Use of lactic acid bacteria for improving feed efficiency

Lacticaseibacillus rhamnosus strain FNZ142 in ruminant feed compositions addresses the limitations of current methods by enhancing feed efficiency, milk production, and reducing methane emissions, achieving up to 1.4 times feed efficiency increase and 40% methane reduction.

JP2025520641APending Publication Date: 2025-07-03FONTERRA COOP GRP LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575164
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-22
Filing Date
2023-06-21
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Current methods for improving feed efficiency, growth, and productivity in ruminants, as well as reducing methane emissions and greenhouse gas footprints, have been limited in effectiveness and mechanism understanding.

Method used

The use of the Lacticaseibacillus rhamnosus strain FNZ142 or its derivatives in ruminant feed compositions to inhibit methanogenic bacteria, alter rumen microbiota metabolism, and enhance feed efficiency, growth, and milk production.

Benefits of technology

The strain enhances feed efficiency by up to 1.4 times, increases milk production by 6% or more, and reduces methane emissions by up to 40%, thereby improving the overall productivity and reducing greenhouse gas emissions in ruminants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025520641000001_ABST
    Figure 2025520641000001_ABST
Patent Text Reader

Abstract

The present invention relates to the use of a probiotic bacterial strain or a derivative thereof for improving feed efficiency, improving growth and / or productivity, improving body weight or body composition, and / or increasing milk production in ruminants, inhibiting the growth of methanogenic bacteria and / or archaea in the forestomachs of ruminants, reducing the methane-producing ability of the rumen microbiota, reducing methane emissions by ruminants, and / or reducing the greenhouse gas emission footprint of ruminants. A ruminant feed composition is also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Technical Field The present invention relates to the use of lactic acid bacteria strains for improving feed efficiency, growth and / or productivity, improving the body weight or body composition of ruminants, and / or increasing the milk production of ruminants, inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, reducing the methane-producing ability of the rumen microbiota, reducing methane emissions by ruminants, and / or reducing the greenhouse gas emission footprint of ruminants. A ruminant feed composition is also provided.

Background Art

[0002] Background Lactic acid bacteria (LAB) are used as human probiotics for various advantages. LAB have also been used in animals to attempt to improve animal health and nutrition, but the results have been variable. They have also been studied as alternatives to antibiotics used as growth promoters.

[0003] On farms, LAB can be used as direct-fed microbials (DFM), probiotics, and silage inoculants. Their effects are strain- and host-specific. Some studies have reported various advantages such as a decrease in the incidence of diarrhea, promotion of rumen development, improvement of feed efficiency, improvement of weight gain, and decrease in morbidity, depending on the specific strain and host used. However, the effects on performance are variable and the mechanism of action is unknown (Krehbiel et al., 2003).

[0004] The use of LAB to reduce methane emissions from ruminants has also been proposed, but success has been limited.

[0005] The main source of methane emissions is the fermentation of organic matter by methanogenic bacteria and archaea. The main source of anthropogenic methane emissions is agriculture, where methane is produced from enteric fermentation in the digestive tract of ruminants and from manure. These sources accounted for approximately 30% of global anthropogenic methane emissions in 2017 (Jackson et al., 2020).

[0006] Furthermore, methane production in ruminants not only leads to greenhouse gas emissions but also represents an energy waste for the animals. It has long been recognized that methane production in ruminants dramatically affects the efficiency with which these animals convert feed into metabolic energy. This efficiency reduction occurs because methane represents a calorie loss of about 5 - 10% of the total calories ingested by ruminants. However, to date, research on the potential use of LAB to reduce methane emissions has been limited.

[0007] Accordingly, there remains a need for methods and compositions useful for improving feed efficiency, growth and / or productivity, improving the body weight or body composition of ruminants, and / or increasing milk production in ruminants. Methods and compositions that inhibit the growth of methanogenic bacteria and / or archaea in the forestomachs of ruminants, reduce the methane-producing capacity of the rumen microbiota, reduce methane emissions by ruminants, and / or reduce the greenhouse gas emission footprint of ruminants are also desirable. SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0008] It is an object of the present invention to achieve one or more of these desires or at least to provide a useful alternative to the public. MEANS FOR SOLVING THE PROBLEMS

[0009] Summary of the Invention In a first aspect, the present invention provides an isolated Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0010] In one embodiment, Lacticaseibacillus rhamnosus strain FNZ142 is a biologically pure culture.

[0011] In a second aspect, the present invention provides a food or feed composition comprising Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated August 2, 2021, or a derivative thereof.

[0012] In a third aspect, the present invention a. increasing the feed efficiency of ruminants, b. enhancing the growth and / or productivity of ruminants, c. improving the body weight and / or body composition of ruminants, d. increasing the yield of milk and / or milk components produced by ruminants, e. inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, f. reducing the methane-producing ability of the rumen microbiota, g. reducing methane emissions by ruminants, h. delivering microorganisms to ruminants, and / or i. reducing the greenhouse gas emission footprint of ruminants, A ruminant feed composition for the purpose of, said feed composition comprising Lacticaseibacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142 of NMIA accession number V21 / 015448 dated August 2, 2021, or a derivative thereof, provides a ruminant feed composition.

[0013] In some embodiments, the ruminant feed composition is a cattle feed composition. In some embodiments, the ruminant feed composition is a goat feed composition. In some embodiments, the ruminant feed composition is a sheep feed composition. In some embodiments, the ruminant feed composition is a bison feed composition. In some embodiments, the ruminant feed composition is a yak feed composition. In some embodiments, the ruminant feed composition is a buffalo feed composition. In some embodiments, the ruminant feed composition is a deer feed composition. In some embodiments, the ruminant feed composition is a camel feed composition. In some embodiments, the ruminant feed composition is an alpaca feed composition. In some embodiments, the ruminant feed composition is a llama feed composition. In some embodiments, the ruminant feed composition is a gnu feed composition. In some embodiments, the ruminant feed composition is an antelope feed composition. In some embodiments, the ruminant feed composition is a nilgai feed composition.

[0014] In a further aspect, the present invention provides a method of enhancing feed efficiency in a ruminant, said method comprising administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0015] In a further aspect, the present invention provides a method of enhancing growth and / or productivity in a ruminant, said method comprising administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0016] In a further aspect, the present invention provides a method of improving the body weight and / or body composition of a ruminant, said method comprising administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0017] In a further aspect, the present invention provides a method for increasing the yield of milk and / or milk components produced from ruminants, said method comprising the step of administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0018] In a further aspect, the present invention provides a method for inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, said method comprising the step of administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0019] In a further aspect, the present invention provides a method for reducing the methanogenic capacity of the rumen microbiota of ruminants, said method comprising the step of administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0020] In a further aspect, the present invention provides a method for reducing methane emissions by ruminants, said method comprising the step of administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0021] In a further aspect, the present invention provides a method for delivering microorganisms to ruminants, said method comprising the step of administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0022] In a further aspect, the present invention provides a method for reducing greenhouse gas emissions from ruminants, said method comprising the step of administering to said animal a food or feed composition according to the second aspect, or a ruminant feed composition according to the third aspect.

[0023] In a further aspect, the present invention provides a method for enhancing feed efficiency in ruminants, the method comprising administering to the animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0024] In a further aspect, the present invention provides a method for enhancing growth and / or productivity in ruminants, the method comprising the step of administering to the animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0025] In a further aspect, the present invention provides a method for improving body weight and / or body composition in ruminants, the method comprising the step of administering to the animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0026] In a further aspect, the present invention provides a method for increasing the yield of milk and / or milk components produced by ruminants, the method comprising the step of administering to the animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0027] In a further aspect, the present invention provides a method for inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, the method comprising administering to the ruminant an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0028] In a further aspect, the present invention provides a method for reducing the methane-producing ability of the rumen microbiota, said method comprising administering to a ruminant an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0029] In a further aspect, the present invention provides a method for reducing methane emissions by ruminants, said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0030] In a further aspect, the present invention provides a method for delivering microorganisms to a ruminant, said method comprising the step of administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0031] In a further aspect, the present invention provides a method for reducing the greenhouse gas emission footprint of a ruminant, said method comprising the step of administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0032] In a further aspect, the present invention provides a method for improving the absorption capacity of the digestive tract, for example, a method for enhancing the absorption capacity of volatile fatty acids (VFA), said method comprising administering to an animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0033] In a further aspect, the present invention provides a method for improving the absorption capacity of the forestomach, for example, a method for enhancing the absorption capacity of volatile fatty acids (VFA), said method comprising administering to an animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0034] In a further aspect, the present invention provides a method for improving the absorption capacity of the lower digestive tract, for example, a method for enhancing the absorption capacity of volatile fatty acids (VFA), said method comprising administering to an animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0035] In a further aspect, the present invention provides a method for promoting the physical and / or functional development of the rumen or other chambers of the forestomach in ruminants, for example, young ruminants, for example, young ruminants before weaning, said method comprising administering to an animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0036] In some embodiments, the method enhances the absorptive capacity of the forestomach and / or the lower digestive tract. In some embodiments, the method enhances the absorptive capacity of the forestomach and / or the lower digestive tract by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35% or at least about 40% compared to an untreated animal.

[0037] In one embodiment, the method promotes the anatomical development of the rumen. For example, the method promotes the development and / or muscularization of the rumen epithelium, for example, promoting the growth of rumen mass, the growth of rumen papillae, the increase in papilla density, for example, the increase in dorsal papilla density, and / or the increase in the total surface area of the rumen wall of the animal.

[0038] In one embodiment, the method increases, for example, rumen weight, rumen wall thickness, rumen muscularization, and / or the density of rumen papillae per 1 cm 2 of the rumen wall compared to an untreated animal.

[0039] In one embodiment, the method increases the length, width and / or surface area of the rumen papillae. For example, in some embodiments, the method increases the length, width and / or surface area of the rumen papillae by at least 1.01, 1.02, 1.03, 1.04, 1.05, 1.06, 1.07, 1.08, 1.09, 1.10, 1.11, 1.12, 1.13, 1.14, 1.15, 1.16, 1.17, 1.18, 1.19, 1.20, 1.22, 1.24, 1.26, 1.28, 1.30, 1.32, 1.34, 1.36, 1.38 or 1.40 times that of an untreated animal.

[0040] In one embodiment, the method decreases the rumen size. For example, in some embodiments, the method decreases the rumen size by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 22%, 24%, 26%, 28% or 30% compared to an untreated animal.

[0041] In one embodiment, the method enhances the functional achievement of the rumen or promotes the maturation of the forestomach. For example, the method stimulates rumination, increases dry matter intake (DMI), enhances absorption capacity, and / or promotes maturation towards a mature physiological function.

[0042] In a further aspect, the present invention provides a method of altering the mean retention time of digesta in the rumen or other compartments of the forestomach of a ruminant, such as a young ruminant, such as a young pre-weaned ruminant, the method comprising administering to the ruminant an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0043] In some embodiments, the method shortens the mean retention time (MRT) of digesta in the rumen, such as particulate or liquid digesta. For example, the method shortens the mean retention time in the rumen by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, or at least 40% compared to an untreated animal. In some embodiments, the mean retention time is less than 30 hours, such as less than 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 hours.

[0044] In some embodiments, the method inhibits the growth of methylotrophic methanogens or reduces their abundance in the digestive tract of the animal (such as the forestomach and / or lower digestive tract). In some embodiments, the method inhibits the growth of methanogens of the genus Methanosphaera or reduces their abundance in the digestive tract of the animal (such as the forestomach and / or lower digestive tract).

[0045] In some embodiments, the method reduces the abundance of the family Ruminococcaceae and / or the family Lachnospiraceae in the digestive tract of the animal (such as the forestomach and / or lower digestive tract).

[0046] In some embodiments, Lactiplantibacillus rhamnosus FNZ142 or a derivative thereof is administered in a composition that is a food, beverage, food additive, beverage additive, animal feed, animal feed additive, animal feed supplement, nutraceutical, carrier, vitamin or mineral premix, nutritional product, enteral nutritional product, solubles, slurry, supplement, pharmaceutical, lick block, drencher, tablet, capsule, pellet or an in-rumen product such as a bolus.

[0047] In a further aspect, the invention provides a composition comprising Lactiplantibacillus rhamnosus strain FNZ142, NMIA Accession No. V21 / 015448 dated 2 August 2021, or a derivative thereof. In some embodiments, the composition is a food, beverage, food additive, beverage additive, animal feed, animal feed additive, animal feed supplement, nutraceutical, carrier, vitamin or mineral premix, nutritional product, enteral nutritional product, solubles, slurry, supplement, pharmaceutical, lick block, drencher, tablet, capsule, pellet, bolus, or an in-rumen product, or Lactiplantibacillus rhamnosus FNZ142 is encapsulated in, for example, liposomes, microbubbles, microparticles or microcapsules.

[0048] In some embodiments, Lactiplantibacillus rhamnosus FNZ142 or a derivative thereof is administered in drinking water, milk, powdered milk, alternative milk, milk fortifier, whey, whey powder, partial or total mixed ration (TMR), corn, soybeans, hay, grains, distilled grains, germinated grains, legumes, vitamins, amino acids, minerals, fiber, kale, pasture, hay, straw, silage, grain, leaves, meal, solubles, slurry, supplement, mash feed, fruit pulp, vegetable pulp, fruit or vegetable pomace, citrus meal, wheat shorts, corn cob meal, molasses, sucrose, maltodextrin, chaff, vermiculite, zeolite or ground limestone.

[0049] In some embodiments, the method comprises administering to an animal Lactobacillus rhamnosus FNZ142 in an amount of at least about 10 4 colony forming units per kilogram of dry weight carrier feed, such as at least about 10 5 at least about 10 6 at least about 10 7 at least about 10 8 at least about 10 9 at least about 10 10 at least about 10 11 at least about 10 12 or at least about 10 13 colony forming units. In some embodiments, the method comprises administering to an animal Lactobacillus rhamnosus FNZ142 in an amount of 10 4 to 10 13 colony forming units per kilogram of dry weight carrier feed. In one embodiment, the method comprises administering to an animal Lactobacillus rhamnosus FNZ142 in an amount of 10 8 to 10 12 colony forming units per kilogram of dry weight carrier feed.

[0050] In some embodiments, a derivative of Lactobacillus rhamnosus FNZ142 is a cell lysate of L. rhamnosus FNZ142, a cell suspension of L. rhamnosus FNZ142, a metabolite of L. rhamnosus FNZ142, or a culture supernatant of L. rhamnosus FNZ142, or heat-killed L. rhamnosus FNZ142. In some embodiments, a derivative of Lactobacillus rhamnosus FNZ142 is heat-killed and / or non-replicating, such as heat-treated, lysed, autoclaved, irradiated and / or UV-treated.

[0051] In some embodiments, the method further comprises administering at least one microorganism of a different species or strain, a methanogen, or a vaccine that inhibits methanogenesis, and / or a naturally or chemically synthesized methanogenesis inhibitor and / or a methanogen inhibitor. An example of a useful inhibitor of methanogenesis is bromoform, which acts by reacting with the reduced vitamin B12 cofactor required for the penultimate step of methanogenesis to inhibit the efficiency of the methyltransferase enzyme.

[0052] In one embodiment, the method further comprises administering at least one microorganism of a different species or strain, a methanogen, or a vaccine that inhibits methanogenesis, and / or a naturally or chemically synthesized methanogenesis inhibitor and / or a methanogen inhibitor that targets hydrogenotrophic methanogens, such as methanogens of the genus Methanobrevibacter.

[0053] In some embodiments, Lactobacillus rhamnosus FNZ142, or a derivative thereof, is administered separately from, simultaneously with, or sequentially with one or more agents selected from one or more prebiotics, one or more probiotics, one or more postbiotics, one or more dietary fiber sources, one or more galactooligosaccharides, one or more short-chain galactooligosaccharides, one or more long-chain galactooligosaccharides, one or more fructooligosaccharides, one or more short-chain fructooligosaccharides, one or more long-chain fructooligosaccharides, inulin, one or more galactans, one or more fructans, lactulose, one or more milk-derived oligosaccharides (e.g., 2'-fucosyllactose, 3'-fucosyllactose, 3'-sialyllactose, 6'-sialyllactose, lacto-N-tetraose, lacto-N-neotetraose), or a mixture of two or more thereof.

[0054] In some embodiments, the method further enhances the growth or productivity of the animal, for example, the method increases the yield of milk and / or milk components produced from ruminants. In some embodiments, the method increases the yield of milk fat, milk protein, or milk solids in the milk produced from the animal.

[0055] In some embodiments, the method further increases the body weight of the ruminant and / or improves the body composition, such as by changing the muscle / fat ratio.

[0056] In some embodiments, the method further increases the growth of wool in ruminants.

[0057] In some embodiments, the ruminant is a bovine animal, goat, sheep, bison, yak, swine, deer, camel, alpaca, llama, gnu, antelope, or nilgai. In one embodiment, the ruminant is a cow or a sheep. In one embodiment, the ruminant is a cow. In one embodiment, the ruminant is a lactating animal. In another embodiment, the ruminant is a pre-weaned animal such as a calf or a lamb.

[0058] In some embodiments, the ruminant feed composition is a partial mixed ration or a total mixed ration (TMR), corn, soybean, hay, grain, distillers grains, germinated grains, legumes, fiber, oats, forage, hay, straw, silage, grain, leaves, meal, mash feed, fruit pulp, vegetable pulp, fruit or vegetable pomace, citrus meal, wheat shorts, corn cob meal, lick block, or molasses, or comprises these.

[0059] In some embodiments, the method further comprises administering at least one microorganism of a different species or strain, a methanogen, or a vaccine that inhibits methane production, and / or a natural or chemically synthesized methane production inhibitor and / or a methanogen inhibitor.

[0060] In one embodiment, the method further comprises administering at least one microorganism of a different species or strain, a methanogen or a vaccine that inhibits methane production, and / or a natural or chemically synthesized methane production inhibitor and / or a methanogen inhibitor that targets hydrogenotrophic methanogens, such as methanogens of the genus Methanobrevibacter.

