RNAi constructs and methods for inhibiting FAM13A expression

Abstract

This application relates to compositions and methods for modulating the expression of the family having Sequence Similarity 13 member A (FAM13A) protein. In particular, the present application relates to nucleic acid-based therapeutic agents for reducing FAM13A gene expression via RNA interference, and methods of using such nucleic acid-based therapeutic agents to reduce abdominal adiposity, reduce body weight, reduce body fat mass, improve metabolic parameters including insulin resistance and non-alcoholic steatohepatitis (NASH), and reduce the risk of myocardial infarction.

Description

Technical Field

[0001] The present application relates to compositions and methods for modulating the expression of a family having Sequence Similarity 13 Member A (FAM13A) protein. In particular, the present application relates to nucleic acid-based therapeutic agents for reducing FAM13A gene expression via RNA interference and methods of using such nucleic acid-based therapeutic agents.

Background Art

[0002] Obesity or excess adiposity is recognized as a disease and has been established as a major risk factor for cardiovascular disease (CVD). The body mass index (BMI), the most common measure of adiposity, leads to an increased odds risk of myocardial infarction (MI). However, this association is significantly reduced after adjustment for the waist-to-hip ratio (WHR), a measurement that reflects visceral fat distribution pattern (also known as central or abdominal obesity). The WHR has been shown to be more strongly associated with the MI risk, and individuals in the highest quintile for WHR have been shown to be more strongly associated with the MI risk, with an odds ratio increase of 2.52-fold (p<0.001), a finding that persists even after adjustment for BMI. See Yusuf et al., Lancet 366:1640-1649 (2005); Cao et al., Medicine (Baltimore) 97, e11639 (2018); de Koning et al., Eur. Heart J., 28, 850-856 (2007). From these data, it is shown that the WHR is a better predictor of MI risk than the BMI and that this measure overcomes some important drawbacks of the BMI (e.g., high muscle mass).

[0003] FAM13A (also known as FAM13A1, KIAA0914, or ARHGAP48) is a cytoplasmic protein that has been shown to regulate AMP-activated protein kinase (AMPK) activity, which is associated with the regulation of hepatic glucose, lipid metabolism, body fat distribution, and adipocyte function. Lin et al., iScience 23, 100928 (2020); Fathzadeh et al., Nature Communications 11, 1465 (2020). For example, human genetic evidence has associated FAM13A with HDL cholesterol, fasting insulin levels adjusted for body mass index (BMI), and waist-to-hip ratio (WHR) adjusted for BMI. In vitro, FAM13A knockdown in human mesenchymal stem cells improves adipocyte differentiation and thermogenesis, while overexpression causes apoptosis of preadipocytes and inhibits adipogenesis. Lundback et al., Diabetologia, 2018; Tang et al., Int. J. Obesity, 2019; Fathzadeh et al., Nat. Comm., 2020. Furthermore, in FAM13A KO mice, diet-induced obesity (DIO) is prevented, hepatic insulin sensitivity is improved, and hepatocyte oxygen consumption rate is increased. Lin et al., iScience, 2020.

Prior Art Documents

Non-Patent Documents

[0004]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Summary of the Invention

Means for Solving the Problems

[0005] This application relates in part to the design and generation of an RNAi construct that targets the FAM13A gene and reduces its expression. Sequence-specific inhibition of FAM13A gene expression is useful for reducing abdominal adiposity, weight loss, reduction of body fat mass, improvement of metabolic parameters such as insulin resistance and non-alcoholic steatohepatitis (NASH), and reduction of the risk of myocardial infarction. Accordingly, in one embodiment, this application provides an RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region comprising a sequence substantially complementary to the FAM13A mRNA sequence. In some embodiments, this RNAi construct targets only the liver. In some embodiments, the antisense strand is substantially complementary to a sequence of at least 15 consecutive nucleotides in a region of the human FAM13A mRNA sequence (SEQ ID NO: 1) and comprises a sequence with 1, 2, or 3 or fewer mismatches. In some embodiments, the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within a specific region of the FAM13A mRNA sequence represented by SEQ ID NO: 1, such as within nucleotides 1300 - 1375 or 4900 - 5300 of SEQ ID NO: 1. In certain embodiments, the antisense strand comprises a region comprising at least 15 consecutive nucleotides from the antisense sequences listed in Table 1 or Table 2.

[0006] In some embodiments, the sense strand of the RNAi construct described herein includes a sequence that is sufficiently complementary to the sequence of the antisense strand to form a double-stranded region that is about 15 to about 30 base pairs in length, about 17 to about 24 base pairs in length, or about 19 to about 21 base pairs in length. In some embodiments, the sense strand and the antisense strand are each independently about 19 to about 30 nucleotides in length or about 19 to about 23 nucleotides in length. In some embodiments, the RNAi construct includes 1 or 2 blunt ends. In other embodiments, the RNAi construct includes 1 or 2 nucleotide overhangs. Such nucleotide overhangs can include 1 to 6 unpaired nucleotides and can be located at the 3' end of the sense strand, the 3' end of the antisense strand, or the 3' ends of both the sense strand and the antisense strand. In certain embodiments, the RNAi construct includes an overhang of 2 unpaired nucleotides at the 3' ends of the sense strand and the antisense strand. In other embodiments, the RNAi construct includes an overhang of 2 unpaired nucleotides at the 3' end of the antisense strand and a blunt end at the 3' end of the sense strand / the 5' end of the antisense strand.

[0007] The disclosed RNAi construct may comprise one or more modified nucleotides, including nucleotides having modifications to the ribose ring, nucleobase, or phosphodiester backbone. In some embodiments, the RNAi construct comprises one or more 2'-modified nucleotides. Such 2'-modified nucleotides may include 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, bicyclic nucleic acid (BNA) deoxyribonucleotides, or combinations thereof. In a particular embodiment, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, or combinations thereof. In some embodiments, all nucleotides in the sense and antisense strands of the RNAi construct are modified nucleotides. For example, at the 3'-end, 5'-end, or both the 3'-end and 5'-end of the sense strand, as terminal nucleotides, abasic nucleotides may be incorporated into the disclosed RNAi construct. In such embodiments, the abasic nucleotides may be in an inverted configuration and may be linked to adjacent nucleotides through, for example, 3'-3' internucleotide linkages or 5'-5' internucleotide linkages.

[0008] In some embodiments, the RNAi construct comprises at least one backbone modification, such as a modified internucleotide linkage or a nucleoside linkage. In certain embodiments, the RNAi constructs described herein comprise at least one phosphorothioate internucleotide linkage. In certain embodiments, the phosphorothioate internucleotide linkage may be located at the 3' or 5' end of the sense and / or antisense strand. For example, in some embodiments, the antisense strand comprises two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3'-end and 5'-end. In some such embodiments, the sense strand comprises one or two phosphorothioate internucleotide linkages between the terminal nucleotides at its 3'-end.

[0009] In some embodiments, the RNAi construct of the present application may target a specific region of the human FAM13A mRNA transcript represented by SEQ ID NO: 1. In some embodiments, the sequence of the antisense strand may be completely complementary to the sequence of at least 15 consecutive nucleotides of a specific region (SEQ ID NO: 1) of the human FAM13A transcript. In some embodiments, the sequence of the antisense strand may be substantially complementary to the sequence of at least 15 consecutive nucleotides of a specific region (SEQ ID NO: 1) of the human FAM13A transcript, and the number of mismatches between the sequence of the antisense strand and the sequence of the specific region of the human FAM13A transcript is 1, 2 or 3 or less. In certain embodiments, the antisense strand and / or sense strand of the present RNAi construct may comprise or consist of sequences from the antisense and sense sequences listed in Table 1. In some embodiments, the sense strand and the antisense strand respectively comprise or consist of SEQ ID NO: 15 and 559, SEQ ID NO: 24 and 568, SEQ ID NO: 125 and 669, SEQ ID NO: 127 and 671, SEQ ID NO: 222 and 766, SEQ ID NO: 406 and 950, SEQ ID NO: 448 and 992, SEQ ID NO: 498 and 1042, SEQ ID NO: 502 and 1046, SEQ ID NO: 503 and 1047, SEQ ID NO: 504 and 1048, SEQ ID NO: 513 and 1057, SEQ ID NO: 526 and 1070, SEQ ID NO: 527 and 1071, SEQ ID NO: 533 and 1077 or SEQ ID NO: 534 and 1078.

[0010] In some embodiments, the present RNAi construct comprises a specific sequence having a specific modification pattern, which is referred to herein as a double strand. In certain embodiments, the antisense strand and / or sense strand of the present RNAi construct with a specific modification pattern may comprise or consist of the antisense sequences and sense sequences listed in Table 2 as a specific double strand. In some embodiments, the present RNAi construct is a double strand called D-1557, D-1597, D-1612, D-1614, D-1623, D-1650, D-1667, D-1680, D-1682, D-1685, D-1686, D-1690, D-1697, D-1698, D-1699, D-1702, D-1704, D-1705, D-1709, D-1768, D-1846, D-1849, D-1853, D-1856, D-1858, D-1861, D-1862, D-1863, D-1864, D-1865, D-1866, D-1868, D-1869, D-1870, D-1871, D-1873, D-1875, D-1876, D-1877, D-1878, D-1879, D-1880, D-1881, D-1883, D-1884, D-1885, D-1886, D-1887, D-1888, D-1899, D-1896, D-1955, D-1970, D-1972, D-1975, D-1976, D-1977, D-1979, D-1980, D-1981, D-1982, D-1983, D-1984, D-1985, D-1987, D-1988, D-1989, D-1990, D-1991, D-1992, D-1993, D-1994, D-1995, D-1996, D-1997, D-1998, D-2000, D-2001, D-2002, D-2003, D-2004, D-2005, D-2012, D-2013, D-2014, D-2017, D-2021, D-2022, D-2023, D-2040, D-2044, D-2045, D-2047, D-2049, D-2051, D-2052, D-2053, D-2054, D-2058, D-2061, D-2075, D-2077, D-2079, D-2080, D-2081, D-2083, D-2090, D-2091 or D-2093.In some embodiments, the RNAi construct is a double-stranded one in which knockdown of FAM13A expression is observed to exceed 80%.

[0011] The disclosed RNAi construct may further comprise a ligand for promoting delivery or uptake of the RNAi construct to a specific tissue or cell such as the liver or adipocytes. In certain embodiments, the ligand targets delivery of the RNAi construct to hepatocytes. In these and other embodiments, the ligand may comprise galactose, galactosamine, or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand comprises a multivalent galactose or multivalent GalNAc moiety such as a trivalent or tetravalent galactose or GalNAc moiety. The ligand may optionally be covalently attached to the 5' or 3' end of the sense strand of the RNAi construct through a linker. In some embodiments, the RNAi construct comprises a ligand and a linker having a structure according to any one of Formulas I-IX described herein. In certain embodiments, the RNAi construct comprises a ligand and a linker having a structure according to Formula VII. In other embodiments, the RNAi construct comprises a ligand and a linker having a structure according to Formula IV. In some embodiments, the ligand comprises a long-chain fatty acid such as lauric acid (C12), myristic acid (C14), palmitic acid (C16), stearic acid (C18), eicosapentaenoic acid (C20), or docosanoic acid (C22). In some embodiments, the ligand is linked through a phosphodiester or phosphorothioate bond.

[0012] The present application also provides a pharmaceutical composition comprising any of the RNAi constructs described herein and a pharmaceutically acceptable carrier, excipient or diluent. Such pharmaceutical compositions are particularly useful for reducing the expression of the FAM13A gene in cells (e.g., liver or adipocytes) of patients in need of reducing the expression of the FAM13A gene. Patients to whom the disclosed pharmaceutical compositions can be administered include patients diagnosed with obesity or at risk of obesity, including patients showing a high WHR and patients diagnosed with abdominal obesity. Patients to whom the disclosed pharmaceutical compositions can be administered also include patients diagnosed with or at risk of metabolic conditions such as fatty liver disease (e.g., NAFLD, NASH, alcoholic fatty liver disease or alcoholic steatohepatitis), insulin resistance and type 2 diabetes (T2D), hypertriglyceridemia or hypercholesterolemia. The present application also provides a method of treating patients in need of reducing the expression of the FAM13A gene in their cells, including patients diagnosed with or at risk of obesity, abdominal obesity, fatty liver disease (e.g., NAFLD, NASH, alcoholic fatty liver disease, or alcoholic steatohepatitis), insulin resistance and type 2 diabetes (T2D), hypertriglyceridemia or hypercholesterolemia. These methods include administering an RNAi construct or pharmaceutical composition described herein. In some embodiments, the RNAi construct is administered with a ligand that targets the RNAi construct to the liver or hepatocytes.

[0013] The use of FAM13A-targeted RNAi constructs in any of the methods described herein or for preparing a medicament for administration by the methods described herein is specifically contemplated. For example, the present application includes FAM13A-targeted RNAi constructs for use in treating, preventing, or reducing the risk of onset of obesity, abdominal obesity, fatty liver disease (e.g., NAFLD, NASH, alcoholic fatty liver disease or alcoholic steatohepatitis), insulin resistance and type 2 diabetes (T2D), hypertriglyceridemia or hypercholesterolemia in patients in need thereof.

Brief Description of the Drawings

[0014]

Figure 1

Figure 2A

Figure 2B

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 4A

Figure 4B

Figure 4C

Figure 5

Figure 6

Figure 7A

Figure 7B

Figure 7C

Figure 7D

Figure 7E

Figure 7F

Figure 7G

Figure 7H

Figure 7I

Figure 7J

Figure 7K

Figure 7L

Figure 7M

Figure 7N

Figure 7O

Figure 7P

Figure 7Q

Figure 7R

Figure 8A

Figure 8B

Figure 8C

Figure 8D

Figure 9A

Figure 9B

Figure 9C

Figure 10A

Figure 10B

Figure 11A

Figure 11B

Figure 11C

Figure 11D

Figure 11E

[0015] The present application is directed to compositions and methods for modulating the expression of the FAM13A gene in cells or mammals. In some embodiments, the composition targets mRNA transcribed from the FAM13A gene, particularly the human FAM13A gene, and includes an RNAi construct that reduces the expression of FAM13A protein in a cell or mammal. Such an RNAi construct is useful for treating, preventing, or reducing the risk of onset of obesity, fatty liver, insulin resistance and type 2 diabetes (T2D), hypertriglyceridemia, or hypercholesterolemia in a patient in need thereof.

[0016] RNAi construct As used herein, the term "RNAi construct" refers to an agent that, when introduced into a cell, can down-regulate the expression of a target gene (e.g., the FAM13A gene) via the RNA interference mechanism. RNA interference is the process by which a nucleic acid molecule induces the cleavage and degradation of a target RNA molecule (e.g., a messenger RNA or mRNA molecule) in a sequence-specific manner, for example, through the RNA-induced silencing complex (RISC) pathway. In some embodiments, the RNAi construct comprises a double-stranded RNA molecule comprising two antiparallel strands of contiguous nucleotides that are sufficiently complementary to each other to hybridize and form a double-stranded region. "Hybridize" or "hybridization" typically refers to the pairing of complementary polynucleotides through hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonds) between complementary bases in two polynucleotides. A strand that contains a region with a sequence that is substantially complementary to a target sequence (e.g., a target mRNA) is called the "antisense strand" or "guide strand". The "sense strand" or "passenger strand" refers to a strand that contains a region that is substantially complementary to a region of the antisense strand. In some embodiments, the sense strand may contain a region having a sequence that is substantially identical to the target sequence.

[0017] The double-stranded RNA molecule may contain chemical modifications to the ribonucleotides, including modifications to the ribose sugar, base or backbone components of the ribonucleotides, such as those described herein or known in the art. Any such modifications as used in double-stranded RNA molecules (e.g., siRNA, shRNA, etc.) are encompassed by the term "double-stranded RNA" for the purposes of this disclosure. Details of potential modifications to the RNAi constructs described herein are provided in the section on Modifications and Preparation of RNAi Constructs below.

[0018] As used herein, a polynucleotide containing a first sequence is "complementary" to a polynucleotide containing a second sequence if, under certain conditions such as physiological conditions, the first polynucleotide can hybridize with the second polynucleotide to form a double-stranded region. Other such conditions can include moderate or stringent hybridization conditions known to those of skill in the art. A first sequence is "perfectly complementary" (100% complementary) to a second sequence if the polynucleotide containing the first sequence base pairs with the polynucleotide containing the second sequence without any mismatches over the entire length of one or both nucleotide sequences. A sequence is "substantially complementary" or "substantially identical" to a target sequence if the sequence is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% complementary to the target sequence. Percent complementarity can be calculated by dividing the number of bases in the first sequence that are complementary to bases at corresponding positions in the second or target sequence by the total length of the first sequence. Also, when two sequences hybridize, the sequences can be said to be substantially complementary to each other if there are 5, 4, 3 or 2 or fewer mismatches over a 30 base pair double-stranded region. Generally, when any nucleotide overhangs as defined herein are present, the sequences of such overhangs are not considered in determining the degree of complementarity between the two sequences. By way of example, a 21 nucleotide sense strand and a 21 nucleotide antisense strand that hybridize to form a 19 base pair double-stranded region with a 2 nucleotide overhang at the 3' end of each strand are perfectly complementary when this term is used herein.

[0019] In some embodiments, the region of the antisense strand comprises a sequence that is substantially or completely complementary to the region of the target RNA sequence (e.g., the FAM13A mRNA sequence). In such embodiments, the sense strand may comprise a sequence that is completely complementary to the sequence of the antisense strand. In other such embodiments, the sense strand may comprise a sequence that is substantially complementary to the sequence of the antisense strand, e.g., a sequence having 1, 2, 3, 4, or 5 mismatches in the double-stranded region formed by the sense and antisense strands. In certain embodiments, any mismatches preferably occur within the terminal regions (e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and / or 3' ends of the strand). In one embodiment, any mismatches in the double-stranded region formed by the sense and antisense strands occur within 6, 5, 4, 3, or 2 nucleotides of the 5' end of the antisense strand.

[0020] In certain embodiments, the sense and antisense strands of the double-stranded RNA are two individual molecules that hybridize to form a double-stranded region but are otherwise unlinked. Such double-stranded RNA molecules formed from two individual strands are referred to as "small interfering RNAs" or "short interfering RNAs" (siRNAs). Thus, in some embodiments, the present RNAi construct comprises siRNAs.

[0021] In other embodiments, the sense and antisense strands that hybridize to form a double-stranded region can be part of a single RNA molecule, i.e., the sense and antisense strands are part of a self-complementary region of a single RNA molecule. In such cases, the single RNA molecule includes a double-stranded region (also referred to as a stem region) and a loop region. The 3' end of the sense strand is linked to the 5' end of the antisense strand by a continuous sequence of unpaired nucleotides that form the loop region. The loop region is typically long enough to allow the RNA molecule to fold back on itself so that the antisense strand can base pair with the sense strand to form a double-stranded or stem region. The loop region can contain from about 3 to about 25, from about 5 to about 15, or from about 8 to about 12 unpaired nucleotides. Such an RNA molecule having at least a partially self-complementary region is called a "small hairpin RNA" (shRNA). In certain embodiments, the present RNAi construct includes shRNA. The length of a single, at least partially self-complementary RNA molecule can be from about 40 nucleotides to about 100 nucleotides, from about 45 nucleotides to about 85 nucleotides, or from about 50 nucleotides to about 60 nucleotides, and can include a double-stranded region and a loop region having each of the lengths described herein.

[0022] In some embodiments, the present RNAi construct includes a sense strand and an antisense strand, and the antisense strand includes a region having a sequence that is substantially or completely complementary to the messenger RNA (mRNA) sequence of FAM13A. As used herein, "FAM13A mRNA sequence" refers to any messenger RNA sequence that encodes a FAM13A protein, including allelic variants and splice variants that include FAM13A protein variants or isoforms from any species (e.g., non-human primate, human).

[0023] The FAM13A mRNA sequence includes the transcript sequence expressed as its complementary DNA (cDNA) sequence. The cDNA sequence refers to the sequence of the mRNA transcript expressed as DNA bases (e.g., guanine, adenine, thymine, and cytosine) rather than RNA bases (e.g., guanine, adenine, uracil, and cytosine). Thus, the antisense strand of this RNAi construct may include a region having a sequence that is substantially or completely complementary to the target FAM13A mRNA sequence or FAM13A cDNA sequence. Examples of FAM13A mRNA or cDNA sequences include any FAM13A mRNA or cDNA sequences in the Ensembl Genome or National Center for Biotechnology Information (NCBI) database, including human sequences such as Ensembl transcript number ENST00000264344.9 (SEQ ID NO: 1) and NCBI Reference Sequence NM_022746.4, but are not limited thereto. The mRNA or cDNA sequence of FAM13A may also include cynomolgus monkey sequences, rhesus monkey sequences, chimpanzee sequences, rat sequences, and mouse sequences. In certain embodiments, the FAM13A mRNA sequence is the human transcript shown below (SEQ ID NO: 1).

Chem.

Chem.

Chem.

[0024] The region of the antisense strand can be substantially or completely complementary to at least 15 contiguous nucleotides of the FAM13A mRNA sequence. In certain embodiments, the region of the antisense strand comprises a sequence that is substantially complementary to a sequence of at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides of a region of the FAM13A mRNA sequence (e.g., the human FAM13A mRNA sequence (SEQ ID NO: 1)), with no more than 1, 2, or 3 mismatches. In related embodiments, the antisense strand comprises a region having a sequence that is substantially complementary to a sequence of at least 15, at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides of a region of the FAM13A mRNA sequence, with no more than 1 mismatch. In some embodiments, the target region of the FAM13A mRNA sequence that the antisense strand comprises a complementary region can range from about 15 to about 30 contiguous nucleotides, from about 16 to about 28 contiguous nucleotides, from about 18 to about 26 contiguous nucleotides, from about 17 to about 24 contiguous nucleotides, from about 19 to about 30 contiguous nucleotides, from about 19 to about 25 contiguous nucleotides, from about 19 to about 23 contiguous nucleotides, or from about 19 to about 21 contiguous nucleotides. In certain embodiments, the region of the antisense strand that comprises a sequence substantially or completely complementary to the FAM13A mRNA sequence can comprise at least 15 contiguous nucleotides from the antisense sequences listed in Table 1 or Table 2. In other embodiments, the sequence of the antisense strand comprises at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides from the antisense sequences listed in Table 1 or Table 2.

[0025] In some embodiments, the region of the antisense strand comprising a sequence that is substantially or completely complementary to the FAM13A mRNA sequence can comprise at least 15 consecutive nucleotides from a region that is particularly susceptible to targeting by an RNAi construct. Thus, in some embodiments, the region of the antisense strand comprising a sequence that is substantially or completely complementary to the FAM13A mRNA sequence can comprise at least 15 consecutive nucleotides within nucleotides 1300 - 1375, 1625 - 1700, 2075 - 2175, or 4900 - 5300 of the human FAM13A mRNA sequence shown in SEQ ID NO: 1. In some embodiments, the region of the antisense strand comprising a sequence that is substantially or completely complementary to the FAM13A mRNA sequence can comprise at least 15 consecutive nucleotides from a sub - section of these regions. Thus, in some embodiments, the sequence can comprise at least 15 consecutive nucleotides from nucleotides 1300 - 1350, 4900 - 5275, 4900 - 5250, 4900 - 5225, 4900 - 5200, 4900 - 5175, 4900 - 5150, 4900 - 5125, 4900 - 5100, 4900 - 5075, 4925 - 5300, 4925 - 5275, 4925 - 5250, 4925 - 5225, 4925 - 5200, 4925 - 5175, 4925 - 5150, 4925 - 5125, 4925 - 5100, 4925 - 5075, 4950 - 5300, 4950 - 5275, 4950 - 5250, 4950 - 5225, 4950 - 5200, 4950 - 5175, 4950 - 5150, 4950 - 5125, 4950 - 5100, 4950 - 5075, 4975 - 5300, 4975 - 5275, 4975 - 5250, 4975 - 5225, 4975 - 5200, 4975 - 5175, 4975 - 5150, 4975 - 5125, 4975 - 5100, 4975 - 5075, 5175 - 3000, 5100 - 5300, 5125 - 5300, 5150 - 5300, 5175 - 5300, 5200 - 5300, or 5225 - 5300.

[0026] The sense strand of the present RNAi construct usually contains a sequence that is sufficiently complementary to the sequence of the antisense strand such that the two strands hybridize under physiological conditions to form a double-stranded region. The "double-stranded region" refers to a region in two complementary or substantially complementary polynucleotides that form base pairs with each other by either Watson-Crick base pairing or other hydrogen-bonding interactions to create a double strand between the two polynucleotides. The double-stranded region of the present RNAi construct should be of sufficient length, for example, by associating with Dicer enzyme and / or RISC complex, to enable the present RNAi construct to enter the RNA interference pathway. For example, in some embodiments, the double-stranded region is about 15 to about 30 base pairs in length. Other lengths of the double-stranded region within this range are, for example, about 15 to about 28 base pairs, about 15 to about 26 base pairs, about 15 to about 24 base pairs, about 15 to about 22 base pairs, about 17 to about 28 base pairs, about 17 to about 26 base pairs, about 17 to about 24 base pairs, about 17 to about 23 base pairs, about 17 to about 21 base pairs, about 19 to about 25 base pairs, about 19 to about 23 base pairs or about 19 to about 21 base pairs and are also suitable. In certain embodiments, the double-stranded region is about 17 to about 24 base pairs in length. In other embodiments, the double-stranded region is about 19 to about 21 base pairs in length. In one embodiment, the double-stranded region is about 19 base pairs in length. In another embodiment, the double-stranded region is about 21 base pairs in length.

