Oligonucleotide conjugated to oleic acid and its use
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF VALENCIA
- Filing Date
- 2023-05-23
- Publication Date
- 2026-06-01
AI Technical Summary
Current treatments for myotonic dystrophy type 1 (DM1) are ineffective, and existing microRNA antagonists face challenges such as short lifespan, poor cellular uptake, narrow therapeutic concentration range, and toxicity issues, limiting their efficacy.
Development of oligonucleotides conjugated to oleic acid, specifically targeting hsa-miR-23b-3p and hsa-miR-218-5p, with a mixture of phosphorothioate and phosphodiester linkages to enhance stability, tissue-specific uptake, and therapeutic index.
The conjugated oligonucleotides effectively increase MBNL1 and MBNL2 protein levels, alleviating DM1 symptoms by improving therapeutic index and delivery to muscle and central nervous system tissues.
Smart Images

Figure 00000067_0000 
Figure 00000067_0001 
Figure 00000067_0002
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medicine. More specifically, the present invention relates to endogenous microRNAs conjugated to oleic acid, particularly oligonucleotide antagonists of hsa-miR-218-5p and hsa-miR-23b-3p, and their use.
Background Art
[0002] Myotonic dystrophy type 1 (DM1) is a rare genetic disease for which there is currently no effective treatment. DM1 is associated with a significant disease burden that causes impairment across many different patient systems and tissues. Muscle weakness and fatigue are the two most common disease symptoms, reported in 93% and 90% of patients respectively, followed by muscle contracture (73%). Other phenotypes include cardiac dysfunction, cataracts, insulin resistance and cognitive impairment. The DM1 disease is based on an expansion of CTG repeats that occur in the DM1 protein kinase (DMPK) gene, which is transcribed into pathogenic mRNA. It is now well established that the expansion of CUG binds to the Muscleblind-like (MBNL1, 2 and 3) protein family with high affinity, inhibiting its normal function, although other changes may contribute to the depletion of MBNL1 and MBNL2. In skeletal muscle and the brain, MBNL1 and MBNL2 are selectively expressed respectively, while MBNL3 is mainly expressed during embryonic development and adult tissue regeneration.
[0003] The MBNL1 and MBNL2 proteins control the alternative splicing and polyadenylation of several transcripts, particularly by causing a shift from the fetal to the adult pattern, act antagonistically to the CUGBP Elav-like family member 1 (CELF) proteins in splicing control, and have been found to be upregulated and mislocalized in DM1. Furthermore, genetic redundancy has been shown between the MBNL1 and MBNL2 genes, since deletion of only one of them results in upregulation of the other and occupancy of its binding sites in target RNAs (see Non-Patent Document 1). Depletion of MBNL1 protein function has been shown to be an important factor in the course of this disease. Indeed, loss of function of MBNL1 accounts for over 80% of mis-splicing events and nearly 70% of expression defects. Upregulation of the MBNL genes and / or MBNL proteins in DM1 mice and patient-derived fibroblasts is well tolerated, rescues several symptoms such as myotonia and mis-splicing events, and reduces focus formation, opening the way for the development of therapeutic approaches aimed at increasing the expression of these genes. Depletion of MBNL1 and MBNL2 also affects several other gene expression processes, for example impairing the transport of membrane-bound mRNAs or miRNA biogenesis.
[0004] MicroRNAs (also referred to herein as "miRNAs" or "miRs") are a type of small non-coding RNAs that play an important role in the regulation of gene expression, particularly in gene silencing. In human cells, the expression of hsa-miR-23b-3p and hsa-miR-218-5p has been shown by luciferase reporter assays to directly regulate MBNL1 and MBNL2 transcripts (Non-Patent Document 2). Silencing of hsa-miR-23b-3p and hsa-miR-218-5p increases Muscleblind-like protein expression and alleviates the myotonic dystrophy phenotype in mammalian models. On the other hand, antimiRs are a type of oligonucleotide that prevent other molecules such as microRNAs from binding to target sites on RNA, particularly messenger RNA (mRNA) molecules. When using normal antimiRs as therapeutic molecules, there are limitations in their development as drug candidates, including their short lifespan due to degradation in the cellular environment, poor cellular uptake from the extracellular medium, and the narrow therapeutic concentration range represented as the ratio of the concentration at which the compound reaches the median of toxicity and efficacy (TC50 / EC50), where a higher ratio is better. Therefore, in order to maximize the potential of antimiRs that inhibit the target hsa-miR-218-5p and hsa-miR-23b-3p, it is necessary to further develop methods aimed at increasing the stability, efficacy, tissue-specific uptake, and therapeutic concentration range of antimiRs among several pharmacological parameters.
[0005] On the other hand, albumin is one of the most abundant proteins in plasma and is responsible for the transport of fatty acids, drugs, ions, and other metabolites. Conjugation of oligonucleotides with fatty acids can increase the albumin-binding affinity of oligonucleotides, improve their ability to cross the endothelial barrier, and enhance their functional uptake into muscle, thereby increasing the in vivo efficacy of oligonucleotides. However, a wide variety of saturated and unsaturated fatty acids with different structures may affect the protein binding or activity of fatty acid conjugates, and it remains unclear which fatty acid is optimal for enhancing oligonucleotide efficacy.
[0006] On the one hand, including other chemical modifications in oligonucleotides can enhance their pharmacological parameters. Among the above modifications, phosphorothioate (PS) linkages have continued to show promising results as first-generation antisense oligos, but there are significant limitations that still hinder the development of fully modified (fully PS) therapeutic oligonucleotides. The above limitations include the toxicity of PS-oligos reported in several studies in mice, rats, monkeys, and humans. In mice and rats, these side effects include thrombocytopenia, elevated liver transaminases, hyperplasia of reticuloendothelial cells in various organs, and renal tubular changes (Non-Patent Document 3, Non-Patent Document 4). In monkeys, the observed side effects are complement activation (Non-Patent Document 5) and prolongation of activated partial thromboplastin time (aPTT). Since similar side effects have been observed after administration of dextran sulfate, it is speculated that these side effects are caused by the polyanionic nature of PS-oligos and are not nucleotide sequence-specific. Therefore, it is necessary to develop oligonucleotides with reduced toxicity and increased stability.
[0007] The present invention overcomes these limitations by providing an improved antimiR conjugated to oleic acid.
Prior Art Documents
Non-Patent Documents
[0008]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
[0009] In one aspect, the present invention relates to an oligonucleotide molecule or a mixture of two or more of such molecules, wherein the oligonucleotide molecule has a length of 10 to 30 nucleotides, the oligonucleotide molecule comprises at least two nucleotides chemically linked by phosphorothioate linkages, and the oligonucleotide molecule is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. Preferably, the molecule is an antagonist of a microRNA, and more preferably, the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.
[0010] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 to 30 nucleotides and contains at least two nucleotides linked by phosphodiester linkages, wherein the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages.
[0011] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 to 30 nucleotides, wherein the oligonucleotide molecule also includes a fragment composed of at least 15 consecutive nitrogenous bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or SEQ ID NOs: 52 to 110.
[0012] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 to 30 nucleotides, wherein the oligonucleotide molecule also includes a fragment composed of at least 15 consecutive nitrogenous bases of nucleotides that are identical to the sequence of the region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p).
[0013] In one embodiment, the oligonucleotide molecule according to the first aspect includes at least one chemical modification, wherein the chemical modification is i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) an additional bridge (LNA) connecting the 2' oxygen and the 4' carbon, selected from the group of.
[0014] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 nucleotides to 30 nucleotides, wherein the oligonucleotide molecule comprises at least 15 consecutive nitrogenous bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50 or SEQ ID NO: 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28 (antagonist of hsa-miR-218-5p).
[0015] In one embodiment, the oligonucleotide molecule according to the first aspect has a length of 15 nucleotides to 30 nucleotides, wherein the nucleotide sequence of the oligonucleotide consists of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50 or SEQ ID NO: 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28 (antagonist of hsa-miR-218-5p).
[0016] In another aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising the oligonucleotide molecule defined in at least the first aspect or any of its embodiments, or a mixture of two or more thereof, optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives.
[0017] In another aspect, the present invention relates to a composition defined in any of the second aspect or its embodiments, which is used in therapy.
[0018] In another aspect, the present invention relates to a composition defined in any of the second aspect or its embodiments, which is used for the targeting of muscle cells in a subject in need of muscle cell targeting.
[0019] In another aspect, the present invention relates to a composition defined in either the second aspect or an embodiment thereof, which is used for the prevention or treatment of muscle diseases or the prevention or treatment of RNA abnormalities.
[0020] Preferably, the disease is myotonic dystrophy, and more preferably, the myotonic dystrophy is type 1. BRIEF DESCRIPTION OF THE DRAWINGS
[0021]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10A
Figure 10B
Figure 10C
Figure 11
Figure 12
Modes for Carrying Out the Invention
[0022] General Definitions It should be noted that as used herein, the singular forms ("a", "an", and "the") include plural references unless the context clearly dictates otherwise. Further, unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to all elements in the series. One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.
[0023] The term "about" when referring to a given amount or quantity indicates that the numerical value can vary by ±20% around its specified value. Preferably, "about" means ±10% around the value, more preferably, "about" means ±10%, 8%, 6%, 5%, 4%, 3%, 2% around the value, or even more preferably, "about" means ±1% around the value, in this order of preference.
[0024] As used herein, the connective “and / or” between a number of recited elements is understood to cover both individual choices and combinations of choices. For example, when two elements are connected by “and / or”, the first choice refers to the first element being applicable excluding the second element. The second choice refers to the second element being applicable excluding the first element. The third choice refers to the first element and the second element being applicable together. Any one of these choices is included within the scope of its meaning and is thus understood to meet the requirements of the term “and / or” as used herein. The simultaneous applicability of two or more choices is also included within the scope of its meaning and is thus understood to meet the requirements of the term “and / or”.
[0025] Throughout this specification and the appended claims, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, are to be interpreted to mean that the specified integer or step or group of integers or steps is included, but not to exclude any other integer or step or group of integers or steps. As used herein, the term “comprising” can be replaced by the term “containing” or “including”, or, as used herein, can sometimes be replaced by the term “having”. None of the above terms (comprising, containing, including, having), when used herein in the context of aspects or embodiments of the present invention, can at any time be replaced by the term “consisting of”, although this is less preferred.
[0026] As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. As used herein, "consisting essentially of" does not exclude materials or steps that do not substantially affect the basic and novel features of the claim.
[0027] As used herein, names referring to mouse genes are written in italics with all letters after the capital letter in lowercase. The names of mouse proteins follow the same rule as the symbols of mouse genes, but are not italicized. When referring to human genes or proteins, capital letters are always used, and genes are italicized. Nevertheless, those skilled in the art will be able to infer the exact nature of the biomolecules (proteins, genes, transcripts) and species from the technical context of this specification.
[0028] As used herein, the term "oligonucleotide" refers to any short segment of DNA, RNA, or DNA / RNA, including both natural and synthetic nucleotides. When used in the present invention, the term "oligonucleotide molecule" includes both the oligonucleotide itself and "oligonucleotide analogs". An "oligonucleotide analog" is a molecule derived from an oligonucleotide that incorporates some chemical modification in at least one of the nucleotide units that form it, either in the phosphate group, the pentose, or one of the nitrogenous bases, and modifications consisting of the addition of non-nucleotide groups at the 5'-end and / or 3'-end are also included, such as phosphorodiamidate morpholino oligomers, peptide nucleic acids (PNA; mimetics of DNA in which the phosphate backbone of deoxyribose is replaced by a pseudo-peptide polymer to which nucleobases are linked), and the like. By way of extension, for the purposes of the present invention and as used herein, the terms "oligonucleotide molecule" and "oligonucleotide analog" or "oligonucleotide analog molecule" also include microRNA sponges, i.e., microRNA sponges. This is because its main components can be considered to be tandem repeats of oligonucleotides, each of these oligonucleotides being either itself or characterized by containing a binding site for the microRNA of interest. For the sake of clarity, it is noted that the oligonucleotide sequences disclosed herein and numbered as "SEQ ID NO:" include the nucleobase sequence, and if any, chemical modifications and / or fatty acid conjugations. For example, SEQ ID NO: 3 refers in particular to the nucleobase sequence "ATCCCTGGCAATGTGA" with LNA, phosphorothioate linkages, and 5-methyl-2'-O-methylcytidine, among other modifications. For this reason, this sequence is represented herein as SEQ ID NO: 3: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCms-AbAmTbGbTmsGbsAb(NHC6)(oleic acid).
[0029] As used herein, "antagonist oligonucleotide" means an oligonucleotide capable of blocking or inhibiting the natural function of a molecule, in this case a microRNA. Thus, the antagonist oligonucleotide of the present invention is an inhibitor molecule that avoids the activation, stability or function of the antimiR to which it binds. In the context of the present invention, "antagonist" is synonymous with "inhibitor" and can therefore be used interchangeably. For example, "antagonist oligonucleotide of hsa-miR-23b-3p" refers to an oligonucleotide molecule that inhibits the function of hsa-miR-23b-3p.
[0030] The "percentage of sequence identity" for polynucleotides and polypeptides is determined by comparing two sequences that are optimally aligned against a comparison window, wherein the portion of the polynucleotide sequence or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the same nucleic acid base or amino acid residue is present in both sequences, obtaining the number of matching positions, dividing the number of such matching positions by the total number of positions in the comparison window, and multiplying the result by 100. The optimal alignment of sequences for comparison can be performed by computer implementations of known algorithms (BLAST in the resources of the National Center for Biotechnology Information, CLUSTAL in the resources of the European Bioinformatics Institute, GAP, BESTFIT, FASTA, and TFASTA in the Genetics Computer Group (GCG) of the Wisconsin Genetics Software Package (575 Science Drive, Madison, Wisconsin)) or by inspection. It should be noted that the "percentage of identity" as used herein is determined in the context of a local alignment, i.e., based on the alignment of locally similar regions between nucleic acid base sequences, as opposed to a global alignment aimed at aligning two sequences over their entire length. Thus, in the context of the present invention, the percentage identity is preferably calculated based on local alignment comparison algorithms only.
[0031] Often, especially in the case of antimiRs, chemical modifications are incorporated into the corresponding nucleotide units, which mainly affect the ribose moiety and / or the phosphate, and are modifications that are difficult to depict in the normal representation of the nucleotide sequence. The nucleotide present at a given position is identified by the abbreviation of the nitrogenous base that is part of it. Thus, in the present invention, the molecules of microRNA antagonists are compared by referring to the percentage of identity between the sequences of the nitrogenous bases or nucleobases of the nucleotides or nucleotide analog units present in these units. This is because it indicates whether two molecules or sequence fragments are designed from the same original basic nucleotide sequence, regardless of the various chemical modifications that may be included in the nucleotides in each case.
[0032] As used herein, two strands of a nucleotide molecule are understood to be 100% complementary when one nucleotide or nucleotide analog sequence read in the 5'-3' sense presents a nitrogenous base that pairs with the nitrogenous base of the other sequence of nucleotides or nucleotide analogs read in the 3'-5' sense. That is, the sequence 5'-UAGC-3' is complementary to the sequences 3'-AUCG-5' and 3'-ATCG-5', which are the sequences 5'-GCUA-3' and 5'-GCTA-3' read in the 5'-3' sense, respectively. In one embodiment, it is preferred that the antagonist molecule contains in its sequence a fragment identical to the complementary sequence of the seed region of the microRNA to be antagonized, at least with respect to the complementarity of the nitrogenous bases.
[0033] As used herein, "antimiR" refers to an oligonucleotide, preferably an oligoribonucleotide, that is complementary to its target microRNA, preferably a mature microRNA, and binds to it with a high affinity to inhibit it. Thus, an antimiR refers to an oligonucleotide that is chemically modified with respect to the corresponding oligomer, which usually consists only of nucleotide units, is complementary, and is thus an inhibitor of the target microRNA. In certain cases of the present invention, the antimiRs described herein are preferably at least partially complementary to the human microRNAs hsa-miR-23b-3p or hsa-miR-218-5p.
[0034] As used herein, a "microRNA sponge" is designed to inhibit microRNAs that typically have complementary heptamer or octamer fragments (seed regions), and using a single sponge construct, it is possible to block an entire family of microRNAs sharing the same motif, although it may contain the entire target sequence of a particular microRNA or only a miRNA-specific region lacking the seed region for specificity.
[0035] The expression "pharmaceutically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce any adverse, allergic, or other reactions when administered to animals or humans. As used herein, "pharmaceutically acceptable vehicles" include solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, fatty acids such as oleic acid, and similar acceptable agents used in the preparation of pharmaceutical formulations such as pharmaceuticals suitable for administration to humans.
[0036] "Prevent", "preventing", or "prevention" includes, but is not limited to, reducing, decreasing, or ameliorating the risk of a symptom, disorder, condition, or disease, and protecting an animal from a symptom, disorder, condition, or disease. Prevention can be applied or carried out prophylactically.
[0037] "To treat", "treating", or "treatment" includes, but is not limited to, suppressing, slowing, halting, reducing, improving, or reversing the progression or severity of an existing symptom, clinical sign, disorder, condition, or disease. Treatment can be applied or administered therapeutically.
[0038] As used herein, "TC50" or "half maximal inhibitory concentration" means the concentration of an inhibitor administered to a test organism or test cell line that produces a toxic effect in 50 percent of a population of organisms or cell lines exposed for a given period of time.
[0039] As used herein, "EC50" or "half maximal effective concentration" means the concentration of an antagonist or inhibitor required to obtain a response intermediate between baseline and maximum for a given period of time. That is, the EC50 is the concentration required to obtain 50% of the effect caused by treatment.
[0040] As used herein, "Emax" means the maximum response achievable by an applied or administered agent, in this case an antagonist molecule. Emax is measured as the maximum fold change in a target protein, such as the MBNL1 protein, obtained after transfection with a particular antimiR-23b-3p or antimiR-218-5p compared to mock (transfected or untransfected with vehicle).
[0041] "Tindex" or "therapeutic index / ratio" is a quantitative measure of the relative safety of a drug. In the present invention, Tindex is defined as the ratio of the amount of a therapeutic agent that causes 50% toxicity (TC50) to the amount that causes 50% therapeutic effect (EC50), multiplied by the maximum response achievable: Tindex = (TC50 / EC50) × Emax
[0042] As used herein, the term "3'-end" refers to the end of a nucleotide chain having a hydroxyl group at the 3rd carbon of the sugar ring at the end. As used herein, the term "5'-end" refers to the end of a nucleotide chain having the 5th carbon of the sugar ring at the end.
[0043] Detailed Description As described above, there is a need to develop improved oligonucleotides that contain chemical modifications that reduce toxicity while enhancing therapeutic efficacy. For this reason, two main objectives were the subject of the present invention. On the one hand, to evaluate what the best fatty acids are for conjugating to oligonucleotides, and to design oligonucleotides with the maximum allowable amount of PS linkage that have a beneficial effect on the molecule but are not overly toxic for in vivo administration. On the other hand, the present invention also provides specific microRNA inhibitors, particularly oligonucleotide molecules or analogs thereof, which aim to correct the insufficient function of Muscleblind-like (MBNL) proteins that is partially due to the overexpression of hsa-miR-23b-3p and hsa-miR-218-5p in patients with myotonic dystrophy (DM), preferably myotonic dystrophy type 1 (DM1).
