Modified immune cells and methods for preparing same

Non-viral transfection of immune cells with nucleic acid molecules encoding CAR, IL-15, and IL-21, combined with electroporation, improves cell therapy by ensuring high efficiency, safety, and rapid production of effective tumor-killing cells.

JP2025526839APending Publication Date: 2025-08-15CELLS & GENES BIOTECH (SHANGHAI) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025507882
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-08-16
Filing Date
2023-08-11
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

Current cell therapy methods face challenges with viral vector transfection, which are costly, complex, and pose safety risks, while non-viral systems have low efficiency and high cytotoxicity, limiting the viability and amplification of immune cells for therapeutic use.

Method used

The use of isolated nucleic acid molecules encoding chimeric antigen receptors (CAR), IL-15, IL-21, and optionally other proteins, transfected via electroporation, utilizing a non-viral vector system with thermodegradable moieties and homologous arms for precise genome integration, enhancing safety and efficiency.

Benefits of technology

The method achieves high transfection efficiency, improved cell viability, and rapid production of modified immune cells with enhanced tumor-killing activity, addressing safety concerns and therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025526839000003
    Figure 2025526839000003
  • Figure 2025526839000004
    Figure 2025526839000004
  • Figure 2025526839000005
    Figure 2025526839000005
Patent Text Reader

Abstract

Provided are modified immune cells and methods for preparing the same, wherein the modified immune cells are prepared by transfecting isolated nucleic acid molecules, the isolated nucleic acid molecules comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present application relates to the field of biomedicine, and in particular to modified immune cells and methods for preparing same. [Background technology]

[0002] Improving cell function through genetic modification is an important means of enhancing the therapeutic efficacy of cell therapy. Currently, in the field of cell therapy, cells are primarily transfected with viral vectors to achieve stable expression of various molecules while simultaneously maintaining cellular functions, including cell viability, amplification rate, and long-term specific function of the expressed molecules, thereby achieving the goals of cell therapy. However, viral vector transfection requires long design time, complex preparation processes, long testing cycles, and high costs. At the same time, introducing viral sequences into the host can induce host immunogenicity, insertional mutagenesis, and potentially pose unpredictable safety risks. For example, reports have shown that lentiviral vectors can insert exogenous nucleic acid sequences into thousands of sites within the T cell genome, which undoubtedly raises potential safety concerns.

[0003] Attempts to use non-viral systems for cell modification or cell transfection to achieve the goal of cell therapy have been reported. However, non-viral system-mediated transfection efficiency is low, and the cytotoxicity required for therapy is high for the majority of transfected cells, significantly affecting the viability of the transfected cells. In particular, non-viral transfection of immune cells, stem cells, fibrocytes, etc. (especially primary cells) to date has resulted in even greater cytotoxicity, high cell mortality, and low amplification rates, making transfection efficiency and viable cell recovery rates less than those required for cell therapy. Given the limitations of existing non-viral methods, various treatments, including long-term in vitro cell induction and amplification, are required to achieve the cell quantities required for cell therapy. However, long-term in vitro induction and amplification alters the phenotype and function of cells and significantly limits the therapeutic efficacy of transfected cells, resulting in the efficiency of cell therapy products produced using current non-viral methods being much lower than that of cell products produced using viral methods. Given the limitations of viral methods themselves, the development and maturation of cell therapy is greatly hindered. Therefore, there is currently an urgent need for a non-viral cell modification method that is safe, has high transfection efficiency, good cell viability, and can produce enough cells for clinical treatment in a short period of time, as well as modified cells prepared by this method. Summary of the Invention [Problem to be solved by the invention]

[0004] The present application provides isolated nucleic acid molecules with novel designs and modified immune cells obtained by transfection (e.g., electroporation transfection) of the molecules. The modified immune cells of the present application exhibit excellent safety and tumor cell-killing activity. [Means for solving the problem]

[0005] In a first aspect, the present application provides an isolated nucleic acid molecule, comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

[0006] In another preferred embodiment, the nucleic acid molecule further comprises a nucleic acid sequence encoding an additional exogenous protein selected from the group consisting of IL2 or a functionally active fragment thereof, IL7 or a functionally active fragment thereof, a cytokine, a BiTE, or a combination thereof.

[0007] In another preferred embodiment, the nucleic acid molecule comprises a tandem expression unit, the expression unit comprising: (E1) a first expression unit for expressing the chimeric antigen receptor; (E2) a second expression unit for expressing the IL-15, or a functionally active fragment thereof, or a fusion protein thereof; (E3) a third expression unit for expressing the IL-21, or a functionally active fragment thereof, or a fusion protein thereof; and (E4) optionally a fourth expression unit for expressing said additional exogenous protein;

[0008] Here, the positions of the first, second, third and fourth expression units can be arbitrarily interchanged.

[0009] In the nucleic acid molecule, each independent expression unit is driven by an exogenous promoter or endogenous promoter operably linked thereto, or by a promoter further upstream, and is a nucleic acid sequence whose 5' end is a thermodegradable portion (e.g., a 2A nucleic acid sequence, an IRES nucleic acid sequence).

[0010] In another preferred example, the number of the first expression unit, the second expression unit, and the third expression unit is independently 1, 2, or 3.

[0011] In another preferred embodiment, the number of fourth expression units is 0, 1, 2, 3, 4, or 5.

[0012] In another preferred example, the nucleic acid molecule encodes one, two, or three of the same or different CAR molecules.

[0013] In another preferred embodiment, the nucleic acid molecule has the structure of Formula I: ARM5-P1-CAR1-P2 / L1-Z1-P3 / L2-Z2-(P4 / L3-Z3)m--ARM3(Ia) In each formula, ARM5 is none or the 5' homologous arm, ARM3 is either absent or a 3' homologous arm, P1 is a promoterless, splicing acceptor, or first exogenous promoter; CAR1 is a nucleic acid sequence encoding the first chimeric antigen receptor (CAR), P2 / L1 is a second exogenous promoter P2 or a nucleic acid sequence L1 encoding a thermolytic moiety; one of Z1 and Z2 is a nucleic acid sequence encoding IL-15, or a functionally active fragment thereof, or a fusion protein thereof, and the other is a nucleic acid sequence encoding IL-21, or a functionally active fragment thereof, or a fusion protein thereof; L2 is a nucleic acid sequence L2 encoding a thermolabile moiety, P3 is the third exogenous promoter, P4 / L3 are independently a fourth exogenous promoter P4 or a nucleic acid sequence encoding a thermolyzable moiety L3; Z3 is a nucleic acid sequence encoding an additional exogenous protein, m is 0, 1, 2, 3, 4 or 5.

[0014] In another preferred embodiment, each of the P4s is the same or different exogenous promoter, and each of the L3s is the same or different nucleic acid sequence encoding a thermolyzable moiety.

[0015] In another preferred embodiment, each Z3 is a nucleic acid sequence encoding the same or a different additional exogenous protein.

[0016] In another preferred embodiment, the ARM5 is a 5' homologous arm and the ARM3 is a 3' homologous arm.

[0017] In another preferred embodiment, the nucleic acid molecule has the structure of Formula II: ARM5-P1-CAR1-L1-Z1-L2-Z2-ARM3(II) In the formula, ARM5, P1, CAR1, L1, Z1, L2, Z2, ARM3 and P2 are as defined above.

[0018] In another preferred embodiment, P1, P2 and P3 are each independently a constitutive promoter or an inducible promoter. In another preferred example, P1 is an exogenous promoter such as the PGK promoter. In another preferred embodiment, P2 is a PGK promoter. In another preferred embodiment, the PGK promoter sequence is as shown in SEQ ID NO:26.

[0019] In another preferred example, the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof encodes IL-15 or a fusion protein thereof, such as an IL-15-Fc fusion protein. In another preferred example, the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof encodes IL-21 or a fusion protein thereof, such as an IL-21-Fc fusion protein.

[0020] In another preferred embodiment, the 5' and 3' homology arms are homologous to a target region within the immune cell genome, thereby localizing and knocking in the nucleic acid sequence between the homology arms to a predetermined site.

[0021] In another preferred embodiment, the nucleic acid sequence is (s1) an endogenous promoter or downstream thereof, wherein a nucleic acid sequence encoding a chimeric antigen receptor (CAR) is operably linked to and driven by the endogenous promoter, or driven by an exogenous promoter; (s2) The target gene is localized and knocked in at a site located in a target gene selected from the group consisting of TRBC, TRAC, PD-1, CD52, CD95, AAVS1, and CCR5.

[0022] In certain embodiments, the nucleic acid molecule comprises, in 5' to 3' order, a nucleic acid sequence encoding the CAR, a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof, or a nucleic acid sequence encoding the CAR, a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof, and a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof.

[0023] In certain embodiments, the CAR comprises a target binding domain that targets a tumor-associated antigen, a target binding domain that targets a viral antigen, a target binding domain that targets an immune-associated antigen, or a combination thereof.

[0024] In a specific embodiment, the tumor-associated antigen is selected from GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2 and Mesothelin, and the viral antigen is selected from EBV-gp350 and HBV s protein.

[0025] In certain embodiments, the nucleic acid molecule further comprises one or more nucleic acid sequences encoding a thermally degradable moiety.

[0026] In certain embodiments, the nucleic acid sequence encoding the thermodegradable moiety is located between any two sequences selected from the group consisting of the nucleic acid sequence encoding the chimeric antigen receptor (CAR), the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof.

[0027] In certain embodiments, the thermally degradable moiety comprises a 2A peptide.

[0028] In certain embodiments, the 2A peptide comprises P2A, T2A, F2A, or E2A.

[0029] In certain embodiments, the nucleic acid molecule further comprises a nucleic acid sequence encoding one or more other exogenous proteins.

[0030] In certain embodiments, the one or more other exogenous proteins comprise an antibody or an antigen-binding fragment thereof.

[0031] In certain embodiments, the antibody or antigen-binding fragment thereof comprises a multispecific antibody or antigen-binding fragment thereof.

[0032] In certain embodiments, the multispecific antibody or antigen-binding fragment thereof comprises a bispecific T cell engager (BiTE).