[0027] For embodiments in which the sense strand and the antisense strand are two separate molecules (e.g., the RNAi construct comprises siRNA), the sense strand and the antisense strand need not be the same length as the length of the double-stranded region. For example, one or both strands may be longer than the double-stranded region and may have one or more unpaired nucleotides or mismatches adjacent to the double-stranded region. Thus, in some embodiments, the present RNAi construct comprises at least one nucleotide overhang. As used herein, "nucleotide overhang" refers to the unpaired nucleotide(s) that extend beyond the double-stranded region at the end of the strand. Nucleotide overhangs are typically generated when the 3' end of one strand extends beyond the 5' end of the other strand, or when the 5' end of one strand extends beyond the 3' end of the other strand. The length of the nucleotide overhang is generally 1 to 6 nucleotides, 1 to 5 nucleotides, 1 to 4 nucleotides, 1 to 3 nucleotides, 2 to 6 nucleotides, 2 to 5 nucleotides, or 2 to 4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, the nucleotide overhang comprises 1 to 4 nucleotides. In certain embodiments, the nucleotide overhang comprises 2 nucleotides. In certain other embodiments, the nucleotide overhang comprises a single nucleotide.

[0028] The nucleotides in the overhang can be ribonucleotides or modified nucleotides as described herein. In some embodiments, the nucleotides in the overhang are 2'-modified nucleotides (e.g., 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides), deoxyribonucleotides, abasic nucleotides, inverted nucleotides (e.g., inverted abasic nucleotides, inverted deoxyribonucleotides) or combinations thereof. For example, in one embodiment, the nucleotides in the overhang are deoxyribonucleotides, e.g., deoxythymidine. In another embodiment, the nucleotides in the overhang are 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides or combinations thereof. In other embodiments, the overhang comprises a 5'-uridine-uridine-3' (5'-UU-3') dinucleotide. In such embodiments, the UU dinucleotide can comprise ribonucleotides or modified nucleotides, e.g., 2'-modified nucleotides. In other embodiments, the overhang comprises a 5'-deoxythymidine-deoxythymidine-3' (5'-dTdT-3') dinucleotide. When the nucleotide overhang is present in the antisense strand, the nucleotides in the overhang can be complementary to the target gene sequence, can form mismatches with the target gene sequence, or can comprise some other sequence (e.g., a polypyrimidine or poly purine sequence, e.g., UU, TT, AA, GG, etc.).

[0029] Nucleotide overhangs can be present at the 5' or 3' end of one or both strands. For example, in one embodiment, the present RNAi construct includes nucleotide overhangs at the 5' and 3' ends of the antisense strand. In another embodiment, the present RNAi construct includes nucleotide overhangs at the 5' and 3' ends of the sense strand. In some embodiments, the present RNAi construct includes nucleotide overhangs at the 5' end of the sense strand and the 5' end of the antisense strand. In other embodiments, the present RNAi construct includes nucleotide overhangs at the 3' end of the sense strand and the 3' end of the antisense strand.

[0030] The present RNAi construct can include a single nucleotide overhang at one end of the double-stranded RNA molecule and blunt ends at the other end. "Blunt ends" means that the sense and antisense strands are completely base-paired at the ends of the molecule and there are no unpaired nucleotides extending beyond the double-stranded region. In some embodiments, the present RNAi construct includes a nucleotide overhang at the 3' end of the sense strand and blunt ends at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the present RNAi construct includes a nucleotide overhang at the 3' end of the antisense strand and blunt ends at the 5' end of the antisense strand and the 3' end of the sense strand. In certain embodiments, the present RNAi construct includes blunt ends at both ends of the double-stranded RNA molecule. In such embodiments, the sense and antisense strands have the same length and the double-stranded region is the same length as the sense and antisense strands (i.e., the molecule is double-stranded throughout its entire length).

[0031] The sense and antisense strands in this RNAi construct can each independently be about 15 to about 30 nucleotides in length, about 19 to about 30 nucleotides in length, about 18 to about 28 nucleotides in length, about 19 to about 27 nucleotides in length, about 19 to about 25 nucleotides in length, about 19 to about 23 nucleotides in length, about 19 to about 21 nucleotides in length, about 21 to about 25 nucleotides in length, or about 21 to about 23 nucleotides in length. In certain embodiments, the sense and antisense strands are each independently about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides in length. In some embodiments, the sense and antisense strands have the same length, but form a double-stranded region that is shorter than these strands so that the RNAi construct has a two-nucleotide overhang. For example, in one embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand that are each 21 nucleotides in length, (ii) a double-stranded region that is 19 base pairs in length, and (iii) nucleotide overhangs of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In another embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand that are each 23 nucleotides in length, (ii) a double-stranded region that is 21 base pairs in length, and (iii) nucleotide overhangs of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the sense and antisense strands have the same length and form a double-stranded region over their entire length such that there are no nucleotide overhangs at either end of the double-stranded molecule. In one such embodiment, the RNAi construct has blunt ends (e.g., has two blunt ends) and comprises (i) a sense strand and an antisense strand that are each 21 nucleotides in length, and (ii) a double-stranded region that is 21 base pairs in length. In another such embodiment, the RNAi construct has blunt ends (e.g., has two blunt ends) and comprises (i) a sense strand and an antisense strand that are each 23 nucleotides in length, and (ii) a double-stranded region that is 23 base pairs in length.In yet another such embodiment, the RNAi construct has blunt ends (e.g., has two blunt ends) and includes (i) a sense strand and an antisense strand each 19 nucleotides in length, and (ii) a double-stranded region 19 base pairs in length.

[0032] In other embodiments, the sense strand or the antisense strand is longer than the other strand such that the RNAi construct includes at least one nucleotide overhang, and the two strands form a double-stranded region having a length equal to the length of the shorter strand. For example, in one embodiment, the RNAi construct includes (i) a sense strand that is 19 nucleotides in length, (ii) an antisense strand that is 21 nucleotides in length, (iii) a double-stranded region 19 base pairs in length, and (iv) a nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand. In another embodiment, the RNAi construct includes (i) a sense strand that is 21 nucleotides in length, (ii) an antisense strand that is 23 nucleotides in length, (iii) a double-stranded region 21 base pairs in length, and (iv) a nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand.

[0033] The antisense strand of the RNAi construct can include or consist of any one of the antisense sequences listed in Table 1 or Table 2, the sequence of nucleotides 1-19 of any of these antisense sequences, or the sequence of nucleotides 2-19 of any of these antisense sequences. Thus, in some embodiments, the antisense strand includes or consists of a sequence selected from SEQ ID NOs: 546-1089 or 1938-2785. In other embodiments, the antisense strand includes or consists of the sequence of nucleotides 1-19 of any one of SEQ ID NOs: 546-1089 or 1938-2785. In yet other embodiments, the antisense strand includes or consists of the sequence of nucleotides 2-19 of any one of SEQ ID NOs: 546-1089 or 1938-2785.

[0034] In these and other embodiments, the sense strand of the RNAi construct can comprise or consist of any one of the sense sequences listed in Table 1 or Table 2, the sequence of nucleotides 1 to 19 of any of these sense sequences, or the sequence of nucleotides 2 to 19 of any of these sense sequences. Thus, in some embodiments, the sense strand comprises or consists of a sequence selected from SEQ ID NOs: 2 to 545 or 1090 to 1937. In other embodiments, the sense strand comprises or consists of the sequence of nucleotides 1 to 19 of any one of SEQ ID NOs: 2 to 545 or 1090 to 1937. In still other embodiments, the sense strand comprises or consists of the sequence of nucleotides 2 to 19 of any one of SEQ ID NOs: 2 to 545 or 1090 to 1937.

[0035] In certain embodiments, the RNAi construct comprises (i) a sense strand comprising or consisting of a sequence selected from 2 to 545 or 1090 to 1937, and (ii) an antisense strand comprising or consisting of a sequence selected from SEQ ID NOs: 546 to 1089 or 1938 to 2785. In some embodiments, the RNAi construct can be any of the double-stranded compounds (including the unmodified nucleotide sequence and / or modified nucleotide sequence of the compound) listed in Table 1 or Table 2. In certain embodiments, the RNAi construct is D-1539, D-1544, D-1545, D-1549, D-1557, D-1559, D-1573, D-1579, D-1586, D-1597, D-1607, D-1611, D-1612, D-1614, D-1623, D-1631, D-1636, D-1639, D-1640, D-1643, D-1644, D-1645, D-1646, D-1648, D-1652, D-1661, D-1667, D-1672 or D-1694.

[0036] Modification and Preparation of RNAi Constructs The RNAi constructs disclosed herein may contain one or more modified nucleotides. "Modified nucleotide" refers to a nucleotide having one or more chemical modifications to the nucleoside, nucleobase, pentose ring, or phosphate group. As used herein, modified nucleotides do not include ribonucleotides containing adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate. However, the RNAi constructs may contain a combination of modified nucleotides and ribonucleotides. Incorporation of modified nucleotides into one or both strands of a double-stranded RNA molecule can improve the in vivo stability of the RNA molecule, for example, by reducing the sensitivity of the molecule to nucleases and other degradation processes. Incorporation of modified nucleotides can also enhance the potency of the RNAi construct for reducing the expression of a target gene.

[0037] In certain embodiments, the modified nucleotide has a modification of the ribose sugar. Such sugar modifications can include modifications at the 2' and / or 5' positions of the pentose ring, as well as bicyclic sugar modifications. A 2'-modified nucleotide refers to a nucleotide having a pentose ring substituted at the 2' position with a substituent other than OH. Such 2'-modifications include, but are not limited to, 2'-H (e.g., deoxyribonucleotide), 2'-O-alkyl (e.g., O-C1-C 10 or O-C1-C 10 substituted alkyl), 2'-O-allyl (O-CH2CH=CH2), 2'-C-allyl, 2'-deoxy-2'-fluoro (also referred to as 2'-F or 2'-fluoro),  2'-O-methyl (OCH3), 2'-O-methoxyethyl (O-(CH2)2OCH3), 2'-OCF3, 2'-O(CH2)2SCH3, 2'-O-aminoalkyl, 2'-amino (e.g., NH2), 2'-O-ethylamine, and 2'-azide. Modifications at the 5' position of the pentose ring include, but are not limited to, 5'-methyl (R or S configuration); 5'-vinyl and 5'-methoxy.

[0038] "Bicyclic sugar modification" refers to the modification of a pentose ring that forms a second ring by linking two atoms of the ring via a bridge to produce a bicyclic sugar structure. In some embodiments, the bicyclic sugar modification includes a bridge between the 4' and 2' carbons of the pentose ring. Nucleotides containing a sugar moiety with a bicyclic sugar modification are referred to herein as bicyclic nucleic acids or BNAs. Representative bicyclic sugar modifications include α-L-methyleneoxy (4'-CH2-O-2') bicyclic nucleic acid (BNA); β-D-methyleneoxy (4'-CH2-O-2') BNA (also referred to as locked nucleic acid or LNA); ethyleneoxy (4'-(CH2)2-O-2') BNA; aminooxy (4'-CH2-O-N(R)-2' (wherein R is H, C1-C 12 alkyl or a protecting group) BNA; oxyamino (4'-CH2-N(R)-O-2' (wherein R is H, C1-C 12 alkyl or a protecting group) BNA; methyl (methyleneoxy) (4'-CH(CH3)-O-2') BNA (also referred to as constrained ethyl or cEt); methylene-thio (4'-CH2-S-2') BNA; methylene-amino (4'-CH2-N(R)-2' (wherein R is H, C1-C 12 alkyl or a protecting group) BNA; methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA; propylene carbocyclic (4'-(CH2)3-2') BNA; and methoxy (ethyleneoxy) (4'-CH(CH2OMe)-O-2') BNA (also referred to as constrained MOE or cMOE), but are not limited thereto. These and other sugar-modified nucleotides that can be incorporated into the present RNAi construct are described in U.S. Patent No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol. 19:937-954, 2012, all of which are hereby incorporated by reference in their entirety.

[0039] In some embodiments, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, bicyclic nucleic acids (BNA), deoxyribonucleotides, or combinations thereof. In certain embodiments, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, or combinations thereof. In some embodiments, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, or combinations thereof.

[0040] Both the sense strand and the antisense strand of the RNAi construct may comprise one or more modified nucleotides. For example, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In certain embodiments, all nucleotides in the sense strand are modified nucleotides. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In other embodiments, all nucleotides in the antisense strand are modified nucleotides. In certain other embodiments, all nucleotides in the sense strand and all nucleotides in the antisense strand are modified nucleotides. In these and other embodiments, the modified nucleotides can be 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, or combinations thereof.

[0041] In certain embodiments, the modified nucleotides incorporated into one or both strands of the RNAi construct have a modification of the nucleobase (also referred to herein as "base"). A "modified nucleobase" or "modified base" refers to a base other than the naturally occurring purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases may be synthetic modifications or natural modifications, and include universal bases, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine (X), hypoxanthine (I), 2-aminoadenine, 6-methyladenine, 6-methylguanine, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azauracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine, among others.

[0042] In some embodiments, the modified base is a universal base. A "universal base" refers to a base analog that forms base pairs indiscriminately with all of the natural bases in RNA and DNA without altering the double helix structure of the resulting double-stranded region. Universal bases are known to those of skill in the art and include inosine, C-phenyl, C-naphthyl and other aromatic derivatives, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole, among others.

[0043] Other suitable modified bases that can be incorporated into the RNAi construct include those described in Herdewijn, Antisense Nucleic Acid Drug Dev., Vol. 10:297-310, 2000 and Peacock et al., J. Org. Chem., Vol. 76:7295-7300, 2011, both of which are incorporated herein by reference in their entirety. Those skilled in the art understand that guanine, cytosine, adenine, thymine, and uracil can be replaced with other nucleobases such as the modified nucleobases described above without substantially altering the base pairing properties of the polynucleotide containing nucleotides having such substituted nucleobases.

[0044] In some embodiments, the sense and antisense strands of the present RNAi construct may include one or more abasic nucleotides. An "abasic nucleotide" or "abasic nucleoside" is a nucleotide or nucleoside lacking a nucleobase at the 1'-position of the ribose sugar. In certain embodiments, the abasic nucleotide is incorporated at the end of the sense and / or antisense strand of the present RNAi construct. In one embodiment, the sense strand includes an abasic nucleotide as the terminal nucleotide at its 3'-end, its 5'-end, or both its 3'-end and 5'-end. In another embodiment, the antisense strand includes an abasic nucleotide as the terminal nucleotide at its 3'-end, its 5'-end, or both its 3'-end and 5'-end. In such embodiments where the abasic nucleotide is the terminal nucleotide, this may be an inverted nucleotide, i.e., it is linked to the adjacent nucleotide through a 3'-3' nucleotide linkage (when on the 3'-end of the strand) or a 5'-5' nucleotide linkage (when on the 5'-end of the strand), rather than the natural 3'-5' nucleotide linkage. The abasic nucleotide may also include a sugar modification such as any of the sugar modifications described above. In certain embodiments, the abasic nucleotide includes a 2'-modification such as a 2'-fluoro modification, a 2'-O-methyl modification, or a 2'-H (deoxy) modification. In one embodiment, the abasic nucleotide includes a 2'-O-methyl modification. In another embodiment, the abasic nucleotide includes a 2'-H modification (i.e., a deoxy abasic nucleotide).

[0045] In certain embodiments, the present RNAi construct may include modified nucleotides incorporated into the sense and antisense strands according to a specific pattern such as the pattern described in WO 2020 / 123410 pamphlet, which is incorporated herein by reference in its entirety. RNAi constructs having such chemical modification patterns have been shown to have improved gene silencing activity in vivo. In one embodiment, the present RNAi construct includes a sense strand and an antisense strand that include sequences that are sufficiently complementary to each other to form a double-stranded region of at least 15 base pairs, where The nucleotides at positions 2, 7, and 14 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides; The nucleotides in the sense strand at positions that pair with positions 8 - 11 and 13 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides; Neither the sense strand nor the antisense strand has more than 7 2'-fluoro-modified nucleotides in total, respectively.

[0046] In other embodiments, the RNAi construct comprises a sense strand and an antisense strand comprising sequences that are sufficiently complementary to each other to form a double-stranded region of at least 19 base pairs, wherein, the nucleotides at positions 2, 7, and 14 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides, the nucleotides at positions 4, 6, 10, and 12 (counting from the 5' end) are optionally 2'-fluoro-modified nucleotides, and all other nucleotides in the antisense strand are modified nucleotides other than 2'-fluoro-modified nucleotides; the nucleotides in the sense strand at positions that pair with positions 8 - 11 and 13 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides, the nucleotides in the sense strand at positions that pair with positions 3 and 5 (counting from the 5' end) in the antisense strand are optionally 2'-fluoro-modified nucleotides; and all other nucleotides in the sense strand are modified nucleotides other than 2'-fluoro-modified nucleotides.

[0047] In such embodiments, modified nucleotides other than 2'-fluoro-modified nucleotides can be selected from 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides. In these and other embodiments, the terminal nucleotides at the 3'-end, 5'-end, or both the 3'-end and 5'-end of the sense strand can be abasic nucleotides or deoxyribonucleotides. In such embodiments, the abasic nucleotides or deoxyribonucleotides can be in an inverted configuration, i.e., not in the natural 3'-5' nucleotide linkage, but linked to adjacent nucleotides through a 3'-3' nucleotide linkage (when on the 3'-end of the strand) or through a 5'-5' nucleotide linkage (when on the 5'-end of the strand).

[0048] In any of the above embodiments, the nucleotides at positions 2, 7, 12, and 14 (counting from the 5'-end) in the antisense strand are 2'-fluoro-modified nucleotides. In other embodiments, the nucleotides at positions 2, 4, 7, 12, and 14 (counting from the 5'-end) in the antisense strand are 2'-fluoro-modified nucleotides. In still other embodiments, the nucleotides at positions 2, 4, 6, 7, 12, and 14 (counting from the 5'-end) in the antisense strand are 2'-fluoro-modified nucleotides. In yet other embodiments, the nucleotides at positions 2, 4, 6, 7, 10, 12, and 14 (counting from the 5'-end) in the antisense strand are 2'-fluoro-modified nucleotides. In alternative embodiments, the nucleotides at positions 2, 7, 10, 12, and 14 (counting from the 5'-end) in the antisense strand are 2'-fluoro-modified nucleotides. In certain other embodiments, the nucleotides at positions 2, 4, 7, 10, 12, and 14 (counting from the 5'-end) in the antisense strand are 2'-fluoro-modified nucleotides.

[0049] In any of the above embodiments, the nucleotides in the sense strand at positions paired with positions 3, 8 to 11, and 13 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides. In some embodiments, the nucleotides in the sense strand at positions paired with positions 5, 8 to 11, and 13 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides. In other embodiments, the nucleotides in the sense strand at positions paired with positions 3, 5, 8 to 11, and 13 (counting from the 5' end) in the antisense strand are 2'-fluoro-modified nucleotides.

[0050] In some embodiments, this RNAi construct comprises a structure represented by formula (A): 5'-(N A ) x N L N L N L N L N L N L N F N L N F N F N F N F N L N L N M N L N M N L N T (n) y -3' 3'-(N B ) z N L N L N L N L N L N F N L N M N L N M N L N L N F N M N L N M N L N F N L -5' (A)

[0051] In formula (A), the upper strand listed in the 5' to 3' direction is the sense strand, and the lower strand listed in the 3' to 5' direction is the antisense strand; each N F represents a 2'-fluoro-modified nucleotide; each N M independently represents a modified nucleotide selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides; each N L independently represents a modified nucleotide selected from 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides; N T represents a modified nucleotide selected from abasic nucleotides, inverted abasic nucleotides, inverted deoxyribonucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides. x can be an integer from 0 to 4, provided that when x is 1, 2, 3, or 4, one or more of the N A nucleotides are modified nucleotides independently selected from abasic nucleotides, inverted abasic nucleotides, inverted deoxyribonucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides. One or more of the N A nucleotides can be complementary to the nucleotides in the antisense strand. y can be an integer from 0 to 4, provided that when y is 1, 2, 3, or 4, one or more n nucleotides are modified or unmodified overhang nucleotides that do not base pair with the nucleotides in the antisense strand. z can be an integer from 0 to 4, provided that when z is 1, 2, 3, or 4, NB One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2'-O-allyl modified nucleotides, BNA, and deoxyribonucleotides. N B One or more of the nucleotides, when present in the sense strand, N A Can be complementary to the nucleotide or can be overhang nucleotides that do not base pair with the nucleotide in the sense strand.

[0052] In some embodiments where the RNAi construct comprises a structure represented by formula (A), there is a nucleotide overhang at the 3' end of the sense strand (i.e., y is 1, 2, 3, or 4). In one such embodiment, y is 2. In embodiments where there is a two-nucleotide overhang at the 3' end of the sense strand (i.e., y is 2), x is 0 and z is 2, or x is 1 and z is 2. In other embodiments where the RNAi construct comprises a structure represented by formula (A), the RNAi construct comprises blunt ends at the 3' end of the sense strand and the 5' end of the antisense strand (i.e., y is 0). In such embodiments where there is no nucleotide overhang at the 3' end of the sense strand (i.e., y is 0), (i) x is 2 and z is 4, (ii) x is 3 and z is 4, (iii) x is 0 and z is 2, (iv) x is 1 and z is 2, or (v) x is 2 and z is 2. In any of the embodiments where x is greater than 0, N, the terminal nucleotide at the 5' end of the sense strand A The nucleotide can be an inverted nucleotide such as an inverted abasic nucleotide or an inverted deoxyribonucleotide.

[0053] In certain embodiments where the RNAi construct comprises a structure represented by formula (A), N at positions 4 and 12 counted from the 5' end in the antisense strand Mare each 2'-fluoro-modified nucleotides. In other embodiments, N at positions 4, 6, and 12 counted from the 5'-end in the antisense strand M are each 2'-fluoro-modified nucleotides. In yet other embodiments, N at positions 4, 6, 10, and 12 counted from the 5'-end in the antisense strand M are each 2'-fluoro-modified nucleotides. In an alternative embodiment where the present RNAi construct comprises a structure represented by formula (A), N at positions 10 and 12 counted from the 5'-end in the antisense strand M are each 2'-fluoro-modified nucleotides. In related embodiments, N at positions 4, 10, and 12 counted from the 5'-end in the antisense strand M are each 2'-fluoro-modified nucleotides. In other alternative embodiments where the present RNAi construct comprises a structure represented by formula (A), N at positions 4, 6, and 10 counted from the 5'-end in the antisense strand M are each 2'-O-methyl-modified nucleotides, and N at position 12 counted from the 5'-end in the antisense strand M is a 2'-fluoro-modified nucleotide. In some embodiments where the present RNAi construct comprises a structure represented by formula (A), each N in the sense strand M is a 2'-O-methyl-modified nucleotide. In other embodiments, each N in the sense strand M is a 2'-fluoro-modified nucleotide. In still other embodiments where the present RNAi construct comprises a structure represented by formula (A), each N in both the sense strand and the antisense strand M is a 2'-O-methyl-modified nucleotide.

[0054] In any of the above embodiments where the present RNAi construct comprises a structure represented by formula (A), each N in both the sense strand and the antisense strand L can be a 2'-O-methyl-modified nucleotide. In these embodiments, and in any of the above embodiments, N in formula (A) TIt can be an inverted abasic nucleotide, an inverted deoxyribonucleotide, or a 2'-O-methyl modified nucleotide.

[0055] In other embodiments, the RNAi construct comprises a structure represented by formula (B): 5'-(N A ) x N L N L N L N L N M N L N F N F N F N F N L N L N L N L N L N L N L N L N T (n) y -3’ 3’-(N B ) z N L N L N L N M N L N F N L N M N L N L N M N M N M N M N L N M N L N F N L -5’ (B)

[0056] In formula (B), the upper strand listed in the 5' to 3' direction is the sense strand, and the lower strand listed in the 3' to 5' direction is the antisense strand; each N F represents a 2'-fluoro modified nucleotide; each N Mrepresents, independently, a modified nucleotide selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides; each N L represents, independently, a modified nucleotide selected from 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides; N T represents a modified nucleotide selected from abasic nucleotides, inverted abasic nucleotides, inverted deoxyribonucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides. x can be an integer from 0 to 4, provided that when x is 1, 2, 3, or 4, one or more of the N A nucleotides are modified nucleotides independently selected from abasic nucleotides, inverted abasic nucleotides, inverted deoxyribonucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides. One or more of the N A nucleotides can be complementary to the nucleotides in the antisense strand. y can be an integer from 0 to 4, provided that when y is 1, 2, 3, or 4, one or more n nucleotides are modified or unmodified overhang nucleotides that do not base pair with the nucleotides in the antisense strand. z can be an integer from 0 to 4, provided that when z is 1, 2, 3, or 4, one or more of the N B nucleotides are modified nucleotides independently selected from 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, BNA, and deoxyribonucleotides. N BWhen one or more of the nucleotides are present in the sense strand, N A It may be complementary to the nucleotide or an overhang nucleotide that does not base pair with the nucleotide in the sense strand.

[0057] In some embodiments where the RNAi construct comprises a structure represented by formula (B), a nucleotide overhang is present at the 3'-end of the sense strand (i.e., y is 1, 2, 3, or 4). In one such embodiment, y is 2. In an embodiment where a two-nucleotide overhang is present at the 3'-end of the sense strand (i.e., y is 2), x is 0 and z is 2, or x is 1 and z is 2. In other embodiments where the RNAi construct comprises a structure represented by formula (B), the RNAi construct comprises blunt ends at the 3'-end of the sense strand and the 5'-end of the antisense strand (i.e., y is 0). In such embodiments where no nucleotide overhang is present at the 3'-end of the sense strand (i.e., y is 0), (i) x is 2 and z is 4, (ii) x is 3 and z is 4, (iii) x is 0 and z is 2, (iv) x is 1 and z is 2, or (v) x is 2 and z is 2. In any of the embodiments where x is greater than 0, N, which is the terminal nucleotide at the 5'-end of the sense strand A The nucleotide can be an inverted nucleotide, such as an inverted abasic nucleotide or an inverted deoxyribonucleotide.