[0061] In some embodiments, the ruminant feed composition further comprises one or more agents selected from one or more prebiotics, one or more probiotics, one or more postbiotics, one or more dietary fiber sources, one or more galactooligosaccharides, one or more short-chain galactooligosaccharides, one or more long-chain galactooligosaccharides, one or more fructooligosaccharides, one or more short-chain fructooligosaccharides, one or more long-chain fructooligosaccharides, inulin, one or more galactans, one or more fructans, lactulose, or any mixture of two or more thereof.

[0062] In a further aspect, the present invention provides a ruminant animal on which the method of the previous aspect has been performed.

[0063] In a further aspect, the present invention provides a method for producing an animal product with a reduced greenhouse gas emission footprint, the method comprising: a. providing a ruminant animal of the previous aspect, and b. producing an animal product from said animal. comprising.

[0064] In some embodiments, the animal product comprises dairy products, meat or wool.

[0065] In a further aspect, the present invention provides for Lactiplantibacillus plantarum (Lactobacillus plantarum) strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof, a. enhancing the feed efficiency of ruminant animals, b. enhancing the growth and / or productivity of ruminants, c. improving the body weight and / or body composition of ruminants, d. increasing the yield of milk and / or milk components produced by ruminants, e. inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, f. reducing the methane-producing ability of the rumen microbiota, g. reducing methane emissions by ruminants, h. delivering microorganisms to ruminants, and / or i. reducing the greenhouse gas emission footprint of ruminants, and provides use for the manufacture of a composition for such purposes.

[0066] In some embodiments, the composition is or comprises a ruminant feed composition according to the third aspect.

[0067] In a further aspect, the present invention a. enhancing the feed efficiency of ruminants, b. enhancing the growth and / or productivity of ruminants, c. improving the body weight and / or body composition of ruminants, d. increasing the yield of milk and / or milk components produced by ruminants, e. inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, f. reducing the methane-producing ability of the rumen microbiota, g. reducing methane emissions by ruminants, h. delivering microorganisms to ruminants, and / or i. reducing the greenhouse gas emission footprint of ruminants, and provides Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof, for use in such.

[0068] The present invention can be broadly said to be composed of components, elements and features individually or collectively mentioned or shown in the specification of the present application, and any one or all combinations of any two or more of the above-mentioned components, elements or features. Also, when a specific integer is described in this specification and the present invention has equivalents known in the relevant technical field, such known equivalents are considered to be incorporated into this specification as if they were individually described.

[0069] The mention of a numerical range (for example, 1 to 10) disclosed in this specification is intended to also incorporate the mention of all rational numbers within that range (for example, 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10), as well as the mention of any range of rational numbers within that range (for example, 2 to 8, 1.5 to 5.5 and 3.1 to 4.7). Therefore, all sub-ranges of all ranges explicitly disclosed in this specification are explicitly disclosed by this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between the recited minimum and maximum values are likewise considered to be explicitly stated in this application.

[0070] As used in this specification, the term "comprising" means "composing at least in part". When interpreting each description containing the term "comprising" in this specification, features other than the features preceding this term can also exist. Related terms such as "comprise" and "comprises" are interpreted in the same way.

[0071] In this specification, when references are made to patent specifications, other external documents, or other information sources, this is generally for the purpose of providing a context for explaining the features of the present invention. Unless otherwise specified, references to such external documents should not be construed as admitting that such documents or such information sources are prior art in any jurisdiction or form part of the general common knowledge in the relevant technical field.

[0072] Embodiments of the present invention will be described below with reference to the drawings.

Brief Description of the Drawings

[0073]

Figure 1

Mode for Carrying Out the Invention

[0074] Detailed Description of the Invention The present invention is based on the discovery that Lacticaseibacillus rhamnosus strain FNZ142 and its derivatives enhance the feed efficiency of ruminants. It is also shown herein that FNZ142 and its derivatives inhibit or suppress the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants and / or reduce the methanogenic capacity of the rumen microbiota. Inhibiting or suppressing the growth of methanogenic bacteria and / or archaea can reduce methane emissions, alter the volatile fatty acid (VFA) profile, total VFA concentration, residual feed intake (RFI), and / or fermentation rate in the rumen and forestomach, which acts as an increase in the energy source, promoting the improvement of feed efficiency, the promotion of weight gain, and / or the improvement of productivity such as milk, meat, and wool production, and can stimulate the development of the rumen such as the development of rumen papillae.

[0075] Accordingly, in a first aspect, the present invention provides an isolated Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated August 2, 2021, or a derivative thereof.

[0076] In a second aspect, the present invention provides a food or feed composition comprising Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0077] In a third aspect, the present invention a. increasing the feed efficiency of ruminants, b. enhancing the growth and / or productivity of ruminants, c. improving the body weight and / or body composition of ruminants, d. increasing the yield of milk and / or milk components produced by ruminants, e. inhibiting the growth of methanogenic bacteria and / or archaea in the forestomachs of ruminants, f. reducing the methane-producing ability of the rumen microbiota, g. reducing methane emissions by ruminants, h. delivering microorganisms to ruminants, and / or i. reducing the greenhouse gas emission footprint of ruminants, A ruminant feed composition for the purpose of, wherein the feed composition comprises Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof, is provided.

[0078] In a further aspect, the present invention provides a method of increasing the feed efficiency of ruminants, the method comprising administering to the animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA accession number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0079] In a further aspect, the present invention provides a method for enhancing the growth and / or productivity of ruminants, said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0080] In a further aspect, the present invention provides a method for improving the body weight and / or body composition of ruminants, said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0081] In a further aspect, the present invention provides a method for increasing the yield of milk and / or milk components produced by ruminants, said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0082] In a further aspect, the present invention provides a method for inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, said method comprising administering to the ruminant an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0083] In a further aspect, the present invention provides a method for reducing the methane-producing capacity of the rumen microbiota of ruminants, said method comprising administering to the ruminant an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0084] In a further aspect, the present invention provides a method for reducing methane emissions by ruminants, said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0085] In a further aspect, the present invention provides a method for delivering microorganisms to ruminants, said method comprising the step of administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0086] In a further aspect, the present invention provides a method for reducing the greenhouse gas emission footprint of ruminants, said method comprising the step of administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0087] In a further aspect, the present invention provides a method for improving the absorption capacity of the forestomach, for example a method for enhancing the absorption capacity of volatile fatty acids (VFA), said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 dated 2 August 2021, or a derivative thereof.

[0088] In a further aspect, the present invention provides a method for promoting the physical and / or functional development of the rumen of a ruminant, such as a young ruminant, such as a young ruminant before weaning, said method comprising administering to said animal an effective amount of Lacticaseibacillus rhamnosus strain FNZ142, NMIA acceptance number V21 / 015448 of 2 August 2021, or a derivative thereof.

[0089] In one embodiment, the method and composition promote the anatomical development of the rumen. For example, the method promotes the development and / or muscularization of the rumen epithelium, such as an increase in the growth of the rumen mass of the animal, the growth of the rumen papillae, the papilla density, such as the dorsal papilla density, and / or an increase in the total surface area of the rumen wall.

[0090] In one embodiment, the methods and compositions disclosed herein increase the rumen weight, the thickness of the rumen wall, or the density of rumen papillae per 1 cm 2 of the rumen wall.

[0091] In one embodiment, the method reduces the rumen size. For example, in some embodiments, the method reduces the rumen size by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 22%, 24%, 26%, 28%, or 30% compared to an untreated animal.

[0092] In one embodiment, the methods and compositions disclosed herein enhance the functional achievement of the rumen. For example, the method stimulates rumination and / or increases dry matter intake (DMI).

[0093] In one embodiment, the methods and compositions disclosed herein alter the abundance of heterofermentative anaerobes in the rumen microbiota. In one embodiment, the methods and compositions disclosed herein increase the abundance of heterofermentative anaerobes in the rumen microbiota.

[0094] In one embodiment, the methods and compositions disclosed herein increase rumen turnover rate, post-rumen digestion, post-rumen absorption, or any combination of any two or more thereof. Without wishing to be bound by theory, it is hypothesized that the higher the rumen turnover rate, the more microorganisms that can grow heterogeneously and rapidly on soluble sugars are selected, resulting in less hydrogen production and thereby less methane production. For example, Kamke et al. (2016) pointed out that when lactic acid is converted to butyric acid rather than propionic acid, 2 moles of hydrogen are produced per mole of hexose, and 0.5 moles of methane are produced via the hydrogenotrophic pathway. For example, it is hypothesized that direct fermentation of hexose to butyric acid and acetic acid by members of the Ruminococcaceae family produces 2.66 moles of hydrogen and forms 0.66 moles of methane. Therefore, it is predicted that methane production will decrease when hydrogen production via the lactic acid to butyric acid pathway decreases.

[0095] In some embodiments, the methods and compositions disclosed herein shorten the mean retention time (MRT) of digesta, such as particulate or liquid digesta, in the rumen. For example, the method shortens the mean retention time by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, or at least 40% compared to an untreated animal.

[0096] The term "administering" refers to the act of introducing an effective amount of Lactobacillus rhamnosus strain FNZ142 or a derivative thereof into the forestomach of a ruminant. More specifically, this administration is oral administration. This administration can be carried out, in particular, by supplementing the strain to animal feed or beverages, and the supplemented feed or beverage is then ingested by the animal.

[0097] The term "effective amount" refers to an amount of Lactobacillus rhamnosus strain FNZ142 or a derivative thereof sufficient to enable a desired effect, namely, inhibition of the growth of methanogenic bacteria and / or archaea in the forestomach of an animal, reduction of methane emissions by the animal, or increase in the feed efficiency of the animal compared to a reference. The desired effect (e.g., inhibition of the growth of methanogenic bacteria and / or archaea, and / or reduction of methane production or emissions) can be measured in vivo or in vitro. For example, the desired effect can be measured in vitro herein using, for example, the methods described in the following examples, in an artificial rumen system as described in T. Hano (1993) J. Gen. Appl. Microbiol., 39, 35-45, or by in vivo oral administration to a ruminant animal.

[0098] This effective amount can be administered to a ruminant animal in one or more administrations.

[0099] The terms "reduction of methane production" and "reduction of methane emissions", e.g., "reduction of methane production by an animal" and "reduction of methane emissions by an animal", refer to a reduction of methane production or emissions from any ruminant-related source by any mechanism. For example, this term can refer to a reduction of methane produced in the forestomach of a ruminant animal, or to a reduction of methane produced or emitted by the feces of a ruminant animal.

[0100] The reduction of methane production is expected to be due to various mechanisms. These can include, for example, the sterilization of methanogens (i.e., bactericidal / archaeicidal effects), the inhibition of methanogen growth (i.e., bacteriostatic / archaeostatic growth inhibitory effects), and / or the inhibition of the methane-producing ability of the forestomach or rumen microbiota. The inhibition of the methane-producing ability of the forestomach or rumen microbiota can occur via various mechanisms, including, for example, physical and / or chemical changes to the forestomach or rumen environment, changes to the microbiota, the inhibition of one or more methane-producing pathways, and / or cross-feeding (or interference with cross-feeding) of mediators between members of the microbiota.

[0101] It will be understood that it is desirable to reduce greenhouse gas (GHG) emissions such as methane emissions. GHG emissions can be reduced directly or indirectly, for example, by reducing the methane-producing ability of the rumen microbiota and / or by reducing methane emissions by ruminants. An example of an indirect reduction in GHG emissions is due to changes in land use and / or land retirement. Animals with improved feed efficiency (e.g., animals to which the methods or compositions of the present invention are applied) may require less forage for feed and / or may require less imported feed. Alternatively or additionally, it may be possible to raise more animals on a given land area, reducing land use while achieving the same production volume. In either case, the reduced land requirement may make it possible to rest unused pastureland, for example, by planting trees or other plants for carbon sequestration. Such changes in land use can further reduce GHG emissions per farm and may reduce the GHG emission footprint per animal and / or per kilogram of animal product (e.g., milk, meat, wool).

[0102] The GHG emission footprint of animals and / or animal products can be determined using techniques known in the art. It will be understood that certain GHGs have a greater potential for global warming than others. For example, the emission of 1 kg of methane produces a global warming impact equivalent to approximately 25 kg of CO2. Taking this into account, GHG emissions are typically reported as CO2 equivalents (CO 2e 2), i.e., the amount of CO2 that would have the same global warming impact. The GHG emission footprint can be calculated per animal or per amount of animal product (e.g., per 1 kg of milk solids, per 1 kg of meat, per 1 kg of wool). As noted above, land use changes such as the planting of trees or other plants for carbon sequestration should be considered in the GHG emission footprint.

[0103] The term "animal product" refers to products produced from or by animals or containing animal-derived components. This term is intended to include products produced directly by animals (e.g., milk, meat, wool), and products containing or made from animal components, optionally together with other components and optionally further processed. For example, this term is intended to include foods and beverages containing animal components such as various dairy products (including buttermilk, cheese, cream, formula, ice cream, milk, powdered milk, pudding, shake, smoothie, and yogurt), meat products (e.g., chops, ground meat, hamburgers, sausages, sausage meat, and steaks), and other products containing animal components.

[0104] The term "feed efficiency" refers to the relationship between feed intake and muscle weight gain or milk production. Microbial fermentation in the forestomach or rumen produces volatile fatty acids (VFAs) such as acetic acid, propionic acid, and butyric acid. These fatty acids are absorbed directly from the rumen wall and used as raw materials for animal growth and development, milk components, and other end digestive products. Fatty acids and other nutrients can also be absorbed in the lower digestive tract such as the small intestine and / or large intestine. Most of the energy consumed in body tissues is used for milk or milk component production or muscle formation. Therefore, when energy absorption and / or utilization is improved, milk yield and / or milk production such as milk fat, milk protein, and / or milk solids can be increased. Improvement in body composition such as muscle gain and / or alteration of the muscle / fat ratio of the animal can also be achieved.

[0105] Feed efficiency can be calculated by dividing the weight of milk produced by the animal or the animal's body weight by the dry matter weight consumed by the animal. Thus, when given the same nutrients, animals with high feed efficiency produce more milk, and, without limitation, milk with a higher content of milk components such as fat and protein, and / or show an improvement in weight gain compared to animals with low feed efficiency. Feed efficiency can be measured by differences in animal growth by any of the parameters of average daily weight gain, total weight gain, feed conversion (including both feed:weight gain and weight gain:feed), mortality, and feed intake. That is, an improvement in feed efficiency can also mean a decrease in the ratio of feed intake / muscle weight gain. An improvement in feed efficiency may also mean an increase in the ratio of muscle weight gain / feed intake. The term "feed efficiency" may also refer to feed intake / weight gain or weight gain / feed intake. Feed efficiency can be standardized using energy-corrected milk (ECM) yield instead of milk weight, taking into account differences in protein and fat content. This can be calculated using the following formula (Tyrrell and Reid, 1965).

[0106] ECM = (12.82 × fat weight (pounds)) + (7.13 × protein weight (pounds)) + (0.323 × milk weight (pounds))

[0107] "Feed conversion rate" and "residual feed intake (RFI)" are also common indicators of feed efficiency, and these terms are often used almost interchangeably. In livestock production, the feed conversion ratio or feed conversion rate is a ratio or rate that measures the efficiency with which an animal's body converts animal feed into a desired product. RFI is defined as the difference between an animal's actual dry matter intake (DMI) and the predicted DMI required for maintenance and growth.

[0108] The main advantage of improving feed efficiency (i.e., improving the feed conversion ratio or reducing RFI) is to reduce an animal's DMI without sacrificing growth performance. This is because feed-related costs often represent the largest production cost in beef or dairy production. Reducing the DMI required to produce one unit of beef or dairy product minimizes feed costs and maximizes the overall profitability of the beef or dairy industry.

[0109] In one embodiment, the feed efficiency of a ruminant animal is increased by at least about 1.01 times, such as at least about 1.02 times, 1.03 times, 1.04 times, 1.05 times, 1.06 times, 1.07 times, 1.08 times, 1.09 times, 1.10 times, 1.12 times, 1.14 times, 1.16 times, 1.18 times, such as at least about 1.20 times, that of an untreated animal.

[0110] The increase in feed efficiency can result from alterations in the volatile fatty acid (VFA) profile, total VFA concentration, and / or fermentation rate in the rumen and forestomach. Alternatively or additionally, the increase in feed efficiency can also result from an improvement in the absorptive capacity of the digestive tract that enhances the absorption of nutrients.

[0111] In some embodiments, the method improves the absorptive capacity of the digestive tract (e.g., the forestomach and / or the lower digestive tract), such as by enhancing the absorptive capacity of volatile fatty acids (VFA).

[0112] Alternatively or additionally, feed efficiency may also be improved by improving digestion. As a result, the treated animals can more effectively digest food sources (such as low-quality feed), thereby increasing the amount of energy compared to untreated animals.

[0113] In some embodiments, Lactobacillus rhamnosus FNZ142 or a derivative thereof shifts hydrogen metabolism from methane production to short-chain / volatile fatty acid (VFA) production, such as propionate production. Propionate is mainly used as a glucose precursor in ruminants, and an increase in propionate production is likely to lead to more efficient utilization of feed energy. By maximizing the flow of metabolic hydrogen in the forestomach or rumen from methane to VFA (mainly propionate), the production efficiency of ruminants is improved, the environmental impact is reduced, and the development of the rumen and / or rumen papillae is promoted.

[0114] Acetic acid, together with β-hydroxybutyric acid produced during butyrate absorption, is a major substrate for mammary lipid synthesis. As a result, a high acetic acid fermentation pattern provides a substrate for maintaining or increasing milk fat.

[0115] Thus, in some embodiments, Lactobacillus rhamnosus strain FNZ142 or a derivative thereof results in an increase in milk fat, milk protein, total milk volume, and / or milk solids as a result of an increase in VFAs in the forestomach or rumen, which can act as an increase in the energy source promoting increased production.