[0033] In a specific embodiment, the BiTE comprises a CD3 binding domain.

[0034] In certain embodiments, the BiTE further comprises a tumor-associated antigen-binding domain.

[0035] In a specific embodiment, the tumor-associated antigen is selected from GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2, and Mesothelin, and the viral antigen is selected from EBV-gp350 and HBV s protein.

[0036] In certain embodiments, the nucleic acid molecule further comprises a 5' homology arm, wherein the 5' homology arm is homologous to a target region in the immune cell genome.

[0037] In certain embodiments, the 5' homology arm is located upstream of the nucleic acid sequence encoding the chimeric antigen receptor (CAR).

[0038] In certain embodiments, the nucleic acid molecule further comprises a 3' homology arm, wherein the 3' homology arm is homologous to a target region in the immune cell genome.

[0039] In a specific embodiment, the 3' homology arm is located downstream of the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof.

[0040] In certain embodiments, the target region is located in a target gene, and the target gene is selected from TRBC, TRAC, PD-1, CD52, CD95, AAVS1, and CCR5.

[0041] In certain embodiments, the target binding domain of the CAR comprises the amino acid sequence shown in SEQ ID NO:1.

[0042] In certain embodiments, the target binding domain of the CAR comprises the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NOs. 31 and 32.

[0043] In certain embodiments, the CAR comprises a hinge region, a transmembrane domain, a costimulatory domain, and an intracellular domain.

[0044] In a specific embodiment, the hinge region is a hinge region derived from CD8α.

[0045] In a specific embodiment, the transmembrane domain is a transmembrane domain derived from CD8α.

[0046] In a specific embodiment, the costimulatory domain is a costimulatory domain derived from 41BB.

[0047] In a specific embodiment, the costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO:3.

[0048] In a specific embodiment, the intracellular domain is an intracellular domain derived from CD3ζ.

[0049] In a specific embodiment, the intracellular domain comprises the amino acid sequence set forth in SEQ ID NO:4.

[0050] In a specific embodiment, the CAR comprises the amino acid sequence shown in SEQ ID NO:5.

[0051] In a specific embodiment, the IL-15 or functionally active fragment thereof comprises the amino acid sequence shown in any one of SEQ ID NOs: 6-7, 9.

[0052] In a specific embodiment, the IL-21 or functionally active fragment thereof comprises the amino acid sequence set forth in any one of SEQ ID NOs: 10-11, 13.

[0053] In certain embodiments, the thermally degradable moiety comprises the amino acid sequence set forth in any one of SEQ ID NOs:14-16.

[0054] In a specific embodiment, the 5' homology arm comprises the nucleic acid sequence shown in SEQ ID NO:17.

[0055] In a specific embodiment, the 3' homology arm comprises the nucleic acid sequence shown in SEQ ID NO:18.

[0056] In a particular embodiment, the nucleic acid molecule comprises a nucleic acid sequence that is at least 3 kb in length.

[0057] In certain embodiments, the nucleic acid molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 20-21, 23-24 and 27-30.

[0058] In certain embodiments, the nucleic acid molecule comprises a circular nucleic acid molecule, a supercoiled nucleic acid molecule and / or a linear nucleic acid molecule.

[0059] In certain embodiments, the nucleic acid molecule comprises a DNA molecule and / or an RNA molecule.

[0060] In certain embodiments, the nucleic acid molecules comprise single-stranded and / or double-stranded nucleic acid molecules.

[0061] In a second aspect, the present application provides a vector comprising a nucleic acid molecule described herein.

[0062] In certain embodiments, the vector is a non-viral vector.

[0063] In certain embodiments, the vector is a plasmid.

[0064] In another preferred embodiment, the plasmid is derived from a microorganism, and the content of the microbiome DNA in the plasmid is <10 wt%, preferably ≦5 wt%, more preferably ≦1 wt% of the total DNA.

[0065] In a third aspect, the present application provides a method of preparing a modified immune cell, said method comprising transfecting the immune cell to be modified with a nucleic acid molecule described herein, or a vector described herein.

[0066] In another preferred embodiment, the method is electroporation based on the combined use of a donor plasmid and a localized nuclease, or donor plasmid-based localized electroporation.

[0067] In another preferred embodiment, the method comprises: (a) providing a donor plasmid, the donor plasmid comprising the nucleic acid molecule of claim 1, the plasmid being derived from a microorganism, and the content of the microbiome DNA in the plasmid being <10 wt% (preferably ≦5 wt%, more preferably ≦1 wt%) of total DNA; and (b) transfecting the modified immune cells with the plasmid, such that the cells contain and / or express the nucleic acid molecule.

[0068] In another preferred embodiment, in step (b), the transfection comprises electrofection.

[0069] In another preferred example, in step (b), transfection is carried out in the presence of a gene editing system (or a gene editing reagent), thereby integrating the nucleic acid molecule into a specific location in the cell genome.

[0070] In another preferred embodiment, the gene editing system comprises a nuclease and a guide RNA.

[0071] In another preferred embodiment, the nuclease comprises a Cas protein, preferably Cas9.

[0072] In another preferred embodiment, the gene editing system comprises a ribonucleoprotein complex RNP, wherein the RNP comprises the Cas protein and the guide RNA.

[0073] In certain embodiments, the method comprises transfecting the modified immune cell with a transfection composition comprising a nucleic acid molecule described herein, or a vector described herein, such that the cell contains and / or expresses the nucleic acid molecule, wherein at least a portion of the nucleic acid molecule or vector is obtained from a host cell, and wherein the portion of the nucleic acid molecule or the portion of the vector obtained from the host cell contains no more than about 10% (w / w) genomic DNA from the host cell.

[0074] In the present application, one or more additional genes can be further knocked out or knocked down in the modified immune cells. For example, the additional gene can include a gene expressing an immune checkpoint (e.g., PD-1). For example, the additional gene can include a gene associated with Fas-FasL-induced cell death (e.g., CD95). For example, the transfection composition can include one or more guide RNAs targeting the additional gene (e.g., ) to be knocked out or knocked down. For example, the guide RNA can target a gene expressing an immune checkpoint (e.g., PD-1) and / or a gene associated with Fas-FasL-induced cell death (e.g., CD95).

[0075] In the present application, the host cells are not or do not comprise mammalian immune cells. In certain embodiments of the methods of the present application, the immune cells comprise immune effector cells. In certain embodiments of the methods of the present application, the immune cells comprise T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells. In certain embodiments of the methods of the present application, the immune cells comprise peripheral blood lymphocytes. In certain embodiments of the methods of the present application, the immune cells are primary cells. In certain embodiments of the methods of the present application, the immune cells comprise autologous and / or allogeneic cells from the subject.

[0076] In certain embodiments of the methods of the present application, the immune cells are activated cells. In certain embodiments of the methods of the present application, said activating comprises contacting said immune cells to be modified with an activating composition. In certain embodiments of the methods of the present application, the activating composition comprises anti-CD3 and / or anti-CD28 antibodies.

[0077] In certain embodiments of the methods of the present application, the activation comprises contacting the modified immune cells with the activation composition for up to about 4 days.

[0078] In certain embodiments, the method comprises contacting the modified immune cells with the activating composition for a period of about 2 days or less while performing the transfection. In certain embodiments of the methods of the present application, said transfection comprises electroporation of said immune cells to be modified.

[0079] In a specific embodiment of the method of the present application, the concentration of the nucleic acid molecule or the vector in the transfection composition is from about 5 μg / mL to about 3000 μg / mL. In a specific embodiment of the method of the present application, the concentration of the nucleic acid molecule or the vector in the transfection composition is about 200 μg / mL to about 800 μg / mL.

[0080] In certain embodiments of the methods of the present application, the nucleic acid molecule or the vector is extracted from the host cell.

[0081] In certain embodiments of the methods of the present application, the host is a microbial host. In certain embodiments of the methods of the present application, the host is one or more selected from the group consisting of bacteria, fungi, actinomycetes, mycoplasmas, chlamydia, rickettsia, and spirochetes. In certain embodiments of the methods of the present application, the host comprises a gram-negative bacterium. In certain embodiments of the methods of the present application, the host comprises E. coli.

[0082] In certain embodiments of the methods of the present application, the size of the genomic DNA of the host cell is at least about 10 kb. In certain embodiments of the methods of the present application, the host cells have a genomic DNA content of about 1% (w / w) or less. In certain embodiments of the methods of the present application, the host cell has a genomic DNA content of about 9‰ (w / w) or less. In certain embodiments of the methods of the present application, the genomic DNA content of the host cells is measured by qPCR.

[0083] In certain embodiments of the method of the present application, the nucleic acid molecule portion or the vector portion obtained from the host cell is treated so as to reduce the content of genomic DNA of the host cell therein, and / or the content of genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and based on the content, it is determined whether to treat the nucleic acid molecule portion or the vector portion so as to reduce the content of genomic DNA of the host cell therein.

[0084] In certain embodiments of the methods of the present application, the content of genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and if the content of genomic DNA of the host cell is about 10% (w / w) or more, the nucleic acid molecule portion or the vector portion is treated so as to reduce the content of genomic DNA of the host cell therein.

[0085] In certain embodiments of the methods of the present application, the treating comprises contacting the nucleic acid molecule portion or the vector portion with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide.

[0086] In certain embodiments of the methods of the present application, the DNase is capable of non-specifically cleaving linear DNA.

[0087] In certain embodiments of the methods of the present application, the DNase is an exonuclease.

[0088] In certain embodiments of the method of the present application, the treatment comprises treating with Mg 2+ and Ca 2+ contacting the transfection composition with the reagent in the presence of

[0089] In certain embodiments of the methods of the present application, the transfection composition further comprises a gene editing system capable of integrating the nucleic acid molecule into a specific location in the cell genome.

[0090] In certain embodiments of the methods of the present application, the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding same (e.g., an mRNA encoding the site-specific enzyme).

[0091] In certain embodiments of the methods of the present application, the site-specific enzyme is selected from a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a transposase, an integrase, and a Cas protein.

