Modified self-replicating mRNA

Abstract

The present invention belongs to the field of nucleotide mRNA, and specifically relates to a modified self-replicating mRNA. The polynucleotide fragment includes one or more of a non-structural replication enzyme domain derived from an alpha virus and an integrated target fragment, the polynucleotide fragment includes a functional nucleotide analog, and the functional nucleotide analog includes at least one of pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine, and N6-methyladenosine.

Description

Technical Field

[0001] Declaration of Priority This application claims the priority and benefits of CN2022108058522, filed on July 8, 2022, the full text of which is incorporated herein by reference.

[0002] Technical Field The present invention belongs to the field of nucleotide mRNA, and specifically relates to modified self-replicating mRNA.

Background Art

[0003] Conventional inactivated vaccines and recombinant protein vaccines have a long manufacturing cycle and a complex process, so they cannot meet the large-scale vaccination needs for sudden large-scale epidemics. mRNA is a rapid response vaccine development platform for explosive diseases.

[0004] In 2020, the modified nucleotide mRNA (messenger ribonucleic acid) vaccines developed by Moderna and BioNTech were respectively launched and sold for mRNA-1273 and Tozinameran during the COVID-19 pandemic, and were used for the preventive vaccination of COVID-19, demonstrating the safety and effectiveness of mRNA vaccines.

[0005] mRNA vaccines are synthesized by an in vitro enzymatic transcription reaction using linearized plasmid DNA as a template, so problems such as the production method of living cell culture, the safety that needs to be considered, and the complex manufacturing process can be avoided. The mRNA vaccine platform is safe and effective, has a short production cycle and a simple process, and is particularly suitable for dealing with explosive diseases.

[0006] Self-replicating mRNA vaccines exhibit strong immunogenicity in animal experiments. Since they can replicate their own sequences using themselves as templates, they require a smaller inoculation dose compared to conventional mRNA vaccines. The adjuvant effect induced by the immune response during self-replication can induce a stronger immune response and further enhance the humoral and cellular immune responses. However, further research is needed on self-replicating mRNA modified with nucleotides.

Summary of the Invention

[0007] The first objective of the present invention is to provide a modified self-replicating mRNA containing one or more polynucleotide fragments comprising functional nucleotide analogs and a non-structural replication enzyme domain derived from an alphavirus and an integrated target fragment. The functional nucleotide analogs include at least one of pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine, and N6-methyladenosine.

[0008] The second objective of the present invention is to provide a vaccine composition containing the above-mentioned modified self-replicating mRNA.

[0009] The third objective of the present invention is to provide a set reagent kit containing the above-mentioned vaccine composition and optionally a container for inoculating the vaccine composition.

[0010] The fourth objective of the present invention is to provide a method for modifying the following characteristics of mRNA after inoculation into an animal body: a) enhancing the immunogenicity of the mRNA; and / or b) enhancing the ability of the mRNA to evade immune surveillance; The method includes the step of substituting the corresponding unmodified form of nucleoside in the mRNA with a functional nucleotide analog.

[0011] This study has shown that modified self-replicating mRNA has a better expression effect than unmodified self-replicating mRNA, can avoid immune surveillance in cell experiments, can induce weak IFN-B1 and / or RIG-1 transcription, and thus can maintain long-term expression and induce an immune response.

Brief Description of the Drawings

[0012] Brief Description of the Accompanying Drawings To more clearly illustrate the technical solutions in specific embodiments of the present invention or the prior art, the drawings necessary for use in the description of specific embodiments or the prior art will be briefly described below. Obviously, the drawings in the following description are some embodiments of the present invention, and those skilled in the art can also obtain other drawings based on these drawings without creative effort.

[0013]

Figure 1

Figure 2

Figure 3-1

Figure 3-2

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Modes for Carrying Out the Invention

[0014] Specific Embodiments Next, references to embodiments of the present invention are provided in detail, and one or more examples thereof are described below. Each example is provided for illustrative purposes and is not intended to limit the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the present invention. For example, features described or depicted as part of one embodiment may be used in another embodiment to yield further embodiments.

[0015] Unless otherwise specified, the meanings of all terms (including technical and scientific terms) used to disclose the present invention are the same as those generally understood by those skilled in the art to which the present invention pertains. Further guidance is provided by subsequent definitions for better understanding of the teachings of the present invention. The terms used in the description of the present invention herein are for the purpose of describing specific embodiments only and are not intended to limit the present invention.

[0016] As used herein, the term "and / or" (including "or / and", "and / or") means that the selection scope includes any one of two or more related list items, and also includes any and all combinations of the related list items, and the said any and all combinations include combinations of any two related list items, any more related list items, or all related list items. It should be understood that when connecting at least three items with at least two combinations of conjunctions selected from "and / or", "or / and", "and / or", in this application, the technical solutions definitely include technical solutions connected by "logical product", and further definitely include technical solutions connected by "logical sum". For example, "A and / or B" includes three parallel cases: A, B, and A + B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, D (that is, technical solutions connected by "logical sum"), and also includes any and all combinations of A, B, C, D, that is, combinations of any two or any three of A, B, C, D, and further includes the combination of the four of A, B, C, D (that is, technical solutions connected by "logical product").

[0017] The terms "comprising", "including" and "containing" used in the present invention are synonyms, and they are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0018] In the present invention, a value range represented by endpoints includes all values, fractions, and the recited endpoints included within the said range.

[0019] The present invention relates to a concentration value whose meaning includes fluctuations within a certain range. For example, it may fluctuate within the corresponding accuracy range. For example, in the case of 2%, fluctuations within the range of ±0.1% may be allowed. For large values or values that do not need to be controlled very precisely, meanings including larger fluctuations are also allowed. For example, in the case of 100 mM, fluctuations within the ranges of ±1%, ±2%, ±5%, etc. may be allowed. In the case of molecular weight, a meaning including fluctuations of ±10% is allowed.

[0020] In the present invention, descriptions such as "a plurality" and "a plurality of types" refer to a number of 2 or more when not particularly limited.

[0021] In the present invention, the technically described features disclosed include closed technical solution means consisting of the listed features, and also include open technical solution means including the listed features.

[0022] In the present invention, it should be understood that "preferred", "better", "more preferred", and "desirable" are only used to describe embodiments or examples with better effects, and they do not limit the protection scope of the present invention. In the present invention, "optionally", "optional", and "optional selection" mean that it may or may not be present, that is, any one selected from two types of parallel cases of "having" or "not having". When a plurality of "optional selections" appear in the technical solution means, without special explanation and without contradiction or mutual restraint, each "optional selection" is independent.