[0058] In certain embodiments where the RNAi construct comprises a structure represented by formula (B), the N at positions 4, 6, 8, 9, and 16 counting from the 5'-end in the antisense strand M are each 2'-fluoro-modified nucleotides, and the N at positions 7 and 12 counting from the 5'-end in the antisense strand M are each 2'-O-methyl-modified nucleotides. In other embodiments, the N at positions 4 and 6 counting from the 5'-end in the antisense strand M are each 2'-fluoro-modified nucleotides, and the N at positions 7-9 counting from the 5'-end in the antisense strandM are each 2'-O-methyl modified nucleotides. In yet other embodiments, N at positions 4, 6, 8, 9 and 16 counted from the 5'-end in the antisense strand M are each 2'-O-methyl modified nucleotides, and N at positions 7 and 12 counted from the 5'-end in the antisense strand M are each 2'-fluoro modified nucleotides. In an alternative embodiment where the RNAi construct comprises a structure represented by formula (B), N at positions 4, 6, 8, 9 and 12 counted from the 5'-end in the antisense strand M are each 2'-O-methyl modified nucleotides, and N at positions 7 and 16 counted from the 5'-end in the antisense strand M are each 2'-fluoro modified nucleotides. In certain other embodiments where the RNAi construct comprises a structure represented by formula (B), N at positions 7, 8, 9 and 12 counted from the 5'-end in the antisense strand M are each 2'-O-methyl modified nucleotides, and N at positions 4, 6, and 16 counted from the 5'-end in the antisense strand M are each 2'-fluoro modified nucleotides. In these and other embodiments where the RNAi construct comprises a structure represented by formula (B), N in the sense strand M is a 2'-fluoro modified nucleotide. In an alternative embodiment, N in the sense strand M is a 2'-O-methyl modified nucleotide.

[0059] In any of the above embodiments where the RNAi construct comprises a structure represented by formula (B), each N in both the sense strand and the antisense strand L can be a 2'-O-methyl modified nucleotide. In these embodiments, and in any of the above embodiments, N in formula (B) T can be an inverted abasic nucleotide, an inverted deoxyribonucleotide or a 2'-O-methyl modified nucleotide.

[0060] This RNAi construct may also include one or more modified internucleotide linkages. As used herein, the term "modified internucleotide linkage" refers to an internucleotide linkage other than the natural 3'-5' phosphodiester linkage. In some embodiments, the modified internucleotide linkage is a phosphorus-containing internucleotide linkage, such as a phosphotriester, aminoalkyl phosphotriester, alkyl phosphonate (e.g., methyl phosphonate, 3'-alkylene phosphonate), phosphinate, phosphoramidate (e.g., 3'-aminophosphoramidate and aminoalkyl phosphoramidate), phosphorothioate, chiral phosphorothioate, phosphorodithioate, thiophosphoramidate, thionoalkyl phosphonate, thionoalkyl phosphotriester, and boranophosphate. In one embodiment, the modified internucleotide linkage is a 2'-5' phosphodiester linkage. In other embodiments, the modified internucleotide linkage is a non-phosphorus-containing internucleotide linkage and can thus be referred to as a modified nucleoside linkage. Such non-phosphorus-containing linkages include morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane linkages (-O-Si(H)2-O-); sulfide, sulfoxide, and sulfone linkages; formacetyl and thioformacetyl linkages; alkene-containing backbones; sulfamate backbones; methylene methylimino (-CH2-N(CH3)-O-CH2-) and methylene hydrazino linkages; sulfonate and sulfonamide linkages; amide linkages; and others having mixed N, O, S, and CH2 constituent moieties, but are not limited thereto. In one embodiment, the modified nucleoside linkage is a peptide-based linkage (e.g., aminoethylglycine) such as those described in U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262 for generating peptide nucleic acids or PNAs.Other suitable internucleotide linkages and inter-nucleoside linkages that can be used in this RNAi construct are described in U.S. Patent No. 6,693,187, U.S. Patent No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol. 19:937-954, 2012 (all of which are incorporated herein by reference in their entirety).

[0061] In certain embodiments, the RNAi construct comprises one or more phosphorothioate internucleotide linkages. The phosphorothioate internucleotide linkages can be present in the sense strand, the antisense strand, or both strands of the RNAi construct. For example, in some embodiments, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In other embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In still other embodiments, both strands comprise 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. The RNAi construct can comprise one or more phosphorothioate internucleotide linkages at the 3′ end, 5′ end, or both the 3′ and 5′ ends of the sense strand, antisense strand, or both strands. For example, in certain embodiments, the RNAi construct comprises about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 3′ end of the sense strand, antisense strand, or both strands. In other embodiments, the RNAi construct comprises about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) consecutive phosphorothioate internucleotide linkages at the 5′ end of the sense strand, antisense strand, or both strands. In some embodiments, the antisense strand comprises at least 1 but 6 or fewer phosphorothioate internucleotide linkages and the sense strand comprises at least 1 but 4 or fewer phosphorothioate internucleotide linkages. In other embodiments, the antisense strand comprises at least 1 but 4 or fewer phosphorothioate internucleotide linkages and the sense strand comprises at least 1 but 2 or fewer phosphorothioate internucleotide linkages.

[0062] In some embodiments, the present RNAi construct comprises a single phosphorothioate internucleotide bond between the terminal nucleotides at the 3'-end of the sense strand. In other embodiments, the present RNAi construct comprises two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at the 3'-end of the sense strand. In one embodiment, the present RNAi construct comprises a single phosphorothioate internucleotide bond between the terminal nucleotides at the 3'-end of the sense strand and a single phosphorothioate internucleotide bond between the terminal nucleotides at the 3'-end of the antisense strand. In another embodiment, the present RNAi construct comprises two consecutive phosphorothioate internucleotide bonds (i.e., phosphorothioate internucleotide bonds in the bond between the first and second nucleotides at the 3'-end of the antisense strand) between the terminal nucleotides at the 3'-end of the antisense strand. In another embodiment, the present RNAi construct comprises two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand. In yet another embodiment, the present RNAi construct comprises two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide bonds at the 5'-end of the sense strand. In still another embodiment, the present RNAi construct comprises two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at the 3'-end of the sense strand. In another embodiment, the present RNAi construct comprises two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at both the 3'-end and 5'-end of the antisense strand and two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at both the 3'-end and 5'-end of the sense strand (i.e., phosphorothioate internucleotide bonds in the bond between the first and second nucleotides at both the 5'-end and 3'-end of the antisense strand and phosphorothioate internucleotide bonds in the bond between the first and second nucleotides at both the 5'-end and 3'-end of the sense strand).In yet another embodiment, the RNAi construct includes two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3' and 5' ends of the antisense strand, and a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3' end of the sense strand. In any of the embodiments where one or both strands include one or more phosphorothioate internucleotide linkages, the remaining internucleotide linkages within the strand can be natural 3' to 5' phosphodiester linkages. For example, in some embodiments, each internucleotide linkage of the sense and antisense strands is selected from phosphodiester and phosphorothioate, and at least one internucleotide linkage is phosphorothioate.

[0063] In embodiments where the RNAi construct includes nucleotide overhangs, two or more of the unpaired nucleotides in the overhang can be linked by phosphorothioate internucleotide linkages. In certain embodiments, all of the unpaired nucleotides in the nucleotide overhang at the 3' end of the antisense strand and / or the sense strand are linked by phosphorothioate internucleotide linkages. In other embodiments, all of the unpaired nucleotides in the nucleotide overhang at the 5' end of the antisense strand and / or the sense strand are linked by phosphorothioate internucleotide linkages. In yet other embodiments, all of the unpaired nucleotides in any nucleotide overhang are linked by phosphorothioate internucleotide linkages.

[0064] The incorporation of phosphorothioate internucleotide linkages introduces additional chiral centers at the phosphorus atoms in the oligonucleotide, and thus gives rise to diastereomeric pairs (Rp and Sp) at each phosphorothioate internucleotide linkage. Diastereomers or diastereoisomers are different stereoisomers of a compound that have the same molecular formula and sequence of bonded atoms, but differ in the three-dimensional orientation of those atoms in space. Unlike enantiomers, diastereomers are not mirror images of each other. Each chiral phosphate atom can be in the "R" configuration (Rp) or the "S" configuration (Sp). In certain embodiments, the RNAi construct can include one or more phosphorothioate internucleotide linkages selected such that the chiral phosphates are predominantly in either the Rp or Sp configuration. For example, in some embodiments where the RNAi construct has one or more phosphorothioate internucleotide linkages, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% of the chiral phosphates are in the Sp configuration. In other embodiments where the RNAi construct has one or more phosphorothioate internucleotide linkages, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% of the chiral phosphates are in the Rp configuration. All chiral phosphates in the RNAi construct can be in either the Sp or Rp configuration (i.e., the RNAi construct is stereopure). In some embodiments, all chiral phosphates in the RNAi construct are in the Sp configuration. In some embodiments, all chiral phosphates in the RNAi construct are in the Rp configuration.

[0065] In certain embodiments, the chiral phosphates in the present RNAi construct may have different configurations at different positions in the sense or antisense strand. In one such embodiment where the RNAi construct contains one or two phosphorothioate internucleotide linkages at the 5' end of the antisense strand, the chiral phosphate at the 5' end of the antisense strand may be in the Rp configuration. In another such embodiment where the RNAi construct contains one or two phosphorothioate internucleotide linkages at the 3' end of the antisense strand, the chiral phosphate at the 3' end of the antisense strand may be in the Sp configuration. In certain embodiments, the RNAi construct contains two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3' and 5' ends of the antisense strand and two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at the 3' end of the sense strand, the chiral phosphate at the 5' end of the antisense strand is in the Rp configuration, the chiral phosphate at the 3' end of the antisense strand is in the Sp configuration, and the chiral phosphate at the 3' end of the sense strand may be either in the Rp or Sp configuration. In certain other embodiments, the RNAi construct contains two consecutive phosphorothioate internucleotide linkages between the terminal nucleotides at both the 3' and 5' ends of the antisense strand and a single phosphorothioate internucleotide linkage between the terminal nucleotides at the 3' end of the sense strand, the chiral phosphate at the 5' end of the antisense strand is in the Rp configuration, the chiral phosphate at the 3' end of the antisense strand is in the Sp configuration, and the chiral phosphate at the 3' end of the sense strand may be either in the Rp or Sp configuration.Methods for controlling the stereochemistry of phosphorothioate linkages during oligonucleotide synthesis are known to those skilled in the art, and such methods can include those described in Nawrot and Rebowska, Curr. Protoc. Nuceleic Acid Chem. 2009, Chapter 4: doi:10.1002 / 0471142700.nc0434s362009; Jahns et al., Nat. Commun., Vol. 6:6317, 2015; Knouse et al., Science, Vol. 361:1234-1238, 2018; and Sakamuri et al., ChemBioChem, Vol. 21(9):1304-1308, 2020.

[0066] In some embodiments of this RNAi construct, the 5' ends of the sense strand, the antisense strand, or both the antisense strand and the sense strand contain a phosphate moiety. As used herein, the term "phosphate moiety" refers to terminal phosphate groups including unmodified phosphate (-O-P=O)(OH)OH) as well as modified phosphates. Modified phosphates are those in which one or more of the O and OH groups are replaced by H, O, S, N(R), or alkyl (e.g., C1-C 12 ), where R is H, an amino protecting group, or unsubstituted or substituted alkyl (e.g., C1-C 12 ). Representative phosphate moieties include 5'-monophosphate; 5'-diphosphate; 5'-triphosphate; 5'-guanosine cap (7-methylated or non-methylated); 5'-adenosine cap or any other modified or unmodified nucleotide cap structure; 5'-monothiophosphate (phosphorothioate); 5'-monodithiophosphate (phosphorodithioate); 5'-α-thiotriphosphate; 5'-γ-thiotriphosphate; 5'-phosphoramidate; 5'-vinyl phosphate; 5'-alkyl phosphonate (e.g., alkyl = methyl, ethyl, isopropyl, propyl, etc.); and 5'-alkyl ether phosphonate (e.g., alkyl ether = methoxymethyl, ethoxymethyl, etc.), but are not limited thereto.

[0067] The modified nucleotides that can be incorporated into the present RNAi construct can have more than one chemical modification as described herein. For example, the modified nucleotide can have a modification to the ribose sugar as well as a modification to the nucleobase. By way of example, the modified nucleotide can include a 2'-sugar modification (e.g., 2'-fluoro or 2'-O-methyl) and can include a modified base (e.g., 5-methylcytosine or pseudouracil). In other embodiments, the modified nucleotide can include a sugar modification in combination with a modification to the 5'-phosphate that will result in a modified internucleotide or inter-nucleoside linkage when the modified nucleotide is incorporated into the polynucleotide. For example, in some embodiments, the modified nucleotide can include a 2'-fluoro modification, a 2'-O-methyl modification or a bicyclic sugar modification as well as a sugar modification such as a 5'-phosphorothioate group. Thus, in some embodiments, one or both strands of the present RNAi construct can include a combination of 2'-modified nucleotides or BNA and phosphorothioate internucleotide linkages. In certain embodiments, both the sense and antisense strands of the present RNAi construct include a combination of 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides and phosphorothioate internucleotide linkages. Representative RNAi constructs containing modified nucleotides and internucleotide linkages are shown in Table 2.

[0068] Representative modification patterns for RNAi constructs are shown in FIGS. 7A-7R. These patterns can be used in connection with the RNAi duplexes disclosed herein or generally in connection with RNAi constructs. FIGS. 7A-7R each show a hybridized sense strand (top) and antisense strand (bottom) in which each nucleotide is modified. The black circles in FIGS. 7A-7R correspond to 2'-O-methyl ribonucleotides, while the white circles correspond to 2'-deoxy-2'-fluoro ("2'-fluoro") ribonucleotides. The patterned circles correspond to inverted abasic deoxynucleotides. The thick lines indicate where phosphorothioate bonds are used instead of standard phosphodiester bonds between nucleotides. Finally, the arrows represent the locations where ligands (e.g., fatty acids such as GalNAc or C22) can be attached to the present RNAi construct. As demonstrated in the following examples, these modification patterns are effective over a range of various trigger sequences in the FAM13A sequence, indicating that they are generally applicable to RNAi constructs.

[0069] The present RNAi construct can be readily prepared using techniques known in the art, such as conventional nucleic acid solid-phase synthesis. The polynucleotides of the present RNAi construct can be constructed using suitable nucleic acid synthesizers with standard nucleotides or nucleoside precursors (e.g., phosphoramidites). Automated nucleic acid synthesizers are commercially available from several vendors, including the DNA / RNA synthesizer from Applied Biosystems (Foster City, CA), the MerMade synthesizer from BioAutomation (Irving, TX), and the OligoPilot synthesizer from GE Healthcare Life Sciences (Pittsburgh, PA). A representative method for synthesizing the present RNAi construct is described in Example 3.

[0070] Oligonucleotides can be synthesized via phosphoramidite chemistry using a 2'-silyl protecting group together with an acid-labile dimethoxytrityl (DMT) at the 5'-position of the ribonucleoside. Final deprotection conditions are known not to significantly degrade the RNA product. All syntheses can be performed on any automated or manual synthesizer, on a large, medium or small scale. Syntheses can also be carried out on multiple well plates, columns or glass slides.

[0071] The 2'-O-silyl group can be removed via exposure to fluoride ions, which can include any source of fluoride ions, such as salts containing fluoride ions paired with inorganic counterions, such as cesium fluoride and potassium fluoride, or salts containing fluoride ions paired with organic counterions, such as tetraalkylammonium fluoride. Crown ether catalysts can be utilized in combination with inorganic fluoride in the deprotection reaction. Representative fluoride ion sources are tetrabutylammonium fluoride or amine hydrofluoride (e.g., by combining triethylamine and aqueous HF in an aprotic dipolar solvent such as dimethylformamide).

[0072] By selecting protecting groups for use in phosphite triesters and phosphotriesters, the stability of the triester to fluoride can be varied. Methyl protection of a phosphotriester or phosphite triester can stabilize the bond to fluoride ions and improve process yields.

[0073] Since ribonucleosides have a reactive 2'-hydroxyl substituent, it may be desirable to protect the reactive 2'-position in RNA with a protecting group that is orthogonal to the 5'-O-dimethoxytrityl protecting group, e.g., one that is stable to acid treatment. Silyl protecting groups meet this condition and can be readily removed in the final fluoride deprotection step, which results in minimal RNA degradation.

[0074] In a standard phosphoramidite coupling reaction, a tetrazole catalyst can be used. Representative catalysts include, for example, tetrazole, S-ethyl-tetrazole, benzylthiotetrazole, p-nitrophenyltetrazole.

[0075] As will be appreciated by those skilled in the art, additional methods for synthesizing the RNAi constructs described herein will be apparent to those skilled in the art. In addition, various synthetic steps may be carried out in alternative orders or sequences to obtain the desired compounds. Other synthetic chemical transformations useful in the synthesis of the RNAi constructs described herein, protecting groups (e.g., for hydroxyl, amino, etc. present in the bases), and protecting group methodologies (protection and deprotection) are known in the art and are described, for example, in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser’s Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995) and their later editions. Custom synthesis of RNAi constructs is also available from several commercial vendors including Dharmacon, Inc. (Lafayette, CO), AxoLabs GmbH (Kulmbach, Germany), and Ambion, Inc. (Foster City, CA).

[0076] This RNAi construct may contain a ligand. As used herein, "ligand" refers to any compound or molecule that can interact directly or indirectly with another compound or molecule. The interaction between a ligand and another compound or molecule can elicit a biological response (e.g., initiate a signal transduction cascade, induce receptor-dependent endocytosis) or simply be a physical association. A ligand can change one or more properties of the double-stranded RNA molecule to which it binds, such as the pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, intracellular uptake, charge, and / or clearance properties of the RNA molecule.

[0077] The ligand can be a serum protein (e.g., human serum albumin, low density lipoprotein, globulin), a cholesterol moiety, a vitamin (biotin, vitamin E, vitamin B 12) can include a folic acid moiety, a steroid, a bile acid (e.g., cholic acid), a fatty acid (e.g., palmitic acid, myristic acid), a carbohydrate (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), a glycoside, a phospholipid, or an antibody or a binding fragment thereof (e.g., an antibody or binding fragment that targets the present RNAi construct to a specific cell type such as the liver). Other examples of ligands include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules such as adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, O3-(oleoyl) lithocholic acid, O3-(oleoyl) chenodeoxycholic acid, dimethoxytrityl or phenoxazine), peptides (e.g., antennapedia peptide, Tat peptide, RGD peptide), alkylating agents, polymers such as polyethylene glycol (PEG) (e.g., PEG-40K), polyamino acids and polyamines (e.g., spermine, spermidine).

[0078] In certain embodiments, the ligand has endosomolytic properties. An endosomolytic ligand promotes endosomal lysis and / or the transport of the present RNAi construct or its components from the endosome to the cytoplasm of the cell. The endosomolytic ligand can be a polycationic peptide or peptidomimetic that exhibits pH-dependent membrane activity and membrane fusogenicity. In one embodiment, the endosomolytic ligand assumes its active conformation at the pH of the endosome. The "active" conformation is the conformation in which the endosomolytic ligand promotes endosomal lysis and / or the transport of the present RNAi construct or its components from the endosome to the cytoplasm of the cell. Representative endosomolytic ligands include the GALA peptide (Subbarao et al., Biochemistry, Vol. 26:2964-2972, 1987), the EALA peptide (Vogel et al., J. Am. Chem. Soc., Vol. 118:1581-1586, 1996), and derivatives thereof (Turk et al., Biochem. Biophys. Acta, Vol. 1559:56-68, 2002). In one embodiment, the endosomolytic component can contain chemical groups (e.g., amino acids) that change in charge or protonation in response to a change in pH. The endosomolytic component can be linear or branched.

[0079] In some embodiments, the ligand comprises a lipid or other hydrophobic molecule. In one embodiment, the ligand comprises a cholesterol moiety or other steroid. Cholesterol-conjugated oligonucleotides have been reported to be more active than their unconjugated oligonucleotides (Manoharan, Antisense Nucleic Acid Drug Development, Vol. 12:103-228, 2002). Ligands comprising cholesterol moieties and other lipids for conjugating to nucleic acid molecules are also described in U.S. Patent Nos. 7,851,615; 7,745,608; and 7,833,992 (all of which are incorporated herein by reference in their entirety). In another embodiment, the ligand comprises a folic acid moiety. Polynucleotides conjugated to folic acid moieties can be taken up by cells via the receptor-dependent endocytosis pathway. Such folic acid-polynucleotide conjugates are described in U.S. Patent No. 8,188,247 (which is incorporated herein by reference in its entirety).

[0080] In certain embodiments, it is desirable to specifically deliver the present RNAi construct to hepatocytes to specifically reduce the expression of FAM13A protein in the liver. Thus, in certain embodiments, the ligand targets the specific delivery of the present RNAi construct to hepatocytes (e.g., hepatocytes) using various approaches, as described in more detail below. In certain embodiments, the present RNAi construct is targeted to hepatocytes by a ligand that binds to an asialoglycoprotein receptor (ASGR) or a component thereof (e.g., ASGR1, ASGR2) expressed on the surface.

[0081] In some embodiments, the RNAi construct can be specifically targeted to the liver by employing a ligand that binds or interacts with a protein expressed on the surface of hepatocytes. For example, in certain embodiments, the ligand can include an antigen-binding protein (e.g., an antibody or a binding fragment thereof (e.g., Fab, scFv)) that specifically binds to a receptor expressed on hepatocytes, such as the asialoglycoprotein receptor and the LDL receptor. In some embodiments, the ligand includes an antibody or a binding fragment thereof that specifically binds to ASGR1 and / or ASGR2. In another embodiment, the ligand includes a Fab fragment of an antibody that specifically binds to ASGR1 and / or ASGR2. A "Fab fragment" is composed of one immunoglobulin light chain (i.e., variable light chain region (VL) and constant region (CL)), and the CH1 region and variable region (VH) of one immunoglobulin heavy chain. In another embodiment, the ligand includes a single-chain variable antibody fragment (scFv fragment) of an antibody that specifically binds to ASGR1 and / or ASGR2. An "scFv fragment" includes the VH region and VL region of an antibody, and these regions are present in a single-chain polypeptide, optionally including a peptide linker between the VH region and the VL region, whereby the Fv can form the desired structure for antigen binding. Representative antibodies and binding fragments thereof that specifically bind to ASGR1 and can be used as ligands for targeting the present RNAi construct to the liver are described in International Publication No. WO 2017 / 058944 (which is incorporated herein by reference in its entirety). Other antibodies or binding fragments thereof that specifically bind to ASGR1, the LDL receptor, or other proteins expressed on the surface of the liver and are suitable for use as ligands in the present RNAi construct are commercially available.

[0082] In certain embodiments, it is desirable to specifically deliver the present RNAi construct to adipose tissue or adipocytes to specifically reduce the expression of FAM13A protein in adipocytes. Thus, in certain embodiments, the ligand specifically targets the delivery of the present RNAi construct to adipocytes (e.g., subcutaneous white adipose tissue (scWAT) or epididymal white adipose tissue (eWAT)) using various approaches as described in more detail below. In certain embodiments, the present RNAi construct is targeted to adipose tissue or cells by complexation with a long-chain fatty acid that is a saturated or unsaturated fatty acid containing 12 to 24 carbon atoms. In some embodiments, the long-chain fatty acid is lauric acid (C12), myristic acid (C14), palmitic acid (C16), stearic acid (C18), eicosapentaenoic acid (C20), docosanoic acid (C22), or docosahexanoic acid (C24).

[0083] In certain embodiments, it is desirable to systemically deliver the present RNAi construct to reduce the expression of FAM13A protein in multiple or all cell types. Thus, in certain embodiments, the ligand targets the delivery of the present RNAi construct using methods known in the art to facilitate cellular delivery of siRNA (see, e.g., U.S. Patent No. 10,633,653 and International Publication No. WO 2022 / 016043, each of which is incorporated by reference in its entirety). In some embodiments, the present RNAi construct is targeted to cells by complexation with cholesterol, α-tocopherol, or a fatty acid. In some embodiments, the present RNAi construct is targeted to cells by complexation with an ω-fatty acid. In certain embodiments, the present RNAi construct is targeted to cells by complexation with a long-chain fatty acid such as lauric acid (C12), myristic acid (C14), palmitic acid (C16), stearic acid (C18), eicosapentaenoic acid (C20), docosanoic acid (C22), or docosahexanoic acid (C24).

[0084] In certain embodiments, the ligand comprises a carbohydrate. "Carbohydrate" refers to a compound composed of one or more monosaccharide units (which can be linear, branched or cyclic) having at least 6 carbon atoms, with oxygen, nitrogen or sulfur atoms bonded to each carbon atom. Carbohydrates include, but are not limited to, sugars (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides containing about 4, 5, 6, 7, 8 or 9 monosaccharide units), and polysaccharides such as starch, glycogen, cellulose and polysaccharide gums. In some embodiments, the carbohydrate incorporated into the ligand is a monosaccharide selected from pentose, hexose or heptose, and disaccharides and trisaccharides containing such monosaccharide units. In other embodiments, the carbohydrate incorporated into the ligand is an amino sugar, e.g., galactosamine, glucosamine, N-acetylgalactosamine and N-acetylglucosamine.

