant according to any one of Embodiments 130 to 164, wherein the amino acid sequence corresponds to positions 584 to 590 numbered according to the amino acid sequence of SEQ ID NO: 981 (for example, T584, Q585, D586, W587, H588, R589, and / or I590). 166. The AAV capsid variant according to any one of Embodiments 121 to 165, wherein the amino acid sequence replaces positions 582, 583, 584, 585, 586, 587, 588, 589, and / or 590 numbered according to the amino acid sequence of SEQ ID NO: 138 (for example, T582, N583, H584, Q585, S586, A587, Q588, A589, and / or Q590). 167. The AAV capsid variant according to any one of Embodiments 121 to 166, wherein the amino acid sequence is present at positions 582, 583, 584, 585, 586, 587, 588, 589, and / or 590 numbered according to the amino acid sequence of SEQ ID NO: 138 or 981. 168. The AAV capsid variant according to any one of Embodiments 121 to 167, wherein the amino acid sequence replaces positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to the amino acid sequence of SEQ ID NO: 138 (for example, T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and / or V5965). 169. The AAV capsid variant according to any one of Embodiments 121 to 168, wherein the amino acid sequence is numbered according to the amino acid sequence of SEQ ID NO: 138 or 981 and is present at positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596. 170. The AAV capsid variant according to any one of Embodiments 1 to 169, comprising one, two, three, four, five, or all of the amino acids other than H (e.g., T) at position 584, amino acids other than S (e.g., D) at position 586, amino acids other than A (e.g., W) at position 587, amino acids other than Q (e.g., H) at position 588, amino acids other than A (e.g., R) at position 589, and / or amino acids other than Q (e.g., I) at position 590, numbered according to SEQ ID NO: 138. 171. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising one, two, three, four, five, or all of the amino acids other than H (e.g., T) at position 584, amino acids other than S (e.g., D) at position 586, amino acids other than A (e.g., W) at position 587, amino acids other than Q (e.g., H) at position 588, amino acids other than A (e.g., R) at position 589, and / or amino acids other than Q (e.g., I) at position 590, numbered according to SEQ ID NO: 138. 172. The AAV capsid variant according to any one of Embodiments 1 to 171, comprising one, two, three, four, five, or all of amino acid T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and / or I at position 590, numbered according to SEQ ID NO: 138 or 981. 173. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising one, two, three, four, five, or all of amino acid T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and / or I at position 590, numbered according to SEQ ID NO: 138 or 981. An AAV capsid variant according to any one of embodiments 1 to 173, numbered according to SEQ ID NO: 138 and comprising one, two, three, four, five, or all of the substitutions H584T, S586D, A587W, Q588H, A589R, and / or Q590I. 175. An AAV capsid variant (e.g., an AAV9 capsid variant) numbered according to SEQ ID NO: 138 and comprising one, two, three, four, five, or all of the substitutions H584T, S586D, A587W, Q588H, A589R, and / or Q590I. 176. An AAV capsid variant according to any one of embodiments 1 to 175, numbered according to SEQ ID NO: 138 and comprising an amino acid other than H at position 584 (e.g., T), an amino acid other than S at position 586 (e.g., D), an amino acid other than A at position 587 (e.g., W), an amino acid other than Q at position 588 (e.g., H), an amino acid other than A at position 589 (e.g., R), and an amino acid other than Q at position 590 (e.g., I). 177. An AAV capsid variant according to any one of embodiments 1 to 176, numbered according to SEQ ID NO: 138 or 981 and comprising amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590. 178. An AAV capsid variant according to any one of embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 98, or 100 to 164, corresponding to positions 584, 586, 587, 588, 589, and 590 of SEQ ID NO: 981. 179. An AAV capsid variant according to any one of embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 178, corresponding to positions 582, 583, 584, 586, 587, 588, 589, and 590 of SEQ ID NO: 981. 180. An AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, or 101 to 179, corresponding to positions 582, 583, 584, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and 596 of SEQ ID NO: 981. 181. An AAV capsid variant according to any one of Embodiments 1 to 181, comprising substitutions H584T, S586D, A587W, Q588H, A589R, and Q590I numbered according to SEQ ID NO: 138. 182. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising amino acid T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 138 or 981. 183. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising substitutions H584T, S586D, A587W, Q588H, A589R, and Q590I numbered according to SEQ ID NO: 138. 184. An AAV capsid variant according to any one of Embodiments 1 to 183, further comprising an amino acid other than A at position 581, numbered according to SEQ ID NO: 138 or 981. 185. An AAV capsid variant according to any one of Embodiments 1 to 184, further comprising T at position 581 or V at position 581, numbered according to SEQ ID NO: 138 or 981. 186. An AAV capsid variant according to any one of Embodiments 1 to 185, comprising substitution A581T or A581V, numbered according to SEQ ID NO: 138 or 981. 187. An AAV capsid variant according to any one of Embodiments 1, 3 to 7, 9 to 15, 17 to 20, 22 to 38, 40 to 48, 50, 130 to 134, 147, 151, 155, 162, 163, 166 to 177, or 181 to 186, comprising an amino acid other than Q at position 585, numbered according to SEQ ID NO: 138. An AAV capsid variant according to any one of Embodiments 1, 3 to 7, 9 to 15, 17 to 20, 22 to 38, 40 to 48, 50, 130 to 134, 147, 151, 155, 162, 163, 166 to 177, 181 to 187, numbered according to SEQ ID NO: 138 and containing amino acid K at position 585. 189. (i) Modifications in loops I, II, IV, and / or VI, such as insertions, substitutions (e.g., conservative substitutions), and / or deletions, and / or (ii) An AAV capsid variant according to any one of the preceding embodiments, further comprising a substitution at position K449, such as a K449R substitution, numbered according to SEQ ID NO: 138. 190. An AAV capsid variant according to any one of the preceding embodiments, comprising an amino acid sequence having at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), with respect to the amino acid sequence of SEQ ID NO: 138, but including 30, 20, or 10 or fewer modifications, such as substitutions (e.g., conservative substitutions). 191. An AAV capsid variant according to any one of the preceding embodiments, comprising an amino acid sequence having at least 1, 2, or 3, but including 30, 20, or 10 or fewer different amino acids, with respect to the amino acid sequence of SEQ ID NO: 138. 192. An AAV capsid variant according to any one of the preceding embodiments, comprising the amino acid sequence of SEQ ID NO: 138, or an amino acid sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 193. An AAV capsid variant according to any one of the preceding embodiments, comprising the amino acid sequence of SEQ ID NO: 138. 194. An AAV capsid variant according to any one of the preceding embodiments, comprising the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of the preceding embodiments, wherein the nucleotide sequence encoding the capsid variant comprises the nucleotide sequence of SEQ ID NO: 137, or a sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of the preceding embodiments, comprising a VP1 protein, a VP2 protein, a VP3 protein, or a combination thereof. The AAV capsid variant according to any one of Embodiments 1 to 196, comprising the amino acid sequence corresponding to VP2 at positions 138 to 736 of SEQ ID NO: 981, or a sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of Embodiments 1 to 197, comprising the amino acid sequence corresponding to VP3 at positions 203 to 736 of SEQ ID NO: 981, or a sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of Embodiments 1 to 198, comprising the amino acid sequence corresponding to VP2 at positions 138 to 736 of SEQ ID NO: 138, or a sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of Embodiments 1 to 199, comprising the amino acid sequence corresponding to VP3 at positions 203 to 736 of SEQ ID NO: 138, or a sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. Comprising an amino acid sequence comprising at least 3, 4, 5, 6, or 7 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (i) wherein the 3 consecutive amino acids comprise TQD, (ii) Four consecutive amino acids include TQDW (SEQ ID NO: 4684), (iii) Five consecutive amino acids include TQDWH (SEQ ID NO: 4685), (iv) Six consecutive amino acids include TQDWHR (SEQ ID NO: 4686) or (v) Seven consecutive amino acids include TQDWHRI (SEQ ID NO: 941), The AAV capsid variant is (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 981, (b) a VP2 protein comprising the amino acid sequence at positions 138 to 736 of SEQ ID NO: 138 or positions 138 to 736 of SEQ ID NO: 981, (c) a VP3 protein comprising the amino acid sequence at positions 203 to 736 of SEQ ID NO: 138 or positions 203 to 736 of SEQ ID NO: 981, or (d) an amino acid sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity with any one of the amino acid sequences in (a) to (c), the AAV capsid variant according to any one of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, 101 to 186, or 189 to 200. 202. Comprising an amino acid sequence containing at least 3, 4, 5, 6, 3, 4, 5, 6, or 7 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (i) Three consecutive amino acids include TQD, (ii) Four consecutive amino acids include TQDW (SEQ ID NO: 4684), (iii) Five consecutive amino acids include TQDWH (SEQ ID NO: 4685), (iv) Six consecutive amino acids include TQDWHR (SEQ ID NO: 4686) or (v) Seven consecutive amino acids include TQDWHRI (SEQ ID NO: 941), The AAV capsid variant according to any one of Embodiments 1-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, 101-186, or 189-201, wherein the AAV capsid variant comprises an amino acid sequence that is at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) identical to the amino acid sequence of SEQ ID NO: 981. The AAV capsid variant according to any one of Embodiments 11-3, 5-8, 10-16, 18-21, 23-39, 42-49, 51-69, 71-83, 85-99, 101-186, or 189-202, which contains 1 or 2, but no more than 3 substitutions with respect to the amino acid sequence of 203.TQDWHRI (SEQ ID NO: 941), and wherein the AAV capsid variant comprises an amino acid sequence that is at least 90% (e.g., at least 95, 96, 97, 98, or 99%) identical to the amino acid sequence of SEQ ID NO: 138 or SEQ ID NO: 981. The AAV capsid variant according to any one of Embodiments 1-203, which contains an amino acid sequence of any one of SEQ ID NO: 981 or an amino acid sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of Embodiments 1-204, which contains an amino acid sequence having at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), but no more than 30, 20, or 10 modifications, e.g., substitutions (e.g., conservative substitutions), with respect to the amino acid sequence of SEQ ID NO: 981. The AAV capsid variant according to any one of Embodiments 1-205, which contains an amino acid sequence having at least 1, 2, or 3, but no more than 30, 20, or 10 different amino acids with respect to the amino acid sequence of SEQ ID NO: 981. The AAV capsid variant according to any one of Embodiments 1 to 206, comprising the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of the preceding Embodiments 1 to 207, wherein the nucleotide sequence encoding the capsid variant comprises the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The AAV capsid variant according to any one of the preceding embodiments, wherein the nucleotide sequence encoding the capsid variant is codon-optimized. The AAV capsid variant (e.g., AAV9 capsid variant) comprising any one of the amino acid sequences of Embodiments 1 to 3, 5 to 8, 10 to 16, 18 to 21, 23 to 39, 42 to 49, 51 to 69, 71 to 83, 85 to 99, 101 to 186, or 189, further comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 981. The AAV capsid variant (e.g., AAV9 capsid variant) comprising the amino acid sequence of SEQ ID NO: 981. The AAV capsid variant (e.g., AAV9 capsid variant) comprising the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence that is at least 95% identical thereto. The AAV capsid variant (e.g., AAV9 capsid variant) comprising the amino acid sequence at positions 203 to 736 of SEQ ID NO: 981, or an amino acid sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto, wherein the AAV capsid variant is numbered according to SEQ ID NO: 981 and comprises amino acid T at position 584, amino acid D at position 586, amino acid W at position 587, amino acid H at position 588, amino acid R at position 589, and amino acid I at position 590. The AAV capsid variant according to embodiment 213, comprising the amino acid sequence at positions 203 to 736 of SEQ ID NO: 981. 215. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising the amino acid sequence at positions 203 to 736 of SEQ ID NO: 981. 216. The AAV capsid variant (e.g., an AAV9 capsid variant), comprising the amino acid sequence at positions 138 to 736 of SEQ ID NO: 981, or an amino acid sequence that is at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) identical thereto, and wherein the AAV capsid variant comprises amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 981. 217. The AAV capsid according to any one of embodiments 213 to 216, wherein the AAV capsid variant comprises the amino acid sequence at positions 138 to 736 of SEQ ID NO: 981. 218. An AAV capsid variant (e.g., an AAV9 capsid variant) comprising the amino acid sequence at positions 138 to 736 of SEQ ID NO: 981. 219. The AAV capsid variant (e.g., an AAV9 capsid variant), comprising the amino acid sequence of SEQ ID NO: 981, or an amino acid sequence that is at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) identical thereto, and wherein the AAV capsid variant comprises amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 981. 220. The AAV capsid according to any one of embodiments 213 to 219, wherein the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 981. 221. The AAV capsid variant according to any one of embodiments 1 to 220, having an increased tropism for CNS cells or tissues, such as brain cells, brain tissue, spinal cord cells, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138. Transduce brain regions, such as the sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, and cerebellum, and optionally measure, for example, by an assay as described in Example 2, such as an immunohistochemistry assay, or a qPCR or ddPCR assay, the level of transduction, which is at least 39, 50, 100, 120, 132, 146, 150, 161, 174, 175, 200, 225, 250, 275, 283, 300, 350, 400, 450, 500, 525, 528, or 550-fold greater compared to the reference sequence of SEQ ID NO: 138. An AAV capsid variant according to any one of Embodiments 1 to 221. For example, when measured by the assay described in Example 1 or 3, at least about 10, 14, 20, 24, 50, 100, 150, 200, 250, 300, 350, 400, 425, 450, or 460-fold enriched in the brain compared to the reference sequence of SEQ ID NO: 138. An AAV capsid variant according to any one of Embodiments 1 to 222. For example, when measured by the assay described in Example 1, at least about 200, 300, 400, 425, 450, or 460-fold enriched in the brain compared to the reference sequence of SEQ ID NO: 138. An AAV capsid variant according to any one of Embodiments 1 to 223. For example, at least 2 to 3 species, such as non-human primates and rodents (e.g., mice), enriched in the brain compared to the reference sequence of SEQ ID NO: 138. An AAV capsid variant according to any one of Embodiments 1 to 224. 226. When measured by an assay as described in Example 1 or 4, compared to the reference sequence of SEQ ID NO: 138, at least 2 to 3 species, for example, at least about 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 190, 200, 205, or 210-fold enriched in the brains of non-human primates and rodents (e.g., mice), the AAV capsid variant according to any one of Embodiments 1 to 225. 227. The AAV capsid variant according to Embodiment 225 or 226, wherein the at least 2 to 3 species are Macaca fascicularis, Chlorocebus sabaeus, Callithrix jacchus, and / or mice (e.g., outbred mice). 228. When measured by the assay described in Example 3, compared to the reference sequence of SEQ ID NO: 981, at least about 2, 3, 4, 5, 10, 15, 17, 20, 50, 75, 100, 103, 107, 125, 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1200-fold enriched in the brain, the AAV capsid variant according to any one of Embodiments 1 to 227. 229. Delivering an increased level of payload to a brain region, and optionally, when measured by an assay (e.g., as described in Example 2), such as a qRT-PCR, ddPCR, or qPCR assay, the level of the payload is at least 39, 50, 100, 120, 132, 146, 150, 161, 174, 175, 200, 225, 250, 275, 283, 300, 350, 400, 450, 500, 525, 528, or 550-fold increased compared to the reference sequence of SEQ ID NO: 138, the AAV capsid variant according to any one of Embodiments 1 to 228. 230. Delivery of an increased level of viral genome to a brain region, optionally, when the level of said viral genome is measured by an assay, for example, a qRT-PCR or qPCR assay (such as described in Example 2), is at least 2, 5, 7, 10, 15, 19, 20, 22, or 25-fold increased compared to the reference sequence of SEQ ID NO: 138, the AAV capsid variant according to any one of Embodiments 1 to 229. 231. The AAV capsid variant according to Embodiment 229 or 230, wherein the brain region is the sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, and / or cerebellum. 232. When measured by the assay described in Example 1 or 2, for example, at least about 5, 10, 50, 100, 115, 120, 150, 175, 200, 207, 225, 250, or 275-fold enriched in the spinal cord compared to the reference sequence of SEQ ID NO: 138, the AAV capsid variant according to any one of Embodiments 1 to 231. 233. The AAV capsid variant according to any one of the preceding embodiments, which is isolated, for example, a recombinant. 234. A polynucleotide encoding the AAV capsid variant according to any one of Embodiments 1 to 233. 235. (i) A nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 modifications, for example, substitutions, but no more than 10 modifications, for example, substitutions, with respect to the nucleotide sequence of SEQ ID NO: 942, (ii) A nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7, but no more than 10, different nucleotides with respect to the nucleotide sequence of SEQ ID NO: 942, or (iii) The nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence that is substantially identical thereto (for example, having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), the polynucleotide according to Embodiment 234. The polynucleotide according to embodiment 234 or 235, comprising the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. The polynucleotide according to any one of embodiments 234 to 236, comprising a codon-optimized nucleotide sequence. 238. A peptide, (a) an amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 14, 15 or 16, (b) an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 14, 15 or 16, (c) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 14, 15 or 16, or (d) the peptide, comprising an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 14, 15 or 16. 239. A peptide, (a) an amino acid sequence of any one of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, (b) An amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, (c) An amino acid sequence containing at least 1, 2, or 3 but 4 or fewer different amino acids relative to the amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, or (d) An amino acid sequence containing at least 1, 2, or 3 but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336, The peptide comprising the above. 240. A peptide, (i) The amino acid sequence of TQDWHRI (SEQ ID NO: 941), (ii) An amino acid sequence containing at least 1, 2, or 3 but 4 or fewer different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (iii) An amino acid sequence containing at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), but 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), or (iv) The peptide comprising at least 3, 4, 5, or 6 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941). 241. A peptide, (i) The nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), (ii) A nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7, but no more than 10, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942, or (iii) The peptide encoded by a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but no more than 10 modifications, e.g., substitutions, relative to the nucleotide sequence of SEQ ID NO: 942. 242. The nucleotide sequence encoding the peptide is (i) The nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), (ii) A nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7, but no more than 10, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942, or (iii) The peptide comprising a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but no more than 10 modifications, e.g., substitutions, relative to the nucleotide sequence of SEQ ID NO: 942. 243. A peptide comprising an amino acid sequence having the following formula: [N1]-[N2]-[N3] according to any one of Embodiments 1 - 4, 7 - 22, 28 - 40, 43 - 51, 54, 55, 58 - 66, 72 - 82, 87 - 94, or 125 - 129. 244. The peptide according to any one of Embodiments 238 - 243, which is fused or conjugated, e.g., conjugated, to an active agent, e.g., a therapeutic or diagnostic agent. At least 1 to 5, for example, at least 1, 2, 3, 4, or 5 peptides are fused to or conjugated to, for example, conjugated to an active agent, such as a therapeutic agent or a diagnostic agent, the peptide according to any one of embodiments 238 to 244. 246. At least 1 to 5, for example, at least 1, 2, 3, 4, or 5 peptides, the peptide according to embodiment 245, which contain the same amino acid sequence. 247. At least 1 to 5, for example, at least 1, 2, 3, 4, or 5 peptides, the peptide according to embodiment 245, which contain different amino acid sequences. 248. At least 1 to 5, for example, at least 1, 2, 3, 4, or 5 peptides are present in tandem (for example, directly or indirectly connected via a linker) or in a multimeric configuration, the peptide according to any one of embodiments 245 to 247. 249. The peptide according to any one of embodiments 238 to 248, wherein the peptide contains an amino acid sequence that is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, or 35 amino acids in length. 250. The active agent is a therapeutic agent selected from proteins (such as enzymes), antibody molecules, nucleic acid molecules (such as RNAi agents), or small molecules, or contains them, the peptide according to any one of embodiments 244 to 249. 251. The active agent is a ribonucleic acid complex (such as a Cas9 / gRNA complex), a plasmid, a closed-end DNA, a circ-RNA, or an mRNA, or contains them, the peptide according to any one of embodiments 244 to 249. 252. The active agent is an RNAi agent, the peptide according to any one of embodiments 244 to 249. The peptide according to embodiment 252, wherein the RNAi agent is dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, an antisense oligonucleotide agent (ASO), or snoRNA, optionally, the RNAi agent is siRNA or ASO, and further optionally, the peptide comprises at least one modified nucleotide. The peptide according to any one of embodiments 244 to 253, wherein the active agent regulates, for example, inhibits, decreases, or increases the expression of a CNS-related gene, mRNA, and / or protein. The peptide according to any one of embodiments 244 to 249, wherein the active agent is a diagnostic agent, an imaging agent (for example, a protein or a small molecule compound bound to a detectable moiety), or comprises the same. The peptide according to any one of embodiments 244 to 255, wherein the peptide is covalently bound to the active agent directly or indirectly, for example, via a linker. The peptide according to any one of embodiments 244 to 256, wherein the peptide is conjugated to the active agent via a linker. The peptide according to embodiment 257, wherein the linker is a cleavable linker or a non-cleavable linker. The peptide according to embodiment 258, wherein the cleavable linker is a pH-sensitive linker or an enzyme-sensitive linker. 260. (i) The pH-sensitive linker comprises a hydrazine / hydrazone linker or a disulfide linker, (ii) The enzyme-sensitive linker comprises a peptide-based linker, for example, a peptide linker sensitive to a protease (for example, a lysosomal protease), or a beta-glucuronide linker, or (iii) The non-cleavable linker is a linker comprising a thioether group or a maleimidocaproyl group. The peptide according to embodiment 258 or 259. 261. (i) The peptide and the active agent are fused or conjugated after translation, for example, using click chemistry, or (ii) The peptide according to any one of embodiments 244 to 260, wherein the peptide and the active agent are fused or conjugated via chemically induced dimerization. 262. The peptide according to any one of embodiments 244 to 261, wherein the peptide is present at the N-terminus relative to the active agent. 263. The peptide according to any one of embodiments 244 to 261, wherein the peptide is present at the C-terminus relative to the active agent. 264. The peptide according to any one of embodiments 244 to 249, 254, or 256 to 263, wherein the peptide is present in or bound to a carrier, such as an exosome, a microvesicle, or a lipid nanoparticle (LNP), and optionally, the carrier comprises a therapeutic agent (e.g., an RNAi agent (e.g., dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, an antisense oligonucleotide agent (ASO), or snoRNA), an mRNA, a ribonucleoprotein complex (e.g., a Cas9 / gRNA complex), or a circular RNA). 265. The peptide according to embodiment 264, wherein the peptide is present on the surface of the carrier, and optionally, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the surface of the carrier comprises at least 1 to 5 peptides, such as at least 1, 2, 3, 4, or 5 peptides, according to any one of embodiments 422 to 436. 266. An AAV capsid variant comprising the peptide according to any one of embodiments 238 to 243. 267. A polynucleotide encoding an AAV capsid variant (e.g., an AAV9 capsid variant), wherein (a) an amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, (b) An amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, (c) An amino acid sequence comprising at least 1, 2, or 3 but no more than 4 different amino acids relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, or (d) An amino acid sequence comprising at least 1, 2, or 3 but no more than 4 modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, Optionally, (i) The amino acid sequence of (a), (b), (c), and / or (d) replaces the positions of T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and / or V596 numbered according to the amino acid sequence of SEQ ID NO: 138, or (ii) The polynucleotide corresponding to the positions of T582, N583, T584, Q585, D586, W587, H588, R589, I590, A591, Q592, T593, G594, W595, and / or V596 of SEQ ID NO: 981, wherein the amino acid sequence of (a), (b), (c), and / or (d) 268. A polynucleotide encoding an AAV capsid variant (e.g., an AAV9 capsid variant), wherein the AAV capsid variant (i) has the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (ii) has an amino acid sequence comprising at least 1, 2, or 3 but no more than 4 different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (iii) An amino acid sequence that has at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), but contains 4 or fewer modifications, such as substitutions (e.g., conservative substitutions), or (iv) Contains at least 3, 4, 5, or 6 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941), Optionally, (a) The amino acid sequence of (i), (ii), (iii), and / or (iv) replaces the positions of H584, Q585, S586, A587, Q588, A589, and / or Q590 numbered according to the amino acid sequence of SEQ ID NO: 138, (b) The polynucleotide wherein the amino acid sequence of (i), (ii), (iii), and / or (iv) corresponds to the positions of T584, Q585, D586, W587, H588, R589, and / or I590 of SEQ ID NO: 981. 269. (i) The nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), (ii) A nucleotide sequence that has at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, to the nucleotide sequence of SEQ ID NO: 942, but contains 10 or fewer modifications, such as substitutions, (iii) A nucleotide sequence that has at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, to the nucleotide sequence of SEQ ID NO: 942, but contains 10 or fewer modifications, such as substitutions, and is the polynucleotide according to Embodiment 267 or 268. 270. The AAV capsid variant is (i) The amino acid sequence of SEQ ID NO: 981, or an amino acid sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto, (ii) an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of SEQ ID NO: 981, or (iii) an amino acid sequence having at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 981, but 30, 20, or 10 or fewer modifications, such as substitutions (e.g., conservative substitutions), the polynucleotide according to any one of Embodiments 267 to 269. 271. The polynucleotide according to any one of Embodiments 267 to 270, comprising the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 80% (e.g., at least 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. 272. An isolated, e.g., recombinant, polynucleotide, peptide, or AAV capsid variant according to any one of Embodiments 1 to 272. 