[0023] As used herein, the term "functional nucleotide analog" refers to a modified form of the classical nucleotides A, G, C, U, or T, and the form (a) retains the base pairing characteristics of the corresponding classical nucleotide, and (b) includes at least one chemical modification of (i) the nucleobase, (ii) the glycosyl, (iii) the phosphate ester group, or (iv) any combination of (i) to (iii) of the corresponding natural nucleotide.

[0024] As used herein, base pairing includes not only classical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between classical nucleotides and functional nucleotide analogs or between a pair of functional nucleotide analogs, where the configuration of the hydrogen bond donor and hydrogen bond acceptor allows the formation of hydrogen bonds between a modified nucleobase and a classical nucleobase or between two complementary modified nucleobase structures. For example, a functional analog of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analog of cytosine. Examples of such non-classical base pairing include base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil.

[0025] As described herein, functional nucleotide analogs may be naturally occurring or non-naturally occurring. Thus, nucleic acid molecules containing functional nucleotide analogs can have at least one modified nucleobase, glycosyl, and / or internucleoside linkage. This specification provides exemplary chemical modifications to the nucleobases, glycosyls, or internucleoside linkages of nucleic acid molecules.

[0026] Examples of functional nucleotide analogs include 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, dihydrouridine, 2'-O-methylpseudouridine, β,D-galactosyl-Q nucleoside, 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylinosine, 2′2-dimethyladenosine, 2-methyladenosine, 2-methylguanosine, 5-methyluridine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2-thiouridine, β,D-mannosyl-Q nucleoside, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-thiomethyl-N6-isopentenyladenosine, N-((9-β-D-ribofuranosyl-2-thiomethylpurin-6-Yl)carbamoyl)threonine, N-((9-β-D-ribofuranosylpurin-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetic acid-methyl ester, uridine-5-oxyacetic acid, wybutoxosine, pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine, Q nucleoside, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-thiouridine, N-((9-β-D-ribofuranosyl-6-yl)-carbamoyl)threonine, 2'-O-methyladenosine-5-methyluridine, 2'-O-methyladenosine, 2'-O-methylcytidine, Wybutosine, 3-(3-amino-3-carboxyl-propyl)uridine, N6-acetyladenosine, and 2-methylthio-N6-methyladenosine, including one, two, or more thereof. Preferred functional nucleotide analogs include at least one, two, or three of pseudouridine, N1-methylpseudouridine, and 5-hydroxymethoxycytidine.

[0027] The present invention relates to mRNA containing a functional nucleotide analog.

[0028] In some embodiments, the mRNA includes self-replicating mRNA.

[0029] In some embodiments, the mRNA includes one or more polynucleotide fragments of non-structural replication enzyme domains derived from alphavirus.

[0030] In some embodiments, the mRNA includes an integrated target polynucleotide fragment. The present invention relates to a modified self-replicating mRNA, the polynucleotide fragment of which includes one or more non-structural replication enzyme domains derived from alphavirus and one or more integrated target fragments, and the polynucleotide fragment includes functional nucleotide analogs.

[0031] In some embodiments, the content of any one type of the functional nucleotide analogs in the mRNA / self-replicating mRNA is 0.01% - 100%, and 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% can also be selected.

[0032] In some embodiments, the total content of all types of the functional nucleotide analogs in the mRNA / self-replicating mRNA is 0.01% - 100%, and 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90% can also be selected.

[0033] The functional nucleotide analog may be located at any position of the mRNA. For example, it may be located in the non-structural replication enzyme domain of the α virus, or in the integrated target polynucleotide fragment, or may be located in both of them simultaneously. In some embodiments, 0% to 100% of the functional nucleotide analog, at least 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, etc., is located in the non-structural replication enzyme domain of the α virus. In some embodiments, 0% to 100% of the functional nucleotide analog, at least 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, etc., is located in the target fragment.

[0034] In the present invention, the "unmodified form" refers to the nucleotide before modification of the functional nucleotide analog, and it is easily understood that they generally have the same base. For example, the unmodified form of pseudouridine and N1-methylpseudouridine may be uridine, and the unmodified form of 5-hydroxymethoxycytidine may be cytidine.

[0035] In some embodiments, the functional nucleotide analog includes at least one of pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine, and N6-methyladenosine.

[0036] In some embodiments, the functional nucleotide analog includes at least one of pseudouridine, N1-methylpseudouridine, and 5-hydroxymethoxycytidine.

[0037] In some embodiments, the unmodified uridine of the polynucleotide fragment is modified to pseudouridine at a ratio of 1% to 100%, or 1% to 50%, or 10% to 50%, or 20% to 40%, or 25% to 35%. The ratio of modification can also be selected from 5%, 10%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%.

[0038] In some embodiments, the unmodified uridine of the polynucleotide fragment is modified to N1-methylpseudouridine at a ratio of 1% to 100%, or 1% to 60%, or 10% to 60%, or 10% to 20%. The ratio of modification can also be selected from 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%.

[0039] In some embodiments, the unmodified cytidine of the polynucleotide fragment is modified to 5-hydroxymethoxycytidine at a ratio of 1% to 100%, or 80% to 100%, or 90% to 100%. The ratio of modification can also be selected from 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%.

[0040] In some embodiments, the unmodified adenosine of the polynucleotide fragment is modified to N6-methyladenosine (m6A) at a ratio of 1% to 100%, or 1% to 30%, or 1% to 10%, or 1% to 5%. The ratio of modification can also be selected from 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%.

[0041] In some embodiments, the target fragment comprises at least one mRNA encoding an antigen or a fragment or epitope thereof. Preferably, the antigen is a pathogenic antigen. More preferably, the antigen is a viral antigen, a bacterial antigen, a parasitic antigen, a fungal antigen, a protozoan antigen, a prion antigen, or a tumor antigen.

[0042] Optionally, the virus includes one or more of the families Adenoviridae, Arenaviridae, Astroviridae, Bunyaviridae, Caliciviridae, Flaviviridae, Hepeviridae, Mononegavirales, Nidovirales, Picornaviridae, Orthocoronavirinae, Orthomyxoviridae, Papillomaviridae, Parvoviridae, Polyomaviridae, Poxviridae, Reoviridae, Retroviridae, and Togaviridae.