[0085] In some embodiments, the ligand comprises a hexose or a hexosamine. The hexose can be selected from glucose, galactose, mannose, fucose, or fructose. The hexosamine can be selected from fructosamine, galactosamine, glucosamine, or mannosamine. In certain embodiments, the ligand comprises glucose, galactose, galactosamine, or glucosamine. In one embodiment, the ligand comprises glucose, glucosamine, or N-acetylglucosamine. In another embodiment, the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine. In certain embodiments, the ligand comprises N-acetyl-galactosamine. Ligands comprising glucose, galactose, and N-acetyl-galactosamine (GalNAc) are particularly effective for targeting compounds to hepatocytes because such ligands bind to the ASGR expressed on the surface of hepatocytes. See, e.g., D’Souza and Devarajan, J. Control Release, Vol. 20:126-139, 2015. Examples of GalNAc- or galactose-containing ligands that can be incorporated into this RNAi construct are described in U.S. Patent Nos. 7,491,805; 8,106,022; and 8,877,917; U.S. Patent Application Publication No. 20030130186; and International Publication No. 2013166155 (each of which is incorporated herein by reference in its entirety).

[0086] In certain embodiments, the ligand comprises a multivalent carbohydrate moiety. As used herein, "multivalent carbohydrate moiety" refers to a moiety that includes two or more carbohydrate units capable of independently binding or interacting with other molecules. For example, a multivalent carbohydrate moiety includes two or more binding domains composed of carbohydrates that can bind to two or more different molecules, or two or more different sites on the same molecule. The valence of the carbohydrate moiety indicates the number of individual binding domains within the carbohydrate moiety. For example, the terms "monovalent," "divalent," "trivalent," and "tetravalent" with respect to a carbohydrate moiety refer to carbohydrate moieties having 1, 2, 3, and 4 binding domains, respectively. The multivalent carbohydrate moiety can include a multivalent lactose moiety, a multivalent galactose moiety, a multivalent glucose moiety, a multivalent N-acetyl-galactosamine moiety, a multivalent N-acetyl-glucosamine moiety, a multivalent mannose moiety, or a multivalent fucose moiety. In some embodiments, the ligand comprises a multivalent galactose moiety. In other embodiments, the ligand comprises a multivalent N-acetyl-galactosamine moiety. In these and other embodiments, the multivalent carbohydrate moiety can be divalent, trivalent, or tetravalent. In such embodiments, the multivalent carbohydrate moiety can be bifurcated or trifurcated. In some embodiments, the multivalent N-acetyl-galactosamine moiety is trivalent or tetravalent. In some embodiments, the multivalent galactose moiety is trivalent or tetravalent. Representative trivalent and tetravalent GalNAc-containing ligands for incorporation into this RNAi construct are detailed below.

[0087] A ligand can bind or complex directly or indirectly to the RNA molecule of the present RNAi construct. For example, in some embodiments, the ligand is covalently bound directly to the sense strand or the antisense strand of the present RNAi construct. In other embodiments, the ligand is covalently bound to the sense strand or the antisense strand of the present RNAi construct via a linker. The ligand can bind to the nucleobase, sugar moiety, or internucleotide linkage of the polynucleotide (e.g., sense strand or antisense strand) of the present RNAi construct. Complexation or binding to a purine nucleobase or a derivative thereof can occur at any position including intra-ring atoms and exocyclic atoms. In certain embodiments, the 2-, 6-, 7-, or 8-position of the purine nucleobase is bound to the ligand. Complexation or binding to a pyrimidine nucleobase or a derivative thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of the pyrimidine nucleobase can be bound to the ligand. Complexation or binding to the sugar moiety of the nucleotide can occur at any carbon atom. Exemplary carbon atoms of the sugar moiety to which the ligand can bind include the 2’, 3’, and 5’ carbon atoms. The 1’ position can also be bound to the ligand in, for example, abasic nucleotides. The internucleotide linkage can also support binding of the ligand. In the case of a phosphorus-containing linkage (e.g., phosphodiester, phosphorothioate, phosphorodithiotate, phosphoramidate, etc.), the ligand can be bound directly to the phosphorus atom or to an O, N, or S atom bound to the phosphorus atom. In the case of an amine- or amide-containing internucleoside linkage (e.g., PNA), the ligand can be bound to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

[0088] In some embodiments, the ligand can be attached to either the 3' or 5' end of either the sense strand or the antisense strand. In certain embodiments, the ligand is covalently attached to the 5' end of the sense strand. In such embodiments, the ligand is attached to the 5' terminal nucleotide of the sense strand. In these and other embodiments, the ligand is attached at the 5' position of the 5' terminal nucleotide of the sense strand. In embodiments where the inverted abasic nucleotide is the 5' terminal nucleotide of the sense strand and is linked to an adjacent nucleotide via a 5'-5' internucleotide bond, the ligand can be attached at the 3' position of the inverted abasic nucleotide. In other embodiments, the ligand is covalently attached to the 3' end of the sense strand. For example, in some embodiments, the ligand is attached to the 3' terminal nucleotide of the sense strand. In certain such embodiments, the ligand is attached at the 3' position of the 3' terminal nucleotide of the sense strand. In embodiments where the inverted abasic nucleotide is the 3' terminal nucleotide of the sense strand and is linked to an adjacent nucleotide via a 3'-3' internucleotide bond, the ligand can be attached at the 5' position of the inverted abasic nucleotide. In alternative embodiments, the ligand is near the 3' end of the sense strand but is attached prior to one or more terminal nucleotides (i.e., prior to 1, 2, 3, or 4 terminal nucleotides). In some embodiments, the ligand is attached at the 2' position of the sugar of the 3' terminal nucleotide of the sense strand. In other embodiments, the ligand is attached at the 2' position of the sugar of the 5' terminal nucleotide of the sense strand.

[0089] In certain embodiments, the ligand is attached to the sense or antisense strand via a linker. A "linker" is an atom or group of atoms that covalently attaches the ligand to the polynucleotide component of the present RNAi construct. The linker can be about 1 to about 30 atoms in length, about 2 to about 28 atoms in length, about 3 to about 26 atoms in length, about 4 to about 24 atoms in length, about 6 to about 20 atoms in length, about 7 to about 20 atoms in length, about 8 to about 20 atoms in length, about 8 to about 18 atoms in length, about 10 to about 18 atoms in length, and about 12 to about 18 atoms in length. In some embodiments, the linker can include a bifunctional linking moiety, generally including an alkyl moiety having two functional groups. One of the functional groups is selected to bind to the compound of interest (e.g., the sense or antisense strand of the present RNAi construct), and the other is selected to bind essentially to any selected group such as a ligand as described herein. In certain embodiments, the linker includes a chain structure or oligomer of repeating units such as ethylene glycol units or amino acid units. Examples of functional groups typically used in bifunctional linking moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups, and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturation (e.g., double bond or triple bond), and the like.

[0090] Linkers that can be used to attach a ligand to the sense or antisense strand in the present RNAi construct include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 6-aminohexanoic acid, substituted C1-C 10 alkyl, substituted or unsubstituted C2-C 10 alkenyl or substituted or unsubstituted C2-C 10 alkynyl. Suitable substituents for such linkers include, but are not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0091] In certain embodiments, the linker is cleavable. A cleavable linker is sufficiently stable outside the cell but is cleaved upon entry into the target cell, releasing the two portions that the linker holds together. In some embodiments, the cleavable linker is cleaved at least 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or more, or at least 100-fold faster in the target cell or under a first reference condition (e.g., selected to mimic or correspond to intracellular conditions) than in the subject's blood or under a second reference condition (e.g., selected to mimic or correspond to conditions found in blood or serum).

[0092] Cleavable linkers are sensitive to the presence of a cleaving agent, such as pH, redox potential, or a degradable molecule. Generally, the cleaving agent is more prevalent or found at higher levels or activities inside the cell than in serum or blood. Examples of such degradable agents include redox agents, such as oxidoreductases or reductases, selected for a particular substrate or without substrate specificity, or reductants such as mercaptans that are present in cells and can decompose a redox-cleavable linker by reduction; esterases; agents that can create an endosomal or acidic environment, such as those that result in a pH of 5 or less; enzymes, peptidases (which may be substrate-specific), and phosphatases that can hydrolyze or degrade an acid-cleavable linker by acting as a general acid.

[0093] Cleavable linkers may include a pH-sensitive moiety. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, in the range of about 7.1 - 7.3. Endosomes have a more acidic pH in the range of 5.5 - 6.0, and lysosomes have a pH of approximately 5.0, which is even more acidic. Some linkers have a cleavable group that is cleaved at a preferred pH, thereby releasing the RNA molecule from the ligand into the interior of the cell or into a desired compartment of the cell.

[0094] The linker may contain a cleavable group that can be cleaved by a specific enzyme. The type of cleavable group incorporated into the linker may depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to an RNA molecule through a linker containing an ester group. Liver cells are rich in esterases, and thus the linker is cleaved more efficiently in liver cells than in cell types that are not rich in esterases. Other types of cells rich in esterases include cells of the lung, renal cortex, and testis. When targeting peptidase-rich cells such as liver cells and synoviocytes, a linker containing a peptide bond can be used.

[0095] In general, the suitability of a cleavable linker candidate can be evaluated by testing the ability (or conditions) of a degrading agent to cleave the linker candidate. It is also desirable to test the cleavable linker candidate for its ability to resist cleavage when in contact with blood or other non-target tissues. Thus, the relative susceptibility to cleavage can be determined between a first condition selected to show cleavage in the target cell and a second condition selected to show cleavage in other tissues or body fluids, such as blood or serum. The evaluation can be performed in a cell-free system, cells, cell cultures, organ or tissue cultures, or in whole animals. It can be useful to perform an initial evaluation under cell-free or culture conditions and confirm with further evaluation in whole animals. In some embodiments, a useful linker candidate is cleaved at least 2-fold, 4-fold, 10-fold, 20-fold, 50-fold, 70-fold, or 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0096] In other embodiments, a redox-cleavable linker is utilized. A redox-cleavable linker is cleaved upon reduction or oxidation. An example of a reductively cleavable group is a disulfide bond group (-S-S-). One or more of the methods described herein can be used to determine whether a cleavable linker candidate is a suitable "reductively cleavable linker" or is suitable for use, for example, with a particular RNAi construct and a particular ligand. For example, the linker candidate can be evaluated by incubating with dithiothreitol (DTT) or other reducing agents known in the art that mimic the cleavage rate observed in cells, such as target cells. The linker candidate can also be evaluated under conditions selected to mimic blood conditions or serum conditions. In certain embodiments, the linker candidate is cleaved up to 10% in blood. In other embodiments, a useful linker candidate is degraded at least 2-fold, 4-fold, 10-fold, 20-fold, 50-fold, 70-fold, or 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or under in vitro conditions selected to mimic extracellular conditions).

[0097] In still other embodiments, a ligand is covalently attached to the sense or antisense strand of the RNAi construct using a phosphate-based cleavable linker that is cleaved by an agent that degrades or hydrolyzes a phosphate group. An example of an agent that hydrolyzes a phosphate group in a cell is an enzyme such as a phosphatase in the cell. Examples of phosphate-based cleavable groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)-S-, and -O-P(S)(Rk)-S-, where Rk is hydrogen or C1-C 10It can be alkyl. Certain embodiments include -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O-, -S-P(S)(H)-O-, -S-P(O)(H)-S- and -O-P(S)(H)-S-. Another specific embodiment is -O-P(O)(OH)-O-. These linker candidates can be evaluated using a method similar to the method described above.

[0098] In other embodiments, the linker can include an acid-cleavable group, which is a group that is cleaved under acidic conditions. In some embodiments, the acid-cleavable group is cleaved in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, 5.5, 5.0 or less), or by an agent such as an enzyme that can act as a general acid. In cells, certain low pH organelles such as endosomes and lysosomes can provide a cleavage environment for acid-cleavable groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. The acid-cleavable group can have the general formula -C=NN-, C(O)O or -OC(O). A specific embodiment is when the carbon (alkoxy group) linked to the oxygen of the ester is an aryl group, a substituted alkyl group, or a tertiary alkyl group, such as dimethyl, pentyl or t-butyl, etc. These candidates can be evaluated using a method similar to those described above.

[0099] In other embodiments, the linker can include a cleavable group based on an ester that is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene groups. The ester-cleavable group has the general formula -C(O)O- or -OC(O)-. These linker candidates can be evaluated using a method similar to the above method.

[0100] In a further embodiment, the linker may include a peptide-based cleavable group that is cleaved by enzymes such as peptidases and proteases in the cell. The peptide-based cleavable group is a peptide bond formed between amino acids that gives rise to oligopeptides (e.g., dipeptides, tripeptides) and polypeptides. The peptide-based cleavable group includes an amide group (-C(O)NH-). The amide group may be formed between any alkylene, alkenylene or alkynylene. The peptide bond is a special type of amide bond formed between amino acids that gives rise to peptides and proteins. The peptide-based cleavable group is generally limited to peptide bonds (i.e., amide bonds) formed between amino acids that give rise to peptides and proteins. The peptide-based cleavable linking group has the general formula -NHCHR A C(O)NHCHR B C(O)-, wherein R A and R B are the side chains of two adjacent amino acids. These candidates can be evaluated using methods similar to the methods described above.

[0101] Other types of linkers suitable for binding a ligand to the sense or antisense strand in this RNAi construct are known in the art and may include the linkers described in U.S. Patent Nos. 7,723,509; 8,017,762; 8,828,956; 8,877,917; and 9,181,551, which are hereby incorporated by reference in their entirety.

[0102] In certain embodiments, the ligand covalently attached to the sense or antisense strand of the present RNAi construct comprises a GalNAc moiety, e.g., a multivalent GalNAc moiety. In some embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 3'-end of the sense strand. In other embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 5'-end of the sense strand. In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 3'-end of the sense strand. In still other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 5'-end of the sense strand.

[0103] In certain embodiments, the present RNAi construct comprises a ligand having the following structure ([Structure 1]):

Chemical formula

[0104] In a preferred embodiment, the ligand having this structure is covalently attached to the 5'-end of the sense strand (e.g., to the 5'-end nucleotide of the sense strand) via a linker such as the linker described herein. In one embodiment, the linker is an aminohexyl linker.

[0105] Representative trivalent and tetravalent GalNAc moieties and linkers that can be attached to the double-stranded RNA molecule in the present RNAi construct are provided in the following Structural Formulas I-IX. "Ac" in the formulas listed herein represents an acetyl group.

[0106] In one embodiment, the present RNAi construct comprises a ligand and a linker having the structure of the following Formula I, wherein each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is attached to the 3'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line):

Chemical formula

[0107] In another embodiment, the present RNAi construct comprises a ligand and a linker having the structure of Formula II below, wherein each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is attached to the 3'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line):

Chemical formula

[0108] In yet another embodiment, the present RNAi construct comprises a ligand and a linker having the structure of Formula III below, wherein the ligand is attached to the 3'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line):

Chemical formula

[0109] In still another embodiment, the present RNAi construct comprises a ligand and a linker having the structure of Formula IV below, wherein the ligand is attached to the 3'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line):

Chemical formula

[0110] In a particular embodiment, the present RNAi construct comprises a ligand and a linker having the structure of Formula V below, wherein each n is independently 1 to 3, k is 1 to 3, and the ligand is attached to the 5'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line):

Chemical formula

[0111] In other embodiments, the present RNAi construct comprises a ligand and a linker having the structure of Formula VI below, wherein each n is independently 1 to 3, k is 1 to 3, and the ligand is attached to the 5'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line): [Chemical formula]

[0112] In some embodiments, the present RNAi construct comprises a ligand and a linker having the structure of Formula VII below, wherein X = O or S, and the ligand is attached to the 5'-end of the sense strand of the double-stranded RNA molecule (represented by the wavy line): [Chemical formula]

[0113] In some embodiments, the present RNAi construct comprises a ligand and a linker having the structure of Formula VIII below, wherein each n is independently 1 to 3, and the ligand is attached to the 5'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line): [Chemical formula]

[0114] In certain embodiments, the present RNAi construct comprises a ligand and a linker having the structure of Formula IX below, wherein the ligand is attached to the 5'-end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line): [Chemical formula]

[0115] The phosphorothioate bond can be replaced with a phosphodiester bond represented by any one of Formulas I to IX to covalently bond the ligand and the linker to the nucleic acid strand.

[0116] Pharmaceutical composition This application also includes pharmaceutical compositions and formulations comprising the RNAi constructs described herein and a pharmaceutically acceptable carrier, excipient or diluent. Such compositions and formulations are useful for reducing the expression of the FAM13A gene and the FAM13A protein in patients in need of reducing the expression of the FAM13A gene and the FAM13A protein. When clinical use is contemplated, the pharmaceutical compositions and formulations are prepared in a form appropriate for the intended use. Generally, this will involve the preparation of a composition that is essentially free not only of pyrogens but also of other impurities that may be harmful to humans or animals.

[0117] The terms "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, "pharmaceutically acceptable carrier, excipient or diluent" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, which are acceptable for use in formulating a drug such as a drug suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. It is contemplated to use them in the therapeutic compositions, except where any conventional media or agent is incompatible with the disclosed RNAi construct. The additional active ingredients can be incorporated into the composition provided they do not inactivate the RNAi construct of the composition.

[0118] Compositions and methods for formulating pharmaceutical compositions depend on several criteria including, but not limited to, the route of administration, the type and extent of the disease or injury to be treated, or the dosage to be administered. In some embodiments, the pharmaceutical composition is formulated based on the intended delivery route. For example, in certain embodiments, the pharmaceutical composition is formulated for parenteral delivery. Parenteral delivery forms include intravenous, intraarterial, subcutaneous, intrathecal, intraperitoneal or intramuscular injection or infusion. In one embodiment, the pharmaceutical composition is formulated for intravenous delivery. In such embodiments, the pharmaceutical composition may comprise a lipid-based delivery vehicle. In another embodiment, the pharmaceutical composition is formulated for subcutaneous delivery. In such embodiments, the pharmaceutical composition may comprise a targeting ligand (e.g., a GalNAc-containing, fatty acid-containing or antibody-containing ligand as described herein).

[0119] In some embodiments, the pharmaceutical composition comprises an effective amount of the RNAi construct described herein. An "effective amount" is an amount sufficient to produce an advantageous or desired clinical result. In some embodiments, the effective amount is an amount sufficient to reduce FAM13A gene expression in a particular tissue or cell type of the patient (e.g., the liver or hepatocytes or adipose tissue). The effective amount of the RNAi construct can be from about 0.01 mg / kg body weight to about 100 mg / kg body weight and can be administered daily, weekly, monthly or at longer intervals. Accurately determining what is considered an effective dosage and dosing frequency can be based on several factors including the size, age and general condition of the patient, the type of disorder to be treated (e.g., fatty liver disease, liver fibrosis or cardiovascular disease), the RNAi construct used and the route of administration.

[0120] Administration of the disclosed pharmaceutical composition can be via any common route as long as the target tissue is accessible via that route. Such routes include, but are not limited to, parenteral (e.g., subcutaneous, intramuscular, intraperitoneal or intravenous), oral, nasal, buccal, intradermal, transdermal and sublingual routes, or direct injection into a tissue (e.g., liver or fat) or delivery through the portal vein. In some embodiments, the pharmaceutical composition is administered parenterally. For example, in certain embodiments, the pharmaceutical composition is administered intravenously. In other embodiments, the pharmaceutical composition is administered subcutaneously.

[0121] Colloidal dispersion systems such as water-in-oil emulsions, micelles, mixed micelles and polymer complexes containing liposomes, nanocapsules, microspheres, beads and lipid-based systems can be used as delivery vehicles for this RNAi construct. Commercially available fat emulsions suitable for delivering nucleic acids include Intralipid® (Baxter International Inc.), Liposyn® (Abbott Pharmaceuticals), Liposyn® II (Hospira), Liposyn® III (Hospira), Nutrilipid (B. Braun Medical Inc.) and other similar lipid emulsions. A typical colloidal system for in vivo use as a delivery vehicle is a liposome (i.e., an artificial membrane vesicle). This RNAi construct may be encapsulated within a liposome or may form a complex with a liposome, particularly a cationic liposome. Alternatively, the RNAi construct may be complexed with a lipid, particularly a cationic lipid. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC) and dipalmitoylphosphatidylcholine (DPPC), distearolyphosphatidyl choline), negative (e.g., dimyristoylphosphatidylglycerol (DMPG)), and cationic (e.g., dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidylethanolamine (DOTMA)). The preparation and use of such colloidal dispersion systems are well known in the art. Representative formulations are also disclosed in U.S. Patent No. 5,981,505, U.S. Patent No. 6,217,900; U.S. Patent No. 6,383,512; U.S. Patent No. 5,783,565; U.S. Patent No. 7,202,227; U.S. Patent No. 6,379,965; U.S. Patent No. 6,127,170; U.S. Patent No. 5,837,533; U.S. Patent No. 6,747,014; and International Publication No. 03 / 093449 pamphlet.

[0122] In some embodiments, the RNAi construct is fully encapsulated in a lipid formulation to form, for example, SNALPs or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to stable nucleic acid lipid particles. SNALPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particles (e.g., a PEG-lipid conjugate). SNALPs exhibit a long circulation lifetime after intravenous injection and accumulate at distal sites (e.g., sites physically separated from the site of administration), and are thus extremely useful for systemic applications. The nucleic acid-lipid particles typically have an average diameter of about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, or about 70 nm to about 90 nm and are substantially non-toxic. In addition, the nucleic acid is resistant to nuclease degradation in aqueous solution when present in the nucleic acid-lipid particle. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Patent Nos. 5,976,567, 5,981,501, 6,534,484, 6,586,410, 6,815,432, and International Publication No. 96 / 40964.

[0123] Pharmaceutical compositions suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In general, these preparations are sterile and fluid to the extent that they are readily injectable. The preparations should be stable under the conditions of manufacture and storage and should be protected from the contaminating action of microorganisms such as bacteria and fungi. Suitable solvents or dispersion media can contain, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycols, etc.), suitable mixtures thereof, and vegetable oils. Suitable fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by using surfactants. Prevention of microbial action can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chloride. Sustained absorption of injectable compositions can be brought about by using agents that delay absorption, for example, aluminum monostearate and gelatin, in the composition.

[0124] Sterile injectable solutions can also be prepared by incorporating the active compound in the appropriate amount, along with any other desired ingredients as appropriate (such as those enumerated above), into a solvent and then filtering the solution sterilize. In general, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the other desired ingredients, such as those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation include vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired ingredients from their previously sterile-filtered solutions.

[0125] The compositions of the present application can generally be formulated in neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with free amino groups) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, and mandelic acid, etc.). Salts formed with free carboxyl groups can also be derived from inorganic bases (e.g., sodium hydroxide, potassium, ammonium, calcium, or ferric) or organic bases (e.g., isopropylamine, trimethylamine, histidine, and procaine, etc.). Pharmaceutically acceptable salts are described in detail in Berge et al., J. Pharmaceutical Sciences, Vol. 66:1-19, 1977.

[0126] For parenteral administration in aqueous solution, for example, the solution is usually appropriately buffered and the liquid diluent is first made isotonic, for example, with sufficient saline or glucose. Such aqueous solutions can be used, for example, for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In particular, in view of the present disclosure, it is preferred to use a sterile aqueous medium as known to those skilled in the art. As an example, a single dose can be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of subcutaneous infusion fluid or injected into the indicated injection site (see, for example, “Remington’s Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). When administered to humans, the preparation should meet the standards of sterility, pyrogenicity, general safety, and purity as required by FDA standards. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile aqueous saline solution and the RNAi construct described herein. In other embodiments, the pharmaceutical composition comprises or consists of the RNAi construct described herein and sterile water (e.g., water for injection, WFI). In still other embodiments, the pharmaceutical composition comprises or consists of the RNAi construct described herein and phosphate buffered saline (PBS).

[0127] In some embodiments, the pharmaceutical composition is packaged in a device for administration or stored within a device. Devices for injectable formulations include, but are not limited to, injection ports, prefilled syringes, automatic infusion devices, infusion pumps, wearable syringes, and injection pens. Devices for aerosolized or powder formulations include, but are not limited to, inhalers, nebulizers, aspirators, and the like. Accordingly, some embodiments include an administration device comprising the disclosed pharmaceutical composition for treating or preventing one or more of the diseases or disorders described herein.

[0128] Use of the disclosed RNAi constructs and methods of using the same This application provides a method for reducing or inhibiting the expression of the FAM13A gene in a cell (e.g., a hepatocyte or an adipocyte), and thus reducing or inhibiting the production of the FAM13A protein, by contacting the cell with any one of the RNAi constructs described herein. The cell can be in vitro or in vivo. The effectiveness of the RNAi construct can be evaluated using any method capable of measuring FAM13A mRNA or FAM13A protein. The terms "FAM13A expression" and "expression of FAM13A" as used herein refer to the level of FAM13A gene transcription, the amount of FAM13A mRNA present, the level of FAM13A translation, and the amount of FAM13A protein present. Accordingly, FAM13A expression can be evaluated by measuring the amount or level of FAM13A mRNA, FAM13A protein, or another biomarker associated with FAM13A expression, such as the serum or plasma levels of triglycerides, cholesterol, or insulin. The phrase "reduction of FAM13A expression" as used herein refers to a reduction of one or more of the level of FAM13A gene transcription, the amount of FAM13A mRNA present, the level of FAM13A translation, and the amount of FAM13A protein present.

[0129] Reduction of FAM13A expression in cells or animals treated with an RNAi construct can be determined by comparison to FAM13A expression in cells or animals not treated with the RNAi construct or treated with a control RNAi construct. For example, in some embodiments, reduction of FAM13A expression is evaluated by: (a) measuring the amount or level of FAM13A mRNA in cells (e.g., liver or adipocytes) treated with the RNAi construct; (b) measuring the amount or level of FAM13A mRNA in cells (e.g., liver or adipocytes) treated with a control RNAi construct (e.g., an RNAi construct targeting an RNA molecule not expressed in the cells or an RNAi construct having a nonsense or scrambled sequence) or no construct; and (c) comparing the measured FAM13A mRNA level from the treated cells in (a) to the measured FAM13A mRNA level from the control cells in (b). Prior to comparison, the FAM13A mRNA levels in the treated and control cells can be normalized to the RNA levels relative to a control gene (e.g., 18S ribosomal RNA or a housekeeping gene). The mRNA level of FAM13A can be measured by a variety of methods including Northern blot analysis, nuclease protection assay, fluorescence in situ hybridization (FISH), reverse transcriptase (RT)-PCR, real-time RT-PCR, quantitative PCR, droplet digital PCR, and the like.