[0092] In certain embodiments of the methods of the present application, the Cas protein is a Cas9 protein.

[0093] In certain embodiments of the methods of the present application, the transposase comprises a PiggyBac (PB) transposase and / or a Sleeping Beauty (SB) transposase.

[0094] In certain embodiments, the gene editing further comprises knocking out one or more genes in the cells. The knocked out genes can include, for example, a gene expressing an immune checkpoint (e.g., PD-1) and / or a gene associated with Fas-FasL-induced cell death (e.g., CD95).

[0095] In certain embodiments of the methods of the present application, the gene editing system further comprises one or more guide RNAs.

[0096] For example, the gene editing system can include one or more guide RNAs targeting the gene to be knocked out. For example, the gene to be knocked out can be selected from the group consisting of TRBC, TRAC, PD-1, CD95, AAVS1, and CCR5. For example, the gene editing system can include a guide RNA targeting a gene expressing the immune checkpoint (e.g., PD-1). For example, the gene editing system can include a guide RNA targeting the Fas-FasL-induced cell death-related gene (e.g., CD95).

[0097] In certain embodiments of the methods of the present application, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell's genome.

[0098] In certain embodiments of the methods of the present application, the gene editing system comprises a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

[0099] In a specific embodiment, the target region is located in a gene region selected from the group consisting of TRBC, TRAC, PD-1, CD95, AAVS1 and CCR5.

[0100] In a fourth aspect, the present application provides a kit comprising a nucleic acid molecule described herein or a vector described herein.

[0101] In a fifth aspect, the present application provides a transfection kit comprising: 1) a nucleic acid molecule described herein or a vector described herein obtained from a host cell; and 2) a reagent capable of reducing or degrading genomic DNA of the host cell.

[0102] In a specific embodiment of the kit of the present application, the reagent 2) comprises one or more selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide.

[0103] In a particular embodiment of the kit of the present application, said DNase is capable of non-specifically cleaving linear DNA. In a particular embodiment of the kit of the present application, said DNase is an exonuclease. In certain embodiments of the present application, the kit comprises Mg 2+ and Ca 2+ The reagent further comprises: In a sixth aspect, the present application provides a transfection composition comprising a nucleic acid molecule described herein, or a vector described herein, wherein at least a portion of the nucleic acid molecule or vector is obtained from a host cell, and the portion of the nucleic acid molecule or the portion of the vector obtained from the host cell contains no more than about 10% (w / w) of genomic DNA from the host cell.

[0104] In certain embodiments of the transfection composition of the present application, the concentration of the nucleic acid molecule or the vector is from about 5 μg / mL to about 3000 μg / mL. In certain embodiments of the transfection composition of the present application, the concentration of the nucleic acid molecule or the vector is from about 200 μg / mL to about 800 μg / mL.

[0105] In certain embodiments of the transfection compositions of the present application, the host is a microbial host. In certain embodiments of the transfection composition of the present application, the host is one or more selected from the group consisting of bacteria, fungi, actinomycetes, mycoplasmas, chlamydia, rickettsia, and spirochetes. In certain embodiments of the transfection compositions of the present application, the host comprises a gram-negative bacterium. In certain embodiments of the transfection compositions of the present application, the host comprises E. coli.

[0106] In certain embodiments of the transfection compositions of the present application, the size of the host cell genomic DNA is at least about 10 kb. In certain embodiments of the transfection compositions of the present application, the host cell contains no more than about 1% (w / w) genomic DNA. In certain embodiments of the transfection composition of the present application, the host cell has a genomic DNA content of about 9‰ (w / w) or less. In certain embodiments of the transfection composition of the present application, the genomic DNA content of the host cell is measured by qPCR.

[0107] In certain embodiments of the transfection composition of the present application, the nucleic acid molecule portion or the vector portion obtained from the host cell is treated to reduce the content of genomic DNA of the host cell therein, and / or the content of genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and based on the content, it is determined whether to treat the nucleic acid molecule portion or the vector portion to reduce the content of genomic DNA of the host cell therein.

[0108] In certain embodiments of the transfection composition of the present application, the content of genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and if the content of genomic DNA of the host cell is about 10% (w / w) or more, the nucleic acid molecule portion or the vector portion is treated to reduce the content of genomic DNA of the host cell therein.

[0109] In certain embodiments of the transfection compositions of the present application, the treating comprises contacting the nucleic acid molecule portion or the vector portion with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide.

[0110] In certain embodiments of the transfection composition of the present application, said DNase is capable of non-specifically cleaving linear DNA.

[0111] In certain embodiments of the transfection composition of the present application, said DNase is an exonuclease.

[0112] In certain embodiments of the transfection compositions of the present application, the treatment comprises the addition of Mg 2+ and Ca 2+ contacting the transfection composition with the reagent in the presence of

[0113] In certain embodiments, the transfection composition of the present application further comprises a gene editing system capable of integrating said nucleic acid molecule into a specific location in the genome of said cell.

[0114] In certain embodiments of the transfection composition of the present application, the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding same.

[0115] In certain embodiments of the transfection composition of the present application, the site-specific enzyme is selected from a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a transposase, an integrase, and a Cas protein.

[0116] In certain embodiments of the transfection composition of the present application, the Cas protein is a Cas9 protein.

[0117] In certain embodiments of the transfection compositions of the present application, the transposase comprises a PiggyBac (PB) transposase and / or a Sleeping Beauty (SB) transposase.

[0118] In certain embodiments of the transfection compositions of the present application, the gene editing system further comprises one or more guide RNAs.

[0119] In certain embodiments of the transfection compositions of the present application, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome.

[0120] In certain embodiments of the transfection composition of the present application, the gene editing system comprises a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

[0121] In certain embodiments of the transfection composition of the present application, the target region is located in a gene region selected from the group consisting of TRBC, TRAC, PD-1, CD95, AAVS1 and CCR5.

[0122] In a seventh aspect, the present application further provides an immune cell prepared by the method described herein.

[0123] In an eighth aspect, the present application provides a modified immune cell comprising a nucleic acid molecule described herein, or a vector described herein.

[0124] In certain embodiments of the modified immune cells of the present application, the nucleic acid molecule is integrated into the genome of the immune cell. In certain embodiments of the modified immune cells of the present application, the nucleic acid molecule is integrated into a target gene within the immune cell genome. In certain embodiments of the modified immune cells of the present application, the nucleic acid molecule is expressed under the regulation of the endogenous regulatory sequences of the target gene.

[0125] In certain embodiments of the modified immune cells of the present application, the target gene is selected from TRBC, TRAC, PD-1, CD95, AAVS1 and CCR5.

[0126] In certain embodiments of the modified immune cells of the present application, one or more additional genes are knocked down or knocked out.

[0127] In certain embodiments, the additional gene is different from the target gene into which the nucleic acid molecule or a functionally active fragment thereof is integrated.

[0128] In certain embodiments, the one or more additional genes comprise an immune checkpoint gene. In a particular embodiment, the one or more additional genes comprise a Fas-FasL-induced cell death associated gene. In certain embodiments, the one or more additional genes include PD-1 and / or CD95.

[0129] In certain embodiments, the immune cells comprise immune effector cells. In certain embodiments, the immune cells comprise T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and / or mast cells. In certain embodiments, the immune cells comprise peripheral blood lymphocytes. In certain embodiments, the immune cells are primary cells. In certain embodiments, the immune cells comprise autologous and / or allogeneic cells from the subject. In certain embodiments, the immune cells are activated cells.

[0130] In certain embodiments of the modified immune cells of the present application, said activating comprises contacting said modified immune cells with an activating composition. In certain embodiments of the modified immune cells of the present application, the activating composition comprises anti-CD3 and / or anti-CD28 antibodies. In certain embodiments of the modified immune cells of the present application, the activation comprises contacting the modified immune cells with the activation composition for up to about 4 days.

[0131] In certain embodiments, the immune cells are isolated cells.

[0132] In a ninth aspect, the present application provides a cell population comprising a cell described in the present application and / or its progeny.

[0133] In a tenth aspect, the present application provides a pharmaceutical composition comprising a nucleic acid molecule described in the present application, a vector described in the present application, a cell described in the present application, and / or a population of cells described in the present application. In certain embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.

[0134] In an eleventh aspect, the present application provides the use of a nucleic acid molecule described in the present application, a vector described in the present application, a cell described in the present application, a cell population described in the present application, and / or a pharmaceutical composition described in the present application for use in the preparation of a medicament. In a particular embodiment, the medicament is used in the prevention, treatment and / or alleviation of cancer. In certain embodiments, the cancer comprises tumor-associated antigen-positive cancer cells. In certain embodiments, the tumor-associated antigen is selected from GPC3, CD19, BCMA, Claudin18.2 and Mesothelin. In certain embodiments, the cancer is liver cancer, hepatocellular carcinoma, or multiple myeloma.

[0135] In a twelfth aspect, the present application provides a method for preventing, treating and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of a nucleic acid molecule described in the present application, a vector described in the present application, a cell described in the present application, a cell population described in the present application, and / or a pharmaceutical composition described in the present application. In certain embodiments, the disease or condition is cancer. In certain embodiments, the cancer comprises tumor-associated antigen-positive cancer cells. In certain embodiments, the tumor-associated antigen is selected from GPC3, CD19, BCMA, Claudin18.2 and Mesothelin. In certain embodiments, the cancer is liver cancer, hepatocellular carcinoma, or multiple myeloma.