273. An AAV particle comprising an AAV capsid variant according to any one of Embodiments 1 to 233, 266, or 272, an AAV capsid variant comprising a peptide according to any one of Embodiments 238 to 243 or 272, or an AAV capsid variant encoded by a polynucleotide according to any one of Embodiments 234 to 237 or 267 to 272. 274. The AAV particle according to Embodiment 273, comprising a nucleotide sequence encoding a payload. 275. The AAV particle according to Embodiment 274, wherein the encoded payload comprises a therapeutic protein or a functional variant thereof, an antibody or antibody fragment, an enzyme, a component of a gene editing system, an RNAi agent (e.g., dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA), or a combination thereof. 276. The AAV particles of embodiment 275, wherein the therapeutic protein or a functional variant thereof, such as a recombinant protein, is associated with (e.g., abnormally expressed in) a neuropathy or neurodegenerative disorder, a muscle disorder or neuromuscular disorder, or a neuro-oncological disorder. 277. The AAV particles of embodiment 275 or 276, wherein the therapeutic protein or a functional variant thereof is selected from apolipoprotein E (APOE) (e.g., ApoE2, ApoE3, and / or ApoE4), human survival motor neuron (SMN) 1 or SMN2, glucocerebrosidase (GBA1), aromatic L-amino acid decarboxylase (AADC), aspartoacylase (ASPA), tripeptidyl peptidase I (CLN2), beta-galactosidase (GLB1), N-sulphoglucosamine sulphonohydrolase (SGSH), N-acetyl-alpha-glucosaminidase (NAGLU), iduronate 2-sulphatase (IDS), intracellular cholesterol transporter (NPC1), gigaxonin (GAN), or a combination thereof. 278. The base antibody or antibody binding fragment is (i) a CNS-related target, such as an antigen associated with a neuropathy or neurodegenerative disorder, such as beta-amyloid, APOE, tau, SOD1, TDP-43, huntingtin (HTT), and / or synuclein, (ii) a muscle or neuromuscular-related target, such as an antigen associated with a muscle disorder or neuromuscular disorder, or (iii) binds to a neuro-oncology-related target, such as an antigen associated with a neuro-oncological disorder, such as HER2, or EGFR (e.g., EGFRvIII), the AAV particles of embodiment 275. 279. The AAV particles of embodiment 275, wherein the enzyme comprises a meganuclease, zinc finger nuclease, TALEN, recombinase, integrase, base editor, Cas9, or a fragment thereof. 280. The AAV particles of embodiment 275, wherein the components of the gene editing system comprise one or more components of the CRISPR-Cas system. One or more components of the CRISPR-Cas system include Cas9, e.g., a Cas9 ortholog or Cpf1, and a single guide RNA (sgRNA), optionally, (i) the sgRNA is located upstream (5') of the cas9 enzyme, or (ii) the sgRNA is located downstream (3') of the cas9 enzyme, the AAV particle according to embodiment 275 or 280. 282. The RNAi agent (e.g., dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA) regulates, e.g., inhibits, the expression of a CNS-related gene, mRNA, and / or protein, the AAV particle according to embodiment 275. 283. The CNS-related gene is selected from SOD1, MAPT, APOE, HTT, C9ORF72, TDP-43, APP, BACE, SNCA, ATXN1, ATXN3, ATXN7, SCN1A to SCN5A, SCN8A to SCN11A, or a combination thereof, the AAV particle according to embodiment 282. 284. An AAV particle according to any one of embodiments 273 to 283, comprising a viral genome comprising a promoter operably linked to a nucleic acid sequence encoding a payload. 285. The AAV particles according to embodiment 284, wherein the promoter is selected from human elongation factor 1α-subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken β-actin (CBA) and its derivative CAG, β-glucuronidase (GUSB), or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β), intercellular adhesion molecule 2 (ICAM-2), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or heavy chain (NFH), β-globin mini gene nβ2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoter (e.g., αMHC, cTnT, and CMV-MLC2k), liver promoter (e.g., hAAT, TBG), skeletal muscle promoter (e.g., desmin, MCK, C512) or a fragment thereof, e.g., a truncated form, or a functional variant thereof. 286. The AAV particles according to embodiment 284 or 285, wherein the promoter is an EF-1a promoter variant, e.g., a truncated EF-1a promoter. 287. The promoter is any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998 - 1007, or any one of the nucleotide sequences provided in Table 8, a nucleotide sequence having at least 1, 2, or 3, but 4 or less modifications, such as substitutions (e.g., conservative substitutions), for any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999 - 1007, or any one of the sequences provided in Table 8, or a nucleotide sequence having at least 80% (e.g., 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity with any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999 - 1007, or any one of the sequences provided in Table 8, the AAV particle according to any one of Embodiments 284 - 286. 288. The viral genome further includes a polyA signal sequence, the AAV particle according to any one of Embodiments 284 - 287. 289. The viral genome further includes an inverted terminal repeat (ITR) sequence, the AAV particle according to any one of Embodiments 284 - 288. 290. The viral genome includes an ITR sequence located 5' to the encoded payload, the AAV particle according to any one of Embodiments 284 - 289. 291. The viral genome includes an ITR sequence located 3' to the encoded payload, the AAV particle according to any one of Embodiments 284 - 290. 292. The viral genome includes an ITR sequence located at the 5' position with respect to the encoded payload and an ITR sequence located at the 3' position with respect to the encoded payload, the AAV particle according to any one of Embodiments 284 - 291. 293. The viral genome further includes an enhancer, Kozak sequence, intron region, and / or exon region, the AAV particle according to any one of Embodiments 284 - 292. 294. The AAV particle according to any one of embodiments 284 to 293, wherein the viral genome further comprises a nucleotide sequence encoding a miR binding site, such as a miR binding site that regulates, for example, reduces the expression of an antibody molecule encoded by the viral genome in a cell or tissue in which the corresponding miRNA is expressed. 295. The AAV particle according to embodiment 294, wherein the encoded miRNA binding site is complementary, such as fully or partially complementary, to a miRNA expressed in a cell or tissue of DRG, liver, heart, hematopoiesis, or a combination thereof. 296. The AAV particle according to embodiment 294 or 295, wherein the encoded miR binding site regulates, for example, reduces the expression of an antibody molecule encoded in a cell or tissue of DRG, liver, heart, hematopoietic system, or a combination thereof. 297. The AAV particle according to any one of embodiments 284 to 296, wherein the viral genome comprises at least 1 to 5 copies, such as at least 1, 2, 3, 4, or 5 copies of the encoded miR binding site. 298. The AAV particle according to any one of embodiments 284 to 297, wherein the viral genome comprises at least 3 copies of the encoded miR binding site, and optionally, all three copies contain the same miR binding site, or at least 1, 2, 3, or all of the copies contain different miR binding sites. 299. The AAV particle according to embodiment 298, wherein the three copies of the encoded miR binding site are contiguous (e.g., not separated by a spacer), or are separated by a spacer, and optionally, the spacer comprises a nucleotide sequence of GATAGTTA, or has at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), but has 4 or fewer modifications, such as substitutions (e.g., conservative substitutions) with respect to GATAGTTA. 300. The AAV particle according to any one of embodiments 284 to 299, wherein the viral genome contains at least 4 copies of the encoded miR binding site, and optionally, all 4 copies contain the same miR binding site, or at least 1, 2, 3, or all of the copies contain different miR binding sites. 301. The AAV particle according to embodiment 300, wherein the 4 copies of the encoded miR binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer, and optionally, the spacer contains the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, relative to GATAGTTA, but having 4 or fewer modifications, e.g., substitutions. 302. The encoded miR binding site contains a miR122 binding site, a miR183 binding site, a miR1 binding site, miR142-3p, or a combination thereof, and optionally, (i) the encoded miR122 binding site contains the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, relative to SEQ ID NO: 4673, but having 10 or fewer modifications, e.g., substitutions, (ii) the encoded miR183 binding site contains the nucleotide sequence of SEQ ID NO: 4676, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, relative to SEQ ID NO: 4676, but having 10 or fewer modifications, e.g., substitutions, (iii) the encoded miR1 binding site comprises the nucleotide sequence of SEQ ID NO: 4679, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, to SEQ ID NO: 4679, but having 10 or fewer modifications, e.g., substitutions, and / or (iv) the encoded miR142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 4675, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, to SEQ ID NO: 4675, but having 10 or fewer modifications, e.g., substitutions; the AAV particle according to any one of embodiments 294 to 301. 303. The AAV particle according to any one of embodiments 284 to 2302, wherein the viral genome comprises an encoded miR122 binding site. 304. The viral genome comprises at least 1 to 5 copies, e.g., 1, 2, or 3 copies, of the miR122 binding site, optionally, each copy is contiguous (e.g., not separated by a spacer), or each copy is separated by a spacer, optionally, the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, to GATAGTTA, but having 4 or fewer modifications, e.g., substitutions; the AAV particle according to any one of embodiments 284 to 303. The encoded miR122 binding site is the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, to SEQ ID NO: 4673, but having 10 or fewer modifications, e.g., substitutions, and the AAV particle according to embodiment 303 or 304. 306. The viral genome is (A) (i) a first encoded miR122 binding site comprising the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, to SEQ ID NO: 4673, but having 10 or fewer modifications, e.g., substitutions, (ii) a first spacer comprising the nucleotide sequence of GATAGTTA or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, to GATAGTTA, but having 4 or fewer modifications, e.g., substitutions, and (iii) a second encoded miR122 binding site comprising the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, to SEQ ID NO: 4673, but having 10 or fewer modifications, e.g., substitutions, or (B)(i) The first encoded miR122 binding site comprising the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but having 10 or fewer modifications, e.g., substitutions, relative to SEQ ID NO: 4673, (ii) The first spacer comprising the nucleotide sequence of GATAGTTA or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, but having 4 or fewer modifications, e.g., substitutions, relative to GATAGTTA, (iii) The second encoded miR122 binding site comprising the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but having 10 or fewer modifications, e.g., substitutions, relative to SEQ ID NO: 4673, (iv) The second spacer comprising the nucleotide sequence of GATAGTTA or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, but having 4 or fewer modifications, e.g., substitutions, relative to GATAGTTA, and (v) An AAV particle according to any one of embodiments 284 to 305, comprising the third encoded miR122 binding site comprising the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but having 10 or fewer modifications, e.g., substitutions, relative to SEQ ID NO: 4673. The AAV particle according to any one of embodiments 284 to 306, wherein the viral genome comprises the encoded miR183 binding site. 308. The AAV particle according to any one of embodiments 284 to 307, wherein the viral genome comprises at least 1 to 5 copies, such as 1, 2, or 3 copies of the miR183 binding site, and optionally, each copy is continuous (e.g., not separated by a spacer), or each copy is separated by a spacer, and optionally, the spacer comprises the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, such as substitutions, but 4 or fewer modifications, such as substitutions, relative to GATAGTTA. 309. The AAV particle according to embodiment 307 or 308, wherein the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, but 10 or fewer modifications, such as substitutions, relative to SEQ ID NO: 4673. 310. The viral genome is (A) (i) a first encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 4676, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, but 10 or fewer modifications, such as substitutions, relative to SEQ ID NO: 4676, (ii) a first spacer comprising the nucleotide sequence of GATAGTTA or a nucleotide sequence having at least 1, 2, or 3 modifications, such as substitutions, but 4 or fewer modifications, such as substitutions, relative to GATAGTTA, and (iii) a second encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 4676, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but 10 or fewer modifications, e.g., substitutions, with respect to SEQ ID NO: 4676, or (B)(i) a first encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 4676, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but 10 or fewer modifications, e.g., substitutions, with respect to SEQ ID NO: 4676, (ii) a first spacer comprising the nucleotide sequence of GATAGTTA or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, but 4 or fewer modifications, e.g., substitutions, with respect to GATAGTTA, (iii) a second encoded miR183 binding site comprising the nucleotide sequence of SEQ ID NO: 4676, or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but 10 or fewer modifications, e.g., substitutions, with respect to SEQ ID NO: 4676, (iv) a second spacer comprising the nucleotide sequence of GATAGTTA or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, but 4 or fewer modifications, e.g., substitutions, with respect to GATAGTTA, and (v) The AAV particle according to any one of embodiments 284 to 309, comprising a third encoded miR183 binding site, which comprises a nucleotide sequence of SEQ ID NO: 4676 or a nucleotide sequence substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, but no more than 10 modifications, e.g., substitutions, with respect to SEQ ID NO: 4676. 311. The AAV particle according to any one of embodiments 284 to 310, wherein the viral genome comprises an encoded miR122 binding site and miR1 binding site. 312. The AAV particle according to any one of embodiments 284 to 311, wherein the viral genome is single-stranded or self-complementary. 313. The AAV particle according to any one of embodiments 284 to 312, wherein the viral genome further comprises a nucleotide sequence encoding a Rep protein, e.g., a non-structural protein, and the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein (e.g., a Rep78 protein and a Rep52 protein). 314. The AAV particle according to any one of embodiments 284 to 313, wherein the AAV particle further comprises a nucleotide sequence encoding a Rep protein, e.g., a non-structural protein, and the Rep protein comprises a Rep78 protein, a Rep68 protein, a Rep52 protein, and / or a Rep40 protein (e.g., a Rep78 protein and a Rep52 protein). 315. The AAV particle according to embodiment 313 or 314, wherein the Rep78 protein, Rep68 protein, Rep52 protein, and / or Rep40 protein is encoded by at least one Rep gene. The AAV particle according to any one of Embodiments 284 to 315, wherein the viral genome further comprises a nucleic acid sequence encoding an AAV capsid variant described in any one of Embodiments 1 to 212, 222, or 228, an AAV capsid variant comprising a peptide described in any one of Embodiments 217 to 221 or 228, or an AAV capsid variant encoded by a polynucleotide described in any one of Embodiments 213 to 216 or 223 to 228. The AAV particle according to any one of Embodiments 273 to 316, which is isolated, for example, a recombinant. A vector comprising a polynucleotide encoding an AAV capsid variant described in any one of Embodiments 1 to 233, 266, or 272, a polynucleotide described in any one of Embodiments 234 to 237 or 267 to 272, or a polynucleotide encoding a peptide described in any one of Embodiments 238 to 243 or 272. A cell, for example, a host cell, comprising an AAV capsid variant described in any one of Embodiments 1 to 233, 266, or 272, a polynucleotide described in any one of Embodiments 234 to 237 or 267 to 272, a peptide described in any one of Embodiments 238 to 243 or 272, an AAV particle described in any one of Embodiments 273 to 317, or a vector described in Embodiment 318. The cell according to Embodiment 319, wherein the cell is a mammalian cell or an insect cell. The cell according to Embodiment 319 or 320, wherein the cell is a cell in a brain region or a spinal cord region, optionally, a cell in the sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, or cerebellum. A method for producing an AAV particle, comprising: (i) providing a host cell comprising a viral genome; (ii) incubating the host cell under conditions suitable for encapsulating the viral genome into an AAV capsid variant described in any one of Embodiments 1 to 233, 266, or 272, an AAV capsid variant containing a peptide described in any one of Embodiments 238 to 243 or 272, or an AAV capsid variant encoded by a polynucleotide described in any one of Embodiments 234 to 237 or 267 to 272, thereby producing the AAV particles, the method. 323. The method according to Embodiment 322, further comprising introducing a first nucleic acid molecule containing a viral genome into a host cell before step (i). 324. The method according to Embodiment 323, wherein the host cell contains a second nucleic acid encoding a capsid variant. 325. The method according to Embodiment 324, wherein the second nucleic acid molecule is introduced into the host cell before, simultaneously with, or after the first nucleic acid molecule. 326. A pharmaceutical composition comprising an AAV particle described in any one of Embodiments 273 to 317, an AAV particle containing a capsid variant described in any one of Embodiments 1 to 233, 266, or 272, an AAV particle containing a peptide described in any one of Embodiments 238 to 243, or 272, and a pharmaceutically acceptable excipient. 327. A method for delivering a payload to a cell or tissue (e.g., a CNS cell or CNS tissue), the method comprising administering an effective amount of the pharmaceutical composition described in Embodiment 326, an AAV particle described in any one of Embodiments 273 to 317, an AAV particle containing a capsid variant described in any one of Embodiments 1 to 233, 266, or 272, or an AAV particle containing a peptide described in any one of Embodiments 238 to 243 or 272. 328. The method according to Embodiment 327, wherein the cell is a cell in a brain region or spinal cord region, optionally a cell in the prefrontal cortex, sensory cortex, motor cortex, caudate nucleus, cerebellar cortex, cerebral cortex, brainstem, hippocampus, or thalamus. The method according to embodiment 327 or 328, wherein the cell is a neuron, a sensory neuron, and / or a motor neuron. The method according to any one of embodiments 327 to 329, wherein the cell or tissue is within a subject. The method according to embodiment 330, wherein the subject has, is diagnosed as having, or is at risk of having a genetic disorder, such as a monogenic disorder or a polygenic disorder. The method according to embodiment 330 or 331, wherein the subject has, is diagnosed as having, or is at risk of having a neuropathy, such as a neurodegenerative disorder. The method according to embodiment 330 or 331, wherein the subject has, is diagnosed as having, or is at risk of having a neuro-oncological disorder. The method according to embodiment 330 or 331, wherein the subject has, is diagnosed as having, or is at risk of having a myopathy or a neuromuscular disorder. A method of treating a subject having or diagnosed as having a genetic disorder, such as a monogenic disorder or a polygenic disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition according to embodiment 326, an AAV particle according to any one of embodiments 273 to 317, an AAV particle comprising a capsid variant according to any one of embodiments 1 to 233, 266, or 272, or an AAV particle comprising a peptide according to any one of embodiments 238 to 243 or 272. A method of treating a subject having or diagnosed as having a neuropathy, such as a neurodegenerative disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition according to embodiment 326, an AAV particle according to any one of embodiments 273 to 317, an AAV particle comprising a capsid variant according to any one of embodiments 1 to 233, 266, or 272, or an AAV particle comprising a peptide according to any one of embodiments 238 to 243 or 272. A method of treating a subject having or diagnosed with a tendon disorder or neuromuscular disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition according to Embodiment 326, the AAV particles according to any one of Embodiments 273-317, the AAV particles comprising a capsid variant according to any one of Embodiments 1-233, 266, or 272, or the AAV particles comprising a peptide according to any one of Embodiments 238-243 or 272. A method of treating a subject having or diagnosed with a neurological tumor disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition according to Embodiment 326, the AAV particles according to any one of Embodiments 273-317, the AAV particles comprising a capsid variant according to any one of Embodiments 1-233, 266, or 272, or the AAV particles comprising a peptide according to any one of Embodiments 238-243 or 272. The method according to any one of Embodiments 287-294, wherein the genetic disorder, the neurological disorder, the neurodegenerative disorder, the tendon disorder, the neuromuscular disorder, or the neurological tumor disorder is Huntington's disease, amyotrophic lateral sclerosis (ALS), Gaucher's disease, dementia with Lewy bodies, Parkinson's disease, spinal muscular atrophy, Alzheimer's disease, leukodystrophy (e.g., Alexander's disease, autosomal dominant leukodystrophy with autonomic disease (ADLD), Canavan disease, cerebrotendinous xanthomatosis (CTX), metachromatic leukodystrophy (MLD), Pelizaeus-Merzbacher disease, or Refsum disease), or cancer (e.g., HER2 / neu positive cancer or glioblastoma). The method according to any one of Embodiments 335-339, wherein treating comprises preventing progression of the disease or disorder in the subject. The method according to Embodiments 330-340, wherein the subject is a human. The method according to any one of Embodiments 330-341, wherein the AAV particles or the pharmaceutical composition are administered to the subject intravenously, via intracisternal injection (ICM), intracranially, intrathecally, intraventricularly, via parenchymal administration, intraarterially, or intramuscularly. 343. The method according to any one of embodiments 330-342, wherein the AAV particles or pharmaceutical composition are administered to the subject via focused ultrasound (FUS), for example, in combination with intravenous administration of microbubbles (FUS-MB), or via MRI-guided FUS in combination with intravenous administration. 344. The method according to any one of embodiments 330-343, wherein the AAV particles or pharmaceutical composition are administered intravenously to the subject. 345. The method according to any one of embodiments 330-344, wherein the AAV particles or pharmaceutical composition are administered to the subject via intracisternal injection (ICM). 346. The method according to any one of embodiments 330-345, wherein the AAV particles or pharmaceutical composition are administered intraarterially to the subject. 347. The method according to any one of embodiments 342-346, wherein administration of the AAV particles or pharmaceutical composition results in a decrease in the presence, level, and / or activity of a gene, mRNA, protein, or combination thereof. 348. The method according to any one of embodiments 342-346, wherein administration of the AAV particles or pharmaceutical composition results in an increase in the presence, level, and / or activity of a gene, mRNA, protein, or combination thereof. 349. A pharmaceutical composition according to embodiment 326, an AAV particle according to any one of embodiments 273-317, an AAV particle comprising a capsid variant according to any one of embodiments 1-233, 266, or 272, or an AAV particle comprising a peptide according to any one of embodiments 238-243 or 272 for use in a method of delivering a payload to a cell or tissue. 350. A pharmaceutical composition according to embodiment 326, an AAV particle according to any one of embodiments 273-317, an AAV particle comprising a capsid variant according to any one of embodiments 1-233, 266, or 272, or an AAV particle comprising a peptide according to any one of embodiments 238-243 or 272 for use in a method of treating a genetic disorder, neuropathy, neurodegenerative disorder, myopathy, neuromuscular disorder, or neuro-oncological disorder. For use in the manufacture of a medicament, the pharmaceutical composition according to embodiment 326, the AAV particles according to any one of embodiments 273 to 317, the AAV particles comprising a capsid variant according to any one of embodiments 1 to 233, 266, or 272, or the AAV particles comprising a peptide according to any one of embodiments 238 to 243, or 272. Use in the manufacture of a medicament of the pharmaceutical composition according to embodiment 326, the AAV particles according to any one of embodiments 273 to 317, the AAV particles comprising a capsid variant according to any one of embodiments 1 to 233, 266, or 272, or the AAV particles comprising a peptide according to any one of embodiments 238 to 243, or 272. Use in the manufacture of a medicament for treating a genetic disorder, a neuropathy, a neurodegenerative disorder, a myopathy, a neuromuscular disorder, or a neuro-oncological disorder of the pharmaceutical composition according to embodiment 326, the AAV particles according to any one of embodiments 273 to 317, the AAV particles comprising a capsid variant according to any one of embodiments 1 to 233, 266, or 272, or the AAV particles comprising a peptide according to any one of embodiments 238 to 243, or 272.
[0040] Details of one or more embodiments of the present disclosure are set forth in the following description which is appended hereto. Other features, objects, and advantages of the present disclosure will become apparent from the specification. In this specification, the singular forms also include the plural forms unless the context clearly dictates otherwise. Specific terms are defined in the Definitions section and throughout.
Mode for Carrying Out the Invention
[0041] Described herein are, inter alia, AAV capsid variants, e.g., compositions comprising the AAV capsid variants described herein, as well as methods of making and using them. Generally, AAV capsid variants have enhanced tropism for delivery of a payload to a cell or tissue, e.g., the cell or tissue, e.g., CNS tissue or CNS cells or hepatocytes or liver tissue.
[0042] As shown in the following examples, certain AAV capsid variants described herein exhibit multiple advantages over wild-type AAV9, including (i) increased penetration through the blood-brain barrier after intravenous administration, (ii) a broader distribution across multiple brain regions, such as the prefrontal cortex, sensory cortex, motor cortex, putamen, thalamus, cerebellar cortex, dentate nucleus, caudate nucleus, and / or the entire hippocampus, and / or (iii) increased expression of the payload in multiple brain regions. Without wishing to be bound by theory, these advantages may be due, in part, to seeding of the AAV capsid variant through the cerebrovascular system. In some embodiments, the AAV capsids described herein enhance delivery of the payload to multiple regions of the brain, including, for example, the prefrontal cortex, sensory cortex, motor cortex, putamen, thalamus, cerebellar cortex, dentate nucleus, caudate nucleus, and / or the hippocampus.
[0043] Several approaches have previously been used to produce AAV capsids with enhanced tropism for cells or tissues, such as CNS cells or tissues. One approach used co-infection with adenovirus in cultured cells (Grimm et al. In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses. J. Virol. 2008 June 82(12):5887-5911, the content of which is incorporated herein by reference in its entirety), or animal tissues within the system (Lisowski et al. Selection and evaluation of clinically relevant AAV variants in a xenograft liver model. Nature 2014 506:382-386, the content of which is incorporated herein by reference in its entirety) to cause exponential replication of infectious AAV DNA. Another approach involved using cell-specific CRE transgenic mice (Deverman et al. Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain. Nat Biotechnol. 2016 Feb. 34(2)204-209 (this content is incorporated herein by reference in its entirety)), which enabled specific viral DNA recombination in astrocytes, followed by recovery of CRE-recombinant capsid variants. Other approaches applied high-throughput DNA synthesis, multiplexing, sequencing technologies, and machine learning to evaluate sequencing reads of viral DNA in different tissues and engineer variant capsids. These approaches are different from the approach disclosed herein.