[0116] In some embodiments, the yield of milk and / or milk components produced from the animals preferably increases by 1.5% or more, more preferably 3.0% or more, 4.5% or more, or 6.0% or more.

[0117] In some embodiments, Lactobacillus rhamnosus strain FNZ142 or a derivative thereof results in an increase in the VFAs in the forestomach or rumen, leading to an improvement in body composition such as an increase in the body weight, muscle mass and / or fat deposition of the animal, and / or a change in the muscle / fat ratio, which can act as an increase in the energy source promoting an increase in production volume.

[0118] In some embodiments, the body weight of the animal preferably increases by 1% or more, more preferably 2% or more, 3% or more, 4% or more, 5% or more, 6% or more, 7% or more, 8% or more, 9% or more, or 10% or more compared to the untreated animal.

[0119] The present invention is expected to be also used to extend the lactation cycle of lactating ruminants such as cows. Cows direct a significant portion of their energy towards milk production during lactation. After a long lactation period, their physical condition deteriorates. Therefore, usually the lactation period is shortened or reduced to prevent excessive deterioration of the physical condition. The methods and ruminant feed compositions disclosed herein are expected to increase the feed efficiency of ruminants and thus reduce the impact of milk production on the physical condition. As a result, it becomes possible to extend the milking period of cows.

[0120] The present invention is expected to be also used to reduce or improve the deterioration of the physical condition due to lactation. The methods and ruminant feed compositions disclosed herein are expected to increase the feed efficiency of ruminants and thus improve the physical condition of the ruminants at the end of lactation. For example, when an animal enters the dry period, the body condition score (BCS) of the animal increases. As a result, ruminants require a smaller dry matter intake to improve their physical condition during the off-season. Alternatively or additionally, the methods and ruminant feed compositions disclosed herein are useful for improving the physical condition of the animal before lactation. For example, the methods and compositions disclosed herein can improve the body composition of the mother and / or the fetus or neonate. For example, the methods and compositions disclosed herein can improve the body composition and / or body weight of the neonate at birth.

[0121] The present invention is also expected to be similarly useful for reducing or improving the deterioration of physical condition during other stresses, such as childbirth, drought, or insufficient feed intake.

[0122] Live weight and body condition score are commonly used in the industry as measures of animal growth and performance.

[0123] Live weight is an objective measure used to evaluate animal growth and is one of the best measures of animal performance. It is the main indicator used by the dairy industry to show how well dairy cows are growing. Important research has focused on the relationship between live weight and performance, particularly in heifers, leading to the identification of live weight targets. Achieving live weight targets optimizes the lifetime performance of heifers, extends the lifespan of livestock, and improves the return on investment in the agricultural business.

[0124] In New Zealand, the live weight targets for heifers are 30, 60, and 90% of the live weight of adult cows at 6, 15 (before mating), and 22 (before calving) months of age. Adjustments due to pregnancy are included in the 22-month target. Heifers that grow to the live weight target are also likely to meet the body condition score (BCS) target at calving, which contributes to improved milk production during the first lactation period.

[0125] The body condition score (BCS) is a subjective indicator used to evaluate animal performance and confirm that animal welfare is maintained. The industry-standard dairy cow BCS scale is applied to young heifers after 20 months of age. The target BCS value for young heifers at 22 months of age (before calving) is 5.5.

[0126] There is an established relationship between live weight and milk production. Therefore, one of the main advantages of achieving live weight targets is an increase in milk production.

[0127] The prepartum live weight of dairy cows has been demonstrated in various studies in both New Zealand (Handcock et al. 2019; McNaughton, LR and T Lopdell. 2013; MacDonald et al. 2005; van der Waaij et al. 1997) and overseas (Carson et al. 2002; Dobos et al. 2001) to have a significant impact on milk production.

[0128] Assuming a 9% milk solids test, the expected response is approximately 2 kg of milk solids per lactation for every 1% increase in target weight. For a cow with a pre-calving target weight of 500 kg, 5 kg corresponds to 1% of body weight. Van der Waaij et al. (1997) reported a response of 6 L of milk and 0.43 kg of milk solids per kg of live weight, and Dobos et al. (2001) reported a response of 5.35 L of milk and 0.42 kg of milk solids per kg of live weight at first calving. Scaling these values by 5 for a 5 kg gain provides 26.8 - 30 L of milk and 2.1 - 2.15 kg of milk solids for every 1% increase in live weight. A similar response has been reported by McNaughton, LR and T Lopdell (2013), where in prepartum dairy cows, for every 1% increase in the achievement rate of target live weight (P < 0.001), the milk volume in the first lactation increased by 23 ± 0.6 liters and in the second lactation by 24 ± 0.9 liters.

[0129] Accordingly, in some embodiments, the methods and compositions disclosed herein increase milk production, such as the yield of milk and / or milk components produced from ruminants. In some embodiments, the methods and compositions disclosed herein increase the yield of milk fat, milk protein, or milk solids in milk produced from animals.

[0130] In some embodiments, the methods and compositions disclosed herein increase the first lactation milk production. In some embodiments, the methods and compositions disclosed herein increase the cumulative milk production over multiple lactation periods, such as the first two or the first three lactation periods. In some embodiments, the methods and compositions disclosed herein increase the cumulative milk production over the entire lactation period of an animal.

[0131] In some embodiments, the milk production of an animal increases, preferably by 1% or more, more preferably by 2% or more, 3% or more, 4% or more, or 5% or more, compared to an untreated animal.

[0132] In some embodiments, the milk production of an animal increases, preferably by 5 kg or more of milk solids per lactation period, more preferably by 6 kg or more, 7 kg or more, 8 kg or more, 9 kg or more, 10 kg or more, 11 kg or more, 12 kg or more, or 13 kg or more of milk solids per lactation period, compared to an untreated animal.

[0133] In some embodiments, the milk production of an animal increases, preferably by 60 L or more of milk solids per lactation period, more preferably by 70 L or more, 80 L or more, 90 L or more, 100 L or more, 110 L or more, 120 L or more, or 130 L or more of milk solids per lactation period, compared to an untreated animal.

[0134] As described above, the methods and compositions disclosed herein promote the physical and / or functional development of the rumen, particularly in the juvenile stage of young or pre-weaned ruminants. The development of the rumen involves three different processes: (i) anatomical development (e.g., growth of rumen mass and growth of rumen papillae), (ii) functional achievement (e.g., fermentation capacity and enzyme activity), and (iii) microbial colonization (bacteria, fungi, methanogens, and protozoa).

[0135] The anatomical development of the rumen is a process that occurs through three stages: non-ruminating (0 - 3 weeks), transitional (3 - 8 weeks), and ruminating (after 8 weeks). During the transitional period, the growth and development of the rumen absorption surface area (papillae) are essential to enable the absorption and utilization of the end products of digestion, particularly rumen volatile fatty acids. The presence and absorption of volatile fatty acids may stimulate rumen epithelial metabolism and could be key to initiating the development of the rumen epithelium. Continuous exposure to volatile fatty acids maintains the growth, size, and function of the rumen papillae. Different volatile fatty acids stimulate such development in different ways, with butyric acid being the most stimulatory, followed by propionic acid. Therefore, it is expected that the shift of hydrogen metabolism from methane production to short-chain / volatile fatty acid (VFA) production, such as propionate production, promotes the growth and development of the rumen epithelium.

[0136] Ruminant Ruminants are a group of herbivorous animals with a stomach containing multiple compartments. They first perform microbial fermentation in the rumen to digest food, form cud, regurgitate it, chew it, and then swallow the chewed cud for further digestion. This group includes, but is not limited to, the suborders Ruminantia and Suina, and several domestic animal species. In one embodiment, the ruminant is a cow, goat, sheep, bison, yak, buffalo, deer, camel, alpaca, llama, gnu, antelope, or nilgai. In a preferred embodiment, the ruminant is a cow or a sheep.

[0137] The term "gastrointestinal tract" refers to the entire tube of the digestive system from the mouth to the anus. In ruminants, the gastrointestinal tract includes (but is not limited to) the mouth, esophagus, multi-compartment stomach, small intestine, cecum, large intestine, and anus.

[0138] The stomach of a ruminant is divided into a non-glandular forestomach (rumen, reticulum, omasum) and a terminal glandular stomach (abomasum). The term "forestomach" refers to the non-glandular part of the multi-compartment stomach of a ruminant, including the rumen, reticulum, and omasum, but excluding the terminal glandular stomach (abomasum).

[0139] The term "lower digestive tract" refers to the part of the digestive tract after the stomach and includes (but is not limited to) the small intestine and the large intestine.

[0140] In one embodiment, the ruminant is a nursing animal. In another embodiment, the ruminant is a pre-weaning animal such as a calf or a lamb.

[0141] In some embodiments, the ruminant is a neonate, a newborn, or a young animal. For example, in some embodiments, the ruminant is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, or 2 months old.

[0142] In some embodiments, Lactobacillus rhamnosus strain FNZ142 or a derivative thereof is administered to a pre-weaning ruminant. In some embodiments, Lactobacillus rhamnosus FNZ142 or a derivative thereof is administered to a post-weaning ruminant. In some embodiments, Lactobacillus rhamnosus FNZ142 or a derivative thereof is administered to a ruminant both pre- and post-weaning. For example, in some embodiments, Lactobacillus rhamnosus strain FNZ142 or a derivative thereof is administered throughout the life of the ruminant.

[0143] For example, Lactobacillus rhamnosus FNZ142 or a derivative thereof is administered to ruminants around or on day 0 after birth, for example around day 0, 1, or 2 after birth. Thereafter, the administration may be performed at least once a day, for example multiple times a day, for a sufficient number of times to obtain the persistence of the effect. For example, the administration may continue for 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 6 weeks, 2 months, 10 weeks, or 3 months or more after birth. In some embodiments, the administration of Lactobacillus rhamnosus strain FNZ142 or a derivative thereof continues for 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, or over the lifetime of the ruminant.

[0144] Lactobacillus rhamnosus FNZ142 A culture of Lactobacillus rhamnosus FNZ142 (Lactobacillus rhamnosus FNZ142) was deposited on August 2, 2021, at the National Measurement Institute of Australia (NMIA), 1 / 153 Bertie Street, Port Melbourne, Victoria, Australia 3207, and was assigned the accession number V21 / 015448. This is recognized as an international depository authority under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The terms Lactobacillus rhamnosus strain FNZ142, Lactobacillus rhamnosus FNZ142, Lactobacillus rhamnosus FNZ142, and L. rhamnosus FNZ142 are used interchangeably herein.

[0145] Hybrid genome assembly was created using whole-genome sequencing that combined short-read (Illumina) and long-read (PacBio) sequencing technologies. The final hybrid assembly contained four contigs. The total length was 2980199 bp (2.98 Mb). Using the taxonomic sequence classification program Kraken, it was confirmed that the species ID of strain FNZ142 was Lacticaseibacillus rhamnosus.

[0146] All WGS and related bioinformatics were performed according to the EFSA guidance available at https: / / efsa.onlinelibrary.wiley.com / doi / pdf / 10.2903 / j.efsa.2018.5206, and the latest EFSA statement (July 2021) available at https: / / efsa.onlinelibrary.wiley.com / doi / full / 10.2903 / j.efsa.2021.6506.

[0147] Morphological characteristics The morphological characteristics of Lacticaseibacillus rhamnosus (L. rhamnosus) FNZ142 are described below.

[0148] When grown in MRS broth, it is generally a short to medium-sized bacillus with a chain-like square end, 0.7 x 1.1 x 2.0 - 4.0 μm. A gram-positive, non-motile, non-spore-forming, catalase-negative facultative anaerobic bacillus.

[0149] Further characterization It will be understood that there are various methods known to and available to those skilled in the art that can be used to confirm the identity of Lacticaseibacillus rhamnosus (L. rhamnosus) FNZ142. Here, exemplary methods include DNA fingerprinting, genomic analysis, sequencing, and related genomic and proteomic technologies.

[0150] Lactobacillus rhamnosus strain FNZ142 and derivatives thereof As described herein, certain embodiments of the invention use live Lactobacillus rhamnosus strain FNZ142. In other embodiments, derivatives of Lactobacillus rhamnosus strain FNZ142 are used.

[0151] As used herein, when referring to bacteria, the term "derivative" and its grammatical synonyms (including use with respect to a particular bacterial strain such as Lactobacillus rhamnosus FNZ142) are considered to include variants and homologs of the bacteria or those derived from bacteria, sterilized or attenuated bacteria such as heat-killed, lysed, fractionated, autoclaved, irradiated, and UV- or light-treated bacteria (without limitation), and materials derived from bacteria such as bacterial cell wall compositions, bacterial cell lysates, freeze-dried bacteria, anti-methanogenic factors derived from bacteria, bacterial metabolites, bacterial cell suspensions, bacterial culture supernatants (without limitation), provided that the derivative retains anti-methanogenic activity. Genetically engineered microorganisms designed to express one or more anti-methanogenic factors are also considered. Methods for producing such derivatives, for example, without limitation, one or more variants of Lactobacillus rhamnosus strain FNZ142 or one or more anti-methanogenic factors and in particular derivatives suitable for administration to ruminants (e.g., as a composition) are well known in the art.

[0152] A method suitable for identifying Lactobacillus rhamnosus strain FNZ142, such as those described above, will be understood to be equally suitable for identifying derivatives of Lactobacillus rhamnosus strain FNZ142 (e.g., mutants or homologs of Lactobacillus rhamnosus strain FNZ142, or including bacterial metabolites from, for example, Lactobacillus rhamnosus strain FNZ142).

[0153] The term "anti-methanogenic factor" refers to bacterial molecules responsible for mediating anti-methanogenic activity and includes, but is not limited to, bacterial DNA motifs, RNA including mRNA and miRNA, proteins, exosomes, bacteriocins, bacteriocin-like molecules, antimicrobial peptides, antibiotics, antimicrobial agents, small molecules, polysaccharides or cell wall components such as lipoteichoic acid and peptidoglycan, or mixtures of two or more thereof. As noted above, these molecules are not specifically identified and it is not desired to be bound by any theory, but their presence can be inferred by the presence of anti-methanogenic activity.

[0154] The term "anti-methanogenic activity" refers to the ability of a particular microorganism to inhibit the growth of methanogenic bacteria and / or archaea, or reduce their abundance, and / or reduce the production of methane by methanogenic bacteria and / or archaea. This ability can be limited to inhibiting the growth and / or methane-producing ability of a particular group of methanogenic bacteria and / or archaea, such as inhibiting the growth of hydrogenotrophic methanogens, inhibiting the methane-producing ability of hydrogenotrophic methanogens, inhibiting the growth of methylotrophic methanogens, inhibiting the methane-producing ability of methylotrophic methanogens, inhibiting the growth of a particular species of methanogen, or inhibiting the methane-producing ability of a particular species of methanogen.

[0155] Reference to maintaining anti-methanogenic activity is intended to mean that derivatives of microorganisms, such as mutants or homologs of microorganisms, or attenuated or killed microorganisms, or cell culture supernatants still have useful anti-methanogenic activity, or that compositions containing microorganisms or derivatives thereof still have useful anti-methanogenic activity. Bacterial molecules responsible for mediating anti-methanogenic bacterium activity have not been clearly identified, but molecules proposed as potential candidates include bacterial DNA motifs, RNA including mRNA and miRNA, proteins, exosomes, bacteriocins, antibiotics, surface proteins, small organic acids, polysaccharides, and cell wall components such as lipoteichoic acid and peptidoglycan. These are hypothesized to interact with components of methanogenic bacteria and / or archaea to produce a growth inhibitory effect. Preferably, the retained activity is at least about 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99 or 100% of the activity of the untreated (i.e., live or non-attenuated) control, and useful ranges can be selected between any of these values (e.g., about 35 - about 100%, about 50 - about 100%, about 60 - about 100%, about 70 - about 100%, about 80 - about 100% and about 90 - about 100%).

[0156] Using conventional solid substrate and liquid fermentation techniques well known in the art, Lactobacillus rhamnosus strain FNZ142 can be grown in an amount sufficient to allow for use as contemplated herein. For example, Lactobacillus rhamnosus strain FNZ142 can be produced in large quantities for pharmaceutical use using nutrient film or submerged culture growth techniques, for example, under the conditions described in WO99 / 10476. Briefly, growth is carried out under aerobic conditions at any temperature sufficient for the growth of the organism. For example, in the case of Lactobacillus rhamnosus strain FNZ142, a temperature range of 30 - 40 °C, preferably 37 °C, is preferred. The pH of the growth medium is slightly acidic, preferably about 6.0 - 6.5. The culture time is sufficient for the isolate to reach the stationary growth phase.

[0157] Bacterial cells can be harvested by methods well known in the art, such as conventional filtration or precipitation methods (e.g., centrifugation), or can be harvested in a dry state using a cyclone system. Bacterial cells can be used immediately or can be stored using standard techniques for a required period, preferably freeze-dried or freeze-dried or cooled at -20°C to 6°C, preferably -4°C. As is known in the art, cryoprotectants, cryopreservatives and / or lyoprotectants can also be used to enhance the stability and / or viability of bacterial cells during drying and / or freezing.

[0158] Supernatant A further embodiment of the present invention utilizes the supernatant from a cell culture comprising Lactobacillus rhamnosus strain FNZ142 or a derivative thereof. Such embodiments include a method for preparing a bacterial culture supernatant, the method comprising culturing bacterial cells and separating the supernatant from the cultured cells to obtain the supernatant. By this method, bacterial molecules responsible for mediating the anti-methanogenic activity obtainable from the supernatant can also be further isolated.

[0159] As will be understood by those skilled in the art, the supernatant useful in the present invention encompasses both the supernatant from such a culture and / or a concentrate of such a supernatant and / or a fraction of such a supernatant.

[0160] The term "supernatant" in this context refers to the medium from a bacterial culture, after which the bacteria have been removed, for example, by centrifugation or filtration.