[0044] First, the inventors tested the effects of conjugating previously published antagomiR-23b and antagomiR-218 oligonucleotides (Non-Patent Document 2) with various hydrophobic moieties (including lipids and fatty acids) in vitro with respect to toxicity, efficacy (level of MBNL1 protein), and therapeutic index (Tindex) (Table 1). The antagomiR sequences used in this study all contained all 2'-OME modified nucleotides, and a mixture of phosphorothioate (PS) linkages and phosphodiester (PO) linkages. Surprisingly, for both the antagomiR-23b and antagomiR-218 oligonucleotides, conjugation with oleic acid was found to result in the most significant improvement in Tindex.
[0045] Next, the inventors tested the ability of oleic acid to act as a carrier. From the experiments shown in FIGS. 11 and Example 9, it was demonstrated that oleic acid is an excellent carrier or vehicle for delivering oligonucleotides to tissues such as muscle and the central nervous system (CNS). Furthermore, from FIGS. 12 and 13 and Example 10, it was demonstrated that the vehiculation of oligonucleotide molecules by oleic acid occurs not only in an animal model with the DM1 phenotype but also in healthy animals (in this case, monkeys). These results open the way for the therapeutic use of oleic acid as a carrier when conjugated to oligonucleotide molecules, particularly in the context of diseases affecting muscle and / or the CNS, which are two of the major tissues in which oleic acid promoted oligonucleotide delivery.
[0046] DM1 is a neuromuscular disease that affects not only muscle tissue but also the central nervous system. Therefore, the inventors screened for antimiR sequences with the best Tindex in DM1 cells from a pool of antimiRs having lengths in the range of 15 to 22 nucleotides, including nucleotides with different chemical modifications such as LNA, 2'OME, and 2'MOE. The best antagonist of human hsa-miR-23b-3p in this study was MD23b-2, and the oligonucleotide with the best Tindex for the antagonist of human hsa-miR-218-5p was 218-D / LNA2 (see Tables 2 and 3, FIG. 1). The modified forms of each of these two molecules were combined with oleic acid, and the resulting molecules were tested in a mouse model of DM1 (HSA LRTested in mouse) and DM1 cells (only the modified form of MD23-b2). From the results of these tests, it became clear that the conjugation of oleic acid to oligonucleotides containing a mixture of PS / PO enhances the therapeutic effect of the oligonucleotides (see Tables 4, 5 and 6). Overall, from the results obtained in this study, the authors concluded that the best fatty acid for conjugating to oligonucleotide molecules to improve the level of MBNL1 in DM1 cells and the mouse model of the disease is oleic acid, and that this conjugation improves the therapeutic index of the oligonucleotide when a mixture of PS / PO linkages is present in the molecule.
[0047] In view of these results, in a first aspect, the present invention relates to an oligonucleotide and / or an oligonucleotide analog molecule or a mixture of two or more of said molecules, wherein the oligonucleotide and / or oligonucleotide analog molecule is conjugated to at least one oleic acid molecule at the 3'-end and / or 5'-end of the oligonucleotide and / or oligonucleotide analog molecule. The oligonucleotide and / or oligonucleotide analog is preferably an antagonist of a microRNA. The oligonucleotide and / or oligonucleotide analog is preferably an antagonist of a microRNA selected from the group consisting of human hsa-miR-23b-3p or human hsa-miR-218-5p.
[0048] MicroRNAs hsa-miR-23b-3p and hsa-miR-218-5p are repressors of the expression of the MBNL gene among numerous gene transcripts, and thus what is decreased by the presence of their antagonists is their inhibitory ability. In the context of the present invention, an inhibitor, silencer or blocker is a compound capable of causing a decrease in the endogenous activity of the above hsa-miR-23b-3p and hsa-miR-218-5p, and thus these three terms are included under the designation "antagonist". Strictly speaking, the term "silencing" can be interpreted as the absolute inactivation of such activity, but since the difference between such inactivation or a non-absolute decrease in inhibitory activity can depend on the concentration of the compound used, any compound that results in a decrease in the inhibitory activity of the microRNA is sufficient to be considered its inhibitor, silencer, blocker, or, in short, antagonist. Additionally, considering the knowledge regarding the possibility of inhibiting microRNA function by targeting mature microRNA, precursor microRNA (pre-microRNA or pre-miRNA) or primary microRNA (pri-microRNA or pri-miRNA), a compound can be considered an inhibitor, silencer, blocker or antagonist of the microRNA according to the present invention if it is capable of decreasing the endogenous activity of the above microRNA not only when targeting mature microRNA but also when targeting precursor microRNA or primary microRNA transcripts. Thus, as used herein, the four terms (inhibitor, silencer, blocker or antagonist) are used as synonyms herein.
[0049] Regarding the nucleotide sequence of the antagonist of the present invention, it is important to note that it should have sufficient complementarity with the endogenous molecule to which it must bind. The endogenous molecule is preferably a microRNA molecule, more preferably an hsa-miR-23b-3p or hsa-miR-218-5p molecule. Human hsa-miR-218-5p and hsa-miR-23b-3p have different nucleotide sequences that need to be taken into account for the design of the antagonist sequence and its microRNA binding site. A "microRNA binding site" is a nucleotide sequence contained in an antagonist that is complementary or partially complementary to at least a part of its target microRNA. Preferably, the microRNA binding site of the antagonist defined herein is complementary or partially complementary to at least a part of hsa-miR-23b-3p or hsa-miR-218-5p. The sequence of the binding site may be completely identical, i.e., having perfect complementarity to the microRNA. Alternatively, the sequence may be partially complementary, i.e., one or more mismatches may occur when the microRNA base pairs with the binding site of the antagonist. Importantly, when the antagonist is partially complementary to the target microRNA (preferably hsa-miR-23b-3p or hsa-miR-218-5p), its binding site preferably includes perfect or nearly perfect complementarity (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or preferably 100% complementary) to the seed region of the target microRNA (preferably hsa-miR-23b-3p or hsa-miR-218-5p). The "seed region" of a microRNA usually includes or consists only of nucleotides 2 to 7 from the 5' end of the microRNA.
[0050] Therefore, in the design of the antimiR of the present invention, the mature sequence of the target microRNA and its seed region can be considered. The mature sequences are shown below, with their respective seed regions in bold and their accession codes (Mimat) in the miRbase database (www.mirbase.org) indicated: Hsa (Homo sapiens)-miR-218-5p (MIMAT0000275): 5’-UUGUGCUUGAUCUAACCAUGU-3’ (SEQ ID NO: 10); seed region: UGUGCU (SEQ ID NO: 12) hsa-miR-23b-3p (MIMAT0000418): 5’-AUCACAUUGCCAGGGAUUACCAC-3’ (SEQ ID NO: 11); seed region: UCACAU (SEQ ID NO: 13)
[0051] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule is an inhibitor, blocker or antagonist of the type known as antimiR and microRNA sponge. Preferably, the oligonucleotide and / or its analog according to any of the first aspect or its embodiments is an antimiR, more preferably an antimiR of hsa-miR-218-5p or hsa-miR-23b-3p.
[0052] In one embodiment, the oligonucleotide and / or its analog has a length of at least 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides. In one embodiment, the oligonucleotide and / or its analog has a length of 10 to 50 nucleotides, more preferably 10 to 30 nucleotides or 15 to 25 nucleotides. The oligonucleotide molecule and / or its analog preferably comprises, consists of, or consists essentially of a fragment composed of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complementary sequence of the region present in SEQ ID NO: 10 (hsa-miR-218-5p) or SEQ ID NO: 11 (hsa-miR-23b-3p). More preferably, the sequence of the nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complementary sequence of SEQ ID NO: 10 (hsa-miR-218-5p) or SEQ ID NO: 11 (hsa-miR-23b-3p).
[0053] In one embodiment, the antagonist is an antimiR, and its sequence comprises a fragment composed of at least 5 to 8 consecutive nucleotide or nucleotide analog units, wherein the sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-23b-3p set forth in SEQ ID NO: 13. Preferably, the antimiR comprises a fragment composed of at least 5 to 8 consecutive nucleotide or nucleotide analog units that are 100% complementary to the seed region set forth in SEQ ID NO: 13. In one embodiment, the antagonist is an antimiR whose sequence comprises a first fragment and a second fragment, wherein the first fragment is composed of at least 5 to 8 consecutive nucleotide or nucleotide analog units, and the sequence of the nitrogenous bases of the first fragment is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-23b-3p set forth in SEQ ID NO: 13, and the second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment) and is composed of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to the complementary sequence of the region present in SEQ ID NO: 11. As used herein, "adjacent" means immediately adjacent to the first fragment, i.e., there are no nucleotides between the first fragment and the second fragment. In some alternative embodiments, the second fragment is located 6, 7, 8, 9, 10 or 11 nucleotides upstream and / or downstream of the first fragment.More preferably, the second fragment is located 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides or 5 nucleotides upstream and / or downstream of the first fragment.
[0054] In one embodiment, the antagonist is an antimiR, and its sequence includes a fragment composed of at least 5 to 8 consecutive nucleotide or nucleotide analog units, where the sequence of the nitrogenous bases of the nucleotide or nucleotide analog unit is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p set forth in SEQ ID NO: 12. Preferably, the antimiR includes a fragment composed of at least 5 to 8 consecutive nucleotide or nucleotide analog units that are 100% complementary to the seed region set forth in SEQ ID NO: 12. In one embodiment, the antagonist is an antimiR whose sequence includes a first fragment and a second fragment, where the first fragment is composed of at least 5 to 8 consecutive nucleotide or nucleotide analog units, and the sequence of the nitrogenous bases of the first fragment is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p set forth in SEQ ID NO: 12, and the second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment) and is composed of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to the complementary sequence of the region present in SEQ ID NO: 10. As used herein, "adjacent" means immediately following the first fragment, i.e., there are no nucleotides between the first fragment and the second fragment. In some alternative embodiments, the second fragment is located 6, 7, 8, 9, 10 or 11 nucleotides upstream and / or downstream of the first fragment.More preferably, the second fragment is located 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides or 5 nucleotides upstream and / or downstream of the first fragment.
[0055] Also included within the concept and scope of oligonucleotide and / or oligonucleotide analog molecules useful for the purposes of the present invention are microRNA inhibitors, blockers or antagonists that act on pri-microRNA or pre-microRNA, which usually alter microRNA biosynthesis and mainly affect microRNA activity by reducing the available active microRNA. In animal cells, immature pri-miRNA is processed into pre-miRNA by the microprocessor complex in the nucleus and then transported to the cytoplasm for further processing into mature miRNA. Therefore, it should be understood that targeting the pri-microRNA and / or pre-microRNA of hsa-miR-23b-3p or hsa-miR-218-5p and altering their biosynthesis such that the levels of these microRNAs are reduced should also cause a decrease in their activity. Thus, for the purposes of the present invention, an antagonist of hsa-miR-23b-3p or an antagonist of hsa-miR-218-5p should be understood to include not only molecules capable of acting on the mature form, but also molecules capable of acting on the pri-microRNA or pre-microRNA and reducing the levels of the mature form of hsa-miR-23b-3p or hsa-miR-218-5p. In order to design them, the following need to be taken into account: The primary microRNA (pri-microRNA) of hsa-miR-23b-3p is a transcript of the gene AOPEP (ENSG00000148120; chr9:97488983-97849441). The microRNA precursor (pre-microRNA) of hsa-miR-23b-3p corresponds to the genomic position hg19 chr9:97847490-97847586[+] and the sequence: CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC (SEQ ID NO: 19). Since this sequence is longer than hsa-miR-23b-3p, it is possible to design an antagonist specific to the pre-microRNA. hsa-miR-218-5p has two genomic positions encoding it and has two precursor pre-microRNAs, Pre-hsa-mir-218-1 (chr4:20529898-20530007): GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA (SEQ ID NO: 20) and Pre-mir-218-2 (chr5:1681951 SI-168195260): GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA (SEQ ID NO: 21). Both precursors can be used for the design of antagonists. Pre-hsa-mir-218-1 is derived from an intramolecular hairpin structure located within the transcript of gene SLIT2 (ENSG00000145147:chr4:20254883-20621284), and hsa-miR-218-5p-2 is derived from gene SLIT3 (ENSG00000184347, for hsa-miR-218-5p-2, chr5:168088745-168728133), and these can be regarded as pri-miRNAs respectively. Other mature microRNAs are not part of the same cluster. Therefore, in the case of hsa-miR-218-5p, both pre-miRNA or pri-miRNA can be considered as targets of antagonists for reducing mature miRNA and increasing MBNL protein level.
[0056] As shown in the following examples, especially in Table 1 and Table 4, the inventors of the present invention developed and optimized several antimiRs against hsa-miR-23b-3p and hsa-miR-218-5p, and their Tindex was significantly improved by the addition of oleic acid. Among them, the specific sequences of antimiRs containing SEQ ID NO: 1 (antagonist of human hsa-miR-218-5p) and SEQ ID NO: 2 (antagonist of human hsa-miR-23b-3p) are particularly mentioned from their optimal properties and efficiencies in DM1 cells as shown in the section of the examples.
[0057] Furthermore, functional equivalents of SEQ ID NO: 1 or SEQ ID NO: 2 are also contemplated herein, where specific changes in specific nucleobases do not significantly destabilize the molecule, so its therapeutic effect is maintained. The above functional equivalent sequences are described in SEQ ID NOs: 52 to 79 (functional equivalents of antimiR-23b-3p of SEQ ID NO: 2) and SEQ ID NOs: 80 to 110 (functional equivalents of antimiR-218-5p of SEQ ID NO: 1). "Functional equivalent" refers herein to other oligonucleotides that have a different nucleobase sequence from SEQ ID NO: 1 or SEQ ID NO: 2 but perform the same function as SEQ ID NO: 1 or SEQ ID NO: 2 and bring the same usefulness or technical effect.
[0058] Therefore, in one embodiment, the oligonucleotide molecule and / or its analog is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment composed of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 1 (TTAGATCAAGCACAA) or SEQ ID NOs: 80 to 110. The full-length sequence of the nitrogenous bases of the nucleotides or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is preferably at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotides in SEQ ID NO: 1 or SEQ ID NOs: 80 to 110.
[0059] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 2 (ATCCCTGGCAATGTGA) or SEQ ID NO: 52 to SEQ ID NO: 79. The complete-length sequence of the nitrogenous bases of the nucleotides or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is preferably at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complete-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 2 or SEQ ID NO: 52 to SEQ ID NO: 79.
[0060] It should be noted that in the oligonucleotide molecule and / or an analog thereof according to the present invention, each uracil base and thymine base within the complete length of the oligonucleotide molecule and / or analog, preferably each uracil base and thymine base in the seed region, can optionally be replaced with a thymine base or a uracil base, respectively. This applies to all "T" nucleobases contained in all oligonucleotides disclosed herein, except for SEQ ID NO: 52 to SEQ ID NO: 110 where "U" is preferred instead of "T" at certain specific positions. For this reason, at the above-mentioned certain specific positions, U rather than T is included.
[0061] Similarly, each guanosine base within the complete length of the oligonucleotide molecule and / or analog, preferably each guanosine in the seed region, can optionally be replaced with a hypoxanthine base. This applies to all oligonucleotides disclosed herein.
[0062] In one embodiment, an oligonucleotide and / or an oligonucleotide analog that is an antagonist human hsa-miR-23b-3p or human hsa-miR-218-5p can increase the endogenous levels of MBNL proteins, preferably MBNL1 protein and / or MBNL2 protein. Preferably, the oligonucleotide and / or oligonucleotide analog has at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identity with the sequence of SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or the sequence of the region present in SEQ ID NOs: 52 to 110, and can increase the endogenous levels of MBNL proteins, preferably MBNL1 protein and / or MBNL2 protein. Preferably, the increase in the endogenous level of MBNL protein is a statistically significant increase compared to untreated cells or tissues, and preferably, the statistical comparison is performed using a Student's t-test. See, for example, FIG. 4. Most preferably, the increase in the endogenous level of MBNL protein, preferably a statistically significant increase, is at least 1.2-fold, 1.3-fold, 1.4-fold or 1.5-fold change in treated cells of muscle tissue (more preferably quadriceps femoris and gastrocnemius muscles) compared to untreated cells of muscle tissue. The increase in the endogenous level of MBNL protein in treated cells or tissues is preferably at least 15%, 20%, 30%, 40%, 50% or more compared to untreated cells or tissues. As used herein, "untreated cells or tissues" refers to one or more cells or tissues, including the whole animal such as a mouse, that are healthy or exhibit a DM1 phenotype and have not been treated with any oligonucleotide and / or oligonucleotide analog of the first aspect or its embodiments. Preferably, the untreated cells are muscle cells and the untreated tissues are muscle tissues.
[0063] The antimiRs of the present invention, including those defined by SEQ ID NO:1 or SEQ ID NO:2, can be further optimized to improve their stability and efficacy in vivo. For this purpose, several modifications in their chemical structure have been described (for an overview, see McKenzie et al., Recent progress in non-native nucleic acid modifications. Chem. Soc. Rev., 2021, 50, 5126-5164). These modifications can be made within the pentose (in a preferred embodiment where the oligonucleotide is an oligoribonucleotide, the modification is within the ribose), within the internucleotide linkage or within the nucleobase, or a combination thereof. When the oligonucleotides or oligoribonucleotides of the present invention are chemically modified, they are considered oligonucleotide analogs or oligoribonucleotide analogs, respectively, in the context of the present invention. In one embodiment, the antimiR is an oligonucleotide analog and contains at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 chemical modifications along the entire molecule. In one embodiment, the antimiR is an oligoribonucleotide analog in which all of its nucleotides are chemically modified.
[0064] Modifications within the internucleotide linkage: Modifications that result in phosphorothioate linkages are considered to be among the possible modifications that give rise to oligonucleotide analogs of the present invention. These are modifications that affect the phosphate group, which is part of the "backbone" of the polynucleotide chain, and result in the introduction of a sulfur atom in place of an oxygen atom of the phosphate group that does not act as a crosslink between nucleotides. In addition to other desirable pharmacological properties, these modifications render the internucleotide linkages resistant to nuclease degradation and are usually inserted between the last 3 to 5 nucleotides at the 5' or 3' end of the oligonucleotide, inhibiting exonuclease degradation and enhancing stability.
[0065] In a preferred embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 or more nucleotides contained in the oligonucleotide or oligonucleotide analog molecule according to either the first aspect or an embodiment thereof are chemically linked by phosphorothioate linkages. Preferably, the oligonucleotide and / or oligonucleotide analog according to either the first aspect or an embodiment thereof has a length of 10 to 30 nucleotides and contains at least two nucleotides chemically linked by phosphorothioate linkages, wherein the oligonucleotide and / or oligonucleotide analog is conjugated to at least one oleic acid molecule at its 3'-end and / or 5'-end. In an even more preferred embodiment, the oligonucleotide or oligonucleotide analog molecule contains a mixture of PS linkages and phosphodiester (PO) linkages, wherein at least two nucleotides of the molecule are chemically linked by phosphorothioate linkages and at least two nucleotides of the molecule are linked by phosphodiester linkages. In a further preferred embodiment, the number of nucleotides chemically linked by phosphorothioate (PS) linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. In one embodiment, the oligonucleotide molecule and / or its analog has a length of 13 to 17 nucleotides and contains at least 7, 8, 9, or 10 nucleotides chemically linked by phosphorothioate (PS) linkages. In one embodiment, the PS:PO ratio in the oligonucleotide molecule and / or its analog is 1.2:1, 1.5:1, 1.7:1, 2:1, 2.2:1, 2.5:1, 2.7:1, 3:1. Preferably, the PS:PS ratio in the oligonucleotide molecule and / or its analog is 1.2:1 to 2.7:1, more preferably 1.5:1 or 2.5:1. As used herein, the "PS:PO ratio" means the number of PS linkages per PO linkage.For example, when an oligonucleotide molecule consists of 15 nucleotides and has 10 PS linkages and 4 PO linkages (see, for example, SEQ ID NO: 7), the molecule is said to have a PS:PO ratio of 2.5:1. In one embodiment, more than 50%, 55%, preferably 60%, 70% or 75% of the linkages between nucleotides are PS linkages.