[0130] In other embodiments, the reduction of FAM13A expression is evaluated by: (a) measuring the amount or level of FAM13A protein in cells (e.g., liver or adipocytes) treated with an RNAi construct; (b) measuring the amount or level of FAM13A protein in cells (e.g., liver or adipocytes) treated with a control RNAi construct (e.g., an RNAi construct against an RNA molecule not expressed in the cells or an RNAi construct having a nonsense or scrambled sequence) or no construct; and (c) comparing the measured FAM13A protein level from the treated cells in (a) with the measured FAM13A protein level from the control cells in (b). Methods for measuring FAM13A protein levels are known to those skilled in the art and include Western blot, immunoassays (e.g., ELISA), and flow cytometry.

[0131] In some embodiments, the method for evaluating FAM13A expression levels is performed in vitro in cells that naturally express FAM13A (e.g., liver or adipocytes) or cells that have been modified to express FAM13A. In certain embodiments, the method is performed in vitro in liver cells or adipocytes. Suitable liver cells include, but are not limited to, primary hepatocytes (e.g., human and non-human primate hepatocytes), HepAD38 cells, HuH-6 cells, HuH-7 cells, HuH-5-2 cells, BNLCL2 cells, Hep3B cells, or HepG2 cells. In one embodiment, the liver cells are HuH-7 cells. In another embodiment, the liver cells are human primary hepatocytes. In yet another embodiment, the liver cells are Hep3B cells. Suitable adipocytes include cells derived from subcutaneous white adipose tissue (scWAT), cells derived from epididymal white adipose tissue (eWAT), or 3T3-L1 cells.

[0132] In other embodiments, the method for assessing the expression level of FAM13A is performed in vivo. The present RNAi construct and any control RNAi construct can be administered to an animal, and the FAM13A mRNA or FAM13A protein level can be assessed in liver or adipose tissue harvested from the animal after treatment. Alternatively or additionally, biomarkers or functional phenotypes associated with FAM13A expression can be assessed in the treated animal. For example, individuals with a FAM13A variant that has decreased FAM13A expression also have decreased serum triglycerides, increased HDL cholesterol, and individuals with a FAM13A variant that has increased FAM13A expression also have increased triglycerides and decreased HDL cholesterol (Figure 1). Additionally, FAM13A expression significantly correlates with fasting insulin levels. Fathzadeh et al., Nature Communications 11, 1465 (2020). Thus, in some embodiments, the goal and result of FAM13A knockdown is to lower the serum or plasma levels of triglycerides, cholesterol, or insulin, and such lowering can be measured in animals treated with the RNAi construct to assess the functional efficacy of lowering FAM13A expression.

[0133] In certain embodiments, the expression of FAM13A mRNA or protein is reduced by at least 40%, at least 45% or at least 50% in the liver or adipocytes by the RNAi construct. In some embodiments, the expression of FAM13A mRNA or protein is reduced by at least 60%, at least 65%, at least 70%, at least 75%, at least 80% or at least 85% in the liver or adipocytes by the RNAi construct. In other embodiments, the expression of FAM13A mRNA or protein is reduced by about 90% or more, such as about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more in the liver or adipocytes by the RNAi construct. The rate of reduction of FAM13A expression can be measured by any of the methods described herein as well as other methods known in the art.

[0134] The present application provides a method for reducing or inhibiting the expression of the FAM13A gene, and thus reducing or inhibiting the production of the FAM13A protein, in a patient in need thereof, as well as a method for treating or preventing a condition, disease or disorder associated with FAM13A expression or activity. "A condition, disease or disorder associated with FAM13A expression" refers to a condition, disease or disorder in which the expression level of FAM13A changes, or an increase in the expression level of FAM13A is associated with an increased risk of developing that condition, disease or disorder. Conditions, diseases or disorders associated with FAM13A expression may also include those resulting from abnormal changes in lipoprotein metabolism, such as changes that result in abnormal levels or increased levels of cholesterol, lipids, triglycerides, etc., or changes that result in impaired clearance of these molecules. In certain embodiments, the present RNAi construct is particularly useful for the treatment or prevention of abdominal obesity, fatty liver disease (e.g., NAFLD and NASH), and cardiovascular disease (e.g., coronary artery disease and myocardial infarction), as well as for the reduction of liver fibrosis and serum cholesterol levels.

[0135] Conditions, diseases and disorders associated with FAM13A expression that can be treated or prevented according to the present method include, but are not limited to, fatty liver disease, such as alcoholic fatty liver disease, abdominal obesity, alcoholic steatohepatitis, NAFLD and NASH; chronic liver disease; cirrhosis; cardiovascular disease, such as myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g., peripheral arterial disease), cerebrovascular disease, vulnerable plaque and aortic stenosis; familial hypercholesterolemia; venous thrombosis; hypercholesterolemia; hyperlipidemia; and dyslipidemia (e.g., manifested as an increase in total cholesterol, an increase in low density lipoprotein (LDL), an increase in very low density lipoprotein (VLDL), an increase in triglycerides and / or a low level of high density lipoprotein (HDL)).

[0136] In certain embodiments, the present application provides a method for reducing the expression of FAM13A protein in a patient in need thereof, the method comprising administering to the patient any of the RNAi constructs described herein. As used herein, the term "patient" refers to a mammal including a human, and may be used interchangeably with the term "subject". Preferably, the expression level of FAM13A in the hepatocytes of the patient is reduced after administration of the RNAi construct when compared to the FAM13A expression level in a patient not receiving the RNAi construct, or when compared to the FAM13A expression level of the patient before administration of the RNAi construct. In some embodiments, after administration of the RNAi construct, the expression of FAM13A in the patient is reduced by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or at least 90%, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. The % reduction rate of FAM13A expression can be measured by any of the methods described herein as well as other methods known in the art.

[0137] In some embodiments, the patients in need of reduced FAM13A expression are patients at risk of having a myocardial infarction. The patients at risk of having a myocardial infarction can be patients having a history of myocardial infarction (e.g., having previously suffered from myocardial infarction). The patients at risk of having a myocardial infarction can also be patients having a family history of myocardial infarction or having one or more risk factors for myocardial infarction. Such risk factors include, but are not limited to, a history of hypertension, high levels of non-HDL cholesterol, high levels of triglycerides, diabetes, obesity or an autoimmune disease (e.g., rheumatoid arthritis, lupus). In one embodiment, the patients at risk of having a myocardial infarction are patients having or diagnosed with coronary artery disease. The risk of myocardial infarction in these and other patients can be reduced by administering to the patient any of the RNAi constructs described herein. Accordingly, a method for reducing the risk of myocardial infarction in a patient in need thereof comprises administering to the patient an RNAi construct described herein. In some embodiments, any of the RNAi constructs described herein can be used in the preparation of a medicament for reducing the risk of myocardial infarction in a patient in need thereof. Some embodiments include a FAM13A-targeted RNAi construct for use in a method for reducing the risk of myocardial infarction in a patient in need thereof.

[0138] In certain embodiments, patients in need of reduced FAM13A expression are patients diagnosed with a cardiovascular disease or having a risk of cardiovascular disease. Thus, a method for treating or preventing cardiovascular disease in a patient in need thereof comprises administering any of the present RNAi constructs. In some embodiments, any of the RNAi constructs described herein can be used in the preparation of a medicament for treating or preventing cardiovascular disease in a patient in need thereof. Some embodiments include FAM13A-targeted RNAi constructs for use in a method for treating or preventing cardiovascular disease in a patient in need thereof. Cardiovascular diseases include, but are not limited to, myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g., peripheral arterial disease), cerebrovascular disease, vulnerable plaque, and aortic stenosis. In some embodiments, the cardiovascular disease to be treated or prevented according to the disclosed method is coronary artery disease. In other embodiments, the cardiovascular disease to be treated or prevented according to the disclosed method is myocardial infarction. In still other embodiments, the cardiovascular disease to be treated or prevented according to the disclosed method is stroke. In yet other embodiments, the cardiovascular disease to be treated or prevented according to the disclosed method is peripheral arterial disease. In certain embodiments, administration of the RNAi constructs described herein reduces the risk of non-fatal myocardial infarction, fatal and non-fatal stroke, certain types of heart surgery (e.g., angioplasty, bypass), hospitalization for heart failure, chest pain in patients with heart disease, and / or cardiovascular events in patients with established heart disease (e.g., history of myocardial infarction, history of heart surgery, and / or chest pain with evidence of arterial occlusion). In some embodiments, administration of the RNAi constructs described herein can be used to reduce the risk of recurrent cardiovascular events.

[0139] In some embodiments, the patient to be treated according to the disclosed method is a patient having vulnerable plaques (also referred to as unstable plaques). Vulnerable plaques are accumulations of macrophages and lipids containing mainly cholesterol under the endothelial lining of the arterial wall. These vulnerable plaques can rupture, resulting in potentially blocking blood flow through the artery and causing the formation of blood clots that can lead to myocardial infarction or stroke. Vulnerable plaques can be identified by methods known in the art, including but not limited to intravascular ultrasound and computed tomography (see Sahara et al., European Heart Journal, Vol. 25; 2026-2033, 2004; Budhoff, J. Am. Coll. Cardiol., Vol. 48; 319-321, 2006; Hausleiter et al., J. Am. Coll. Cardiol., Vol. 48; 312-318, 2006).

[0140] In other embodiments, the patient in need of reduced FAM13A expression is a patient with high blood levels of cholesterol (e.g., total cholesterol, non-HDL cholesterol, or LDL cholesterol). Thus, in some embodiments, a method for reducing the blood level of cholesterol (e.g., serum or plasma) in a patient in need thereof comprises administering to the patient any of the RNAi constructs described herein. In some embodiments, any of the RNAi constructs described herein can be used in the preparation of a medicament for reducing the blood level of cholesterol (e.g., serum or plasma) in a patient in need thereof. Some embodiments include FAM13A-targeted RNAi constructs for use in a method for reducing the blood level of cholesterol (e.g., serum or plasma) in a patient in need thereof. In certain embodiments, the cholesterol reduced according to the disclosed method is LDL cholesterol. In other embodiments, the cholesterol reduced according to the method of the invention is non-HDL cholesterol. Non-HDL cholesterol is a measure of all cholesterol-containing atherogenic lipoproteins, including LDL cholesterol, very low density lipoprotein, intermediate density lipoprotein, lipoprotein(a), chylomicrons, and chylomicron remnants. Non-HDL cholesterol has been reported to be an excellent predictor of cardiovascular risk (Rana et al., Curr. Atheroscler. Rep., Vol. 14:130-134, 2012). Non-HDL cholesterol levels can be calculated by subtracting HDL cholesterol levels from total cholesterol levels.

[0141] In some embodiments, the patient to be treated is a patient with elevated non-HDL cholesterol levels (e.g., elevated serum or plasma levels of non-HDL cholesterol). Ideally, the level of non-HDL cholesterol should be approximately 30 mg / dL above the target value for the LDL cholesterol level for any given patient. In certain embodiments, the RNAi construct is administered if the patient has a non-HDL cholesterol level of about 130 mg / dL or higher. In one embodiment, the RNAi construct is administered if the patient has a non-HDL cholesterol level of about 160 mg / dL or higher. In another embodiment, the RNAi construct is administered if the patient has a non-HDL cholesterol level of about 190 mg / dL or higher. In yet another embodiment, the RNAi construct is administered if the patient has a non-HDL cholesterol level of about 220 mg / dL or higher. In certain embodiments, in accordance with the 2013 ACC / AHA Guideline on the Assessment of Cardiovascular Risk (Goff et al., ACC / AHA guideline on the assessment of cardiovascular risk: a report of the American College of Cardiology / American Heart Association Task Force on Practice Guidelines. J Am Coll Cardiol, Vol. 63:2935-2959, 2014), if the patient has a high or very high risk of cardiovascular disease and the patient's non-HDL cholesterol level is about 100 mg / dL or higher, the RNAi construct is administered to the patient.

[0142] In certain embodiments, when the risk of a patient's cardiovascular disease is moderate or higher according to the 2013 ACC / AHA Guideline on the Assessment of Cardiovascular Risk (referred to herein as the "2013 Guideline"), the RNAi construct described herein is administered to the patient. In certain embodiments, the RNAi construct is administered to a patient when the patient's LDL cholesterol level is higher than about 160 mg / dL. In other embodiments, the RNAi construct is administered to a patient when the patient's LDL cholesterol level is higher than about 130 mg / dL and the patient has a moderate risk of cardiovascular disease according to the 2013 Guideline. In yet other embodiments, the RNAi construct is administered to a patient when the patient's LDL cholesterol level is higher than 100 mg / dL and the patient has a high or very high risk of cardiovascular disease according to the 2013 Guideline.

[0143] In other embodiments, the patient in need of reduced FAM13A expression is a patient diagnosed with or at risk of fatty liver disease. Accordingly, methods for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof include administering any of the disclosed RNAi constructs to the patient. In some embodiments, any of the RNAi constructs described herein can be used in the preparation of a medicament for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof. Other embodiments include FAM13A-targeting RNAi constructs for use in methods for treating, preventing, or reducing the risk of developing fatty liver disease in a patient in need thereof. Fatty liver disease is a condition in which fat accumulates in the liver. There are two major types of fatty liver disease: the first type (alcoholic steatohepatitis) associated with heavy alcohol use, and the second type (non-alcoholic fatty liver disease (NAFLD)) not associated with alcohol use. NAFLD is typically characterized by the presence of fat accumulation in the liver, but little or no inflammation or hepatocellular damage. NAFLD can progress to non-alcoholic steatohepatitis (NASH), which is characterized by liver inflammation and cellular damage, both of which can subsequently lead to liver fibrosis and ultimately cirrhosis or liver cancer. In certain embodiments, the fatty liver disease to be treated, prevented, or reduced in risk is NAFLD. In other embodiments, the fatty liver disease to be treated, prevented, or reduced in risk is NASH. In yet other embodiments, the fatty liver disease to be treated, prevented, or reduced in risk is alcoholic steatohepatitis. In some embodiments, the patient in need of treatment or prevention for or at risk of developing fatty liver disease has been diagnosed with type 2 diabetes, a metabolic disorder, or is obese (e.g., has a body mass index of ≧30.0).In other embodiments, patients in need of treatment or prevention of fatty liver disease or at risk of developing fatty liver disease have high levels of non-HDL cholesterol or triglycerides. Depending on the patient and other risk factors the patient may have, high non-HDL cholesterol levels can be about 130 mg / dL or higher, about 160 mg / dL or higher, about 190 mg / dL or higher, or about 220 mg / dL or higher. High triglyceride levels can be about 150 mg / dL or higher, about 175 mg / dL or higher, about 200 mg / dL or higher, or about 250 mg / dL or higher.

[0144] In certain embodiments, patients in need of reduced FAM13A expression are patients diagnosed with or at risk of developing liver fibrosis or cirrhosis. Accordingly, some embodiments include methods for treating, preventing, or reducing liver fibrosis in patients in need of treatment, prevention, or reduction of liver fibrosis, including administering any of the disclosed RNAi constructs to the patient. Some embodiments include the use of any of the RNAi constructs described herein in the preparation of a medicament for treating, preventing, or reducing liver fibrosis in patients in need of treatment, prevention, or reduction of liver fibrosis. Some embodiments include FAM13A-targeted RNAi constructs for use in a method for treating, preventing, or reducing liver fibrosis in patients in need of treatment, prevention, or reduction of liver fibrosis. In some embodiments, patients at risk of developing liver fibrosis or cirrhosis are diagnosed with NAFLD. In other embodiments, patients at risk of developing liver fibrosis or cirrhosis are diagnosed with NASH. In still other embodiments, patients at risk of developing liver fibrosis or cirrhosis are diagnosed with alcoholic steatohepatitis. In yet other embodiments, patients at risk of developing liver fibrosis or cirrhosis are diagnosed with hepatitis. In certain embodiments, administration of the disclosed RNAi construct prevents or delays the development of cirrhosis in the patient.

[0145] In other embodiments, the patient in need of reduced FAM13A expression is a patient diagnosed with abdominal adiposity or a high waist-to-hip ratio (WHR). In some embodiments, the patient in need of reduction has a waist-to-hip ratio greater than 0.95, greater than 1.0, greater than 1.05, or greater than 1.1. Thus, in some embodiments, a method for reducing abdominal adiposity or reducing WHR in a patient in need of reduction of abdominal adiposity or reduction of WHR comprises administering to the patient any of the RNAi constructs described herein. In some embodiments, any of the RNAi constructs described herein can be used in the preparation of a medicament for reducing abdominal adiposity or reducing WHR in a patient in need of reduction of abdominal adiposity or reduction of WHR. Some embodiments include an RNAi construct targeting FAM13A for use in a method for reducing abdominal adiposity or reducing WHR in a patient in need of reduction of abdominal adiposity or reduction of WHR.

[0146] In some embodiments, the patient in need of reduced FAM13A expression is treated using an RNAi construct specifically targeted to the liver. In some embodiments, the RNAi construct is targeted by conjugation to a ligand comprising N-acetyl-galactosamine (GalNAc). Thus, in some embodiments, a method for reducing FAM13A levels in a patient in need of reduced FAM13A levels comprises administering to the patient any of the RNAi constructs described herein conjugated to GalNAc.

[0147] Definitions of common terms and expressions To make the present disclosure more readily understandable, certain terms are first defined. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. As used in this application, each of the following terms shall have the meaning set forth below, unless specifically provided otherwise herein. Further definitions are set forth throughout this application.

[0148] Units, prefixes, and symbols are shown in the form approved by the International System of Units (SI).

[0149] As used in the present disclosure and the claims, the singular forms "a," "an," and "the" include plural forms unless the context clearly dictates otherwise. Unless otherwise specified or clear from the context, as used herein, the term "or" is understood to be inclusive. As used herein in phrases such as "A and / or B," the term "and / or" shall mean "A and B," "A or B," "A," and "B." Similarly, as used herein in phrases such as "A, B, and / or C," the term "and / or" shall include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0150] Whenever an embodiment is described herein with the term "comprising," it is understood that otherwise similar embodiments are also provided that are described with the terms "consisting of" and / or "consisting essentially of." In this disclosure, "comprises," "comprising," "containing," and "having," etc., may have the meaning ascribed to them in U.S. patent law and may mean "includes," "including," etc.; "consisting essentially of" or "consists essentially of," etc., similarly have the meaning ascribed to them in U.S. patent law, and the terms are open-ended, allowing for the presence of more than what is recited but excluding prior art embodiments, so long as the basic or novel characteristics of the recited items are not changed by the presence of more than what is recited.

[0151] The terms "about" or "comprising essentially of" refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which depends in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, "about" or "comprising essentially of" can mean within one standard deviation or more than one standard deviation, in accordance with practice in the art. Alternatively, "about" or "comprising essentially of" can mean a range of up to 20%. Moreover, particularly with respect to biological systems or processes, these terms can mean values up to an order of magnitude or up to five times higher. When a particular value or composition is provided in this application and claims, unless otherwise specified, the meaning of "about" or "comprising essentially of" should be assumed to be within an acceptable error range for that particular value or composition.

[0152] Any composition or method provided herein can be combined with any one or more of the other compositions and methods provided herein.

[0153] The following examples, including the experiments conducted and the results achieved, are provided for illustrative purposes only and are not to be construed as limiting the appended claims.

Example

[0154] Example 1: Genomic and Expression Analysis of FAM13A Genomic analysis was performed to examine the association of three common FAM13A variants with WHR adjusted for BMI (WHRadjBMI), triglyceride levels, HDL cholesterol levels, systolic blood pressure, and FAM13A expression in subcutaneous adipose tissue eQTL data. The results of this analysis are given in Figure 1, which shows that the three FAM13A variants are associated independently of WHR adjusted for BMI.

[0155] First, the signal A variant rs57400569 - A is a disease - protective intronic SNP associated with an increase in HDL cholesterol and decreases in WHR, triglycerides, and systolic blood pressure. rs57400569 - A is associated with a decrease in FAM13A expression in deCODE adipose tissue eQTL data. rs57400569 - A is consistent with FAM13A expression correlating with the disease state. The analysis also confirmed the previously reported association with blood pressure while discovering previously unreported associations with WHR, triglycerides, and HDL. rs57400569 - A was also a top cis - eQTL variant in adipose.

[0156] Next, the signal B variant rs7657817 - T is a protein - coding missense variant associated with decreases in WHR and triglycerides and an increase in HDL cholesterol. rs7657817 - T is also disease - protective, and this analysis confirmed the relevance of previously reported literature.

[0157] Finally, the signal C variant rs9991328-T is a disease-promoting intronic SNP and is associated with a decrease in HDL cholesterol and an increase in WHR, triglycerides, and FAM13A expression in deCODE adipose tissue eQTL data. Notably, rs9991328 has a strong and reproducible genome-wide association analysis (GWAS) association with WHR in multiple studies (5-10) and has a highly significant association reported in the UK Biobank data (p = 1×10 -51 )(5). Additionally, the rs9991328 WHR-increasing allele was significantly associated with an increase in fasting insulin levels (a measure of insulin resistance; p = 5.9×10 -21 ). rs9991328-T is disease-promoting, and this analysis confirmed the association with previously reported literature.

[0158] The WHR-increasing allele is associated with an increase in triglycerides, a decrease in HDL cholesterol, an increase in systolic blood pressure, and an increase in FAM13A expression in subcutaneous adipose tissue.

[0159] Example 2: siRNA-mediated knockdown of mouse Fam13a in vivo To test the hypothesis that a decrease in Fam13a expression is associated with a decrease in WHR and CVD risk factors, a series of mouse Fam13a siRNA experiments were performed. Fam13a siRNA was complexed with palmitic acid lipid (C16) or GalNAc (conjugated as described in Example 3 below), and these molecules were tested for their ability to decrease Fam13a expression in cultured cells or in vivo (i.e., in adipose tissue or liver). These experiments were performed using commercially available mouse Fam13a siRNA triggers. The triggers were available from Ambion (s81721) or Dharmacon (J-041073-09) and were prepared as modified siRNA duplexes. The mouse siRNA duplex sequences were D-0001 sense (SEQ ID NO: 2786) GAAAGAUUCCAGGACGAU D-0001 antisense (SEQ ID NO: 2787) UAUCGUCCUGGAAUCUUUCUG D-0002 sense (SEQ ID NO: 2788) GAAUCAAGAUGGUGAAGA D-0002 antisense (SEQ ID NO: 2789) AUCUUCACCAUCUUGAUUCCUC D-0003 sense (SEQ ID NO: 2790) AGGAAUCAAGAUGGUGAAGA D-0003 antisense (SEQ ID NO: 2791) AUCUUCACCAUCUUGAUUCCUCU It was.

[0160] These sequences were prepared as modified duplexes as shown below. The nucleotide sequences of these modified duplexes use the following notation: a, u, g, and c = the corresponding 2'-O-methylribonucleotides; Af, Uf, Gf, and Cf = the corresponding 2'-deoxy-2'-fluoro ("2'-fluoro") ribonucleotides; and invAb = inverted abasic deoxynucleotide (i.e., an abasic deoxynucleotide that is linked to an adjacent nucleotide via a substituent at its 3' position when at the 3' end of the strand (3'-3' linkage) or at its 5' position when at the 5' end of the strand (5'-5' internucleotide linkage)). The insertion of an "s" in a sequence indicates that two adjacent nucleotides are linked by a phosphorothiodiester group (e.g., a phosphorothioate internucleotide linkage). Unless otherwise indicated, all other nucleotides are linked by a 3'-5' phosphodiester group. Fam13a siRNA was conjugated to palmitic acid lipid (C16) or GalNAc using the methods provided in Example 3 below. D-0004 sense (SEQ ID NO: 2792) gaaagaUfuCfCfAfGfgacgasus{invAb} D-0004 antisense (SEQ ID NO: 2793) usAfsucguCfcuggAfaUfcuuucsusg D-0005 sense (SEQ ID NO: 2794) gaaucaAfgAfUfGfGfugaagsas{invAb} D-0005 antisense (SEQ ID NO: 2795) asUfscuucAfccauCfuUtgauucscsu D-0006 sense (SEQ ID NO: 2796) {DCA-C6}saggaaucaAfgAfUfGfGfugaagas{invAb} D-0006 antisense (SEQ ID NO: 2797) asUfscuucAfccauCfuUfgauuccuscsu

[0161] In vitro Fam13a siRNA treatment In mouse kidney-derived (Renca cell line; ATCC 2947) and fat-derived (primary adipocytes) cultured cells, the effect of Fam13a siRNA on the Fam13a RNA expression level was analyzed. Figures 2A and 2B show the results of this in vitro dose-response test of the effect of Fam13a siRNA in Renca cells and primary adipocytes.

[0162] For experiments in Renca cells, siRNA was transfected into the cells using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific). Cells were seeded at 12,500 cells per well in a 96-well plate in 100 μL of basal medium (RPMI-1640, 10% FBS, 1% non-essential amino acids, 1% sodium pyruvate, 2% L-glutamine and 1% penicillin-streptomycin) and incubated overnight. For transfection, 150 μL of RNAiMAX was mixed with OptiMEM (final dilution of 0.3 μL RNAiMAX per well), then 1 mM siRNA was diluted to 60 μM in OptiMEM / RNAiMAx and then further diluted to a starting concentration of 6 nM. The siRNA was serially diluted 1:10 from 6 nM to 0.6 nM, 0.06 nM and 0.006 nM. 20 μL of OptiMEM / RNAiMAX+siRNA was added to 100 μL of plating medium to give final concentrations of 1 nM, 0.1 nM, 0.01 nM, 0.001 nM and 0 nM of each siRNA. The cells were incubated at 37 °C and 5% CO2 for 72 h, then the medium was removed and the cells were lysed in 150 μL of buffer RLT (Qiagen). RNA was isolated using the RNeasy 96 RNA isolation protocol according to the manufacturer's instructions (Qiagen). Real-time PCR was performed using 4.25 μL of RNA and TaqMan® gene expression assays (ThermoFisher) for Fam13a (Mm00467910) and Hprt (Mm03024075) using the TaqMan® RNA-to-CT™ 1-Step Kit according to the manufacturer's instructions (ThermoFisher).