[0161] The supernatant useful in the present invention can be easily obtained by a simple method for preparing a bacterial culture supernatant, the method comprising a) culturing cells of Lactobacillus rhamnosus strain FNZ142, b) Optionally, but not necessarily, releasing the active compounds and / or extracellular components of the cells by acidic or alkaline modification, sonication, detergents such as sodium dodecyl sulfate (SDS) and / or Triton X, wall-degrading enzymes such as mutanolysin and / or lysozyme, various cell treatment agents such as salts and / or alcohols, and, c) Separating the supernatant from the cultured cells, thereby obtaining the supernatant.

[0162] In a preferred embodiment of this method, the supernatant composition is further subjected to a drying step to obtain a dried culture product.

[0163] The drying step may be freeze-drying or spray-drying, but any drying process including vacuum drying and air drying, which is suitable for drying anti-methanogenic factors such as bacteriocins, is contemplated.

[0164] The content of the supernatant produced by Lactobacillus rhamnosus strain FNZ142 has not yet been characterized in detail, but since certain bacterial strains are known to produce bacteriocins, which are small heat-stable proteins, without being bound by theory, it is expected that an active composition can be obtained even by a drying method such as spray-drying that moderately heats the culture eluate product, as demonstrated in the examples described herein.

[0165] Lysate The fluid containing the contents of the lysed cells is called a lysate. The lysate contains the active components of the bacterial cells and is either a crude product (therefore containing all cell components) or is separated into separated fractions such as extracellular components, intracellular components, proteins, etc., partially and / or completely.

[0166] Methods for producing bacterial cell lysates are well known in the art. Such methods include, but are not limited to, mechanical lysis such as mechanical shearing, grinding, milling, sonication, enzymatic lysis with enzymes that break down the bacterial cell wall, chemical lysis such as the use of detergents, denaturing agents, pressure changes and / or osmotic shock, and combinations thereof.

[0167] Accordingly, a further embodiment of the invention utilizes a lysate of Lactobacillus rhamnosus strain FNZ142 or a derivative thereof.

[0168] Cell suspension In some embodiments, the invention can also use a cell suspension comprising Lactobacillus rhamnosus strain FNZ142 or a derivative thereof.

[0169] In this context, the term "cell suspension" refers to a large number of cells of Lactobacillus rhamnosus strain FNZ142 or a derivative thereof dispersed or suspended in a liquid, such as a liquid nutrient medium, a culture medium, or a salt solution.

[0170] The cells can be presented in the form of a cell suspension in a solution suitable for dispersion. The cell suspension can be dispersed, for example, by spraying, dipping or any other suitable application method.

[0171] The cells can be viable, but the suspension can contain inactivated or dead cells or lysates thereof. In one embodiment, the suspension of the invention contains viable cells. In another embodiment, the suspension of the invention contains inactivated, dead or lysed cells.

[0172] Bacteriocin Bacteriocins are antimicrobial compounds produced by bacteria that inhibit other bacterial strains and species.

[0173] Lactic acid bacteria (LAB) are well known to produce bacteriocins, and these compounds have attracted worldwide attention in the food industry for inhibiting the growth of many spoilage and pathogenic bacteria and extending the shelf life and safety of foods. Bacteriocins are typically considered narrow-spectrum antibiotics. Furthermore, bacteriocins from LAB in particular exhibit very low toxicity to humans and have been consumed in fermented foods for thousands of years.

[0174] A further aspect of the present invention provides an isolated antimicrobial compound obtained from Lactobacillus rhamnosus FNZ142 or a derivative thereof. Such an antimicrobial compound can be obtained, for example, from the supernatant or lysate obtained from the method described herein which further includes an isolation step.

[0175] As demonstrated in the examples disclosed herein, Lactobacillus rhamnosus strain FNZ142 and / or a composition comprising Lactobacillus rhamnosus strain FNZ142, and / or the culture supernatant of Lactobacillus rhamnosus strain FNZ142, have been found to be useful as antimicrobial compounds for inhibiting, in particular, the growth of methanogenic bacteria and / or the methane-producing ability of methanogens.

[0176] In this context, the term antimicrobial compound is used for a compound that kills microorganisms, inhibits their survival, or inhibits their growth. Antimicrobial compounds can be classified mainly according to the microorganisms on which they act. For example, antibacterial agents are used against bacteria and antifungal agents are used against fungi. They can also be classified according to their function. A compound that kills microorganisms is called microbicidal and a compound that merely inhibits the growth of microorganisms is called microbiostatic.

[0177] In one embodiment, the present invention relates to an antimicrobial compound that is microbicidal. In another embodiment, the present invention relates to an antimicrobial compound that is microbistatic. In another embodiment, the present invention relates to an antimicrobial compound that is antibacterial.

[0178] Ruminant feed or carrier composition Ruminant feed compositions useful herein can be formulated as foods, beverages, food additives, beverage additives, animal feeds, animal feed additives, animal feed supplements, nutraceuticals, carriers, vitamin or mineral premixes, nutritional products, enteral nutritional products, solubles, slurries, supplements, pharmaceuticals, lick blocks, drenches, tablets, capsules, pellets or ruminant in-products such as boluses. Suitable formulations can be prepared by those skilled in the art with respect to the art and the teachings herein.

[0179] The composition can be administered as a top dressing to standard feed materials such as daily rations or admixed therewith. Further, the strain can be administered by mixing with a partial or total mixed ration (TMR), pellet feed, liquid feed or beverage, mixing with a protein premix, or delivery via a vitamin and mineral premix.

[0180] In one embodiment, the compositions useful herein include any edible feed product capable of retaining bacteria or bacterial derivatives. As used in this application, the terms "feed" or "animal feed" refer to materials that are consumed by animals and contribute energy and / or nutrients to the animal's diet. Animal feed typically includes various components that can be present in the form of, for example, concentrates, premixes, co-products or pellets. Examples of feeds and feed ingredients include partial or total mixed rations (TMR), corn, soybeans, hay, grains, distillers grains, germinated grains, legumes, vitamins, amino acids, minerals, fiber, oats, forage, hay, straw, silage, grain kernels, leaves, meal, soluble substances, slurries, supplements, mash feeds, fruit pulp, vegetable pulp, fruit or vegetable pomace, citrus meal, wheat shorts, corn cob meal and molasses. Other compositions useful as carriers include milk, powdered milk, alternative milk, milk fortifiers, colostrum, whey, whey powder, sucrose, maltodextrin, bran, etc.

[0181] In certain embodiments, the feed composition is formed by a method of growing Lactobacillus rhamnosus strain FNZ142 using a milk-based carrier such as heat-treated milk or a non-milk-based carrier to create a fermented yogurt-like composition. Such methods of creating fermented yogurt-like compositions are well known in the art and can include, for example, incubating the milk at an appropriate temperature, such as 25-30°C, using a warm water bath or other heating means for a sufficient period of time, such as 12 hours or more, until a sufficient cell density is reached. Optionally, the milk can include other additives that promote the growth of bacteria, such as yeast extract. In certain embodiments, this method is performed on-site, such as on a farm where probiotic feed supplementation is carried out. The fermented yogurt-like composition can be administered by oral administration, such as by soaking in water. In some embodiments, the fermented yogurt-like composition is administered at a dose of 1-100 ml per day, such as 2-50 ml per day, 5-30 ml per day or 10-20 ml per day.

[0182] Other suitable feed formulations for ruminants are described in E. W. Crampton et al., Applied Animal Nutrition, W. H. Freeman and Company, San Francisco, Calif., 1969 and D. C. Church, Livestock Feeds and Feeding, O & B Books, Corvallis, Oreg., 1977, both of which are incorporated herein by reference.

[0183] In one embodiment, the compositions useful herein include any non-feed carrier consumed by an animal to which bacteria or bacterial derivatives are added, such as vermiculite, zeolite, or ground limestone.

[0184] In certain embodiments, the compositions of the invention include the live Lactobacillus rhamnosus strain FNZ142. Methods for producing such compositions are well known in the art.

[0185] In some embodiments, the compositions of the invention include one or more derivatives of Lactobacillus rhamnosus strain FNZ142. Again, methods for producing such compositions are well known in the art and standard microbiological and pharmaceutical practices can be utilized. In some embodiments, the composition includes a dried culture product such as a supernatant or cell lysate as described herein.

[0186] It will be understood that such compositions can include a wide range of additives or carriers, for example, to improve or maintain the viability of bacteria or to enhance the anti-methanogenic activity of Lactobacillus rhamnosus strain FNZ142 or its derivatives. For example, surfactants, wetting agents, humectants, adhesives, dispersants, stabilizers, penetrants, so-called stress additives (e.g., potassium chloride, glycerol, sodium chloride and glucose) for improving the viability, growth, replication and survival of bacterial cells, as well as cryoprotectants such as maltodextrin can be included. Additives can also include compositions that assist in maintaining the viability of microorganisms during long-term storage, such as unrefined corn oil, or “reverse” emulsions that contain a mixture of oil and wax on the outside and water, sodium alginate and bacteria on the inside).

[0187] In some embodiments, Lactobacillus rhamnosus FNZ142 or its derivatives are encapsulated. Methods for producing such encapsulated bacteria are well known in the art. In some embodiments, Lactobacillus rhamnosus FNZ142 or its derivatives are encapsulated within liposomes, microbubbles, microparticles or microcapsules. Such encapsulating agents can include natural, semi-synthetic or synthetic polymers, waxes, lipids, fats, fatty alcohols, fatty acids and / or plasticizers, such as alginates, gums, κ-carrageenan, chitosan, starch, sugars, gelatin and the like.

[0188] In certain embodiments, Lactobacillus rhamnosus strain FNZ142 is in a viable reproductive form and amount.

[0189] The composition can include a carbohydrate source such as a disaccharide including, for example, sucrose, fructose, glucose or dextrose. Preferably, the carbohydrate source is one that can be utilized aerobically or anaerobically by Lactobacillus rhamnosus strain FNZ142.

[0190] In such embodiments, the composition can preferably support the reproductive viability of Lactobacillus rhamnosus strain FNZ142 for a period exceeding about 2 weeks, preferably for a period exceeding about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, more preferably for a period exceeding about 6 months, and most preferably for a period of at least about 2 to about 3 years or more.

[0191] In certain embodiments, the oral composition is formulated to be able to administer an effective amount of Lactobacillus rhamnosus strain FNZ142 to establish a population within the animal's gastrointestinal tract when ingested. The established population can be a transient or a permanent population.

[0192] Although various routes and methods of administration are contemplated, oral administration of Lactobacillus rhamnosus strain FNZ142, such as a composition suitable for oral administration, is currently preferred. Of course, in certain situations, other routes and methods of administration may be utilized or preferred, which will be understood.

[0193] The term "oral administration" includes oral, intraoral, enteral, intraluminal and intragastric administration.

[0194] In theory, one colony forming unit (cfu) should be sufficient to establish a population of Lactobacillus rhamnosus strain FNZ142 in an animal's body, but in practice, a minimum number of units is required for this. Therefore, in treatment mechanisms that rely on viable populations of probiotic bacteria, the number of units administered to a subject affects efficacy.

[0195] In one embodiment, the composition formulated for administration comprises at least about 6x10 9 cfu of Lactobacillus rhamnosus strain FNZ142, for example at least about 6x10 11 cfu per day is sufficient. In another embodiment, the composition formulated for administration will be sufficient to provide at least about 10 12 cfu of Lactobacillus rhamnosus strain FNZ142.

[0196] Methods for determining the presence of a population of intestinal and / or rumen flora such as Lactobacillus rhamnosus strain FNZ142 in a subject's gastrointestinal tract are well known in the art, and examples of such methods are provided herein. In certain embodiments, the presence of a population of Lactobacillus rhamnosus strain FNZ142 can be determined directly, for example, by analyzing one or more samples obtained from an animal and determining the presence or amount of Lactobacillus rhamnosus strain FNZ142 in said sample. In other embodiments, the presence of a population of Lactobacillus rhamnosus strain FNZ142 can be determined indirectly, for example, by observing a decrease in methane emissions or methane production, a decrease in hydrogen production, or a decrease in the number of other intestinal and / or rumen flora in a sample obtained from an animal. Combinations of such methods are also envisioned.

[0197] The effectiveness of the useful composition according to the present invention can be evaluated both in vivo and in vitro. For example, see the following examples. Briefly, the composition can be tested for its ability to inhibit the growth of methanogenic bacteria and / or archaea, or to reduce their abundance, or to reduce methane production by methanogenic bacteria and / or archaea. In in vivo studies, the composition can be fed or injected to ruminants, and then its effect on rumen methanogenic bacteria and / or archaea, and its effect on methane emissions can be evaluated. Based on the results, an appropriate dosage range and administration route can be determined.

[0198] The method for calculating the appropriate dosage can depend on the nature of the active agent in the composition. For example, when the composition contains live bacteria, the dosage can be calculated with reference to the number of live bacteria present. For example, as described in the examples herein, the dosage can be set with reference to the number of colony-forming units (cfu) administered per day, or the number of cfu per kilogram of dry feed weight.

[0199] As a general example, about 1×10 6 cfu to about 1×10 12 cfu of Lactobacillus rhamnosus strain FNZ142 per kilogram of dry feed weight per day, preferably about 1×10 6 cfu to about 1×10 11 cfu / kg / day, about 1×10 6 cfu to about 1×10 10 cfu / kg / day, about 1×10 6 cfu to about 1×10 9 cfu / kg / day, about 1×10 6 cfu to about 1×10 8 cfu / kg / day, about 1×10 6 cfu to about 5×10 7 cfu / kg / day, or about 1×10 6 cfu to about 1×10 7 cfu / kg / day of administration is considered. Preferably, about 5×10 6 cfu to about 5×108 Administration of Lactobacillus rhamnosus strain FNZ142 at cfu, preferably about 5×10 6 cfu to about 4×10 8 cfu / kg / day, about 5×10 6 cfu to about 3×10 8 cfu / kg / day, about 5×10 6 cfu to about 2×10 8 cfu / kg / day, about 5×10 6 cfu to about 1×10 8 cfu / kg / day, about 5×10 6 cfu to about 9×10 7 cfu / kg / day, about 5×10 6 cfu to about 8×10 7 cfu / kg / day, about 5×10 6 cfu to about 7×10 7 cfu / kg / day, about 5×10 6 cfu to about 6×10 7 cfu / kg / day, about 5×10 6 cfu to about 5×10 7 cfu / kg / day, about 5×10 6 cfu to about 4×10 7 cfu / kg / day, about 5×10 6 cfu to about 3×10 7 cfu / kg / day, about 5×10 6 cfu to about 2×10 7 cfu / kg / day, about 5×10 6 cfu to about 1×10 7 cfu / kg / day is contemplated.

[0200] In certain embodiments, the regular dosage need not vary according to the weight of the subject, the dry feed weight, or other characteristics. In such an example, about 1×10 6 cfu to about 1×10 13 cfu of Lactobacillus rhamnosus strain FNZ142, preferably about 1×10 6 cfu to about 1×10 12 cfu / day, about 1×10 6 cfu to about 1×10 11 cfu / day, about 1×106 cfu ~ about 1×10 10 cfu / day, about 1×10 6 cfu ~ about 1×10 9 cfu / day, about 1×10 6 cfu ~ about 1×10 8 cfu / day, about 1×10 6 cfu ~ about 5×10 7 cfu / day, or about 1×10 6 cfu ~ about 1×10 7 Administration of cfu / day is assumed.

[0201] In certain embodiments, about 5×10 7 cfu ~ about 5×10 10 cfu of Lactobacillus rhamnosus strain FNZ142 is administered, preferably about 5×10 7 cfu ~ about 4×10 10 cfu / day, about 5×10 7 cfu ~ about 3×10 10 cfu / day, about 5×10 7 cfu ~ about 2×10 10 cfu / day, about 5×10 7 cfu ~ about 1×10 10 cfu / day, about 5×10 7 cfu ~ about 9×10 9 cfu / day, about 5×10 7 cfu ~ about 8×10 9 cfu / day, about 5×10 7 cfu ~ about 7×10 9 cfu / day, about 5×10 7 cfu ~ about 6×10 9 cfu / day, about 5×10 7 cfu ~ about 5×10 9 cfu / day, about 5×10 7 cfu ~ about 4×10 9 cfu / day, about 5×10 7 cfu ~ about 3×10 9 cfu / day, about 5×10 7 cfu ~ about 2×10 9 cfu / day, or about 5×10 7 cfu ~ about 1×10 9cfu / day is assumed. Preferably, a dose of 1×10 8 ~1×10 9 cfu / kg body weight is administered.

[0202] In certain embodiments, it will be understood that it is not necessary to administer the dose daily. For example, the composition can be formulated to be administered every two days, twice a week, weekly, biweekly or monthly. Alternatively, in certain embodiments, the composition can be formulated to be administered 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 times per day, per meal, or per mouthful.

[0203] It will be understood that the composition is preferably formulated to be able to administer an effective dose of Lactobacillus rhamnosus strain FNZ142 and / or one or more of its derivatives. The dose, administration period, and general dosing regimen of the composition administered can vary among animals depending on variables such as the selected mode of administration, the age, sex, weight and species of the animal. Furthermore, as described above, the appropriate dose can be determined by the nature of the active agent in the composition and the method of formulation.

[0204] Furthermore, the dosage of the composition can vary over time. For example, in some embodiments, a maintenance dosing regimen may follow an initial dosing regimen. It should be understood that a higher dosage may be required to establish a population of Lactobacillus rhamnosus FNZ142 in the animal's body, and a lower dosage may be sufficient to maintain that population. Thus, in some embodiments, the initial dosing regimen includes a higher dosage and / or more frequent administration than the maintenance dosing regimen. Preferably, the initial dosing regimen is effective to establish a population of Lactobacillus rhamnosus FNZ142 in the animal's body, and preferably, the maintenance dosing regimen is effective to maintain a population of Lactobacillus rhamnosus FNZ142 in the animal's body. In some embodiments, the maintenance dosing regimen includes daily, every other day, twice a week, weekly, bi-weekly or monthly administration.