[0043] Optionally, the bacterium includes one or more of the genera Staphylococcus, Streptococcus, Listeria, Erysipelothrix, Neofiber, Bacillus, Clostridium, Mycobacterium, Actinomyces, Nocardia, Corynebacterium, Rhodococcus, and / or one or more of Bacillus anthracis, Erysipelothrix rhusiopathiae, Clostridium tetani, Listeria monocytogenes, Klebsiella pneumoniae, Mycobacterium tuberculosis, Escherichia coli, Proteus spp., Shigella spp., Streptococcus pneumoniae, Brucella spp., Clostridium welchii, Haemophilus influenzae, Haemophilus parainfluenzae, Moraxella catarrhalis, Acinetobacter spp., Yersinia enterocolitica, Legionella pneumophila, Bordetella pertussis, Bordetella parapertussis, Salmonella spp., Pasteurella spp., Vibrio cholerae, and Vibrio parahaemolyticus.

[0044] Optionally, the fungus includes one or more of Coccidioides immitis, Coccidioides coccidioides, Histoplasma capsulatum, Histoplasma donovani, Blastomyces robo, Paracoccidioides brasiliensis, Blastomyces dermatitidis, Sporothrix schenckii, Penicillium marneffei, Candida albicans, Candida glabrata, Candida tropicalis, Candida portugal, Aspergillus, Exophiala jeanselmei, Dematiaceous mold Paraley, Dematiaceous mold Compact, Dematiaceous wart mold, Dematiaceous dermatitis mold, Geotrichum candidum, Podopodium body, Cryptococcus neoformans, Hyphospora yeast, Rhizopus oryzae, Mucor indicus, Acanthella umbellifera, Comosporium racemosa, Fulgosporium fecalis, Otospora coronaris, Otospora heterospora, Cyberi, Hialomyces hyalin, and Hyphomycete fujifera.

[0045] Optionally, the parasite includes one or more of gastrointestinal parasites, intrahepatic parasites, intrapulmonary parasites, intracerebral tissue parasites, intravascular parasites, intralymphatic parasites, intramuscular tissue parasites, intracellular parasites, bone tissue parasites, and intraocular parasites.

[0046] Optionally, the tumor includes a tumor that occurred as a lesion in any one of bone, bone joint, muscle, lung, trachea, heart, spleen, artery, vein, blood, capillary, lymph node, lymphatic vessel, lymph fluid, oral cavity, pharynx, esophagus, stomach, duodenum, small intestine, colon, rectum, anus, appendix, liver, gallbladder, pancreas, parotid gland, sublingual gland, urinary organs and kidneys, ureter, bladder, urethra, ovary, fallopian tube, uterus, vagina, vulva, scrotum, testis, vas deferens, penis, eye, ear, nose, tongue, skin, brain, brainstem, medulla oblongata, spinal cord, cerebrospinal fluid, nerve, thyroid gland, parathyroid gland, adrenal gland, pituitary gland, pineal gland, pancreatic islets, thymus gland, gonads, sublingual gland, and parotid gland.

[0047] In some embodiments, the target fragment is mRNA derived from SARS-CoV-2, preferably spike protein mRNA or a fragment thereof, and more preferably includes the RBD gene or a fragment thereof.

[0048] In some embodiments, the alpha virus is selected from at least one of Venezuelan Equine Encephalitis Virus (TC83 VEEV), Sindbis virus, Chikungunya virus, Eastern equine encephalitis virus, Western equine encephalitis virus, Mayaro virus, Semliki forest virus, and Venezuelan equine encephalitis virus. Preferably, the virus of the alpha virus family is Venezuelan Equine Encephalitis Virus (TC83 VEEV). However, it should be understood that the viruses of the alpha virus family listed herein are merely exemplary and are not limited thereto.

[0049] In some embodiments, the nucleotide sequence of the unmodified form of the modified self-replicating mRNA is as shown in SEQ ID NO: 3.

[0050] The present invention further relates to a vaccine composition comprising the modified self-replicating mRNA as described above.

[0051] In some embodiments, the vaccine composition further comprises at least one of a pharmaceutically acceptable vector, diluent, and excipient.

[0052] The term "pharmaceutically acceptable" means that when a molecular entity, molecular fragment, or composition is appropriately administered to an animal or human, they do not produce adverse, allergic, or other side effects.

[0053] Specific examples of some substances that can be used as pharmaceutically acceptable vectors or components thereof include phosphoric acid, citric acid, and other organic acids; antioxidants (e.g., ascorbic acid and methionine); antibacterial agents (e.g., octadecyldimethylphenylammonium chloride, hexamethonium chloride, benzalkonium chloride, phenol, butanol or benzyl alcohol, alkyl paraben, catechol, resorcinol, cyclohexanol, 3-amyl alcohol, or m-cresol); low molecular weight (less than about 10 kDa) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids (e.g., glycine, glutamine, asparagine, histidine, arginine, or lysine); monosaccharides, disaccharides and other carbohydrates (e.g., including glucose, mannose, or dextran); chelating agents (e.g., EDTA); sugars (e.g., sucrose, mannitol, trehalose, or sorbitol); salt-forming counterions, metal complexes; and / or nonionic surfactants (e.g., including TWEEN™, PLURONICS™, or polyethylene glycol).

[0054] Furthermore, those skilled in the art can appropriately select commonly used fillers, diluents, binders, humectants, disintegrants, and / or surfactants according to the formulation method. The vaccine composition may be in solid, semi-solid or liquid form, preferably in liquid form.

[0055] In some embodiments, the vaccine composition further comprises a nucleic acid stabilizer.

[0056] Examples of agents used to stabilize and maintain the stabilization of nucleic acids include cationic compounds, detergents, chaotropic salts, ribonuclease inhibitors, chelating agents, etc. and mixtures thereof.

[0057] Examples of stabilizers include crosslinking and fixing agents such as paraformaldehyde and precipitants such as ethanol. The stabilizer can act by forming covalent bonds between cell molecules, or by precipitating some intracellular molecules, or by other methods.

[0058] In some embodiments, the stabilizer comprises a cell lysis buffer. Cell permeabilization buffers are also known in the art and may include detergents that permeabilize the cell membrane to allow probes and dyes to pass through the membrane. Examples of detergents used in cell lysis buffers include, but are not limited to, Tweeru Triton X-100, saponin, NP-40, etc.

[0059] For a given end use, the concentrations of the cell lysing agent and the permeabilizing agent are adjusted. If their concentrations are too low, cell lysis and permeabilization may not be optimal. If their concentrations are too high, unwanted cell destruction may occur. Conventional steps based on experience can be performed to determine the preferred route in each case.