[0044] There are several limitations to the capsid generation methods known in the art. For example, the transgenic CRE system used by Deverman et al. (2016) is difficult to handle in other animal species, and AAV variants selected by directed evolution in mouse tissues do not exhibit similar properties in large animals. The transduction-specific approaches described above are not suitable for large animal studies for the following reasons: 1) many of the tissues of interest (e.g., CNS) are not readily accessible to adenovirus co-infection, 2) the specific adenovirus tropism itself biases the library distribution, and 3) large animals typically do not adapt to transgenesis or genetic manipulation and do not express CRE recombinase in defined cell types.
[0045] To address these limitations, a broadly applicable functional AAV capsid library screening platform for cell type-specific biopanning in non-transgenic animals has been developed and is described in the accompanying examples. In the TRACER (Tropism Redirection of AAV by Cell type-specific Expression of RNA) platform system, the capsid gene is placed under the control of a cell type-specific promoter and drives the expression of capsid mRNA in the absence of co-infection with helper virus. Without wishing to be bound by theory, this RNA-guided selection is thought to increase the selective pressure in favor of capsid variants that transduce a particular cell type. The TRACER platform enables the generation of AAV capsid libraries without the need for transgenic animals or co-infection with helper virus, thereby achieving specific recovery and subcloning of capsid mRNA expressed in transduced cells. Without wishing to be bound by theory, since mRNA transcription is characteristic of complete transduction, the methods disclosed herein enable the identification of fully infectious AAV capsid variants and, in addition to its higher stringency, this method is designed to express CAP mRNA under the control of any cell type-specific promoter, such as, but not limited to, the synapsin-1 promoter (neurons), the GFAP promoter (astrocytes), the TBG promoter (liver), the CAMK promoter (skeletal muscle), the MYH6 promoter (cardiomyocytes), etc., and is thought to enable the identification of capsids with high tropism for a particular cell type using libraries designed to do so. Described herein are, for example, novel AAV capsid variants generated using the TRACER method that have been shown to enhance tropism for CNS cells, CNS tissue, hepatocytes, liver tissue, muscle cells, or muscle tissue.
[0046] In some embodiments, the AAV capsid variants disclosed herein include modifications at positions 580-599, for example, positions 584, 586, 587, 588, 589, and / or 590, numbered according to, for example, SEQ ID NO: 138 or 981, in loop VIII of AAV9. In some embodiments, a loop (e.g., loop VIII) is used interchangeably herein with the terms variable region (e.g., variable region VIII), or VR (e.g., VR-VIII). In some embodiments, loop VIII includes positions 580-599 (e.g., amino acids VATNHQSAQAQAQTGWVQNQ (SEQ ID NO: 5122)), numbered according to SEQ ID NO: 138. In some embodiments, loop VIII includes positions 582-593 (e.g., amino acids TNHQSAQAQAQT (SEQ ID NO: 5123)), numbered according to SEQ ID NO: 138. In some embodiments, loop VIII includes positions 587-593 (e.g., amino acids AQAQAQT (SEQ ID NO: 4687)), numbered according to SEQ ID NO: 138. In some embodiments, loop VIII includes positions 587-590 (e.g., amino acids AQAQ (SEQ ID NO: 5099)), numbered according to SEQ ID NO: 138. In some embodiments, loop VIII or variable region VIII (VR-VIII) is as described in DiMattia et al. “Structural Insights into the Unique Properties of the Adeno-Associated Virus Serotype 9,” Journal of Virology, 12(86):6947-6958 (the entire content of which is incorporated herein by reference), and includes, for example, positions 581-593, numbered according to SEQ ID NO: 138.
[0047] The AAV particles and payloads of the present disclosure can be delivered to one or more target cells, tissues, organs, or organisms. In some embodiments, the AAV particles of the present disclosure exhibit enhanced tropism for a target cell type, tissue, or organ. By way of non-limiting example, the AAV particles can have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively). In some embodiments, the AAV particles of the present disclosure can, in addition or alternatively, have reduced tropism for a cell type, tissue, or organ.
[0048] In some embodiments, AAV includes small, non-enveloped icosahedral capsid viruses of the Parvoviridae family and is characterized by a single-stranded DNA viral genome. Parvoviridae viruses consist of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. The Parvoviridae family includes the genus Dependovirus, which includes AAVs that can replicate in vertebrate hosts including, but not limited to, human, primate, bovine, canine, equine, and ovine species.
[0049] Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, “Parvoviridae: The Viruses and Their Replication,” Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996), the contents of which are hereby incorporated by reference in their entirety.
[0050] In some embodiments, AAVs are used as biological tools due to their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into or replication in the host genome, and their relatively benign immunogenic profile. The viral genome can be engineered to contain the minimal components for the assembly of a functional recombinant virus or viral particle that is loaded with a desired payload or engineered to express or deliver a desired payload to a specific tissue.
[0051] In some embodiments, the AAV is a naturally occurring (e.g., wild-type) AAV or a recombinant AAV. In some embodiments, the wild-type AAV vector genome is a linear single-stranded DNA (ssDNA) molecule that is approximately 5,000 nucleotides (nt) in length. In some embodiments, the inverted terminal repeats (ITRs) cap the viral genome at both the 5' and 3' ends and provide an origin of replication for the viral genome. In some embodiments, the AAV viral genome typically includes two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure defined by self-complementary regions (145 nt in wild-type AAV) at the 5' and 3' ends of the ssDNA that form an energetically stable double-stranded region. The double-stranded hairpin structure includes, but is not limited to, multiple functions including acting as an origin of DNA replication by functioning as a primer for the host viral replication cell's endogenous DNA polymerase complex.
[0052] In some embodiments, the wild-type AAV viral genome further comprises nucleotide sequences for two open reading frames, one for four non-structural Rep proteins (encoded by the Rep78, Rep68, Rep52, Rep40, Rep genes), and one for three capsid, or structural, proteins (VP1, VP2, VP3, encoded by the capsid gene or Cap gene). The Rep proteins are used for replication and packaging, while the capsid proteins are assembled to create the protein shell of AAV, or an AAV capsid polypeptide, such as an AAV capsid variant. Alternative splicing and alternative start codons and promoters result in the production of four different Rep proteins from a single open reading frame and the production of three capsid proteins from a single open reading frame. Although it varies depending on the AAV serotype, as a non-limiting example, for AAV9 / hu.14 (SEQ ID NO: 123 of US7,906,111, the entire content of which is incorporated herein by reference), VP1 refers to amino acids 1 to 736, VP2 refers to amino acids 138 to 736, and VP3 refers to amino acids 203 to 736. In some embodiments, with respect to any one of the amino acid sequences of SEQ ID NO: 981, VP1 comprises amino acids 1 to 736, VP2 comprises amino acids 138 to 736, and VP3 comprises amino acids 203 to 736. In other words, VP1 is the full-length capsid sequence, and VP2 and VP3 are shorter components overall. As a result, a change in the sequence within the VP3 region is also a change to VP1 and VP2, but since VP3 is the shortest of the three sequences, the percent difference compared to the parental sequence is greatest for VP3. Although described here in relation to amino acid sequences, the same can be said for the nucleic acid sequences encoding these proteins. The three capsid proteins assemble together to create the AAV capsid protein. Without wishing to be bound by theory, the AAV capsid protein typically contains VP1:VP2:VP3 in a molar ratio of 1:1:10.
[0053] The AAV vectors of the present disclosure may be recombinantly produced and may be based on adeno-associated virus (AAV) reference sequences. In addition to single-stranded AAV viral genomes (e.g., ssAAV), the present disclosure also provides self-complementary AAV (scAAV) viral genomes. The scAAV vector genome contains DNA strands that anneal to one another to form double-stranded DNA. scAAV enables rapid expression in transduced cells by omitting second-strand synthesis. In some embodiments, the AAV particles of the present disclosure are scAAV. In some embodiments, the AAV particles of the present disclosure are ssAAV.
[0054] Methods for producing and / or modifying AAV particles are disclosed in the art, such as pseudotyped AAV vectors (PCT Patent Publications WO200028004, WO200123001, WO2004112727, WO2005005610, and WO2005072364, the contents of each of which are hereby incorporated by reference in their entirety).
[0055] As described herein, the AAV particles of the present disclosure, including AAV capsid variants and viral genomes, have enhanced tropism for cell types or tissues, such as CNS cell types, regions, or tissues.
[0056] Peptide Disclosed herein are peptides and related AAV particles comprising AAV capsid variants and peptides for enhanced or improved transduction of target tissues (e.g., cells of the CNS or PNS). In some embodiments, the peptide is isolated, e.g., a recombinant peptide. In some embodiments, the nucleic acid encoding the peptide is isolated, e.g., a recombinant nucleic acid.
[0057] In some embodiments, the peptide can increase the distribution of AAV particles to cells, regions, or tissues of the CNS. The cells of the CNS can be, but are not limited to, neurons (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), glial cells (e.g., microglia, astrocytes, oligodendrocytes), and / or supporting cells of the brain such as immune cells (e.g., T cells). The tissues of the CNS can be, but are not limited to, the cortex (e.g., frontal, parietal, occipital, temporal), thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, olfactory cortex, basal ganglia, or deep cerebellar nuclei. In some embodiments, the tissues of the CNS are the sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, cerebellum, or combinations thereof.
[0058] In some embodiments, the peptide can increase the distribution of AAV particles to cells, regions, or tissues of the PNS. The cells or tissues of the PNS may be, but are not limited to, the dorsal root ganglion (DRG).
[0059] In some embodiments, the peptide can increase the distribution of AAV particles to the CNS (e.g., sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, and / or cerebellum) after intravenous administration. In some embodiments, the peptide can increase the distribution of AAV particles to the CNS (e.g., sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, and / or cerebellum) after focused ultrasound (FUS), for example, in combination with intravenous administration of microbubbles (FUS-MB) or in combination with MRI-guided FUS combined with intravenous administration.
[0060] In some embodiments, the peptide can increase the distribution of AAV particles to the PNS (e.g., DRG) after intravenous administration. In some embodiments, the peptide can increase the distribution of AAV particles to the PNS (e.g., DRG) after focused ultrasound (FUS), for example, in combination with intravenous administration of microbubbles (FUS-MB) or in combination with MRI-guided FUS combined with intravenous administration.
[0061] The length of the peptide can vary. In some embodiments, the peptide is about 3 to about 20 amino acids in length. By way of non-limiting example, the peptide can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 3 to 5, 3 to 8, 3 to 10, 3 to 12, 3 to 15, 3 to 18, 3 to 20, 5 to 10, 5 to 15, 5 to 20, 10 to 12, 10 to 15, 10 to 20, 12 to 20, or 15 to 20 amino acids in length. In some embodiments, the peptide is about 10 to 16 amino acids in length, for example, about 15 amino acids in length. In some embodiments, the peptide is about 5 to 10 amino acids in length, for example, about 7 amino acids in length.
[0062] In some embodiments, the peptide can include the sequences shown in Table 1. In some embodiments, the peptide can include the sequences shown in Table 2A. In some embodiments, the peptide can include the sequences shown in Table 2B (for example, any of the sequences of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336). In some embodiments, the peptide can include the sequences shown in Table 9. In some embodiments, the peptide can include the sequences shown in Table 14. In some embodiments, the peptide can include the sequences shown in Table 15. In some embodiments, the peptide can include the sequences shown in Table 16. In some embodiments, the peptide is isolated, for example, recombinant.
Table 1-1
Table 1-2
Table 1-3
Table 2
Table 3
[0063] In some embodiments, the peptides described herein include an amino acid sequence having the formula [N1]-[N2]-[N3] (SEQ ID NO: 4681), wherein [N2] includes the amino acid sequence of DWHR (SEQ ID NO: 4682), [N1] includes positions X1, X2, X3, and X4, the X4 position is Q, K, E, S, P, R, N, H, or a conservative substitution thereof, and / or [N3] includes positions X5, X6, and X7, and the X5 position is I, V, T, M, S, N, L, F, or a conservative substitution thereof. In some embodiments, the X4 position of [N1] is Q. In some embodiments, the X4 position of [N1] is K. In some embodiments, the X5 position of [N3] is I. In some embodiments, the X1 position of [N1] is T, S, R, A, I, C, N, K, L, or Q. In some embodiments, the X2 position of [N1] is N, T, G, V, S, Y, K, I, H, D, or F. In some embodiments, the X3 position of [N1] is T, N, K, D, I, S, P, A, Y, E, V, L, M, R, H, Q, or C. In some embodiments, [N1] is TNTQ (SEQ ID NO: 4688) or includes it. In some embodiments, [N1] is TNTK (SEQ ID NO: 4689) or includes it. In some embodiments, [N1]-[N2] is TNTQDWHR (SEQ ID NO: 4898) or includes it. In some embodiments, [N1]-[N2] is TNTKDWHR (SEQ ID NO: 4899) or includes it. In some embodiments, the X6 position of [N3] is A, Y, P, N, S, T, G, E, V, W, F, or Q. In some embodiments, the X7 position of [N3] is Q, G, N, K, H, R, E, L, P, or M. In some embodiments, [N3] is IAQ or includes it. In some embodiments, [N2]-[N3] is DWHRIAQ (SEQ ID NO: 5027) or includes it. In some embodiments, [N1]-[N2]-[N3] is TNTQDWHRIAQ (SEQ ID NO: 343) or includes it. TNTKDWHRIAQ (SEQ ID NO: 344). In some embodiments, the peptide further includes [N4], and [N4] is X8, X9, X 10 , and X11 contains a position, the X8 position is T, S, N, P, A, or I, the X9 position is G, N, D, R, V, A, S, or Q, the X 10 position is W, S, C, R, L, or G, and / or the X 11 position is V, A, S, I, C, G, D, F, L, or T. In some embodiments, [N4] is TGWV (SEQ ID NO: 5066) or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is any one of SEQ ID NOs: 201-245, 247-250, 253-255, 257-265, 268-274, 276-286, 288, 290-297, 299-303, 305-309, 311, 313-319, 323-328, 330-337, 339-342, 539-542, 544, 546, 547, 549-557, 559-589, 592, 593, 595, 596, 598, 599, 601-608, 610-614, 616-622, 625, 628, 630, 631, 633, 636, 638, 639-646, 649, 651-657, 667, 669, 670, 672, 673, 679-683, 685-690, 692, 693, 695, 697, 699-701, 703-705, 708-710, 712-717, 719-723, 728-731, 733-738, 740, or 742 or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is TNTQDWHRIAQTGWV (SEQ ID NO: 201) or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is TNTKDWHRIAQTGWV (SEQ ID NO: 202) or includes it.
[0064] In some embodiments, the peptide described herein has an amino acid sequence having the formula [N1]-[N2]-[N3] (SEQ ID NO: 4683), where [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), [N1] comprises positions X1, X2, X3, and X4, position X4 is Q, P, or a conservative substitution thereof, and / or [N3] comprises positions X5, X6, and X7, and position X5 is I, V, or a conservative substitution thereof. In some embodiments, position X4 of [N1] is Q. In some embodiments, position X5 of [N3] is I. In some embodiments, position X5 of [N3] is V. In some embodiments, position X1 of [N1] is T or S. In some embodiments, position X2 of [N1] is N, T, G, S, I, or V. In some embodiments, position X3 of [N1] is T, N, I, S, A, V, or L. In some embodiments, [N1] is TNTQ (SEQ ID NO: 4688) or comprises it. In some embodiments, [N1]-[N2] is TNTQDWHR (SEQ ID NO: 4898) or comprises it. In some embodiments, position X6 of [N3] is A, P, S, Y, or N. In some embodiments, position X7 of [N3] is Q, G, or N. In some embodiments, [N3] is IAQ or comprises it. In some embodiments, [N2]-[N3] is DWHRIAQ (SEQ ID NO: 5027) or comprises it. In some embodiments, [N1]-[N2]-[N3] is TNTQDWHRIAQ (SEQ ID NO: 343) or comprises it.). In some embodiments, the peptide further comprises [N4], and [N4] comprises positions X8, X9, X 10 , and X 11 positions, and position X 10 is W. In some embodiments, position X8 of [N4] is T, S, or N. In some embodiments, position X9 of [N4] is G, or N. In some embodiments, position X 11The position is V, A, I, or S. In some embodiments, [N4] is TGWV (SEQ ID NO: 5066) or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336 or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is TNTQDWHRIAQTGWV (SEQ ID NO: 201) or includes it.
[0065] In some embodiments, [N1] exists immediately after [N2]. In some embodiments, [N3] exists immediately after [N2]. In some embodiments, [N4] exists immediately after [N3]. In some embodiments, the peptide includes [N1]-[N2]-[N3] from the N-terminus to the C-terminus. In some embodiments, the peptide includes [N1]-[N2]-[N3]-[N4] from the N-terminus to the C-terminus.
[0066] In some embodiments, the peptide includes an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the peptide includes an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336.
[0067] In some embodiments, three consecutive amino acids include TQD. In some embodiments, four consecutive amino acids include TQDW (SEQ ID NO: 4684). In some embodiments, five consecutive amino acids include TQDWH (SEQ ID NO: 4685). In some embodiments, six consecutive amino acids include TQDWHR (SEQ ID NO: 4686). In some embodiments, seven consecutive amino acids include TQDWHRI (SEQ ID NO: 941).
[0068] In some embodiments, three consecutive amino acids include TNT. In some embodiments, four consecutive amino acids include TNTQ (SEQ ID NO: 4688). In some embodiments, five consecutive amino acids include TNTQD (SEQ ID NO: 5119). In some embodiments, six consecutive amino acids include TNTQDW (SEQ ID NO: 5120). In some embodiments, seven consecutive amino acids include TNTQDWH (SEQ ID NO: 5121). In some embodiments, eight consecutive amino acids include TNTQDWHR (SEQ ID NO: 4898). In some embodiments, nine consecutive amino acids include TNTQDWHRI (SEQ ID NO: 746).
[0069] In some embodiments, the peptide comprises an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the peptide comprises an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the peptide comprises an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the sequences of SEQ ID NO: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. In some embodiments, the peptide comprises an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences of SEQ ID NO: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336.
[0070] In some embodiments, the peptide comprises an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941). In some embodiments, the peptide comprises an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941).
[0071] In some embodiments, the peptide comprises an amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the peptide comprises an amino acid sequence of any of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336.
[0072] In some embodiments, the peptide comprises an amino acid sequence encoded by a nucleotide sequence described herein, for example, the nucleotide sequences of Table 2A. In some embodiments, the peptide comprises an amino acid sequence encoded by a nucleotide sequence that has at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, insertions, or deletions, but 10 or fewer modifications, such as substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 942. In some embodiments, the peptide comprises an amino acid sequence encoded by a nucleotide sequence that contains at least 1, 2, 3, 4, 5, 6, or 7 but 10 or fewer different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942. In some embodiments, the peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 942 or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).
[0073] In some embodiments, the nucleotide sequence encoding the peptides described herein comprises a nucleotide sequence described herein, such as that described in Table 2A. In some embodiments, the nucleotide sequence encoding the peptides described herein is codon-optimized. In some embodiments, the nucleotide sequence encoding the peptides described herein is isolated, e.g., recombinant.
[0074] In some embodiments, the nucleotide sequence encoding the peptide described herein comprises the nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, insertions, or deletions, but 10 or fewer modifications, such as substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 942. In some embodiments, the nucleotide sequence encoding the peptide described herein comprises a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942. In some embodiments, the nucleic acid sequence encoding the peptide described herein comprises a nucleotide sequence that comprises the nucleotide sequence of SEQ ID NO: 942, or is substantially identical thereto (e.g., has at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).
[0075] In some embodiments, the peptides described herein are fused or conjugated to, for example, conjugated to, an active agent. In some embodiments, the active agent is a therapeutic agent. In some embodiments, the active agent is one or more components of a therapeutic protein, an antibody molecule, an enzyme, a genome editing system, an Fc polypeptide fused or conjugated (e.g., covalently or non-covalently) to a therapeutic agent, and / or an RNAi agent (e.g., dsRNA, antisense oligonucleotide (ASO), siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA). In some embodiments, the therapeutic agent is an antibody. In some embodiments, the peptides described herein are fused or conjugated to, for example, conjugated (e.g., directly or indirectly) to the Fc region of an antibody, for example, at the C-terminus of the Fc region or the N-terminus of the Fc region. In some embodiments, the therapeutic agent is an RNAi agent. In some embodiments, the RNAi agent is siRNA or ASO. In some embodiments, the ASO or siRNA comprises at least one (e.g., one or more or all) modified nucleotide. In some embodiments, the peptides described herein are fused or conjugated to, for example, conjugated (e.g., directly or indirectly via a linker) to at least one strand of an RNAi agent. In some embodiments, the peptides described herein are conjugated directly or indirectly to, for example, via a linker, the C-terminus of at least one strand of an RNAi agent. In some embodiments, the peptides described herein are conjugated directly or indirectly to, for example, via a linker, an internal nucleotide of at least one strand of an RNAi agent. In some embodiments, at least one strand is a sense strand. In some embodiments, the therapeutic agent modulates, e.g., inhibits, decreases, or increases, the expression of a CNS-related gene, mRNA, and / or protein.
[0076] In some embodiments, the active agent is a diagnostic agent. In some embodiments, the diagnostic agent is or includes an imaging agent (e.g., a protein or small molecule compound conjugated to a detectable moiety). In some embodiments, the imaging agent includes a PET or MRI ligand, or an antibody molecule conjugated to a detectable moiety. In some embodiments, the detectable moiety is or includes a radiolabel, fluorophore, chromophore, or affinity tag. In some embodiments, the radiolabel is tc99m, iodine-123, spin label, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese, or iron, or includes them. In some embodiments, the active agent is a small molecule. In some embodiments, the active agent is a ribonucleic acid complex (e.g., Cas9 / gRNA complex), plasmid, closed-end DNA, circ-RNA, or mRNA.
[0077] In some embodiments, at least 1 to 5 peptides, e.g., at least 1, 2, 3, 4, or 5 peptides, are fused to or conjugated to, e.g., conjugated with, an active agent, e.g., a therapeutic or diagnostic agent. In some embodiments, at least 1 to 5 peptides, e.g., at least 1, 2, 3, 4, or 5 peptides, comprise the same amino acid sequence. In some embodiments, at least 1 to 5 peptides, e.g., at least 1, 2, 3, 4, or 5 peptides, comprise different amino acid sequences. In some embodiments, at least 1 to 5 peptides, e.g., at least 1, 2, 3, 4, or 5 peptides, are present in tandem (e.g., directly or indirectly connected via a linker), or in a multimeric arrangement. In some embodiments, the peptide comprises an amino acid sequence that is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, 20, 25, 30, or 35 amino acids in length.
[0078] In some embodiments, the peptide covalently binds directly or indirectly to the active agent, e.g., via a linker. In some embodiments, the peptide is conjugated to the active agent via a linker. In some embodiments, the linker is a cleavable linker or a non-cleavable linker. In some embodiments, the cleavable linker is a pH-sensitive linker or an enzyme-sensitive linker. In some embodiments, the pH-sensitive linker comprises a hydrazine / hydrazone linker or a disulfide linker. In some embodiments, the enzyme-sensitive linker comprises a peptide-based linker, e.g., a peptide linker sensitive to proteases (e.g., lysosomal proteases), or a beta-glucuronide linker. In some embodiments, the non-cleavable linker is a linker comprising a thioether group or a maleimidocaproyl group. In some embodiments, the peptide and the active agent are fused or joined after translation, e.g., using click chemistry. In some embodiments, the peptide and the active agent are fused or joined via chemically induced dimerization. In some embodiments, the peptide is present at the N-terminus relative to the active agent. In some embodiments, the peptide is present at the C-terminus relative to the active agent.
[0079] In some embodiments, the peptide is present in or bound to a carrier. In some embodiments, the carrier comprises exosomes, microvesicles, or lipid nanoparticles (LNP). In some embodiments, the carrier comprises a therapeutic agent (e.g., an RNAi agent (e.g., dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, antisense oligonucleotide agent (ASO), or snoRNA), mRNA, ribonucleoprotein complex (e.g., Cas9 / gRNA complex), or circRNA). In some embodiments, the peptide is present on the surface of the carrier. In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the surface of the carrier comprises at least 1 to 5, e.g., at least 1, 2, 3, 4, or 5, of the peptides described herein.
[0080] The present disclosure also provides nucleic acids or polynucleotides encoding any of the peptides described herein, as well as AAV capsid variants, AAV particles, vectors, and cells comprising them.
[0081] AAV capsid variant In some embodiments, the AAV particles described herein comprise an AAV capsid variant, e.g., an AAV capsid variant described herein (e.g., an AAV capsid variant comprising a peptide described herein). In some embodiments, the AAV capsid variant comprises a peptide shown in any of Tables 1, 2A, 2B, 9, 14, 15, or 16.