[0066] In one embodiment, all nucleotides included in an oligonucleotide or oligonucleotide analog molecule are chemically linked by phosphorothioate linkages. As described above, the oligonucleotide or oligonucleotide analog molecule is preferably an antagonist of microRNA (i.e., antimiR).
[0067] Modifications in pentose, preferably ribose: The most widely used sugar modification is located at the 2'-position OH group. Among them, 2'-fluoro modification (2'F: introduction of a fluorine atom at the 2'-position of ribose), 2'-O-methoxyethyl (MOE) modification or 2'O-methyl (OMe) modification are the most important in the context of the present invention. Thus, in one embodiment, an oligonucleotide or oligonucleotide analog molecule according to the present invention, preferably an antimiR, is chemically modified to include at least one pentose having one of the following modifications: 2'-fluoro (2'F: introduction of a fluorine atom at the 2'-position of ribose), 2'-O-methoxyethyl (MOE) and / or 2'O-methyl (OMe). In one embodiment, all nucleotides in the oligonucleotide molecule are 2'OME-modified nucleotides.
[0068] Another modification that can be made to the oligonucleotide or oligonucleotide analog molecule of the present invention, preferably an antimiR, is the formation of a bicyclic 2'-4' modification. By forming a bicyclic structure having a bridge between the 2'-oxygen and the 4'-position, there are various ribose derivatives that lock the carbohydrate ring into the 3'-end conformation. In one embodiment, a bridge is formed between the 2'-oxygen and the 4'-carbon, locking the ribose into the 3'-end conformation and resulting in a modification called locked nucleic acid or LNA. The introduction of the LNA modification greatly enhances the stability of the antimiR-target miRNA hybrid, making it thermodynamically much more stable and resistant to degradation. This occurs especially when the above modification is placed at the end of the molecule. In one embodiment, the first nucleotide starting from the 3'-region contains the LNA modification. In another embodiment, each of the first two oligonucleotides starting from the 5'-region contains the LNA modification. Further modifications of the bicyclic nucleotide include bridged nucleic acid, ethyl-bridged (ENA), constrained ethyl (cEt) nucleic acid, bicyclic (bicyclo DNA) and tricyclic (tricyclo DNA) structures, and conformationally restricted nucleotides (CRN) having various affinities for the target sequence.
[0069] A further modification includes so-called PMO (nucleic acid in which ribose is replaced by a morpholino group). "Morpholino" is understood to be a base attached to the backbone of a methylene morpholine ring linked via a phosphorodiamidate group. Another backbone modification includes so-called PNA ("peptide nucleic acid": peptide nucleic acid in which the ribose-phosphate group is replaced by an amino acid moiety and the backbone of the nucleotide analog is a structure of repeating units of N-(2-aminoethyl)-glycine linked by peptide bonds).
[0070] In one embodiment, the oligonucleotide or oligonucleotide analog molecule according to the present invention, preferably an antimiR, is chemically modified to include at least one pentose of the nucleotides forming the antimiR and includes morpholino nucleic acid (PMO) or peptide nucleic acid (PNA).
[0071] Modifications within nucleobases: Due to its frequent use, chemical modifications that give rise to the oligonucleotides of the present invention, preferably oligoribonucleotide analogs, preferably antimiRs, also include 5-methylation of the nitrogen base cytosine (C), which reduces the detection of oligonucleotide analogs by the immune system. Thus, in one embodiment, at least 1, 2, 3, 4, 5, or 6 or more of the nucleotides included in the oligonucleotide and / or oligonucleotide analog molecule, preferably antimiR, according to either the first aspect or an embodiment thereof, comprise methylated cytosine. In a preferred embodiment, all cytosines in the oligonucleotide or oligonucleotide analog molecule, preferably antimiR, according to either the first aspect or an embodiment thereof, are methylated.
[0072] Another possible modification is 2,6-diaminopurine, which can form a base pair with thymidine or uridine having additional hydrogen bonds (three hydrogen bonds instead of the two hydrogen bonds present in the natural A:T base pair). Thus, in one embodiment, at least 1, 2, 3, 4, 5, or 6 or more of the nucleotides included in the oligonucleotide and / or oligonucleotide analog molecule according to either the first aspect or an embodiment thereof comprise 2,6-diaminopurine.
[0073] As can be inferred from the definitions of "oligonucleotide molecule" and "oligonucleotide analog," the definition of oligonucleotide analog includes hybrid molecules in which some units exhibit modifications and others do not, as well as hybrids between nucleic acid and peptide analogs, or further, hybrid molecules in which some of the nucleotide units are nucleotides (or analogs thereof) and others are deoxynucleotides (nucleotides in which the sugar is deoxyribose), and analogs of the latter, i.e., RNA-DNA hybrids and their analogs. Other chemical modifications are possible and are known, and these are also included in the possible modifications that give rise to oligonucleotide analogs.
[0074] Regarding possible chemical modifications contained in oligonucleotide and / or oligonucleotide analog molecules, this term applies in particular, from the perspective of basic research, to one or more conventional modifications known to those skilled in the art of molecular biology, especially in the search for therapeutic uses of these molecules. Information regarding such modifications can be found in general common knowledge.
[0075] Modification of oligonucleotide and / or oligonucleotide analog molecules with other non-nucleotide molecules As described above, a first aspect of the present invention provides an oligonucleotide and / or oligonucleotide analog molecule, preferably an antimiR, more preferably an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, or a mixture of two or more of such molecules, wherein the oligonucleotide and / or oligonucleotide analog molecule is conjugated to at least one oleic acid molecule at the 3'-end and / or 5'-end of the oligonucleotide and / or oligonucleotide analog molecule. For this reason, all oligonucleotides included in the present invention are conjugated to at least one oleic acid molecule at their 3' and / or 5'.
[0076] In some embodiments, other non-nucleotide molecules, such as organic compounds, can also be conjugated at the 3'-end and / or 5'-end of oligonucleotides and / or oligonucleotide analog molecules. The conjugation may be a direct conjugation or through a spacer molecule. As used herein, a "spacer molecule" refers to any molecule(s) that connects to an oligonucleotide or oligonucleotide analog on one hand and to a non-nucleotide molecule, preferably oleic acid, on the other hand. The spacer molecule(s) can be coupled at the 3'-end or 5'-end of the oligonucleotide or oligonucleotide analog. The spacer molecule preferably covalently binds to the oligonucleotide. The spacer molecule(s) (in some cases multiple) is preferably bound, for example as shown in FIG. 8, at one end through a bond between the terminal carbon on the spacer and the oxygen group in the 3'-terminal phosphate of the oligonucleotide, and at the other end through a bond to the terminal nitrogen group on a linker that forms an amide bond with the carboxy group of oleic acid.
[0077] In a preferred embodiment, the spacer molecule is selected from the group consisting of 3-aminopropyl (NHC3), 5-aminopentyl (NHC5), 6-aminohexyl (NHC6), threoninol, or derivatives thereof. In other embodiments, the spacer molecule(s) may include Thiol-Modifier C6 S-S(C6SSC6). In a further embodiment, the spacer is directly bound to the oligonucleotide and may include Thiol-Modifier C6 S-S(C6SSC6) followed by 3-aminopropyl (NHC3), 6-aminohexyl (NHC6), threoninol, or derivatives thereof (see FIG. 8).
[0078] In some embodiments, the oligonucleotide may be provided as a prodrug and may include a spacer molecule that contains or consists of a self-immolative group. As used herein, a "self-immolative" group refers to a molecule that spontaneously and irreversibly dissociates from the molecule to which it is conjugated, in this case the oligonucleotide. In one embodiment, the self-immolative group is a disulfide linkage that is reduced intracellularly by a naturally occurring thiol such as glutathione, resulting in the release of the oligonucleotide.
[0079] The spacer can be an aliphatic straight or branched hydrocarbon chain, cyclohexylphenyl and other aromatic spacers, and polar spacers based on one or several units of ethylene glycol, glycerol, amino acids, peptides or carbohydrates. In some cases, the oleyl derivative can be covalently linked to the amino group by an amide linkage, or directly linked to the nucleobase by an amine linkage, and also linked to the phosphate linkage as oleyl phosphate.
[0080] Oleic acid is preferably conjugated to the oligonucleotide at its 3'-end. More preferably, as shown in Figure 8, oleic acid is conjugated by a spacer molecule, preferably NHC6, threoninol or NHC3. It should be noted that the addition of a spacer molecule as a connector between the oligonucleotide and oleic acid is not essential. See SEQ ID NO: 51, for example, where oleic acid is conjugated by direct conjugation at the 5'-end of the oligonucleotide and / or oligonucleotide analog molecule.
[0081] Preferably, all oligonucleotide molecules disclosed in the present invention are conjugated to at least one oleic acid molecule at their 3'-end and / or 5'-end, wherein the oligonucleotide molecule further comprises at least two nucleotides chemically linked by phosphorothioate linkages. Preferably, the oligonucleotide molecule further comprises at least two nucleotides chemically linked by phosphorothioate linkages, and at least two nucleotides of the molecule are linked by phosphodiester linkages. More preferably, the number of nucleotides chemically linked by phosphorothioate (PS) linkages is greater than the number of nucleotides chemically linked by phosphodiester (PO) linkages.
[0082] To prepare the oligonucleotides of the present invention, various means known in the art can be used. In particular, oligonucleotides can be synthesized by solid-phase or liquid-phase methods. Oligonucleotides functionalized with spacer molecules and oleyl-oligonucleotide conjugates can be prepared using solid-phase oligonucleotide synthesis protocols. In this methodology, a solid support such as controlled pore glass (CPG) is functionalized with the first nucleotide at the 3'-end of the oligonucleotide sequence, and the oligonucleotide is usually synthesized in the 3'-to-5' direction. Introduction of a spacer molecule at the 5'-position is carried out using a phosphoramidite derivative of the spacer molecule that introduces the spacer molecule via a phosphate linkage at the 5'-position of the oligonucleotide. To introduce a spacer molecule at the 3'-position, it is necessary to prepare a solid support functionalized with a linker molecule, which is a molecule used to attach the nucleotide to the support. Examples of linker molecules include labile compounds such as phthalimide linkers or succinyl linkers. The spacer is conjugated to the oligonucleotide molecule and remains conjugated to the molecule, but it should be noted that the linker is a temporary conjugation for the purpose of immobilizing the oligonucleotide during synthesis using the solid-phase method.
[0083] In the case of the liquid phase preparation method, instead of the linker of the type defined by the solid phase method, a protecting group such as benzoyl or acetyl may be used.
[0084] Among all the oligonucleotides disclosed in the context of the present invention, the following embodiments including modifications and combinations of modifications are considered preferable.
[0085] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to any of the first aspect or its embodiments has a length of 10 nucleotides to 30 nucleotides and is an anti-miR type oligonucleotide analog, wherein at least two nucleotides of the molecule are chemically linked by phosphorothioate linkages, at least two nucleotides of the molecule are linked by phosphodiester linkages, preferably, the number of nucleotides chemically linked by phosphorothioate linkages is more than the number of nucleotides chemically linked by phosphodiester linkages, and a. The sequence of the nitrogenous bases of the monomer units of the nucleotide or nucleotide analog is at least 85%, 90%, 93%, 95%, 98% or 100% complementary to the endogenous molecule (preferably a microRNA molecule, more preferably hsa-miR-23b-3p of SEQ ID NO: 11 or hsa-miR-218-5p of SEQ ID NO: 10) to which it is to bind, b. At the 5'-end and / or 3'-end, preferably by a spacer molecule, it is conjugated to at least one oleic acid molecule.
[0086] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to either the first aspect or an embodiment thereof has a length of 10 to 30 nucleotides and is an antimiR-type oligonucleotide analog, wherein at least two nucleotides of the molecule are chemically linked by phosphorothioate linkages, at least two nucleotides of the molecule are linked by phosphodiester linkages, and preferably, the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. Also, a. The sequence of the oligonucleotide comprises a first fragment and a second fragment, wherein the first fragment is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary sequence of the seed region of hsa-miR-23b-3p set forth in SEQ ID NO: 13 and is composed of at least 5 to 8 consecutive nucleotides or nucleotide analog units, and the second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment) and is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to a complementary sequence of a region present in SEQ ID NO: 11 and is composed of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units. b. At the 5'-end and / or 3'-end, preferably by a spacer molecule, it is conjugated to at least one oleic acid molecule.
[0087] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to either the first aspect or an embodiment thereof has a length of 10 nucleotides to 30 nucleotides and is an antimiR-type oligonucleotide analog, wherein at least two nucleotides of the molecule are chemically linked by phosphorothioate linkages, at least two nucleotides of the molecule are linked by phosphodiester linkages, and preferably, the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. Also, a. The sequence of the oligonucleotide comprises a first fragment and a second fragment, wherein the first fragment is composed of at least 5 to 8 consecutive nucleotides or nucleotide analog units that are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the complementary sequence of the seed region of hsa-miR-218-5p set forth in SEQ ID NO: 12, and the second fragment is adjacent to the first fragment (i.e., located upstream and / or downstream of the first fragment) and is composed of at least 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to the complementary sequence of the region present in SEQ ID NO: 10. b. At the 5'-end and / or 3'-end, preferably by a spacer molecule, it is conjugated to at least one oleic acid molecule.
[0088] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to either the first aspect or an embodiment thereof has a length of 10 nucleotides to 30 nucleotides, wherein a. At least two nucleotides of the molecule are chemically linked by phosphorothioate linkages, and at least two nucleotides of the molecule are linked by phosphodiester linkages. Preferably, the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. b. Its sequence comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 1 or SEQ ID NO: 2, or SEQ ID NOs: 52 - 110. c. At the 5' end and / or 3' end, preferably conjugated to at least one oleic acid molecule, preferably by a spacer molecule.
[0089] In one embodiment, the oligonucleotide and / or oligonucleotide analog molecule according to any of the first aspect or its embodiments has a length of 10 to 30 nucleotides and is an antimiR - type oligonucleotide analog, wherein at least two nucleotides of the molecule are chemically linked by phosphorothioate linkages, at least two nucleotides of the molecule are linked by phosphodiester linkages, and preferably, the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. Also, a. A nucleotide analog in which at least one of the monomer units exhibits one or more chemical modifications in the pentose moiety, preferably ribose, the internucleotide linkage, the nitrogenous base, or all of these. b. The nucleotide sequence of the nitrogenous base of the monomer unit of the nucleotide or nucleotide analog is at least 85%, 90%, 93%, 95%, 98% or 100% identical to the nucleotide sequence of the nitrogenous base of the monomer unit of the oligonucleotide of SEQ ID NO: 1 or the oligonucleotide of SEQ ID NO: 2, or their functional equivalents of SEQ ID NOs: 52 to 110, c. At the 5' end and / or 3' end, preferably conjugated to at least one oleic acid molecule by a spacer molecule.
[0090] In a preferred embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 or more of the nucleotides contained in the oligonucleotide or oligonucleotide analog molecule according to any of the first aspect or its embodiments comprise or consist of at least one modification selected from the group consisting of locked nucleic acid, 2'-methoxy, 2'-O-methoxyethyl-, 2'-fluoro, BNA, PMO, PNA, CRN, 2,6-diaminopurine, methylated cytosine and / or any combination thereof.
[0091] In a preferred embodiment, the oligonucleotide and / or oligonucleotide analog molecule has a length of 10 to 30 nucleotides, is an antagonist of human hsa-miR-23b-3p or hsa-miR-218-5p, and contains at least two nucleotides chemically linked by phosphorothioate linkages and at least two nucleotides chemically linked by phosphodiester linkages. Preferably, the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. The oligonucleotide is conjugated to at least one oleic acid molecule, and the one oleic acid molecule is conjugated at the 3'-end and / or 5'-end of the oligonucleotide and / or its analog. The oligonucleotide and / or oligonucleotide analog conjugated to at least one molecule of oleic acid at the 3'-end and / or 5'-end and containing more PS linkages than PO linkages preferably comprises, consists of, or consists essentially of a fragment composed of at least 15 consecutive nitrogenous bases of nucleotides or nucleotide analog units, where at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the nucleotides or nucleotide analog units are identical to those in the region present in any of SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or their functional equivalents from SEQ ID NO: 52 to SEQ ID NO: 110.
[0092] In a preferred embodiment, at least 3, 4, 5, 6, 7, 8, or 9 or more nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule are chemically modified, where the chemical modification is selected from the group consisting of i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) an additional bridge connecting the 2' oxygen and the 4' carbon (LNA), and / or any combination thereof. In a further embodiment, the nucleotides contained in the oligonucleotide analog molecule are chemically modified to include an additional bridge (LNA) connecting the 2' oxygen and the 4' carbon of at least the nucleotides located at the 3' and 5' ends of the oligonucleotide. More preferably, the LNA modification is introduced into at least the fourth, third, preferably the second or last nucleotide(s) located at the 3' and 5' ends of the oligonucleotide. Also preferably, at least one of the nucleotides contained in the oligonucleotide and / or oligonucleotide analog molecule is 2,6-diaminopurine and / or at least methylated cytosine.
[0093] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3’Ol), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 3’ end. Preferably, the complete length sequence of the nitrogenous bases of the nucleotides or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complete length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3’Ol), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 3’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 3 or SEQ ID NO: 22.
[0094] In a further embodiment, the oligonucleotide molecule and / or an analogue thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analogue units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2 PS / PO 3’Ol), wherein the oligonucleotide molecule and / or an analogue thereof comprises oleic acid conjugated at least at the 3’ end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and / or an analogue thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2 PS / PO 3’Ol), wherein the oligonucleotide molecule and / or an analogue thereof comprises oleic acid conjugated at least at the 3’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 4 or SEQ ID NO: 23.
[0095] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2 PS / PO 5’Ol), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 5’ end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotides or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2 PS / PO 5’Ol), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 5’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51.
[0096] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-23b-3p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3’Ol containing C6SSC6), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 3’ end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3’Ol containing C6SSC6), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 5’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3’Ol containing C6SSC6).
[0097] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE Oleic 3’), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 3’ end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE Oleic 3’), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated at least to the 3’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 7 or SEQ ID NO: 25.
[0098] In a further embodiment, the oligonucleotide molecule and / or its analog is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotide or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD Oleic 3'), wherein the oligonucleotide molecule and / or its analog comprises oleic acid conjugated to at least the 3'-end. Preferably, the complete sequence of the nitrogenous bases of the nucleotide or nucleotide analog units contained in the oligonucleotide molecule and / or its analog is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the complete sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD Oleic 3'), wherein the oligonucleotide molecule and / or its analog comprises oleic acid conjugated to at least the 3'-end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 8 or SEQ ID NO: 26.
[0099] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE Oleic 3’), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated to at least the 3’ end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotides or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME / MOE Oleic 3’), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated to at least the 3’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 9 or SEQ ID NO: 27.