[0136] In a thirteenth aspect, the present application provides a nucleic acid molecule described in the present application, a vector described in the present application, a cell described in the present application, a cell population described in the present application, and / or a pharmaceutical composition described in the present application for use in the prevention, treatment and / or amelioration of a disease or condition in a subject. [Effects of the Invention]

[0137] Those skilled in the art will readily recognize other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As those skilled in the art will appreciate, the contents of this application will enable them to make changes to the specific embodiments disclosed without departing from the spirit and scope of the invention to which this application pertains. Correspondingly, the drawings and description in the present application are merely illustrative, rather than limiting. [Brief explanation of the drawings]

[0138] A better understanding of the features and advantages of the inventions referred to in this application can be obtained by reference to the exemplary embodiments described in detail below and the accompanying drawings, the brief description of which follows:

[0139] [Figure 1A] 1 shows the expansion performance and biomarker expression status of the modified immune cells of the present application. [Figure 1B] 1 shows the expansion performance and biomarker expression status of the modified immune cells of the present application. [Figure 1C] 1 shows the expansion performance and biomarker expression status of the modified immune cells of the present application. [Figure 1D] 1 shows the expansion performance and biomarker expression status of the modified immune cells of the present application. [Figure 2A] 1 shows the performance of modified immune cells of the present application after cryopreservation and recovery. [Figure 2B] 1 shows the performance of modified immune cells of the present application after cryopreservation and recovery. [Figure 2C] 1 shows the performance of modified immune cells of the present application after cryopreservation and recovery. [Figure 3A] The modified immune cells of the present application demonstrate the ability to be cryopreserved and recovered, and then activated and expanded. [Figure 3B] The modified immune cells of the present application demonstrate the ability to be cryopreserved and recovered, and then activated and expanded. [Figure 4] 1 shows the proliferation status of modified immune cells of the present application. [Figure 5A] 1 shows the killing effect of the modified immune cells of the present application on tumor cells. [Figure 5B] 1 shows the killing effect of the modified immune cells of the present application on tumor cells. [Figure 6A] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 6B] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 6C] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 6D] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 6E] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 6F] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 7A] 1 shows the expression status of exogenous genes by modified immune cells of the present application. [Figure 7B] 1 shows the expression status of exogenous genes by modified immune cells of the present application. [Figure 8A] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 8B] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 9A] 1 shows the expression status of exogenous genes and the killing effect on tumor cells by the modified immune cells of the present application. [Figure 9B] 1 shows the expression status of exogenous genes and the killing effect on tumor cells by the modified immune cells of the present application. [Figure 10A] 1 shows a comparison of the performance of different modified immune cells of the present application. [Figure 10B] 1 shows a comparison of the performance of different modified immune cells of the present application. [Figure 10C] 1 shows a comparison of the performance of different modified immune cells of the present application. [Figure 10D] 1 shows a comparison of the performance of different modified immune cells of the present application. [Figure 10E] 1 shows a comparison of the performance of different modified immune cells of the present application. [Figure 11A] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 11B] 1 shows the in vivo tumor-inhibitory effect of the modified immune cells of the present application. [Figure 12A] 1 shows the detection of cell viability, cell proliferation ability, and cell protein expression ability after transfection of cells with plasmids containing different amounts of host genomic DNA. [Figure 12B]1 shows the detection of cell viability, cell proliferation ability, and cell protein expression ability after transfection of cells with plasmids containing different amounts of host genomic DNA. [Figure 12C] 1 shows the detection of cell viability, cell proliferation ability, and cell protein expression ability after transfection of cells with plasmids containing different amounts of host genomic DNA. [Figure 13A] Figure 1 shows the inhibition of RPMI-8226 multiple myeloma cells and HepG2 liver cancer cells by engineered immune cells under the control of an exogenous promoter, where BCMA-CAR-15 represents the BCMA CAR-2A-IL15 construct, BCMA-CAR-15-21 represents the BCMA CAR-2A-IL15-2A-IL21 construct, BCMA-CAR-PGK-15-21 represents the PGK-BCMA CAR-2A-IL15-2A-IL21 construct, and PGK-GPC3CAR represents the PGK-GPC3 CAR-2A-IL15-2A-IL21 construct. [Figure 13B] Figure 1 shows the inhibition of RPMI-8226 multiple myeloma cells and HepG2 liver cancer cells by engineered immune cells under the control of an exogenous promoter, where BCMA-CAR-15 represents the BCMA CAR-2A-IL15 construct, BCMA-CAR-15-21 represents the BCMA CAR-2A-IL15-2A-IL21 construct, BCMA-CAR-PGK-15-21 represents the PGK-BCMA CAR-2A-IL15-2A-IL21 construct, and PGK-GPC3CAR represents the PGK-GPC3 CAR-2A-IL15-2A-IL21 construct. DETAILED DESCRIPTION OF THE INVENTION

[0140] After extensive and thorough research, the present inventors have developed for the first time an efficient method for electroporation of immune cells based on the combined use of a plasmid (or donor plasmid) and a localized nuclease. Specifically, the present invention relates to a plasmid containing a nucleic acid molecule comprising elements such as a nucleic acid sequence encoding a chimeric antigen receptor (CAR), a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, and an efficient localized electroporation method for immune cells based on the plasmid in combination with a localized nuclease. Based on this, the present invention has been completed.

[0141] The present inventors unexpectedly discovered that typical immune cells, such as T cells, are highly sensitive to conventional plasmid-based electroporation, resulting in reduced survival rates after transfection and inefficient preparation of locally integrated immune cells. However, after treating the plasmid to significantly reduce the content of the microbiome DNA in the plasmid (e.g., ≦5 wt%, more preferably ≦1 wt%, more preferably ≦0.2%, more preferably ≦0.1%), the donor plasmid carrying the CAR coding sequence can be efficiently introduced into immune cells, such as T cells, and the prepared CAR immune cells have high survival rates, high expansion potential, and high CAR expression rates.

[0142] Furthermore, the present inventors have further developed nucleic acid molecules or plasmids comprising a nucleic acid sequence encoding a CAR, a nucleic acid sequence encoding IL21 (or a fusion protein or active fragment thereof), and a nucleic acid sequence encoding IL15 (or a fusion protein or active fragment thereof), and the method of the present invention can efficiently introduce the plasmids into immune cells, such as T cells. When co-incubated with target cells in vivo, the CAR-T cells of the present invention can have excellent expansion ability, high survival rates, and high CAR expression rates without the need for the addition of IL-2. However, IL-15 and IL-21 expressed by the CAR-T cells of the present invention themselves cannot provide sufficient support for cell survival in the absence of target cells and IL-2 cytokines during incubation, or in the presence of only IL-2 without target cells. In these cases, the survival time of the CAR-T cells is significantly shortened, indicating no or extremely low risk of tumor formation.

[0143] Hereinafter, embodiments of the present invention will be described with reference to specific examples, but those skilled in the art will easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0144] Definition of Terms In the present application, the term "transfection efficiency" generally refers to the relative amount of material introduced into and / or expressed by a transfected cell. In the present application, transfection can refer to the introduction of one or more materials (e.g., polynucleotides) into a cell. The introduced material may be stably or transiently maintained in the transfected cell. In the present application, the transfection efficiency can be measured by the amount of the introduced material.

[0145] In the present application, the term "deoxyribonuclease (DNase)" generally refers to an enzyme capable of cleaving phosphodiester bonds in DNA. The DNase may be a type of nuclease. The DNase can digest double-stranded DNA into deoxynucleotides (e.g., under weakly alkaline conditions). For example, the DNase may be substantially inactive (e.g., unable to cleave) circular or supercoiled nucleic acid molecules or fragments thereof (e.g., closed circular double-stranded DNA and / or supercoiled DNA). For example, the DNase can cleave linear double-stranded DNA. For example, the DNase may be a DNA exonuclease. For example, the DNase may be exonuclease V. For example, the DNase may be an ATP-dependent DNase, such as Plasmid-Safe™ ATP-dependent DNase.

[0146] In the present application, the term "nucleic acid molecule or fragment thereof" generally refers to nucleotides (e.g., ribonucleotides, deoxyribonucleic acids, and / or modified forms of both) or fragments thereof. The nucleic acid molecule or fragment thereof may comprise a polymeric form of nucleotides or a fragment thereof. The nucleic acid molecule or fragment thereof may be interchangeable with "polynucleotide" under certain circumstances. The nucleic acid molecule may include DNA, RNA, cDNA, genomic DNA sense and antisense strands, as well as synthetic forms, mixtures, and / or polymers thereof. The nucleic acid molecule or fragment thereof may comprise any topological image, for example, single-stranded, double-stranded, partially double-stranded, triple-stranded, hairpin, circular, and / or padlock structures. The nucleotides in the nucleic acid molecule or fragment thereof may be natural or modified. The nucleotides in the nucleic acid molecule or fragment thereof may be linked to each other by naturally occurring and / or non-naturally occurring nucleotide bonds.

[0147] In this application, the term "exogenous nucleic acid molecule" generally refers to a nucleic acid molecule that is not produced directly inside an organism, tissue, or cell. For example, the nucleic acid molecule is introduced into an organism, tissue, or cell in some form from outside. The structure, composition, or function of the nucleic acid molecule may be the same as or different from the corresponding endogenously expressed nucleic acid molecule. For example, under certain circumstances, the exogenous nucleic acid molecule can have the same nucleotide sequence as the corresponding endogenously expressed nucleic acid molecule. Under certain circumstances, the exogenous nucleic acid molecule is not the same as any endogenously expressed nucleic acid molecule.

[0148] In the present application, the term "transfection composition" generally refers to a mixture necessary for carrying out transfection. In the present application, the transfection composition may contain one or more materials (e.g., polynucleotides or exogenous nucleic acid molecules) to be introduced. For example, the transfection composition may contain an exogenous nucleic acid molecule encoding an exogenous gene to be transfected. For example, the transfection composition may contain a vector containing the nucleic acid molecule. For example, the transfection composition may further contain impurities (which may, under certain circumstances, include a nucleic acid molecule or a fragment thereof). In the present application, the impurities may include a nucleic acid molecule or a fragment thereof derived from a microorganism. The impurities carried by the vector may include impurities carried by the vector (e.g., a nucleic acid molecule or a fragment thereof that is homologous or heterologous to the backbone of the vector).

[0149] In this application, the terms "total nucleic acid molecule content" and "total DNA content" are used interchangeably and generally refer to the total mass of all nucleotide-containing materials in the transfection composition. For example, the nucleotide-containing materials may include the nucleic acid molecules or fragments thereof and the materials.