[0205] In some embodiments, the effects of the methods described herein persist after administration of Lactobacillus rhamnosus FNZ142. Without wishing to be bound by theory, it is expected that administration of Lactobacillus rhamnosus FNZ142 as described herein may result in long-term or permanent changes in the forestomach and / or rumen of ruminants. In some embodiments, the effects persist for at least 2 days after the last administration of Lactobacillus rhamnosus FNZ142, for example, at least 3 days, 5 days, 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years or 7 years after the last administration of Lactobacillus rhamnosus FNZ142. In a preferred embodiment, the effects persist throughout the life of the animal.

[0206] In an example where the composition comprises one or more derivatives of Lactobacillus rhamnosus strain FNZ142, the dosage can be calculated with reference to the amount or concentration of the derivative administered per day. For example, when the bacteria are inactivated, the aforementioned amount is calculated before inactivation. In a composition containing the culture supernatant of Lactobacillus rhamnosus strain FNZ142, the dosage can be calculated with reference to the concentration of the culture supernatant present in the composition. The concentration of the culture supernatant present in the composition can be calculated, for example, based on the cfu of the culture. For example, from the total yield of the culture and the total volume of the culture supernatant, the dosage of the culture supernatant corresponding to 1×10 9 cfu / day can be calculated.

[0207] It will be understood that the preferred compositions are formulated to provide an effective dosage in a convenient form and amount. In certain embodiments, for example, without limitation, in embodiments where the regular dosage need not vary depending on the weight or other characteristics of the animal, the composition can be formulated for unit dosage. It should be understood that administration can include once-daily administration, or administration divided into a clearly divided number of times as needed. For example, an effective dosage of Lactobacillus rhamnosus strain FNZ142 can be incorporated into the feed for oral administration.

[0208] However, as a general example, the inventors contemplate administering a composition useful herein at about 1 mg to about 1000 mg per day, preferably about 50 to about 500 mg per day, or about 150 to about 410 mg per day, or about 110 to about 310 mg per day. In one embodiment, the inventors contemplate administering a composition useful herein at about 0.05 mg to about 250 mg per kg of body weight.

[0209] In one embodiment, a composition useful herein comprises, consists essentially of, or consists of at least about 0.1, 0.2, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, 99.5, 99.8 or 99.9 weight % of Lactobacillus rhamnosus strain FNZ142 and / or a derivative thereof, and useful ranges can be selected between any of these aforementioned values (e.g., about 0.1 to about 50%, about 0.2 to about 50%, about 0.5 to about 50%, about 1 to about 50%, about 5 to about 50%, about 10 to about 50%, about 15 to about 50%, about 20 to about 50%, about 25 to about 50%, about 30 to about 50%, about 35 to about 50%, about 40 to about 50%, about 45 to about 50%, about 0.1 to about 60%, about 0.2 to about 60%, about 0.5 to about 60%, about 1 to about 60%, about 5 to about 60%, about 10 to about 60%, about 15 to about 60%, about 20 to about 60%, about 25 to about 60%, about 30 to about 60%, about 35 to about 60%, about 40 to about 60%, about 45 to about 60%, about 0.1 to about 70%, about 0.2 to about 70%, about 0.5 to about 70%, about 1 to about 70%, about 5 to about 70%, about 10 to about 70%, about 15 to about 70%, about 20 to about 70%, about 25 to about 70%, about 30 to about 70%, about 35 to about 70%, about 40 to about 70%, about 45 to about 70%, about 0.1 to about 80%, about 0.2 to about 80%, about 0.5 to about 80%, about 1 to about 80%, about 5 to about 80%, about 10 to about 80%, about 15 to about 80%, about 20 to about 80%, about 25 to about 80%, about 30 to about 80%, about 35 to about 80%, about 40 to about 80%, about 45 to about 80%, about 0.1 to about 90%, about 0.2 to about 90%, about 0.5 to about 90%, about 1 to about 90%, about 5 to about 90%, about 10 to about 90%, about 15 to about 90%, about 20 to about 90%, about 25 to about 90%, about 30 to about 90%, about 35 to about 90%, about 40 to about 90%, about 45 to about 90%, about 0.1 to about 99%, about 0.2 to about 99%, about 0.5 to about 99%, about 1 to about 99%, about 5 to about 99%, about 10 to about 99%, about 15 to about 99%, about 20 to about 99%, about 25 to about 99%, about 30 to about 99%, about 35 to about 99%, about 40 to about 99%, and about 45 to about 99%).

[0210] In one embodiment, a composition useful herein comprises, consists essentially of, or consists of at least about 0.001, 0.01, 0.05, 0.1, 0.15, 0.2, 0.3, 0.4, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 grams of Lactobacillus rhamnosus strain FNZ142 and / or derivatives thereof, and useful ranges can be selected between any of these aforementioned values (e.g., about 0.01 to about 1 gram, about 0.01 to about 10 grams, about 0.01 to about 19 grams, about 0.1 to about 1 gram, about 0.1 to about 10 grams, about 0.1 to about 19 grams, about 1 to about 5 grams, about 1 to about 10 grams, about 1 to about 19 grams, about 5 to about 10 grams, and about 5 to about 19 grams).

[0211] In certain embodiments, a composition useful herein comprises, consists essentially of, or consists of at least about 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 or 10 13 colony forming units (cfu) of Lactobacillus rhamnosus strain FNZ142, and useful ranges can be selected between any of these aforementioned values (e.g., about 10 5 to about 10 13 cfu, about 10 6 to about 10 12 cfu, about 10 7 to about 10 12 cfu, about 10 8 to about 10 11 cfu, about 10 8 to about 10 10 cfu, and about 10 8 to about 10 9 cfu).

[0212] The concentration of Lactobacillus rhamnosus (L. rhamnosus strain) FNZ142 and / or one or more of its derivatives in a composition formulated for administration may be lower, for example, than in a composition formulated for distribution or storage, and it is clear that the concentration of the composition formulated for storage and its subsequent formulation into a composition suitable for administration must be suitable for being concentrated sufficiently so that the composition for administration can be administered in an effective dose.

[0213] The compositions useful herein can be used alone or in combination with one or more other therapeutic agents. The therapeutic agents can be foods, beverages, food additives, beverage additives, food ingredients, beverage ingredients, dietary supplements, vitamin or mineral premixes, oils, oil blends, oily feed supplements, nutritional products, medical foods, dietary supplements, pharmaceuticals or medicaments. The therapeutic agents can be probiotic agents or probiotic factors, preferably effective in inhibiting the growth of, or reducing the abundance of, methanogenic bacteria and / or archaea, or in reducing methane emissions by methanogenic bacteria and / or archaea. In some embodiments, the oil, oil blend, or oily feed supplement is palm kernel expeller (PKE) and / or PROLIQ.

[0214] When used in combination with another therapeutic agent, the administration of the compositions useful herein and the other therapeutic agent can be simultaneous or sequential. Simultaneous administration includes administration of a single dosage form containing all components, or administration of separate dosage forms substantially simultaneously. Sequential administration preferably includes administration according to different schedules such that the periods during which the compositions useful herein and the other therapeutic agent are provided overlap. Examples of other therapeutic agents include at least one microorganism of a different species or strain, a methanogen or a vaccine that inhibits methane production, and / or a natural or chemically synthesized methanogen inhibitor and / or a methane production inhibitor such as bromoform.

[0215] Suitable agents that can be administered separately, simultaneously, or sequentially with the compositions useful herein include one or more prebiotic agents, one or more probiotic agents, one or more postbiotic agents, one or more phospholipids, one or more gangliosides, other suitable agents known in the art, and combinations thereof.

[0216] Typically, the term prebiotic refers to substances that stimulate the growth and / or activity of bacteria with biological activity in the digestive system of animals. Prebiotics are selectively fermented components that bring about specific changes in the composition and / or activity of the gastrointestinal microbiota, resulting in health benefits to the host. Probiotics generally refer to microorganisms that contribute to the intestinal microbial balance and play a role in maintaining health or providing other biological activities. Many species of lactic acid bacteria (LAB), such as Lactobacillus casei and Bifidobacterium spp., are generally considered probiotics, but some species of Bacillus and some yeasts have also been identified as suitable candidates. Postbiotics refer to non-viable bacterial products or metabolic by-products from microorganisms such as probiotics with biological activity in the host.

[0217] Useful prebiotics include galactooligosaccharides (GOS), short-chain GOS, long-chain GOS, fructooligosaccharides (FOS), short-chain FOS, long-chain FOS, inulin, galactan, fructan, lactulose, and mixtures of two or more thereof. Some prebiotics have been reviewed by Boehm G and Moro G (Structural and functional aspects of prebiotics used in infant nutrition, J. Nutr. (2008) 138(9):1818S-1828S), which is incorporated herein by reference. Other useful substances can include dietary fibers such as completely or partially insoluble or indigestible dietary fibers.

[0218] Thus, in one embodiment, Lactobacillus rhamnosus strain FNZ142 and / or its derivatives can be administered separately, simultaneously, or sequentially with one or more probiotics, one or more prebiotics, one or more dietary fiber sources, one or more galactooligosaccharides, one or more short-chain galactooligosaccharides, one or more long-chain galactooligosaccharides, one or more fructooligosaccharides, one or more short-chain fructooligosaccharides, one or more long-chain fructooligosaccharides, inulin, one or more galactans, one or more fructans, lactulose, or any arbitrary mixture of any two or more thereof.

[0219] In certain embodiments, the composition comprises Lactobacillus rhamnosus strain FNZ142 and / or its derivatives, and one or more prebiotics, one or more probiotics, one or more postbiotics, and one or more dietary fiber sources. In certain embodiments, the prebiotics comprise one or more fructooligosaccharides, one or more galactooligosaccharides, inulin, one or more galactans, one or more fructans, lactulose, or a mixture of two or more thereof.

[0220] Without wishing to be bound by theory, it is believed that co-culturing and / or co-administering two or more lactic acid bacterial strains, such as three lactic acid bacterial strains, can reduce the incidence of culture failure due to infection by bacteriophage. Thus, in certain embodiments, the composition comprises Lactobacillus rhamnosus FNZ142 and one or more other lactic acid bacterial strains, preferably two or more other lactic acid bacterial strains. In other embodiments, a composition comprising Lactobacillus rhamnosus FNZ142 is administered simultaneously or sequentially with one or more other compositions comprising one or more other lactic acid bacterial strains, preferably two or more other lactic acid bacterial strains.

[0221] It will be understood that the different compositions of the present invention can be formulated for administration to a specific group of ruminant animals. For example, the formulation of a composition suitable for administration to cattle can be different from that suitable for administration to different ruminants such as sheep. It should also be understood that the compositions of the present invention can be of different formulations so as to be suitable for administration to ruminants of different ages. For example, the formulation of a composition suitable for administration to calves or lambs can be different from that suitable for administration to adult cattle or sheep. In certain embodiments, a first composition can be formulated for administration in an initial dosing regimen to young animals such as pre-weaned animals, and a second composition can be formulated for administration in a maintenance dosing regimen to the same animals. In some embodiments, the first composition is formulated for pre-weaned animals and the second composition is formulated for post-weaned animals.

[0222] Preparation of Lactobacillus rhamnosus strain FNZ142 Its use in methods of modulating rumen function and improving performance of direct-fed microbials (DFMs) and ruminant animals is known in the art, as is its method of manufacture.

[0223] Briefly, Lactobacillus rhamnosus strain FNZ142 can be cultured using conventional liquid or solid fermentation techniques. In at least one embodiment, the strain is grown in a liquid nutrient broth to a level at which the most cells are formed. The strain is produced by fermenting a bacterial strain that can be initiated by scaling up a seed culture. This includes repeatedly and aseptically transferring the culture to a larger volume to function as an inoculum for fermentation, which can be carried out in a large stainless steel fermenter in a medium containing the proteins, carbohydrates and minerals required for optimal growth. Exemplary media, without limitation, are MRS or TSB. However, other media can also be used. After adding the inoculum to the fermentation vessel, the temperature and agitation are controlled to allow maximum growth. When the culture reaches its maximum population density, the culture is harvested by separating the cells from the fermentation medium. This is usually done by centrifugation.

[0224] In one embodiment, to prepare Lactobacillus rhamnosus strain FNZ142, the strain is fermented to a level of 1x10 8 CFU / ml to about 1x10 9 CFU / ml. The bacteria are harvested by centrifugation and the supernatant is removed. The pelleted bacteria can then be used to produce DFM. In at least some embodiments, the pelleted bacteria are lyophilized and then used to form DFM. However, it is not necessary to lyophilize the strain before use. The strain can also be used in concentrated, non-concentrated or diluted form, with or without preservatives.

[0225] Thereafter, the count of the culture can be determined. CFU or colony forming units is the number of viable cells in a sample obtained by standard microbiological plating methods. This term is derived from the fact that a single cell plated on a suitable medium grows into a viable colony on an agar medium.

[0226] Since multiple cells can produce a single visible colony, the term colony forming unit is a more useful unit of measurement than the number of cells.

Example

[0227] Example Example 1 - Plate-based screening of bacteriocin extracts against indicator methanogenic strains 1.1. Materials and methods 1.1.1. Bacteriocin extraction A bacteriocin extract was prepared from Lactobacillus rhamnosus FNZ142 culture, and its effects on indicator methanogenic strains Methanobrevibacter boviskoreani JH1 (‘JH1’), Methanosphaera sp. WGK6 (‘WGK6’), Methanobrevibacter ruminantium M1 (‘M1’), and Methanobrevibacter gottschalkii D5 (‘D5’) were tested.

[0228] Lactobacillus rhamnosus FNZ142 was revived from an -80 °C storage by plating on De Man-Rogosa-Sharpe agar (MRS, De Man et al., 1960) + lactose (2 g / L). A small inoculation loop was used to streak the glycerol stock onto an MRS agar plate to obtain isolated colonies. The plate was incubated at 37 °C for 48 h in a sealed container. After growth, a single colony was selected and picked, and the agar plate was streaked again to obtain isolated colonies by culturing at 37 °C. After 48 h, one colony was selected from the re-streaked plate, inoculated into MRS liquid medium, and incubated at 37 °C for 48 h. Then, an inoculum (1 mL) of each revived strain was subcultured into 16 mL of MRS + nisin liquid medium (final concentration 1 ng / mL). These media contained nisin at a very low concentration to induce bacteriocin production. The cultures were incubated at 37 °C overnight. The overnight-grown Lactobacillus rhamnosus FNZ142 culture was used for bacteriocin extraction. A wet mount slide was prepared using a drop of the culture, the cells were examined using a phase contrast microscope, and Gram staining was prepared to confirm the purity of the culture.

[0229] The remaining culture (about 16 mL) was transferred to a 50 mL Falcon tube and used for bacteriocin extraction according to the method of Gaspar et al. (2018), with several modifications as follows. The pH of the culture was adjusted to approximately 6.8 with 6 M NaOH. Next, 0.3 mL of catalase (2 mg / L) was added to the culture, incubated at 37 °C for 30 min, and then incubated at 70 °C for 45 min. The culture was then centrifuged at 12,000 × g for 20 min at 4 °C, the supernatant was decanted, and the cell pellet was resuspended in 8 mL of 0.9% NaCl, pH 2. The pH of the resuspended pellet was checked and adjusted to pH 2 with 1 M HCl if necessary. The cells were cultured at 4 °C for 2 h with gentle agitation on a shaker. The cells were then centrifuged at 12,000 × g for 20 min at 4 °C, and the supernatant was collected in a new 15 mL Falcon tube. The pH of the supernatant was adjusted to 6.8 with 1 M NaOH and filtered through a sterile filter (Millex-GP 0.22 μm, diameter 25 mm, Millipore, Merck, Sigma-Aldrich NZ) using a 10 mL syringe and needle under sterile conditions and placed into a sterile and N2-flushed Hungate tube. The filtered supernatant was frozen at -20 °C until use.

[0230] Methanobrevibacter boviskoreani (Mbb. Boviskoreani) JH1 Cultivation To identify potential candidate LAB strains with anti-methanogenic activity, a microtiter plate-based methanogen growth inhibition bioassay using the model methanogenic strain Methanobrevibacter boviskoreani JH1 (Li et al., 2019) was used. Methanobrevibacter boviskoreani (Mbb. Boviskoreani) JH1 has the unusual ability to grow using ethanol as a source of reducing power to reduce CO2 to CH4 and can grow JH1 in a microtiter plate cultured under anaerobic conditions without the need to supply H2 via a 1 atm overpressure of H2:CO2 (80:20). This enables a high-throughput JH1 screening method for identifying inhibitory activity from LAB strains.

[0231] The Methanobrevibacter boviskoreani (Mbb. boviskoreani) JH1 culture for inoculating the plate assay was cultured in a Balch tube (anaerobic tube, 18 x 150 mm, butyl rubber septum stopper, aluminum crimp, Bellco Glass, Vineland, NJ, USA) containing 9 mL of BY medium (Joblin, 1995) supplemented with 60 mM sodium formate, 200 mM ethanol, 0.1 mL of vitamin solution (1x), and 0.1 mL of coenzyme M solution (10 μM) using anaerobic techniques with a syringe. The tube was incubated at 39 °C without shaking until turbidity appeared after 3 - 5 days, and used for inoculating the microtiter plate assay after the OD 600 reached 0.8 - 1.0 against a distilled water blank. The overpressure in the JH1 culture tube was released by inserting a needle into the butyl rubber septum to release the accumulated gas, and the inoculum was later removed.

[0232] The newly grown culture was examined using a wet mount under a fluorescence microscope, and Methanobrevibacter boviskoreani (Mbb. Boviskoreani) JH1 appeared as short ovoid rods that fluoresced green under ultraviolet (UV) irradiation. Contamination of the culture was checked by inoculating a sample of the culture into 9 mL of BY medium supplemented with 5 mM glucose and culturing at 39 °C for 1 day. If no turbidity was seen after 1 day, the culture was considered uncontaminated. Genomic DNA was extracted from the culture, and the 16S rRNA gene was PCR amplified using both conventional bacterial 16S primers (27f - GAGTTTGATCMTGGCTCAG, 1492r - GGYTACCTTGTTACGACTT) and archaeal - specific 16S primers (915af - AGGAATTGGCGGGGGGAGCAC, 1386r - GCGGTGTGTGCAAGGAGC) for further verification of the culture at any time. The presence of bands with the archaeal primer set and the absence of bands with the bacterial primer set, along with the sequencing results of the PCR products, were used to confirm the purity of the culture.