[0100] In a further embodiment, the oligonucleotide molecule and / or an analog thereof is an antagonist of human hsa-miR-218-5p and comprises, consists of, or consists essentially of a fragment of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive nitrogenous bases of nucleotides or nucleotide analog units that are at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of the region present in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE Oleic 3’2), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated to at least the 3’ end. Preferably, the full-length sequence of the nitrogenous bases of the nucleotides or nucleotide analog units contained in the oligonucleotide molecule and / or an analog thereof is at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%, or 100% identical to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME / MOE Oleic 3’2), wherein the oligonucleotide molecule and / or an analog thereof comprises oleic acid conjugated to at least the 3’ end. In one embodiment, the oligonucleotide consists of only SEQ ID NO: 14 or SEQ ID NO: 28.
[0101] Preferably, the oligonucleotide molecule and / or its analog of the first aspect comprises, or consists only of, a sequence having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50 or SEQ ID NO: 51 (antagonist of hsa-miR-23b) or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28 (antagonist of hsa-miR-218-5p), or SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28.
[0102] Preferably, the oligonucleotide and / or oligonucleotide analog is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% identical to any of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28, preferably SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 25, and can increase, preferably statistically increase, the endogenous levels of MBNL protein, preferably MBNL1 protein and / or MBNL2 protein, compared to untreated cells or tissues. Most preferably, the oligonucleotide molecule and / or its analog of the first aspect consists only of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28. It should be noted that in the context of the present invention, when an oligonucleotide molecule and / or its analog is said to be specific from a particular SEQ ID NO, it is understood that the oligonucleotide molecule and / or its analog also consists of the chemical modifications, spacer molecules and oleic acid conjugations described in that SEQ ID NO. For example, when the oligonucleotide molecule and / or its analog consists only of SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 7, the oligonucleotide molecule and / or its analog consists only of the nucleotide sequence defined in SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 7, as well as the chemical modifications, spacers and oleic acid conjugations defined in SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 7 above. A detailed description of the chemical modifications included in each SEQ ID NO is included in the "Sequence Listing" section.
[0103] Furthermore, the present invention also includes compounds such as prodrug forms, i.e., oligonucleotide molecules and / or analogs thereof that are not fully active but are converted or metabolized in vivo after administration to yield the fully pharmacologically active oligonucleotide molecules and / or analogs described herein.
[0104] It is also necessary to consider the cellular expression of the microRNA to be inhibited. According to miRGator v3.0 (miRGator v3.0: a microRNA portal for deep sequencing, expression profiling and mRNA targeting. Sooyoung Cho et al., Nucleic Acids Research, Volume 41, Issue D1, 1 January 2013, Pages D252-D257, https: / / doi.org / 10.1093 / nar / gks1168), hsa-miR-218-5p is expressed in adipose tissue, brain, central nervous system, kidney, heart, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, stem cells, testis, uterus and joints. On the other hand, hsa-miR-23b-3p is expressed in the central nervous system, gastrointestinal tract, adipose tissue, breast, bladder, heart, keratinocytes, kidney, liver and biliary system, lung, lymphoid cells, nose, pharynx, placenta, prostate, skin, spleen, stem cells, testis, thyroid and uterus. Therefore, possible embodiments of the present invention to be considered are preferably antimiRs, more preferably antagonists of hsa-miR-218-5p or hsa-miR-23b-3p, or a mixture of two or more of these molecules, and the target miRNA is at least one organ selected from the group of brain, cerebellum, hippocampus, or other organs of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes, and lymphoid cells, or one or more cells of a primary culture derived from one of these organs, or an established cell line (including induced pluripotent stem cells known by the abbreviation IPSC) derived from one of these organs or stem cells derived from one of these organs, and are oligonucleotide and / or oligonucleotide analog molecules expressed therein. The selection of the specific microRNA to be antagonized, particularly the specific selection between human hsa-miR-218-5p or human hsa-miR-23b-3p, also determines the range of tissues in which the antagonistic effect can be exerted.
[0105] In a second aspect, the present invention relates to a composition, preferably a pharmaceutical composition, comprising the oligonucleotide defined in at least any one of the first aspect or its embodiments, or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives. The composition preferably comprises an antimiR defined in any one of the first aspect or its embodiments, more preferably an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3p. In one embodiment, a composition comprising one of these antimiRNAs or a mixture thereof, and an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3p, or any other antimiRNA against them, or generally, an inhibitor of any oligonucleotide and / or oligonucleotide analog molecule that downregulates the expression of one of these microRNAs or another microRNA that downregulates the expression of human genes MBNL1 and / or MBNL2 also includes a composition comprising a pharmaceutically acceptable carrier and / or additive.
[0106] In one possible embodiment, the pharmaceutical composition comprises an effective dose of an inhibitor or antagonist defined in any one of the first aspect or its embodiments, preferably an antimiR, more preferably an antagonist of human hsa-miR-218-5p or human hsa-miR-23b-3pp, or a mixture thereof. Preferably, the inhibitor / antagonist of human hsa-miR-218-5p present in the composition is the antimiR-type inhibitor used in the examples of the present invention represented by SEQ ID NO: 1, or a functional equivalent thereof from SEQ ID NO: 80 to SEQ ID NO: 110, and the inhibitor / antagonist of human hsa-miR-23b-3p present in the composition is the antimiR-type inhibitor represented by SEQ ID NO: 2 or a functional equivalent thereof from SEQ ID NO: 52 to SEQ ID NO: 79, where the inhibitor is conjugated to at least one oleic acid molecule at its 3' end and / or 5' end. More preferably, the inhibitor(s) / antagonist(s) comprised in the composition are present at a concentration that allows for administration of a therapeutically effective dose.
[0107] "Effective amount" or "therapeutically effective amount" is an amount sufficient to achieve a beneficial or desired clinical outcome. Based on previous results obtained using molecules against other microRNAs, the effective amount of an inhibitor / antagonist of microRNA can be about 0.5 mg / kg to about 100 mg / kg, preferably about 1.5 mg / kg to 100 mg / kg, in mice, or about 0.75 mg / kg to 50 mg / kg in rats. However, the exact determination of the amount considered to be the effective amount in humans may be based on individual factors for each patient, including body size, age, and the nature of the inhibitor or antagonist (e.g., if it is an expression construct, antimiR or oligonucleotide analog, etc.). Nevertheless, the dosage can be readily determined by one of ordinary skill in the art based on this specification and the knowledge in the art.
[0108] For its clinical use, the composition according to the use of the present invention is regarded as a pharmaceutical composition of the present invention and can be prepared in a form suitable for the desired use. It may be necessary or convenient to administer multiple doses to a subject during a specific treatment period, and the doses can be administered daily, weekly, monthly, once every two months, once every three months, or once every six months. In certain embodiments, the subject first receives a loading dose that is more than one or more subsequent doses or maintenance doses. In certain embodiments, particularly in the treatment of chronic diseases such as DM1, the subject receives regular or long-term administration.
[0109] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, pearls, and oil-in-water emulsions, micelles, mixed micelles, other oligonucleotide-based delivery vehicles, and lipid-based systems including liposomes, can be used as the administration vehicle for the inhibitors / antagonists of the present invention, and the pharmaceutical compositions of the present invention are formed using the same. Another possibility is to prepare the pharmaceutical compositions of the present invention using appropriate salts and buffers to stabilize the administration vehicle and assist in capture by target cells. The compositions of the present invention include an effective amount of the administration vehicle and contain the oligonucleotide molecules of the present invention either independently or in the form of liposomes or other complexes, or contain their expression vectors, and can be aqueous compositions dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
[0110] Additional active ingredients may be incorporated into the composition as long as they do not inactivate the molecules of the present invention or their expression vectors.
[0111] Solutions of the active compound as the free base or a pharmaceutically acceptable salt can be prepared in water appropriately mixed with a surfactant such as hydroxypropyl cellulose. The dispersion can also be prepared in glycerol, liquid polyethylene glycol and their mixtures, and also in oil. Under normal storage and use conditions, these preparations generally contain preservatives to prevent the growth of microorganisms. The oligonucleotide can also be prepared in a solution of phosphate buffered saline and sodium chloride. For example, the oligonucleotide can be prepared at a concentration of about 150 mM in phosphate buffered saline and sodium chloride at pH 6.5 - 8, preferably at a pH of about 6.8 - 7.
[0112] The composition of the present invention can usually be formulated in a neutral form or a salt form. Examples of pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of proteins) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid), and the like. Salts formed with the free carboxyl groups of proteins may be derived from inorganic bases (e.g., sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide) or organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).
[0113] In a third aspect, the present invention provides an oligonucleotide as defined in any of the first aspect or its embodiments, or a composition as defined in any of the second aspect or its embodiments, preferably a pharmaceutical composition, for use in therapy. Preferably, oleic acid conjugated to the oligonucleotide molecule and / or its analog serves as a vehicle for delivering the oligonucleotide molecule and / or its analog to relevant tissues, such as muscle and / or the CNS. Thus, an oligonucleotide molecule or its analog conjugated to at least one oleic acid molecule at the 3'-end and / or 5'-end according to the first aspect can be used in a method of treatment by therapy in a human subject in need thereof, wherein the oligonucleotide molecule and / or its analog is an active ingredient for treatment by said therapy, and the oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier for the oligonucleotide molecule and / or its analog. The term "active ingredient" is used in the present invention to refer to a substance that is pharmaceutically active and involved in a therapeutic effect. In the case of an antagonist of an antimiR, the active ingredient is a molecule that targets an endogenous miR, preferably an oligonucleotide molecule. Most preferably, the term "active ingredient" is used in the present specification to refer to the oligonucleotide molecule and / or its analog as defined in the first aspect of the present invention.
[0114] In a fourth aspect, the present invention provides an oligonucleotide as defined in any of the first aspect or an embodiment thereof, or a composition as defined in any of the second aspect or an embodiment thereof, preferably a pharmaceutical composition, for use in the prevention or treatment of a muscle disease and / or a nervous system disease, preferably accompanied by muscle tissue atrophy and wasting, in particular a muscle disease accompanied by muscle strength loss, increased impairment, and deformation, and / or a nervous system disease preferably accompanied by structural changes and / or functional changes in the brain and / or other tissues of the CNS. The muscle disease is preferably a muscular dystrophy disease. The muscular dystrophy disease is preferably selected from the group consisting of Becker muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophy, myotonic dystrophy, and oculopharyngeal muscular dystrophy. Preferably, the muscle disease is myotonic dystrophy, preferably type 1 and / or type 2. Preferably, the use according to the fourth aspect involves conjugating an oligonucleotide molecule and / or an analogue thereof and using at least one oleic acid molecule as a vehicle when delivering the oligonucleotide molecule and / or an analogue thereof to relevant tissues, such as muscle and / or CNS.
[0115] In an alternative fourth aspect, the present invention provides an oligonucleotide as defined in any of the first aspect or its embodiments, or a composition as defined in any of the second aspect or its embodiments, preferably a pharmaceutical composition, for use in the prevention or treatment of a disease characterized by an insufficient amount or function of an MBNL gene and / or protein in a subject in need thereof. Preferably, said use involves conjugating an oligonucleotide molecule and / or an analog thereof and using at least one oleic acid molecule as a vehicle for delivering said oligonucleotide molecule and / or an analog thereof to a relevant tissue, such as muscle and / or the CNS. "Insufficient amount or function of an MBNL gene and / or protein" refers herein to a statistically significantly lower amount or function of an MBNL gene and / or protein as compared to a healthy subject. Further in an alternative fourth aspect, the present invention provides an oligonucleotide as defined in any of the first aspect or its embodiments, or a composition as defined in any of the second aspect or its embodiments, preferably a pharmaceutical composition, for use in targeting muscle cells and / or CNS cells in a subject in need of targeting, preferably muscle cells in a subject suffering from DM or DM1. "Targeting of muscle cells and / or CNS cells" means herein increasing the insufficient amount of MBNL protein and / or gene in said cells. CNS cells preferably include neurons, but also glial cells (astrocytes, oligodendrocytes, ependymal cells and microglia), choroid plexus cells, blood vessels and cells associated with the covering. Muscle cells include smooth muscle cells, preferably skeletal muscle cells and cardiomyocytes. Preferably, the increase is a statistically significant increase, preferably as compared to control cells or untreated cells.
[0116] In a further alternative fourth aspect, the present invention provides an oligonucleotide as defined in any of the first aspect or its embodiments, or a composition as defined in any of the second aspect or its embodiments, preferably a pharmaceutical composition, for use in the prevention or treatment of a disease characterized by the expression of toxic RNA (also referred to as RNA abnormality or RNA-mediated / RNA-dominant disease). Preferably, the above use involves conjugating an oligonucleotide molecule and / or its analog and using at least one oleic acid molecule as a vehicle when delivering the oligonucleotide molecule and / or its analog to relevant tissues, such as muscle and / or the CNS. The above disease is usually characterized by the expansion of unstable microsatellite repeats caused by abnormal mutation mechanisms, and the expression of the expansion of the repeat element increases the mass of the target RNA per nucleus among several mechanisms, and also creates a sink of RNA-binding proteins by increasing the avidity of RNA-protein interactions due to the high local concentration of binding sites in each mutant transcript. Preferably, the RNA abnormality or RNA-mediated / RNA-dominant disease is a neuromuscular disease or a neurodegenerative disease, more preferably DM type 1 (ORPHA:273) or type 2 (ORPHA:606), fragile X-associated tremor / ataxia syndrome (ORPHA:93256; FXTAS), C9ORF72 amyotrophic lateral sclerosis and / or frontotemporal dementia (ORPHA:275872; ALS / FTD), spinocerebellar ataxia (SCA) or benign adult familial myoclonic epilepsy (BAFME).
[0117] In a further alternative fourth aspect, the present invention provides an oligonucleotide as defined in any of the first aspect or its embodiments, or a composition as defined in any of the second aspect or its embodiments, preferably a pharmaceutical composition, for use in the prevention or treatment of a disease characterized by an excess of the amount or function of miR-23b-3p and / or miR-218-5p. "Excess amount or function of miR-23b-3p and / or miR-218-5p" as used herein refers to an amount or function of miR-23b-3p and / or miR-218-5p that is statistically significantly higher compared to the amount or function in a healthy subject. Preferably, the disease characterized by an excess of the amount or function of miR-23b-3p and / or miR-218-5p is myotonic dystrophy, preferably type 1 and / or type 2. Preferably, the use described above includes the use of an oligonucleotide molecule and / or an analog thereof conjugated to at least one oleic acid molecule as a vehicle for delivering the oligonucleotide molecule and / or an analog thereof to a relevant tissue, such as muscle and / or the CNS.
[0118] Preferably, the oligonucleotide or oligonucleotide analog molecule defined in any of the first aspect or its embodiments, alone or included in a pharmaceutical composition, for use according to the third or fourth aspect, is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2, or SEQ ID NO: 1 or SEQ ID NO: 2, respectively. Preferably, the oligonucleotide or oligonucleotide analog molecule defined in any of the first aspect or its embodiments, alone or included in a pharmaceutical composition, for use according to the third or fourth aspect, is an inhibitor of human hsa-miR-218-5p or human hsa-miR-23b-3p having a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NOs: 80 to 110 or SEQ ID NOs: 52 to 79, or SEQ ID NOs: 80 to 110 or SEQ ID NOs: 52 to 79, respectively.
[0119] More preferably, the oligonucleotide or oligonucleotide analog molecule defined in any of the first aspect or its embodiments for use according to the third aspect or the fourth aspect is SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5 (antimiR against hsa-miR-23b-3p), or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 14 (antimiR against hsa-miR-218-5p), or SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5 (antimiR against hsa-miR-23b-3p) or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 14 (antimiR against hsa-miR-218-5p) and has at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence, or consists only of such a sequence. More preferably, the oligonucleotide or oligonucleotide analog molecule defined in any of the first aspect or its embodiments for use according to the third aspect or the fourth aspect is SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50 or SEQ ID NO: 51 (antimiR against hsa-miR-23b-3p), or SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28 (antimiR against hsa-miR-218-5p), or SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5 (antimiR against hsa-miR-23b-3p) or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 14 (antimiR against hsa-miR-218-5p) and has at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the sequence, or consists only of such a sequence. As described above in the first aspect, the oligonucleotide or its analog for use according to the third aspect and the fourth aspect also includes at least one oleic acid molecule conjugated at the 3'-end and / or 5'-end.
[0120] In one embodiment of the fourth aspect, the treatment is a palliative treatment of one or more symptoms of myotonic dystrophy type 1 and / or type 2, or a palliative treatment of one or more muscle disorders that are part of the symptoms of myotonic dystrophy type 1 and / or type 2. In a preferred embodiment of the fourth aspect, the treatment is a treatment of chronic myotonic dystrophy type 1 and / or type 2. In a preferred embodiment, the treatment is a therapeutic treatment. Preferably, the above use includes the use of at least one oleic acid molecule as a vehicle when the oligonucleotide molecule and / or its analog is conjugated to the oligonucleotide molecule and / or its analog for delivery to a relevant tissue, such as muscle and / or the CNS.
[0121] In one embodiment of the third and fourth aspects, the subject in need thereof is a mammal, preferably a human, more preferably a human suffering from DM, preferably DM1.
[0122] Administration of the antagonist via a possible expression vector can direct expression to a tissue or a particular group of tissues by following the orientation of the basic vector itself and / or by selecting control elements that result in the expression of the linked coding sequence only in a particular tissue. In addition, some particular dosage forms may support greater access to one or the other organ. For this reason, possible embodiments that can be combined with any other embodiments of the third and fourth aspects of the present invention, which are directly referred to by their therapeutic use, are also the brain, cerebellum, hippocampus, or other central nervous system organs, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphocytes, or at least one or more organs selected from the group of stem cells derived from one or more of these organs. The oligonucleotide and / or oligonucleotide analog molecule of the present invention, a mixture of two or more of them, or the use of a composition containing at least one of the molecules can be defined as for the manufacture of a medicament for the treatment of myotonic dystrophy type 1 by inhibiting or antagonizing the action of human hsa-miR-218-5p or hsa-miR-23b-3p in at least one or more organs. Other organs that can be similarly targeted by the oligonucleotides of the present invention are selected as desired or as necessary from the group of the brain, cerebellum, hippocampus, or another organ of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis and uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphocytes, or stem cells derived from one or more of these organs, or combinations thereof.
[0123] Considering the stability of the antimiR, direct administration to a mammal, preferably a human, by, for example, the subcutaneous or systemic route, preferably dissolved or suspended in, for example, a pharmaceutically acceptable carrier, such as water or an aqueous solution, such as physiological saline or phosphate buffer, for intravenous or intrathecal, or intra-articular delivery, may be considered. The composition for administering the antimiR may contain pharmaceutically acceptable additives.
[0124] The active composition of the present invention can be administered by any of the common routes as long as the target tissue is available via that route. This includes the oral route, nasal route, intrathecal route or buccal route, and preferably, the administration can be by the intradermal route, transdermal route, subcutaneous route, intramuscular route, intraperitoneal route or intravenous route. As mentioned above, it is common to formulate the composition containing antimiR for intravenous or subcutaneous administration. However, oleic acid is preferably administered intravenously, intraarterially or subcutaneously because it promotes the delivery of oligonucleotide molecules and / or their analogs to muscle and / or CNS cells when the administration is intravenous (see Examples 9 and 10). Furthermore, it is also preferred that the above intravenous, intraarterial or subcutaneous administration is long-term administration, that is, it is performed regularly (over the entire life of the patient in need thereof).