[0150] In this application, the term "editing efficiency of gene editing" generally refers to the ratio of nucleic acid molecules in which a cut is generated at a target position by a gene editing means to all nucleic acid molecules processed by the gene editing. The editing efficiency of the gene editing can reflect the ability of the gene editing to act at the target position.

[0151] In this application, the term "DNA homologous recombination efficiency" generally refers to the proportion of individuals (e.g., cell number) in which DNA homologous recombination occurs relative to the proportion of individuals used for DNA homologous recombination. The DNA homologous recombination efficiency can be verified by means such as gene sequencing and detecting the expression of the corresponding protein.

[0152] In this application, the term "cell viability" generally refers to the ability of a cell to exist and / or perform a biological function (e.g., division, proliferation, secretion, killing, preservation, and / or recovery) under specific conditions. Under certain circumstances, the cell viability can be measured by the proportion of surviving cells at a specific time and under certain conditions relative to the total number of living and dead cells at that time. In this application, cell viability can be measured by the proportion of cells having a specific biological function and / or activity at a specific time and under certain conditions relative to the total number of cells at that time.

[0153] In this application, the term "host" generally refers to an organism for carrying, amplifying, or producing an exogenous nucleic acid molecule to be transfected, and may include, for example, a host cell such as a microorganism or a mammalian cell. In this application, a host cell is not an immune cell.

[0154] In this application, the term "microorganism" generally refers to eukaryotic and prokaryotic microbial species from the Archaea, Bacteria, and / or Eucarya classes. For example, the microorganisms may include bacteria, viruses, fungi, actinomycetes, rickettsia, mycoplasma, chlamydia, and / or spirochetes. In this application, the term bacteria generally refers to all types of prokaryotes, including prokaryotes of all phyla within the kingdom Prokaryote. The bacteria may include cocci, bacilli, spirochetes, spheroplasts, and protoplasts. The bacteria may include gram-positive and gram-negative bacteria. "Gram-negative" and "gram-positive" refer to staining patterns using Gram staining methods well known in the art.

[0155] In this application, the term "host cell genomic DNA" generally refers to a host cell genomic DNA molecule or a fragment thereof.

[0156] In this application, the terms "nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism)" and "genomic DNA of a host" are used interchangeably and generally refer to a nucleic acid molecule or a nucleic acid molecular fragment derived from the genome of the host (e.g., a microorganism). For information derived from the genome of a host (e.g., a microorganism), see The Genomic Catalog of Earth's Microbiomes, Nature Biotechnology (2020).

[0157] In this application, the term "Gram-negative bacteria" generally refers to bacteria that do not retain the primary dye used in Gram staining but are stained by a counterstain. Therefore, Gram-negative bacteria typically exhibit a red color in Gram staining. The cell wall of the Gram-negative bacteria has a low peptidoglycan content and a high lipid content. For example, the cell wall of the Gram-negative bacteria may have a lipopolysaccharide layer. For example, the Gram-negative bacteria may include Escherichia coli, Pseudomonas aeruginosa, Proteus, Shigella, Klebsiella pneumoniae, Brucella, Haemophilus influenzae, Haemophilus parainfluenzae, Moraxella catarrhalis, Acinetobacter sp., Yersinia sp., Legionella pneumophila, Bordetella pertussis, Bordetella parapertussis, Shigella sp., Pasteurella sp., Vibrio cholerae, Salmonella enteritidis, and / or Shigella-like bacteria.

[0158] In this application, the term "E. coli" generally refers to Escherichia coli, which belongs to the genus Escherichia in the family Enterobacteriaceae.

[0159] In this application, the term "transient transfection" refers to a transfection method in which an exogenous gene introduced into a cell by transfection is not integrated into the cell's own genome. The procedure for transient transfection is known to those skilled in the art. For example, the transient transfection can be performed by liposome-mediated transfection. For example, the transient transfection can include electroporation transfection. The transient transfection can use a transfection reagent, such as FuGENE6.

[0160] In this application, the term "stable transfection" generally refers to the introduction and integration of an exogenous nucleic acid molecule into the genome of the transfected cell, e.g., the exogenous gene is integrated into the genome of the transfected cell.

[0161] In this application, the term "stem cell" generally refers to a class of undifferentiated cells that have the ability to self-renew while retaining various levels of potential to form differentiated cells and tissues. The stem cells may be apoptotic, pluripotent, or totipotent stem cells. Apoptotic stem cells are induced stem cells that have lost the ability to differentiate. Totipotent stem cells can form all cells and tissues found in an entire organism. For example, the totipotent stem cells can form an entire organism.

[0162] In this application, the terms "pluripotent stem cell" and "multipotent stem cell" are used interchangeably and generally refer to stem cells that have the capacity to form the cells and tissues ultimately found in a complete organism, but are unable to form a complete organism.

[0163] In the present application, the term "mesenchymal stem cell" generally refers to a cell that can generate mesenchymal cells. The mesenchymal stem cells are considered to belong to the pluripotent stem cells. The mesenchymal stem cells can generate one or more types of mesenchymal cells. The mesenchymal cells can be derived from various tissues, for example, bone marrow tissue, adipose tissue, muscle tissue, reproductive tissue (e.g., amniotic membrane, amniotic fluid, or umbilical cord tissue), skin tissue, bone tissue, and / or dental tissue.

[0164] In this application, the term "immune cell" generally refers to a cell that plays a role in an immune response. The immune cells may include lymphocytes, monocytes, and / or granulocytes, as well as their precursors and / or mature derivatives. The immune cells may include T cells, B cells, Th cells, natural killer cells, monocytes, macrophages, eosinophils, basophils, mast cells, dendritic cells, and / or granulocytes. The immune cells may include immune effector cells. The immune effector cells can participate in an immune response, such as by promoting an immune effector response. The immune effector cells may include T cells, such as α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NTK) cells, mast cells, and bone marrow-derived phagocytes.

[0165] In this application, the term "fibrocyte" generally refers to a functionally inactive fibroblast. The fibrocyte can be transformed into a fibroblast (e.g., can participate in the repair process when tissue is damaged). In this application, the term "muscle cell" generally refers to a cell or group of cells derived from muscle. The muscle cells can be derived from skeletal muscle, smooth muscle (e.g., derived from the digestive tract, bladder, blood vessels), and cardiac muscle cells and tissues.

[0166] In this application, the term "plasmid" generally refers to a construct containing genetic material. The plasmid can be designed to deliver genetic material (e.g., one or more nucleic acid sequences) to cells. The plasmid can contain an autonomously replicating sequence of single-stranded or double-stranded nucleic acid (e.g., DNA or RNA) derived from any source. The term "plasmid" is interchangeable with the term "vector" in this application. The plasmid can have different configurations, for example, a linear plasmid, a circular plasmid, or a supercoiled plasmid. The linear plasmid can be a linear DNA molecule. The supercoiled plasmid can contain two nucleic acid strands that maintain an intact structure (e.g., may include covalently closed circular DNA, cccDNA) and exhibit a supercoiled configuration. The circular plasmid can maintain an intact circular structure for at least one nucleic acid strand. The plasmid may not be integrated into the genome of a cell.

[0167] In the present application, the term "multiple cloning site" or "multiple cloning site (MCS)" generally refers to a nucleic acid sequence containing at least one restriction site. The multiple cloning site allows a nucleic acid molecule to be ligated into a vector described in the present application, for example, allowing insertion of the nucleic acid molecule at a specified site via the restriction site. The restriction site may be a restriction endonuclease recognition site. For example, the restriction endonuclease can be AclUHindIII, Sspl, MLuCI, Tsp509I, Pcil, AgeKBspMI, BfuAI, SexAI, MLuI, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, SpeI, Bsrl, Bmrl, BglII, AfeI, Alul, StuI, Seal, Clal, BspDI, PI-SceI, NsiI, Asel, Swal, CspCI, MfeI, BssSI, BmgBI, PmLl, Drall, Alel, EcoP15I, PvuII, AlwNI, or BtsMutI.

[0168] In this application, the term "exogenous promoter" generally refers to a promoter that is not native to the host in which it is placed. The exogenous promoter can be transfected and / or inserted into the host cell (e.g., into the genome of the cell). The promoter can be a recognition site in a polynucleotide (DNA or RNA) to which an RNA polymerase binds. The RNA polymerase can efficiently catalyze the assembly of messenger RNA complementary to the appropriate DNA strand of the coding region. The number of promoters can be one or more.

[0169] The exogenous promoter may be a constitutive promoter or an inducible promoter, and representative examples include a PGK promoter, an EF1α promoter, etc. The sequence of the PGK promoter may be as shown in SEQ ID NO:26.

[0170] In this application, the term "gene editing" generally refers to the insertion, deletion, and / or replacement of nucleic acids in a genome. The gene editing can be achieved by homology-directed repair (HDR), non-homologous end joining (NHEJ), or single-base modification. The gene editing can be performed using gene editing tools well known to those skilled in the art, such as zinc finger nuclease system (ZFN), TALEN system, and / or CRISPR technology.

[0171] In this application, the term "gene editing knock-in" generally refers to a genetic engineering process (e.g., it can be called knock-in), which replaces DNA sequence information in a genetic site one-to-one or inserts sequence information that is not present in the endogenous site. The gene editing knock-in can utilize homologous recombination. For example, under certain circumstances, homologous recombination can be used to introduce an exogenous functional gene (a gene that was not present in the genome or that has been inactivated) into a cell and undergo homologous recombination with a homologous sequence in the genome, resulting in insertion into the genome and expression in the cell. For example, the gene editing knock-in can allow an exogenous gene to at least partially replace a cellular genome. The gene editing knock-in can achieve site-specific "targeted knock-in" using CRISPR technology. For example, the gene editing knock-in can use transposons and transposase systems such as PiggyBac (PB) transposase and / or Sleeping Beauty (SB) transposase.