[0082] In some embodiments, the AAV capsid variant described herein comprises an amino acid sequence having the formula [N1]-[N2]-[N3] (SEQ ID NO: 4681), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), [N1] comprises positions X1, X2, X3, and X4, position X4 is Q, K, E, S, P, R, N, H, or a conservative substitution thereof, and / or [N3] comprises positions X5, X6, and X7, and position X5 is I, V, T, M, S, N, L, F, or a conservative substitution thereof. In some embodiments, position X4 of [N1] is Q. In some embodiments, position X4 of [N1] is K. In some embodiments, position X5 of [N3] is I. In some embodiments, position X1 of [N1] is T, S, R, A, I, C, N, K, L, or Q. In some embodiments, position X2 of [N1] is N, T, G, V, S, Y, K, I, H, D, or F. In some embodiments, position X3 of [N1] is T, N, K, D, I, S, P, A, Y, E, V, L, M, R, H, Q, or C. In some embodiments, [N1] is TNTQ (SEQ ID NO: 4688) or comprises it. In some embodiments, [N1] is TNTK (SEQ ID NO: 4689) or comprises it. In some embodiments, [N1]-[N2] is TNTQDWHR (SEQ ID NO: 4898) or comprises it. In some embodiments, [N1]-[N2] is TNTKDWHR (SEQ ID NO: 4899) or comprises it. In some embodiments, position X6 of [N3] is A, Y, P, N, S, T, G, E, V, W, F, or Q. In some embodiments, position X7 of [N3] is Q, G, N, K, H, R, E, L, P, or M. In some embodiments, [N3] is IAQ or comprises it. In some embodiments, [N2]-[N3] is DWHRIAQ (SEQ ID NO: 5027) or comprises it. In some embodiments, [N1]-[N2]-[N3] is TNTQDWHRIAQ (SEQ ID NO: 343) or comprises it. TNTKDWHRIAQ (SEQ ID NO: 344). In some embodiments, the AAV capsid variant further comprises [N4], and [N4] is X8, X9, X10 and X 11 positions, where the X8 position is T, S, N, P, A, or I, the X9 position is G, N, D, R, V, A, S, or Q, and the X 10 position is W, S, C, R, L, or G, and / or the X 11 position is V, A, S, I, C, G, D, F, L, or T. In some embodiments, [N4] is TGWV (SEQ ID NO: 5066) or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is any one of SEQ ID NOs: 201-245, 247-250, 253-255, 257-265, 268-274, 276-286, 288, 290-297, 299-303, 305-309, 311, 313-319, 323-328, 330-337, 339-342, 539-542, 544, 546, 547, 549-557, 559-589, 592, 593, 595, 596, 598, 599, 601-608, 610-614, 616-622, 625, 628, 630, 631, 633, 636, 638, 639-646, 649, 651-657, 667, 669, 670, 672, 673, 679-683, 685-690, 692, 693, 695, 697, 699-701, 703-705, 708-710, 712-717, 719-723, 728-731, 733-738, 740, or 742 or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is TNTQDWHRIAQTGWV (SEQ ID NO: 201) or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is TNTKDWHRIAQTGWV (SEQ ID NO: 202) or includes it.
[0083] In some embodiments, the AAV capsid variant described herein, the peptide described herein comprises an amino acid sequence having the formula [N1]-[N2]-[N3] (SEQ ID NO: 4683), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), [N1] comprises positions X1, X2, X3, and X4, position X4 is Q, P, or a conservative substitution thereof, and / or [N3] comprises positions X5, X6, and X7, and position X5 is I, V, or a conservative substitution thereof. In some embodiments, position X4 of [N1] is Q. In some embodiments, position X5 of [N3] is I. In some embodiments, position X5 of [N3] is V. In some embodiments, position X1 of [N1] is T or S. In some embodiments, position X2 of [N1] is N, T, G, S, I, or V. In some embodiments, position X3 of [N1] is T, N, I, S, A, V, or L. In some embodiments, [N1] is TNTQ (SEQ ID NO: 4688) or comprises it. In some embodiments, [N1]-[N2] is TNTQDWHR (SEQ ID NO: 4898) or comprises it. In some embodiments, position X6 of [N3] is A, P, S, Y, or N. In some embodiments, position X7 of [N3] is Q, G, or N. In some embodiments, [N3] is IAQ or comprises it. In some embodiments, [N2]-[N3] is DWHRIAQ (SEQ ID NO: 5027) or comprises it. In some embodiments, [N1]-[N2]-[N3] is TNTQDWHRIAQ (SEQ ID NO: 343) or comprises it.). In some embodiments, the AAV capsid variant further comprises [N4], and [N4] comprises positions X8, X9, X 10 , and X 11 positions, and position X 10 is W. In some embodiments, position X8 of [N4] is T, S, or N. In some embodiments, position X9 of [N4] is G, or N. In some embodiments, position X 11The position is V, A, I, or S. In some embodiments, [N4] is TGWV (SEQ ID NO: 5066) or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is any one of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336 or includes it. In some embodiments, [N1]-[N2]-[N3]-[N4] is TNTQDWHRIAQTGWV (SEQ ID NO: 201) or includes it.
[0084] In some embodiments, [N1]-[N2]-[N3] is present in loop VIII of the AAV capsid variant. In some embodiments, [N4] is present in loop VIII of the AAV capsid variant. In some embodiments, [N1]-[N2]-[N3]-[N4] is present in loop VIII of the AAV capsid variant. In some embodiments, loop VIII includes positions 581-593 numbered according to SEQ ID NO: 138. In some embodiments, loop VIII includes positions 580-599 numbered according to SEQ ID NO: 138.
[0085] In some embodiments, [N1] replaces positions 582 - 585 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, and Q585). In some embodiments, [N1] corresponds to positions 582 - 585 of SEQ ID NO: 981. In some embodiments, [N1] corresponds to positions 582 - 585 of SEQ ID NO: 138 (e.g., T582, N583, H584, Q585). In some embodiments, [N1] numbered according to SEQ ID NO: 981 is present at positions 582 - 585. In some embodiments, X1 of [N1] numbered according to SEQ ID NO: 981 is present at position 582, X2 of [N1] is present at position 583, X3 of [N1] is present at position 584, and X4 of [N1] is present at position 585. In some embodiments, [N2] replaces positions 586 - 589 numbered according to the amino acid sequence of SEQ ID NO: 138 (e.g., S586, A587, Q588, and A589). In some embodiments, [N2] corresponds to positions 586 - 589 of SEQ ID NO: 981 (e.g., D586, W587, H588, and R589). In some embodiments, [N2] numbered according to SEQ ID NO: 981 is present at positions 586 - 589. In some embodiments, [N1]-[N2] replaces positions 582 - 589 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589). In some embodiments, [N1]-[N2] corresponds to positions 582 - 589 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585, D586, W587, H588, R589). In some embodiments, [N1]-[N2] numbered according to SEQ ID NO: 981 is present at positions 582 - 589. In some embodiments, [N3] replaces positions 590 - 592 numbered according to SEQ ID NO: 138 (e.g., Q590, A591, and Q592). In some embodiments, [N3] corresponds to positions 590 - 592 of SEQ ID NO: 981 (e.g., I590, A591, and Q592). In some embodiments, [N3] numbered according to SEQ ID NO: 981 is present at positions 590 - 592.In some embodiments, X5 of [N3] numbered according to SEQ ID NO: 981 is present at position 590, X6 of [N3] is present at position 591, and X7 of [N3] is present at position 592. In some embodiments, [N2]-[N3] replaces positions 586-592 numbered according to SEQ ID NO: 138 (e.g., S586, A587, Q588, A589, Q590, A591, and Q592). In some embodiments, [N2]-[N3] corresponds to positions 586-592 of SEQ ID NO: 981 (e.g., D586, W587, H588, R589, I590, A591, and Q592). In some embodiments, [N2]-[N3] numbered according to SEQ ID NO: 981 is present at positions 586-592. In some embodiments, [N1]-[N2]-[N3] replaces positions 582-592 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592). In some embodiments, [N1]-[N2]-[N3] corresponds to positions 582-592 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585, D586, W587, H588, R589, I590, A591, Q592). In some embodiments, [N1]-[N2]-[N3] numbered according to SEQ ID NO: 981 is present at positions 582-592. In some embodiments, [N4] replaces positions 593-596 numbered according to SEQ ID NO: 138 (e.g., T593, G594, W595, and V596). In some embodiments, [N4] corresponds to positions 593-596 of SEQ ID NO: 138 or 981 (e.g., T593, G594, W595, and V596). In some embodiments, [N4] numbered according to SEQ ID NO: 981 is present at positions 593-596. In some embodiments, X8 of [N4] numbered according to SEQ ID NO: 981 is present at position 593, X9 of [N4] is present at position 594, X of [N4]. 10 is present at position 595, and X of [N4] 11is present at position 596. In some embodiments, [N2]-[N3]-[N4] replaces positions 586 to 596 numbered according to SEQ ID NO: 138 (e.g., S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and V596). In some embodiments, [N2]-[N3]-[N4] corresponds to positions 586 to 596 of SEQ ID NO: 981 (e.g., D586, W587, H588, R589, I590, A591, Q592, T593, G594, W595, and V596). In some embodiments, [N2]-[N3]-[N4] numbered according to SEQ ID NO: 981 is present at positions 586 to 596. In some embodiments, [N1]-[N2]-[N3]-[N4] replaces positions 582 to 596 numbered according to SEQ ID NO: 138 (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, Q590, A591, Q592, T593, G594, W595, and V596). In some embodiments, [N1]-[N2]-[N3]-[N4] corresponds to positions 582 to 596 of SEQ ID NO: 981 (e.g., T582, N583, T584, Q585, D586, W587, H588, R589, I590, A591, Q592, T593, G594, W595, and V596). In some embodiments, [N1]-[N2]-[N3]-[N4] numbered according to SEQ ID NO: 981 is present at positions 582 to 596.
[0086] In some embodiments, the AAV capsid variant comprises [N1]-[N2]-[N3] from the N-terminus to the C-terminus. In some embodiments, the AAV capsid variant comprises [N1]-[N2]-[N3]-[N4] from the N-terminus to the C-terminus.
[0087] In some embodiments, the AAV capsid variants described herein comprise an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 contiguous amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the AAV capsid variant comprises an amino acid sequence comprising at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 contiguous amino acids from any one of SEQ ID NOs: 201, 205 - 209, 211 - 214, 216, 219, 220, 230, 232, 237, 238, 255, 262 - 265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. In some embodiments, the amino acid sequence is present in Loop VIII. In some embodiments, Loop VIII comprises positions 581 - 593 numbered according to SEQ ID NO: 138. In some embodiments, Loop VIII comprises positions 580 - 599 numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence replaces 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of positions 582 (e.g., T582), 583 (e.g., N583), 584 (e.g., H584), 585 (e.g., Q585), 586 (e.g., S586), 587 (e.g., A587), 588 (e.g., Q588), 589 (e.g., A589), 590 (e.g., Q590), 591 (e.g., A591), 592 (e.g., Q592), 593 (e.g., T593), 594 (e.g., G594), 595 (e.g., W595), and / or 596 (e.g., V596) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence is present in 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to SEQ ID NO: 981.In some embodiments, the AAV capsid variant comprises one or more amino acid substitutions at position 582 (e.g., T582), position 583 (e.g., N583), position 584 (e.g., H584), position 585 (e.g., Q585), position 586 (e.g., S586), position 587 (e.g., A587), position 588 (e.g., Q588), position 589 (e.g., A589), position 590 (e.g., Q590), position 591 (e.g., A591), position 592 (e.g., Q592), position 593 (e.g., T593), position 594 (e.g., G594), position 595 (e.g., W595), and / or position 596 (e.g., V596), numbered according to SEQ ID NO: 138.
[0088] In some embodiments, three consecutive amino acids comprise TQD. In some embodiments, four consecutive amino acids comprise TQDW (SEQ ID NO: 4684). In some embodiments, five consecutive amino acids comprise TQDWH (SEQ ID NO: 4685). In some embodiments, six consecutive amino acids comprise TQDWHR (SEQ ID NO: 4686). In some embodiments, seven consecutive amino acids comprise TQDWHRI (SEQ ID NO: 941).
[0089] In some embodiments, three consecutive amino acids comprise TNT. In some embodiments, four consecutive amino acids comprise TNTQ (SEQ ID NO: 4688). In some embodiments, five consecutive amino acids comprise TNTQD (SEQ ID NO: 5119). In some embodiments, six consecutive amino acids comprise TNTQDW (SEQ ID NO: 5120). In some embodiments, seven consecutive amino acids comprise TNTQDWH (SEQ ID NO: 5121). In some embodiments, eight consecutive amino acids comprise TNTQDWHR (SEQ ID NO: 4898). In some embodiments, nine consecutive amino acids comprise TNTQDWHRI (SEQ ID NO: 746).
[0090] In some embodiments, the AAV capsid variants described herein include an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the AAV capsid variant includes an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the AAV capsid variant includes an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of any one of the sequences of SEQ ID NOs: 945-980 or 985-986. In some embodiments, the AAV capsid variant includes an amino acid sequence having at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. In some embodiments, the amino acid sequence is present in Loop VIII. In some embodiments, Loop VIII includes positions 581-593 numbered according to SEQ ID NO: 138. In some embodiments, Loop VIII includes positions 580-599 numbered according to SEQ ID NO: 138.In some embodiments, the amino acid sequence replaces 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of positions 582 (e.g., T582), 583 (e.g., N583), 584 (e.g., H584), 585 (e.g., Q585), 586 (e.g., S586), 587 (e.g., A587), 588 (e.g., Q588), 589 (e.g., A589), 590 (e.g., Q590), 591 (e.g., A591), 592 (e.g., Q592), 593 (e.g., T593), 594 (e.g., G594), 595 (e.g., W595), and / or 596 (e.g., V596) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence is present at 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to SEQ ID NO: 981.
[0091] In some embodiments, the AAV capsid variant comprises an amino acid sequence that has at least 1, 2, or 3, but 4 or fewer, modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941). In some embodiments, the AAV capsid variant comprises an amino acid sequence that contains at least 1, 2, or 3, but 4 or fewer, different amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941).
[0092] In some embodiments, the AAV capsid variant comprises an amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16. In some embodiments, the peptide comprises an amino acid sequence of any of SEQ ID NOs: 201, 205-209, 211-214, 216, 219, 220, 230, 232, 237, 238, 255, 262-265, 274, 283, 286, 290, 291, 293, 301, 306, 307, 308, 309, 314, or 336. In some embodiments, the amino acid sequence is present in Loop VIII. In some embodiments, Loop VIII comprises positions 581-593 numbered according to SEQ ID NO: 138. In some embodiments, Loop VIII comprises positions 580-599 numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence replaces 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of positions 582 (e.g., T582), 583 (e.g., N583), 584 (e.g., H584), 585 (e.g., Q585), 586 (e.g., S586), 587 (e.g., A587), 588 (e.g., Q588), 589 (e.g., A589), 590 (e.g., Q590), 591 (e.g., A591), 592 (e.g., Q592), 593 (e.g., T593), 594 (e.g., G594), 595 (e.g., W595), and / or 596 (e.g., V596) numbered according to SEQ ID NO: 138. In some embodiments, the amino acid sequence is present in 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of positions 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to SEQ ID NO: 981. In some embodiments, the amino acid sequence is present in 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or all of positions 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, and / or 596 numbered according to SEQ ID NO: 981.In some embodiments, the AAV capsid variant comprises one or more amino acid substitutions at position 582 (e.g., T582), position 583 (e.g., N583), position 584 (e.g., H584), position 585 (e.g., Q585), position 586 (e.g., S586), position 587 (e.g., A587), position 588 (e.g., Q588), position 589 (e.g., A589), position 590 (e.g., Q590), position 591 (e.g., A591), position 592 (e.g., Q592), position 593 (e.g., T593), position 594 (e.g., G594), position 595 (e.g., W595), and / or position 596 (e.g., V596), numbered according to SEQ ID NO: 138.
[0093] In some embodiments, the AAV capsid variant (e.g., the AAV capsid variants described herein) comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid variants described herein comprise the nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, but 10 or fewer modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 942, and that encodes an amino acid sequence. In some embodiments, the AAV capsid variant comprises an amino acid sequence encoded by a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7, but 10 or fewer, different nucleotides relative to the nucleotide sequence of SEQ ID NO: 942.
[0094] In some embodiments, the AAV capsid variants described herein include the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the amino acid sequence replaces positions 584-590 (e.g., H584, Q585, S586, A587, Q588, A589, Q590) numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variants described herein include the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the amino acid sequence corresponds to positions 584-590 of SEQ ID NO: 981 (e.g., T584, Q585, D586, W587, H588, R589, I590). In some embodiments, the AAV capsid variants described herein include the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the amino acid sequence is present at positions 584-590 numbered according to SEQ ID NO: 981. In some embodiments, the AAV capsid variants described herein include the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the amino acid sequence is present at positions 584-590 numbered according to SEQ ID NO: 138.
[0095] In some embodiments, the AAV capsid variant further includes an amino acid other than A at position 581 numbered according to SEQ ID NO: 138 or 981. In some embodiments, the AAV capsid variant further includes the amino acid T at position 581 numbered according to SEQ ID NO: 138 or 981. In some embodiments, the AAV capsid variant further includes the amino acid V at position 581 numbered according to SEQ ID NO: 138 or 981. In some embodiments, the AAV capsid variant includes the substitution A581T or A581V numbered according to SEQ ID NO: 138 or 981.
[0096] In some embodiments, the AAV capsid variants described herein include one, two, three, four, five, or all of the amino acids other than H at position 584 (e.g., T), other than S at position 586 (e.g., D), other than A at position 587 (e.g., W), other than Q at position 588 (e.g., H), other than A at position 589 (e.g., R), and / or other than Q at position 590 (e.g., I), numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant includes the amino acids other than H at position 584 (e.g., T), other than S at position 586 (e.g., D), other than A at position 587 (e.g., W), other than Q at position 588 (e.g., H), other than A at position 589 (e.g., R), and other than Q at position 590 (e.g., I), numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variants described herein include the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 138 or 981.
[0097] In some embodiments, the AAV capsid variants described herein include one, two, three, four, five, or all of the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and / or I at position 590, numbered according to SEQ ID NO: 138 or 981. In some embodiments, the AAV capsid variant includes the amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO: 138 or 981.
[0098] In some embodiments, the AAV capsid variants described herein include one, two, three, four, five, or all of the substitutions H584T, S586D, A587W, Q588H, A589R, and / or Q590I numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant includes the substitutions H584T, S586D, A587W, Q588H, A589R, and Q590I numbered according to SEQ ID NO: 138 or 981.
[0099] In some embodiments, the AAV capsid variants described herein include the amino acid Q at position 585 numbered according to SEQ ID NO: 138 or 981.
[0100] In some embodiments, the AAV capsid variants described herein include an amino acid other than Q at position 585 numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variants described herein include the amino acid K at position 585 numbered according to SEQ ID NO: 138.
[0101] In some embodiments, the AAV capsid variants described herein include an amino acid other than Q at position 590 numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant includes the amino acid I at position 590 numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant includes the amino acid V at position 590 numbered according to SEQ ID NO: 138.
[0102] In some embodiments, the AAV capsid variants described herein include the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the amino acid sequence of TQDWHRI (SEQ ID NO: 941) is present at positions 584-590 in the AAV capsid variant numbered according to SEQ ID NO: 981. In some embodiments, the AAV capsid variants described herein include the amino acid sequence of TQDWHRI (SEQ ID NO: 941), and the amino acid sequence of TQDWHRI (SEQ ID NO: 941) is present at positions 584-590 in the AAV capsid variant numbered according to SEQ ID NO: 138.
[0103] In some embodiments, the AAV capsid variants described herein include amino acid W at position 595 numbered according to SEQ ID NO: 138 or 981.
[0104] In some embodiments, the AAV capsid variant further includes a substitution at position K449, such as a K449R substitution, numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant further includes an amino acid other than K (e.g., R) at position 449 numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant includes R at position 449 numbered according to the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further includes modifications, such as insertions, substitutions, and / or deletions in loops I, II, IV, and / or VI.
[0105] In some embodiments, the AAV capsid variant is at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, of the amino acid sequence of SEQ ID NO: 138, but further includes an amino acid sequence comprising 30, 20, or 10 or fewer modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions. In some embodiments, the AAV capsid variant further includes an amino acid sequence that is at least 1, 2, or 3, but 30, 20, or 10 or fewer amino acids different from the amino acid sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variant further includes the amino acid sequence of SEQ ID NO: 138, or an amino acid sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
[0106] In some embodiments, the AAV capsid variant comprises (a) a VP1 protein comprising the amino acid sequence of SEQ ID NO: 138 or 981, (b) a VP2 protein comprising the amino acid sequence of positions 138 to 736 of SEQ ID NO: 138 or 981, (c) a VP3 protein comprising the amino acid sequence of positions 203 to 736 of SEQ ID NO: 138 or 981, or (d) an amino acid sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity to any of the amino acid sequences in (a) to (c), an amino acid sequence comprising at least 1, 2, or 3, but 30, 20, or 10 or fewer different amino acids relative to any of the amino acid sequences in (a) to (c), or an amino acid sequence comprising at least 1, 2, or 3 modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, but 30, 20, or 10 or fewer modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, relative to any of the amino acid sequences in (a) to (c).
[0107] In some embodiments, the AAV capsid variant further comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the AAV capsid variant further comprises the amino acid sequence encoded by a nucleotide sequence that has at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 137, but that comprises 30, 20, or fewer than 10 modifications, e.g., substitutions, insertions, or deletions. In some embodiments, the AAV capsid variant further comprises the amino acid sequence encoded by a nucleotide sequence that has at least 1, 2, or 3, but 30, 20, or fewer than 10, different nucleotides relative to the amino acid sequence of SEQ ID NO: 137.
[0108] In some embodiments, the nucleotide sequence encoding the AAV capsid variant further comprises the nucleotide sequence of SEQ ID NO: 137, or a sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the nucleotide sequence encoding the AAV capsid variant further comprises a nucleotide sequence that has at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 137, but that comprises 30, 20, or fewer than 10 modifications, e.g., substitutions, insertions, or deletions. In some embodiments, the nucleotide sequence encoding the AAV capsid variant further comprises a nucleotide sequence that has at least 1, 2, or 3, but 30, 20, or fewer than 10, different nucleotides relative to the amino acid sequence of SEQ ID NO: 137.
[0109] In some embodiments, the AAV capsid variants of the present disclosure comprise the amino acid sequences described herein, e.g., those described in Tables 3 and 4, e.g., the amino acid sequence of the AAV capsid variant of TTJ-001.
[0110] In some embodiments, the AAV capsid variants described herein include VP1, VP2, and / or VP3 proteins that include the amino acid sequences described herein, such as those described in Tables 3 and 4, for example, the amino acid sequence of the AAV capsid variant of TTJ-001.
[0111] In some embodiments, the AAV capsid variants described herein include the amino acid sequences encoded by the nucleotide sequences described herein, such as those described in Tables 3 and 5, for example, the nucleotide sequence of the AAV capsid variant of TTJ-001.
[0112] In some embodiments, the polynucleotide or nucleic acid encoding the AAV capsid variants of the present disclosure includes the nucleotide sequences described herein, such as those described in Tables 3 and 5, for example, the nucleotide sequence of the AAV capsid variant of TTJ-001. [Table 4] [Table 5] [Table 6-1] [Table 6-2]
[0113] In some embodiments, the polynucleotide encoding the AAV capsid variants described herein includes the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
[0114] In some embodiments, the polynucleotide encoding the AAV capsid variant described herein comprises the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the nucleotide sequence encoding the AAV capsid variant described herein is at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 983, but comprises a nucleotide sequence comprising 30, 20, or 10 or fewer modifications, e.g., substitutions, insertions, or deletions. In some embodiments, the nucleotide sequence encoding the AAV capsid variant described herein comprises a nucleotide sequence that is at least 1, 2, or 3, but 30, 20, or 10 or fewer different nucleotides relative to the amino acid sequence of SEQ ID NO: 983. In some embodiments, the nucleic acid sequence encoding the AAV capsid variant described herein is codon-optimized.
[0115] In some embodiments, the AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 981, or an amino acid sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the AAV capsid variant described herein is at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the amino acid sequence of SEQ ID NO: 981, but comprises an amino acid sequence comprising 30, 20, or 10 or fewer modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions. In some embodiments, the AAV capsid variant described herein comprises an amino acid sequence that is at least 1, 2, or 3, but 30, 20, or 10 or fewer different amino acids relative to the amino acid sequence of SEQ ID NO: 981.
[0116] In some embodiments, the AAV capsid variants described herein comprise an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the AAV capsid variants described herein comprise an amino acid sequence encoded by a nucleotide sequence that contains at least 1, 2, or 3, but 30, 20, or 10 or fewer different nucleotides relative to the amino acid sequence of SEQ ID NO: 983. In some embodiments, the AAV capsid variants described herein comprise an amino acid sequence encoded by a nucleotide sequence that contains at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, but 30, 20, or 10 or fewer modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of SEQ ID NO: 983.
[0117] In some embodiments, the AAV capsid variants described herein comprise the VP1, VP2, VP3 proteins, or combinations thereof. In some embodiments, the AAV capsid variant comprises the amino acid sequence corresponding to positions 138 to 736 of SEQ ID NO: 981, e.g., the amino acid sequence corresponding to VP2, or a sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the AAV capsid protein comprises the amino acid sequence corresponding to positions 203 to 736 of SEQ ID NO: 981, e.g., VP3, or a sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto. In some embodiments, the AAV capsid variant comprises the amino acid sequence corresponding to positions 1 to 736 of SEQ ID NO: 981, e.g., VP1, or an amino acid sequence having at least 70% (e.g., at least 80, 85, 90, 95, 96, 97, 98, or 99%) sequence identity thereto.