[0125] After formulation, it is preferred to administer the solution in a form suitable for the administration formulation and in a therapeutically effective amount. The formulation can be easily administered in various dosage forms such as injection solutions, drug release capsules and the like.
[0126] A further aspect provides a method of treating DM, preferably DM1, in a subject in need of treatment, comprising administering to a patient in need thereof the oligonucleotide or pharmaceutical composition of the present invention. In some embodiments, the oligonucleotide is present at a concentration that allows for administration of a therapeutically effective dose. Preferably, the treatment method involves the use of at least one oleic acid molecule as a vehicle when the oligonucleotide molecule and / or its analog is conjugated to deliver the oligonucleotide molecule and / or its analog to relevant tissues such as muscle and / or CNS.
[0127] As described above, the examples provide evidence as to how oleic acid can increase delivery to target tissues such as muscle and brain. Thereby, not only can oleic acid reduce toxicity when a greater amount of PS is included in the molecule relative to PO, but it is concluded that oleic acid is an efficient vehicle for transporting oligonucleotide molecules and / or analogs thereof to target tissues such as muscle and / or the CNS. In view of this, a fifth aspect of the invention relates to the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier when the oleic acid is conjugated to an oligonucleotide molecule and / or an analog thereof, preferably conjugated to the 3' or 5' of the oligonucleotide molecule and / or analog. Importantly, the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier refers to the use in which the oleic acid molecule is responsible for the transport, delivery, and conveyance of the oligonucleotide molecule and / or an analog thereof to which it is conjugated to a specific target tissue, preferably muscle and / or CNS tissue. In this context, "vehicle" and "carrier" are considered synonyms and are thus used interchangeably.
[0128] Methods are known to those skilled in the art for testing whether oleic acid functions as a vehicle for the oligonucleotide molecule and / or an analog thereof to which it is conjugated. For example, a method for evaluating whether at least one oleic acid is used as a vehicle is to measure the amount of oligonucleotide molecule and / or an analog thereof that reaches the target tissue (preferably the CNS and / or muscle tissue) after intravenous, intraarterial, or subcutaneous administration, and compare that amount with the amount present in the tissue when the oligonucleotide molecule and / or an analog thereof is administered without being conjugated to at least one oleic acid.
[0129] Preferably, the oligonucleotide molecule and / or its analog to which oleic acid is conjugated is the oligonucleotide molecule and / or its analog defined in any of the first aspect or its embodiments of the present invention. Accordingly, a preferred embodiment of the fifth aspect is that when the above oleic acid is conjugated to the 3'-end or 5'-end of the oligonucleotide molecule and / or its analog defined in the first aspect, preferably, when the oligonucleotide molecule and / or its analog is an active ingredient of a treatment method by a therapy defined in any of the third aspect or the fourth aspect of the present invention, or their embodiments, it refers to the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier. It should be noted that the conjugation of the oligonucleotide molecule and / or its analog may be either direct conjugation or conjugation via a spacer molecule, as described in the first aspect of the present invention. Preferably, the oleic acid used as a vehicle is conjugated to the oligonucleotide molecule and / or its analog via a spacer molecule selected from the group consisting of NHC3, NHC5, NHC6, threoninols, and their derivatives.
[0130] In one embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the 5'-end or 3'-end of the oligonucleotide molecule and / or its analog of any of the first aspect or its embodiments, so that a single oleic acid molecule acts as a vehicle for the oligonucleotide molecule and / or its analog. In one embodiment of the fifth aspect, only one oleic acid molecule is conjugated to the oligonucleotide molecule and / or its analog of any of the first aspect or its embodiments, so that a single oleic acid molecule acts as a vehicle for the oligonucleotide molecule and / or its analog, and the oligonucleotide molecule and / or its analog defined in the first aspect acts as an active ingredient in a treatment method by a therapy defined in the third aspect or the fourth aspect.
[0131] In a preferred embodiment, at least one oleic acid molecule conjugated to an oligonucleotide molecule and / or an analog thereof as defined in either the first aspect of the present invention or an embodiment thereof can transport the oligonucleotide molecule and / or an analog thereof to a target tissue, such as muscle and / or the CNS, more efficiently than when the oligonucleotide molecule and / or an analog thereof is not conjugated to oleic acid, as shown in Example 9 or Example 10. Therefore, the oleic acid molecule is used as an active ingredient delivery vehicle, where the components of the active ingredient are the oligonucleotide molecule and / or an analog thereof as defined in either the first aspect or an embodiment thereof.
[0132] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3'-end or 5'-end of an oligonucleotide molecule and / or an analog thereof according to either the first aspect or an embodiment thereof, and the oligonucleotide molecule and / or an analog thereof includes a mixture of phosphorothioate linkages and phosphodiester linkages that chemically link nucleotides, and preferably, the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages.
[0133] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3'-end or 5'-end of an oligonucleotide molecule and / or an analog thereof according to either the first aspect or an embodiment thereof, where the oligonucleotide molecule and / or an analog thereof is an antagonist of microRNA, preferably an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p.
[0134] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3'- or 5'-end of an oligonucleotide molecule and / or analog of the first aspect or any of its embodiments, wherein the oleic acid used as the vehicle delivers the oligonucleotide molecule and / or its analog to muscle cells and / or CNS cells in a subject in need thereof when the oligonucleotide molecule and / or its analog is administered via an intravenous, intraarterial or subcutaneous route.
[0135] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3'- or 5'-end of an oligonucleotide molecule and / or its analog as defined in the first aspect or any of its embodiments, wherein the oligonucleotide molecule and / or its analog is an active ingredient of a treatment method by a therapy including prevention or treatment of a muscle disease, a nervous system disease and / or an RNA abnormality.
[0136] In one embodiment, at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3'- or 5'-end of an oligonucleotide molecule or its analog as defined in the first aspect or any of its embodiments, wherein the oligonucleotide molecule and / or its analog is an active ingredient of a treatment method by a therapy including prevention or treatment of myotonic dystrophy, preferably, the myotonic dystrophy is type 1.
[0137] In a fifth aspect, the present invention also provides a conjugate, where the conjugate consists of at least one oleic acid conjugated to the 3'-end or 5'-end of an oligonucleotide molecule or an analog thereof as defined in either the first aspect or an embodiment thereof. The oligonucleotide molecule or an analog thereof is used as an active ingredient in a treatment method by a therapy as defined in either the third aspect or the fourth aspect, or an embodiment thereof. The at least one oleic acid is used as a pharmaceutically acceptable vehicle for delivering the oligonucleotide molecule or an analog thereof to a target tissue such as the CNS and / or muscle tissue.
[0138] The following items are also included in the present invention: 1. An oligonucleotide molecule or a mixture of two or more of such molecules, wherein the oligonucleotide molecule has a length of 10 nucleotides to 30 nucleotides, the oligonucleotide molecule contains at least two nucleotides chemically linked by phosphorothioate linkages, and the oligonucleotide molecule is conjugated to at least one oleic acid molecule at the 3'-end and / or 5'-end. 2. The oligonucleotide molecule of item 1, wherein the molecule is an antagonist of a microRNA. 3. The oligonucleotide molecule of item 2, wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p. 4. The oligonucleotide molecule according to any one of items 1 to 3, wherein the oligonucleotide molecule has a length of 15 nucleotides to 30 nucleotides, at least two nucleotides of the molecule are linked by phosphodiester linkages, and the number of nucleotides chemically linked by phosphorothioate linkages is greater than the number of nucleotides chemically linked by phosphodiester linkages. 5. The oligonucleotide molecule has a length of 15 to 30 nucleotides, and the oligonucleotide molecule comprises a fragment composed of at least 15 consecutive nitrogenous bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or SEQ ID NOs: 52 to 110. The oligonucleotide molecule according to any one of items 1 to 4. 6. The oligonucleotide molecule has a length of 15 to 30 nucleotides, and the oligonucleotide molecule comprises a fragment composed of at least 15 consecutive nitrogenous bases of nucleotides that are identical to the sequence of the region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p). The oligonucleotide molecule according to any one of items 1 to 5. 7. Comprising at least one chemical modification, and the chemical modification is i) 2'-O-methyl (2'OMe), ii) 2'-O-methoxyethyl (2'MOE), and / or iii) An additional bridge (LNA) connecting the 2' oxygen and the 4' carbon, The oligonucleotide molecule according to any one of items 1 to 6, which is selected from the group. 8. The oligonucleotide molecule has a length of 15 to 30 nucleotides, and the oligonucleotide molecule comprises a fragment composed of at least 15 consecutive nitrogenous bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50 or SEQ ID NO: 51 (antagonist of hsa-miR-23b) or SEQ ID NOs: 7, 8, 9, 14, 25, 26, 27 or 28 (antagonist of hsa-miR-218-5p). The oligonucleotide molecule according to any one of items 1 to 7. 9. The oligonucleotide molecule has a length of 15 to 30 nucleotides, and the nucleotide sequence of the oligonucleotide consists only of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 49, SEQ ID NO: 50 or SEQ ID NO: 51 (an antagonist of hsa-miR-23b) or SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 14, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28 (an antagonist of hsa-miR-218-5p), and is an oligonucleotide molecule according to any one of Items 1 to 8. 10. A composition, preferably a pharmaceutical composition, comprising the oligonucleotide molecule defined in at least any one of Items 1 to 9 or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives. 11. A composition used for therapy, preferably a pharmaceutical composition, comprising the oligonucleotide molecule defined in at least any one of Items 1 to 9 or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives. 12. A composition, preferably a pharmaceutical composition, used for targeting muscle cells in a subject in need thereof, comprising the oligonucleotide defined in at least any one of Items 1 to 9 or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives. 13. A composition, preferably a pharmaceutical composition, used for the prevention or treatment of muscle diseases or the prevention or treatment of RNA abnormalities, comprising the oligonucleotide defined in at least any one of Items 1 to 9 or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives. 14. A composition for use according to Item 13, preferably a pharmaceutical composition, wherein the disease is myotonic dystrophy. 15. A composition for use according to Item 14, preferably a pharmaceutical composition, wherein the myotonic dystrophy is type 1.
[0139] Sequence Listing (in the 5' to 3' direction) As described above, the SEQ ID NOs. listed below and referred to throughout the present application include nucleic acid base sequences and, for oligonucleotides that deviate from the natural chemical properties, also include their chemical modifications and / or fatty acid conjugations. To define the chemical modifications included in the SEQ ID NOs. disclosed herein, the following nomenclature is used throughout this specification: LNA nucleotides are represented by combinations of upper and lower case letters: Ab, Gb, Tb, Cb. Phosphorothioate linkages are represented by the lower case letter "s". 2'-O-MOE RNA nucleotides are represented by combinations of upper and lower case letters: Am, Cm, Gm, Tm. 2'-O-methyl-nucleotides are represented by lower case letters: a, g, c, u. 2'-fluoro RNA nucleotides are represented by combinations of upper and lower case letters: Af, Cf, Gf, Tf. 2'-O-methyl-2,6-diaminopurine modification is represented by the expression (dap). Deoxynucleotides are represented by combinations of lower and upper case letters: dA, dC, dG, dT. 2'-OMe-5-methyluridine or 2'-OMe-ribothymidine is represented by the lower case letter "t". 5-methyl-2'-O-methylcytidine is represented by the expression (5Mc). The expression (oleic acid) means that the oligonucleotide is conjugated to oleic acid. The expression (palmitic acid) means that the oligonucleotide is conjugated to palmitic acid. (Spacer molecule) is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof. The spacer molecule is preferably NHC6 or NHC3. "Y" is used for any pyrimidine (C or U / T). "I" is used for hypoxanthine since hypoxanthine is the nucleic acid base of inosine. SEQ ID NO: 1: Antagonist of human hsa-miR-218-5p: TTAGATCAAGCACAA SEQ ID NO: 2: Antagonist of human hsa-miR-23b-3p: ATCCCTGGCAATGTGA SEQ ID NO: 3: MD23b-2 V2 3’ Ol: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(oleic acid) SEQ ID NO: 4: MD23b-2-PS / PO 3’ Ol: AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb(NHC6)(oleic acid) SEQ ID NO: 5: MD23b-2-PS / PO 5’ Ol: (oleic acid)(NHC6)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb SEQ ID NO: 6: MD23b-2-PS / PO: AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb SEQ ID NO: 7: 218 MOE Oleic 3’: TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb(NHC6)(oleic acid) SEQ ID NO: 8: 218 MOE DD Oleic 3’: TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(NHC6)(oleic acid) SEQ ID NO: 9: 218 OME / MOE oleic 3’: TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(oleic acid) SEQ ID NO: 10: hsa-miR-218-5p: UUGUGCUUGAUCUAACCAUGU SEQ ID NO: 11: hsa-miR-23b-3p: AUCACAUUGCCAGGGAUUACCAC Sequence number 12: Seed region of hsa-miR-218-5p: UGUGCU Sequence number 13: Seed region of hsa-miR-23b-3p: UCACAU Sequence number 14: 218 OME / MOE oleic 3’2: TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(NHC6)(oleic acid) Sequence number 15: 218 MOE: TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb Sequence number 16: MD23b-2 V2 3’Pal: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NHC6)(palmitic acid) Sequence number 17: MD23b-2 V2: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb Sequence number 18: MD23 MOE: AbsTbsCmsCmCmsTmsGmGmsCmAmAmsTbGmsTmGbsAb Sequence number 19: MicroRNA precursor (pre-microRNA) of hsa-miR-23b-3p: CUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGC Sequence number 20: Pre-hsa-miR-218-5p-1 (chr4:20529898-20530007): GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Sequence number 21: Pre-miR-218-2 (chr5:1681951 SI-168195260): GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA SEQ ID NO: 22: MD23b-2 V2 3’O1 without specific spacer molecule AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb (spacer molecule) (oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 23: MD23b-2-PS / PO 3’O1 without specific spacer molecule AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb (spacer molecule) (oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 24: MD23b-2-PS / PO 5’O1 without specific spacer molecule: (oleic acid) (spacer molecule) AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 25: 218 MOE Oleic 3’ without specific spacer molecule TbsTbsAmsGbsAmsTmsCbAmsAmGbCmAbsCmsAbsAb (spacer molecule) (oleic acid) (wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 26: 218 MOE DD Oleic 3’ without specific spacer molecule TbsTbsAmsGbsAmsTmsCbAmsAmsGbCmAbsCms(dap)s(dap)(Spacer molecule)(Oleic acid)(wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 27: 218 OME / MOE oleic 3’ without specific spacer molecule TbsTmsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(Spacer molecule)(Oleic acid)(wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 28: 218 OME / MOE oleic 3’2 without specific spacer molecule TbsTbsasGbsastsCbAmsAmGbCmAbsCmsAmsAb(Spacer molecule)(Oleic acid)(wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 29: MD23b-2 V2 3’Pal without specific spacer molecule AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(Spacer molecule)(Palmitic acid)(wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol or derivatives thereof) SEQ ID NO: 49: MD23b-2 V2 3’Ol having C6SSC6 and NHC6 AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC6)(Oleic acid) SEQ ID NO: 50: MD23b-2 V2 3’Ol having C6SSC6 and NHC3 AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(C6SSC6)(NHC3)(Oleic acid) Accession number 51: MD23b-2-PS / PO 5’Ol without spacer molecule (oleic acid)AbsTms(5Mc)s(5Mc)(5Mc)Tbgsgs(5Mc)sAbAmTbGbsTmsGbsAb Accession number 52: Functional equivalent sequence of antimiR-23b-3p YTCCCTGGCAATGTGA Accession number 53: Functional equivalent sequence of antimiR-23b-3p ATCCCTYGCAATGTGA Accession number 54: Functional equivalent sequence of antimiR-23b-3p ATCCCTGYCAATGTGA Accession number 55: Functional equivalent sequence of antimiR-23b-3p ATCCCTGGCYATGTGA Accession number 56: Functional equivalent sequence of antimiR-23b-3p ATCCCTGGCAYTGTGA Accession number 57: Functional equivalent sequence of antimiR-23b-3p ATCCCTGGCAATYTGA Accession number 58: Functional equivalent sequence of antimiR-23b-3p ATCCCTGGCAATGTYA Accession number 59: Functional equivalent sequence of antimiR-23b-3p ATCCCTGGCAATGTGY Accession number 60: Functional equivalent sequence of antimiR-23b-3p GTCCCTGGCAATGTGA Accession number 61: Functional equivalent sequence of antimiR-23b-3p ATUCCTGGCAATGTGA Accession number 62: Functional equivalent sequence of antimiR-23b-3p ATCUCTGGCAATGTGA Accession number 63: Functional equivalent sequence of antimiR-23b-3p ATCCUTGGCAATGTGA SEQ ID NO: 64: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGUAATGTGA SEQ ID NO: 65: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCGATGTGA SEQ ID NO: 66: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAGTGTGA SEQ ID NO: 67: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGG SEQ ID NO: 68: Functional equivalent sequence of antimiR-23b-3p: ITCCCTGGCAATGTGA SEQ ID NO: 69: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCIATGTGA SEQ ID NO: 70: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAITGTGA SEQ ID NO: 71: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGI SEQ ID NO: 72: Functional equivalent sequence of antimiR-23b-3p: AICCCTGGCAATGTGA SEQ ID NO: 73: Functional equivalent sequence of antimiR-23b-3p: ATCCCIGGCAATGTGA SEQ ID NO: 74: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAAIGTGA SEQ ID NO: 75: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGIGA SEQ ID NO: 76: Functional equivalent sequence of antimiR-23b-3p: ATCCCTIGCAATGTGA SEQ ID NO: 77: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGICAATGTGA SEQ ID NO: 78: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATITGA SEQ ID NO: 79: Functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTIA SEQ ID NO: 80: Functional equivalent sequence of antimiR-218-5p: TTYGATCAAGCACAA SEQ ID NO: 81: Functional equivalent sequence of antimiR-218-5p: TTAYATCAAGCACAA SEQ ID NO: 82: Functional equivalent sequence of antimiR-218-5p: TTAGYTCAAGCACAA SEQ ID NO: 83: Functional equivalent sequence of antimiR-218-5p: TTAGATCYAGCACAA SEQ ID NO: 84: Functional equivalent sequence of antimiR-218-5p: TTAGATCAYGCACAA SEQ ID NO: 85: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAYCACAA SEQ ID NO: 86: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCYCAA SEQ ID NO: 87: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACYA SEQ ID NO: 88: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAY SEQ ID NO: 89: Functional equivalent sequence of antimiR-218-5p: TTGGATCAAGCACAA SEQ ID NO: 90: Functional equivalent sequence of antimiR-218-5p: TTAGGTCAAGCACAA SEQ ID NO: 91: Functional equivalent sequence of antimiR-218-5p: TTAGATUAAGCACAA SEQ ID NO: 92: Functional equivalent sequence of antimiR-218-5p: TTAGATCGAGCACAA SEQ ID NO: 93: Functional equivalent sequence of antimiR-218-5p: TTAGATCAGGCACAA SEQ ID NO: 94: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGUACAA SEQ ID NO: 95: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCGCAA SEQ ID NO: 96: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCAUAA SEQ ID NO: 97: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACGA SEQ ID NO: 98: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAG SEQ ID NO: 99: Functional equivalent sequence of antimiR-218-5p: TTIGATCAAGCACAA SEQ ID NO: 100: Functional equivalent sequence of antimiR-218-5p: TTAGITCAAGCACAA SEQ ID NO: 101: Functional equivalent sequence of antimiR-218-5p: TTAGATCIAGCACAA SEQ ID NO: 102: Functional equivalent sequence of antimiR-218-5p: TTAGATCAIGCACAA SEQ ID NO: 103: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCICAA SEQ ID NO: 104: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACIA SEQ ID NO: 105: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAI SEQ ID NO: 106: Functional equivalent sequence of antimiR-218-5p: ITAGATCAAGCACAA SEQ ID NO: 107: Functional equivalent sequence of antimiR-218-5p: TIAGATCAAGCACAA SEQ ID NO: 108: Functional equivalent sequence of antimiR-218-5p: TTAGAICAAGCACAA SEQ ID NO: 109: Functional equivalent sequence of antimiR-218-5p: TTAIATCAAGCACAA SEQ ID NO: 110: Functional equivalent sequence of antimiR-218-5p: TTAGATCAAICACAA SEQ ID NO: 111: TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester
[0140] The following examples are merely for explaining the present invention.