[0060] In some embodiments, the stabilizer comprises chloroform, phenol, TRIZOL. However, in more preferred embodiments, the stabilizer is a component that is easily removable or has low toxicity to cells, and most preferably is a pharmaceutically acceptable component.

[0061] The vaccine provided by the present invention preferably further comprises an adjuvant. Adjuvants applicable to the vaccines of the present invention include self-replicating mRNAs, particularly adjuvants that can enhance the immunogenicity against target fragments therein.

[0062] For example, an adjuvant for an antibody response against a B cell epitope of an antigen, and an adjuvant that can enhance a cell-mediated response against a T cell epitope of the antigen, etc. These adjuvants are well known in the art.

[0063] In some embodiments, the adjuvant is selected from one or more of alum, complete Freund's adjuvant, incomplete Freund's adjuvant, squalene, squalane, muramyl dipeptide, MF59, AS03, monophosphoryl lipid A, flagellar protein, CpG-ODN, Poly(I:C), and small molecules of aluminum or calcium salts. All of these adjuvants are well known in the art and are available from several commercial sources.

[0064] Here, complete Freund's adjuvant, incomplete Freund's adjuvant, squalane, and alum are generally not used in humans.

[0065] In some embodiments, the vaccine is a water-in-oil emulsion having an aqueous phase and an oil phase.

[0066] In some embodiments, the vaccine is an oil-in-water emulsion having an aqueous phase and an oil phase.

[0067] Vaccines are typically formulated for parenteral administration. Typical immunizations are achieved by oral injection, subcutaneous injection (SC), intranasal injection, intramuscular injection (IM), intravenous injection (IV), intraperitoneal injection (IP), or intradermal (ID) injection.

[0068] The above vaccines are administered in a dose such as a therapeutically effective amount or an immunogenic effective amount in a manner compatible with the dosage formulation. The dose depends on the subject being treated, the subject's ability of the immune system to synthesize antibodies, and the degree of protection expected. The exact amount of the active ingredient that needs to be administered depends on the judgment of the physician, and the dosage varies from individual to individual. Although the appropriate plan for the first dose and booster vaccination can also vary, typically, one injection is given at a certain interval (several weeks or months) after the first dose, or administered in other ways.

[0069] In some embodiments, the vaccine composition is encapsulated and delivered in the form of a plasmid, a viral vector, a liposome, a dendrimer, an inorganic nanoparticle, or a cell-penetrating peptide.

[0070] The mRNA molecule may be directly encapsulated or encapsulated as its precursor. The plasmid and viral vector may include a selection marker (e.g., an easily concentrated tag such as a histag or an easily detectable tag such as GFP), and an origin of replication compatible with the cell type specified by the cloning vector. The expression vector includes regulatory elements necessary to affect expression in the specified target cells. The viral vector may be a bacteriophage, a slow virus, a retrovirus, an adenovirus, or an adeno-associated virus.

[0071] The liposome may be a cationic liposome or a neutral liposome and can be prepared or modified by known methods. For example, by adding polyethylene glycol (PEG)-modified liposomes, aggregation of the liposome vector can be effectively prevented and its stability can be enhanced.

[0072] Dendrimers are a family of special polymers with a well-defined molecular structure, an accurately controllable chemical structure, and unique multivalency properties and are becoming non-viral vectors for gene delivery.

[0073] Typical dendrimers, such as poly(acylaminoamine) (PAMAM) dendritic polymers, can be further modified, for example, by modifying 2-amino-6-chloropurine, a nucleic acid base analog, on the PAMAM surface to construct the derivative AP-PAMAM, or by coupling chondroitin sulfate (CS) with PAMAM to prepare CS-PAMAM.

[0074] Inorganic nanoparticles can be selected such as gold nanoparticles (AuNPs), magnetic nanoparticles, mesoporous silica nanoparticles (MSNs), and the like.

[0075] Cell-penetrating peptides (CPPs) are small-molecule peptides with strong transmembrane transport ability and can transport multiple types of macromolecular substances such as polypeptides, proteins, and nucleic acids into cells. They can be cationic CPPs (such as TAT, Penetratin, Polyarginine, P22N, DPV3, and DPV6, etc.), amphiphilic CPPs (which may be covalently bonded by a hydrophobic peptide sequence and NLS, or isolated from natural proteins such as pVEC, ARF(1-22), and BPrPr(1-28)), and hydrophobic CPPs (generally containing only non-polar amino acid residues and having a net charge of less than about 20% of the total charge of the amino acid sequence).

[0076] Another embodiment of the present invention relates to a set reagent kit comprising the above vaccine and a container for inoculating the vaccine composition.

[0077] The inoculation container is preferably a medical syringe.

[0078] The present invention further relates to a method for modifying the following properties of mRNA after inoculation into an animal body: a) enhancing the immunogenicity of the mRNA; and / or b) enhancing the ability of the mRNA to avoid immune surveillance; The method includes the step of substituting the corresponding unmodified form of nucleoside in the mRNA with a functional nucleotide analog.

[0079] In some embodiments, the mRNA is self-replicating mRNA, and preferably, a modified self-replicating mRNA as described above is obtained after substitution.

[0080] In some embodiments, the animal is a chicken, duck, goose, cat, dog, cow, sheep, horse, donkey, pig, giant panda, monkey, rabbit, mouse, or human.

[0081] Hereinafter, embodiments of the present invention will be described in detail together with examples. It should be understood that these examples are used only for explaining the present invention and do not limit the scope of the present invention.

[0082] In the following examples, for experimental methods where specific conditions are not specified, the guidelines provided in the present invention may be preferentially referred to, or the experimental manuals or conventional conditions in the relevant technical field may be referred to, or other known experimental methods in the relevant technical field may be referred to, or the conditions proposed by the manufacturer may be referred to.

[0083] In the following specific examples, for the measurement parameters regarding raw material components, there may be slight deviations within the weighing accuracy range unless otherwise specified. For the parameters of temperature and time, acceptable deviations due to instrument test accuracy or operation accuracy are allowed.

Example

[0084] 1. Synthesis of RBD gene fragment Search for the spike protein (SARS-CoV-2) from NCBI, design the receptor-binding domain (RBD) gene, and then perform corresponding optimization based on human codons. The nucleotide sequence is as shown in SEQ ID NO:1. Then, an ApaI enzyme cleavage site and a promoter are added upstream, and a NotI enzyme cleavage site is added downstream. Finally, the DNA sequence is directly obtained by synthesis (obtained so that the company provides the cloned plasmid pUC57-RBD).