[0118] In some embodiments, the AAV capsid variants described herein have increased tropism for CNS cells or tissues, such as brain cells, brain tissue, spinal cord cells, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138.
[0119] In some embodiments, the AAV capsid variants described herein transduce a brain region, such as the midbrain region (e.g., hippocampus, or thalamus), or the brainstem. In some embodiments, the level of transduction is at least 39, 50, 100, 120, 132, 146, 150, 161, 174, 175, 200, 225, 250, 275, 283, 300, 350, 400, 450, 500, 525, 528, or 550-fold higher compared to the reference sequence of SEQ ID NO: 138.
[0120] In some embodiments, the AAV capsid variants described herein are at least about 10, 14, 20, 24, 50, 100, 150, 200, 250, 300, 350, 400, 425, 450, or 460-fold enriched in the brain compared to the reference sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variants described herein are at least about 200, 250, 300, 350, 400, 425, 450, or 460-fold enriched in the brain compared to the reference sequence of SEQ ID NO: 138.
[0121] In some embodiments, the AAV capsid variants described herein are enriched in the brains of at least two to three species, such as non-human primates and rodent (e.g., mouse) species, as compared to the reference sequence of SEQ ID NO: 138. In some embodiments, the AAV capsid variants described herein are at least about 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 190, 200, 205, or 210-fold enriched in the brains of at least two to three species, such as non-human primates and rodent (e.g., mouse) species, as compared to the reference sequence of SEQ ID NO: 138. In some embodiments, at least two to three species are Macaca fascicularis, Chlorocebus sabaeus, Callithrix jacchus, and / or mouse (e.g., outbred mouse).
[0122] In some embodiments, the AAV capsid variants described herein are at least about 2, 3, 4, 5, 10, 15, 17, 20, 50, 75, 100, 103, 107, 125, 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1200-fold enriched in the brain as compared to the reference sequence of SEQ ID NO: 981.
[0123] In some embodiments, the AAV capsid variants described herein deliver increased levels of viral genome to brain regions. In some embodiments, the level of viral genome is increased by at least 2, 5, 7, 10, 15, 19, 20, 22, or 25-fold as compared to the reference sequence of SEQ ID NO: 138. In some embodiments, the brain regions include the sensory cortex, motor cortex, putamen, thalamus, caudate nucleus, hippocampus, and / or cerebellum.
[0124] In some embodiments, the AAV capsid variants described herein deliver increased levels of payload to brain regions. In some embodiments, the level of payload is at least 39, 50, 100, 120, 132, 146, 150, 161, 174, 175, 200, 225, 250, 275, 283, 300, 350, 400, 450, 500, 525, 528, or 550-fold increased compared to the reference sequence of SEQ ID NO: 138. In some embodiments, the brain regions include the sensory cortex, motor cortex, putamen, thalamus, caudate, hippocampus, and / or cerebellum.
[0125] In some embodiments, the AAV capsid variants described herein are at least about 5, 10, 50, 100, 115, 120, 150, 175, 200, 207, 225, 250, or 275-fold enriched in the spinal cord compared to the reference sequence of SEQ ID NO: 138.
[0126] In some embodiments, the AAV capsid variants of the present disclosure have a reduced tropism for the liver. In some embodiments, the AAV capsid variants include modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, that result in reduced tropism (e.g., off-targeting) and / or activity in the liver. In some embodiments, the reduced tropism in the liver is compared to other similar capsids that do not include the modification, e.g., the wild-type capsid polypeptide. In some embodiments, the described AAV capsid variants include modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, that result in one or more of the following characteristics: (1) reduced tropism in the liver, (2) off-target expression in the liver, (3) reduced activity in the liver, and / or (4) reduced binding to galactose. In some embodiments, any one or all of the reductions in characteristics (1)-(3) are compared to other similar AAV capsid variants that do not include the modification. Exemplary modifications are provided in WO2018 / 119330, Pulicherla et al. (2011) Mol. Ther. 19(6):1070-1078, Adachi et al. (2014) Nature Communications 5(3075), DOI:10.1038 / ncomms4075, and Bell et al. (2012) J. Virol. 86(13):7326-33 (the contents of which are incorporated herein by reference in their entirety). In some embodiments, the AAV capsid variants include modifications, such as substitutions (e.g., conservative substitutions), insertions, or deletions, at position N470 (e.g., N470A), position D271 (e.g., D271A), position N272 (e.g., N272A), position Y446 (e.g., Y446A), position N498 (e.g., N498Y or N498I), position W503 (e.g., W503R or W503A), position L620 (e.g., L620F), or combinations thereof, relative to the reference sequence numbered according to SEQ ID NO: 138.In some embodiments, the AAV capsid variant comprises 1, 2, 3, 4, 5, or all of the following amino acids other than N at position 470 (e.g., A), amino acids other than D at position 271 (e.g., A), amino acids other than N at position 272 (e.g., A), amino acids other than Y at position 446 (e.g., A), and amino acids other than N at position 498 / (e.g., Y or I), and amino acids other than W at position 503 (e.g., R or A), and amino acids other than L at position 620 (e.g., F), relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, at positions N470 (e.g., N470A), D271 (e.g., D271A), N272 (e.g., N272A), Y446 (e.g., Y446A), and W503 (e.g., W503R or W503A), relative to the reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the AAV capsid variant comprises modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, at N498 (e.g., N498Y) and L620 (e.g., L620F).
[0127] In some embodiments, the AAV capsid variants included herein comprise the modifications described in Adachi et al. (2014) Nature Communications 5(3075), DOI:10.1038 / ncomms4075 (the contents of which are hereby incorporated by reference in their entirety). Exemplary modifications that alter or do not alter tissue transduction in at least the brain, liver, heart, lung, and / or kidney can be found in Supplementary Data 2 showing AAV barcode-Seq data obtained with AAV9-AA-VBCLib of Adachi et al. (supra), the contents of which are hereby incorporated by reference in their entirety.
[0128] In some embodiments, the AAV capsid variants of the disclosure are isolated and, for example, recombinant. In some embodiments, the AAV capsid polypeptides of the disclosure, for example, the polynucleotides encoding AAV capsid variants, are isolated and, for example, recombinant.
[0129] Also provided herein are polynucleotide sequences encoding any of the above-described AAV capsid variants, as well as AAV particles, vectors, and cells comprising the same.
[0130] AAV Serotypes and Capsids In some embodiments, the AAV particles of the disclosure may comprise a capsid protein or variant thereof in any natural or recombinant AAV serotype. AAV serotypes may differ in characteristics such as, but not limited to, packaging, tropism, transduction, and immunogenicity profiles. Without wishing to be bound by theory, in some embodiments, an AAV capsid protein, for example, an AAV capsid variant, may be able to modulate, for example, direct the tropism of an AAV particle to a particular tissue.
[0131] In some embodiments, the AAV capsid variants described herein enable blood-brain barrier penetration after intravenous administration. In some embodiments, the AAV capsid variant enables blood-brain barrier penetration after intravenous administration, in combination with, for example, intravenous administration of microbubbles (FUS-MB), focused ultrasound (FUS), or MRI-guided FUS in combination with intravenous administration. In some embodiments, the AAV capsid variant enables increased distribution to brain regions. In some embodiments, the brain regions include the prefrontal cortex, sensory cortex, motor cortex, caudate cortex, dentate nucleus, cerebellar cortex, cerebral cortex, brainstem, hippocampus, thalamus, putamen, or combinations thereof. In some embodiments, the AAV capsid variant enables preferential transduction in brain regions over transduction in the dorsal root ganglion (DRG).
[0132] In some embodiments, the AAV capsid variant enables increased distribution to the spinal cord region. In some embodiments, the spinal cord region includes the cervical spinal cord region, the thoracic spinal cord region, and / or the lumbar spinal cord region.
[0133] In some embodiments, the AAV capsid variant is suitable for intramuscular administration and / or transduction of muscle fibers. In some embodiments, the AAV capsid variant enables increased distribution to the muscle region. In some embodiments, the muscle region includes the myocardium, quadriceps muscle, diaphragm muscle region, or combinations thereof. In some embodiments, the muscle region includes the myocardial region, e.g., the atrial muscle region or the ventricular muscle region.
[0134] In some embodiments, the start codon for translation of the AAV VP1 capsid protein described herein, e.g., of the capsid variant, can be CTG, TTG, or GTG as described in U.S. Patent No. 8,163,543, the contents of which are incorporated herein by reference in their entirety.
[0135] The present disclosure refers to the structural capsid proteins (including VP1, VP2, and VP3) encoded by the Cap gene. These capsid proteins form the outer protein structural shell (e.g., the capsid) of viral vectors such as AAV. The VP capsid proteins synthesized from the Cap polynucleotide generally contain methionine (Met1) as the first amino acid within the peptide sequence, which associates with the start codon (AUG or ATG) in the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue or generally any first amino acid (AA1) is typically cleaved after or during polypeptide synthesis by protein processing enzymes such as Met-aminopeptidase. This "Met / AA clipping" process often correlates with the corresponding acetylation of the second amino acid (e.g., alanine, valine, serine, threonine, etc.) within the polypeptide sequence. Met clipping generally occurs in the VP1 and VP3 capsid proteins, but may also occur in the VP2 capsid protein.
[0136] When Met / AA cleavage is incomplete, a mixture of one or more (1, 2, or 3) of the VP capsid proteins that make up the viral capsid may be produced, some of which may contain Met1 / AA1 amino acids (Met+ / AA+), and some of which may lack Met1 / AA1 amino acids as a result of Met / AA cleavage (Met− / AA−). For further consideration of Met / AA-cleavage in capsid proteins, see Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct. 28(5):255-267, Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19. 327(5968):973-977, each of which is hereby incorporated by reference in its entirety.
[0137] According to the present disclosure, references to capsid proteins, such as AAV capsid variants, are not limited to either clipped (Met− / AA−) or unclipped (Met+ / AA+), and in context, can refer to individual capsid proteins, viral capsids composed of mixtures of capsid proteins, and / or polynucleotide sequences (or fragments thereof) that encode, describe, produce, or result in the capsid proteins of the present disclosure. Direct references to capsid proteins or capsid polypeptides (such as VP1, VP2, or VP3) can also include VP capsid proteins that include Met1 / AA1 amino acids (Met+ / AA+), as well as the corresponding VP capsid proteins that lack Met1 / AA1 amino acids as a result of Met / AA cleavage (Met− / AA−).
[0138] Furthermore, according to the present disclosure, since sequences lacking the first-described amino acid (regardless of whether it is Met1 / AA1) are readily apparent upon sequence examination, reference to a specific SEQ ID NO. (either a protein or a nucleic acid) that contains or encodes one or more capsid proteins each containing the Met1 / AA1 amino acid (Met+ / AA+) should be understood to teach a VP capsid protein lacking the Met1 / AA1 amino acid.
[0139] As a non-limiting example, reference to a VP1 polypeptide sequence that is 736 amino acids in length and contains the "Met1" amino acid (Met+) encoded by the AUG / ATG start codon may also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and does not contain the "Met1" amino acid (Met-) of the 736-amino acid Met+ sequence. As a second non-limiting example, reference to a VP1 polypeptide sequence that is 736 amino acids in length and contains the "AA1" amino acid (AA1+) encoded by any NNN start codon may also be understood to teach a VP1 polypeptide sequence that is 735 amino acids in length and does not contain the "AA1" amino acid (AA1-) of the 736-amino acid AA1+ sequence.
[0140] Reference to a viral capsid formed from VP capsid proteins (e.g., reference to a specific AAV capsid serotype) can incorporate VP capsid proteins containing the Met1 / AA1 amino acid (Met+ / AA1+), the corresponding VP capsid proteins lacking the Met1 / AA1 amino acid (Met- / AA1-) as a result of Met / AA1 clipping, and combinations thereof (Met+ / AA1+ and Met- / AA1-).
[0141] As a non-limiting example, the AAV capsid serotype can include VP1 (Met+ / AA1+), VP1 (Met- / AA1-), or a combination of VP1 (Met+ / AA1+) and VP1 (Met- / AA1-). The AAV capsid serotype can also include VP3 (Met+ / AA1+), VP3 (Met- / AA1-), or a combination of VP3 (Met+ / AA1+) and VP3 (Met- / AA1-), and can also include any optional combination of VP2 (Met+ / AA1) and VP2 (Met- / AA1-).
[0142] Additional AAV sequences In some embodiments, the AAV capsid variant includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids of any of the amino acid sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16 numbered at positions 582, 583, 584, 585, 586, 587, 588, 589, and / or 590 relative to SEQ ID NO: 138.
[0143] In some embodiments, the AAV capsid variant comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids of any of the amino acid sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16 immediately following a position numbered 582, 583, 584, 585, 586, 587, 588, 589, and / or 590 relative to SEQ ID NO: 138, or a corresponding position in any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO2021 / 230987, the contents of which are incorporated herein by reference in their entirety). In some embodiments, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive amino acids of any of the amino acid sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16 replace at least 1, 2, 3, 4, 5, 6, 7, 8, or all of positions 582, 583, 584, 585, 586, 587, 588, 589, and / or 590 corresponding to equivalent positions in SEQ ID NO: 138 or any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO2021 / 230987, the contents of which are incorporated herein by reference in their entirety) (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, and / or Q590).In some embodiments, the AAV capsid variant contains, at one, two, three, four, five, six, seven, eight, or all of positions 582, 583, 584, 585, 586, 587, 588, 589, and / or 590, which correspond to equivalent positions in the amino acid sequence of SEQ ID NO: 138, are numbered according to the amino acid sequence of SEQ ID NO: 138, or are numbered according to any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO2021 / 230987, the content of which is incorporated herein by reference in its entirety), amino acids other than wild-type, e.g., natural amino acids. In some embodiments, the AAV capsid variant contains, at one, two, three, four, five, six, seven, eight, or all of positions 582, 583, 584, 585, 586, 587, 588, 589, and / or 590, which correspond to equivalent positions in the amino acid sequence of SEQ ID NO: 138, are numbered according to the amino acid sequence of SEQ ID NO: 138, or are numbered according to any other AAV serotype (e.g., AAV1, AAV2, AAV3, AAV3b, AAV4, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, AAVrh32.33, AAVrh74, PHP.N, PHP.B, or an AAV serotype as provided in Table 6 of WO2021 / 230987, the content of which is incorporated herein by reference in its entirety), modifications, e.g., substitutions (e.g., T582, N583, H584, Q585, S586, A587, Q588, A589, and / or Q590).
[0144] In some embodiments, the AAV capsid polypeptides or AAV capsid variants described herein can include a VOY101 capsid polypeptide, an AAVPHP.B (PHP.B) capsid polypeptide, an AAVPHP.N (PHP.N) capsid polypeptide, an AAV1 capsid polypeptide, an AAV2 capsid polypeptide, an AAV5 capsid polypeptide, an AAV9 capsid polypeptide, an AAV9K449R capsid polypeptide, an AAVrh10 capsid polypeptide, or a functional variant thereof. In some embodiments, the AAV capsid polypeptide, e.g., the AAV capsid variant, includes an amino acid sequence of any of the AAV capsid polypeptides in Table 6, or an amino acid sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding the AAV capsid polypeptide includes any one of the nucleotide sequences in Table 6, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity).
[0145] In some embodiments, the AAV capsid polypeptide or AAV capsid variant described herein comprises the amino acid sequence of SEQ ID NO: 138, or an amino acid sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises an amino acid sequence that has at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 138, but comprises 30, 20, or fewer than 10 modifications, e.g., substitutions (e.g., conservative substitutions). In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the nucleotide sequence encoding the AAV capsid polypeptide or AAV capsid variant comprises the nucleotide sequence of SEQ ID NO: 137, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises a substitution at position K449 numbered according to SEQ ID NO: 138, e.g., a K449R substitution.
[0146] In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262). In some embodiments, the peptide is present immediately after position 588 relative to a reference sequence numbered according to SEQ ID NO: 138. In some embodiments, the capsid polypeptide comprises the amino acid substitutions of A587D and Q588G numbered according to SEQ ID NO: 138.
[0147] In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises an amino acid substitution of K449R numbered according to SEQ ID NO: 138, and a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), the peptide being present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138.
[0148] In some embodiments, the AAV capsid polypeptide or AAV capsid variant is a peptide comprising an amino acid substitution of K449R numbered according to SEQ ID NO: 138, and an amino acid sequence of TLAVPFK (SEQ ID NO: 1262), the insert being present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138, and comprising amino acid substitutions of A587D and Q588G numbered according to SEQ ID NO: 138.
[0149] In some embodiments, the AAV capsid polypeptide or AAV capsid variant is a peptide comprising the amino acid sequence of TLAVPFK (SEQ ID NO: 1262), the insert being present immediately after position 588 relative to the reference sequence numbered according to SEQ ID NO: 138, and comprising amino acid substitutions of A587D and Q588G numbered according to SEQ ID NO: 138.
[0150] In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 11, or an amino acid sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises an amino acid sequence having at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO: 11, but comprising 30, 20, or 10 or fewer modifications, e.g., substitutions (conservative substitutions), and optionally, position 449 is not R.
[0151] In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises the amino acid sequence of SEQ ID NO:1, or an amino acid sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity). In some embodiments, the AAV capsid polypeptide or AAV capsid variant comprises an amino acid sequence that has at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), relative to the amino acid sequence of SEQ ID NO:1, but comprises 30, 20, or fewer than 10 modifications, e.g., substitutions (e.g., conservative substitutions).
Table 7-1
Table 7-2
Table 7-3
[0152] Viral genome of AAV particles In some embodiments, the AAV particles described herein that comprise the AAV capsid variants described herein can be used to deliver a viral genome to a tissue (e.g., the CNS, DRG, and / or muscle). In some embodiments, the AAV particles that comprise the AAV capsid variants described herein can be used to deliver a viral genome to a tissue or cell, e.g., the CNS, DRG, or muscle cell or tissue. In some embodiments, the AAV particles of the present disclosure are recombinant AAV particles. In some embodiments, the AAV particles of the present disclosure are isolated AAV particles.
[0153] The viral genome can encode any payload, including but not limited to polypeptides (e.g., therapeutic polypeptides), antibodies, enzymes, RNAi agents, and / or components of gene editing systems. In one embodiment, the AAV particles described herein are used to deliver a payload to cells of the CNS after intravenous delivery. In another embodiment, the AAV particles described herein are used to deliver a payload to cells of the DRG after intravenous delivery. In some embodiments, the AAV particles described herein are used to deliver a payload to cells of muscle, e.g., cardiomyocytes, after intravenous delivery.
[0154] In some embodiments, the viral genome of the AAV particles comprising the AAV capsid variants described herein comprises a nucleotide sequence comprising a transgene encoding a payload. In some embodiments, the viral genome comprises inverted terminal repeats (ITRs). In some embodiments, the viral genome comprises two ITR sequences, one at the 5' end of the viral genome (e.g., 5' to the encoded payload) and one at the 3' end of the viral genome (e.g., 3' to the encoded payload). In some embodiments, the viral genome of the AAV particles, e.g., the AAV particles comprising the AAV capsid variants described herein, can comprise regulatory elements (e.g., promoters) to enhance transgene expression, untranslated regions (UTRs), miR binding sites, polyadenylation sequences (polyA), filler or stuffer sequences, introns, and / or linker sequences.
[0155] In some embodiments, the viral genome components are selected and / or engineered for expression of the payload in a target tissue (e.g., the CNS, muscle, or DRG).
[0156] Viral genome component: Inverted terminal repeat (ITR) In some embodiments, the AAV particles comprising the AAV capsid variants described herein comprise a viral genome that includes ITRs and a transgene encoding a payload. In some embodiments, the viral genome includes two ITRs. In some embodiments, the two ITRs flank the nucleotide sequence encoding the payload at the 5' and 3' termini. In some embodiments, the ITR functions as an origin of replication that includes recognition sites for replication. In some embodiments, the ITR includes sequence regions that can be arranged complementarily and symmetrically. In some embodiments, the ITR incorporated into the viral genomes described herein can be composed of naturally occurring polynucleotide sequences or polynucleotide sequences derived recombinantly.
[0157] In some embodiments, the ITR can be derived from the same serotype as the capsid polypeptide, selected from any of the known serotypes, or a variant thereof, e.g., the capsid variant. In some embodiments, the ITR can be of a serotype different from the capsid. In some embodiments, the viral genome includes two ITR sequence regions and the ITRs are of the same serotype as each other. In some embodiments, the viral genome includes two ITR sequence regions and the ITRs are of different serotypes. Non-limiting examples include zero, one, or both of the ITRs having the same serotype as the capsid. In one embodiment, both ITRs of the viral genome of the AAV particle are AAV2 ITRs.
[0158] Viral genome component: Promoter In some embodiments, the viral genome of the AAV particles described herein includes at least one element for enhancing payload target specificity and expression (see, e.g., Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015, the content of which is incorporated herein by reference in its entirety). Non-limiting examples of elements for enhancing payload target specificity and expression include promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (polyA) signal sequences, and upstream enhancers (USEs), CMV enhancers, and introns.
[0159] In some embodiments, the AAV particles comprising the AAV capsid variants described herein include a viral genome comprising a nucleic acid comprising a transgene encoding a payload, wherein the transgene is operably linked to a promoter. In some embodiments, the promoter is a species-specific promoter, an inducible promoter, a tissue-specific promoter, or a cell cycle-specific promoter (e.g., the promoters described in Parr et al., Nat. Med. 3:1145-9 (1997), the content of which is incorporated herein by reference in its entirety).
[0160] In some embodiments, the promoter may be naturally occurring or may not be naturally occurring. Non-limiting examples of promoters include those derived from viruses, plants, mammals, or humans. In some embodiments, the promoter may be derived from human cells or systems. In some embodiments, the promoter may be shortened or mutated, e.g., it may be a promoter variant.
[0161] In some embodiments, the promoter is, for example, a ubiquitous promoter capable of expression in multiple tissues. In some embodiments, the promoter is a human elongation factor 1α subunit (EF1α) promoter, a cytomegalovirus (CMV) immediate early enhancer and / or promoter, a chicken β-actin (CBA) promoter and its derivative CAG, a β-glucuronidase (GUSB) promoter, or a ubiquitin C (UBC) promoter. In some embodiments, the promoter is, for example, a cell- or tissue-specific promoter capable of expression in tissues or cells of the central or peripheral nervous system, target regions therein (e.g., the prefrontal cortex), and / or subsets of cells therein (e.g., excitatory neurons). In some embodiments, the promoter is a cell type-specific promoter capable of expression of the payload in excitatory neurons (e.g., glutamatergic), inhibitory neurons (e.g., GABAergic), neurons of the sympathetic or parasympathetic nervous system, sensory neurons, neurons of the dorsal root ganglia, motor neurons, or supporting cells of the nervous system, such as microglia, glial cells, astrocytes, oligodendrocytes, and / or Schwann cells.
[0162] In some embodiments, the promoter is a liver-specific promoter (e.g., hAAT, TBG), a skeletal muscle-specific promoter (e.g., desmin, MCK, C512), a B cell promoter, a monocyte promoter, a leukocyte promoter, a macrophage promoter, a pancreatic acinar cell promoter, an endothelial cell promoter, a lung tissue promoter, and / or a heart or cardiovascular promoter (e.g., αMHC, cTnT, and CMV-MLC2k).
[0163] In some embodiments, the promoter is a tissue-specific promoter for payload expression in tissues or cells of the central nervous system. In some embodiments, the promoter is a synapsin (Syn) promoter, a vesicular glutamate transporter (VGLUT) promoter, a vesicular GABA transporter (VGAT) promoter, a parvalbumin (PV) promoter, a sodium channel Na v 1.8 promoter, a tyrosine hydroxylase (TH) promoter, a choline acetyltransferase (ChaT) promoter, a methyl-CpG binding protein 2 (MeCP2) promoter, Ca 2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, a metabotropic glutamate receptor 2 (mGluR2) promoter, a neurofilament light chain (NFL) or heavy chain (NFH) promoter, a neuron-specific enolase (NSE) promoter, a β-globin mini-gene nβ2 promoter, a preproenkephalin (PPE) promoter, an enkephalin (Enk) promoter, and an excitatory amino acid transporter 2 (EAAT2) promoter, or fragments thereof. In some embodiments, the promoter is a cell type-specific promoter that can be expressed in astrocytes, such as a glial fibrillary acidic protein (GFAP) promoter and an EAAT2 promoter, or fragments thereof. In some embodiments, the promoter is a cell type-specific promoter that can be expressed in oligodendrocytes, such as a myelin basic protein (MBP) promoter, or fragments thereof.
[0164] In some embodiments, the promoter is a GFAP promoter. In some embodiments, the promoter is a synapsin (syn or syn1) promoter, or a fragment thereof.
[0165] In some embodiments, the promoter comprises an insulin promoter, or a fragment thereof.