[0233] 1.1. Methanosphaera sp. WGK6 culture Members of the genus Methanosphaera constitute approximately 8% of rumen methanogens (Henderson et al., 2015) and are generally H2-dependent methylotrophs that use H2 to reduce methanol to methane. Methanosphaera sp. WGK6 is an H2-utilizing methylotrophic methanogen isolated from the gut of Australian kangaroos, but can also use ethanol as a source of reducing power to reduce methanol to methane (Hoedt, 2017). Similar to Methanospirillum sp. (Mbb. Boviskoreani) JH1, this metabolic ability allows WGK6 to potentially grow on ethanol without the need for overpressure of H2 and thus grow in microtiter plates. The growth of Methanosphaera sp. WGK6 was tested using BRN-RF10 medium (Balch et al. 1979; Hoedt, 2017) in Hungate tubes with H2 (180 kPa overpressure of H2+CO2, 80:20) or ethanol as the energy source and methanol as the terminal electron acceptor in both cases. Attempts to grow WGK6 on ethanol + methanol were unsuccessful, but WGK6 was able to grow on methanol + H2 in Hungate tubes. In the first attempt to grow Methanosphaera sp. WGK6 in microtiter plate format using methanol under an H2+CO2 atmosphere (180 kPa overpressure) in a pressurizable stainless steel gas canister, little detectable growth was seen after one week. However, better growth of Methanosphaera sp. WGK6 was obtained after increasing the cysteine concentration added to the BRN-RF10 medium. Therefore, a plate assay was developed using a pressurizable stainless steel gas canister (H2+CO2, 80:20).

[0234] The Methanosphaera sp. WGK6 culture for the assay was grown anaerobically in a Balch tube in 9 mL of BRN-RF10 medium supplemented with (final concentration) 60 mM sodium formate, 1% methanol, 0.1 mL of vitamin solution (1×), and 0.1 mL of coenzyme M solution (10 μM) under a pressure of 180 kPa of H2+CO2 (80:20, BOC Gases NZ) using a syringe. The tubes were incubated at 39 °C without shaking until visible turbidity appeared after 3 - 5 days and used for inoculation of the plate assay when the OD 600 reached 0.8 - 1.0 against a distilled water blank. The overpressure in the WGK6 culture tubes was released by inserting a needle through the butyl rubber septum to vent the accumulated gas, and the inoculum was removed.

[0235] 1.1.4 Methanobrevibacter ruminantium M1 and Methanobrevibacter gottschalkii D5 cultures The procedure for growing Methanobrevibacter ruminantium M1 and Methanobrevibacter gottschalkii D5 was the same as the WGK6 protocol described in 1.1.3 above, except that BY medium was used for growth. Cultures for the assay were grown anaerobically in Balch tubes in 9 mL of BY medium supplemented with (final concentration) 60 mM sodium formate, 0.1 mL of vitamin solution (1×), and 0.1 mL of coenzyme M solution (10 μM) using anaerobic techniques and an overpressure of 180 kPa of H2+CO2 (80:20, BOC Gases NZ). The tubes were cultured at 39 °C without shaking until turbidity was visible after 3 - 5 days and used for inoculation of the microtiter plate assay.

[0236] 1.1.5 Methanobrevibacter boviskoreani JH1 growth inhibition assay The bacteriocin extract from Lactobacillus rhamnosus FNZ142 frozen and stored in a Hungate tube under anaerobic conditions was thawed at room temperature. All assay components for each assay except the JH1 inoculum were added to 3.75 mL of BY+ formate medium in a sterile 7.5 mL Hungate tube at the ratios shown in Table 1 using a CO2 flush syringe and needle. Subsequently, each tube was inoculated with freshly grown JH1 culture, incubated at 39 °C for 1 hour, then transferred to an anaerobic chamber (98% CO2 - 2% H2 atmosphere, Coy Laboratory Products, USA) and dispensed into the wells of a multiwell 96-well plate. The filled plate was placed in an AnaeroPack 2.5L rectangular jar together with MCG Anaeropack-Anaero (Ngaio Diagnostics, Nelson, New Zealand), the lid was sealed, and the jar was removed from the anaerobic chamber and incubated at 39 °C. The plates were observed daily through the clear jar until the Methanobrevibacter boviskoreani JH1 control wells showed visible turbidity (usually within 5 - 6 days). Subsequently, after shaking for 5 seconds with a Multiskan FC microplate photometer (Thermo Scientific, Auckland, New Zealand), the optical density of each well was recorded at 595 nm (OD 595 ). The absorbance measurements of the medium control wells were subtracted as background, and the % inhibition of Methanobrevibacter boviskoreani JH1 growth by the bacteriocin extract samples was calculated by comparison with the JH1 positive growth control wells (containing buffer only).

[0237]

Table 1

[0238] Methanosphaera sp. WGK6 growth inhibition assay For each assay component of the assay excluding the WGK6 inoculum, as described in Table 2, 1% methanol (final concentration 247 mM) was added via a CO2 flush syringe and needle to 3.75 mL of BRN-RF10 medium in a Hungate tube. Next, the tubes were transferred to the chamber along with the inoculum tubes. The medium containing all components except the inoculum was dispensed onto plates in the chamber, and the inoculum was added to the appropriate wells. The plates were placed in a stainless-steel gas canister positioned horizontally so that a maximum of four microtiter plates could be held at once. Two anaerobic sachets (MCG Anaeropack-Anaero, Ngaio Diagnostics, Nelson, New Zealand) were added, the canister was sealed, removed from the anaerobic chamber, pumped up to a pressure of 180 kPa with H2+CO2 (80:20, BOC Gases NZ), and incubated at 39 °C for 1 week. The canister was checked regularly to ensure that overpressure was maintained and, if necessary, repressurized with H2+CO2. After 1 week of incubation, the canister was opened and the plates were removed. The contents of each well were repeatedly pipetted with a multichannel pipettor to resuspend them uniformly. Then, after shaking for 5 seconds with a Multiskan FC microplate photometer (Thermo Scientific, Auckland, New Zealand), the optical density of each well was immediately recorded at 595 nm (OD 595 ). The absorbance measurements of the medium control wells were subtracted as background, and the % inhibition of Methanosphaera sp. WGK6 growth by the bacteriocin extract samples was calculated by comparing them to the WGK6 positive growth control wells (containing only buffer instead of the bacteriocin extract).

[0239]

Table 2

[0240] 1.1.7 Methanobrevibacter ruminantium (Mbb. Ruminantium) M1 and Methanobrevibacter gottschalkii (Mbb. Gottschalkii) D5 Growth Inhibition Assay The cultures of Methanobrevibacter ruminantium (Mbb. Ruminantium) M1 and Methanobrevibacter gottschalkii (Mbb. Gottschalkii) D5 were prepared as described in 1.1.4 above. The overpressure in the tubes was released before removing the inoculum.

[0241] The assay components were added to 3.5 mL of sterile BY medium in 7.5 mL Hungate tubes via a CO2 flush syringe and needle as described in Table 3. Next, each tube was inoculated with freshly grown culture, incubated at 39 °C for 1 hour, then transferred into an anaerobic chamber and dispensed into the wells of a 96-well multiwell plate. The plate was sealed and incubated under an overpressure of 180 kPa of H2+CO2 in a stainless-steel gas canister, and the optical density was recorded with a spectrophotometer at OD 595 as described in the Methanosphaera sp. WGK6 assay of 1.1.6 above. The OD 595 reading of the BY medium control well was subtracted as background, and the % inhibition rate was calculated by comparing with the positive growth control well (containing buffer instead of bacteriocin extract) of the growth of Methanobrevibacter ruminantium (Mbb. Ruminantium) M1 or Methanobrevibacter gottschalkii (Mbb. Gottschalkii) D5 caused by the bacteriocin extract sample.

[0242]

Table 3

[0243] 1.2 Results Bacteriocins extracted from a total of 1,712 lactic acid bacteria were screened against Methanosphaera sp. WGK6. Among them, 1,580 strains (>92%) showed less than 50% inhibition. The 1,712 lactic acid bacteria included 94 strains of Lacticaseibacillus rhamnosus, of which 62 strains (about 66%) showed less than 20% inhibition of WGK6, 81 strains (about 86%) showed less than 50% inhibition, and only 3 strains (about 3%) showed about 80% or more inhibition. Together, this suggests that methanogen inhibition is likely to be a strain-specific effect.

[0244] The bacteriocin extract of Lacticaseibacillus rhamnosus (L. rhamnosus) FNZ142 showed very strong inhibition against the indicator methylotrophic methanogen Methanosphaera sp. WGK6, weak inhibition against the indicator hydrogenotrophic methanogen Methanobrevibacter boviskoreani JH1, and very weak or no inhibition against Methanobrevibacter ruminantium M1 or Methanobrevibacter gottschalkii D5, as shown in Table 4.

[0245]

Table 4

[0246] 1.3 Discussion and conclusions Members of the genera Methanobrevibacter and Methanosphaera are dominant methanogens in the rumen of multiple ruminant species. WGK6 has been used as an indicator bacterium for common methylotrophic methanogens, especially the Methanosphaera genus. Methanobrevibacter boviskoreani JH1, Methanobrevibacter ruminantium M1, and Methanobrevibacter gottschalkii D5 have been used as indicator bacteria for Methanobrevibacter spp. This example shows that the bacteriocin extract of Lactobacillus rhamnosus FNZ142 exhibits a strong inhibitory effect against the methylotrophic methanogen Methanosphaera sp. WGK6, a weaker inhibitory effect against Methanobrevibacter boviskoreani JH1, and no effect against Methanobrevibacter ruminantium M1 and Methanobrevibacter gottschalkii D5 methanogens.

[0247] 2. Example 2 - Influence of Lactobacillus rhamnosus FNZ142 on Rumen In Vitro Assay 2.2 Materials and Methods 2.1.1 Preparation of Test Bacterial Cultures and Supernatants Seven Hungate tubes, each containing 5 mL of anaerobic MRS medium (Sigma - Aldrich), were inoculated with Lactobacillus rhamnosus FNZ142 and incubated at 39 °C for 16 hours (until the cultures reached the stationary phase). The cultures were pooled into 250 mL CO2 - flushed serum bottles. An aliquot (1 mL) of the mixed culture was seeded into 9 mL of sterile MRS medium, and OD 600was measured. Furthermore, an aliquot (0.5 mL) of the culture mixture was inoculated three times into 4.5 mL of sterile anaerobic buffer, serially diluted 10-fold under CO2, plated on MRS plates, and the colony-forming unit number (CFU·mL -1 ) of the original culture was measured. Half of the remaining culture was used for one set of rumen in vitro fermentation (test culture), and the other half was filtered (Millipore 0.22 μm pore size), and the filtrate was placed in a new sterile anaerobic serum bottle (supernatant treatment, SN). Anaerobic phosphate buffer (0.46 M K2HPO4, 0.54 M KH2PO4, pH 7) was used as an untreated control (buffer).

[0248] 2.1.2 Preparation of rumen fluid and setup of in vitro fermentation For inoculation of the rumen in vitro fermentation vessel, fresh rumen contents were collected from six Friesian cows fitted with rumen fistulas. After squeezing through a single layer of cheesecloth, the rumen fluid obtained from two animals was mixed (approx. 150 mL of rumen fluid), providing three biological replicates. An aliquot (12.5 mL) of the mixed rumen fluid was added to 0.5 mg of dried grass and 36.5 mL of anaerobic phosphate buffer in a 250 mL serum bottle. After adding 1 mL of the treatment solution of either buffer, test culture, SN or bacteriocin extract, the serum bottle was closed with a butyl rubber stopper, providing a final fermentation volume of 50 mL containing 25% (v / v) rumen fluid. The gas production amount and methane content were measured using an automatic incubation system (Muetzel et al., 2014).

[0249] 2.1.1 Collection and analysis of VFA samples Samples were collected from the bottle for VFA analysis. At each time point, 3 mL aliquots were collected and their pH was measured. 1.8 mL samples of these aliquots were used for VFA and non-VFA analysis. The VFA samples were centrifuged at 21,000×g for 10 minutes at 4 °C, 0.9 mL of the supernatant was taken out and added to 0.1 mL of the internal standard (20 mM butyric acid 2-ethyl in 20% phosphoric acid), mixed, and frozen at -20 °C until analysis. After thawing, they were recentrifuged at 21,000×g for 10 minutes at 4 °C, 0.9 mL was taken for derivatization for non-VFA analysis, and the remaining samples were analyzed directly by GC.

[0250] 2.2 Results Lactobacillus rhamnosus FNZ142 was examined for its effect on gas production in an in vitro rumen assay as shown in Tables 5 - 10. The data shown are the average of three replicates. Negative numbers represent stimulation, not inhibition. Asterisks (*) are used to indicate statistical significance (p < 0.05) by Student's T test with Welch's correction.

[0251] [Table 5]

[0252] [Table 6]

[0253] [Table 7]

[0254] [Table 8]

[0255] [Table 9]

[0256]

Table 10

[0257] Lactobacillus rhamnosus FNZ142 significantly decreased the total methane produced at 2 and 6 hours in the rumen in vitro assay in 2 out of 3 biological replicate tests. This effect was also seen when using the culture supernatant in 1 of the biological replicate tests. The bacteriocin extract did not show a significant effect on methane production. It should be noted that the rumen in vitro test is a closed system and may be subject to nutrient limitation over time. Therefore, animals typically consume more food and liquid over a 24-hour period, so the 0 - 12-hour time points may more accurately reflect the in vivo situation. The RIV replicate tests were conducted at different times using rumen fluid collected from different cows fed a forage-based diet. Therefore, the variation between RIV replicate tests may at least partially be due to seasonal changes in forage quality.

[0258] Overall, the Lactobacillus rhamnosus FNZ142 culture caused a decrease in total gas production, which varied between RIV replicates and was significant at some time points in only some replicates. The culture supernatant and bacteriocin extract did not have a significant effect on the total gas produced in the rumen in vitro assay.

[0259] There was also no significant effect on the total volatile fatty acids produced, or the amounts of acetic, propionic, and butyric acids produced, although acetic acid increased at 12 hours in 1 replicate of the FNZ142 culture, propionic acid decreased at 24 hours in 1 replicate of the FNZ142 culture, and propionic acid increased at 6 hours with the bacteriocin extract.

[0260] 2.3 Conclusions The in vitro rumen assay of Lactobacillus rhamnosus FNZ142 showed an impact on the final fermentation products, indicating a significant decrease in methane production. This occurred without significantly affecting volatile fatty acid production.

[0261] 3. Example 3 - Methane emissions from calves 3.1 Materials and methods 3.1.1 Calf research design, animal ethics, and housing facilities This example used a design including treatments with Lactobacillus rhamnosus FNZ142 and a control to test the ability of FNZ142 to reduce CH4 emissions from calves when fed to calves over a 14 - week period after birth. Statistical power calculations using previous CH4 emission measurement data from calves showed that at least 20 animals per treatment group were needed to detect a 20% difference in CH4 emissions. In previous studies, calves were excluded from the trial due to umbilical infections caused by umbilical sucking by pen mates. To mitigate these potential losses, 24 calves per group were used. This study was approved by the AgResearch Ruakura Animal Ethics Committee. The calf rearing sheds were divided into pens of approximately 12 m 2 each. Each pen housed 4 calves, was bedded with wood chips, supplied with fresh water, and equipped with feeders for calf pellets and hay.

[0262] 3.1.2 Calf enrollment and feeding Female dairy calves of the Friesian breed were enrolled in the study over a 3-week period. Calf enrollment was staggered over 3 weeks to disperse calf ages so that three groups of animals of the same age could be measured sequentially in the bovine CH4 measurement chamber. Newborn calves were removed from their mothers twice daily and taken to the calf rearing shed. Calves were weighed upon arrival at the shed and then weekly while in the calf rearing facility. Calves were randomly assigned to treatment groups (FNZ142 or control) every week after enrollment, balanced for birth weight and sire of the calf, with 8 calves per week assigned to each treatment group. Within the first 12 hours after entering the barn, each calf was fed 2 - 3 L of warm colostrum twice, and the morning colostrum feed contained the FNZ142 or control treatment. Lyophilized Lactobacillus rhamnosus FNZ142 was stored at -20 °C until use. Each calf treated with FNZ142 received 5×10 10CFU of FNZ142 was administered daily. The control treatment (3 g maltodextrin / calf / day) was the excipient used to mix the concentrated freeze-dried Lactobacillus rhamnosus FNZ142 product to the correct daily dose. After colostrum was given, calves were given 6 L of calf milk replacer (CMR) (Ancalf, NZAgBiz / Fonterra, 150 g / L mixed with tap water at approximately 37 °C) daily, divided into 3 L in the morning and 3 L in the afternoon. FNZ142 and the control treatment were added only to the 3 L of morning milk and mixed into the preheated CMR until the lyophilized material was evenly dispersed throughout the milk. Calves were also given solid feed in the form of pelleted calf feed containing 20% fiber source (alfalfa and soybean hulls) and a coccidia-specific non-ionic forage coccidia inhibitor (see Table 11). To avoid the possibility of variation in solid feed intake among calves and its potential impact on rumen development and CH4 emissions from calves, hay was not given to calves for the first 6 weeks. However, after the first CH4 measurement at week 6, hay from the pasture and hay from the pasture with husks (cut to approximately 75 mm) were given to calves to stimulate saliva secretion and stabilize rumen pH. Pellet feed and hay intake were measured at the pen level.

[0263] Since calves were almost weaned from week 10, by the end of week 11, they were only receiving 0.5 L of CMR containing FNZ142 and the control treatment in the morning. The treatment was continued to be given to calves as 0.5 L of CMR in the morning feed until the second CH4 measurement was completed at week 14.