[0085] 2. Construction of TC83 self-replicating vector The self-replicating mRNA is designed based on the genome of Venezuelan equine encephalitis virus (TC83, VEEV) of the alphavirus family. It contains a gene that can encode the self-replicating component of the alphavirus, but lacks the structural proteins for encoding and producing infectious alphavirus particles. The designed sequence is directly obtained by synthesis, and the nucleotide sequence is as shown in SEQ ID NO:2.

[0086] 3. The preparation method of the recombinant plasmid JCXH-107 is as follows (the prepared recombinant plasmid JCXH-107 is as shown in Figure 1).

[0087] Perform double enzyme digestion on pUC57-RBD and the TC83 self-replicating vector with ApaI and NotI. The enzyme digestion system (20 μL) is 1 μg of pUC57-RBD or the TC83 self-replicating vector, 1 μL of ApaI, 1 μL of NotI, and 2 μL of 10× CutSmart buffer. Supplement ddH2O to make the system reach 20 μL. Digest the plasmid in a 25°C water bath for 1 hour, and then digest the plasmid in a 37°C water bath for 1 hour. The vector fragment needs to be dephosphorylated by adding 0.5 μL of CIP and incubating in a 37°C water bath for 30 minutes. Mix the enzyme digestion mixture with 6× sample loading buffer and perform electrophoresis (1% agarose, 94 V), and recover the fragments of the corresponding length (the length of the pUC57-RBD recovered fragment and the RBD gene fragment is 2574 bp, and the length of the recovered fragment of the TC83 self-replicating vector is about 9.5 Kb) from the gel and elute with 30 μL of elution buffer.

[0088] Collect the RBD gene fragment and the TC83 self-replicating vector fragment respectively. The vector is 50 ng, the molar ratio of the inserted fragment to the vector fragment is 5:1, the T4 ligase is 1 μL, the 10× ligase buffer is 5 μL, and supplement ddH2O to make the system reach 10 μL. Ligate at 22°C for 1 hour according to the ligation system.

[0089] Softly mix the ligation product with the recipient cells of Escherichia coli DH5α at a volume ratio of 1:10, incubate in an ice bath for 30 minutes, perform heat shock at 42°C for 45 s, incubate in an ice bath for 3 minutes, add 500 μL of LB medium without antibiotics, and after mixing, culture at 37°C and 180 rpm for 1 hour, then spread on an LK plate (LB-Kan plate: LB plate containing 50 μg / mL Kan) and culture at 37°C for 16 - 20 hours.

[0090] PCR Screening: Using the bacterial plasmid extracted by the boiling method as a template, amplify the spike protein of the target band. The upstream primer F is 5’-TATGGCCATGACTACTCTAGCTA-3’, the downstream primer R is 5’-GGGAAACGCCTGGTATCTTT-3’. The reaction cycle conditions are 94°C for 3 minutes → (94°C for 1 minute, 47°C for 30 s, 72°C for 3 minutes) × 30 cycles → 72°C for 10 minutes → 4°C. Perform electrophoresis (electrophoresis conditions: 1% agarose gel, 90V, sample loading volume: 5 μl PCR product), observe the PCR results, and the expected result is an RBD fragment of about 2977 bp.

[0091] Enzyme Cleavage Verification: Extract the plasmid from the positive bacteria verified by PCR screening, perform enzyme cleavage with ApaI and NotI according to the above enzyme cleavage system, mix the enzyme cleavage mixture with 6× sample loading buffer, and perform electrophoresis (1% agarose, 94V).

[0092] Sequencing Verification: Extract the plasmid that meets the expected values of PCR and enzyme cleavage, and send it to a sequencing company for sequencing. After sequencing verification, the Escherichia coli with the positive plasmid that completely meets the conditions was stored at -80°C.

[0093] 4. The JCXH-107 plasmid was linearized by enzyme cleavage with BspQI and recovered by the following method.

[0094] The JCXH-107 plasmid is 10 μg, BspQI is 1 μL, 10× NE buffer is 3.15 μL, ddH2O was supplemented to make the system 50 μL, and the plasmid was enzyme cleaved in a water bath at 50°C for 1 hour. The enzyme cleavage mixture was mixed with 6× sample loading buffer, electrophoresed (1% agarose, 94V), and the fragment of the corresponding length (for JCXH-107 plasmid, length about 12 Kb) was recovered from the gel and eluted with 30 μL of elution buffer.

[0095] 5. The linearized JCXH-107 plasmid uses an in vitro transcription reaction (IVT) with T7 RNA polymerase and the Turbo DNase enzyme to degrade the template DNA. The Vaccinia capping enzyme adds a 7-methylguanylate cap structure (referred to as Cap0) to the 5' end of the transcribed mRNA. The specific method is as follows.

[0096] The 10× reaction buffer is 2 μL, each NTP is 0.5 mM, and uridine (U) may be replaced with pseudouridine at ratios of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or uridine (U) may be replaced with N1-methylpseudouridine at ratios of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or cytidine (C) may be replaced with 5-hydroxymethoxycytidine at ratios of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%. Supplement water to make 20 μL with 1 μg of linearized JCXH-107 and 2 μL of T7 RNA Polymerase, react at 30 °C for 1 hour, then add 1 μL of TURBO TM DNase, 4 μL of 10× capping buffer, 2 μL of GTP (10 mM), 2 μL of SAM (2 mM), and 2 μL of Vaccinia capping enzyme, supplement water to make the total volume 40 μL, and react at 30 °C for 1 hour.

[0097] Then, supplement water to make 200 μL, add 120 μL of 7.5 M lithium chloride, mix well, let stand at -20 °C for 30 minutes, then centrifuge at 14000 g for 30 minutes at 4 °C, discard the supernatant, wash the precipitate with 70% alcohol, centrifuge at 14000 g for 5 minutes at 4 °C, discard the supernatant, air dry for 5 minutes, and dissolve in 40 μL of water.

[0098] After quantification with a spectrophotometer, 400 ng was taken, mixed with 10 μL of Northern Max-Gly Sample Loading Dye, incubated at 50 °C for 30 minutes, and then electrophoresed using Northern Max-Gly Gel Prep / Running buffer (1% agarose, 70 V).

[0099] The electrophoretic result image after in vitro transcription of self-replicating mRNA-RBD (denoted as SAM-CD5-RBD in the figure) is as shown in Figure 2, and the nucleotide sequence in the unmodified form is as shown in SEQ ID NO: 3.