[0163] For experiments with primary mouse adipocytes, subcutaneous WAT was isolated from male DIO mice using the method originally described by Viswanadha and Londos (Viswanadha, S. & Londos, C. Optimized conditions for measuring lipolysis in murine primary adipocytes. J. Lipid Res. 47, 1859-1864 (2006)). The tissue was dissected, weighed, and immediately immersed in Krebs-Ringer bicarbonate (KRB) buffer, pH 7.4, containing 4% bovine serum albumin (BSA), 500 nM adenosine, and 5 mM glucose. The stromal vascular fraction (SVF) and primary adipocytes were isolated by collagenase digestion (1 ml / mL KRB) and incubated at 37°C with shaking at 220 rpm for 1 hour. After digestion, the mixture was filtered through a 250 μm gauze mesh into a 15 mL conical polypropylene tube, and the infranatant containing collagenase solution and SVF were carefully removed using a long needle and syringe. SVF was cultured as previously described by Hausman et al. (Hausman, DB, Park, HJ, & Hausman, GJ. Isolation and culture of preadipocytes from rodent white adipose tissue. Methods Mol. Biol. 456, 201–219 (2008)). SVF cells were pelleted by centrifugation of the SVF-containing solution at 200 × g for 10 min, resuspended in 10 mL plating medium (DMEM / F12 + 10% FBS), and subsequently filtered through a sterile 20 μm mesh filter into a sterile 50 mL plastic centrifuge tube. SVF cells were seeded at 250,000 cells / well in 24-well plates and incubated overnight at 37°C and 5% CO2. The plating medium and non-adherent cells were then removed and replaced with DMEM / F12 medium + 5% FBS, with medium changes every 2 days until the cells reached confluence (5-6 days after seeding).Differentiation was induced by the addition of differentiation medium (DMEM / F12 + 5% FBS + 17 nM insulin, 0.1 μM dexamethasone, 250 μM 3-isobutyl-1-methylxanthine (IBMX) and 60 μM indomethacin) over 48 hours. After 48 hours, the differentiation medium was changed to maintenance medium (DMEM / F12 + 10% FBS + 17 nM insulin) for a total of 10 days, and the maintenance medium was changed every 2 - 3 days. On the 10th day of differentiation, C16 complexed siRNA was diluted to 10 μM in maintenance medium, and then 10 μM siRNA was successively diluted 1:10 from 10 μM to 1 μM, 100 nM, 10 nM, 1 nM, 0.1 nM and 0.01 nM. The maintenance medium was removed from the cells and replaced with 1.5 mL siRNA-containing medium, and the cells were incubated at 37 °C and 5% CO2 for 72 hours. After 72 hours, the medium was removed and the cells were harvested in 1 mL Qiazol (Qiagen) per well. RNA was isolated using the RNeasy 96 Universal Tissue Kit RNA isolation protocol according to the manufacturer's instructions (Qiagen). Real-time PCR was performed using 4.25 μL RNA and TaqMan® Gene Expression Assays (ThermoFisher) for Fam13a (Mm00467910) and Ppib (Mm00478295) using the TaqMan® RNA-to-Ct™ 1-Step Kit according to the manufacturer's instructions (ThermoFisher).

[0164] As shown in FIGS. 2A and 2B, each of the Fam13a siRNA constructs tested decreased Fam13a expression in a dose-dependent manner. At the highest concentration, a 58%, 68% or 81% decrease in Fam13a mRNA expression levels was observed in Renca cells. Similarly, at the highest concentration, a 49%, 75% and 78% decrease in Fam13a mRNA levels was observed in primary adipocytes.

[0165] 5-day in vivo Fam13a siRNA treatment in diet-induced obese mice The effect of Fam13a siRNA on Fam13a RNA expression levels was analyzed in a high-fat diet (HFD) mouse model of diet-induced obesity (DIO) and insulin resistance within 5 days. Mice were fed an HFD for 12 weeks (18 weeks old; n = 6 mice / group). Next, mice were injected subcutaneously with a single injection containing 30 mg / kg dose of C16-complexed mouse Fam13a siRNA, a control C16 siRNA targeting mHprt (C16-Hprt siRNA), or a vehicle control. Mice were sacrificed on the 5th day after injection, and necropsy was performed, where subcutaneous WAT, epididymal WAT, and liver tissues were obtained. The Fam13a RNA expression levels were to use the RNeasy 96 Universal Tissue Kit RNA isolation protocol according to the manufacturer's instructions (Qiagen). For Fam13a (Mm00467910) and Ppib (Mm00478295), real-time PCR was performed using 4.25 μL RNA and TaqMan® Gene Expression Assay (ThermoFisher) according to the manufacturer's instructions (ThermoFisher) using the TaqMan® RNA-to-CT™ 1-Step Kit. As shown in Figures 3A - 3D, the Fam13a siRNA construct decreased Fam13a RNA expression in both the liver and adipose tissues.

[0166] 30-Day In Vivo Fam13a siRNA Treatment in Diet-Induced Obesity Mice The physiological effects of Fam13a siRNA were analyzed in a high-fat diet (HFD) mouse model of diet-induced obesity and insulin resistance after repeated 30-day siRNA injections. Mice were fed an HFD for 12 weeks (19 weeks of age; n = 7 or 8 per group). Mice were then administered a 30 mg / kg dose of C16-conjugated mouse Fam13a siRNA (D-0002 or D-0003), a control C16 siRNA targeting mHprt (C16-Hprt siRNA), or a vehicle control (SC) once every 10 days for a total of three doses (see Figure 4A). Body weight was measured for each mouse at the start of treatment and every 10 days thereafter (until the mice were sacrificed 30 days after injection), and at necropsy. Fat mass was measured for each mouse 4 days before the first siRNA administration and 28 days after treatment.

[0167] Figures 4B and 4C are plots showing the effects of Fam13a siRNA on mouse body weight and fat mass. After 30 days of treatment, both tested Fam13a siRNAs significantly reduced body weight by 11% and fat mass by 20% compared to controls. These data demonstrate that when conjugated to C16, C16-conjugated siRNA induces a significant reduction in Fam13a expression in adipose tissue in vivo.

[0168] Furthermore, liver weight was reduced by -25%, liver triglycerides by -31%, plasma insulin by -40%, and plasma LDL by -17%. These liver-related effects indicate that the C16-conjugated siRNA trigger was also effective in liver tissue.

[0169] 60-day in vivo Fam13a siRNA treatment in diet-induced obese mice The experiment was conducted to compare the results using GalNAc-conjugated Fam13a siRNA (specifically targeting siRNA to the liver) directly with the results using C16-conjugated Fam13a siRNA (targeting siRNA to both adipose tissue and the liver). Obese mice were treated every 10 days for 60 days with the following molecules: (1) physiological saline, (2) C16-conjugated non-targeting (NT) siRNA control (30 mg / kg), (3) C16-Fam13a siRNA (D-0002; 30 mg / kg), (4) C16-Fam13a siRNA (D-0002; 5 mg / kg), (5) GalNAc-conjugated NT siRNA control (5 mg / kg), or (6) GalNAc-Fam13a siRNA (D-0002; 5 mg / kg).

[0170] Sixty days after treatment, both C16 and GalNAc siRNA treatments significantly decreased body weight, body fat mass, liver weight, insulin, total cholesterol, LDL cholesterol, and ALT compared to their respective NT siRNA controls (Figure 5). In obese mice, mouse Fam13a x GalNAc siRNA administered at 5 mg / kg every 10 days for 60 days significantly decreased body weight by -15%, body fat mass by -22%, liver weight by -49%, insulin by -66%, total cholesterol by -37%, LDL cholesterol by -37%, and ALT by -60%. Importantly therapeutically, GalNAc-Fam13a siRNA (5 mg / kg) treatment was sufficient to significantly decrease all metabolic endpoints to at least approximately the same extent as C16-Fam13a siRNA (30 mg / kg) treatment, indicating that liver targeting is sufficient for the efficacy of Fam13a siRNA in obese mice. In addition, GalNAc-Fam13a siRNA significantly decreased total cholesterol more substantially than C16 Fam13a siRNA, suggesting that liver-specific targeting can exceed broad targeting by lipid complexes and result in enhanced therapeutic effects at one-sixth the dose.

[0171] Example 3: Selection, Design, and Synthesis of Modified FAM13A siRNA Molecules Using bioinformatics analysis of human FAM13A transcripts, candidate sequences for the design of therapeutic siRNA molecules targeting the human FAM13A gene were identified, and the sequence is shown herein as SEQ ID NO: 1 (Ensembl transcript number ENST00000264344.9). The bioinformatics analysis included performing information analysis of SEQ ID NO: 1, including tiling SEQ ID NO: 1 with 21-nucleotide-long triggers. To minimize the risk of off-target effects, none of the triggers that were complementary to human microRNAs and had less than 3 base pair mismatches to any identified human gene were prepared for functional testing. In addition, sequences were selected for their ability to cross-react with human and cynomolgus FAM13A mRNAs. Based on the results of the bioinformatics analysis, sequences were selected for initial synthesis and in vitro testing.

[0172] The unmodified sense and antisense sequences for the double-stranded molecules ranked by priority from the bioinformatics analysis are listed in Table 1 below. The first nucleotide in the range of nucleotides targeted by the siRNA molecules of each sequence family within the human FAM13A transcript (SEQ ID NO: 1) is also shown in Table 1.

[0173] [Table 1]

[0174] [Table 2]

[0175] [Table 3]

[0176] [Table 4]

[0177]

Table 5

[0178]

Table 6

[0179]

Table 7

[0180]

Table 8

[0181]

Table 9

[0182]

Table 10

[0183]

Table 11

[0184]

Table 12

[0185]

Table 13

[0186]

Table 14

[0187]

Table 15

[0188]

Table 16

[0189]

Table 17

[0190]

Table 18

[0191]

Table 19

[0192]

Table 20

[0193]

Table 21

[0194]

Table 22

[0195]

Table 23

[0196] Table 2 below provides the sequences of representative sense and antisense strands having chemically modified od duplexes used in the experiments disclosed herein. In Table 2, nucleotide sequences are listed according to the following notation: a, u, g, and c = corresponding 2'-O-methyl ribonucleotides; Af, Uf, Gf, and Cf = corresponding 2'-deoxy-2'-fluoro ("2'-fluoro") ribonucleotides; and invAb = inverted abasic deoxynucleotide (i.e., linked to the adjacent nucleotide via its 3'-substituent when at the 3'-end of the strand (3'-3' bond) or linked to the adjacent nucleotide via its 5'-substituent when at the 5'-end of the strand (5'-5' internucleotide bond) abasic deoxynucleotide). Insertion of "s" in the sequence indicates that two adjacent nucleotides are linked by a phosphorothioate group (e.g., phosphorothioate internucleotide bond). Unless otherwise indicated, all other nucleotides are linked by 3'-5' phosphodiester groups. [DCA-C6] represents conjugated docosanic acid (C22). [GalNAc3] represents the GalNAc moiety shown in Formula VII. The [DCA-C6] and [GalNAc] ligands are covalently attached to the 5'-terminal nucleotide of the 5'-end of the sense strand via a phosphodiester bond, or a phosphorothioate bond if "s" follows the [GalNAc3] or [DCA-C6] notation. When the invAb nucleotide is the 5'-terminal nucleotide of the 5'-end of the sense strand, this is linked to the adjacent nucleotide via a 5'-5' bond, and the GalNAc or C22 moiety is covalently attached to the 3'-carbon of the invAb nucleotide. In other respects, this moiety is covalently attached to the 5'-carbon of the 5'-terminal nucleotide of the sense strand.

[0197]

Table 24

[0198]

Table 25

[0199]

Table 26

[0200]

Table 27

[0201]

Table 28

[0202]

Table 29

[0203]

Table 30

[0204]

Table 31

[0205]

Table 32

[0206]

Table 33

[0207]

Table 34

[0208]

Table 35

[0209]

Table 36

[0210]

Table 37

[0211]

Table 38

[0212]

Table 39

[0213]

Table 40

[0214]

Table 41

[0215]

Table 42

[0216]

Table 43

[0217]

Table 44

[0218]

Table 45

[0219]

Table 46

[0220]

Table 47

[0221]

Table 48

[0222]

Table 49

[0223]

Table 50

[0224]

Table 51

[0225]

Table 52

[0226]

Table 53

[0227]

Table 54

[0228]

Table 55

[0229]

Table 56

[0230]

Table 57

[0231]

Table 58

[0232]

Table 59

[0233]

Table 60

[0234]

Table 61

[0235]

Table 62

[0236]

Table 63

[0237]

Table 64

[0238]

Table 65

[0239]

Table 66

[0240] The following method was applied to synthesize and purify the RNAi constructs identified in Tables 1 and 2.

[0241] Synthesis RNAi constructs were synthesized using solid-phase phosphoramidite chemistry. The synthesis was performed on a MerMade synthesizer (Bioautomation). Various chemical modifications including 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, inverted deoxy base nucleotides, and phosphorothioate internucleotide linkages were incorporated into the molecule. This RNAi construct was generally designed to form a 19 - 21 base pair double-strand when annealed with either a construct having no overhangs at the 3'-ends of the antisense strand and / or sense strand (double bluntmer) or a construct having one or two overhangs of two nucleotides. For in vivo studies, the sense strand of this RNAi construct was conjugated with either a trivalent N-acetyl-galactosamine (GalNAc) moiety or a hydrophobic moiety (e.g., palmitic acid or docosanoic acid) as further described below.

[0242] Materials used in the synthesis of the RNAi construct included the following: · Acetonitrile (DNA synthesis grade, AXO152 - 2505, EMD) · Capping reagent A (80:10:10 (v / v / v) tetrahydrofuran / lutidine / acetic anhydride, BIO221 / 4000, EMD) · Capping reagent B (16% 1-methylimidazole / tetrahydrofuran, BIO345 / 4000, EMD) · Activator solution (0.25 M 5-(ethylthio)-1H-tetrazole (ETT) in acetonitrile, BIO152 / 0960, EMD) · detritylation reagent (3% dichloroacetic acid in dichloromethane, BIO830 / 4000, EMD) · Oxidation reagent (70:20:10 (v / v / v) tetrahydrofuran / pyridine / water with 0.02 M iodine, BIO420 / 4000, EMD) · Diethylamine solution (20% DEA in acetonitrile, NC0017-0505, EMD) · Thiolating reagent (0.05 M 5-N-[(dimethylamino)methylene]amino-3H-1,2,4-dithiazole-3-thione (BIOSULII / 160K) in pyridine) · 5’-Aminohexyl linker phosphoramidites and 2’-methoxy and 2’-fluoro phosphoramidites of adenosine, guanosine and cytidine (Thermo Fisher Scientific), 0.10 M in acetonitrile on Molecular Trap Packs (0.5 g per 30 mL, Bioautomation) · 2’-Methoxy-uridine phosphoramidite (Thermo Fisher Scientific), 0.10 M in 90:10 (v / v) acetonitrile / DMF on Molecular Trap Packs (0.5 g per 30 mL, Bioautomation) · 2’-Deoxy-inverted abasic phosphoramidite (ChemGenes), 0.10 M in acetonitrile on Molecular Trap Packs (0.5 g per 30 mL, Bioautomation) · CPG support (Hi-Load Universal Support, 500A (BH5-3500-G1), 79.6 μmol / g, 0.126 g (10 μmol)) or 1 μmol Universal Synthesis Column, 500A, Pipette Style Body (MM5-3500-1, Bioautomation) · Ammonium hydroxide (concentrated, J.T.Baker)

[0243] The reagent solution, phosphoramidite solution, and solvent were connected to the MerMade machine. A column containing a solid support (BioAutomation, Universal Support, 500 Å) was fixed to the machine and washed with acetonitrile. The synthesis was initiated using Poseidon software. The phosphoramidite and reagent solution lines were purged. The synthesis was performed by repeating the deprotection / coupling / capping / oxidation / capping synthesis cycle. A detritylation reagent was added to the solid support to remove the 5'-dimethoxytrityl (DMT) protecting group. The solid support was washed with acetonitrile. A phosphoramidite (4 eq.) and activator solution (20 eq.) were added to the support, and the incoming nucleotide was coupled to the free 5'-hydroxyl group. The coupling reaction (6 minutes) was repeated twice. The support was washed with acetonitrile, and then capping reagents A and B were added to terminate any unreacted oligonucleotide chains. The support was washed with acetonitrile. An oxidation or thiolation reagent was added to the support to convert the triester phosphite to a phosphate triester or phosphorothioate. The oxidation reaction was extended from 3 minutes to 5 minutes. Capping reagents A and B were added to the support to dehydrate the support and terminate any unreacted oligonucleotide chains. The solid support was washed with acetonitrile. After the final reaction cycle, the resin was first treated with a diethylamine solution to remove the 2-cyanoethyl protecting group from the phosphate backbone. The support was washed with acetonitrile, and the DMT group was removed from the antisense strand. The 5'-end of the sense strand was left 5'-monomethoxytrityl (MMT) protected.

[0244] Analysis of the crude synthetic RNAi construct The crude sample was prepared for ion-pair formation (IP)-LCMS by diluting 20-fold in water (100 μL final volume). The sample was analyzed by ion-pair formation (IP)-LCMS on an Agilent 1290 analytical HPLC. The sample was eluted from a Waters Xbridge BEH OST C18 column (1.7 um, 2.1×50 mm) using a linear gradient of acetonitrile in 15.7 mM DIEA / 50 mM HFIP at a flow rate of 400 μL / min over 3.5 min.

[0245] Complexation To promote acylation on the resin or complexation to GalNAc, the MMT group was removed by adding a deprotection solution consisting of trifluoroacetic acid and triisopropylsilane (2% each, v / v) in dichloromethane (DCM). The mixture was gently stirred and allowed to stand for approximately 2 - 5 minutes. The mixture was first gravity filtered until the solution was no longer drained, and then filtered under vacuum. This process was repeated 5 - 10 times until the filtrate was no longer colored. The resin was washed with DCM, neutralized with 5% DIEA in DCM (2×2 minutes), and washed again with DCM.

[0246] When complexation with docosanic acid (C22) was desired, docosanic acid (10 molar equivalents relative to the resin) was dissolved in DCM (70 mM, 34.1 mg, 100 μmol, TCI), TATU (500 mM DMSO) (32.2 mg, 100 μmol, ChemPep) was added (10 eq), followed by DIEA (500 mM DCM) (25.24 mg, 200 μmol, Aldrich) (20 eq). The solution was mixed and allowed to stand for 5 - 10 minutes for pre-activation. The activated ester was added to the oligo resin and the reaction vessel was sealed. The reaction vessel was placed on a vortex mixer at 700 RPM at room temperature for 14 hours. The solvent was drained and the resin was washed with DMF and DCM.

[0247] When conjugation to the palmitoyl group was desired, palmitic acid (10 molar equivalents relative to the resin) was dissolved in DCM (300 mM, 25.64 mg, 100 μmol, Aldrich), transferred to a polypropylene tube (10 molar equivalents relative to the resin), and TATU (500 mM DMSO) (32.2 mg, 100 μmol, ChemPep) (10 eq) and then DIEA (500 mM DCM) (25.24 mg, 200 μmol, Aldrich) (20 eq) were added. The solution was mixed and allowed to stand for 5 - 10 minutes for pre-activation. The activated ester was added to the oligo resin and the reaction vessel was sealed. The reaction vessel was placed on a vortex mixer at 700 RPM at room temperature for 14 hours. The solution was drained and the resin was washed with DMF and DCM.

[0248] When conjugation to GalNAc was desired, a solution of GalNAc3-Lys2-Ahx (67 mg, 40 μmol) in DMF (0.5 mL) was prepared in a separate vial. Using 1,1,3,3-tetramethyluronium tetrafluoroborate (TATU, 12.83 mg, 40 μmol) and diisopropylethylamine (DIEA, 13.9 μL, 80 μmol), GalNAc3-Lys2-Ahx having the structure shown as formula VII below was prepared. The activated coupling solution was added to the resin, the column was capped and incubated overnight at room temperature. The resin was washed with DMF, DCM and dried under vacuum.

Chemical formula

[0249] In formula VII, X = O or S. The wavy line represents the point of attachment to the 5'-terminal nucleotide of the sense strand of this RNAi construct. The GalNAc moiety is linked to the 5'-carbon of the 5'-terminal nucleotide of the sense strand, provided that in the case where an inverted abasic (invAb) deoxynucleotide is the 5'-terminal nucleotide and is linked to the adjacent nucleotide via a 5'-5' nucleotide linkage, in this case the GalNAc moiety is linked to the 3'-carbon of the inverted abasic deoxynucleotide.

[0250] Cleavage from resin The column was placed in a cutting chuck, and 1.2 mL of a solution containing 20% ethanol in concentrated ammonium hydroxide (1:4 v / v) was added to the column. The solvent was gravity-drained through the solid support, and the filtrate was collected in a 24-well plate. The cleavage step was repeated three times, and the filtrates were combined. The plate was sealed in a deprotection chuck, placed in an incubator at 55 °C, and mixed at 200 RPM for 20 hours. The chuck / plate was cooled to room temperature, and samples were taken for LCMS. The plate was placed in a Genevac HT4X, and the samples were concentrated for 2 hours, leaving approximately 2 mL of concentrate.

[0251] RP-HPLC purification of lipid-complexed oligos The crude oligo was purified by RP-HPLC using a Phenomenex Oligo-RP C18 column (5 µm, 10×250 mm) at a flow rate of 6 mL / min. The mobile phase consisted of 0.02 M ammonium bicarbonate with 5% acetonitrile (buffer-A) and 75% acetonitrile (buffer-B). The fractions were pooled for desalting as described below.

[0252] Anion exchange purification of oligos The antisense strand and GalNAc-complexed sense strand were purified by anion exchange (AEX) chromatography. The oligos were eluted from two consecutive Tosoh TSK Gel SuperQ-5PW columns (21×150 mm, 13 µm) at a flow rate of 8 mL / min using a linear gradient of 20 mM sodium phosphate, 15% acetonitrile, and 1 M sodium bromide in pH 8.5. The samples were desalted and UV-quantified as described below.

[0253] Desalting The pooled fractions were desalted by size exclusion chromatography on a GE Akta Pure using a GE Hi-Prep 26 / 10 column and a 19.9% EtOH mobile phase. The desalted samples were analyzed by IP-LCMS, quantified by UV (Nanodrop), and lyophilized on a Genevac S3 HT12.

[0254] Final QC The sample was analyzed by ion pair formation (IP)-LCMS on an Agilent 1290 analytical HPLC. The sample was eluted from a Waters Xbridge BEH OST C18 column (1.7 um, 2.1×50 mm) using a linear gradient of acetonitrile in 15.7 mM DIEA / 50 mM HFIP at a flow rate of 400 μL / min over 6.5 minutes.

[0255] Annealing Single-strands were reconstituted at 2 mM in PBS and quantified by UV. Single-strands were diluted to 1 mM in PBS and equal volumes were combined to anneal the corresponding double-strands. The double-strands were annealed at 90 °C for 5 minutes and cooled to room temperature. Double-strand formation was monitored by analytical AEX and single-strands were titrated as needed.

[0256] Example 4: In Vitro Evaluation of FAM13A siRNA Molecules in Cell-Based Assays A panel of fully chemically modified siRNAs from Example 3 was prepared and tested in vitro for the potency and selectivity of FAM13A mRNA knockdown. Each siRNA duplex consisted of two strands, a sense or "passenger" strand and an antisense or "guide" strand.

[0257] An RNA FISH (fluorescent in situ hybridization) assay was performed to measure FAM13A mRNA knockdown by the test siRNA. HUH-7 cells (Sekisui Xenotech JCRB0403) were cultured in Eagle's Minimum Essential Medium (EMEM) (ATCC® 30-2003™) supplemented with 10% fetal bovine serum (FBS, Sigma) and 1% penicillin-streptomycin (P-S, Corning). The siRNA was transfected into the cells by reverse transfection using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific). 1 μL of the test siRNA (out of 10 data points for administration at 1:3 dilutions starting at a final concentration of 500 nM) or phosphate-buffered saline (PBS) vehicle and 4 μL of plain EMEM without supplements were added to a PDL-coated CellCarrier-384 Ultra assay plate (PerkinElmer) by a Bravo automated liquid handling platform (Agilent). Subsequently, 5 μL of Lipofectamine RNAiMAX (Thermo Fisher Scientific) pre-diluted in plain EMEM (0.06 μL RNAiMAX in 5 μL EMEM) was dispensed into the assay plate by a Multidrop Combi reagent dispenser (Thermo Fisher Scientific). After incubating the siRNA / RNAiMAX mixture for 20 minutes at room temperature (RT), 30 μL of HepG2 cells (2000 cells per well) in EMEM supplemented with 10% FBS and 1% P-S were added to the transfection complexes using the Multidrop Combi reagent dispenser. The assay plate was incubated for 20 minutes at RT before being placed in the incubator. The cells were incubated at 37 °C and 5% CO2 for 72 hours.