[0264]

Table 11

[0265] 3.1.1 Animal Health Calves were dehorned and vaccinated and treated for parasites according to the animal health and welfare protocol.

[0266] 3.1.4 Measurement of Methane Emissions from Calves CH4 measurements were carried out on 20 calves per treatment group at 6 weeks of age (before weaning), 14 weeks of age (after weaning), and 12 months of age. The calves were measured in four cattle respiration chambers, four at a time, for two days each. The first pre-weaning CH4 measurement period was 34 days, and the second post-weaning period was also 34 days long. The third period at 12 months of age was also 34 days long.

[0267] First Round of CH4 Measurements Calves (four per transport) were transported from the calf rearing shed to the methane measurement facility at the New Zealand Animal Ruminant Methane Measurement Centre. Upon arrival, the calves were placed in a pen lined with wood chips and given afternoon milk (3 L before weaning) or solid feed (after weaning), and fresh water was also available for drinking. At around 8:00 the next morning, the calves were transferred to individual cattle respiration chambers where morning milk (CMR; 3 L) was given, and pellet feed (plus hay with husks after weaning) and water were available ad libitum. While in the chamber, the calves continued to receive FNZ142 and the control treatment and solid pellet feed. The calves remained in the chamber for two days for CH4 measurement, and feeding and pen cleaning were carried out twice a day. At 8:00 am on the third day, the calves were transferred from the chamber to the pen, and the next four calves (which had been in the pen the previous night) were placed in the chamber. At around 9:00 am, the calves that had come out of the chamber were given morning milk and pellets (plus hay with husks after weaning) ad libitum, and water was available ad libitum. Two hours after feeding (around 11:00 am), samples of rumen contents and faeces were collected from each calf. Samples of rumen (via a stomach tube) and faeces (collected digitally) were immediately used for pH measurement and then stored at -80 °C for subsequent volatile fatty acid (VFA) analysis.

[0268] After the first CH4 measurement period ended at 6 weeks, the calves were returned to the calf rearing facility and given hay ad libitum in addition to the calf pellets provided ad libitum until week 12.

[0269] Second Round of CH4 Measurements For two weeks until the CH4 measurement in the second round of the 14th week, chaffy hay was freely provided instead of hay. When the calves entered the respiration chamber for measurement after weaning at 14 weeks of age, chaffy hay was provided at approximately 10% (500 g / day) of the calf pellets (5 kg) given daily. The intakes of milk and solid feed were measured in both rounds of CH4 measurement. Feed samples were dried, the daily dry matter intake (DMI) per calf was estimated, and a composition analysis was performed. The measured values of CH4, hydrogen (H2), and CO2 in the chamber were reported as emissions (g / day) or yields (g / kg DMI / day).

[0270] After the second round of CH4 measurement and sampling were completed in the 14th week, the calves were transported to the farm to adapt them to feeding on pasture. The calves were placed on pasture with calf pellets given at the previous daily intake, and the amount of pellets given was reduced over a three-week period (a 33% reduction in pellet supply per week) to encourage the transition to pasture.

[0271] Third round of CH4 measurement At approximately 9 months of age, rumen contents and fecal samples were collected as described above, but due to facility limitations, respiration chamber measurements were not performed at this time. At approximately 1 year of age, the animals were returned to the respiration chamber for measurement.

[0272] The animals were adapted to harvested pasture (harvested daily) for 7 days and continued to receive harvested pasture for an additional 2 days while in the cattle respiration chamber. Two hours after leaving the respiration chamber, rumen contents and fecal samples of each animal were collected as described above.

[0273] The feed intake of the animals in the respiration chamber over a two-day period was measured, the feed samples were dried, and the daily dry matter intake (DMI) per animal was estimated. Sub-samples of the dried feed were used for composition analysis. The measured values of methane, hydrogen, and carbon dioxide in the respiration chamber were reported as emissions (g / day) or yields (g / kg DMI / day).

[0274] 3.1.5 Growth of animals after weaning After methane measurement at 14 weeks, the calves were moved to pasture and their body weight and average daily gain were monitored monthly until 13 months of age. Treated animals and control animals were moved to separate pastures, and the pasture quality was monitored to ensure comparability of the results. As expected in a pasture-based agricultural system, there were seasonal variations in metabolic energy (ME) and digestibility (in vitro DOMD%) in both pastures, but no significant differences between pastures. Treatment with FNZ142 was discontinued after weaning at 14 weeks of age.

[0275] Statistical analysis was performed in R using the lme4 package. The body weight model was fitted by REML, including the effect of treatment with FNZ142, time (i.e., month of body weight measurement), and two interactions, with a random effect for the animals.

[0276] ADG was calculated by averaging the daily body weight gain between 4 - 5 months of age and 13 - 14 months of age for each treatment. A two-sample t-test was used to investigate the difference in daily body weight gain between treatment and control.

[0277] 3.2. Results A total of 48 female Freesian breed calves were enrolled in the study over a three-week period from July 23 to August 12, 2021. When the calves were born, they were assigned to one of two treatment groups (n = 24 per group) - FNZ142 or control (vehicle only). Twenty calves from each group were used for the measurements described below.

[0278] 3.2.1 Growth of animals before weaning The body weight of the calves was measured when they first arrived at the calf rearing shed. There were no statistical differences in birth weight between the treatment groups (Table 12).

[0279]

Table 12

[0280] Calves were treated starting from the first feeding of colostrum and continued to be treated once a day in the morning until the second CH4 measurement was completed after 14 weeks of age. Table 13 shows the pellet and hay intake of calves while they were in the respiration chamber during methane measurement.

[0281]

Table 13

[0282] Table 14 shows an overview of the live weight (LWT) and average daily gain (ADG) before CH4 measurement at 6 and 14 weeks of age. At 6 weeks of age, there was no significant difference in LWT or ADG between FNZ142-treated and control calves. At 14 weeks of age, there was no significant difference in ADG, but the FNZ142-treated group showed a 5% decrease in LWT compared to the control, reaching a significant difference (p < 0.05).

[0283] It is known that CH4 measurement in the respiration chamber can stress animals and affect feed intake and growth rate. Therefore, the LWT and ADG of calves in the respiration chamber were also examined. Although there were several animals whose weight decreased during movement in the chamber (average LWT decrease of 0.392 kg over 4 days), most animals maintained or increased their weight (average LWT increase of 0.774 kg, ADG of 0.194 kg over 4 days). There was no significant difference in ADG between FNZ142-treated calves and control-treated calves in the chamber.

[0284]

Table 14

[0285] 3.2.2 Methane Emission Of the calves registered in the study, 40 calves were selected for CH4 emissions measurement. The selection was made from the weekly registration of the animal group, and the criteria used for calf exclusion were previous health status and whether veterinary intervention was required prior to CH4 measurement. The animals were measured in 3 rounds. The first round was at 6 weeks of age before weaning, the second round was at 14 weeks of age after weaning, and the third round was at approximately 1 year old. Each measurement round was carried out in 3 batches over 34 days.

[0286] In the first round, the calves received 2×3 L / day of CMR (including therapeutic agent) in the morning and afternoon feeding, and free access to calf pellets while in the chamber. In the second round, the calves received only 0.5 L of CMR containing therapeutic agent in the morning feeding, free access to calf pellets, and 10% of the expected solid feed intake as hay with chaff. In the third round, the animals received harvested pasture.

[0287]

Table 15

[0288] CH4 generated from calves at the 6-week measurement was in the range of 7 - 10 g / day, and the CH4 yield was 12 - 15 g / kg DMI / day (Table 15). This is expected as calves before weaning mainly consume a milk diet (6 L / day: 0.9 kg of milk solids) and have a low solid feed intake (0.6 - 0.7 kg / day).

[0289] Calves that received the FNZ142 treatment showed a significantly (P<0.01) 17% decrease in CH4 production (g / day) and a significantly (P<0.01) 7.5% decrease in CO2 production (g / day) compared to calves that received the control treatment (placebo only).

[0290] Calves that received the FNZ142 treatment showed a significantly (P<0.05) approximately 17% decrease in pellet intake. However, since the calves also consumed 6 L of CMR per day (900 g of milk solids per day), the pellet intake was only about 40% of the total intake.

[0291] After weaning at 14 weeks, the CH4 production of calves treated with FNZ142 was 47.08 g / day, while that of control calves was 51.55 g / day. However, the CH4 yield of calves treated with FNZ142 was 15.39 g CH4 / kg DMI / day, while that of control calves was 14.88 g CH4 / kg DMI / day. These CH4 emissions are lower than those of adult animals but are within the range expected for weaned calves.

[0292] Animals that received FNZ142 continued to have significantly lower CH4 production (g CH4 / day, p<0.001) and yield (g CH4 / kg DMI, p<0.05) at 1 year, despite the discontinuation of FNZ142 supplementation after methane measurements at 14 weeks (Table 15). Animals that received FNZ142 also had significantly lower production of H2 and CO2. Animals that received FNZ142 showed significantly lower total dry matter intake at 1 year compared to control animals (p<0.001, Table 15).

[0293] Samples of rumen contents and feces were collected from calves after CH4 measurement rounds at 6 weeks, 14 weeks, 9 months, and 1 year, and their pH values were measured. There was no significant difference in rumen pH between the FNZ142 treatment group and the control group (Table 16). There was no significant difference in fecal pH between the FNZ142 treatment group and the control group, except for the fecal pH at 14 weeks. The fecal pH at 14 weeks was lower in the FNZ142 treatment group than in the control group.

[0294]

Table 16

[0295] After calves exited the chamber at 6 weeks (before weaning), 14 weeks, 9 months, and 1 year (after weaning), volatile fatty acids in the rumen contents were measured from the collected samples. The main VFAs detected were acetic acid, and propionic acid and butyric acid constituted a small proportion (Table 17). When comparing calves given FNZ142 with the control group, there was no significant difference in the amount of acetic acid, propionic acid, or total VFAs. Butyric acid was significantly decreased in 1-year-old animals treated with FNZ142 compared with the control group, but there was no significant difference at other measurement time points.

[0296]

Table 17

[0297] Compared with control animals at 14 weeks, the amount of isovaleric acid in the treated animals was significantly decreased. However, at 9 months, the treated animals showed a very significant increase in the amount of isobutyric acid, valeric acid, and isovaleric acid present in the rumen samples (Table 18).

[0298]

Table 18

[0299] There was no significant difference in the amount of formic acid, lactic acid, and succinic acid detected in the treated or control animals at 6 weeks, 14 weeks, or 9 months (Table 19). At 1 year, the amount of formic acid, lactic acid, and succinic acid was significantly decreased in the treated animals compared with the control animals.

[0300]

Table 19

[0301] 3.2.3 Growth of Animals after Weaning After methane measurement at 14 weeks, the calves were moved to pasture, and body weight and average daily weight gain were monitored monthly.

[0302] During methane measurement at 1 year old, the feed intake of FNZ142-treated animals was 5.69 kg of forage dry matter per animal per day, with a standard deviation of 0.77. In control animals, the feed intake was 7.26 kg per animal per day, with a standard deviation of 0.95 (Table 15). The FNZ142-treated animals had a significantly lower feed intake (p < 0.001).

[0303] The body weights of FNZ142-treated animals and control animals were similar from 4 to 5 months to 6 to 7 months (p > 0.05) (Table 20, Figure 1). However, after 7 to 8 months, the control animals had a significantly lower weight gain, and as a result, their body weight was significantly lower than that of FNZ142-treated animals (p < 0.05) (Table 20, Figure 1).

[0304] The average daily body weight gain (ADG) over 4 to 14 months was significantly higher in FNZ142-treated animals than in control animals (p = 0.003).

[0305]

Table 20

[0306] 3.3 Discussion In the first-round CH4 measurement (6 weeks), it was shown that calves receiving the FNZ142 treatment had approximately 17% lower CH4 production. Overall, the CH4 production and CH4 yield of these young calves were lower compared to adult cattle fed pasture forage (typically about 22 g / kg DMI). This is expected as pre-weaned calves are mainly fed milk feed (6 L / day: 0.9 kg milk solids) and consume a small amount (0.6 - 0.7 kg / day) of solid feed (grain-based).

[0307] Feeding with the FNZ142 strain did not affect the CMR intake or solid feed intake in the pen during the period until the first CH4 measurement. Calves consumed all of the CMR during the first-round CH4 measurement, but the pellet intake of calves fed FNZ142 in the chamber was approximately 100 g / day less and the solid feed intake was approximately 17% less than that of calves fed the control feed, indicating this.

[0308] Due to the stress of CH4 measurement in the respiration chamber, some animals may lose weight, but most of the calves in the first round continued to gain weight, albeit at a lower rate compared to when the animals were not in the chamber. Since there was no significant difference in ADG between calves fed FNZ142 and those given the control treatment while the animals were in the chamber, the difference in solid feed intake observed in the chamber is thought to be due to the effect of the LAB treatment. In these pre-weaned calves, since the milk component accounted for the majority (about 60%) of the diet intake, the decrease in pellet intake did not affect the LWT or ADG of the entire group of calves receiving the FNZ142 treatment.

[0309] After weaning at 14 weeks, the CH4 production measured from calves increased by about five-fold, but the CH4 yield remained at the same level as the measurement at 6 weeks. The post-weaning diet mainly consisted of pellets and hay with hulls (average pellet intake 3.9 kg / day, average hay intake 0.35 kg / day), and the CMR was slight (average CMR intake of solids 0.075 kg / day), so the overall increase in CH4 production was expected. The CH4, H2, and CO2 production of calves given FNZ142 were all numerically low, but there was no significant difference compared to the control calves.

[0310] After one year, the CH4 production and yield, H2 production, and CO2 production of the treated animals were all significantly lower than those of the untreated animals. The DMI intake was also significantly lower in the treated animals than in the untreated animals (p<0.001). Nevertheless, the treated animals showed a higher body weight than the untreated animals.

[0311] The possible cause of the reduced DMI in calves may be related to the low rumen pH caused by the diet, but this does not seem to be the cause of the reduced DMI observed in calves given FNZ142. Some individual rumen samples (23%) were below 5.6 at the time of sampling (2 hours after feeding when the rumen pH is likely to be at its lowest), but the rumen pH was not significantly different between calves given FNZ142 and those given the control treatment, suggesting that pH was not the cause of the reduced intake in calves given FNZ142.

[0312] In the VFA analysis of rumen contents of calves at 6 and 14 weeks (after weaning), no significant difference was shown when comparing calves administered FNZ142 and control animals.

[0313] At 1 year old, the amount of butyric acid present in the rumen samples of the animals that received the FNZ142 treatment decreased significantly. The amount of VFA present in the rumen samples is the balance between rumen VFA production and VFA absorption. The decrease in the VFA amount in the rumen samples may be due to a decrease in VFA production (for example, because less feed is digested) and / or an increase in rumen VFA absorption (which means more VFA is available for growth and development). Combined with the weight gain seen in the treated animals, the decrease in rumen VFA concentration is consistent with an increase in absorption, leading to an improvement in feed efficiency.

[0314] After weaning, the animals continued to show similar weight gain from 4 - 5 months to 6 - 7 months of age. From 7 - 8 months to 9 - 10 months of age, the animals treated with FNZ142 had a significant increase in weight, resulting in a significantly higher weight than the control animals (p < 0.05). After 10 - 11 months of age, the animals treated with FNZ142 showed numerically higher weights than the control animals but did not reach a significant level.

[0315] The ADG of the FNZ142 - treated heifers during the late weaning period (4 - 14 months of age) was also very significantly higher than that of the control animals (p = 0.003). This suggests that the FNZ142 - treated animals were more productive and had higher feed efficiency than the control animals, despite a decrease in dry matter intake (measured during the methane chamber measurement).

[0316] 3.4 Conclusions In this example, supplementation with Lactobacillus rhamnosus FNZ142 for 14 weeks after birth supports normal or increased growth and leads to weight gain, thereby improving the feed efficiency of weaned animals, despite a decrease in dry matter intake. This effect persisted until at least 1 year old, despite the supplementation stopping at 14 weeks of age.

[0317] This example also shows that Lactobacillus rhamnosus FNZ142 can significantly reduce methane production in calves before weaning (6 weeks of age). Also, this effect persisted until at least 1 year of age, even though supplementation stopped at 14 weeks of age.

[0318] Calves given FNZ142 had lower methane production and ate less when measured before weaning, but achieved similar live weights and average daily weight gains as control animals. Reducing feed intake and methane production while maintaining animal growth suggests a mechanism involved in the efficient utilization of ingested feed for rumen metabolism and production.

[0319] This example also shows that Lactobacillus rhamnosus FNZ142 supports normal growth after weaning and leads to improved weight gain even after supplementation has stopped.

[0320] 4. Example 4 - Effects of Lactobacillus rhamnosus FNZ142 on the rumen and fecal microbiota 4.1 Materials and methods Rumen and fecal samples were collected at the end of methane measurements and immediately frozen at -80 °C until DNA extraction. DNA was extracted using the bead beating / phenol chloroform method (Rius et al., 2012) and used in PCR reactions to generate 16S ribosomal RNA gene amplicons using barcoded sequencing primers specific for bacteria, archaea, and protozoa (Kittelmann and Janssen, 2011). Amplicons were purified, normalized, pooled, and sequenced by an Illumina MiSeq sequencer. Sequencing results were quality controlled, filtered, and the filtered sequences were analyzed in QIIME using the Silva database containing rumen-specific 16S rRNA gene sequences. Operational taxonomic units (OTUs) were selected at 99% similarity and summarized in tables.

[0321] 4.2 Results Samples for rumen and fecal microbiota analysis were collected at 6 and 14 weeks, simultaneously with the methane measurements being recorded in Example 3.

[0322] 4.2.1 Rumen microbiota (bacteria) Overall, no significant differences in rumen bacterial microbiota were observed at the phylum level between FNZ142-treated animals and control animals at week 6 or 14 (data not shown).