[0100] 6. The expression of intracellular self-replicating mRNA-RBD was detected by Western blot. BHK cells purchased from the Shanghai Cell Center were subcultured. When the cell number was sufficient, trypsin was used to digest each well of a 6-well plate for cell culture, and the plate was cultured overnight in a 37 °C CO2 incubator.

[0101] The next day, liposome-encapsulated mRNA-RBD was transfected into the spread BHK cells. After culturing for 24 hours, the cells were lysed and protein samples were collected. The specific method is as follows.

[0102] 1) Cell culture and spreading on the plate: The revived BHK cells were inoculated into a 75 cm 2 culture flask, and the culture medium was DMEM high-glucose medium + 5% double antibody + 10% fetal bovine serum. After the cell density at the bottom of the flask reached 80% or more, the cells were digested with trypsin and counted. An appropriate number of cells were spread on a 6-well cell culture plate and cultured overnight in a 37 °C CO2 incubator.

[0103] 2) Transfection of Liposomal mRNA into BHK or Hela Cells: Aspirate and dry the medium in the expanded 6-well plate, wash it once with PBS buffer, mix 0.5 μg of liposome-encapsulated mRNA with 200 μL of Opti-MEM medium, add it to the washed 6-well plate, culture it in a 37°C CO2 incubator for 6 hours, and then supplement it with 200 μL of DMEM high-glucose medium containing 20% fetal bovine serum. Continue culturing in a 37°C CO2 incubator for 18 hours.

[0104] 3) Treatment of Protein Samples: Add 200 μL of cell lysis buffer and 1% PMSF to BHK cells after 24 hours, leave it on ice for 5 minutes, centrifuge at 14000 g for 5 minutes, transfer the supernatant to a new centrifuge tube, and place it in a 5×SDS metal bath at 95°C for 12 minutes. Leave it at -20°C for use.

[0105] 4) Western Blot Detection: Electrophoresis: The concentration of the polyacrylamide separation gel is 6%, the protein sample loading volume is 20 μL, the electrophoresis conditions for the stacking gel are 150 V for 10 minutes, and the electrophoresis conditions for the separation gel are 200 V for 30 minutes.

[0106] Electrotransfer: Use a nitrocellulose membrane and perform electrotransfer at 100 V for 1 hour.

[0107] Blocking: Prepare 5% BSA as a blocking solution using 1×PBST and block it overnight at 4°C.

[0108] Primary Antibody Incubation: Dilute the SARA-Cov-2 (2019-nCov) spike protein antibody at a dilution ratio of 1:2000 using the blocking solution and incubate it at room temperature for 1 hour. Wash it 3 times with 1×PBST for 10 minutes each.

[0109] Secondary Antibody Incubation: Dilute the secondary antibody at a dilution ratio of 1:5000 using the blocking solution and incubate it at room temperature for 1 hour. Wash it 3 times with 1×PBST for 10 minutes each.

[0110] Development: Development is carried out in an imaging system with a developer solution A: developer solution B = 1:1.

[0111] The experimental results are as shown in FIGS. 3-1 and 3-2. FIGS. 3-1 and 3-2 are diagrams comparing the expression of the RBD protein of the modified nucleotide and the conventional nucleotide self-replicating mRNA-RBD (denoted as SAM-CD5-RBD in the figure) after transfection into BHK cells in vitro, and include the detection of the expression of the RBD protein in the cell lysate and cell supernatant. Here, Actin protein is used as an internal reference substance in the cell lysate, and protein by the Bradford method is used as an internal reference substance in the cell supernatant. FIG. 4 is a diagram showing the quantification statistic of the RBD protein in the cell lysate of FIGS. 3-1 and 3-2. From FIGS. 3-1, 3-2, and 4, it can be seen that the self-replicating mRNA-RBD has good expression of the RBD protein after transfection into BHK cells in vitro.

[0112] 7. The present invention compares the mRNA-RBD of the self-replicating mRNA-RBD (denoted as SAM-CD5-RBD in the figure) obtained from in vitro transcription reactions using modified nucleotides and conventional nucleotides by real-time fluorescence quantitative PCR detection, and detects the transcription level of the innate immune regulator IFN-β1 after transfection into Hela cells in vitro.

[0113] The specific method is as follows. 1) Extraction of Cellular RNA: Aspirate the cell culture medium, wash the cells once with PBS, add 1 mL of RNAiso, blow the cells, and collect them in an EP tube. Add 0.2 mL of chloroform, mix by vibration, let stand for 5 minutes, then centrifuge at 12,000 g for 15 minutes and aspirate the supernatant. Add isopropyl alcohol of the same volume as the supernatant, mix by vibration, and let stand at room temperature for 10 minutes. Centrifuge at 12,000 g for 10 minutes and discard the supernatant. Add Nuclease-Free water containing 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 12,000 g for 5 minutes and discard the supernatant. Dry the precipitate, add 20 μL of Nuclease-Free water, gently blow, and dissolve the precipitate. Measure the OD260 / OD280 value and RNA concentration with an ultraviolet spectrophotometer.

[0114] 2) Preparation of cDNA Samples: Take 1.5 μg of each RNA sample, add it to 5×gDNA Digester Mix and Nuclease-Free, dilute to 15 μL with water, and incubate at 42°C for 2 minutes. Add 2 μL of 10×Hifair® III Super Buffer, 1 μL of Hifair® III RT Enzyme Mix, 1 μL of Random Primers N6, and 1 μL of Nuclease-Free water, mix uniformly, and perform a reverse transcription reaction. The procedure for reverse transcription is 25°C for 5 minutes, 60°C for 15 minutes, and 85°C for 5 minutes.

[0115] 3) Real-time fluorescence quantitative PCR detection: The cDNA sample is diluted 5-fold. The reaction system is composed of 5 μL of 2× ChamQ Universal SYBR qPCR Master Mix, 0.2 μL of 10 μM upstream primer, 0.2 μL of 10 μM downstream primer, 1 μL of diluted cDNA sample, and 3.6 μL of Nuclease-Free water. These are uniformly mixed for detection. The upstream primer sequence for detecting IFN-B1 gene expression is CATTACCTGAAGGCCAAGGA, and the downstream primer sequence is CAGCATCTGCTGGTTGAAGA. The upstream primer sequence for detecting the GAPDH gene expression of the internal reference substance is GAAGGCTGGGGCTCATTT, and the downstream primer sequence is CAGGAGGCATTGCTGATGAT. The upstream primer sequence for detecting RIG-I gene expression is GTTGTCCCCATGCTGTTCTT, and the downstream primer sequence is GCAAGTCTTACATGGCAGCA.