[0166] In some embodiments, the promoter of the viral genome described herein (e.g., contained within AAV particles including the AAV capsid variants described herein) includes, for example, an EF-1α promoter or a variant thereof as provided in Table 8. In some embodiments, the EF-1α promoter is any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999-1007, or any one of the sequences provided in Table 8, a nucleotide sequence that includes at least 1, 2, or 3, but 4 or fewer modifications, e.g., substitutions, relative to any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999-1007, or any one of the nucleotide sequences provided in Table 8, or a nucleotide sequence having at least 70% (e.g., 80, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) sequence identity to any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999-1007, or any one of the nucleotide sequences provided in Table 8.
Table 8-1
Table 8-2
Table 8-3
Table 8-4
[0167] Viral genome component: Untranslated region (UTR) In some embodiments, the wild-type untranslated region (UTR) of a gene is transcribed but not translated. Generally, the 5’UTR starts at the transcription start site and ends at the start codon, and the 3’UTR starts immediately after the stop codon and continues to the termination signal for transcription.
[0168] Features typically found in genes highly expressed in specific target organs (e.g., CNS tissue, muscle, or DRG) can be engineered into the UTRs to enhance stability and protein production. As a non-limiting example, the 5’ UTR from mRNAs normally expressed in the brain (e.g., huntingtin) can be used in the viral genome of the AAV particles described herein to enhance expression in central nervous system neuronal cells or other cells.
[0169] Without wishing to be bound by theory, wild-type 5’ untranslated regions (UTRs) contain features that play a role in translation initiation. The Kozak sequence, which is generally known to be involved in the process by which ribosomes initiate translation of many genes, is typically contained within the 5’ UTR. The Kozak sequence has the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), followed by another “G”.
[0170] In one embodiment, the 5’ UTR in the viral genome contains a Kozak sequence.
[0171] In one embodiment, the 5’ UTR in the viral genome does not contain a Kozak sequence.
[0172] While not wishing to be bound by theory, the wild-type 3’UTR is known to have stretches of adenosine and uridine embedded within it. These AU-rich signatures are particularly widespread within genes having a high turnover rate. Based on their sequence features and functional properties, AU-rich elements (AREs) can be divided into three classes (Chen et al, 1995, the contents of which are hereby incorporated by reference in their entirety): Class I AREs, such as but not limited to c-Myc and MyoD, contain several dispersed copies of the AUUUA motif within a U-rich region. Class II AREs, such as but not limited to GM-CSF and TNF-a, have two or more overlapping UUAUUUA(U / A)(U / A)9-mers. Class III AREs, such as but not limited to c-Jun and myogenin, are less well defined. These U-rich regions do not contain the AUUUA motif. Most proteins that bind to AREs are known to destabilize the messenger, but members of the ELAV family, notably HuR, have been demonstrated to increase mRNA stability. HuR binds to AREs of all three classes. Engineering the introduction of HuR-specific binding sites into the 3’UTR of a nucleic acid molecule results in HuR binding and thereby stabilizes the message in vivo.
[0173] The stability of a polynucleotide can be regulated using the introduction, removal or modification of 3’UTR AU-rich elements (AREs). When engineering a particular polynucleotide, such as the payload region of a viral genome, the introduction of one or more copies of an ARE can be used to decrease the stability of the polynucleotide, thereby reducing translation and decreasing the production of the resulting protein. Similarly, identifying, removing or mutating an ARE can be used to increase intracellular stability, thereby increasing translation and the production of the resulting protein.
[0174] In one embodiment, the 3’UTR of a viral genome can contain an oligo(dT) sequence for template addition of the polyA tail.
[0175] In one embodiment, the viral genome can include at least one miRNA seed, binding site, or full sequence. MicroRNA (or miRNA or miR) is a 19-25 nucleotide non-coding RNA that binds to a site on a nucleic acid target and downregulates gene expression by reducing the stability of the nucleic acid molecule or inhibiting translation. In some embodiments, the microRNA sequence includes a seed region having a Watson-Crick sequence that is fully or partially complementary to the miRNA target sequence of the nucleic acid, for example, the sequence of the region at positions 2-8 of the mature microRNA.
[0176] In one embodiment, the viral genome of the AAV particle can be engineered to include, modify, or remove at least one miRNA binding site, full sequence, or seed region.
[0177] Any UTR from any gene known in the art can be incorporated into the viral genome of the AAV particle. These UTRs or portions thereof may be arranged in the same orientation as the gene from which they were selected, or the orientation or position may be modified. In one embodiment, the UTRs used in the viral genome of the AAV particle can be inverted, shortened, extended, or created from one or more other 5' UTRs or 3' UTRs known in the art. As used herein, the term "modified" with respect to a UTR means that the UTR has changed in some way with respect to a reference sequence. For example, a 3' or 5' UTR may be altered relative to a wild-type or native UTR by a change in orientation or position as taught above, or may be altered by the inclusion of additional nucleotides, nucleotide deletions, nucleotide swapping, or transpositions.
[0178] In one embodiment, the viral genome of the AAV particle includes at least one artificial UTR that is not a variant of the wild-type UTR.
[0179] In one embodiment, the viral genome of the AAV particle comprises a UTR selected from a family of transcripts whose proteins share a common function, structure, feature, or property.
[0180] Viral genome component: Polyadenylation sequence The viral genome of the AAV particles described herein (e.g., AAV particles comprising an AAV capsid variant described herein) may comprise a polyadenylation sequence. In some embodiments, the viral genome of the AAV particle (e.g., AAV particles comprising an AAV capsid variant described herein) comprises a polyadenylation sequence between the 3' end of the nucleotide sequence encoding the payload and the 5' end of the 3' ITR.
[0181] Viral genome component: Intron In some embodiments, the viral genome of the AAV particles described herein (e.g., AAV particles comprising an AAV capsid variant) comprises an element for enhancing payload target specificity and expression (e.g., see Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, Discov. Med, 2015, 19(102):49-57, which is incorporated herein by reference in its entirety), such as an intron. Non-limiting examples of introns include MVM (67-97 bps), F.IX cleavage intron 1 (300 bps), β-globin SD / immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor / immunoglobulin splice acceptor (500 bps), SV40 late splice donor / splice acceptor (19S / 16S) (180 bps), and hybrid adenovirus splice donor / IgG splice acceptor (230 bps).
[0182] Viral genome component: Stuffing sequence In some embodiments, the viral genome of the AAV particles described herein (e.g., AAV particles comprising an AAV capsid polypeptide, e.g., an AAV capsid variant) includes elements for improving packaging efficiency and expression, such as a stuffer or filler sequence. Non-limiting examples of stuffer sequences include albumin and / or alpha-1 antitrypsin. Any known viral, mammalian, or plant sequence can be engineered for use as a stuffer sequence.
[0183] Viral genome component: miRNA In one embodiment, the viral genome includes a sequence encoding an miRNA to reduce payload expression in neurons of a tissue or cell, e.g., a dorsal root ganglion (DRG), or other ganglia such as those of the sympathetic or parasympathetic nervous system. In some embodiments, an miRNA, e.g., miR183, miR182, and / or miR96, can be encoded in the viral genome to regulate, e.g., reduce, viral genome expression in DRG neurons. As another non-limiting example, the miR122 miRNA can be encoded in the viral genome to regulate, e.g., reduce, viral genome expression in the liver. In some embodiments, an miRNA, e.g., miR142-3p, can be encoded in the viral genome to regulate, e.g., reduce, viral genome expression in hematopoietic lineage cells or tissues, including, e.g., antigen presenting cells or APCs (including, e.g., dendritic cells (DCs), macrophages, and B-lymphocytes). In some embodiments, an miRNA, e.g., miR1, can be encoded in the viral genome to regulate, e.g., reduce, viral genome expression in cardiac cells or tissues.
[0184] Viral genome component: miR binding site The tissue-specific or cell-specific expression of the AAV viral particles disclosed herein can be enhanced by introducing tissue-specific or cell-specific control sequences, such as promoters, enhancers, microRNA binding sites, such as targeting sites. Without wishing to be bound by theory, the encoded miR binding site is based on the expression of the corresponding endogenous microRNA (miRNA) or the corresponding regulated exogenous miRNA in a tissue or cell, such as a non-targeted cell or tissue, and can regulate, for example, prevent, suppress, or otherwise inhibit the expression of the gene of interest on the viral genome disclosed herein. In some embodiments, the miR binding site regulates, for example, reduces the expression of the payload encoded by the viral genome of the AAV particles described herein in the cell or tissue in which the corresponding mRNA is expressed.
[0185] In some embodiments, the viral genome of the AAV particles described herein comprises a nucleotide sequence encoding a microRNA binding site, such as a detargeting site. In some embodiments, the viral genome of the AAV particles described herein comprises a nucleotide sequence encoding a miR binding site, a series of microRNA binding sites (miR BS), or their reverse complements.
[0186] In some embodiments, the nucleotide sequence encoding the miR binding site series or the miR binding site is located in the 3'-UTR region of the viral genome (e.g., 3' to the nucleotide sequence encoding the payload), such as before the polyA sequence, in the 5'-UTR region of the viral genome (e.g., 5' to the nucleotide sequence encoding the payload), or both.
[0187] In some embodiments, the encoded miR binding site series contains at least 1 to 5 copies of the miR binding site (miR BS), for example, at least 1 to 3, 2 to 4, 3 to 5, 1, 2, 3, 4, 5, or more copies. In some embodiments, all copies are identical, for example, contain the same miR binding site. In some embodiments, the miR binding sites within the encoded miR binding site series are contiguous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by a spacer, for example, a non-coding sequence. In some embodiments, the spacer has a nucleotide length of about 1 to 6 nucleotides, or about 5 to 10 nucleotides, for example, about 7 to 8 nucleotides. In some embodiments, the spacer coding sequence or its reverse complement contains one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) to (iii). In some embodiments, the spacer is the nucleotide sequence of GATAGTTA, or has at least 1, 2, or 3 modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions, but has 4 or fewer modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to the nucleotide sequence of GATAGTTA.
[0188] In some embodiments, the encoded miR binding site series contains at least 1 to 5 copies of the miR binding site (miR BS), for example, at least 1 to 3, 2 to 4, 3 to 5, 1, 2, 3, 4, 5, or more copies. In some embodiments, at least 1, 2, 3, 4, 5, or all of the copies are different, for example, contain different miR binding sites. In some embodiments, the miR binding sites within the encoded miR binding site series are continuous and not separated by a spacer. In some embodiments, the miR binding sites within the encoded miR binding site series are separated by a spacer, for example, a non-coding sequence. In some embodiments, the spacer is about 1 to 6 nucleotides in length, or about 5 to 10 nucleotides, for example, about 7 to 8 nucleotides. In some embodiments, the spacer contains one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) to (iii). In some embodiments, the spacer contains a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, for example, substitutions (e.g., conservative substitutions), insertions, but 4 or fewer modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions.
[0189] In some embodiments, the encoded miR binding site is substantially identical (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical) to the miR in the host cell. In some embodiments, the encoded miR binding site contains at least 1, 2, 3, 4, or 5 mismatches, or 6 or fewer, 7 or fewer, 8 or fewer, 9 or fewer, or 10 or fewer mismatches with respect to the miR in the host cell. In some embodiments, the mismatched nucleotides are continuous. In some embodiments, the mismatched nucleotides are non - continuous. In some embodiments, the mismatched nucleotides occur outside the seed region binding sequence of the miR binding site, e.g., at one or both ends of the miR binding site. In some embodiments, the miR binding site is 100% identical to the miR in the host cell.
[0190] In some embodiments, the nucleotide sequence encoding the miR binding site is substantially complementary (e.g., at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% complementary) to the miR in the host cell. In some embodiments, the complementary sequence of the nucleotide sequence encoding the miR binding site contains at least 1, 2, 3, 4, or 5 mismatches, or 6 or fewer, 7 or fewer, 8 or fewer, 9 or fewer, or 10 or fewer mismatches with respect to the miR in the host cell. In some embodiments, the mismatched nucleotides are continuous. In some embodiments, the mismatched nucleotides are non - continuous. In some embodiments, the mismatched nucleotides occur outside the seed region binding sequence of the miR binding site, e.g., at one or both ends of the miR binding site. In some embodiments, the encoded miR binding site is 100% complementary to the miR in the host cell.
[0191] In some embodiments, the encoded miR binding site or sequence region is at least about 10 to 125 nucleotides in length, such as at least about 10 to 50 nucleotides in length, 10 to 100 nucleotides in length, 50 to 100 nucleotides in length, 50 to 125 nucleotides in length, or 100 to 125 nucleotides in length. In some embodiments, the encoded miR binding site or sequence region is at least about 7 to 28 nucleotides in length, such as at least about 8 to 28 nucleotides in length, 7 to 28 nucleotides in length, 8 to 18 nucleotides in length, 12 to 28 nucleotides in length, 20 to 26 nucleotides in length, 22 nucleotides in length, 24 nucleotides in length, or 26 nucleotides in length, and optionally includes at least one contiguous region (e.g., 7 or 8 nucleotides) that is complementary (e.g., fully or partially complementary) to the seed sequence of a miRNA (e.g., miR122, miR142, miR183, or miR1).
[0192] In some embodiments, the encoded miR binding site is complementary (e.g., fully or partially complementary) to an miR expressed in the liver or hepatocytes, such as miR122. In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises an miR122 binding site sequence. In some embodiments, the encoded miR122 binding site has the nucleotide sequence ACAAACACCATTGTCACACTCCA (SEQ ID NO: 4673), or has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4673, or comprises a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, insertions, or deletions, but having 10 or fewer modifications, e.g., insertions, deletions, or substitutions, wherein, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR122 binding site, e.g., of the series of encoded miR122 binding sites, optionally, the series of encoded miR122 binding sites has the nucleotide sequence ACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCACACAAACACCATTGTCACACTCCA (SEQ ID NO: 4674), or has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4674, or comprises a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, insertions, or deletions, but having 10 or fewer modifications, e.g., substitutions (e.g., conservative substitutions), insertions, or deletions, wherein, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA.In some embodiments, at least two of the encoded miR122 binding sites are directly connected, for example, without a spacer. In other embodiments, at least two of the encoded miR122 binding sites are located between two or more consecutive encoded miR122 binding site sequences, for example, separated by a spacer of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In embodiments, the spacer is about 1 to 6 nucleotides in length, or about 5 to 10 nucleotides in length, for example, about 7 to 8. In some embodiments, the spacer coding sequence or its reverse complement contains one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) to (iii). In some embodiments, the series of encoded miR binding sites includes at least 3 to 5 copies (e.g., 4 copies) of miR122 binding sites with or without a spacer, and the spacer is about 1 to 6 nucleotides in length or about 5 to 10 nucleotides in length, for example, about 7 to 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer is a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions, relative to the nucleotide sequence of GATAGTTA, but having 4 or fewer modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions.
[0193] In some embodiments, the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in the heart. In embodiments, the encoded miR binding site or series of encoded miR binding sites includes a miR1 binding site. In some embodiments, the encoded miR1 binding site has a nucleotide sequence of ATACATACTTCTTTACATTCCA (SEQ ID NO: 4679), or has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4679, or includes a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, e.g., substitutions, insertions, or deletions, but having 10 or fewer modifications, e.g., substitutions, insertions, or deletions, where, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome includes at least 2, 3, 4, or 5 copies of the encoded miR1 binding site, e.g., a series of encoded miR1 binding sites. In some embodiments, at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR1 binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides in length or about 5 to 10 nucleotides in length, e.g., about 7 to 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer sequence includes one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or repeats of one or more of (i)-(iii). In some embodiments, the spacer has a nucleotide sequence of GATAGTTA, or includes a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, but having 4 or fewer modifications, e.g., substitutions, insertions, or deletions, to the nucleotide sequence of GATAGTTA.
[0194] In some embodiments, the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed in the hematopoietic system, including immune cells (e.g., antigen presenting cells or APCs, including dendritic cells (DCs), macrophages, and B lymphocytes). In some embodiments, the encoded miR binding site complementary to a miR expressed in the hematopoietic system includes, for example, the nucleotide sequences disclosed in US2018 / 0066279, the entire content of which is incorporated herein by reference.
[0195] In embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR142-3p binding site sequence. In some embodiments, the encoded miR142-3p binding site has a nucleotide sequence of TCCATAAAGTAGGAAACACTACA (SEQ ID NO: 4675), and has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4675, or comprises a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, insertions, or deletions, but having 10 or fewer modifications, such as substitutions, insertions, or deletions, where, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR142-3p binding site, such as a series of encoded miR142-3p binding sites. In some embodiments, at least 2, 3, 4, or 5 copies (such as 2 or 3 copies) of the encoded miR142-3p binding site are contiguous (such as not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides in length or about 5 to 10 nucleotides in length, such as about 7 to 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i)-(iii). In some embodiments, the spacer has a nucleotide sequence of GATAGTTA, or comprises a nucleotide sequence having at least 1, 2, or 3 modifications, such as substitutions, insertions, or deletions, but having 4 or fewer modifications, such as substitutions, insertions, or deletions, with respect to the nucleotide sequence of GATAGTTA.
[0196] In some embodiments, the encoded miR binding site is complementary (e.g., fully or partially complementary) to a miR expressed at the miR183, miR182, and / or miR96 binding site in a dorsal root ganglion (DRG) neuron. In some embodiments, the encoded miR binding site complementary to a miR expressed in a DRG neuron comprises, for example, the nucleotide sequences disclosed in WO2020 / 132455, the contents of which are hereby incorporated by reference in their entirety.
[0197] In some embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR183 binding site sequence. In some embodiments, the encoded miR183 binding site has a nucleotide sequence of AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 4676), and has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4676, or comprises a nucleotide sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, insertions, or deletions, but having 10 or fewer modifications, such as substitutions, insertions, or deletions, where, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the sequence complementary to the seed sequence corresponds to the double-underlined portion of the encoded miR183 binding site sequence. In some embodiments, the viral genome comprises the encoded miR183 binding site, for example, at least 2, 3, 4, or 5 copies (e.g., at least 2 or 3 copies) of the encoded miR183 binding site. In some embodiments, at least 2, 3, 4, or 5 copies (e.g., 2 or 3 copies) of the encoded miR183 binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides in length or about 5 to 10 nucleotides in length, such as about 7 to 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer comprises a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, such as substitutions, insertions, or deletions, but having 4 or fewer modifications, such as substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i)-(iii).
[0198] In some embodiments, the encoded miR binding site or series of encoded miR binding sites includes a miR182 binding site sequence. In some embodiments, the encoded miR182 binding site has a nucleotide sequence of AGTGTGAGTTCTACCATTGCCAAA (SEQ ID NO: 4677), at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4677, or includes a sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, insertions, or deletions, but having 10 or fewer modifications, such as substitutions, insertions, or deletions, where, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome includes at least 2, 3, 4, or 5 copies of the encoded miR182 binding site, such as a series of encoded miR182 binding sites. In some embodiments, at least 2, 3, 4, or 5 copies (such as 2 or 3 copies) of the encoded miR182 binding site are contiguous (such as not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 - 6 nucleotides in length or about 5 - 10 nucleotides in length, such as about 7 - 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer has a nucleotide sequence of GATAGTTA, or includes a nucleotide sequence having at least 1, 2, or 3 modifications, such as substitutions, insertions, or deletions, but having 4 or fewer modifications, such as substitutions, insertions, or deletions, to the nucleotide sequence of GATAGTTA. In some embodiments, the spacer sequence includes one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) - (iii).
[0199] In certain embodiments, the encoded miR binding site or series of encoded miR binding sites comprises a miR96 binding site sequence. In some embodiments, the encoded miR96 binding site has a nucleotide sequence of AGCAAAAATGTGCTAGTGCCAAA (SEQ ID NO: 4678), and has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4678, or comprises a sequence having at least 1, 2, 3, 4, 5, 6, or 7 modifications, such as substitutions, insertions, or deletions, but having 10 or fewer modifications, such as substitutions, insertions, or deletions, where, for example, the modifications can result in mismatches between the encoded miR binding site and the corresponding miRNA. In some embodiments, the viral genome comprises at least 2, 3, 4, or 5 copies of the encoded miR96 binding site, such as a series of encoded miR96 binding sites. In some embodiments, at least 2, 3, 4, or 5 copies (such as 2 or 3 copies) of the encoded miR96 binding site are contiguous (e.g., not separated by a spacer) or are separated by a spacer. In some embodiments, the spacer is about 1 - 6 nucleotides in length or about 5 - 10 nucleotides in length, such as about 7 - 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer has a nucleotide sequence of GATAGTTA, or comprises a nucleotide sequence having at least 1, 2, or 3 modifications, such as substitutions, insertions, or deletions, but having 4 or fewer modifications, such as substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) - (iii).
[0200] In some embodiments, the encoded miR binding site series includes a miR122 binding site, miR1, miR142 binding site, miR183 binding site, miR182 binding site, miR96 binding site, or a combination thereof. In some embodiments, the encoded miR binding site series includes at least 2, 3, 4, or 5 copies of a miR122 binding site, miR142 binding site, miR183 binding site, miR182 binding site, miR96 binding site, or a combination thereof. In some embodiments, at least two of the encoded miR binding sites are directly connected, for example, without a spacer. In other embodiments, at least two of the encoded miR binding sites are located between two or more consecutive encoded miR binding site sequences, for example, separated by a spacer of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In an embodiment, the spacer is at least about 5-10 nucleotides, for example, about 7-8 nucleotides or about 8 nucleotides in length. In some embodiments, the spacer coding sequence or its reverse complement includes one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i)-(iii). In some embodiments, the spacer is a nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions, but having 4 or fewer modifications, for example, substitutions (e.g., conservative substitutions), insertions, or deletions, with respect to the nucleotide sequence of GATAGTTA.
[0201] In some embodiments, the series of encoded miR binding sites comprises at least 2, 3, 4, 5, or all combinations of at least 2 to 5 copies (e.g., 2 or 3 copies) of miR1, miR122 binding site, miR142 binding site, miR183 binding site, miR182 binding site, miR96 binding site, and each miR binding site within the series is contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides in length or about 5 to 10 nucleotides in length, e.g., about 7 to 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) to (iii). In some embodiments, the spacer is the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, but 4 or fewer modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
[0202] In some embodiments, the encoded series of miR binding sites comprises at least 2 to 5 copies (e.g., 2 or 3 copies) of a combination of miR122 binding sites and miR1 binding sites, and each of the miR binding sites within the series is either contiguous (e.g., not separated by a spacer) or separated by a spacer. In some embodiments, the spacer is about 1 to 6 nucleotides in length or about 5 to 10 nucleotides in length, e.g., about 7 to 8 nucleotides in length or about 8 nucleotides in length. In some embodiments, the spacer sequence comprises one or more of (i) GGAT, (ii) CACGTG, (iii) GCATGC, or one or more repeats of (i) to (iii). In some embodiments, the spacer is the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least 1, 2, or 3 modifications, e.g., substitutions, insertions, or deletions, but 4 or fewer modifications, e.g., substitutions, insertions, or deletions, relative to the nucleotide sequence of GATAGTTA.
[0203] Genome size In one embodiment, the AAV particles described herein (e.g., AAV particles comprising an AAV capsid variant) can comprise a single-stranded or double-stranded viral genome. The size of the viral genome can be small, medium, large, or maximum size. As described above, the viral genome can comprise a promoter and a polyA tail.
[0204] In one embodiment, the viral genome can be a small single-stranded viral genome. The small single-stranded viral genome can be about 2.1 to about 3.5 kb in size, e.g., but not limited to, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, or 3.5 kb in size.
[0205] In one embodiment, the viral genome may be a small double-stranded viral genome. The small double-stranded viral genome may have a size of about 1.3 to about 1.7 kb, and for example, without limitation, may have a size of 1.3, 1.4, 1.5, 1.6, or 1.7 kb.
[0206] In one embodiment, the viral genome may be a medium single-stranded viral genome. The medium single-stranded viral genome may have a size of about 3.6 to about 4.3 kb, and for example, without limitation, may have a size of 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, or 4.3 kb.
[0207] In one embodiment, the viral genome may be a medium double-stranded viral genome. The medium double-stranded viral genome may have a size of about 1.8 to about 2.1 kb, and for example, without limitation, may have a size of 1.8, 1.9, 2.0, and 2.1 kb.
[0208] In one embodiment, the viral genome may be a large single-stranded viral genome. The large single-stranded viral genome may have a size of about 4.4 to about 6.0 kb, and for example, without limitation, may have a size of 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, and 6.0 kb.
[0209] In one embodiment, the viral genome may be a large double-stranded viral genome. The large double-stranded viral genome may have a size of about 2.2 to about 3.0 kb, and for example, without limitation, may have a size of 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, and 3.0 kb.
[0210] Payload In some embodiments, the AAV particles of the present disclosure (e.g., AAV particles comprising an AAV capsid variant described herein) comprise a viral genome comprising a nucleic acid encoding a payload. In some embodiments, the encoded payload is an RNAi agent or a polypeptide. The payloads of the present disclosure can be, but are not limited to, peptides, polypeptides, proteins, antibodies, RNAi agents, and the like.
[0211] In some embodiments, the nucleotide sequence encoding the payload may comprise a combination of a coding nucleic acid sequence and a non-coding nucleic acid sequence. In some embodiments, the nucleotide sequence encoding the payload may encode a coding RNA or a non-coding RNA.