[0172] In the present application, the term "donor plasmid" generally refers to a plasmid capable of transcribing and / or translating an encoded exogenous gene in a cell into which it is introduced. For example, the donor plasmid may be suitable for the gene editing knock-in. For example, the donor plasmid may comprise a nucleic acid molecule encoding the exogenous gene. The donor plasmid may further comprise elements such as a promoter for regulating expression of the exogenous gene (e.g., production and / or accumulation at the transcriptional and / or translational levels). The donor plasmid may be a plasmid suitable for a eukaryotic expression system. Preferably, the donor plasmid of the present invention comprises the nucleic acid molecule of the first aspect of the present invention.

[0173] In the present application, the term "exogenous gene to be knocked in" generally refers to a heterologous gene that can be introduced by a gene editing knock-in method. The exogenous gene to be knocked in can be integrated into a target (e.g., cells within a subject's body, etc.) into which it is introduced. The exogenous gene to be knocked in can be integrated into the genome of a target. The exogenous gene to be knocked in can be a native gene derived from a different species, or can be a modified gene (e.g., a chimeric gene). In the present invention, representative exogenous genes to be knocked in include, but are not limited to, a nucleic acid sequence encoding a chimeric antigen receptor (CAR), a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, and a nucleic acid sequence encoding an additional exogenous protein (e.g., a cytokine, a BITE, an antibody).

[0174] In this application, the term "antibody" generally refers to an immunoglobulin that reacts with a designated protein or peptide or fragment thereof. Antibodies may be derived from any species and include, but are not limited to, IgG, IgA, IgM, IgD, and IgE, and antibodies from any subclass (e.g., IgG1, IgG2, IgG3, and IgG4). Antibodies may have a heavy chain constant region selected from, for example, IgG1, IgG2, IgG3, or IgG4. Antibodies may further have a light chain selected from, for example, kappa (κ) or lambda (λ). Antibodies in this application may be derived from any species.

[0175] In this application, the term "antigen-binding fragment" typically refers to a specific portion of an antibody molecule, comprising the amino acid residues that interact with an antigen and confer the antibody specificity and affinity for the antigen. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab)2, Fv fragment, F(ab')2, scFv, di-scFv, and / or dAb. In this application, the term "Fab" typically refers to a fragment comprising a heavy chain variable domain and a light chain variable domain, and further comprising a light chain constant domain and the first heavy chain constant domain (CH1). The term "Fab'" typically refers to a fragment that differs from Fab by the addition of a few residues (including one or more cysteines from the antibody hinge region) at the carboxy terminus of the heavy chain CH1 domain. The term "F(ab')2" typically refers to a dimer of Fab', an antibody fragment comprising two Fab fragments linked by disulfide bridges in the hinge region. The term "Fv" generally refers to the minimum antibody fragment containing a complete antigen recognition and binding site. In certain cases, the fragment may be composed of a dimer of one heavy-chain variable region and one light-chain variable region in non-covalent tight association, and the term "dsFv" generally refers to a disulfide-stabilized Fv fragment in which a single light-chain variable region is linked to a single heavy-chain variable region by a disulfide bond. The term "dAb fragment" generally refers to an antibody fragment consisting of a VH domain. In this application, the term "scFv" generally refers to a monovalent molecule formed by covalently pairing one heavy-chain variable domain and one light-chain variable domain of an antibody via a flexible peptide linker. Such scFv molecules may generally have a structure such as NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH.

[0176] In this application, the term "bispecific antibody" generally refers to an antibody having variable regions that recognize one or more epitopes on one or more antigens. Bispecific antibodies include, but are not limited to, full-length antibodies, antibodies having two or more VL and VH domains, antibody fragments such as Fab, Fv, dsFv, and scFv, diantibodies, and covalently or non-covalently linked antibody fragments. Under certain circumstances, such bispecific antibodies can recognize two different epitopes on the same or different antigens. Under certain circumstances, such bispecific antibodies can recognize two different antigens. In this application, multispecific antibodies include bispecific or trispecific antibodies, or antigen-binding fragments thereof.

[0177] In the present application, the terms "antigen-binding domain" and "target-binding domain" are used interchangeably and generally refer to a domain capable of binding to a target antigen. The antigen-binding domain may include a chimeric antigen receptor and a fragment thereof, an antibody, or an antigen-binding fragment thereof, capable of specifically binding to an antigen. The antigen-binding domain may be a domain capable of binding to a tumor-associated antigen, and in the present application, the tumor-associated antigens include, but are not limited to, CD19, CD20, CD22, CD123, CD33 / IL3Ra, CD138, CD33, BCMA, CS1, C-Met, EGFRvIII, CEA, Her2, GD2, MAG3, GPC3, Claudin18.2, Mesothelin, and NY-ESO-1.

[0178] In this application, the term "chimeric antigen receptor" generally refers to a fusion protein comprising an extracellular domain capable of binding to an antigen and at least one intracellular domain. CAR is the core component of chimeric antigen receptor T cells (CAR-T), which may comprise an antigen (e.g., tumor-specific antigen and / or tumor-associated antigen) binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In this application, the CAR can be combined with a T cell receptor activating intracellular domain based on the antigen (e.g., CD19) specificity of the antibody. T cells genetically modified to express the CAR can identify and eliminate malignant cells expressing the target antigen. For a description of CARs and CAR-T cells, see, e.g., Sadelain M, Brentjens R, Riviere I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013;3(4):388-398; Turtle CJ, Hudecek M, Jensen MC, Riddell SR. Engineered T cells for anti-cancer therapy. Curr Opin Immunol. 2012;24(5):633-639; Dotti G, Gottschalk S, Savoldo B, Brenner MK. Design and development of therapies using chimeric antigen receptor-expressing T cells. Immunol Rev. 2014;257(1):107-126. In the present invention, tumor-associated antigens (TAA) include TAA of hematological tumors and TAA of solid tumors, and representative TAA include (but are not limited to): GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2, and Mesothelin.

[0179] In this application, the term "BiTE" generally refers to a bispecific T cell engager. The BiTE can be a single polypeptide chain molecule with two antigen-binding domains, one of which binds to a T cell antigen and the other of which binds to an antigen on the surface of a target cell (see WO05 / 061547; Baeuerle, P. et al. (2008) "BiTE™: A New Class of Antibodies That Recruit T Cells Drugs of the Future 33:137-147; or Bargou et al. (2008) "Tumor Regression in Cancer Patients by Very Low Doses of a T Cell-Engaging Antibody / 'Science 321:974-977).

[0180] In this application, the term "polyprotein" generally refers to a polypeptide chain comprising multiple protein molecules, which may be consecutively present in the polypeptide chain, and in which any two protein molecules may optionally be spaced apart by a heat-degradable moiety (e.g., a 2A peptide).

[0181] In this application, the term "homologous arm" generally refers to a polynucleotide suitable for targeting an exogenous gene to be knocked into a donor plasmid to a genome by homologous recombination. Homologous recombination refers to a new combination between or within DNA molecules containing homologous sequences between sister chromatins or on the same chromosome. Two homologous arms may be present (e.g., a 5' homologous arm and / or a 3' homologous arm). The homologous arms may be located upstream and downstream of the exogenous gene to be knocked into the donor plasmid. Under certain circumstances, the target location of the exogenous gene to be knocked into the genome may be fragmented by the action of a nuclease. The homologous arms are completely identical to or share at least 80% identity with the DNA sequences at both ends of the cut (i.e., the 5' and / or 3' ends) of the target location. For example, the homologous arms have at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identity to the DNA sequences on either side of the target site for cleavage. In the present application, the donor plasmid may comprise a 5' homologous arm and / or a 3' homologous arm.

[0182] In this application, the term "cell viability" generally refers to the ability of cells to continue to survive under certain conditions. The cell viability can be measured by the ratio of live cells under the conditions to the total number of cells present at that time within a certain period of time. The cell viability can reflect the effect of certain conditions on cell production. For example, the higher the cell viability, the more favorable the conditions are for cell viability.

[0183] In this application, the term "cell expansion ability" generally refers to the ability of cells to proliferate and / or self-renew. The cell expansion ability can be measured by the total number of cells generated by cell expansion within a certain period of time. For example, the more cells there are within a certain period of time, the higher the cell expansion ability. The cell expansion ability can also be reflected in improved cell function (e.g., proliferation).

[0184] In this application, the term "cell killing ability" generally refers to the killing ability of a cell against its target cell. For example, immune effector cells (e.g., T cells, NK cells) can mediate killing of target cells (e.g., tumor cells) and kill the target cells. For example, the mediation can include localization of the target cells by the immune effector cells (e.g., through mutual recognition of molecules and / or epitopes expressed by the immune effector cells and the target cells). The cell killing ability can be measured by the number of target cells killed as a result of cell-mediated target cell killing under a certain period and conditions.

[0185] In this application, the term "cell secretory capacity" generally refers to the ability of a cell to secrete a secretory factor. For example, the secretory factor may be a molecule that leaves the cell by secretion. The secretory factor may include a protein encoded by an exogenous gene. The cell secretory capacity can be measured by the number of secretory factors secreted from the cell under a certain period and condition.

[0186] In this application, the term "cell preservation capacity" generally refers to the ability of cells to survive and / or maintain their original functions under storage conditions. For example, the storage conditions may include long-term storage at room temperature or low temperature (e.g., non-refrigerated temperature or storage refrigerated temperature, e.g., under liquid nitrogen conditions). Storage may reduce the metabolic level of the cells, causing them to temporarily lose their growth state. The cells can recover after the storage. The cell preservation capacity can be measured as the ratio of the number of cells after the storage to the number of cells before the storage, under a certain period and conditions.

[0187] In this application, the term "cell recovery ability" generally refers to the ability of cells to recover and grow after re-cultivation. The re-cultivation may refer to thawing and re-cultivating cells cryopreserved in liquid nitrogen or a -80°C freezer. The cell recovery ability can be measured as the ratio of the number of cells that have recovered their growth ability after re-cultivation under certain conditions and for a certain period of time.

[0188] In this application, the term "cell line" generally refers to a clonal population of cells that can continue to divide, e.g., the cell line can acquire the ability to grow indefinitely in vitro.