Examples
[0141] Materials and Methods Cell culture experiments Immortalized MyoD-inducible (doxycycline) DM1 and control fibroblasts (Arandel L., et al. (2017). "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds." Dis Model Mech 10(4): 487-497.) were grown in DMEM (Sigma, St. Louis, MO) containing 4.5 g / L glucose, 1% P / S, and 10% FBS. The differentiation conversion of fibroblasts into myotubes was according to Non-Patent Document 2 (Cerro-Herreros et al. (2018). "miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes in mammalian models". Nat. Commun. 9, 2482).Differentiation conversion was induced on day 0, and the test compounds were added to the cell culture medium by lipofection using X-tremeGENE™ HP (Roche, Basel, Switzerland) at different concentrations (MD23b-2, MD23b-8, MD23b-4, MD23b-13, MD23b-7, MD23b-14, MD-23b-1, 23-LNA4, MD23b-10, MD23b-3, AntimiR-23b, MD23b-6, MD23b-12, MD23b-9, MD23b-5, MD23b-11, 23-LNA6, unconjugated-23b, 5’-23b-Oleic, 5’-23b-Linoleic, 5’-23b-MeToc, 5’-23b-MeChol, 5’-23b-MePal, 5’-23b-Elaidic, 5’-23b-Estearic, OL-MD23b-2, MD23b-2-PS / PO, MD23b-2-PS / PO 5’Ol, unconjugated-218, Ax-218, 5’-218-Oleic, 5’-218-MeChol, 5’-218-Linoleic, 5’-218-MePal, 5’-218-MeToc, Sc-Oleic, MD218-12, MD218-6, MD218-11, unconjugated-218, MD218-13, MD218-5, MD218-4, MD218-15, MD218-10, MD218-3 at 10 nM, 50 nM, 200 nM, 1 μM and 5 μM; 23-LNA8, AX-23b, MD23b-2 V2 3’Ol, MD23b-2 V2 3’Ol(C6SSC6)(NHC6), MD23b-2 V2 3’Ol(C6SSC6)(NHC3) and MD23b-2 V2 3’Ol(threoninol) at 2 nM, 10 nM, 50 nM, 200 nM and 1 μM; 23-D / LNA1, 23-D / LNA2 and 218-2F / LNA1: 0.4 nM, 2 nM, 10 nM, 50 nM and 200 nM); 218-D / LNA2, 218-2F / MOE at 0.08 nM, 0.4 nM, 2 nM, 10 nM and 50 nM), and the medium was replaced with fresh differentiation medium 4 hours later. Cells were harvested in the differentiation medium on day 4 and processed for protein extraction.
[0142] Cell proliferation assay 10 in a 96-well plate 5Cells seeded at cells / ml were transfected with antimiR 24 hours later as described above. After 96 hours, cell proliferation was measured using the CellTiter 96® Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, Wisconsin). The TC50 was calculated using non-linear least squares regression, and absorbance levels were determined using an Infinite M200 PRO plate reader (Tecan, Männedorf, Switzerland).
[0143] Quantitative dot blot (QDB) assay For the activity assay, cells were seeded in 6-well plates at 8×10 per well 4Seeded at the density of cells and transfected with antimiR 24 hours later as described above. For total protein extraction, human muscle cells were sonicated, and mouse muscles (gastrocnemius and quadriceps) were homogenized in Pierce (TM) RIPA buffer (Thermo Scientific, Waltham, MA) supplemented with protease and phosphatase inhibitor cocktails (Roche Applied Science, Penzberg, Germany). Quantification of total protein was performed using the Pierce (TM) BCA Protein Assay Kit (Thermo Scientific, Waltham, MA) with bovine serum albumin as a standard. For the immunodetection assay, cell samples at 1 μg / well and mouse samples at 2 μg / well were denatured (at 100 °C for 5 minutes) and loaded onto QDB plates (Quanticision Diagnostics Inc, Research Triangle Park, NC). Each cell sample was loaded quadruplicate onto two different plates, one for the detection of MBNL1 and the other for the detection of GAPDH, which was used here as an endogenous control. In the case of mouse samples, each sample was loaded quadruplicate onto three different plates, one for the detection of MBNL1, one for the detection of tubulin, which was used as an endogenous control, and the other for the detection of anti-mouse IgG secondary antibody as a negative control for background subtraction. For the QDB protocol, proteins are prepared at 2 μg / well. Each sample is loaded quadruplicate onto two different plates, one for the detection of MBNL1 and the other for the detection of GAPDH, which is used here as an endogenous control. For the preparation of sample mixes (for 10 samples to account for pipetting errors), protein extracts are added at the designated concentration, 10.4 μl of 4x loading buffer is added, and finally made up to 50 μl with ddH2O. After preparing the samples, boil them in water for 5 minutes and then place them on ice after protein denaturation. Invert the QDB plates (Quanticision Diagnostics, Inc) to load the samples. Place 5 μl of the protein mix prepared earlier onto each membrane circle.Dry the loaded QDB plate at room temperature for 30 minutes in a well-ventilated place to completely dry the membrane. After drying, immerse the QDB plate in transfer buffer (0.039 M glycine, 0.048 M Tris, 0.37% SDS, 20% methyl alcohol) and gently shake the plate for 1 minute. Rinse the plate 3 times with TBST (137 mM NaCl, 2.7 mM KCl, 20 mM Tris (pH 7.4) + 0.1% Tween-20) and blot it with blocking buffer (5% non-fat milk in TBST) in one container. Incubate the plate overnight at 4°C in a 96-well plate with primary mouse anti-MBNL1 (1:1000, ab77017, Abcam) or mouse anti-GAPDH (1:500, clone G-9, Santa Cruz). Wash the plate 3 times with TBST, incubate it again for 2 hours with secondary antibody anti-mouse-POD (1:200, Sigma-Aldrich), and then wash the plate 3 times again with TBST. Insert the plate into a 96-well plate loaded with 100 μL / well of ECL substrate (Pierce) solution for 1 minute, then insert it into a white 96-well plate for chemiluminescence signal quantification using a Tecan Infiniti 200 pro microplate reader and select the option of "covered plate" in the user interface.
[0144] Incubate the plate overnight at 4°C with primary mouse anti-MBNL1 antibody (1:200, MB1a(4A8), DSHB, Iowa City, IA) and rabbit anti-α-tubulin antibody (1:1000, PA5-16891, Thermo Fisher). The primary antibodies were detected using goat horseradish peroxidase (HRP) conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies (1:3500, Sigma-Aldrich, St. Louis, MO), respectively. The immunoreaction was detected using Pierce™ ECL Western Reagent (Thermo Scientific, Waltham, MA), and the luminescence was acquired using an Infinite M200 PRO plate reader (Tecan, Männedorf, Switzerland).
[0145] RNA extraction, reverse transcription PCR (RT-PCR), and real-time quantitative reverse transcription PCR (qRT-PCR) Total RNA from mouse gastrocnemius and quadriceps muscles was isolated using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. One microgram of RNA was digested with DNase I (Invitrogen, Carlsbad, CA), and reverse transcribed with SuperScript II (Invitrogen, Carlsbad, CA) using random hexanucleotides. For subsequent PCR reactions, 20 ng of cDNA was used with GoTaq polymerase (Promega, Madison, WI). Specific primers were used to analyze alternative splicing of Atp2a1, Nfix, Mbnl1, and Clcn1 in mouse samples (both muscles). Endogenous reference levels were established using 0.2 ng of cDNA based on Gapdh levels. PCR products were separated on a 2% agarose gel and quantified using ImageJ software (NIH, Bethesda, MD). The percentage splicing restoration index (PSR) was defined as the value % SI -X% DSI divided by X% DSI -X% HSI (SI: splicing inclusion of each sample; DSI: disease splicing inclusion; HSI: healthy splicing inclusion; in all cases, splicing refers to the inclusion of the designated alternative exon). This ratio was calculated for ATP2A1, NFIX, MBNL1, and CLCN1. The primer sequences and exons analyzed are available in (Non-Patent Document 2 (Cerro-Herreros et al. 2018 2018 Jun 26;9(1):2482. doi: 10.1038 / s41467-018-04892-4.)) and are reproduced below: SEQ ID NO: 30: Gapdh Fwd: ATCAACGGGAAGCCCATCAC SEQ ID NO: 31: Gapdh Rv: CTTCCACAATGCCAAAGTTGT SEQ ID NO: 32: Atp2a Fwd: GCTCATGGTCCTCAAGATCTCAC SEQ ID NO: 33: Atp2a Rv: GGGTCAGTGCCTCAGCTTTG SEQ ID NO: 34: Clcn1 Fwd: GTCCTCAGCAAGTTTATGTCC SEQ ID NO: 35: Clcn1 Rv: GAATCCTCGCCAGTAATTCC SEQ ID NO: 36: Nfix Fwd: TCGACGACAGTGAGATGGAG SEQ ID NO: 37: Nfix Rv: CAAACTCCTTCAGCGAGTCC SEQ ID NO: 38: Mbnl1 ex5 F: AGGGGAGATGCTCTCGGGAAAAGTG SEQ ID NO: 39: Mbnl1 ex5 R: GTTGGCTAGAGCCTGTTGGTATTGGAAAATAC
[0146] 1 ng of mouse tissue cDNA was used as a template for multiplex qRT-PCR using the QuantiFast Probe PCR Kit reagent. Commercial TaqMan probes (Qiagen, Hilden, Germany) were used for mouse genes (MBNL1 and MBNL2; FAM-labeled probes) and the reference gene (GAPDH; MAX-labeled probe). The results were normalized against Gapdh endogenous gene expression. The primers used were as follows: SEQ ID NO: 40: Probe Mbnl1: / 56-FAM / TCGCAAATCAGCTGTGAGGAGATTCCCT / 3IAbRQSp / SEQ ID NO: 41: Mbnl1 F: TACCGATTGCACCACCAAAC SEQ ID NO: 42: Mbnl1 R: GCTGCTTTCAGCAAAGTTGTC SEQ ID NO: 43: Mbnl2 Probe: / 56-FAM / CCCGGCAGACAGCACCATGATCGA / 3IAbRQSp / SEQ ID NO: 44: Mbnl2 F: GAGACAGACTGCCGCTTTG SEQ ID NO: 45: Mbnl2 R: GGTTACGGTGTTGTCGTTTGT Accession number 46: Gapdh probe: / 5MAXN / -CGCCTGGTCACCAGGGCTGCT- / 3BHQ_1 / Accession number 47: Gapdh_For: CAACGGATTTGGTCGTATTGG Accession number 48: Gapdh_Rev: TGATGGCAACAATATCCACTTTACC
[0147] miRNA expression in muscle tissue was quantified using specific miRCURY (trademark)-locked nucleic acid microRNA PCR primers (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Relative gene expression was normalized to U1 (YP00203909) and U6 (YP00203907) snRNA.
[0148] Expression levels were measured using a QuantStudio 5 Real-Time PCR System (Applied Biosystems, Foster City, CA). Expression relative to the endogenous gene and control groups was calculated using the 2 -ΔΔCt −ΔΔCt method. Pairs of samples were compared using a two-sided t-test (α = 0.05), with Welch's correction applied as needed. Statistical differences were estimated by Student's t-test (p < 0.05) on the normalized data.
[0149] Animal experiments and oligonucleotide administration The handling of mice and experimental procedures were approved by the Conselleria de Agricultura, Generalitat Valenciana, in accordance with European law on the care and use of laboratory animals (2003 / 65 / CE). Homozygous transgenic HSALR (strain 20b) mice (Mankodi et al. 2000 Science: 289(5485):1769 - 73. doi: 10.1126 / science.289.5485.1769) were provided by Professor C. Thornton (University of Rochester Medical Center, Rochester, NY, USA). Experimental groups consisted of HSALR mice treated with all experimental oligonucleotides, FVB as normal controls, and HSALR treated with PBS as negative controls. The sample size was 4 mice per treatment group, 12 mice for PBS, and 18 mice for the FVB group. All groups received an intravenous (tail vein) injection of 150 μl of 1×PBS (vehicle) or a specific oligonucleotide (see Figures 2 - 5) at a single dose of 3 mg / kg. Mice were sacrificed 4 days after injection, and the tissues of interest were frozen in liquid nitrogen for molecular assays.
[0150] Electromyography study As previously described (Kanadia et al. 2006 Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11748 - 53. doi: 10.1073 / pnas.0604970103), electromyography was performed under general anesthesia before treatment and at the time of sacrifice. To eliminate bias, the determinations were made blindly. Five needle insertions were made into the quadriceps muscles of both hindlimbs, and myotonic discharges were scored on a 5 - point scale: 0, no myotonia; 1, occasional myotonic discharges in less than 50% of insertions; 2, myotonic discharges in more than 50% of insertions; 3, myotonic discharges in almost all insertions; 4, myotonic discharges in all insertions.
[0151] Forelimb grip strength test Forelimb grip strength was measured using a Grip Strength Meter (BIO-GS3; Bioseb, Pinellas Park, FL). The peak traction force (measured in grams) when the mouse grasped the bar was recorded using a digital force transducer. After each measurement, the gauge of the force transducer was reset to 0 g. The tension at the moment the mouse released its front paw from the bar was recorded using a gauge. Three consecutive measurements were taken at 30-second intervals. Body weight was measured in parallel. The final value was obtained by dividing the average value of the grip strength by the body weight of each mouse. Body weight was measured in parallel, and the experiments were conducted on animals identified by code to eliminate experimental bias.
[0152] Radar chart The values obtained were expressed as a recovery index (RI), and treatment HSA LR It measures how close the different parameter values obtained in mice are to those of the FVB control. This RI is obtained according to the following formula for various parameters (Mbnl1 protein, Mbnl1 / 2 expression level, splicing recovery, Mbnl1 ex5 inclusion recovery, and functional recovery) in each mouse after treatment: (Value %MT - X %MNT) / (X %MH - X %MNT), where MT is the value of each treated mouse (PBS or oligonucleotide), MNT is the HSA treated with PBS LR in mice (PBS), and MH is the value of healthy mice (FVB). These values range from 0 to 1, where 0 is the untreated mouse (HSA LR -PBS), and 1 is the healthy mouse (FVB).
[0153] The Mbnl1 protein refers to the average of the values obtained by quantitative dot blot of both muscles (quadriceps and gastrocnemius) in each treatment group.
[0154] The Mbnl1 / 2 expression level refers to the average of the mRNA values of the genes Mbnl1 and Mbnl2 obtained by real-time PCR in both muscles (quadriceps and gastrocnemius) and each treatment group by applying the above formula.
[0155] Splicing recovery refers to the average percentage of inclusion for Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in both muscles of each treatment group.
[0156] Mbnl1 ex5 inclusion recovery refers to the percentage of inclusion for Mbnl1 exon 5 in both muscles of each treatment group.
[0157] Functional recovery refers to the average of the values obtained by force / body weight of each mouse after treatment and the grade of myotonic discharge of each treatment group. Force was obtained using the forelimb grip strength test, and the grade of myotonic discharge was obtained using electromyogram examination.
[0158] Example 1 The present inventors have previously shown that inhibition of miR-23b-3p or miR-218-5p can be therapeutic in myotonic dystrophy by using commercially available antimiRs having an antagomiR structure against miR-23b-3p (Ax-23b) or miR-218-5p (Ax-218) (Non-Patent Document 2 (Cerro-Herreros et al. 2018 Nat. Commun. 26;9(1):2482. doi: 10.1038 / s41467-018-04892-4.)). Transfection of human DM1 cells with these antimiRs and their injection in a mouse model of the disease resulted in downregulation of target miRNA expression and at the same time upregulation of MBNL1, their direct target. The antimiRs used were long (22 nt), contained an almost perfect complementary sequence to the miRNA, and were all composed of 2’OME nucleotides. The antagomiRs had phosphorothioate linkages between the nucleotides at the 3’ and 5’ ends to improve the stability of the nucleotide portion of the molecule and were conjugated to cholesterol at the 3’ as a carrier to enhance pharmacokinetic behavior and cellular internalization. Seeking the most effective and safe carrier, the polynucleotide portion of Ax-23b (sequence name: unconjugated-23b in Table 1) was combined at either the 3’ or 5’ end of the molecule with various lipid carriers containing the sterol cholesterol and tocopherol; and the fatty acids palmitic acid, stearic acid, elaidic acid, linoleic acid and oleic acid (list of molecules in Table 1). Screening was performed on human DM1 cells transfected with these conjugated antagomiRs (Arandel L., et al. (2017). Dis Model Mech 10(4): 487-497.). "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds." Dis Model Mech 10(4): 487-497.) to determine the toxicity (cell viability study) and the effect of the antagomiR on MBNL1 protein levels.
[0159] Each of these molecules was transfected into DM1 human myotubes at five different concentration ranges, and the percentage of cell viability and the level of MBNL1 protein were quantified. The antimiRs were ranked according to the therapeutic index (TI) defined as follows: TI=(TC50 / EC50)×Emax where TC50 is the concentration of the compound that reduces cell viability to 50% of the mock, EC50 is the concentration of the compound that yields 50% of Emax, and Emax is the maximum fold change in MBNL1 protein obtained after transfection with a specific antimiR compared to the mock (transfected with vehicle).
[0160] From these experiments, the following conclusions were drawn: Conjugation with oleic acid (a cis-monounsaturated fatty acid with 18 carbon atoms) resulted in the highest Tindex (see Table 1). The curves of the toxicity and efficacy (level of MBNL1 protein) of the molecules named "non-conjugate-23b" and "5'-23b-Oleic" are shown in Figures 1C and 1B for direct comparison. Importantly, the low Tindex of the scrambled oligo conjugated with oleic acid ("Sc-Oleic") indicates that oleic acid itself does not affect the Tindex. Linoleic acid (a cis-polyunsaturated fatty acid with 18 carbon atoms) was the second most effective carrier. Surprisingly, the Tindex results obtained with elaidic acid (the trans isomer of oleic acid), palmitic acid (a saturated non-esterified fatty acid with 16 carbon atoms), and stearic acid (a saturated fatty acid having an 18-carbon chain) were significantly lower. Thus, from our data, it is shown that cis-unsaturated fatty acids are better carriers of antimiRs in our DM1 cells. Cholesterol was the only carrier tested by conjugating at two different positions, 3’ and 5’. According to the inventors' data, conjugation at 3’ seemed to function more efficiently than at 5’. Using cholesterol derivatives as tocopherols did not improve the Tindex.