[0212] In some embodiments, the AAV particles described herein, e.g., AAV particles comprising an AAV capsid variant, comprise a nucleic acid encoding a payload. In some embodiments, the encoded payload comprises a therapeutic protein, an antibody, an enzyme, one or more components of a genome editing system, and / or an RNAi agent (e.g., dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA). In some embodiments, the encoded payload modulates, e.g., increases or decreases, the presence, level, and / or activity of a gene, mRNA, protein, or a combination thereof in, e.g., a cell or tissue.
[0213] Polypeptide In some embodiments, the encoded payload of the AAV capsid polypeptide described herein, such as an AAV capsid variant, comprises a polypeptide, protein, or peptide, such as the polypeptides, proteins, or peptides described herein. The nucleic acid encoding the payload can encode the product of any known gene and / or its recombinant version. In some embodiments, the nucleic acid encoding the payload can encode at least one allele of apolipoprotein E (APOE), such as, but not limited to, ApoE2, ApoE3, and / or ApoE4. In one embodiment, the nucleic acid encoding the payload encodes the ApoE2 (cys112, cys158) protein or a fragment or variant thereof. In one embodiment, the nucleic acid encoding the payload encodes the ApoE3 (cys112, arg158) protein or a fragment or variant thereof. In one embodiment, the nucleic acid encoding the payload encodes ApoE4 (arg112, arg158). As another non-limiting example, the encoded payload comprises the aromatic L-amino acid decarboxylase (AADC) protein. As another non-limiting example, the encoded payload comprises an antibody, or a fragment thereof. As another non-limiting example, the encoded payload comprises the human survival motor neuron (SMN) 1 or SMN2 protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload region comprises the glucocerebrosidase (GBA1) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload comprises the progranulin or progranulin (GRN) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload comprises the aspartoacylase (ASPA) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload comprises the tripeptidyl peptidase I (CLN2) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload comprises the beta-galactosidase (GLB1) protein, or a fragment or variant thereof.As another non-limiting example, the encoded payload includes an N-sulfo-glucosamine sulfohydrolase (SGSH) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload includes an N-acetyl-alpha-glucosaminidase (NAGLU) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload includes an iduronate 2-sulfatase (IDS) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload includes an intracellular cholesterol transporter (NPC1) protein, or a fragment or variant thereof. As another non-limiting example, the encoded payload includes a gigaxonin (GAN) protein, or a fragment or variant thereof. The AAV viral genome encoding the polypeptides described herein may be useful in the fields of human disease, virus, infectious disease veterinary applications, as well as various in vivo and in vitro settings.
[0214] The amino acid sequence of the payload polypeptide encoded by the viral genome described herein can be translated as the whole polypeptide, multiple polypeptides or fragments of the polypeptide, which can be independently encoded by one or more nucleic acids, fragments of nucleic acids, or variants of any of the foregoing.
[0215] Antibodies and antibody-binding fragments In some embodiments, the encoded payload of the AAV particles comprising the AAV capsid variants described herein comprises an antibody or an antibody-binding fragment. In some embodiments, the antibody can be a full antibody, fragment, or any functional variant thereof. By way of non-limiting example, the antibody can be a natural antibody (e.g., having two heavy chains and two light chains), a heavy chain variable region, a light chain variable region, a heavy chain constant region, a light chain constant region, a Fab, Fab’, F(ab’)2, Fv, or scFv fragment, a diabody, a linear antibody, a single-chain antibody, a multispecific antibody, an intrabody, one or more heavy chain complementarity determining regions (CDRs), one or more light chain CDRs, a bispecific antibody, a monoclonal antibody, a polyclonal antibody, a humanized antibody, an antibody mimetic, an antibody variant, a nanobody, a uniobody, a maxibody, and / or a chimeric antigen receptor. The encoded antibody or antibody-binding fragment can be useful for the treatment of neurological diseases, neurodegenerative disorders, muscle diseases, neuromuscular disorders, neuro-oncological disorders, or any disorder associated with the central and / or peripheral nervous system.
[0216] In some embodiments, the viral genome of the AAV particles (e.g., the AAV particles comprising the AAV capsid variants described herein) can comprise a nucleic acid engineered to enable or enhance the expression of an antibody, or an antibody-binding fragment thereof.
[0217] In some embodiments, the encoded antibody of the payload of the AAV particles comprising the AAV capsid variants described herein comprises at least one immunoglobulin variable domain sequence. The antibody can include, for example, full-length mature antibodies, and antigen-binding fragments of antibodies. For example, the antibody can include a heavy (H) chain variable domain sequence (VH) and a light (L) chain variable domain sequence (VL). In another example, the antibody includes two heavy (H) chain variable domain sequences and two light (L) chain variable domain sequences, thereby forming two antigen-binding sites such as Fab, Fab’, F(ab’)2, Fc, Fd, Fd’, Fv, single-chain antibodies (e.g., scFv), single variable domain antibodies, diabodies (Dab) (bivalent and bispecific), and chimeric (e.g., humanized) antibodies, which can be produced by modification of whole antibodies or newly synthesized antibodies using recombinant DNA technology. These functional antibody fragments, e.g., antibody-binding fragments, retain the ability to selectively bind to their respective antigens or receptors.
[0218] In some embodiments, an antibody binding fragment comprises at least one portion of an intact antibody or a recombinant variant thereof, and refers to an antigen-binding domain, e.g., the antigen-determining variable region of an intact antibody, which is sufficient to confer recognition and specific binding of the antibody fragment to a target such as an antigen. Examples of antigen-binding fragments include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains, (ii) an F(ab’)2 fragment, a divalent fragment comprising two Fab fragments linked by a disulfide bridge in the hinge region, (iii) an Fd fragment consisting of the VH and CH1 domains, (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a diabody (dAb) fragment consisting of a VH domain, (vi) a camelid or camelized variable domain, (vii) a single-chain Fv (scFv), e.g., see Bird et al. (1988) Science 242:423-426, and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883), and (viii) a single-domain antibody. These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and these fragments are screened for utility in the same manner as intact antibodies. Antibody fragments can also be incorporated into single-domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, tribodies, tetrabodies, v-NAR, and bis-scFv (e.g., see Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005).
[0219] In some embodiments, the encod...
Claims
1. An AAV capsid variant comprising an amino acid sequence having the following formula: [N1]-[N2]-[N3] (SEQ ID NO: 4681), wherein [N2] comprises the amino acid sequence of DWHR (SEQ ID NO: 4682), (i) [N1] is X 1 , X 2 , X 3 , and X 4 positions, and the position of X 4 is Q, K, E, S, P, R, N, or H, and / or (ii) [N3] is X 5 , X 6 , and X 7 positions, and the position of X 5 is I, V, T, M, S, N, L, or F, The AAV capsid variant, wherein the AAV capsid variant comprises the amino acid sequence at positions 203-736 of SEQ ID NO: 981, or an amino acid sequence having at least 95% identity to the amino acid sequence at positions 203-736 of SEQ ID NO:
981.
2. [N1] is X 1 , X 2 , X 3 , and X 4 positions, (i) The position of X 1 is T, S, R, A, I, C, N, K, L, or Q, (ii) The position of X 2 is N, T, G, V, S, Y, K, I, H, D, or F, (iii) The position of X 3 is T, N, K, D, I, S, P, A, Y, E, V, L, M, R, H, Q, or C, (iv) The position of X 4 is Q, K, E, S, P, R, N, or H. The AAV capsid variant according to Claim 1.
3. [N1] is TNTQ (SEQ ID NO: 4688), TNTK (SEQ ID NO: 4689), TNNQ (SEQ ID NO: 4690), SNNQ (SEQ ID NO: 4691), TNKQ (SEQ ID NO: 4692), TNNE (SEQ ID NO: 4693), SNKQ (SEQ ID NO: 4694), SNTQ (SEQ ID NO: 4695), TTNQ (SEQ ID NO: 4696), TNDQ (SEQ ID NO: 4697), TTIQ (SEQ ID NO: 4698), RNTQ (SEQ ID NO: 4699), TTKQ (SEQ ID NO: 4700), TTSQ (SEQ ID NO: 4701), TTDQ (SEQ ID NO: 4702), TNPS (SEQ ID NO: 4703), TNKE (SEQ ID NO: 4704), TTTQ (SEQ ID NO: 4705), TGKQ (SEQ ID NO: 4706), TTAQ (SEQ ID NO: 4707), TVKQ (SEQ ID NO: 4708), TNYQ (SEQ ID NO: 4709), TNTP (SEQ ID NO: 4710), STKQ (SEQ ID NO: 4711), TTEQ (SEQ ID NO: 4712), TSKQ (SEQ ID NO: 4713), TNIQ (SEQ ID NO: 4714), TYNQ (SEQ ID NO: 4715), STIQ (SEQ ID NO: 4716), TTVQ (SEQ ID NO: 4717), TGTQ (SEQ ID NO: 4718), TNTR (SEQ ID NO: 4719), TTLQ (SEQ ID NO: 4720), TTMQ (SEQ ID NO: 4721), ANNQ (SEQ ID NO: 4722), SNIQ (SEQ ID NO: 4723), TKNQ (SEQ ID NO: 4724), TYTQ (SEQ ID NO: 4725), TNKS (SEQ ID NO: 4726), SNTE (SEQ ID NO: 4727), TNTE (SEQ ID NO: 4728), TNIE (SEQ ID NO: 4729), TTRQ (SEQ ID NO: 4730), TNSQ (SEQ ID NO: 4731), TYTK (SEQ ID NO: 4732), TTTK (SEQ ID NO: 4733), TNIQ (SEQ ID NO: 4734), SNTK (SEQ ID NO: 4735), TNNK (SEQ ID NO: 4736), TNSK (SEQ ID NO: 4737), TSTK (SEQ ID NO: 4738), TITK (SEQ ID NO: 4739), INTK (SEQ ID NO: 4740), TNAK (SEQ ID NO: 4741), TKTK (SEQ ID NO: 4742), STNQ (SEQ ID NO: 4743), ANTK (SEQ ID NO: 4744), RNNQ (SEQ ID NO: 4745), TGNQ (SEQ ID NO: 4746), TSNQ (SEQ ID NO: 4747), THTK (SEQ ID NO: 4748), TDTK (SEQ ID NO: 4749), TNEQ (SEQ ID NO: 4750), CNTQ (SEQ ID NO: 4751), TNPK (SEQ ID NO: 4752), INNQ (SEQ ID NO: 4753),An AAV capsid variant according to claim 1 or 2, comprising TYTQ (SEQ ID NO: 4754), NNNQ (SEQ ID NO: 4755), KNNQ (SEQ ID NO: 4756), TNNR (SEQ ID NO: 4757), LNNQ (SEQ ID NO: 4758), TINQ (SEQ ID NO: 4759), TNHQ (SEQ ID NO: 4760), STTQ (SEQ ID NO: 4761), SNSQ (SEQ ID NO: 4762), STSQ (SEQ ID NO: 4763), TYIQ (SEQ ID NO: 4764), SGTQ (SEQ ID NO: 4765), THNQ (SEQ ID NO: 4766), TITQ (SEQ ID NO: 4767), TSTQ (SEQ ID NO: 4768), TNSN (SEQ ID NO: 4769), TNQQ (SEQ ID NO: 4770), RNIQ (SEQ ID NO: 4771), TNNP (SEQ ID NO: 4772), TITE (SEQ ID NO: 4773), TNTN (SEQ ID NO: 4774), TFSQ (SEQ ID NO: 4775), RNSQ (SEQ ID NO: 4776), INTQ (SEQ ID NO: 4777), RNTE (SEQ ID NO: 4778), TNNH (SEQ ID NO: 4779), TNMQ (SEQ ID NO: 4780), RTTQ (SEQ ID NO: 4781), SNIE (SEQ ID NO: 4782), TNTs (SEQ ID NO: 4783), KNTQ (SEQ ID NO: 4784), TNLQ (SEQ ID NO: 4785), TSMQ (SEQ ID NO: 4786), SYTQ (SEQ ID NO: 4787), TNcq (SEQ ID NO: 4788), SSTQ (SEQ ID NO: 4789), TVTQ (SEQ ID NO: 4790), or QNTQ (SEQ ID NO: 4791). **Claim 4** An AAV capsid variant according to any one of claims 1 to 3, wherein [N1] comprises TNTQ (SEQ ID NO: 4688) or TNTK (SEQ ID NO: 4689). **Claim 5** [N1]-[N2] is TNTQDWHF (SEQ ID NO: 4898), TNTKDWHF (SEQ ID NO: 4899), TNNQDWHF (SEQ ID NO: 4900), SNNQDWHF (SEQ ID NO: 4901), TNKQDWHF (SEQ ID NO: 4902), TNNEDWHF (SEQ ID NO: 4903), SNKQDWHF (SEQ ID NO: 4904), SNTQDWHF (SEQ ID NO: 4905), TTNQDWHF (SEQ ID NO: 4906), TNDQDWHF (SEQ ID NO: 4907), TTIQDWHF (SEQ ID NO: 4908), RNTQDWHF (SEQ ID NO: 4909), TTKQDWHF (SEQ ID NO: 4910), TTSQDWHF (SEQ ID NO: 4911), TTDQDWHF (SEQ ID NO: 4912), TNPSDWHF (SEQ ID NO: 4913), TNKEDWHF (SEQ ID NO: 4914), TTTQDWHF (SEQ ID NO: 4915), TGKQDWHF (SEQ ID NO: 4916), TTAQDWHF (SEQ ID NO: 4917), TVKQDWHF (SEQ ID NO: 4918), TNYQDWHF (SEQ ID NO: 4919), TNTPDWHF (SEQ ID NO: 4920), STKQDWHF (SEQ ID NO: 4921), TTEQDWHF (SEQ ID NO: 4922), TSKQDWHF (SEQ ID NO: 4923), TNIQDWHF (SEQ ID NO: 4924), TY NQDWHF (SEQ ID NO: 4925), STIQDWHF (SEQ ID NO: 4926), TTVQDWHF (SEQ ID NO: 4927), TGTQDWHF (SEQ ID NO: 4928), TNTRDWHF (SEQ ID NO: 4929), TT LQDWHF (SEQ ID NO: 4930), TTMQDWHF (SEQ ID NO: 4931), ANNQDWHF (SEQ ID NO: 4932), SNIQDWHF (SEQ ID NO: 4933), TKNQDWHF (SEQ ID NO: 4934), TY TQDWHF (SEQ ID NO: 4935), TNKSDWHF (SEQ ID NO: 4936), SN TEDWHF (SEQ ID NO: 4937), TN TEDWHF (SEQ ID NO: 4938), TN IEDWHF (SEQ ID NO: 4939), TTRQDWHF (SEQ ID NO: 4940), TN SQDWHF (SEQ ID NO: 4941), TY TKDWHF (SEQ ID NO: 4942), TTTKDWHF (SEQ ID NO: 4943), TN IKDWHF (SEQ ID NO: 4944), SN TKDWHF (SEQ ID NO: 4945), TN NKDWHF (SEQ ID NO: 4946), TN SKDWHF (SEQ ID NO: 4947), TSTKDWHF (SEQ ID NO: 4948), TITKDWHF (SEQ ID NO: 4949),INTKDWHR (SEQ ID NO: 4950), TNAKDWHR (SEQ ID NO: 4951), TKTKDWHR (SEQ ID NO: 4952), STNQDWR (SEQ ID NO: 4953), ANTKDWHR (SEQ ID NO: 4954), RNNQDWR (SEQ ID NO: 4955), TGNQDWR (SEQ ID NO: 4956), TSNQDWR (SEQ ID NO: 4957), THTKDWHR (SEQ ID NO: 4958), TDTKDWHR (SEQ ID NO: 4959), TNEQDWR (SEQ ID NO: 4960), CNTQDWR (SEQ ID NO: 4961), TNPKDWR (SEQ ID NO: 4962), INNQDWR (SEQ ID NO: 4963), TYTEDWR (SEQ ID NO: 4964), NNNQDWR (SEQ ID NO: 4965), KNNQDWR (SEQ ID NO: 4966), TNNRDWR (SEQ ID NO: 4967), LNNQDWR (SEQ ID NO: 4968), TINQDWR (SEQ ID NO: 4969), TNHQDWR (SEQ ID NO: 4970), STTQDWR (SEQ ID NO: 4971), SNSQDWR (SEQ ID NO: 4972), STSQDWR (SEQ ID NO: 4973), TYIQDWR (SEQ ID NO: 4974), SGTQDWR (SEQ ID NO: 4975), THNQDWR (SEQ ID NO: 4976), TITQDWR (SEQ ID NO: 4977), TSTQDWR (SEQ ID NO: 4978), TNSNDWR (SEQ ID NO: 4979), TNQQDWR (SEQ ID NO: 4980), RNIQDWR (SEQ ID NO: 4981), TNNPDWR (SEQ ID NO: 4982), TITEDWR (SEQ ID NO: 4983), TNTDWR (SEQ ID NO: 4984), TFSQDWR (SEQ ID NO: 4985), RNSQDWR (SEQ ID NO: 4986), INTQDWR (SEQ ID NO: 4987), RNTDWR (SEQ ID NO: 4988), TNNHDR (SEQ ID NO: 4989), TNMQDWR (SEQ ID NO: 4990), RTTQDWR (SEQ ID NO: 4991), SNIEDWR (SEQ ID NO: 4992), TNTSDWR (SEQ ID NO: 4993), KNTQDWR (SEQ ID NO: 4994), TNLQDWHR (SEQ ID NO: 4995), TSMQDWR (SEQ ID NO: 4996), SYTQDWR (SEQ ID NO: 4997), TNCDWR (SEQ ID NO: 4998), SSTQDWR (SEQ ID NO: 4999), TVTQDWR (SEQ ID NO: 5000), or QNTQDWR (SEQ ID NO: 5001)The AAV capsid variant according to any one of claims 1 to 4.
6. The AAV capsid variant according to any one of claims 1 to 5, wherein [N1]-[N2] comprises TNTQDWR (SEQ ID NO: 4898) or TNTKDWR (SEQ ID NO: 4899).
7. [N3] is X 5 、X 6 、and X 7 positions, (i) the X 6 position is A, Y, P, N, S, T, G, E, V, W, F, or Q, (ii) the X 7 position is Q, G, N, K, H, R, E, L, P, or M, (iii) the X 5 position is I, V, T, M, S, N, L, or F, the AAV capsid variant according to any one of claims 1 to 6.
8. The AAV capsid variant according to any one of claims 1 to 7, wherein [N3] comprises IAQ, IAG, IYQ, VPQ, IAN, INQ, VNQ, VYQ, VAN, ISG, ISQ, VAQ, ITQ, TAQ, MAQ, SAQ, IGQ, IEQ, IVQ, NAQ, LAQ, IAK, IAH, IPQ, IAR, IAE, IAL, IAP, FAQ, VSQ, VTM, ISM, IWQ, IFQ, IQQ, VQQ, IFM, IAM, or ISN.
9. The AAV capsid variant according to any one of claims 1 to 8, wherein [N2]-[N3] comprises DWHRI AQ (SEQ ID NO: 5027), DWHRI AG (SEQ ID NO: 5028), DWHRI YQ (SEQ ID NO: 5029), DWHRI VPQ (SEQ ID NO: 5030), DWHRI AN (SEQ ID NO: 5031), DWHRI NQ (SEQ ID NO: 5032), DWHRI VNQ (SEQ ID NO: 5033), DWHRI VYQ (SEQ ID NO: 5034), DWHRI VAN (SEQ ID NO: 5035), DWHRI SG (SEQ ID NO: 5036), DWHRI SQ (SEQ ID NO: 5037), DWHRI VAQ (SEQ ID NO: 5038), DWHRI TQ (SEQ ID NO: 5039), DWHRI TAQ (SEQ ID NO: 5040), DWHRI MAQ (SEQ ID NO: 5041), DWHRI SAQ (SEQ ID NO: 5042), DWHRI GQ (SEQ ID NO: 5043), DWHRI EQ (SEQ ID NO: 5044), DWHRI VQ (SEQ ID NO: 5045), DWHRI NQ (SEQ ID NO: 5046), DWHRI LAQ (SEQ ID NO: 5047), DWHRI AK (SEQ ID NO: 5048), DWHRI AH (SEQ ID NO: 5049), DWHRI PQ (SEQ ID NO: 5050), DWHRI AR (SEQ ID NO: 5051), DWHRI AE (SEQ ID NO: 5052), DWHRI AL (SEQ ID NO: 5053), DWHRI AP (SEQ ID NO: 5054), DWHRI FAQ (SEQ ID NO: 5055), DWHRI VSQ (SEQ ID NO: 5056), DWHRI VTM (SEQ ID NO: 5057), DWHRI SM (SEQ ID NO: 5058), DWHRI WQ (SEQ ID NO: 5059), DWHRI FQ (SEQ ID NO: 5060), DWHRI QQ (SEQ ID NO: 5061), DWHRI VQQ (SEQ ID NO: 5062), DWHRI FM (SEQ ID NO: 5063), DWHRI AM (SEQ ID NO: 5064), or DWHRI SN (SEQ ID NO: 5065).
10. The AAV capsid variant according to any one of claims 1 to 9, wherein [N2]-[N3] comprises DWHRI AQ (SEQ ID NO: 5027).
11. The AAV capsid variant according to any one of claims 1 to 10, wherein [N1]-[N2]-[N3] comprises any one amino acid sequence of SEQ ID NOs: 343 to 538.
12. The AAV capsid variant according to any one of claims 1 to 11, wherein [N1]-[N2]-[N3] comprises TNTQDWHRIQ (SEQ ID NO: 343) or TNTKDWHRIQ (SEQ ID NO: 344). **Claim 13** Further comprising [N4], wherein [N4] comprises the X 8 , X 9 , X 10 , and X 11 positions, and (i) the X 8 position is T, S, N, P, A, or I, (ii) the X 9 position is G, N, D, R, V, A, S, or Q, (iii) the X 10 position is W, S, C, R, L, or G, and / or (iv) the X 11 position is V, A, S, I, C, G, D, F, L, or T, the AAV capsid variant according to any one of claims 1 to 12. **Claim 14** The AAV capsid variant according to claim 13, wherein [N4] comprises TGWV (SEQ ID NO: 5066), TGWA (SEQ ID NO: 5067), TNWS (SEQ ID NO: 5068), SNWV (SEQ ID NO: 5069), TNWV (SEQ ID NO: 5070), TNWI (SEQ ID NO: 5071), NNW (SEQ ID NO: 5072), TGWS (SEQ ID NO: 5073), TGWI (SEQ ID NO: 5074), TGWC (SEQ ID NO: 5075), TGWG (SEQ ID NO: 5076), SGWV (SEQ ID NO: 5077), PGWV (SEQ ID NO: 5078), TGSV (SEQ ID NO: 5079), TDWV (SEQ ID NO: 5080), TGCV (SEQ ID NO: 5081), TGRV (SEQ ID NO: 5082), TGLV (SEQ ID NO: 5083), TGGV (SEQ ID NO: 5084), AGWV (SEQ ID NO: 5085), IGW (SEQ ID NO: 5086), TGWD (SEQ ID NO: 5087), NGWV (SEQ ID NO: 5088), TGWF (SEQ ID NO: 5089), TRWV (SEQ ID NO: 5090), TVWV (SEQ ID NO: 5091), TGWL (SEQ ID NO: 5092), TAWV (SEQ ID NO: 5093), TSWV (SEQ ID NO: 5094), TGWT (SEQ ID NO: 5095), SVWV (SEQ ID NO: 5096), TQWV (SEQ ID NO: 5097), or PGWG (SEQ ID NO: 5098).
15. [N1]-[N2]-[N3]-[N4] is (i) any one of the amino acid sequences of SEQ ID NOs: 201-245, 247-250, 253-255, 257-265, 268-274, 276-286, 288, 290-297, 299-303, 305-309, 311, 313-319, 323-328, 330-337, 339-342, 539-542, 544, 546, 547, 549-557, 559-589, 592, 593, 595, 596, 598, 599, 601-608, 610-614, 616-622, 625, 628, 630, 631, 633, 636, 638, 639-646, 649, 651-657, 667, 669, 670, 672, 673, 679-683, 685-690, 692, 693, 695, 697, 699-701, 703-705, 708-710, 712-717, 719-723, 728-731, 733-738, 740, or 742; (ii) TNTQDWHRI AQTGV (SEQ ID NO: 201), or (iii) TNTKDWHRI AQTGV (SEQ ID NO: 202), the AAV capsid variant according to claim 13 or 14.
16. (a) [N1]-[N2]-[N3] is present in loop VIII, and / or (b) [N4] is present in loop VIII, loop VIII contains positions 580 to 599 of SEQ ID NO: 981, the AAV capsid variant according to any one of claims 13 to 15.
17. (i) X of [N1], numbered according to SEQ ID NO: 981 1 is present at position 582, X of [N1] 2 is present at position 583, X of [N1] 3 is present at position 584, X of [N1] 4 is present at position 585, (ii) [N2], numbered according to SEQ ID NO: 981, is present at positions 586 to 589, (iii) X of [N3], numbered according to SEQ ID NO: 981 5 is present at position 590, X of [N3] 6 is present at position 591, X of [N3] 7 is present at position 592, (iv) X of [N4], numbered according to SEQ ID NO: 981 8 is present at position 593, X of [N4] 9 is present at position 594, X of [N4] 10 is present at position 595, X of [N4] 11 is present at position 596, the AAV capsid variant according to any one of claims 13 to 16.