[0258] On an automated FISH assay platform assembled in-house, an RNA FISH assay was performed 72 hours after siRNA gene transfer using the manufacturer's assay reagents and protocol (QuantiGene® ViewRNA HC Screening Assay from Thermo Fisher Scientific). Briefly, cells were fixed at RT for 15 minutes in 4% formaldehyde (Thermo Fisher Scientific), permeabilized at RT for 3 minutes with a surfactant, and then treated at RT for 10 minutes with a protease solution. Target-specific probes (ThermoFisher VA6-3175340-VC) or vehicle (target probe diluent without target probe as negative control) were incubated for 3 hours, while the preamplifier, amplifier, and labeled probe were each incubated for 1 hour. All hybridization was performed at 40 °C in a Cytomat 2 C-LIN automated incubator (Thermo Fisher Scientific).

[0259] After the hybridization reaction, cells were stained with Hoechst and CellMask Blue (Thermo Fisher Scientific) for 30 minutes and then imaged with an Opera Phenix high-content screening system (PerkinElmer). Images were analyzed using the Columbus image data storage and analysis system (PerkinElmer) to obtain the average number of spots per cell. High (PBS containing target probe) and low (PBS without target probe) control wells were used to normalize the average number of spots per cell. The high and low controls had normalized values of 100 and 0, respectively. The normalized values for the test siRNA concentrations were fitted to a four-parameter sigmoidal model using Genedata Screener data analysis software (Genedata, Basel, Switzerland) to obtain the IC50 value and maximum activity.

[0260] To verify and compare the results, several siRNA duplexes were analyzed more than twice using the above assay.

[0261] The results of the assay are shown in Table 3. FAM13A knockdown provides the percentage of knockdown compared to the control sample. When the siRNA duplexes were tested more than twice, each test is shown as a separate row in Table 3 as a different "run" of the assay. Negative values indicate a decrease in FAM13A mRNA levels. Undetermined means that the Genedata Screener software was unable to fit the curve.

[0262] [Table 67]

[0263] [Table 68]

[0264] [Table 69]

[0265] [Table 70]

[0266] [Table 71]

[0267] [Table 72]

[0268] [Table 73]

[0269]

Table 74

[0270]

Table 75

[0271]

Table 76

[0272]

Table 77

[0273]

Table 78

[0274]

Table 79

[0275]

Table 80

[0276]

Table 81

[0277]

Table 82

[0278] Example 5: In Vivo Efficacy of siRNA Molecules in the AAV Human FAM13A Mouse Model To evaluate the efficacy of the FAM13A siRNA molecules, the highest performing FAM13A siRNA molecules from the in vitro activity assay described in Example 4 were evaluated for in vivo efficacy and durability in a C57BL / 6 mouse model. Broadly, FAM13A siRNA molecules were administered to mice expressing a portion of the human FAM13A gene. For these experiments, the sense strand in each of the siRNA molecules tested was conjugated to a trivalent GalNAc moiety represented by Formula VII or to docosanoic acid (C22) using the method described in Example 3. In some experiments, FAM13A siRNA molecules were evaluated for in vivo efficacy and durability with modified chemical modification patterns.

[0279] The mouse model used was the AAV-human FAM13A mouse model. Prior to siRNA injection, 10-12 week-old C57BL / 6 mice (The Jackson Laboratory) were fed a standard chow diet (Harlan, 2020xTeklad global soy protein-free extruded rodent diet). Female C57BL / 6 mice (10-14 weeks old) were intravenously injected with adeno-associated virus (AAV) engineered to co-express both eGFP and a portion of the human FAM13A gene transcript. The constructs used were: AAV-hFAM13A-1 (encoding nucleotides 1200-2900 of SEQ ID NO:1; "AAV1"), AAV-hFAM13A-2 (encoding nucleotides 2800-4500 of SEQ ID NO:1; "AAV2"), AAV-hFAM13A-3 (encoding nucleotides 4400-6100 of SEQ ID NO:1; "AAV3"), AAV-hFAM13A-9span (encoding nucleotides 15, 24, 125, 127, 222, 223, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 300, 33, 481, 498, 503, 504, and 513; "AAV-9 span"), or AAV-FAM13A-22 span (encoding selected portions of SEQ ID NO:1 containing SEQ ID NOs:15, 24, 41, 125, 127, 150, 164, 222, 233, 406, 448, 466, 470, 481, 498, 503, 504, 513, 523, 526, 527, 533, and 534, linked by a linker; "AAV-22 span").

[0280] For each mouse, 1 x 10 per animal 12 Two weeks after AAV injection, mice were given a single subcutaneous (sc) injection of buffer (PBS) or FAM13A siRNA molecules at doses of 0.5 mg / kg, 1 mg / kg, 3 mg / kg, 5 mg / kg, 15 mg / kg, or 20 mg / kg body weight in PBS (n = 3 or 4 mice per group, as indicated below).

[0281] The liver and subcutaneous white adipose tissue (scWAT) were collected and analyzed 2 or 4 weeks after siRNA administration. RNA from the collected animal tissues was processed for qPCR analysis. RNA was isolated from 50 - 100 mg of tissue using the RNeasy 96 Universal Tissue Kit RNA isolation protocol according to the manufacturer's instructions (Qiagen) or the KingFisher Apex system and MagMAX mirVana Total RNA Isolation Kit according to the manufacturer's instructions (ThermoFisher). Real-time PCR was performed using 50 ng of RNA per reaction and the following primer-probe sets according to the manufacturer's instructions (ThermoFisher) with the TaqMan® RNA-to-Ct™ 1-Step Kit: (1) eGFP1 forward primer: CTATGTGCAGGAGAGAACCATC (sense; SEQ ID NO: 2798); reverse primer: GCCCTTCAGCTCGATTCTATT (antisense; SEQ ID NO: 2799); probe: 5’-6FAM-TACAAGACCCGCGCTGAAGTCAAG TAMRA-3’ (sense; SEQ ID NO: 2800); (2) eGFP2 forward primer: TCATCTGCACCACTGGAAAG (sense; SEQ ID NO: 2801), reverse primer: CTGCTTCATATGGTCTGGGTATC (antisense; SEQ ID NO: 2802); probe: 5’-6FAM CCAACACTGGTCACTACCCTCACC TAMRA-3’ (sense; SEQ ID NO: 2803); (3) BGH forward primer: 5’-GCCAGCCATCTGTTGT-3’ (SEQ ID NO: 2804); reverse primer: 5’-GGAGTGGCACCTTCCA-3’ (SEQ ID NO: 2805); probe: 5’-6FAM-TCCCCCGTGCCTTCCTTGACC TAMRA-3’ (sense; SEQ ID NO: 2806); and (4) mPpib Taqman® gene expression assay (Mm00478295 Thermo Fisher).Using a primer set targeting either the eGFP sequence at the 5'-end of the construct (i.e., eGFP primer set #1 or eGFP primer set #2) or the bovine growth hormone polyadenylation signal (BGHpA primer set) present in the viral mRNA at the 3'-end of the construct, mRNA-level knockdown was quantified. The knockdown efficiency of the siRNA trigger was determined using semi-quantitative real-time polymerase chain reaction on a QuantStudio 7 Flex real-time thermocycler. Gene expression was calculated using the ΔΔCt approach while utilizing cyclophilin (PPIB) as a reference gene. The percentage change in human FAM13A mRNA in the liver or scWAT for each animal was calculated by comparing it to the level of human FAM13A mRNA in the liver or scWAT of control animals. The control animals used to calculate the percentage change expressed the same human FAM13A mRNA but received an injection of buffer only instead of siRNA injection.

[0282] The results of the tests in the AAV-FAM13A mouse model with different FAM13A siRNA molecules are shown in Tables 4 - 17 below. The data are presented as the mean percent change from control at weeks 4 - 6 of each test for each treatment group (i.e., 2 or 4 weeks after siRNA injection as shown), with animals n = 3 or 4 per group as shown. The trigger family refers to the first nucleotide of a series of SEQ ID NO:1 nucleotides targeted by a given siRNA molecule. As detailed in Table 2, if FAM13A siRNA molecules have the same trigger family designation as another FAM13A siRNA molecule but different duplex numbers, these two molecules have the same core sequence (i.e., siRNA molecules targeting the same region of the FAM13A transcript) but different chemical modification patterns. A chart of this subset of the data is also shown in FIGS. 8A - 8D.

[0283]

Table 83

[0284]

Table 84

[0285]

Table 85

[0286]

Table 86

[0287]

Table 87

[0288]

Table 88

[0289]

Table 89

[0290]

Table 90

[0291]

Table 91

[0292]

Table 92

[0293]

Table 93

[0294]

Table 94

[0295]

Table 95

[0296]

Table 96

[0297]

Table 97

[0298]

Table 98

[0299]

Table 99

[0300]

Table 100

[0301]

Table 101

[0302]

Table 102

[0303]

Table 103

[0304]

Table 104

[0305]

Table 105

[0306]

Table 106

[0307]

Table 107

[0308]

Table 108

[0309]

Table 109

[0310]

Table 110

[0311]

Table 111

[0312]

Table 112

[0313]

Table 113

[0314]

Table 114

[0315]

Table 115

[0316]

Table 116

[0317]

Table 117

[0318]

Table 118

[0319]

Table 119

[0320]

Table 120

[0321]

Table 121

[0322]

Table 122

[0323]

Table 123

[0324]

Table 124

[0325]

Table 125

[0326]

Table 126

[0327]

Table 127

[0328]

Table 128

[0329]

Table 129

[0330] Testing of FAM13A-directed siRNA molecules in the AAV human FAM13A mouse model has shown that various different regions within FAM13A mRNA can be targeted to effectively reduce FAM13A expression. As shown in Figure 6, the effective siRNA triggers targeted regions across the entire FAM13A mRNA transcript (SEQ ID NO: 1). In the table above, the regions targeted by the siRNA are identified by the trigger family, which refers to the first nucleotide of the series of nucleotides of SEQ ID NO: 1 targeted by a given siRNA molecule.

[0331] (For at least one probe set having at least one double strand) The trigger families that achieved a maximum knockdown of 40 - 60% relative to the vehicle control were T-1328, T-1631, T-1666, T-2343, T-2417, T-2623, T-2886, T-2887, T-2889, T-3133, T-3187, T-3189, T-3498, T-3499, T-4008, T-4109, T-4485, T-4927, T-4989, T-4993, T-4996, T-4998, T-5060 and T-5114.

[0332] (For at least one probe set having at least one double strand) The trigger families that achieved a maximum knockdown of 60 - 80% relative to the vehicle control were T-1678, T-2263, T-4834, T-4932, T-4957, T-4995 and T-5204. Representative double strands within these families that were demonstrated to be effective in reducing FAM13A expression by 60 - 80% included D-1615, D-1695 and D-1867 from trigger family T-1678; D-1573 from trigger family T-2263; D-1781, D-1894, D-1906, D-1918 and D-1930 from trigger family T-4834; D-1783, D-1895, D-1907 and D-1931 from trigger family T-4932; D-1631, D-1696, D-1703, D-1717, D-1724 and D-1731 from trigger family T-4957; D-2036 from T-4995; and D-1792, D-1898 and D-1928 from trigger family T-5204.

[0333] (For at least one probe set having at least one double strand) The trigger families that achieved knockdown exceeding 80% relative to the vehicle control were T-1309, T-1333, T-2080, T-2144, T-3000, T-4412, T-4717, T-4999, T-5042, T-5043, T-5045, T-5080, T-5247, T-5249, T-5274 and T-5276.Representative double-strands within these families that have been proven to be effective in reducing FAM13A expression by more than 80% include D-1667, D-1686, and D-1849 from trigger family T-1309; D-1597, D-1853, and D-2017 from trigger family T-1333; D-1680, D-1685, and D-1690 from trigger family T-2080; D-1682 and D-1858 from trigger family T-2144; D-1557, D-1650, and D-1861 from trigger family T-3000; D-1955 from trigger family T-4412; D-1896 from trigger family T-4717; D-1614, D-1697, D-1702, D-1709, D-1856, D-1863, D-1865, D-1866, D-1869, D-1873, D-1877, D-1878, D-1879, D-1880, D-1881, D-1884, D-1887, D-1987, D-1992, D-1997, and D-2002 from trigger family T-4999; D-2040 from trigger family T-5042; D-1698, D-1705, D-1864, D-1870, D-1875, D-1883, D-1886, D-1980, D-1984, D-1989, D-1994, and D-2004 from trigger family T-5043; D-1699, D-1612, D-1704, D-1868, D-1871, D-1876, D-1885, D-1888, D-1979, D-1983, D-1988, D-1993, D-1998, and D-2003 from trigger family T-5045; D-1623, D-1846, D-1862, D-1981, D-1985, D-1990, D-1995, D-2000, and D-2005 from trigger family T-5080; D-1768, D-2075, and D-2077 from trigger family T-5247; D-1970 from trigger family T-5249; D-1972 from trigger family T-5274; and D-1975, D-1991, D-1976, D-1977, D-1982, D-1996, and D-2001 from trigger family T-5276.

[0334] When testing various modification patterns for several trigger families, it was found that several triggers consistently promoted a high level of knockdown of FAM13A. For example, using the T-4999 trigger family sequences (D-1614, D-1697, D-1702, D-1709, D-1716, D-1723, D-1730, D-1737, D-1856, D-1863, D-1865, D-1866, D-1869, D-1872, D-1877, D-1878, D-1879, D-1880, D-1881, D-1884, D-1887, D-1978, D-1987, D-1992, D-1997, D-2002, D-2008, D-2017, D-2049, D-2054 and D-2090; see Table 2 for the sense and antisense sequences and the modification patterns used in these double-strands), 31 different modification patterns were tested in the above AAV-based experiments. Each of these double-strands utilized different modification patterns in the context of the same sense and antisense sequences (SEQ ID NOs: 498 and 1042). Among these double-strands, 25 modification patterns were observed to promote knockdown of more than 80% of FAM13A mRNA in at least one assay, and the remaining 6 modification patterns were observed to promote knockdown of 60% - 80% in at least one assay. These data indicate that the T-4999 trigger family is a particularly effective and reliable trigger for reducing FAM13A expression.

[0335] Another effective and reliable trigger family is the T-5043 trigger family, for which 25 different modification patterns were tested in the AAV-based experiments described above (D-1611, D-1698, D-1705, D-1712, D-1719, D-1726, D-1733, D-1740, D-1855, D-1864, D-1870, D-1875, D-1883, D-1886, D-1980, D-1984, D-1989, D-1994, D-1999, D-2004, D-2013, D-2022, D-2044, D-2048, and 2053; see Table 2 for the sense and antisense sequences and modification patterns used in these duplexes). Each of these duplexes utilized a different modification pattern in the context of the same sense and antisense sequences (SEQ ID NOs: 503 and 1047). Of these duplexes, 16 modification patterns were observed to promote greater than 80% knockdown of FAM13A mRNA in at least one assay, 8 were observed to promote 60%-80% knockdown in at least one assay, and 1 was observed to promote 40%-60% knockdown of FAM13A mRNA in at least one assay.

[0336] The third particularly effective trigger family is the T-5045 trigger family (the target sequences mostly overlap with the T-5043 trigger family). For this family, 25 different modification patterns were tested in the above AAV-based experiments (D-1612, D-1699, D-1704, D-1711, D-1718, D-1725, D-1732, D-1739, D-1868, D-1871, D-1876, D-1882, D-1885, D-1888, D-1979, D-1983, D-1988, D-1993, D-1998, D-2003, D-2012, D-2021, D-2043, D-2047 and D-2052; see Table 2 for the sense and antisense sequences in these double strands and the modification patterns used). Each of these double strands utilized different modification patterns in the context of the same sense and antisense sequences (SEQ ID NOs: 504 and 1048). Among these double strands, 18 modification patterns were observed to promote knockdown of more than 80% of FAM13A mRNA in at least one assay, and 7 were observed to promote knockdown of 60% - 80% in at least one assay.

[0337] Other trigger families that were able to show effective knockdown with multiple modification patterns included the T-1309, T-1333, T-2144, T-3000, T-5080 and 5226 trigger families.

[0338] By testing a wide range of triggers across FAM13A transcripts, it was revealed which transcript regions are susceptible to RNAi-mediated knockdown. Figure 6 summarizes the positions at which different effective trigger families target the FAM13A mRNA transcript (as provided in SEQ ID NO: 1), while classifying the maximum degree to which FAM13A expression could be knocked down in the above-described AAV-based assay. The triggers were classified based on whether the maximum knockdown observed for that trigger fell within the range of 40 - 60% knockdown, 60 - 80% knockdown, or greater than 80% knockdown.

[0339] As shown in Figure 6, one region of the human FAM13A mRNA transcript that is particularly sensitive to RNAi-based knockdown is the portion between nucleotides 4900 - 5300 of the FAM13A mRNA transcript. Within this small region, 24 distinct trigger families that promoted knockdown of FAM13A were identified, most of which were confirmed in multiple different double-strands with different modification patterns. These families included 12 trigger families that promoted knockdown greater than 80%, 5 families that promoted knockdown of 60% - 80%, and 7 families that promoted knockdown of 40% - 60%. Since the successful targets were unexpectedly concentrated, targeting between nucleotides 4900 - 5300 is shown to be a particularly useful strategy for knocking down FAM13A expression.

[0340] Other regions that were sensitive at multiple target positions included nucleotides 1300 - 1375, nucleotides 1625 - 1700, and nucleotides 2075 - 2175. Thus, these data also show that targeting any of these regions is a useful strategy for knocking down FAM13A expression.

[0341] These AAV-based experiments also tested the effectiveness of conjugating different ligands to the siRNA duplexes in promoting knockdown in different tissues. Figures 8A - 8D and Table 14 show the test results of FAM13A siRNA from the T-4999 and T-5043 families when the duplexes were conjugated to either GalNAc (Formula VII) or fatty acid C22. In these figures, "*" indicates the duplex conjugated to C22, while those without an asterisk indicate those conjugated to GalNAc. Knockdown data were collected in both the liver and adipose tissue after systemic administration. The duplex conjugated to GalNAc was administered at 3 mg / kg, while the trigger conjugated to C22 was administered at 20 mg / kg. All of the T-4999 and T-5043 duplexes tested were able to reduce the expression of FAM13A in the liver. In adipose tissue, the GalNAc-conjugated trigger was less effective in reducing FAM13A expression, and some had no detectable effect. In contrast, the triggers conjugated to C22 consistently promoted a decrease in FAM13A expression in adipose tissue to the same extent as they did in the liver. Examination of these data in combination with studies of weight, body fat mass, and metabolic profile assessment (see Examples 2, 6, and 7) shows that, surprisingly, GalNAc targeting can achieve results similar to C22 targeting, despite having less impact on FAM13A expression in biologically important adipose tissue.

[0342] From the above data, it is also possible to compare the bindings used to bind C22 to the siRNA duplex. The two tested bindings are through a phosphodiester bond (PO) and through a phosphorothioate bond (PS). Unexpectedly, the ligation of C22 with PS led to significantly better knockdown than ligation with PO. This was observed through the comparison of pairs of duplexes that differed only in their complexation methods. For example, one T-4999 trigger family pair showed a 43% increase in knockdown when switching from a PO to a PS bond (compare D-1697 (PO; 37% KD) and D-1856 (PS; 80% KD)). Another T-4999 trigger family pair showed a more modest 6% increase in knockdown when switching from a PO to a PS bond (compare D-1869 (PO; 74% KD) and D-1887 (PS; 80% KD)). The T-5080 trigger family pair showed a 25% increase in knockdown when switching from a PO to a PS bond (compare D-1846 (PO; 44% KD) and D-1862 (PS; 69% KD)). The T-5043 trigger family pair showed a 45% increase in knockdown when switching from a PO to a PS bond (compare D-1698 (PO; 13% KD) and D-1855 (PS; 58% KD)). Another T-5043 trigger family pair showed a 30% increase in knockdown when switching from a PO to a PS bond (compare D-1875 (PO; 40% KD) and D-1886 (PS; 70% KD)). Also, the T-5045 trigger family pair showed a 38% increase in knockdown when switching from a PO to a PS bond (compare D-1871 (PO; 27% KD) and (D-1882 (PS; 65% KD)). From these and other data in Tables 4-17 above, it is shown that unexpectedly and consistently, ligating C22 to siRNA duplexes having PS led to significantly better knockdown than ligating it to the same siRNA duplexes having PO.

[0343] Example 6: In Vivo Knockdown of Endogenous Mouse Fam13a in an Obesity Model To determine which human siRNA duplexes (see Examples 4 and 5) would be suitable for testing in endogenous mouse Fam13a knockdown experiments, the validated trigger families (see Examples 4 and 5 above) were reviewed for cross-reactivity with mouse Fam13a mRNA. This review revealed that the T-4999 trigger family aligns with the mouse Fam13a sequence for all but one base of its sequence. Assuming that this might still be sufficient to demonstrate knockdown activity, experiments were performed to evaluate the efficacy of the T-4999 FAM13A siRNA molecule against endogenous mouse Fam13a mRNA in a diet-induced obesity (DIO) model in C57BL / 6 mice.

[0344] For this assay, three duplexes from the T-4999 trigger family were selected: D-1709 (conjugated to GalNAc via PS), D-1869 (conjugated to C22 via PO), and D-1887 (conjugated to C22 via PS). The duplexes D-2086 (conjugated to GalNAc via PS) and D-2087 (conjugated to C22 via PS), which target human FAM13A but were not predicted to bind to mouse FAM13A, were used as negative controls. Two duplexes that perfectly match the mouse FAM13A mRNA sequence, D-2086 (conjugated to GalNAc via PS) and D-2087 (conjugated to C22 via PS), were also tested.

[0345] Male C57BL6 mice were fed a diet starting at 5 weeks of age that contained a high fat content (Research Diets D12492, 60% kcal from fat). When the mice reached 19 weeks of age (14 weeks on the high fat diet), they were given a subcutaneous injection of buffer (PBS) or FAM13A siRNA molecules at doses of 3 mg / kg body weight or 20 mg / kg body weight in PBS (n = 8 mice / group). Body weight was measured continuously throughout the study. Body composition was measured by NMR (EchoMRI 3n1 Body Composition Analyzer) at baseline (2 days before injection) and on day 25 after injection. Liver and subcutaneous white adipose tissue (scWAT) were harvested and analyzed 4 weeks after siRNA administration.

[0346] RNA from the harvested animal tissues was processed for qPCR analysis. RNA was isolated from 50 - 100 mg of tissue using the RNeasy 96 Universal Tissue Kit RNA isolation protocol according to the manufacturer's instructions (Qiagen). Real-time PCR was performed using the TaqMan® RNA-to-Ct™ 1-Step-Kit according to the manufacturer's instructions (ThermoFisher), with 50 ng of RNA per reaction and a primer-probe set complementary to mouse Fam13a mRNA. The percent change in mouse Fam13a mRNA in the liver or scWAT for each animal was calculated by comparing to the level of mouse Fam13a mRNA in the liver or scWAT of animals administered PBS buffer control.

[0347] The results of these tests are shown in Figures 9A - 9C and Figures 10A - 10B. These figures show the levels of knockdown achieved in the liver, inguinal WAT, and epididymal WAT of each mouse. Each of the non-targeting control siRNA duplexes showed the same expression levels as the buffer-only control mice (in all three tissues).

[0348] In the liver, all Fam13a-directed duplexes effectively reduced mouse Fam13a expression (Figure 9A). GalNAc-conjugated duplexes 2086 and D-1709 equally reduced Fam13a expression in the liver (62% and 63%, respectively). This indicated that the T-4999 duplex (D-1709) was effective despite having one mismatch with the target sequence. Each of the C22-conjugated duplexes also promoted Fam13a knockdown in the liver, with D-2087 resulting in 76% knockdown, D-1869 resulting in 55% knockdown, and D-1887 resulting in 69% knockdown.

[0349] In inguinal WAT, C22-conjugated duplexes were more effective than GalNAc-conjugated duplexes in reducing mouse Fam13a expression. GalNAc-conjugated duplexes, D-2086 and D-1709, reduced expression by 8% and 19%, respectively, in the liver. In contrast, C22-conjugated duplexes resulted in Fam13a knockdown at levels similar to those achieved in the liver: D-2087 resulted in 66% knockdown, D-1869 resulted in 60% knockdown, and D-1887 resulted in 62% knockdown.

[0350] In epididymal WAT, the knockdown observed was less than that in the other two tissue types. Neither of the GalNAc-conjugated duplexes resulted in significant knockdown of mouse Fam13a. In contrast, C22-conjugated duplexes resulted in some Fam13a knockdown: D-2087 resulted in 22% knockdown, D-1869 resulted in 26% knockdown, and D-1887 resulted in 26% knockdown.

[0351] Figure 10A shows the effect of siRNA treatment on the body weight of DIO mice. Untreated and control-treated mice had a 5 - 8% increase in body weight over the course of the experiment. Treatment with either of the Fam13a double-strands reduced or prevented this weight gain. With the GalNAc-conjugated double-strands D-2086 and D-1709, the weight gain was limited to 2% and 4%, respectively. The C22-conjugated double-strands also limited weight gain, with D-2087 actually causing a 1% weight loss in the mice, D-1869 suppressing the increase to 2%, and D-1887 suppressing the increase to 3%.

[0352] Figure 10B shows the effect of siRNA treatment on the body fat mass of DIO mice. Untreated and control-treated mice had an 8 - 9% increase in body fat mass over the course of the experiment. Treatment with any of the Fam13a double-strands reduced or prevented this weight gain. With the GalNAc-conjugated double-strands D-2086 and D-1709, the weight gain was suppressed to 6% and 4%, respectively. The C22-conjugated double-strands also suppressed weight gain, with D-2087 actually causing a 2% weight loss in the mice, D-1869 suppressing the increase to 3%, and D-1887 suppressing the increase to 3%.

[0353] These data provide further support for FAM13A siRNA (and specifically the T-4999 trigger family) for various purposes such as reduction of abdominal adiposity, weight loss, reduction of body fat mass, improvement of metabolic parameters including insulin resistance and non-alcoholic steatohepatitis (NASH), and reduction of the risk of myocardial infarction.