[0189] In this application, the term "complementary" generally refers to Watson-Crick base pairing between nucleotides, and specifically to nucleotides that are bound to each other by hydrogen bonds, where a thymine or uracil residue is bound to an adenine residue through two hydrogen bonds, and cytosine and guanine residues are bound through three hydrogen bonds. Nucleic acids typically contain nucleotide sequences that are described as having a "percent complementarity" to a specified second nucleotide sequence. Those skilled in the art will recognize that two complementary nucleotide sequences include sense and antisense strands.

[0190] In this application, the terms "homology," "identity," or "similarity" generally refer to the sequence similarity between two peptides or two nucleic acid molecules. The term "homologous region" generally refers to a region on a donor molecule that has a certain level of homology with a target sequence. Homology can be determined by comparing positions within each sequence. For example, homology between sequences can be determined by performing a sequence alignment. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The level of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence has less than 40% identity with one of the sequences of this application, but preferably less than 25% identity. A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) has a certain percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) of "sequence identity" or "homology" with another sequence, meaning that, when aligned, that percentage of bases (or amino acids) are the same in the two sequences being compared. The alignment and percentage of homology or sequence identity can be determined by software programs known in the art and are described, for example, in Current Protocols in Molecular Biology, edited by Ausubel et al. (2007).

[0191] In this application, the term "transfection" generally refers to a method used to introduce biologically active substances (e.g., nucleic acids, proteins, enzymes, or small molecules) into cells. The nucleic acids can be DNA (delivered as plasmids or oligomers) and / or RNA, or a combination thereof.

[0192] In this application, the term "electroporation" generally refers to a transfection method in which an external electric field is applied to cells. In certain embodiments, the electroporation method used is electrostatic poration.

[0193] In this application, the terms "IL15" and "IL-15" are used interchangeably and generally refer to the cytokine interleukin-15 and / or functionally active fragments thereof. IL-15 can bind to the IL-15 receptor on various cells of the immune system, thereby mediating associated signal transduction. The amino acid sequence of human IL-15 is set forth in UniprotKB:P40933. As used herein, the term "IL-15" includes human IL-15 (hIL-15), variants, isoforms, and species homologs of hIL-15, as well as analogs that share at least one common epitope with hIL-15 (e.g., fusion proteins comprising IL-15, e.g., fusion proteins of IL-15 and Fc).

[0194] In this application, the terms "IL21" and "IL-21" are used interchangeably and generally refer to the cytokine interleukin-21 and / or functionally active fragments thereof. IL-21 can bind to the IL-21 receptor on various cells of the immune system, thereby mediating associated signaling. The amino acid sequence of human IL-21 is set forth in UniProtKB:Q9HBE4. As used herein, the term "IL-21" includes human IL-21 (hIL-21), variants, isoforms, and species homologs of hIL-21, as well as analogs that share at least one shared epitope with hIL-21 (e.g., fusion proteins comprising IL-21, e.g., fusion proteins of IL-21 and Fc).

[0195] In this application, the term "functionally active fragment" generally refers to a fragment having a partial region of a full-length protein or nucleic acid, but which retains or partially retains the biological activity or function of the full-length protein or nucleic acid. For example, a functionally active fragment can retain or partially retain the ability of the full-length protein to bind to another molecule. For example, a functionally active fragment of IL-15 can retain or partially retain the receptor-binding function or one or more other biological activities of full-length IL-15. For example, a functionally active fragment of IL-21 can retain or partially retain the receptor-binding function or one or more other biological activities of full-length IL-21.

[0196] Unless the context clearly indicates otherwise, in this application, the terms "comprise," "have," and "include" are used interchangeably and generally refer to the possibility of including other components, elements, values, steps, etc. In certain circumstances, "comprise" refers to the inclusion of situations such as "is" and "consist of," for example, based on a description that a composition "comprises" component "A," one skilled in the art can infer that, in certain circumstances, the composition may consist of only component A.

[0197] In this application, the term "about" generally refers to within 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05% of a specified value or range of values referred to in this application. In this application, when "about" refers to the first value of two or more numerical values, it applies to all values of that point.

[0198] Detailed Description of the Invention Isolated Nucleic Acid Molecules and Vectors In a first aspect, the present application provides an isolated nucleic acid molecule, comprising a nucleic acid sequence encoding a chimeric antigen receptor (CAR), a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof. In certain embodiments, the nucleic acid molecule comprises, in 5' to 3' order, a nucleic acid sequence encoding the CAR, a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. For example, the 3' side (or downstream) of the nucleic acid sequence encoding the CAR can comprise the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and one or more sections of a first spacer nucleic acid sequence can be included between them. For example, the 3' end of the nucleic acid sequence encoding the CAR can be linked to the 5' end of the first spacer nucleic acid sequence, while the 3' end of the first spacer nucleic acid sequence can be linked to the 5' end of the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof. For example, the 3' side (or downstream) of the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof can comprise the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof, and one or more sections of a second spacer nucleic acid sequence can be included between them. For example, the 3' end of the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof can be linked to the 5' end of the second spacer nucleic acid sequence, while the 3' end of the second spacer nucleic acid sequence can be linked to the 5' end of the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. The first spacer nucleic acid sequence can be the same as or different from the second spacer nucleic acid sequence. In certain embodiments, the first spacer nucleic acid sequence and / or the second spacer nucleic acid sequence can include nucleic acid sequences encoding one or more other proteins.

[0199] In the present application, the chimeric antigen receptor CAR may comprise a target binding domain that targets a tumor-associated antigen. For example, the chimeric antigen receptor may comprise at least one target binding domain that targets an antigen. For example, the chimeric antigen receptor may be capable of specifically binding to one antigen. For example, the chimeric antigen receptor may be capable of specifically binding to two antigens and / or to at least two different epitopes of one antigen. In the present application, the antigen may be a tumor-associated antigen (TAA). The tumor-associated antigen may be an antigen associated with tumor cells, such as breast cancer cells, B-cell lymphoma cells, Hodgkin's lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, lung cancer cells (e.g., small cell lung cancer cells), non-Hodgkin's B-cell lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, lung cancer cells (e.g., small cell lung cancer cells), melanoma cells, chronic lymphocytic leukemia cells, glioma, glioblastoma, medulloblastoma, and colorectal cancer cells. Cancer cell-associated antigens can be expressed by non-cancer cells.

[0200] In the present application, the tumor-associated antigen may be selected from GPC3, CD19, BCMA, Claudin18.2, and Mesothelin. For example, the antigen may be CD19. For example, the antigen may be GPC3 or BCMA.

[0201] In some circumstances, the target-binding domain may be a single-chain antibody (scFv), cAb VHH (camelized antibody variable domain) and its humanized variants, IgNAR VH (shark antibody variable domain) and its humanized variants, sdAb VH (single-domain antibody variable domain) and "camelized" antibody variable domain. The target-binding domain may be a discrimination domain based on a T-cell receptor (TCR), such as a single-chain TCR (scTv, VαVβ-containing single-chain two-domain TCR).

[0202] In certain cases, the target binding domain of the CAR may comprise the amino acid sequence shown in SEQ ID NO:1.

[0203] In certain cases, the target binding domain of the CAR may comprise an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO. 31 or 32.

[0204] In the present application, the chimeric antigen receptor may comprise a transmembrane domain. The N-terminus of the transmembrane domain can be directly or indirectly linked to the C-terminus of the target-binding domain. In the present application, any transmembrane (TM) structure provided for inserting a polypeptide into the cell membrane of a eukaryotic cell (e.g., a mammalian cell) can be applied to the transmembrane domain.

[0205] For example, the transmembrane domain may comprise a transmembrane domain derived from a protein selected from the α, β or ζ chain of the T cell receptor, CD28, CD3e, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154.

[0206] In certain circumstances, the chimeric antigen receptor may comprise a hinge region, wherein the hinge region may be located between the target binding domain and the transmembrane domain. The hinge region may be an immunoglobulin heavy chain hinge region, or the hinge region may be a receptor-derived hinge region polypeptide (e.g., a hinge region from CD8).

[0207] The length of the hinge region can be about 4 to about 50 amino acids, for example, about 4 to about 10 amino acids, about 10 to about 15 amino acids, about 15 to about 20 amino acids, about 20 to about 25 amino acids, about 25 to about 30 amino acids, about 30 to about 40 amino acids, or about 40 to about 50 amino acids.

[0208] The hinge region may contain at least one cysteine. The amino acid sequence of the hinge region may be known in the art, see, for example, Tan et al. (1990) Proc. Natl. Acad. Sci. USA 87:162; and Huck et al. (1986) Nucl. Acids Res. 14:1779.

[0209] In the present application, the hinge region may comprise the amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4 hinge region. For example, compared to a wild-type (naturally occurring) hinge region, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions.

[0210] In the present application, the chimeric antigen receptor may comprise a costimulatory domain. The length of the costimulatory domain may be about 30 to about 70 amino acids. The costimulatory domain may be derived from a receptor polypeptide. For example, the costimulatory domain may be the intracellular portion of a transmembrane protein. For example, the costimulatory domain may comprise a costimulatory domain derived from a protein such as 4-1BB (CD137), CD28, ICOS, OX-40, BTLA, CD27, CD30, GITR, and / or HVEM. For example, the costimulatory domain may comprise a costimulatory domain derived from a protein such as CD28, 4-1BB, OX-40, and / or ICOS.

[0211] In the present application, the chimeric antigen receptor may further comprise a linker. The linker may be located between the transmembrane domain and the costimulatory domain. The linker may be a connecting peptide. For example, the connecting peptide may have a length of about 6 to about 40 amino acids. The connecting peptide may have any amino acid sequence as long as it has a flexible structure.

[0212] In the present application, the chimeric antigen receptor may comprise an intracellular signaling domain. For example, the intracellular signaling domain may comprise an intracellular signaling domain derived from a protein such as CD8β, CD4, CD3ζ, CD28, CD134, and / or CD7. For example, the intracellular signaling domain may comprise a signaling domain derived from CD3ζ.