[0116] The detection is performed using a Thermo Fisher QuantStudio 1 real-time fluorescence quantitative PCR system. The detection procedure is as follows: Step 1: Repeat at 95°C for 3 minutes once; Step 2: Repeat at 95°C for 10 s, 60°C for 30 s, 40 times; Step 3 Dissolution curve: Repeat at 95°C for 15 s, 60°C for 60 s, 95°C for 15 s once.

[0117] The relative quantification method was adopted to analyze the fold change (2-ΔΔCT) of target gene expression. The results are as shown in Figure 5. As positive controls, non-self-replicating mRNA-RBD modified with pseudouridine at a ratio of 100% and non-self-replicating mRNA-RBD modified with N1-methylpseudouridine at a ratio of 100% hardly stimulated the high expression of the innate immune regulator IFN-B1 gene after transfection into cells. On the other hand, self-replicating mRNA-RBD modified with conventional nucleotides stimulated the high expression of IFN-B1 after transfection into cells. Compared with self-replicating mRNA-RBD modified with conventional nucleotides, self-replicating mRNA-RBD modified with pseudouridine at ratios of 10%, 20%, and 30% could reduce the stimulation of IFN-B1 after transfection into cells. As the ratio of modified nucleotides increased, the reduction of IFN-B1 became more obvious. The modified nucleotides hardly affected the translation of the RBD protein. Self-replicating mRNA-RBD modified with N1-methylpseudouridine at ratios of 10%, 20%, and 30% had the same effect of reducing the high expression of IFN-B1 after transfection into cells and hardly affected the translation of the RBD protein at the same time. While self-replicating mRNA-RBD modified with pseudouridine at a ratio of 100% and self-replicating mRNA-RBD modified with N1-methylpseudouridine at a ratio of 100% hardly stimulated the high expression of the IFN-B1 gene after transfection into cells, but had an obvious inhibitory effect on the translation of the RBD protein. Self-replicating mRNA-RBD modified with 5-methylcytidine at a ratio of 100% reduced the high expression of IFN-B1 to some extent after transfection into cells, but its reduction effect was not as good as that of self-replicating mRNA-RBD modified with pseudouridine at a ratio of 30% and hardly affected the translation of the RBD protein. When comprehensively comparing the effects of different types and degrees of nucleotide modifications on IFN-B1 gene expression and RBD protein translation, self-replicating mRNA-RBD modified with pseudouridine at a ratio of 30% was more than that of self-replicating mRNA-RBD modified with conventional nucleotides.It has a high inhibitory effect on inflammatory genes and maintains good expression of RBD protein translation.

[0118] 8. The encapsulation step of mRNA-RBD and lipids is as follows. The mRNA is mixed rapidly with lipids (including 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000), cholesterol, and distearoyl phosphatidylcholine (DSPC) and cationic lipids, dissolved in alcohol) by a Nanoassemblr mixer, whereby the lipids precipitate and the mRNA is encapsulated into LNP under the action of charge. Then, the mRNA-RBD-LNP complex is transferred to the formulation solution by concentration and buffer exchange.

[0119] 9. Detection of anti-spike protein antibody titers in mRNA-RBD-LNP vaccinated mice After 6- to 8-week-old female BALB / c mice were adaptively bred for 3 days, they were divided into groups, with 6 mice in each group. One group was the control group, injected with the formulation buffer, and the remaining 10 groups were injected with conventional nucleotide self-replicating mRNA-RBD-LNP, self-replicating mRNA-RBD-LNP modified with pseudouridine at ratios of 10%, 20%, 30%, self-replicating mRNA-RBD-LNP modified with N1-methylpseudouridine at ratios of 10%, 20%, 30%, self-replicating mRNA-LNP modified with 5-methylcytidine at a ratio of 100%, non-self-replicating mRNA-RBD-LNP modified with pseudouridine at a ratio of 100%, and non-self-replicating mRNA-RBD-LNP modified with N1-methylpseudouridine at a ratio of 100%, respectively.

[0120] On day 0, each mouse was intraspinally injected with 3 μg of mRNA-RBD-LNP. On day 2, the spleens of three mice in each group were collected to detect IFN-B1 expression. The results are as shown in Figure 6. For the remaining three mice in each group, after collecting serum on days 7 and 14, each mouse was intraspinally injected with a second dose of 3 μg of mRNA-RBD-LNP. Then, on days 21 and 28, serum was collected from the mice respectively, and the antibody titer against RBD was detected by ELISA. The experimental process and design are as shown in Figure 7.

[0121] The method for detecting the antibody titer was ELISA, and the specific operation was as follows. Each well of a 96-well enzyme plate was coated with 50 ng of the RBD structural domain protein of the piktan protein overnight at room temperature. The next day, it was washed three times with PBST, blocked with 5% milk, washed three times with PBST after 1 hour at 37°C, added with mouse serum at the corresponding dilution ratio, washed three times with PBST after 1 hour at 37°C, added with anti-mouse IgG heavy chain-light chain HRP, washed three times with PBST after 1 hour at 37°C, and finally, a chromogenic solution was added to cause color development.

[0122] The experimental results are as shown in Figure 8. Mice injected with non-self-replicating mRNA-RBD-LNP modified with pseudouridine at a ratio of 100% and non-self-replicating mRNA-RBD-LNP modified with N1-methylpseudouridine at a ratio of 100% had high RBD-specific antibodies in their sera. In the case of self-replicating mRNA-RBD-LNP, mice injected with self-replicating mRNA-RBD-LNP modified with pseudouridine at a ratio of 30% had high RBD-specific antibodies in their sera.

[0123] From the results of the above examples, it was found that the self-replicating mRNA obtained by performing nucleotide modification using the method of the present invention can be well expressed in cells and can induce a good antibody response in animals.

Example

[0124] Based on Example 1, the modification type was changed to m6A, and it will be briefly described below. I. Experimental Methods 1. Detection at the cellular level 1.1 In this experiment, the SrRNA-TC83 self-replicating mRNA system was used, and the inserted fragment is the RBD.

[0125] 1.2 In vitro synthesis of m6A-modified self-replicating mRNA: Design and synthesize self-replicating mRNA with different m6A modification ratios (0%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%).

[0126] 1.3 Cell transfection: In this experiment, the BHK cell line and the Hela cell line were used for transfection, and the Lipofectamine liposome transfection reagent was used. The transfection dosage was 0.5 μg, and samples were collected 24 hours later.