18. An AAV capsid variant, (a) the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15 or 16, (b) an amino acid sequence comprising at least 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, or (c) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, or (d) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, substitutions relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 9, 14, 15, or 16, and the AAV capsid variant, wherein the AAV capsid variant comprises the amino acid sequence at positions 203 to 736 of SEQ ID NO: 981, or an amino acid sequence that is at least 95% identical to the amino acid sequence at positions 203 to 736 of SEQ ID NO:
981.
19. (a) the amino acid sequence of any one of SEQ ID NOs: 201 to 245, 247 to 250, 253 to 255, 257 to 265, 268 to 274, 276 to 286, 288, 290 to 297, 299 to 303, 305 to 309, 311, 313 to 319, 323 to 328, 330 to 337, 339 to 342, 539 to 542, 544, 546, 547, 549 to 557, 559 to 589, 592, 593, 595, 596, 598, 599, 601 to 608, 610 to 614, 616 to 622, 625, 628, 630, 631, 633, 636, 638, 639 to 646, 649, 651 to 657, 667, 669, 670, 672, 673, 679 to 683, 685 to 690, 692, 693, 695, 697, 699 to 701, 703 to 705, 708 to 710, 712 to 717, 719 to 723, 728 to 731, 733 to 738, 740, 742, or 941; (b) an amino acid sequence comprising at least 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of SEQ ID NOs: 201-245, 247-250, 253-255, 257-265, 268-274, 276-286, 288, 290-297, 299-303, 305-309, 311, 313-319, 323-328, 330-337, 339-342, 539-542, 544, 546, 547, 549-557, 559-589, 592, 593, 595, 596, 598, 599, 601-608, 610-614, 616-622, 625, 628, 630, 631, 633, 636, 638, 639-646, 649, 651-657, 667, 669, 670, 672, 673, 679-683, 685-690, 692, 693, 695, 697, 699-701, 703-705, 708-710, 712-717, 719-723, 728-731, 733-738, 740, 742, or 941; (c) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, different amino acids relative to any one of SEQ ID NOs: 201-245, 247-250, 253-255, 257-265, 268-274, 276-286, 288, 290-297, 299-303, 305-309, 311, 313-319, 323-328, 330-337, 339-342, 539-542, 544, 546, 547, 549-557, 559-589, 592, 593, 595, 596, 598, 599, 601-608, 610-614, 616-622, 625, 628, 630, 631, 633, 636, 638, 639-646, 649, 651-657, 667, 669, 670, 672, 673, 679-683, 685-690, 692, 693, 695, 697, 699-701, 703-705, 708-710, 712-717, 719-723, 728-731, 733-738, 740, 742, or 941; or The AAV capsid variant according to claim 18, comprising an amino acid sequence containing at least 1, 2, or 3, but 4 or fewer substitutions, for any one of the amino acid sequences of SEQ ID NOs: 201 to 245, 247 to 250, 253 to 255, 257 to 265, 268 to 274, 276 to 286, 288, 290 to 297, 299 to 303, 305 to 309, 311, 313 to 319, 323 to 328, 330 to 337, 339 to 342, 539 to 542, 544, 546, 547, 549 to 557, 559 to 589, 592, 593, 595, 596, 598, 599, 601 to 608, 610 to 614, 616 to 622, 625, 628, 630, 631, 633, 636, 638, 639 to 646, 649, 651 to 657, 667, 669, 670, 672, 673, 679 to 683, 685 to 690, 692, 693, 695, 697, 699 to 701, 703 to 705, 708 to 710, 712 to 717, 719 to 723, 728 to 731, 733 to 738, 740, 742, or 941.
20. An AAV capsid variant comprising an amino acid sequence having at least 95% sequence identity with positions 203 to 736 of SEQ ID NO: 981, wherein the AAV capsid variant comprises amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO:
981.
21. An AAV capsid variant comprising an amino acid sequence having at least 95% sequence identity with positions 138 to 736 of SEQ ID NO: 981, wherein the AAV capsid variant comprises amino acids T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, numbered according to SEQ ID NO:
981.
22. An AAV capsid variant comprising an amino acid sequence having at least 95% sequence identity with SEQ ID NO: 981, wherein the AAV capsid variant is numbered according to SEQ ID NO: 981 and has amino acid T at position 584, D at position 586, W at position 587, H at position 588, R at position 589, and I at position 590, said AAV capsid variant.
23. The AAV capsid variant according to any one of claims 1 to 20, comprising the amino acid sequence of positions 203 to 736 of SEQ ID NO:
981.
24. The AAV capsid variant according to any one of claims 1 to 21 or 23, comprising the amino acid sequence of positions 138 to 736 of SEQ ID NO:
981.
25. The AAV capsid variant according to any one of the preceding claims, comprising the amino acid sequence of SEQ ID NO:
981.
26. An AAV capsid variant comprising the amino acid sequence of SEQ ID NO:
981.
27. The following characteristics: (i) Increased tropism for CNS cells or tissues, such as brain cells, brain tissue, spinal cord cells, or spinal cord tissue, relative to the tropism of a reference sequence comprising the amino acid sequence of SEQ ID NO: 138, (ii) When transducing brain regions, such as the sensory cortex, motor cortex, nucleus accumbens, thalamus, caudate nucleus, hippocampus, cerebellum, and optionally measuring, for example, by an assay as described in Example 2, such as an immunohistochemical assay, or a qPCR or ddPCR assay, the level of transduction is at least 39, 50, 100, 120, 132, 146, 150, 161, 174, 175, 200, 225, 250, 275, 283, 300, 350, 400, 450, 500, 525, 528, or 550 times greater compared to the reference sequence of SEQ ID NO:
138. (iii) When measured by an assay as described in Example 1 or 3, at least about 10, 14, 20, 24, 50, 100, 150, 200, 250, 300, 350, 400, 425, 450, or 460-fold enriched in the brain as compared to the reference sequence of SEQ ID NO: 138, (iv) When measured by an assay as described in Example 1, at least about 200, 300, 400, 425, 450, or 460-fold enriched in the brain as compared to the reference sequence of SEQ ID NO: 138, (v) When measured by an assay as described in Example 1 or 4, at least 2 to 3 species, for example, at least about 2, 3, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 190, 200, 205, or 210-fold enriched in the brain of at least non-human primates and rodents (e.g., mice) as compared to the reference sequence of SEQ ID NO: 138, (vi) When measured by an assay as described in Example 3, at least about 2, 3, 4, 5, 10, 15, 17, 20, 50, 75, 100, 103, 107, 125, 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1200-fold enriched in the brain as compared to the reference sequence of SEQ ID NO: 981, (vi) Delivering an increased level of payload to a brain region and optionally, when measured by an assay (e.g., as described in Example 2), such as a qRT-PCR, ddPCR, or qPCR assay, for example, the level of the payload is at least 39, 50, 100, 120, 132, 146, 150, 161, 174, 175, 200, 225, 250, 275, 283, 300, 350, 400, 450, 500, 525, 528, or 550-fold increased as compared to the reference sequence of SEQ ID NO: 138, (v) delivering an increased level of viral genome to the brain region and optionally measuring, for example, by an assay (such as the assay described in Example 2), e.g., a qRT-PCR or qPCR assay, wherein the level of the viral genome is increased by at least 2, 5, 7, 10, 15, 19, 20, 22, or 25-fold as compared to the reference sequence of SEQ ID NO: 138, (vi) being enriched by at least about 5, 10, 50, 100, 115, 120, 150, 175, 200, 207, 225, 250, or 275-fold in the spinal cord as compared to the reference sequence of SEQ ID NO: 138 when measured by an assay such as that described in Example 1 or 2, including one, two, three, four, five, six, or all of them, the AAV capsid variant according to any one of the preceding claims.
28. A polynucleotide encoding the AAV capsid variant according to any one of claims 1 to 27.
29. A polynucleotide encoding an AAV capsid variant, wherein the polynucleotide (i) comprises a nucleotide sequence that has at least 1, 2, 3, 4, 5, 6, or 7, but no more than 10, different nucleotides as compared to the nucleotide sequence of SEQ ID NO: 942, (iii) the nucleotide sequence of SEQ ID NO: 942, or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and / or (iv) the nucleotide sequence of SEQ ID NO: 983, or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and optionally the polynucleotide comprises a nucleotide sequence that is codon-optimized.
30. A peptide, wherein (a) the amino acid sequence of any of the sequences provided in Tables 1, 2A, 2B, 14, 15, or 16 (b) an amino acid sequence comprising at least 7, 8, 9, 10, 11, 12, 13, or 14 consecutive amino acids from any one of the sequences provided in Tables 1, 2A, 2B, 14, 15, or 16, (c) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 14, 15, or 16, or (d) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, substitutions relative to the amino acid sequence of any one of the sequences provided in Tables 1, 2A, 2B, 14, 15, or 16, the peptide comprising the same.
31. A peptide, (i) the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (ii) an amino acid sequence comprising at least 1, 2, or 3, but 4 or fewer, different amino acids relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), (iii) an amino acid sequence comprising at least 1, 2, or 3 substitutions, but 4 or fewer substitutions, relative to the amino acid sequence of TQDWHRI (SEQ ID NO: 941), or (iv) the peptide comprising at least 3, 4, 5, or 6 consecutive amino acids from the amino acid sequence of TQDWHRI (SEQ ID NO: 941).
32. An AAV capsid variant comprising the peptide according to Claim 31, wherein the peptide is present at positions 584 - 590 numbered according to SEQ ID NO: 981 or 138.
33. An AAV particle comprising the AAV capsid variant according to Claim 32.
34. An AAV particle comprising an AAV capsid variant according to any one of claims 1 to 27, an AAV capsid variant encoded by a polynucleotide according to claim 28 or 29, or an AAV capsid variant comprising a peptide according to claim 30 or 31.
35. An AAV particle according to claim 33 or 34, comprising a nucleotide sequence encoding a payload, optionally wherein the encoded payload comprises a therapeutic protein or a functional variant thereof, an antibody or an antibody fragment, an enzyme, a component of a gene editing system, an RNAi agent (e.g., dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA), or a combination thereof.
36. (i) the therapeutic protein or a functional variant thereof, e.g., a recombinant protein, is associated with (e.g., abnormally expressed in) a neurological or neurodegenerative disorder, a muscle disorder or neuromuscular disorder, or a neuro-oncological disorder, and optionally, the therapeutic protein or a functional variant thereof is selected from apolipoprotein E (ApoE) (e.g., ApoE2, ApoE3, and / or ApoE4), human survival motor neuron (SMN) 1 or SMN2, glucocerebrosidase (GBA1), aromatic L-amino acid decarboxylase (AADC), aspartoacylase (ASPA), tripeptidyl peptidase I (CLN2), beta-galactosidase (GLB1), N-sulphoglucosamine sulphohydrolase (SGSH), N-acetyl-alpha-glucosaminidase (NAGLU), iduronate 2-sulphatase (IDS), intracellular cholesterol transporter (NPC1), gigaxonin (GAN), or a combination thereof, (ii) the antibody or antibody binding fragment is (a) a CNS-related target, e.g., an antigen associated with a neurological or neurodegenerative disorder, e.g., beta-amyloid, ApoE, tau, SOD1, TDP-43, huntingtin (HTT), and / or synuclein, (b) a muscle or neuromuscular-related target, for example, an antigen associated with a muscle disorder or a neuromuscular disorder, or (c) binds to a nerve tumor-related target, for example, a nerve tumor disorder, for example, an antigen associated with HER2, or EGFR (for example, EGFRvIII), (iii) the enzyme comprises a meganuclease, zinc finger nuclease, TALEN, recombinase, integrase, base editor, Cas9, or a fragment thereof, (iv) the components of the gene editing system comprise one or more components of the CRISPR-Cas system, optionally, the one or more components of the CRISPR-Cas system comprise Cas9, for example, a Cas9 ortholog or Cpf1, and a single guide RNA (sgRNA), (a) the sgRNA is located upstream (5') of the cas9 enzyme, and / or (b) the sgRNA is located downstream (3') of the cas9 enzyme, and / or (v) the RNAi agent (for example, dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA) regulates, for example, inhibits the expression of a CNS-related gene, mRNA, and / or protein, optionally, the CNS-related gene is selected from SOD1, MAPT, APOE, HTT, C9ORF72, TDP-43, APP, BACE, SNCA, ATXN1, ATXN3, ATXN7, SCN1A-SCN5A, SCN8A-SCN11A, or a combination thereof, the AAV particle according to claim 35.
37. comprising a viral genome comprising a promoter operably linked to the nucleic acid sequence encoding the payload, optionally, (i) the promoter is selected from human elongation factor 1α-subunit (EF1α), cytomegalovirus (CMV) immediate early enhancer and / or promoter, chicken β-actin (CBA) and its derivative CAG, β-glucuronidase (GUSB), or ubiquitin C (UBC), neuron-specific enolase (NSE), platelet-derived growth factor (PDGF), platelet-derived growth factor B chain (PDGF-β), intercellular adhesion molecule 2 (ICAM-2), synapsin (Syn), methyl-CpG binding protein 2 (MeCP2), Ca2+ / calmodulin-dependent protein kinase II (CaMKII), metabotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or heavy chain (NFH), β-globin mini-gene nβ2, preproenkephalin (PPE), enkephalin (Enk) and excitatory amino acid transporter 2 (EAAT2), glial fibrillary acidic protein (GFAP), myelin basic protein (MBP), cardiovascular promoters (e.g., αMHC, cTnT, and CMV-MLC2k), liver promoters (e.g., hAAT, TBG), skeletal muscle promoters (e.g., desmin, MCK, C512) or fragments thereof, e.g., truncated forms, or functional variants thereof, or (ii) the promoter is an EF-1a promoter variant, e.g., a truncated EF-1a promoter, or (iii) the promoter is any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999 to 1007, or any one of the nucleotide sequences provided in Table 8, any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999 to 1007, or any one of the sequences provided in Table 8, a nucleotide sequence containing at least 1, 2, 3, 4, 5, 6, or 7 substitutions, but 4 or fewer substitutions, or any one of SEQ ID NOs: 987, 988, 990, 991, 995, 996, 998, 999 to 1007, or any one of the sequences provided in Table 8 and having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, the AAV particle according to any one of claims 33 to 36.
38. the viral genome is (i) a polyA signal sequence, (ii) an inverted terminal repeat (ITR) sequence, optionally, the ITR sequence is at the 5'-position relative to the encoded payload, and / or the ITR sequence is at the 3'-position relative to the encoded payload, the inverted terminal repeat (ITR) sequence, (iii) an enhancer, Kozak sequence, intron region, and / or exon region, and / or (iv) an miR binding site, for example, a nucleotide sequence encoding an miR binding site that regulates, for example, reduces the expression of an antibody molecule encoded by the viral genome in a cell or tissue in which the corresponding miRNA is expressed, optionally, the encoded miR binding site regulates, for example, reduces the expression of the antibody molecule encoded in a cell or tissue of DRG, liver, heart, hematopoietic system, or a combination thereof, the nucleotide sequence, further comprising the AAV particle according to claim 37.
39. the viral genome is (i) at least 1 to 5 copies of the encoded miR binding site, for example, at least 1, 2, 3, 4, or 5 copies, (ii) at least 3 copies of the encoded miR binding site, optionally, (a) all 3 copies contain the same miR binding site, or at least 1, 2, 3, or all of said copies contain different miR binding sites, and / or (b) said 3 copies of the encoded miR binding site are contiguous (e.g., not separated by a spacer), or separated by a spacer, optionally, said spacer being a nucleotide sequence of GATAGTTA, or having at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), but 4 or fewer modifications, e.g., substitutions (e.g., conservative substitutions), with respect to GATAGTTA, and containing a nucleotide sequence of said at least 3 copies, or (iii) at least 4 copies of the encoded miR binding site, optionally, (a) all 4 copies contain the same miR binding site, or at least 1, 2, 3, or all of said copies contain different miR binding sites, and / or (b) said 4 copies of the encoded miR binding site are contiguous (e.g., not separated by a spacer), or separated by a spacer, optionally, said spacer being a nucleotide sequence of GATAGTTA, or having at least 1, 2, or 3 modifications, e.g., substitutions (e.g., conservative substitutions), but 4 or fewer modifications, e.g., substitutions (e.g., conservative substitutions), with respect to GATAGTTA, and containing a nucleotide sequence of said at least 4 copies, comprising the AAV particle according to claim 38.
40. The encoded miR binding site contains a miR122 binding site, a miR183 binding site, a miR1 binding site, miR142-3p, or a combination thereof, optionally, (i) the encoded miR122 binding site comprises the nucleotide sequence of SEQ ID NO: 4673, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or at least 1, 2, 3, 4, 5, 6, or 7 modifications to SEQ ID NO: 4673, such as substitutions, insertions, or deletions, but including 10 or fewer modifications, such as substitutions, insertions, or deletions, (ii) the encoded miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 4676, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or at least 1, 2, 3, 4, 5, 6, or 7 modifications to SEQ ID NO: 4676, such as substitutions, insertions, or deletions, but including 10 or fewer modifications, such as substitutions, insertions, or deletions, (iii) the encoded miR1 binding site comprises the nucleotide sequence of SEQ ID NO: 4679, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or at least 1, 2, 3, 4, 5, 6, or 7 modifications to SEQ ID NO: 4679, such as substitutions, insertions, or deletions, but having 10 or fewer modifications, such as substitutions, insertions, or deletions, and / or (iv) the encoded miR142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 4675, or a nucleotide sequence that is substantially identical thereto (e.g., having at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity), or at least 1, 2, 3, 4, 5, 6, or 7 modifications to SEQ ID NO: 4675, such as substitutions, insertions, or deletions, but having 10 or fewer modifications, such as substitutions, insertions, or deletions, the AAV particle according to claim 38 or 39.
41. wherein the viral genome is (i) single-stranded, or (ii) self-complementary, the AAV particle according to any one of claims 37 to 40.
42. an isolated, e.g., recombinant, AAV capsid variant according to any one of claims 1 to 27 or 32, a polynucleotide according to claim 28 or 29, a peptide according to claim 30 or 31, or an AAV particle according to any one of claims 33 to 41.
43. a vector comprising a polynucleotide encoding an AAV capsid variant according to any one of claims 1 to 27, 32, or 42, a polynucleotide according to claim 28, 29, or 42, or a polynucleotide encoding a peptide according to claim 30, 31, or 42.
44. a cell, e.g., a host cell, comprising an AAV capsid variant according to any one of claims 1 to 27, 32, or 42, a polynucleotide according to any one of claims 28, 29, or 42, a polynucleotide encoding a peptide according to any one of claims 30, 31, or 42, an AAV particle according to any one of claims 33 to 42, or a vector according to claim 43, optionally (i) the cell is a mammalian cell or an insect cell, (ii) the cell is a cell in the brain region or spinal cord region, optionally a cell in the brainstem, hippocampus, or thalamus, and / or (iii) the cell is a neuron, sensory neuron, motor neuron, astrocyte, glial cell, oligodendrocyte, or muscle cell (e.g., a cell of the heart, diaphragm, or quadriceps), said cell.
45. A method for producing AAV particles, comprising (i) providing a host cell comprising a viral genome, and (ii) incubating the host cell under conditions suitable for encapsulating the viral genome in an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or an AAV capsid variant encoded by a polynucleotide according to any one of claims 28, 29 or 42; The method for producing the AAV particles thereby.
46. An AAV particle according to any one of claims 33 to 42, an AAV particle comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or an AAV particle comprising a peptide according to any one of claims 30, 31 or 42, and a pharmaceutically acceptable excipient.
47. A method of delivering a payload to a cell or tissue (e.g., CNS cells or CNS tissue) comprising administering an effective amount of the pharmaceutical composition according to claim 46, an AAV particle according to any one of claims 33 to 42, an AAV particle comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or an AAV particle comprising a peptide according to any one of claims 30, 31 or 42.
48. The cell is (i) a cell in the brain region or spinal cord region, optionally a cell in the temporal cortex, perinasal cortex, globus pallidus, putamen, caudate nucleus, thalamus, hippocampus, geniculate nucleus, Purkinje layer, deep cerebellar nucleus, cerebellum, cervical spinal cord region, thoracic spinal cord region, lumbar spinal cord region, or a combination thereof; (ii) a cell of the heart, e.g., a cell of the atrium or ventricle; (iii) a cell of muscle (e.g., a cell of the quadriceps femoris) or liver; (iv) a neuron, sensory neuron, motor neuron, astrocyte, glial cell, or oligodendrocyte, or (v) within the subject, and optionally, the subject has, is diagnosed as having, or is at risk of having a genetic disorder (e.g., a monogenic disorder or a polygenic disorder), a neurological disorder (e.g., a neurodegenerative disorder), a neuro-oncological disorder, a muscular disorder, or a neuromuscular disorder, the method of claim 47. **Claim 49** A method of treating a subject having or diagnosed as having a genetic disorder, e.g., a monogenic disorder or a polygenic disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 46, an AAV particle of any one of claims 33-42, an AAV particle comprising an AAV capsid variant of any one of claims 1-27, 32 or 42, or an AAV particle comprising a peptide of any one of claims 30, 31, or 42. **Claim 50** A method of treating a subject having or diagnosed as having a neurological disorder (e.g., a neurodegenerative disorder), a neuro-oncological disorder, a muscular disorder, or a neuromuscular disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 46, an AAV particle of any one of claims 33-42, an AAV particle comprising an AAV capsid variant of any one of claims 1-27, 32 or 42, or an AAV particle comprising a peptide of any one of claims 30, 31, or 42. **Claim 51** A method of treating a subject having or diagnosed as having a muscular disorder or a neuromuscular disorder, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 46, an AAV particle of any one of claims 33-42, an AAV particle comprising an AAV capsid variant of any one of claims 1-27, 32 or 42, or an AAV particle comprising a peptide of any one of claims 30, 31, or 42. **Claim 52** A method for treating a subject having or diagnosed with a neurological tumor disorder, comprising administering to the subject an effective amount of the pharmaceutical composition according to claim 46, the AAV particles according to any one of claims 33 to 42, the AAV particles comprising the AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or the AAV particles comprising the peptide according to any one of claims 30, 31, or 42.
53. The method according to any one of claims 48 to 52, wherein the genetic disorder, the neurological disorder, the neurodegenerative disorder, the muscular disorder, the neuromuscular disorder, or the neurological tumor disorder is Huntington's disease, amyotrophic lateral sclerosis (ALS), Gaucher's disease, dementia with Lewy bodies, Parkinson's disease, spinal muscular atrophy, Alzheimer's disease, leukodystrophy (e.g., Alexander's disease, autosomal dominant leukodystrophy with autonomic neuropathy (ADLD), Canavan disease, cerebrotendinous xanthomatosis (CTX), metachromatic leukodystrophy (MLD), Pelizaeus-Merzbacher disease, or Refsum disease), or cancer (e.g., HER2 / neu positive cancer or glioblastoma).
54. The method according to any one of claims 49 to 53, wherein treating comprises preventing progression of the disease or disorder in the subject.
55. The method according to any one of claims 48 to 54, wherein the subject is a human.
56. The AAV particles or the pharmaceutical composition are administered to the subject (i) intravenously, into the brain via intracisternal injection (ICM), intrathecally, intraventricularly, via parenchymal administration, or intramuscularly, (ii) via focused ultrasound with intravenous administration of microbubbles (FUS-MB), or via MRI-guided FUS with intravenous administration, or (iii) intravenously, according to the method according to any one of claims 48 to 55.
57. The pharmaceutical composition according to claim 46, the AAV particles according to any one of claims 33 to 42, the AAV particles comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or the AAV particles comprising a peptide according to any one of claims 30, 31, or 42 for use in a method of delivering a payload to a cell or tissue.
58. The pharmaceutical composition according to claim 46, the AAV particles according to any one of claims 33 to 42, the AAV particles comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or the AAV particles comprising a peptide according to any one of claims 30, 31, or 42 for use in a method of treating a genetic disorder, a neurological disorder, a neurodegenerative disorder, a muscular disorder, a neuromuscular disorder, or a neuro-oncological disorder.
59. The pharmaceutical composition according to claim 46, the AAV particles according to any one of claims 33 to 42, the AAV particles comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or the AAV particles comprising a peptide according to any one of claims 30, 31, or 42 for use in the manufacture of a medicament.
60. Use of the pharmaceutical composition according to claim 46, the AAV particles according to any one of claims 33 to 42, the AAV particles comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or the AAV particles comprising a peptide according to any one of claims 30, 31, or 42 in the manufacture of a medicament.
61. Use of the pharmaceutical composition according to claim 46, the AAV particles according to any one of claims 33 to 42, the AAV particles comprising an AAV capsid variant according to any one of claims 1 to 27, 32 or 42, or the AAV particles comprising a peptide according to any one of claims 30, 31, or 42 in the manufacture of a medicament for treating a genetic disorder, a neurological disorder, a neurodegenerative disorder, a muscular disorder, a neuromuscular disorder, or a neuro-oncological disorder.