[0354] Example 7: FAM13A siRNA in Non-Human Primates To evaluate the efficacy of FAM13A siRNA molecules in a non-human primate model, the in vivo efficacy of the top performing FAM13A siRNA molecules from the in vitro and in vivo activity assays described in Examples 4 and 5 was evaluated using cynomolgus monkeys. In particular, triggers from the T-4999 and T-5043 families were selected. The selected triggers target sequences present in both human and cynomolgus monkey FAM13A mRNAs and were thus expected to be effective in knocking down endogenous cynomolgus monkey FAM13A.

[0355] For these experiments, using the method described in Example 3, the sense strand in each siRNA molecule tested was conjugated to a trivalent GalNAc moiety shown in Formula VII or to docosanoic acid (C22). Thus, in the experiments, T-4999 duplex T-1709 (conjugated to GalNAc via PS) and T-1887 (conjugated to C22 via PS) and T-5043 duplex D-1705 (conjugated to GalNAc via PS) and D-1886 (conjugated to C22 via PS) were used.

[0356] The test design is given in Figure 18 below. Briefly, there were N = 3 animals per treatment group (naïve and non-naïve, female, lean cynomolgus monkeys, Cambodian origin, 3 years old). A single subcutaneous dose was administered to the mid-scapular region of each animal. Liver tissue biopsy samples were collected on days -14 or -11 prior to dosing and on days 14, 30, and 45 (relative to dosing on day 0) after dosing. Adipose tissue biopsy samples were collected on days -14 or -11 prior to dosing (omentum fat), and on days 14 (falciform fat), 30 (omentum fat), and 45 (omentum fat and falciform fat) after dosing. Blood for clinical chemistry analysis was collected via the femoral vein on days -14 (before biopsy), -7, 7, 14 (before biopsy), 20, 25, 30 (before biopsy), 35, and 45 (before necropsy). The animals were fasted on days -14, 14, and 30 for the tissue biopsy collection procedure.

[0357]

Table 130

[0358] For analysis of FAM13A knockdown levels in the liver and adipose tissues, total RNA was isolated from 10 - 20 mg of tissue for each tissue sample at each time point. Next, cDNA samples were prepared from each total RNA sample and diluted 1:10 for ddPCR analysis. The cynomolgus FAM13A primer / probe set and the cynomolgus PPIB primer / probe set were used for the analysis. % mRNA knockdown was calculated for each individual animal by comparing to the pre - administration FAM13A expression level and then averaged across time points.

[0359] Data on the knockdown of FAM13A mRNA levels in the liver are shown in Figure 11A. The most effective duplex in the liver was D - 1709, a GalNAc - conjugated siRNA from the D - 4999 trigger family. In the liver, a single administration of D - 1709 reduced the FAM13A mRNA level by an average of 81% by day 14, and the knockdown was maintained at day 30 (77%) and day 45 (80%) without any subsequent treatment. Duplex D - 1887 was identical to D - 1709 except that it was conjugated to C22 and was (at a higher dose) approximately as effective as D - 1709. A single administration of D - 1887 reduced the FAM13A mRNA level by an average of 68% by day 14, and the knockdown increased at day 30 (71%) and day 45 (75%) without any subsequent treatment.

[0360] Figure 11A also shows liver knockdown achieved by two double-strands from the T-5043 trigger family. Single administration of D-1705 (GalNAc) reduced FAM13A mRNA levels by an average of 58% by day 14, and the knockdown was maintained at day 30 (52%) and day 45 (48%) without any subsequent treatment. However, one of the three treated animals showed minimal knockdown and may have been an outlier, as knockdown in two of the animals was much higher. The other double-strand in the T-5043 family, D-1886 (C22), reduced FAM13A mRNA levels by an average of 45% by day 14, but the knockdown levels decreased by day 30 (35%) and day 45 (8.4%).

[0361] Figure 11B shows data on knockdown of FAM13A mRNA in adipose tissue. The most effective double-strands in adipose tissue were D-1887 (T-4999;C22) and D-1886 (T-5043;C22). Single administration of D-1887 reduced FAM13A mRNA levels by an average of 83% by day 14, and the knockdown was maintained at day 30 (80%) and day 45 (75%) without any subsequent treatment. Similarly, single administration of D-1886 reduced FAM13A mRNA levels by an average of 79% by day 14, and the knockdown was maintained at day 30 (64%) and day 45 (83%) without any subsequent treatment. The two GalNAc-conjugated double-strands showed a time shift in silencing activity but were also effective for knockdown of FAM13A. Single administration of D-1709 reduced FAM13A mRNA levels by an average of 11% by day 14, and the knockdown increased at day 30 (45%) and day 45 (56%) without any subsequent treatment. Single administration of D-1705 had minimal effect on FAM13A mRNA levels at day 14 (19% reduction) and day 30 (15% increase), but an average knockdown of 55% was observed at day 45.

[0362] Figures 11C - 11E show the results of clinical chemical analysis performed on serum samples from treated animals. For all of the double-strands tested, there was a consistent decrease of approximately 20% or more in serum cholesterol (Figure 11C), serum LDL (Figure 11D), and serum HDL (Figure 11E) between 20 - 30 days after siRNA treatment. These decreases are consistent with the effect of FAM13A-targeted siRNA on mouse blood chemistry (see Example 2 and Figure 5). Thus, these data provide further support for FAM13A siRNA (and specifically the T-4999 and T-5043 trigger families) for use for various purposes such as reduction of abdominal adiposity, weight loss, reduction of body fat mass, improvement of metabolic parameters including insulin resistance and non-alcoholic steatohepatitis (NASH), and reduction of the risk of myocardial infarction.

[0363] Further evidence for the effectiveness of FAM13A siRNA in the treatment of such conditions is collected through the use of obese cynomolgus monkeys. After administration of T-4999 double-strand T-1709 (complexed with GalNAc via PS) and D-1887 (complexed with C22 via PS) and T-5043 double-strand D-1705 (complexed with GalNAc via PS) and D-1886 (complexed with C22 via PS), these animals are monitored. Body weight, body fat mass, blood chemistry, and other metabolic parameters are monitored and correlated with knockdown of FAM13A expression in both the liver and adipose tissue.

Claims

1. An RNAi construct comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence sufficiently complementary to the sequence of the antisense strand to form a double-stranded region, wherein the antisense strand is (a) a region having substantial identity to at least 15 consecutive nucleotides within nucleotides 1300 to 1375 or 4900 to 5300 of the FAM13A mRNA sequence shown in SEQ ID NO: 1, and having no more than 2 mismatches between the region of substantial identity of the antisense strand and the consecutive nucleotides; or (b) a region having substantial identity to at least 15 consecutive nucleotides from the antisense sequences listed in Table 1 or Table 2, and having no more than 2 mismatches between the region of substantial identity of the antisense strand and the consecutive nucleotides and the RNAi construct comprising the same.

2. The RNAi construct according to claim 1, wherein the antisense strand comprises (a) a region consisting of at least 15 consecutive nucleotides within nucleotides 1300 to 1375 or 4900 to 5300 of the FAM13A mRNA sequence shown in SEQ ID NO: 1, or (b) a region consisting of at least 15 consecutive nucleotides from the antisense sequences listed in Table 1 or Table 2.

3. The RNAi construct according to claim 1, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 4950 to 5100 of the FAM13A mRNA sequence shown in SEQ ID NO:

1.

4. The RNAi construct according to claim 3, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 4975 to 5075 of the FAM13A mRNA sequence shown in SEQ ID NO:

1.

5. The RNAi construct according to claim 1, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 5225 to 5300 of the FAM13A mRNA sequence shown in SEQ ID NO:

1.

6. The RNAi construct according to any one of claims 1 to 5, wherein the sense strand and the antisense strand form a double-stranded region having a length of about 15 to about 30 base pairs.

7. The RNAi construct according to claim 6, wherein the double-stranded region is about 17 to about 24 base pairs in length.

8. The RNAi construct according to claim 6, wherein the double-stranded region is about 19 to about 21 base pairs in length.

9. The RNAi construct according to any one of claims 1 to 8, wherein the sense strand and the antisense strand are each independently about 19 to about 30 nucleotides in length.

10. The RNAi construct according to claim 9, wherein the sense strand and the antisense strand are each independently about 19 to about 23 nucleotides in length.

11. The RNAi construct according to any one of claims 1 to 10, comprising one or two blunt ends.

12. The RNAi construct according to any one of claims 1 to 10, comprising one or two nucleotide overhangs of 1 to 4 unpaired nucleotides.

13. The RNAi construct according to claim 12, wherein the nucleotide overhang has two unpaired nucleotides.

14. The RNAi construct according to claim 12 or 13, comprising a nucleotide overhang at the 3'-end of the sense strand, the 3'-end of the antisense strand, or both the 3'-ends of the sense strand and the antisense strand.

15. The RNAi construct according to any one of claims 1 to 14, comprising one or more modified nucleotides.

16. The RNAi construct according to claim 15, wherein the one or more modified nucleotides are 2'-modified nucleotides.

17. The RNAi construct according to claim 15, wherein the one or more modified nucleotides are 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-allyl-modified nucleotides, bicyclic nucleic acids (BNAs), deoxyribonucleotides, or combinations thereof.

18. The RNAi construct according to any one of claims 15 to 17, wherein all of the nucleotides in the sense strand and the antisense strand are modified nucleotides.

19. The RNAi construct according to claim 18, wherein the modified nucleotides are 2'-O-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, or combinations thereof.

20. The RNAi construct according to any one of claims 1 to 19, wherein the sense strand contains a depurinated nucleotide as a terminal nucleotide at its 3'-end, its 5'-end, or both its 3'-end and 5'-end.

21. The RNAi construct according to claim 20, wherein the depurinated nucleotide is linked to an adjacent nucleotide through a 3'-3' internucleotide bond or a 5'-5' internucleotide bond.

22. The RNAi construct according to any one of claims 1 to 21, wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand contain one or more phosphorothioate internucleotide bonds.

23. The RNAi construct according to claim 22, wherein the antisense strand contains two consecutive phosphorothioate internucleotide bonds between terminal nucleotides at both the 3'-end and the 5'-end.

24. The RNAi construct according to claim 22 or 23, wherein the sense strand contains a single phosphorothioate internucleotide bond between terminal nucleotides at the 3'-end.

25. The RNAi construct according to claim 22 or 23, wherein the sense strand contains two consecutive phosphorothioate internucleotide bonds between terminal nucleotides at the 3'-end.

26. The RNAi construct according to any one of claims 1 to 25, wherein the antisense strand contains or consists of a sequence selected from the antisense sequences listed in Table 1 or Table 2.

27. The RNAi construct according to any one of claims 1 to 26, wherein the sense strand contains or consists of a sequence selected from the sense sequences listed in Table 1 or Table 2.

28. The RNAi construct according to any one of claims 1 to 27, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 15 and 559, SEQ ID NO: 24 and 568, SEQ ID NO: 125 and 669, SEQ ID NO: 127 and 671, SEQ ID NO: 222 and 766, SEQ ID NO: 406 and 950, SEQ ID NO: 448 and 992, SEQ ID NO: 498 and 1042, SEQ ID NO: 502 and 1046, SEQ ID NO: 503 and 1047, SEQ ID NO: 504 and 1048, SEQ ID NO: 513 and 1057, SEQ ID NO: 526 and 1070, SEQ ID NO: 527 and 1071, SEQ ID NO: 533 and 1077 or SEQ ID NO: 534 and 1078. **Claim 29** The RNAi construct according to claim 28, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 24 and 568, SEQ ID NO: 406 and 950, SEQ ID NO: 498 and 1042, SEQ ID NO: 503 and 1047, SEQ ID NO: 504 and 1048, SEQ ID NO: 513 and 1057, SEQ ID NO: 527 and 1071 or SEQ ID NO: 534 and 1078. **Claim 30** The RNAi construct according to claim 28, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 498 and 1042. **Claim 31** The RNAi construct according to any one of claims 1 to 27, which is D-1557, D-1597, D-1612, D-1614, D-1623, D-1650, D-1667, D-1680, D-1682, D-1685, D-1686, D-1690, D-1697, D-1698, D-1699, D-1702, D-1704, D-1705, D-1709, D-1768, D-1846, D-1849, D-1853, D-1856, D-1858, D-1861, D-1862, D-1863, D-1864, D-1865, D-1866, D-1868, D-1869, D-1870, D-1871, D-1873, D-1875, D-1876, D-1877, D-1878, D-1879, D-1880, D-1881, D-1883, D-1884, D-1885, D-1886, D-1887, D-1888, D-1899, D-1896, D-1955, D-1970, D-1972, D-1975, D-1976, D-1977, D-1979, D-1980, D-1981, D-1982, D-1983, D-1984, D-1985, D-1987, D-1988, D-1989, D-1990, D-1991, D-1992, D-1993, D-1994, D-1995, D-1996, D-1997, D-1998, D-2000, D-2001, D-2002, D-2003, D-2004, D-2005, D-2012, D-2013, D-2014, D-2017, D-2021, D-2022, D-2023, D-2040, D-2044, D-2045, D-2047, D-2049, D-2051, D-2052, D-2053, D-2054, D-2058, D-2061, D-2075, D-2077, D-2079, D-2080, D-2081, D-2083, D-2090, D-2091 or D-2093.

32. The RNAi construct according to any one of claims 1 to 27, which is D-1492, D-1614, D-1697, D-1702, D-1709, D-1716, D-1723, D-1730, D-1737, D-1856, D-1863, D-1865, D-1866, D-1869, D-1872, D-1877, D-1878, D-1879, D-1880, D-1881, D-1884, D-1887, D-1978, D-1987, D-1992, D-1997, D-2002, D-2008, D-2017, D-2049, D-2054 or D-2090.

33. The RNAi construct according to any one of claims 1 to 27, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 1800 and 2648 (D-1709) or SEQ ID NO: 2861 and 3115 (D-1887).

34. The RNAi construct according to any one of claims 1 to 33, further comprising a ligand.

35. The RNAi construct according to claim 34, wherein the ligand comprises a cholesterol moiety, a vitamin, a steroid, a bile acid, a folic acid moiety, a fatty acid, a carbohydrate, a glycoside or an antibody or an antigen-binding fragment thereof.

36. The RNAi construct according to claim 34, wherein the ligand comprises galactose, galactosamine or N-acetyl-galactosamine.

37. The RNAi construct according to claim 36, wherein the ligand comprises a polyvalent galactose moiety or a polyvalent N-acetyl-galactosamine moiety.

38. The RNAi construct according to claim 37, wherein the polyvalent galactose moiety or the polyvalent N-acetyl-galactosamine moiety is trivalent or tetravalent.

39. The RNAi construct according to claim 35, wherein the ligand is a long-chain fatty acid.

40. The RNAi construct according to claim 39, wherein the long-chain fatty acid is lauric acid (C12), myristic acid (C14), palmitic acid (C16), stearic acid (C18), eicosapentaenoic acid (C20), docosanoic acid (C22) or docosahexaenoic acid (C24).

41. The RNAi construct according to claim 40, wherein the long-chain fatty acid is docosanoic acid (C22).

42. The RNAi construct according to any one of claims 34 to 41, wherein the ligand is optionally covalently attached to the sense strand through a linker. **Claim 43** The RNAi construct according to claim 42, wherein the ligand is covalently attached to the 5' end of the sense strand. **Claim 44** The RNAi construct according to any one of claims 34 to 43, wherein the ligand is linked through a phosphodiester or phosphorothioate bond. **Claim 45** A pharmaceutical composition comprising the RNAi construct according to any one of claims 1 to 44 and a pharmaceutically acceptable carrier or excipient. **Claim 46** A method for reducing the expression of FAM13A protein in a patient in need thereof, the method comprising administering to the patient the RNAi construct according to any one of claims 1 to 44 or the pharmaceutical composition according to claim 45. **Claim 47** The method according to claim 46, wherein the expression level of FAM13A in hepatocytes is reduced in the patient after administration of the RNAi construct or the pharmaceutical composition as compared to the FAM13A expression level in a patient who has not received the RNAi construct or the pharmaceutical composition. **Claim 48** The method according to claim 46 or claim 47, wherein the expression level of FAM13A in adipocytes is reduced in the patient after administration of the RNAi construct or the pharmaceutical composition as compared to the FAM13A expression level in a patient who has not received the RNAi construct or the pharmaceutical composition. **Claim 49** The method according to any one of claims 46 to 48, wherein the patient is diagnosed with or at risk of obesity, abdominal obesity, NASH, fatty liver, insulin resistance, type 2 diabetes, hypertriglyceridemia or hypercholesterolemia. **Claim 50** A method for reducing the body weight or body fat mass of a patient, the method comprising administering to the patient the RNAi construct according to any one of claims 1 to 44 or the pharmaceutical composition according to claim 45. **Claim 51** The method according to any one of claims 46 to 50, wherein the patient has a high waist-to-hip ratio. **Claim 52** The method according to claim 50, wherein the waist-to-hip ratio is greater than 1.

0. **Claim 53** The method according to claim 50 or 51, wherein the patient is diagnosed with abdominal obesity. **Claim 54** The method according to any one of claims 46 to 53, wherein the RNAi construct or pharmaceutical composition is administered to the patient via a parenteral route of administration.

55. The method according to claim 54, wherein the parenteral route of administration is intravenous or subcutaneous.

56. An RNAi construct according to any one of claims 1 to 44 for use in treating, preventing or reducing the risk of onset of obesity, abdominal obesity, NASH, fatty liver, insulin resistance, type 2 diabetes, hypertriglyceridemia or hypercholesterolemia in a patient in need thereof.

57. Use of an RNAi construct according to any one of claims 1 to 44 in the preparation of a medicament for treating, preventing or reducing the risk of onset of obesity, abdominal obesity, NASH, fatty liver, insulin resistance, type 2 diabetes, hypertriglyceridemia or hypercholesterolemia in a patient in need thereof.

58. A method of reducing body weight or body fat mass by administering an RNAi construct comprising a sense strand, an antisense strand and a ligand targeting delivery to hepatocytes, wherein the antisense strand has a sequence complementary to the mRNA sequence of FAM13.

59. The method according to claim 58, wherein the FAM13A mRNA sequence is a human mRNA sequence.

60. The method according to claim 58, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 1300 to 1375 or 4900 to 5300 of the FAM13A mRNA sequence shown in SEQ ID NO:

1.

61. The method according to claim 58, wherein the antisense strand comprises a region comprising a sequence substantially complementary to the FAM13A mRNA sequence, and the region comprises at least 15 consecutive nucleotides from the antisense sequences listed in Table 1 or Table 2.

62. The method according to claim 60, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 4950 to 5100 of the FAM13A mRNA sequence represented by SEQ ID NO:

1.

63. The method according to claim 62, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 4975 to 5075 of the FAM13A mRNA sequence represented by SEQ ID NO:

1.

64. The method according to claim 60, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 5225 to 5300 of the FAM13A mRNA sequence represented by SEQ ID NO:

1.

65. The method according to any one of claims 58 to 64, wherein the sense strand comprises a sequence sufficiently complementary to the sequence of the antisense strand to form a double-stranded region about 15 to about 30 base pairs in length.

66. The method according to claim 65, wherein the double-stranded region is about 17 to about 24 base pairs in length.

67. The method according to claim 66, wherein the double-stranded region is about 19 to about 21 base pairs in length.

68. The method according to any one of claims 58 to 67, wherein the sense strand and the antisense strand are each independently about 19 to about 30 nucleotides in length.

69. The method according to claim 68, wherein the sense strand and the antisense strand are each independently about 19 to about 23 nucleotides in length.

70. The method according to any one of claims 58 to 69, wherein the RNAi construct comprises one or two blunt ends.

71. The method according to any one of claims 58 to 69, wherein the RNAi construct comprises one or two nucleotide overhangs of 1 to 4 unpaired nucleotides.

72. The method according to claim 71, wherein the nucleotide overhang has two unpaired nucleotides.

73. The method according to claim 71 or 72, wherein the RNAi construct comprises a nucleotide overhang at the 3' end of the sense strand, the 3' end of the antisense strand, or both the 3' ends of the sense strand and the antisense strand.

74. The method according to any one of claims 58 to 73, wherein the RNAi construct comprises one or more modified nucleotides.

75. The method according to claim 74, wherein the one or more modified nucleotides are 2'-modified nucleotides. **Claim 76** The method according to claim 74, wherein the one or more modified nucleotides are 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNA), deoxyribonucleotides or combinations thereof. **Claim 77** The method according to any one of claims 74 to 76, wherein all nucleotides in the sense strand and the antisense strand are modified nucleotides. **Claim 78** The method according to claim 77, wherein the modified nucleotides are 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides or combinations thereof. **Claim 79** The method according to any one of claims 58 to 78, wherein the sense strand contains a depurinated nucleotide as a terminal nucleotide at its 3'-end, its 5'-end or both its 3'-end and 5'-end. **Claim 80** The method according to claim 79, wherein the depurinated nucleotide is linked to an adjacent nucleotide through a 3'-3' internucleotide bond or a 5'-5' internucleotide bond. **Claim 81** The method according to any one of claims 58 to 80, wherein the sense strand, the antisense strand or both the sense strand and the antisense strand contain one or more phosphorothioate internucleotide bonds. **Claim 82** The method according to claim 81, wherein the antisense strand contains two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at both the 3'-end and the 5'-end. **Claim 83** The method according to claim 81 or 82, wherein the sense strand contains a single phosphorothioate internucleotide bond between the terminal nucleotides at the 3'-end. **Claim 84** The method according to claim 81 or 82, wherein the sense strand contains two consecutive phosphorothioate internucleotide bonds between the terminal nucleotides at the 3'-end. **Claim 85** The method according to any one of claims 58 to 84, wherein the antisense strand contains or consists of a sequence selected from the antisense sequences listed in Table 1 or Table 2. **Claim 86** The method according to any one of claims 58 to 85, wherein the sense strand comprises or consists of a sequence selected from the sense sequences listed in Table 1 or Table 2.

87. The method according to any one of claims 58 to 86, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 15 and 559, SEQ ID NO: 24 and 568, SEQ ID NO: 125 and 669, SEQ ID NO: 127 and 671, SEQ ID NO: 222 and 766, SEQ ID NO: 406 and 950, SEQ ID NO: 448 and 992, SEQ ID NO: 498 and 1042, SEQ ID NO: 502 and 1046, SEQ ID NO: 503 and 1047, SEQ ID NO: 504 and 1048, SEQ ID NO: 513 and 1057, SEQ ID NO: 526 and 1070, SEQ ID NO: 527 and 1071, SEQ ID NO: 533 and 1077, or SEQ ID NO: 534 and 1078.

88. The method according to claim 87, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 24 and 568, SEQ ID NO: 406 and 950, SEQ ID NO: 498 and 1042, SEQ ID NO: 503 and 1047, SEQ ID NO: 504 and 1048, SEQ ID NO: 513 and 1057, SEQ ID NO: 527 and 1071, or SEQ ID NO: 534 and 1078.

89. The method according to claim 87, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 498 and 1042.

90. The method according to any one of claims 58 to 86, wherein the RNAi construct is D-1557, D-1597, D-1612, D-1614, D-1623, D-1650, D-1667, D-1680, D-1682, D-1685, D-1686, D-1690, D-1697, D-1698, D-1699, D-1702, D-1704, D-1705, D-1709, D-1768, D-1846, D-1849, D-1853, D-1856, D-1858, D-1861, D-1862, D-1863, D-1864, D-1865, D-1866, D-1868, D-1869, D-1870, D-1871, D-1873, D-1875, D-1876, D-1877, D-1878, D-1879, D-1880, D-1881, D-1883, D-1884, D-1885, D-1886, D-1887, D-1888, D-1899, D-1896, D-1955, D-1970, D-1972, D-1975, D-1976, D-1977, D-1979, D-1980, D-1981, D-1982, D-1983, D-1984, D-1985, D-1987, D-1988, D-1989, D-1990, D-1991, D-1992, D-1993, D-1994, D-1995, D-1996, D-1997, D-1998, D-2000, D-2001, D-2002, D-2003, D-2004, D-2005, D-2012, D-2013, D-2014, D-2017, D-2021, D-2022, D-2023, D-2040, D-2044, D-2045, D-2047, D-2049, D-2051, D-2052, D-2053, D-2054, D-2058, D-2061, D-2075, D-2077, D-2079, D-2080, D-2081, D-2083, D-2090, D-2091 or D-2093.

91. The method according to any one of claims 58 to 86, wherein the RNAi construct is D-1492, D-1614, D-1697, D-1702, D-1709, D-1716, D-1723, D-1730, D-1737, D-1856, D-1863, D-1865, D-1866, D-1869, D-1872, D-1877, D-1878, D-1879, D-1880, D-1881, D-1884, D-1887, D-1978, D-1987, D-1992, D-1997, D-2002, D-2008, D-2017, D-2049, D-2054 or D-2090.

92. The method according to any one of claims 58 to 86, wherein the sense strand and the antisense strand each comprise or consist of SEQ ID NO: 1800 and 2648 (D-1709) or SEQ ID NO: 2861 and 3115 (D-1887).

93. An RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within a target polynucleotide, and is complexed with a fatty acid molecule, and the fatty acid is bound through a phosphorothioate bond.

94. The RNAi construct according to claim 93, wherein the fatty acid is C22.

95. The RNAi construct according to claim 93 or 94, wherein the antisense strand comprises a region comprising a sequence substantially complementary to at least 15 consecutive nucleotides within nucleotides 1300 to 1375 or 4900 to 5300 of the FAM13A mRNA sequence represented by SEQ ID NO:

1.

96. The RNAi construct according to claim 93 or 94, wherein the antisense strand comprises a region comprising a sequence substantially complementary to the FAM13A mRNA sequence, and the region comprises at least 15 consecutive nucleotides from the antisense sequences listed in Table 1 or Table 2.

97. A non-therapeutic or cosmetic method for reducing the body weight or body fat mass of an individual, comprising applying or administering to the individual the RNAi construct according to any one of claims 1 to 44.

Images