[0161] The same experiment was conducted by conjugating the nucleotide portion of Ax-218 (sequence name: unconjugated-218 in Table 1) with various lipid carriers (Table 1). Oleic acid was confirmed to be the best carrier among all the fatty acids tested, and cholesterol functioned better at 3’ than at 5’. However, it should be noted that cholesterol is associated with toxicity in the mouse liver, although the liver changes may be reversible after the recovery period (see Cholesterol Registration Dossier ECHA, April 4, 2017, available at https: / / echa.europa.eu / es / registration-dossier / - / registered-dossier / 11031 / 7 / 6 / 1#). However, since the pharmacokinetics of oligonucleotides are intended for chronic treatment, cholesterol as a linker may increase the risk of toxicity in the liver. In contrast, oleic acid has a good safety profile and has been used as a food additive with beneficial effects in humans (see FDA Response Letter to the Health Claim Petition Concerning Oleic Acid, November 19, 2018, available at https: / / www.fda.gov / food / cfsan-constituent-updates / fda-completes-review-qualified-health-claim-petition-oleic-acid-and-risk-coronary-heart-disease).
[0162] After finding a suitable carrier, the next step was to optimize the sequences and chemical modifications included in the antimiR molecules conjugated to the carrier. Thus, the same in vitro screening was also performed to find the most effective sequences and chemical modifications that improve the Tindex of unconjugated (non-conjugated) antimiR in DM1 cells. A group of various single-stranded molecules (ranging in length from 16 to 22 nucleotides) complementary to different parts of human miR-23b-3p or miR-218-5p was created. The molecules included in this screening had various chemical modifications including LNA, 2'OME and 2'MOE oligonucleotides, and all linkages between nucleotides were phosphorothioate (PS) (list of tested molecules in Tables 2 and 3).
[0163] The molecule with a better Tindex score for miR-23b-3p was MD23b-2, and in the case of the antimiR molecule designed to inhibit miR-218-5p, the molecule with the best score was 218-D / LNA2 (see Tables 2 and 3). Importantly, MD23b-2 showed a significantly higher effect than 218-D / LNA2 on the MBNL1 level (Emax) and Tindex. The curves of the toxicity and efficacy (level of MBNL1 protein) of these molecules are shown in Figures 1A and 1D.
[0164] Next, the effect of oleic acid conjugation on the best-scoring antimiR sequence MD23b-2 was tested (Table 4). Surprisingly, the conjugated molecule (Ol-MD23b-2) showed a decreased Tindex compared to MD23b-2. On the other hand, it was observed that oleic acid conjugation to oligonucleotides with a PS / PO mixture increased its Tindex (Table 4). From this data, it is confirmed that the effect of oleic acid on the Tindex is surprisingly prominent in the mixed PS / PO oligonucleotides.
[0165] TIFF2025522282000001.tif254170
[0166] TIFF2025522282000002.tif254170
[0167] TIFF2025522282000003.tif254170
[0168] TIFF2025522282000004.tif254170
[0169] Example 2 Next, the best oligomers against miR-23b-3p (MD23b-2) and miR-218-5p (218-D / LNA2) in vitro were selected, and several modifications were applied to these molecules to improve their ADMET (absorption, distribution, metabolism, excretion, and toxicity) properties in order to evaluate their in vivo therapeutic potential in a mouse model of DM1 (HSA LR ). The rationale behind the introduced modifications was as follows: (1) Methylation of cytosine is a known method to inhibit the activation of the immune system by in vivo treatment with antisense oligomers (Joseph J. Senn, et al. Non-CpG-Containing Antisense 2'-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88. Journal of Pharmacology and Experimental Therapeutics September 1, 2005, 314 (3) 972-979; DOI: https: / / doi.org / 10.1124 / jpet.105.084004). (2) LNA and 2’MOE-modified chemically modified nucleotides are known to be more stable than standard RNA, DNA, or 2’OME-modified oligos (W. Brad Wan and Punit P. Seth. 2016. The Medicinal Chemistry of Therapeutic Oligonucleotides). (3) In all molecules tested in vitro, the phosphodiester (PO) linkages between nucleotides have been replaced by phosphorothioate (PS) linkages to enhance their stability and efficacy. Fully modified PS oligos are widely used in in vitro studies. However, some in vivo toxicity associated with an excess of PS linkages in a single molecule has been previously reported (e.g., Smith and Zain. 2019. Therapeutic oligonucleotides: State of the Art. Annual Review of Pharmacology and Toxicology and Hu et al. 2020. Therapeutic siRNA: state of the art. Signal transduction and targeted therapy), and it has been demonstrated that mixed oligo PS / PO are more stable in vivo (Zhang, et al. In vivo stability, disposition and metabolism of a "hybrid" oligonucleotide phosphorothioate in rats. Biochemical Pharmacology. Volume 50, Issue 4, 1995, Pages 545-556, ISSN 0006-2952, https: / / doi.org / 10.1016 / 0006-2952(95)00159-W). Therefore, in order to design antisense oligos that can be tested in an in vivo model, it was decided to reduce the amount of PS linkages in subsequent in vivo studies.
[0170] Considering these three criteria, four antisense oligos were generated: MD23b-2 PS / PO, which preserves the same chemical modifications as seen in MD23b-2 but has a lower PS content and all cytosines are methylated. MD23b-2 V2, which has the same sequence as MD23b-2 but some 2’ OME modifications are replaced by MOE, has a lower PS content, and all cytosines are methylated. 218 MOE, which has the sequence of 218-D / LNA2, all natural DNA nucleotides are replaced by 2’ MOE, all cytosines are methylated, and has a lower PS content. 218 OME / MOE, which has the sequence of 218-D / LNA2, all natural DNA nucleotides are replaced by 2’ MOE or 2’ MOE, all cytosines are methylated, and has a lower PS content.
[0171] These molecules are HSA LRTo assess their therapeutic potential in mice (see Mankodi, A., et al. (2000). "Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat." Science 289(5485): 1769-1773, a model of DM1), they were used unconjugated (except for 218 OME / MOE) and conjugated to oleic acid. Specifically, MD23b-2 PS / PO was used unconjugated, conjugated to oleic acid at the 3' end (MD23b 2 PS / PO 3’Ol), and conjugated to oleic acid at the 5' end (MD23b-2 PS / PO 5’Ol) to assess the effect of the conjugation site with oleic acid on the therapeutic effect. MD23b-2 V2 was used unconjugated, conjugated to oleic acid at the 3' end (MD23b-2 V2 3’Ol), and conjugated to palmitic acid at the 3' end (MD23b-2 V2 3’Palm) to confirm whether conjugation with oleic acid produces a stronger effect of the antimiR than conjugation with palmitic acid in vivo. Two antimiRs against miR-218-5p were both conjugated to oleic acid at the 3'.
[0172] All of these molecules were 3 to 5 months old HSA LRIt was intravenously injected into the tail vein of mice at a concentration of 3 mg / kg. The grip strength and myotonia of these mice were also evaluated immediately before the injection and before sacrifice 5 days after the single injection. Figure 2 shows the results of the levels of grip strength (A) and myotonia (B) normalized to body weight, measured immediately before sacrificing the mice. In all mice treated with antimiR, grip strength was improved compared to PBS-injected mice, but the difference was statistically significant only for some antimiRs. Similarly, myotonia decreased in antimiR-treated mice. The most significant decrease in myotonia was achieved by the molecules MD23b-2 V2 3’Ol and 218 MOE Oleic 3’. For both molecules, the oleic acid-conjugated molecules produced a stronger rescue than the non-conjugated type and had a stronger effect when conjugated at the 3’.
[0173] Example 3 At the time of sacrifice, the quadriceps femoris and gastrocnemius muscles of the hindlimbs of the mice were dissected and processed for protein and RNA extraction. It was shown that all antimiRs efficiently reduced the levels of the corresponding miRNAs by qPCR after reverse transcription of the extracted RNA using specific probes for detecting the levels of miR-23b-3p (Figure 3A) or miR-218-5p (Figure 3B). Importantly, the non-conjugated type of antimiR tended to be less efficient than the conjugated type. For the antimiR against miR-218-5p, 218 MOE was the least effective.
[0174] Example 4 Using qRT-PCR, the expression levels of Mbnl1 (Figure 4A) and Mbnl2 (Figure 4B) transcripts in quadriceps and gastrocnemius muscles were quantified, and total proteins extracted from these muscles were processed for protein Mbnl1 detection by quantitative dot blot analysis (Figure 4C). Regarding the levels of Mbnl1 transcripts, a slight difference was detected between antimiR-23b-3p and antimiR-218-5p, but the miR-23b-3b antimiR had a stronger effect on Mbnl protein. Importantly, no difference was observed regardless of whether the oleic acid carrier was placed at the 3’ or 5’ of the molecule MD23b-2 PS / PO. In the case of the molecule MD23b-2 V2, the unconjugated form was clearly less efficient than the conjugated form with oleic acid or palmitoyl acid, and oleic acid had a stronger effect, especially on the levels of Mbnl2 transcripts and Mbnl1 protein.
[0175] Example 5 Also, using total RNA, the mis-splicing of transcripts regulated by Mbnl1 protein such as Atp2a1 exon 22, Nfix exon 7, Mbnl1 exon 5, and chloride channel (Clcn1) exon 7a was analyzed (Figures 5 and 6).
[0176] Nfix, Clcn1, Atp2a1, and Mbnl1 transcripts were LR In mice, they showed abnormally increased inclusion of exons 7, 7a, 22, and 5, respectively. After treatment with 3 mg / kg of MD23-b V2 3’Ol and other similar molecules, 30% - 50% of the normal values were restored in the muscles.
[0177] Example 6 To analyze all DM1-related functional and molecular phenotypes measured in the model mice, a spider graph (Figure 7) was created to calculate the recovery index (RIm) for each individual mouse for various parameters (Mbnl1 protein, Mbnl1 / 2 expression levels, splicing recovery, Mbnl1 ex5 inclusion recovery, and functional recovery) after treatment according to the following formula: RIm = (value MT / X MNT ) / (X MH / X MNT ) Here, value MT is the individual value of each treated (PBS or oligonucleotide injection) mouse, X MNT is the average value of untreated diseased mice (PBS injection), and X MH is the average value of the healthy mouse group (FVB). Next, the individual RI values (RIm) were averaged to generate the overall RI value shown in Figure 7.
[0178] These values range from 0 to 1, where 0 is the untreated mouse (HSA LR -PBS) and 1 is the healthy mouse (FVB). The Mbnl1 protein refers to the average of the values obtained by quantitative dot blot of both muscles (quadriceps and gastrocnemius) in each treatment group. The Mbnl1 / 2 expression levels refer to the average of the values obtained by real-time PCR of both muscles (quadriceps and gastrocnemius) and genes (Mbnl1 and Mbnl2) in each treatment group by applying the previous formula. Splicing recovery refers to the average percentage of inclusion of Nfix exon 7, Atp2a1 exon 22, and Clcn1 exon 7a in both muscles of each treatment group. Mbnl1 ex5 inclusion recovery refers to the percentage of inclusion of Mbnl1 exon 5 in both muscles of each treatment group. Functional recovery refers to the average of the values obtained by force / body weight of each mouse after treatment and the grade of myotonic discharge in each treatment group.
[0179] From the display of these graphs in Figure 7 and Tables 5 and 6, it is shown that MD23b-2 V2 3’Ol was the antimiR molecule that produced the strongest rescue in all phenotypes studied. Notably, the difference in efficacy when this same antimiR sequence was not conjugated or conjugated to palmitic acid supports the surprising results of the inventors in in vitro studies, and a clearly stronger therapeutic effect on the molecule conjugated to oleic acid is confirmed. The second best molecule was MD23b-2 PS / PO 3’Ol, which was slightly better than MD23b-2 PS / PO 5’Ol. These data also support the results obtained in vitro by cholesterol conjugation, confirming that conjugation of the carrier at the 3’ is beneficial. As observed in vitro, the antimiR against miR-218-5p produced a lower phenotypic rescue. The data support the therapeutic effect of stronger inhibition of miR-23b-3p (Figure 7B and Table 5) compared to inhibition of miR-218-5p (Figure 7B and Table 6). In the case of molecule 218 MOE (Figure 7B), conjugation with oleic acid also improves its activity in vivo. Thus, it is confirmed that the effect of oleic acid conjugation on the therapeutic effect in vivo is not limited to a specific nitrogen base sequence and is more generally applicable.
[0180] TIFF2025522282000005.tif84170
[0181] TIFF2025522282000006.tif55170
[0182] Example 7 For all the antimiRs tested, a spacer containing an amino group was always used to form an amide linkage between oleic acid and the oligonucleotide, conjugating oleic acid at either the 3’ or 5’ end. The first spacer was a 6-aminohexyl group (NHC6 spacer) introduced at both the 3’ and 5’ ends. Next, the addition of other types of spacers (NHC6, NHC3, or threoninol) and spacers of different sizes (either 3 or 6 carbon atoms) between the oligo sequence MD23b-2 V2 and oleic acid (Figure 8) was tested to see if it could improve the effect of the resulting conjugate molecules on the level of MBNL1 protein. It was observed that all the antimiRs generated (a total of 4 in Tables 7, 8, and Figure 9) could bring about upregulation of the MBNL1 protein. Notably, the molecule conjugated with threoninol was the most active as it reached the EC50 at the lowest concentration, while the molecule with a 6-carbon spacer (NHC6) was the one that brought about the strongest maximum upregulation of the protein. This data demonstrates that modifications in the spacer can further tune the efficacy and pharmacodynamics of the oleic acid-conjugated antimiRs of the present invention.
[0183] TIFF2025522282000007.tif62170
[0184] TIFF2025522282000008.tif31170
[0185] Example 8 Methods for synthesizing oligonucleotides are widely known in the art, but herein, an example of the synthesis of MD23b-2 V2 3’Ol is presented. MD23b-2 V2 3’Ol is a 16-nt long oligonucleotide consisting of LNA, 2’-O-MOE, and 2’-O-Me modified building blocks linked by phosphodiester or phosphorothioate linkages. Its 3’ end is modified with an oleic acid moiety (Figure 10). This oleic acid is introduced by coupling an activated carboxylic acid at the 3’ end of the precursor oligonucleotide to a hexylamino spacer. The synthesis of MD23b-2 V2 3’Ol is based on solid-phase synthesis using building blocks and spacer-GPG. This process consists of two main steps.
[0186] First, the synthesis of a non-conjugated oligonucleotide (precursor) having the sequence AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(NH2C6). The first phosphoramidite, considered the building block of the strand, is attached to the solid surface by a catalytic condensation reaction. This step is repeated the same number of times as the length of the nucleotides in the final sequence. In this case, it is 16 times. After completion of the solid-phase synthesis, the manufacturing includes the following steps: cleavage and deprotection, purification, and desalting.
[0187] Second, conjugate the oleic acid. After conjugating the desalted non-conjugated oligonucleotide from the last step to oleic acid, it is purified, desalted, and lyophilized.
[0188] Example 9 1.1 Quantification of MD23b-2 V2 3’Ol by ELISA MD23b-2 V2 and MD23b-2 V2 3’Ol were used. A 12 mg / kg dose of the compound was administered to HSA LRIt was intravenously administered to mice. After 14 days, all mice were euthanized, and their brains, kidneys, livers, gastrocnemius muscles, and quadriceps femoris muscles were excised, weighed, and frozen for further processing. The experiment was conducted blindly by researchers who were unaware of the group assignments. Samples were taken from the brains, muscles (quadriceps femoris and gastrocnemius muscles), kidneys, and livers from all experimental groups during the autopsy procedure. The samples were weighed in grams to at least the third decimal place at the time of collection. Each piece was placed in an RNase-free tube and flash-frozen (e.g., 2 ml RNase-free Eppendorf tube).
[0189] 1.1.1 Sample Preparation 1) Excise the tissue and wash it with phosphate-buffered saline. 2) Dry the tissue on absorbent paper and weigh it (20 mg per tissue; for the brain, take 30 mg per tissue). 3) Add 100 μL of RIPA buffer supplemented with PhosSTOP EASYpack and Complete ULTRA Tablets, Mini, EASYpack (1 tablet per 10 mL of RIPA buffer) per 10 mg of tissue. 4) Homogenize the tissue in a 2 ml Eppendorf tube using a tissuelyser at 5000 RPM for 20 seconds, 4 times, or until the tissue is completely homogenized. 5) Incubate the homogenate overnight at 55 °C. 6) Centrifuge the homogenate at 15000 rpm for 15 minutes, collect the supernatant, and store it at -20 °C in preparation for analysis.
[0190] For muscle lysates, a 10-fold dilution of the actual homogenate in oligonucleotide dilution buffer was used. If the sample exceeded the limit of quantification, a 40-fold dilution was applied. For the brain, a 5-fold dilution was used, and for the liver and kidneys, a 400-fold dilution was used.
[0191] 1.1.2 Stock Preparation for Standard Curve For the preparation of the stock for the standard curve. First, a 20 μM stock of MD23b-2 V2 3’Ol was prepared. A concentration of 1 μM was used for creating the standard curve. Therefore, the 20 μM stock was diluted with water to the final volume such that it became 1 μM and stored in different fixed aliquots. The standard curve was recreated for each experiment, and for this purpose, the 1 μM stock had to be heated at 65 °C for 15 minutes each time. On the other hand, after preparing the tissue homogenate, 55 μL of the homogenate was added to 5445 μL of the compound dilution buffer to obtain the control tissue homogenate.
[0192] 1.1.3 Preparation of the standard curve For this purpose, the control tissue homogenate is required for the preparation of the standard dilutions. Then, to prepare the serial dilutions, 1 μM of the desired compound was denatured at 65 °C for 15 minutes and vortexed for at least 30 seconds. Then, 32 μL of this denatured compound was diluted with 968 μL of the control homogenate. This is the first point of the standard curve (32000 pM). Then, for the next point, 500 μL of 32000 pM was diluted with 500 μL of the compound dilution buffer (16000 pM). 8000 pM, 4000 pM, 2000 pM, and 1000 pM were prepared in a similar manner.
[0193] TIFF2025522282000009.tif52170
[0194] 1.1.4 QC Three QC levels (L, M, H) in triplicate for each run Acceptance criteria: More than 67% of the QC must be within ±30% of the nominal (theoretical) value.