[0323] At the family level, the relative abundance of Lachnospiraceae significantly decreased at 6 weeks (p<0.05) (Table 21). The difference remained at 14 weeks but did not reach a significant level.

[0324] [Table 21]

[0325] At the genus level, the abundance of Succiniclasticum significantly decreased at 14 weeks compared to the control (Table 22). Since Succiniclasticum is known to be involved in succinate metabolism, this decrease may indicate disruption of the succinate metabolic pathway in the rumen.

[0326] [Table 22]

[0327] 4.2.2 Rumen microbiota (archaea) Overall, no significant differences in rumen archaeal microbiota were observed at the family, genus, or phylotype level between FNZ142-treated animals and control animals at 6 or 14 weeks (data not shown).

[0328] 4.2.3 Fecal microbiota (bacteria) At the phylum level, after 6 weeks, the relative abundance of Firmicutes in the feces of animals administered FNZ142 increased significantly compared to that of control animals (Table 23). This effect did not persist until 14 weeks. Lactiplantibacillus rhamnosus FNZ142 is a member of Firmicutes, but no corresponding significant increase was observed in Lactiplantibacillus, suggesting that the increase in Firmicutes reflects not only the increase in FNZ142 but also the increase in other bacterial genera within this phylum.

[0329] [Table 23]

[0330] At the family level, after 6 weeks, the relative abundance of Erysipelotrichaceae in the feces of animals administered FNZ142 increased significantly compared to that of control animals (p < 0.05) (Table 24). This effect did not persist until 14 weeks.

[0331] [Table 24-1] [Table 24-2]

[0332] At the genus level, there was no significant difference between the feces of animals administered FNZ142 and the control (data not shown).

[0333] 4.2.4 Fecal microbiota (archaea) When comparing the feces of FNZ142-treated animals with those of the control, there was no significant difference in the diversity of archaea at the family, genus, or clade level (data not shown).

[0334] 4.3 Conclusion In this example, it is shown that Lactobacillus rhamnosus FNZ142 can reduce methane production in calves without causing major disruptions to the bacterial or archaeal microbiota (as shown in Example 3). The decrease in the abundance of Lachnospiraceae in the rumen at 6 weeks is consistent with the decrease in methane yield in sheep, but no corresponding increase in Erysipelotrichaceae in the rumen, particularly in the genus Sharpea or Megasphaera, was observed. An increase in Erysipelotrichaceae was observed in the feces at 6 weeks.

[0335] Literature Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R. & Wolfe, R.S., 1979. Methanogens: re-evaluation of a unique biological group. Microbiol. Rev. 43, 260-96. Carson AF, Dawson LER, McCoy MA, Kilpatrick DJ, Gordon FJ 2002. Effects of rearing regime on body size, reproductive performance and milk production during the first lactation in high genetic merit dairy herd replacements. Animal Science 74: 553-565. De Man, J.C., Rogosa, M., & Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli. J. Appl. Bacteriol. 23(1), 130-135. https: / / doi.org / 10.1111 / j.1365-2672.1960.tb00188.x Dobos RC, Nandra KS, Riley K, Fulkerson WJ, Lean IJ, Kellaway RC 2001. Effects of age and liveweight at first calving on first lactation milk, protein and fat yield of Friesian heifers. Australian Journal of Experimental Agriculture 41: 13-19. Gaspar, C., Donders, G.G., Palmeira-de-Oliveira, R., Queiroz, J.A., Tomaz, C., Martinez-de-Oliveira, J., & Palmeira-de-Oliveira, A. 2018. Bacteriocin production of the probiotic Lactobacillus acidophilus KS400. AMB Express. 8(1), 153. doi: 10.1186 / s13568-018-0679-z. Krehbiel, C. R., Rust, S. R., Zhang, G., and Gilliland, S. E. (2003). Bacterial direct-fed microbials in ruminant diets: performance response and mode of action. J. Anim. Sci. 81, 120-132. Henderson G, Cox F, Ganesh S, Jonker A, Young W, Global Rumen Census Collaborators, and Janssen PH. 2015. Rumen microbial community composition varies with diet and host, but a core microbiome is found across a wide geographical range. Scientific Reports 5()14567; doi: 10.1038 / srep14567. Hoedt, E.C., 2017. Functional and comparative studies of members of the genus Methanosphaera, and their adaptations to the gut environment. PhD Thesis, The University of Queensland, Brisbane, Australia. https: / / doi.org / 10.1007 / s002849900262 IPCC, 2014. Mitigation of Climate Change. Contribution of Working Group III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge. Jackson, R.B., Saunois, M., Bousquet, P., Canadell, J.G., Poulter, B., Stavert, A.R., Bergamaschi, P., Niwa, Y., Segers, A., Tsuruta, A., 2020. Increasing anthropogenic methane emissions arise equally from agricultural and fossil fuel sources. Environ. Res. Lett. 15, 071002. https: / / doi.org / 10.1088 / 1748-9326 / ab9ed2 Joblin, K. N. 1995. Methanogenic archaea. In Methods in Gut Microbial Ecology for Ruminants pp 47-53. Kamke, J., Kittelmann, S., Soni, P., Li, Y., Tavendale, M., Ganesh, S., Janssen, P.H., Shi, W., Froula, J., Rubin, E.M., & Attwood, G.T., 2016. Rumen metageno average d metatranscripto average analyses of low methane yield sheep reveals a Sharpea-enriched microbiome characterised by lactic acid formation and utilisation. Microbiome 4(1). https: / / doi.org / 10.1186 / s40168-016-0201-2 Li, Y., Kelly, W. J., Attwood, G. T., Reid, P. and Leahy, S. C. 2019. Methanobrevibacter boviskoreani JH1T growth on alcohols allows development of a high throughput bioassay. Proceedings of the Chicago Congress on Gastrointestinal Function Chicago 2019. MacDonald KA, Penno JW, Bryant AM, Roche JR 2005. Effect of feeding level pre- and post-puberty and body weight at first calving on growth, milk production and fertility in grazing dairy cows. Journal of Dairy Science 88: 3363-3375. McNaughton, LR and T Lopdell. 2013. Effect of heifer liveweight on calving pattern and milk production. Proceedings of the New Zealand Society of Animal Production. 73: 103-107. Muetzel, S., Hunt, C., and Tavendale, M.H. (2014). A fully automated incubation system for the measurement of gas production and gas composition. Animal Feed Science and Technology 196, 1-11. Perez, R.H., Zendo, T., Sonomoto, K., 2014. Novel bacteriocins from lactic acid bacteria (LAB): various structures and applications. Microb. Cell Factories 13 Suppl 1, S3. https: / / doi.org / 10.1186 / 1475-2859-13-S1-S3 Tyrrell, H.F., Reid, J.T., 1965. Prediction of the energy value of cow’s milk. J. Dairy Sci. 48, 1215-1223. https: / / doi.org / 10.3168 / jds.S0022-0302(65)88430-2 van der Waaij EH, Galesloot PJB, Garrick DJ 1997. Some relationships between weights of growing heifers and their subsequent lactation performances. New Zealand Journal of Agricultural Research 40:87-92.

[0336] Industrial applicability The present invention relates to the use of probiotic bacteria, in particular Lactobacillus rhamnosus strain FNZ142 and / or its derivatives, and in particular to the improvement of the body weight or body composition of ruminants, the improvement of feed efficiency, the improvement of growth and / or productivity, and / or the increase in milk production of ruminants, the inhibition of the growth or the decrease in the abundance of methanogenic bacteria and / or archaea in the forestomach of ruminants, the decrease in the methane-producing ability of the rumen microbiota, and / or the reduction of methane emissions by ruminants. The present invention also provides a method for using Lactobacillus rhamnosus strain FNZ142 and / or its derivatives, and a ruminant feed composition containing them.

Claims

Claim 1 A separated Lacticaseibacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142, or a derivative thereof, with the NMIA acceptance number V21 / 015448 dated August 2, 2021. Claim 2 A food or feed composition comprising a Lacticaseibacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142, or a derivative thereof, with the NMIA acceptance number V21 / 015448 dated August 2, 2021. Claim 3 The food or feed composition according to claim 2, wherein the composition is a ruminant feed composition. Claim 4 a. Enhancing the feed efficiency of ruminants; b. Enhancing the growth and / or productivity of ruminants; c. Improving the body weight and / or body composition of ruminants; d. Increasing the yield of milk and / or milk components produced by ruminants; e. Inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants; f. Reducing the methane-producing ability of the rumen microbiota; g. Reducing methane emissions by ruminants; h. Delivering microorganisms to ruminants, and / or i. Reducing the greenhouse gas emission footprint of ruminants, A ruminant feed composition for the purpose of, wherein the feed composition comprises a Lacticaseibacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142 with the NMIA acceptance number V21 / 015448 dated August 2, 2021, or a derivative thereof. Claim 5 The feed composition is a fermented yogurt-like composition, and the fermented yogurt-like composition is formed by a method of growing Lacticaseibacillus rhamnosus (L. rhamnosus) FNZ142 using a milk-based carrier or a non-milk-based carrier. The ruminant feed composition according to claim 4. Claim 6 The ruminant feed composition according to claim 4, which is a partial mixed feed or a total mixed ration (TMR), corn, soybeans, alfalfa, grains, distillers grains, germinated grains, legumes, fiber, barley, forage, hay, straw, silage, grain, leaves, meal, mash feed, fruit pulp, vegetable pulp, fruit or vegetable pomace, citrus meal, wheat shorts, corn cob meal, lick block or molasses, or contains the same.

7. The ruminant feed composition according to any one of claims 4 to 6, further comprising at least one microorganism of a different species or strain, a methanogen or a vaccine that inhibits methane production, and / or a natural or chemically synthesized methane production inhibitor and / or a methanogen inhibitor such as bromoform.

8. The ruminant feed composition according to any one of claims 4 to 7, further comprising one or more agents selected from one or more prebiotics, one or more probiotics, one or more postbiotics, one or more dietary fiber sources, one or more galactooligosaccharides, one or more short-chain galactooligosaccharides, one or more long-chain galactooligosaccharides, one or more fructooligosaccharides, one or more short-chain fructooligosaccharides, one or more long-chain fructooligosaccharides, inulin, one or more galactans, one or more fructans, lactulose, or any arbitrary mixture of any two or more thereof.

9. The ruminant feed composition according to any one of claims 4 to 8, wherein the derivative of Lactobacillus rhamnosus FNZ142 is a cell lysate of the strain, a cell suspension of the strain, a metabolite of the strain, a culture supernatant of the strain, or heat-killed Lactobacillus rhamnosus FNZ142.

10. a. Increasing the feed efficiency of ruminants; b. Enhancing the growth and / or productivity of ruminants; c. Improving the body weight and / or body composition of ruminants; d. Increasing the yield of milk and / or milk components produced by ruminants; e. Inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants; f. Reducing the methane-producing ability of the rumen microbiota of ruminants; g. Reducing methane emissions by ruminants; h. Delivering microorganisms to ruminants, and / or i. A method for reducing the greenhouse gas emission footprint of ruminants, wherein the method comprises administering to the animal i. The food or feed composition according to claim 2 or 3, ​ ii. The ruminant feed composition according to any one of claims 4 to 9, or iii. administering an effective amount of Lactaseibacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142 with NMIA accession number V21 / 015448 dated August 2, 2021, or a derivative thereof A method comprising the step of **Claim 11** The method according to claim 10, wherein the method inhibits the growth of methylotrophic methanogens, preferably methanogens of the genus Methanosphaera, in the forestomach of the animal or reduces the abundance thereof. **Claim 12** The method according to claim 10 or 11, which inhibits the growth of hydrogenotrophic methanogens, such as methanogens of the genus Methanobrevibacter, in the forestomach of the animal or reduces the abundance thereof. **Claim 13** Lactaseibacillus rhamnosus (L. rhamnosus) FNZ142 or a derivative thereof is administered in a composition that is a food, beverage, food additive, beverage additive, animal feed, animal feed additive, animal feed supplement, dietary supplement, carrier, vitamin or mineral premix, nutritional product, enteral nutritional product, solubles, supplement, pharmaceutical, lick block, drencher, tablet, capsule, pellet or intraruminal product such as a bolus, or Lactaseibacillus rhamnosus (L. rhamnosus) FNZ142 is encapsulated in, for example, liposomes, microbubbles, microparticles or microcapsules. The method according to any one of claims 10 to 12. **Claim 14** Lactaseibacillus rhamnosus (L. rhamnosus) FNZ142 or a derivative thereof is administered to drinking water, milk, powdered milk, alternative milk, milk fortifier, whey, whey powder, partial or total mixed ration (TMR), corn, soybeans, hay, grains, distilled grains, germinated grains, legumes, vitamins, amino acids, minerals, fiber, chaff, forage, hay, straw, silage, grain, leaves, meal, solubles, supplements, mash feed, fruit pulp, vegetable pulp, fruit or vegetable pomace, citrus meal, wheat shorts, corn cob meal, lick block, molasses, sucrose, maltodextrin, rice husks, vermiculite, zeolite or ground limestone. The method according to claim 13. **Claim 15** To the animal a. 10 to 10 colony forming units per kilogram of dry weight carrier feed, preferably 10 to 10 colony forming units per kilogram of dry weight carrier feed 4 ~10 13 colony forming units, preferably 10 8 ~10 12 colony forming units b. 10 per day per kilogram of the animal's body weight 4 to 10 10 colony forming units, preferably 10 per day per kilogram of the animal's body weight 5 to 10 8 colony forming units, or c. 10 per day 4 ~10 13 colony forming units, preferably 10 per day 6 ~10 13 colony forming units, The method according to any one of claims 10 to 14, comprising administering an amount of Lactobacillus rhamnosus FNZ142.

16. The method according to any one of claims 10 to 15, wherein the derivative of Lactobacillus rhamnosus FNZ142 is a cell lysate of the strain, a cell suspension of the strain, a metabolite of the strain, a culture supernatant of the strain, or heat-killed Lactobacillus rhamnosus FNZ142.

17. The method according to any one of claims 10 to 16, further comprising administering at least one microorganism of a different species or strain, a methanogen or a vaccine that inhibits methanogenesis, and / or a natural or chemically synthesized methanogenesis inhibitor and / or a methanogen inhibitor such as bromoform.

18. Lactobacillus rhamnosus FNZ142 or a derivative thereof is administered separately, simultaneously or sequentially with one or more agents selected from one or more prebiotics, one or more probiotics, one or more postbiotics, one or more dietary fiber sources, one or more galactooligosaccharides, one or more short-chain galactooligosaccharides, one or more long-chain galactooligosaccharides, one or more fructooligosaccharides, one or more short-chain fructooligosaccharides, one or more long-chain fructooligosaccharides, inulin, one or more galactans, one or more fructans, lactulose, or any arbitrary mixture of any two or more thereof. The method according to any one of claims 10 to 17.

19. The method is a. enhancing the growth or productivity of ruminants; b. increasing the yield of milk and / or milk components produced by ruminants; c. increasing the yield of milk fat, milk protein or milk solids in the milk produced by ruminants, and / or d. further improving the body weight and / or body composition of ruminants. The method according to any one of claims 10 to 18.

20. The ruminant is a bovine animal, goat, sheep, bison, yak, water buffalo, deer, camel, alpaca, llama, gnu, antelope or nilgai, preferably a cow or a sheep, more preferably a cow. The method according to any one of claims 10 to 19.

21. a. The ruminant is a mammal. b. The ruminant is an animal before weaning, such as a calf or a lamb. c. The ruminant is an animal after weaning, or d. The method according to any one of claims 10 to 20, wherein Lactobacillus rhamnosus FNZ142 is administered to ruminants both before and after weaning.

22. The administration is performed on an animal before weaning, and the inhibition of the growth of methanogenic bacteria and / or archaea in the forestomach of the ruminant, the methane emission by the ruminant, for example, the reduction of methane production, and / or the improvement of feed efficiency in the ruminant continue even after weaning. The method according to any one of claims 10 to 21.

23. The inhibition of the growth of methanogenic bacteria and / or archaea in the forestomach of the ruminant, the methane emission by the ruminant, for example, the reduction of methane production, and / or the increase in feed efficiency in the ruminant lasts for at least 2 days, 3 days, 5 days, 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years or 7 years after the last administration of Lactobacillus rhamnosus FNZ142, preferably lasting throughout the life of the ruminant. The method according to any one of claims 10 to 22.

24. A ruminant to which the method according to any one of claims 10 to 23 has been applied.

25. A method for producing an animal product with a reduced greenhouse gas emission footprint, the method comprising: a. providing a ruminant according to claim 24, and b. producing an animal product from the animal. The method comprising.

26. Of Lactobacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142 or a derivative thereof with NMIA acceptance number V21 / 015448 dated August 2, 2021 a. enhancing the feed efficiency of ruminants, b. enhancing the growth and / or productivity of ruminants, c. improving the body weight and / or body composition of ruminants, d. increasing the yield of milk and / or milk components produced by ruminants, e. inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, f. reducing the methane-producing ability of the rumen microbiota, g. reducing methane emissions by ruminants, h. delivering microorganisms to ruminants and / or i. reducing the greenhouse gas emission footprint of ruminants, for use in the manufacture of a composition for such purposes.

27. The use according to claim 26, wherein the composition comprises the food or feed composition according to claim 2 or 3, or the ruminant feed composition according to any one of claims 4 to 9.

28. a. enhancing the feed efficiency of ruminants, b. enhancing the growth and / or productivity of ruminants, c. improving the body weight and / or body composition of ruminants, d. increasing the yield of milk and / or milk components produced by ruminants, e. inhibiting the growth of methanogenic bacteria and / or archaea in the forestomach of ruminants, f. reducing the methane-producing ability of the rumen microbiota, g. reducing methane emissions by ruminants, h. delivering microorganisms to ruminants and / or i. reducing the greenhouse gas emission footprint of ruminants, Lacticaseibacillus rhamnosus (Lactobacillus rhamnosus) strain FNZ142 or a derivative thereof with NMIA acceptance number V21 / 015448 dated August 2, 2021 for use in the above.