[0127] 1.4 Result detection: WB was used to detect the change in the expression level of the RBD protein in BHK cells and Hela cells, and the change in the expression of the Hela cell IFN-B1 and / or RIG-I genes was detected.

[0128] 2. Animal experiments: 2.1 Encapsulate self-replicating mRNA modified with m6A at different ratios using LNP and conduct animal experiments.

[0129] 2.2 Use SrRNA-TC83 as a vector to detect the expression of hEPO (human Erythropoietin) and Luciferase gene proteins in animal experiments.

[0130] 2.3 The LNP-hEPO-mRNA animal experiment adopted the intravenous injection method, and the LNP-Luciferase-mRNA animal experiment adopted the intramuscular injection method.

[0131] 2.4 For hEPO, the protein expression effect in vivo was detected by WB, and for Luciferase, the protein expression effect in vivo was detected by fluorescence imaging.

[0132] II. Experimental Results: 1. Cellular-level experiment 1.1 The expression of the RBD protein is hardly affected or significantly increased under m6A modification at a specific ratio (e.g., 20% or less, or 10% or less, or 5% or less). The results are as shown in Figures 9 and 10. Here, in Figure 9, A and C are the expression of proteins in the cell lysate, and B and D are the expression of proteins in the supernatant. It can be seen that m6A modification of 10% or less results in low expression of RBD.

[0133] The results of detecting RBD expression by WB are as shown in Figure 10. As can be seen from the figure, m6A modification of 1% and 5% does not disrupt the expression of RBD.

[0134] 1.2 The results of IFN-B1 gene expression are as shown in Figure 11, and it was found that m6A modification can effectively reduce IFN-B1 expression.

[0135] 2. Animal-level experiment 2.1 The Luciferase fluorescence signal was enhanced under m6A modification at a specific ratio. 2.2 The expression of the hEPO protein was increased under m6A modification at a specific ratio, and the expression of mouse inflammatory genes was significantly decreased.

[0136] From the above, it was found that the self-replicating mRNA modified with m6A hardly affects protein expression or has a promoting effect, and the self-replicating mRNA modified with m6A can effectively reduce the expression of inflammatory genes.

[0137] Although the above embodiments have described several embodiments of the present invention in detail, they should not be construed as limiting the scope of the patent of the present invention. Those skilled in the art should note that without departing from the concept of the present invention, some modifications and improvements can be made, and all of these should belong to the protection scope of the present invention. Therefore, the scope of patent protection of the present invention shall be in accordance with the appended claims, and the specification and drawings can be used to explain the content of the claims.

Claims

1. The polynucleotide fragment contains one or more of a non-structural replication enzyme domain derived from an alphavirus and an integrated target fragment, the polynucleotide fragment contains a functional nucleotide analog, the functional nucleotide analog contains at least one of pseudouridine, N1-methylpseudouridine, 5-hydroxymethoxycytidine, and N6-methyladenosine, and is a modified self-replicating mRNA.

2. The uridine in the unmodified form of the polynucleotide fragment is modified to pseudouridine at a ratio of 1% to 100%, or 1% to 50%, or 10% to 50%, or 20% to 40%, or 25% to 35%, and is the modified self-replicating mRNA according to Claim 1.

3. The uridine in the unmodified form of the polynucleotide fragment is modified to N1-methylpseudouridine at a ratio of 1% to 100%, or 1% to 60%, or 10% to 60%, or 10% to 20%, and is the modified self-replicating mRNA according to Claim 1.

4. The cytidine in the unmodified form of the polynucleotide fragment is modified to 5-hydroxymethoxycytidine at a ratio of 1% to 100%, or 80% to 100%, or 90% to 100%, and is the modified self-replicating mRNA according to Claim 1.

5. The adenosine in the unmodified form of the polynucleotide fragment is modified to N6-methyladenosine at a ratio of 1% to 100%, or 1% to 10%, and is the modified self-replicating mRNA according to Claim 1.

6. The target fragment contains at least one mRNA encoding an antigen or a fragment or epitope thereof. Preferably, the antigen is a pathogenic antigen. More preferably, the antigen is a viral antigen, a bacterial antigen, a parasitic antigen, a fungal antigen, a protozoan antigen, a prion antigen, or a tumor antigen, and is the modified self-replicating mRNA according to any one of Claims 1 to 5.

7. The target fragment is an mRNA derived from SARS-CoV-2. Preferably, it is a spike protein mRNA or a fragment thereof. More preferably, it contains an RBD gene or a fragment thereof, and is the modified self-replicating mRNA according to Claim 6.

8. The α virus is selected from at least one of Venezuelan equine encephalitis virus (TC83 Venezuelan Equine Encephalitis Virus, VEEV), Sindbis virus, Chikungunya virus, Eastern equine encephalitis virus, Western equine encephalitis virus, Mayaro virus, Semliki Forest virus and Venezuelan equine encephalitis virus, and the modified self-replicating mRNA according to any one of claims 1 to 5 and 7 is characterized in that.

9. The modified self-replicating mRNA according to claim 8, wherein the unmodified nucleotide sequence is as shown in SEQ ID NO:

3.

10. A vaccine composition comprising the modified self-replicating mRNA according to any one of claims 1 to 9.

11. The vaccine composition according to claim 10, further comprising at least one of a pharmaceutically acceptable vector, diluent and excipient.

12. The vaccine composition according to claim 10, further comprising a nucleic acid stabilizer and / or an immune adjuvant.

13. The vaccine composition according to any one of claims 10 to 12, characterized in that it is encapsulated and delivered in the form of a plasmid, virus vector, liposome, dendrimer, inorganic nanoparticle or cell-penetrating peptide.

14. A set reagent kit comprising the vaccine composition according to any one of claims 10 to 12, and optionally a container for inoculating the vaccine composition.

15. After inoculation into an animal body, the mRNA a) The property of enhancing the immunogenicity of the mRNA and / or b) A method used to change the property of enhancing the ability of the mRNA to avoid immune surveillance, The method is characterized by including the step of substituting the corresponding unmodified nucleoside in the mRNA with a functional nucleotide analog.

16. The mRNA is self-replicating mRNA, and preferably, the method according to claim 15, characterized in that the modified self-replicating mRNA according to any one of claims 1 to 9 is obtained after substitution.

17. The method according to claim 15 or 16, characterized in that the animal is a chicken, duck, goose, cat, dog, cow, sheep, horse, donkey, pig, giant panda, monkey, rabbit, mouse or human.

Images