[0195] 1.1.5 ELISA protocol The probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester (the stock is 100 μM in water and this stock is prepared to 1 μM in water) has to be heated at 65 °C for 15 minutes and vortexed for 30 seconds. Prepare serial dilutions of the sample homogenate and oligonucleotides before starting the experiment. Dilute the probe (1 μM) to 0.5 nM concentration with hybridization buffer. Add 70 μL of each dilution of the desired compound in triplicate, or in duplicate for the sample homogenate. Then add 70 μL of the probe at 0.5 nM concentration. Seal the plate with a PCR film and incubate at 37 °C for 30 minutes (an important step for hybridization of the probe and compound!). This step can be carried out in a normal transparent 96-well plate up to this point. Then immediately transfer 100 μL of the hybridized solution to a black NeutrAvidin-coated plate. Then seal the plate again with a PCR film and incubate at 37 °C for 30 minutes (an important step to bind biotin to the avidin-coated plate). During the incubation step, prepare Micrococcus nuclease with Micrococcus nuclease dilution buffer (1.6 μL of nuclease + 16 mL of buffer). This calculation is done for the entire plate. First, remove the liquid, wash the plate 6 times with 100 μL of wash buffer, then invert the plate and dry the plate using absorbent paper, and add 150 μL of Micrococcus nuclease per well (final amount 30 U / well). After adding Micrococcus nuclease, seal the plate with a PCR film and incubate the plate at 37 °C for 1 hour (this step is sufficient to cleave at least 99% of the single-stranded probe). Prepare TBS buffer containing 0.25% Tween 20 and antibody (anti-digoxigenin antibody, Roche #11093274910), vortex well, and place at RT. For the remaining amount that is not needed, it can be aliquoted and stored in the freezer. First, remove the liquid, then wash the plate 6 times with 100 μL of washing buffer, dry the plate, and add 150 μL of anti-digoxigenin antibody (conjugated to alkaline phosphatase) diluted 5000-fold with TBS buffer (containing 0.25% (v / v) Tween 20). Seal the plate with a PCR film and incubate at 37 °C for 30 minutes. To prepare the Attophos substrate, dilute 36 mg of the powder (in a bottle) by adding 60 ml of Attophos buffer, store in the refrigerator (preferably wrapped in aluminum foil) protected from light. Remove the liquid, wash the plate 6 times with 100 μL of washing buffer, dry the plate, and add 150 μL of Attophos substrate (diluted to a 1:1 ratio with Attophos buffer). After sealing the plate with a PCR film, wrap it in aluminum foil and incubate at room temperature (RT) for 40 minutes. Then, use Synergy H1 (Biotek) to determine the fluorescence intensity. Use excitation at 444 nm and emission at 555 nm. Perform continuous readings at 1-second intervals per well at 60 minutes, 70 minutes, 80 minutes, and 90 minutes.
[0196] TIFF2025522282000010.tif75170
[0197] TIFF2025522282000011.tif56170
[0198] Results and Figure 11 The presence of both compounds was observed in the muscles (gastrocnemius and quadriceps femoris) as well as the liver and kidneys 14 days after administration. In all tissues, the control group was below the limit of quantification. On the other hand, compound MD23b-2 V2 3’Ol is the only compound that can reach the brain. Regarding tissue delivery, the MD23b-2 V2 3’Ol compound is superior to MD23b-2 V2 as it can be efficiently reached by all tissues including the gastrocnemius, quadriceps femoris, liver, kidneys, and brain. Larger amounts of MD23b-2 V2 3’Ol were detected in all tissues, but its delivery to the gastrocnemius and quadriceps femoris was 9.5-fold and 8.8-fold higher respectively compared to MD23b-2 V2. In contrast, the delivery to the kidneys and liver was only 4-fold and 4.5-fold respectively, indicating that the delivery to muscles is enhanced compared to tissues with low relevance in the disease. MD23b-2 V2 3’Ol can reach the brain, while MD23b-2 V2 cannot, and conjugation with oleic acid is shown to be advantageous for reaching this tissue. From the above, it is concluded that oleic acid improves the delivery of the inventors' compounds, especially to tissues such as muscles and the brain involved in the pathology.
[0199] Example 10: Determination of MD23b-2 V2 3’OL and MBNL1 Protein Levels in the Brain of Non-Human Primates The aim of this study was to determine the brain exposure of animals treated with MD23b-2 V2 3’OL using enzyme-linked immunosorbent assay (ELISA). Furthermore, the target engagement in the brains of treated animals was measured by quantifying the Muscleblind-like 1 (MBNL1) protein levels from the brains of non-human primates.
[0200] 1. Experimental Design 1.1 Experimental Groups and Administration For these purposes, a total of eight cynomolgus monkeys (four males and four females) aged approximately 24 to 50 months were divided into three experimental groups and further assigned to a first phase (maximum tolerated dose (MTD) group assignment) and a second phase (fixed dose (FD) group assignment). During the first phase (maximum tolerated dose (MTD) phase), one male and one female Asian cynomolgus monkey were assigned to group 1, and single doses of MD23b-2 V2 3’Ol were intravenously administered at 5 mg / kg, 10 mg / kg, 15 mg / kg, and 20 mg / kg at a dose volume of 5 mL / kg under non-fasting conditions on days 1, 15, 29, and 43 of the MTD phase in a gradually increasing dose design (slow bolus (10 minutes)).
[0201] After completion of the MTD phase, three male and three female Asian cynomolgus monkeys were assigned to groups 2 and 3 of the second phase (fixed dose phase), and a vehicle (phosphate buffered saline (PBS, pH: 7.4)) or 20 mg / kg of MD23b-2 V2 3’Ol was intravenously administered at a dose volume of 5 mL / kg under non-fasting conditions on days 1 and 22 of the second phase (slow bolus (10 minutes)).
[0202] Samples from the brain were collected during the necropsy procedure on the sacrifice day.
[0203] Group assignment and dose levels
[0204] TIFF2025522282000012.tif45170
[0205] TIFF2025522282000013.tif34170
[0206] 2. Experimental data 2.1 Experimental procedure 2.1.1 Sample collection Two weeks after the last administration to the animals from the first phase and three weeks after the end of the treatment period of the animals from the second phase, the brains of all animals in groups 1 to 3 were collected for ELISA quantification, MBNL1 investigation, and determination of potential off-targets. Each piece was placed in a separate RNase-free Eppendorf tube, frozen in liquid nitrogen, and stored at (-80 ± 10°C). A total of eight brain samples were generated.
[0207] 2.1.2 ELISA Quantification 2.1.2.1 Sample Preparation 1) Excise the tissue and wash it with phosphate-buffered saline. 2) Dry the tissue on absorbent paper and weigh it (20 mg per tissue). 3) Add 100 μL of RIPA buffer with PhosSTOP EASYpack and Complete ULTRA Tablets, Mini, EASYpack (1 tablet per 10 mL of RIPA buffer) to 10 mg of tissue. 4) Homogenize the tissue in a 2 ml Eppendorf tube at 5000 RPM for 20 seconds, 4 times using a tissue lysing device, or until the tissue is completely homogenized. 5) Incubate the homogenate overnight at 55 °C. 6) Centrifuge the homogenate at 15000 rpm for 15 minutes, collect the supernatant, and store it at -20 °C in preparation for analysis.
[0208] For brain lysates, a 5-fold dilution of the actual homogenate (80 μL + 320 μL of oligonucleotide dilution buffer) was used.
[0209] 2.1.2.2 Stock Preparation for Standard Curve For the stock preparation of the standard curve, first, a 20 μM stock of MD23b-2 V2 3’Ol was prepared. This can be stored at -20 °C for a longer time. Several dilutions can be made from this 20 μM stock as needed. 1 μM is required for standard curve preparation. Therefore, the 20 μM stock was diluted with water to a final volume of 1 μM and stored in different aliquots. The standard curve was recreated for each experiment, and for this, the 1 μM stock needs to be heated at 65 °C for 15 minutes each time. On the other hand, after preparing the tissue homogenate, 55 μL of the homogenate was added to the compound dilution buffer of 5445 to make a control tissue homogenate.
[0210] 2.1.2.3 Standard Curve Creation For this purpose, a control tissue homogenate is required for the preparation of the standard dilutions. Then, to prepare the serial dilutions, first take 1 μM of the desired compound, denature it at 65 °C for 15 minutes, and vortex for at least 30 seconds. Then, take 16 μL of this denatured compound and dilute it with 984 μL of the control homogenate. This is the first point of the standard curve (16000 pM). Then, for the next point, take 500 μL of 16000 pM and dilute it with 500 μL of PMO dilution buffer (8000 pM). Prepare 4000 pM, 2000 pM, 1000 pM, and 500 pM in a similar manner.
[0211] TIFF2025522282000014.tif67170
[0212] 2.1.2.4 QC Three QC levels (L, M, H) in triplicate for each run. Acceptance criteria: More than 67% of the QCs should be within ±20% of the nominal (theoretical) value, and more than 50% of the QCs for each level should be within ±20% of the nominal concentration.
[0213] 2.1.2.5 ELISA protocol The probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-digoxigenin NHS ester (stock is 100 μM in water, and this stock is prepared to 1 μM in water) needs to be heated at 65 °C for 15 minutes and vortexed for 30 seconds. Prepare sample homogenates and serial dilutions of oligonucleotides before starting the experiment. Dilute the probe (1 μM) to a concentration of 0.5 nM with hybridization buffer. Add 70 μL of each dilution of the desired compound in triplicate, or in duplicate for sample homogenates. Then, add 70 μL of the probe at a concentration of 0.5 nM. Seal the plate with a PCR film and incubate at 37 °C for 30 minutes (an important step for hybridization of the probe and the compound!). This step can be carried out using a normal transparent 96-well plate up to this point. Then, immediately transfer 100 μL of the hybridization solution to a black NeutrAvidin-coated plate. Then, seal the plate again with a PCR film and incubate at 37 °C for 30 minutes (an important step for binding biotin to the avidin-coated plate!). During the incubation step, prepare Micrococcus nuclease with Micrococcus nuclease dilution buffer (1.6 μL of nuclease + 16 ml of buffer). This calculation is performed for the entire plate. First, remove the liquid, wash the plate 6 times with 100 μL of wash buffer, then invert the plate and dry the plate using absorbent paper, and add 150 μL of Micrococcus nuclease per well (final amount 30 U / well). After adding Micrococcus nuclease, seal the plate with a PCR film and incubate the plate at 37 °C for 1 hour (this step is sufficient to cleave at least 99% of the single-stranded probe). Prepare TBS buffer containing 0.25% Tween 20 and the antibody, vortex well, and place at RT. The remaining amount that is not needed can be aliquoted and stored in the freezer. First, remove the liquid, then wash the plate 6 times with 100 μL of wash buffer, dry the plate, and add 150 μL of anti-digoxigenin antibody (conjugated to alkaline phosphatase) diluted 5000-fold with TBS buffer (containing 0.25% (v / v) Tween 20). Seal the plate with a PCR film and incubate at 37 °C for 30 minutes. To prepare the Attophos substrate, dilute 36 mg of the powder (in a bottle) by adding 60 ml of Attophos buffer, protect from light, and store in the fridge (preferably wrapped in aluminum foil). Remove the liquid, wash the plate 6 times with 100 μL of wash buffer, dry the plate, and add 150 μl of Attophos substrate (diluted 1:1 with Attophos buffer). After sealing the plate with a PCR film, wrap it in aluminum foil and incubate at room temperature (RT) for 40 minutes. Then, use Synergy H1 (Biotek) to determine the fluorescence intensity. Use an excitation of 444 nm and an emission of 555 nm. Perform continuous readings at 1-second intervals per well at 40, 50, 60, 70, 80, and 90 minutes.
[0214] 2.1.2.6 Passing Criteria for ELISA Assays The accuracy of an analytical method represents the closeness of the average test results obtained by the method to the true value (concentration) of the analysis. Accuracy is estimated by the relative error (RE%) of the measurement. The true values of the reference controls for both ELISA assays did not correspond to the theoretical concentrations based solely on calculation. Therefore, the nominal concentration of the control is calculated as the average of all references pooled for each concentration level from all analytical batches. RE(%) = (average calculated concentration - theoretical concentration) / theoretical concentration × 100
[0215] The precision of an analytical method represents the closeness of the individual measured values of the analyte when the procedure is repeatedly applied to multiple aliquots of a single homogeneous volume of biological matrix. Precision is estimated by the coefficient of variation (CV%). CV(%) = standard deviation / average × 100
[0216] TIFF2025522282000015.tif74170
[0217] 2.1.3 Determination of MBNL 2.1.3.1 Protein Extraction NHP brain samples were mechanically disrupted using TissueLyser II (QIAGEN) and homogenized in RIPA buffer (Thermo Scientific, catalog number 89900) supplemented with protease inhibitor and phosphatase inhibitor (Roche, catalog numbers 11873580001 and 4906845001). Total protein was quantified using the Pierce™ BCA Protein Assay Kit (catalog number 23225) with bovine serum albumin as the standard.
[0218] 2.1.3.2 Western blot: For immunodetection of MBNL1 and GAPDH (internal control for normalization) proteins, 15 μg of total protein from each animal sample was denatured by heat treatment at 100 °C for 5 minutes, separated by electrophoresis on a 12% SDS-PAGE gel, and subsequently transferred onto a 0.45 μm nitrocellulose membrane (GE Healthcare).
[0219] The membrane was blocked with 5% skim milk in PBS-T (8 mM Na2HPO4, 150 mM NaCl, 2 mM KH2PO4, 3 mM KCl, 1% Tween 20, pH 7.4) for 1 hour. After blocking, the membrane was incubated overnight at 4 °C with the primary anti-MBNL1 mouse antibody (1:200, MB1a(4A8)(DSHB, Iowa City, IA)). Following incubation with the primary antibody, incubation with the horseradish peroxidase-conjugated anti-mouse secondary antibody (1:3500, (HRP)-conjugated anti-mouse IgG secondary antibody, Sigma-Aldrich, St. Louis, MO) was performed at room temperature for 1 hour. Finally, visualization was performed using an enhanced chemiluminescence substrate (ECL, Pierce), and images were acquired using an ImageQuant 800 Amersham instrument (GE Healthcare).
[0220] After detecting the immunoreactive band corresponding to MBNL1, the membrane was stripped to remove the antibodies used so far, and the band corresponding to the GAPDH protein used as a normalization substance was detected. This detection was performed using an anti-GAPDH antibody (1:3500, clone G-9, Santa Cruz) conjugated to HRP after blocking (performed as described above). For the HRP-conjugated anti-GAPDH antibody, the incubation time took 1 hour and was performed at room temperature. The analysis was performed in duplicate.
[0221] 2.1.3.3 Quantification: All images were quantified using the analysis software ImageJ. The results for the amount of MBNL1 protein were first normalized to GAPDH in all samples, and this ratio was normalized to the average ratio of non-treated animals (relative protein level).
[0222] 3. Results 3.1 Determination of MD23b-2 V2 3’OL from NHP brain
[0223] TIFF2025522282000016.tif41170
[0224] For the determination of MD23b-2 V2 3’OL by ELISA, 8 samples from 8 animals were analyzed on 1 plate in one analytical run. All samples were measured in triplicate. The analytical run met the acceptance criteria.
[0225] All treated animals from Phase I and Phase II showed some level of the test item during the analysis. Animals from the control group did not have quantifiable levels of MD23b-2 V2 3’OL in the brain.
[0226] All animals treated at a fixed dose of 20 mg / kg showed levels of the test item in all brains tested. For the animals from the MTD, the male (P0001) showed levels above the limit of quantification.
[0227] 3.2 MBNL1 relative levels
[0228] TIFF2025522282000017.tif43170
[0229] The MBNL1 protein level from Group 1 was quantified in samples collected 2 weeks after the last administration. The results showed higher MBNL1 protein levels in the tested brains compared to samples from non-treated animals (Table 18, Figure 12). The protein levels in the brain were 2-fold higher than those in the control group. The test item produced a pharmacological effect in the brain, resulting in an increase in MBNL protein compared to non-treated animals, and the increase was still observed 2 and 3 weeks after administration. The results were the same in males and females.
[0230] 4. Discussion and Conclusions The results of quantification by ELISA showed that the treated groups (Group 1 and Group 3) had quantifiable levels of MD23b-2 V2 3’OL in the brain 2 and 3 weeks after the last intravenous administration of MD23b-2 V2 3’OL. In addition, the treated animals had higher MBNL1 protein levels in the brain 2 and 3 weeks after the last administration compared to non-treated animals. These results demonstrated evidence of the presence and activity of the test item in the brains of animals treated with MD23b-2 V2 3’OL.
Claims
1. An oleic acid molecule conjugated to the 3' and / or 5' ends of an oligonucleotide molecule or analogue used in therapeutic treatment methods, wherein the oleic acid molecule is a pharmaceutically acceptable vehicle or carrier, the oligonucleotide molecule or analogue is an active ingredient, and the oligonucleotide molecule or analogue contains a mixture of phosphorothioate linkages and phosphodiester linkages that chemically link nucleotides, with the number of phosphorothioate linkages being greater than the number of phosphodiester linkages.
2. The oleic acid for use according to claim 1, wherein the ratio of phosphorothioate linkage to phosphodiester linkage is 1.2:1 to 2.7:
1.
3. Oleic acid for use according to claim 1 or 2, used in a treatment method by therapy including the prevention or treatment of muscle diseases, neurological diseases and / or RNA disorders, wherein the RNA disorder is a neuromuscular disease or a neurodegenerative disease.
4. The oleic acid for use according to claim 1 or 2, wherein the oligonucleotide molecule or analog thereof is a microRNA antagonist.
5. The oleic acid for use according to claim 4, wherein the microRNA is human hsa-miR-23b-3p or human hsa-miR-218-5p.
6. The oleic acid for use according to claim 1 or 2, wherein when the oligonucleotide molecule or analogue is administered via an intravenous, intraarterial, or subcutaneous route, the oleic acid used as a vehicle delivers the oligonucleotide molecule or analogue to muscle cells and / or CNS cells in a subject requiring it.
7. Oleic acid for use according to claim 1 or 2, used in a treatment method including the prevention or treatment of myotonic dystrophy.
8. The oleic acid for use according to claim 7, wherein the myotonic dystrophy is type 1.
9. An oligonucleotide molecule or a mixture of two or more such molecules, conjugated to at least one oleic acid molecule at its 3' and / or 5' end, wherein the oligonucleotide molecule is an antagonist of human hsa-miR-23b-3p or human hsa-miR-218-5p, has a length of 10 to 30 nucleotides, and comprises a fragment consisting of at least 15 consecutive nitrogen bases of nucleotides that are at least 80% identical to the sequence of the region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or SEQ ID NOs: 52 to 110, and comprises a mixture of phosphorothioate linkages and phosphodiester linkages that chemically link nucleotides, wherein the number of phosphorothioate linkages is greater than the number of phosphodiester linkages.
10. The oligonucleotide molecule according to claim 9, wherein the ratio of phosphorothioate linkage to phosphodiester linkage is 1.2:1 to 2.7:
1.
11. The oligonucleotide molecule according to claim 9 or 10, wherein the oligonucleotide molecule comprises a fragment composed of a series of at least 15 consecutive nitrogen bases of the same nucleotide sequence as the region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p).
12. The oligonucleotide molecule according to claim 9 or 10, wherein the oligonucleotide molecule is at least 80% identical to SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO:
25.
13. The oligonucleotide molecule according to claim 9 or 10, wherein the oligonucleotide molecule is at least 80% identical to SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 25, and the oligonucleotide molecule is capable of increasing the endogenous levels of MBNL1 protein and / or MBNL2 protein.
14. The oligonucleotide molecule according to claim 9 or 10, wherein the nucleotide sequence of the oligonucleotide consists only of SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO:
7.
15. A composition comprising at least one oligonucleotide molecule according to claim 9 or 10 or a mixture of two or more thereof, and optionally further comprising a carrier and / or one or more pharmaceutically acceptable additives.
16. The composition according to claim 15, used for therapeutic purposes.
17. The composition according to claim 15, which, when administered via an intravenous, intra-arterial, or subcutaneous route, is used to target muscle cells and / or CNS cells in a subject requiring such administration.
18. The composition according to claim 15, used for the prevention or treatment of muscle diseases, neurological diseases and / or RNA disorders.
19. The composition for use according to claim 18, wherein the disease is myotonic dystrophy.
20. The composition for use according to claim 19, wherein the myotonic dystrophy is type 1.