[0213] In the present application, the intracellular signaling domain may comprise an ITAM motif-containing portion derived from a polypeptide containing an ITAM motif, for example, DAP12, FCER1G (Fcε receptor Iγ chain), CD3D (CD3δ), CD3E (CD3ε), CD3G (CD3γ), CD3Z (CD3ζ), and CD79A (antigen receptor complex-associated protein α chain).

[0214] In certain embodiments, the CAR may comprise a hinge region, a transmembrane domain, a costimulatory domain, and an intracellular domain. For example, the hinge region may be a hinge region derived from CD8α. In certain cases, the hinge region may comprise the hinge region sequence in the amino acid sequence set forth in SEQ ID NO:2. For example, the transmembrane domain may be a transmembrane domain derived from CD8α. In certain cases, the transmembrane domain may comprise a transmembrane domain portion in the amino acid sequence set forth in SEQ ID NO:2. In certain embodiments, the hinge region and the transmembrane domain may comprise the amino acid sequence set forth in SEQ ID NO:2. For example, the costimulatory domain may be a costimulatory domain derived from 41BB. In certain cases, the costimulatory domain may comprise the amino acid sequence set forth in SEQ ID NO:3. For example, the intracellular domain may be an intracellular domain derived from CD3ζ. In certain cases, the intracellular domain may comprise the amino acid sequence set forth in SEQ ID NO:4. In a specific embodiment, the CAR comprises the amino acid sequence shown in SEQ ID NO:5.

[0215] In the present application, the IL-15 or a functionally active fragment thereof may comprise its endogenous signal peptide or a signal peptide derived from another protein. For example, the IL-15 or a functionally active fragment thereof may comprise a signal peptide derived from IL-7. In the present application, the IL-15 or a functionally active fragment thereof may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 6 to 7 and 9.

[0216] In the present application, the IL-21 or a functionally active fragment thereof may comprise its endogenous signal peptide or a signal peptide derived from another protein. For example, the IL-21 or a functionally active fragment thereof may comprise a signal peptide derived from CCL19. In the present application, the IL-21 or a functionally active fragment thereof may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 10 to 11 and 13.

[0217] The nucleic acid molecule described in the present application may further comprise one or more nucleic acid sequences encoding a thermally degradable moiety. The nucleic acid sequence encoding the thermally degradable moiety can be located between any two sequences selected from the group consisting of the nucleic acid sequence encoding the chimeric antigen receptor (CAR), the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. For example, the nucleic acid sequence encoding the thermally degradable moiety can be located between the nucleic acid sequence encoding the CAR and the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof. For example, the nucleic acid sequence encoding the thermally degradable moiety can be located between the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof and the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. In certain embodiments, a nucleic acid sequence encoding a first thermolyzable moiety may be included between the nucleic acid sequence encoding the CAR and the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding a second thermolyzable moiety may be included between the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof and the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. The first thermolyzable moiety and the second thermolyzable moiety may be the same or different.

[0218] For example, the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof can be expressed in the form of a polyprotein, e.g., the polyprotein can include the heat-degradable moiety between two or more proteins.

[0219] In the present application, the thermodegradable moiety may comprise a 2A peptide. The 2A peptide may comprise P2A, T2A, F2A or E2A.

[0220] For example, the thermally degradable portion may comprise the amino acid sequence shown in any one of SEQ ID NOs:14-16.

[0221] In certain cases, the nucleic acid molecules of the present application may further comprise nucleic acid sequences encoding one or more other exogenous proteins.

[0222] In the present application, the other exogenous protein may include any one or more functional proteins. For example, the other exogenous protein may be selected from the group consisting of cytokines, chemokines, and antibodies or antigen-binding fragments thereof. For example, the functional protein may be used to treat a disease associated with a gene defect. For example, the functional protein may be a protein that is deleted and / or mutated in the host in which the transfected cell is located.

[0223] In certain cases, the one or more other exogenous proteins may include an antibody or antigen-binding fragment thereof. For example, the antibody or antigen-binding fragment thereof may include a multispecific antibody or antigen-binding fragment thereof. For example, the multispecific antibody or antigen-binding fragment thereof may simultaneously target immune effector cells (e.g., T cells, NK cells) and tumor cells.

[0224] For example, the multispecific antibody or antigen-binding fragment thereof may comprise a bispecific T cell engager (BiTE). For example, the BiTE can specifically bind at least one tumor-associated antigen (TAA) and T cells. For example, the BiTE can specifically bind to an antigen expressed on the surface of T cells, e.g., it can specifically bind to the CD3 receptor. For example, the BiTE can specifically target an MHC-independent tumor-associated antigen (TAA). For example, the BiTE can comprise a CD3-binding domain. The BiTE can comprise at least one antigen-binding moiety, e.g., it can comprise at least one single-chain antibody scFv. For example, the BiTE can comprise a tumor-associated antigen-binding domain. For example, the tumor-associated antigen can be selected from GPC3, CD19, BCMA, Claudin 18.2, and Mesothelin.

[0225] In the present application, when the isolated nucleic acid molecule simultaneously encodes a CAR and a BiTE, the tumor-associated antigen targeted by the BiTE may be the same as or different from the tumor-associated antigen targeted by the CAR. In certain embodiments, the BiTE targets the same epitope as the CAR. In certain embodiments, the BiTE and the CAR target the same target, but each specifically recognizes or binds to a different epitope of the target. In certain embodiments, the BiTE and the CAR target different targets.

[0226] In the present application, the isolated nucleic acid molecule may further comprise one or more homologous regions. For example, each of the homologous regions may comprise at least 10 nucleotides (e.g., at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 110 nucleotides, at least 120 nucleotides, at least 130 nucleotides, at least 140 nucleotides, at least 150 nucleotides, at least 160 nucleotides, at least 170 nucleotides, at least 180 nucleotides, at least 190 nucleotides, at least 200 nucleotides or more). For example, in the isolated nucleic acid molecule, the homologous region can be located at the 3' end and / or 5' end of the nucleic acid sequence encoding the CAR, IL-15 or a functionally active fragment thereof, or IL-21 or a functionally active fragment thereof. In certain embodiments, at least one of the homologous regions is located at the 5' end of the nucleic acid sequence encoding the CAR, and at least another of the homologous regions is located at the 3' end of the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof.

[0227] For example, the nucleic acid sequence of the homologous region (or homologous arm) can have at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identity to the nucleic acid sequence at the 5' end and / or 3' end of the knock-in position in the genomic DNA of the immune cell to be modified. For example, the size of the homologous arm can be 100 to 1,000 bp. For example, the homologous arm can be about 150 to 1,000 bp, about 200 to 1,000 bp, about 300 to 1,000 bp, about 400 to 1,000 bp, or about 800 to 1,000 bp.

[0228] In certain embodiments, the isolated nucleic acid molecule of the present application further comprises a 5' homology arm, which may be homologous to a target region in the immune cell genome. The target region may be located in a target gene (e.g., a coding region, non-coding region, or other regulatory region of the target gene). The target gene may be selected from TRBC, TRAC, PD-1, CD95, AAVS1, and CCR5. In certain embodiments, in the isolated nucleic acid molecule, the 5' homology arm is located upstream of the nucleic acid sequence encoding the chimeric antigen receptor (CAR). For example, the 5' homology arm may comprise the nucleic acid sequence set forth in SEQ ID NO: 17.

[0229] In certain embodiments, the isolated nucleic acid molecule of the present application further comprises a 3' homology arm, which may be homologous to a target region in the immune cell genome. The target region may be located in a target gene (e.g., a coding region, non-coding region, or other regulatory region of the target gene). The target gene may be selected from TRBC, TRAC, PD-1, CD95, AAVS1, and CCR5. In certain embodiments, in the isolated nucleic acid molecule, the 3' homology arm is located downstream of the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. For example, the 3' homology arm may comprise the nucleic acid sequence set forth in SEQ ID NO: 18.

[0230] For example, an isolated nucleic acid molecule of the present application may comprise (in 5' to 3' order): a 5' homology arm - a nucleic acid sequence encoding a CAR - a nucleic acid sequence encoding a thermodegradable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof - a nucleic acid sequence encoding a thermodegradable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof - a 3' homology arm.

[0231] For example, an isolated nucleic acid molecule of the present application may comprise (in 5' to 3' order): a 5' homology arm - a nucleic acid sequence encoding a CAR - a nucleic acid sequence encoding a thermodegradable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof - a nucleic acid sequence encoding a thermodegradable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof - polyA - a 3' homology arm.

[0232] For example, an isolated nucleic acid molecule of the present application may comprise (in 5' to 3' order): a 5' homology arm - a nucleic acid sequence encoding a CAR - a nucleic acid sequence encoding a thermodegradable moiety (e.g., a 2A peptide) - a nucleic acid sequence encoding an IL-7 signal peptide - a nucleic acid sequence encoding an IL-15 or a functionally active fragment thereof - a nucleic acid sequence encoding a thermodegradable moiety (e.g., a 2A peptide) - a nucleic acid sequence encoding a CCL19 signal peptide - a nucleic acid sequence encoding an IL-21 or a functionally active fragment thereof - polyA - a 3' homology arm.

[0233] In certain embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 20-21, 23-24, and 27-30.

[0234] The isolated nucleic acid molecule of the present application can be integrated into the genome of the immune cell. For example, expression of the isolated nucleic acid molecule can be regulated by an endogenous promoter of the immune cell genome. For example, after the isolated nucleic acid molecule is integrated into the genome of the cell, its expression can be regulated by an endogenous promoter. For example, the homologous region can be homologous to a target region in the genomic DNA of the immune cell. For example, the target region can be located in a target gene (e.g., a coding region, non-coding region, or other regulatory region of the target gene). The target gene can be selected from TCR-β subunit constant gene (TRBC), TCR-α subunit constant gene (TRAC), PD-1, CD95, AAVS1, and CCR5.

[0235] In the present application, the size of the isolated nucleic acid molecule can be at least about 1000 bp (e.g., at least about 1500 bp, at least about 2000 bp, at least about 2500 bp, at least about 3000 bp, at least about 3500 bp, at least about 4000 bp, at least about 4500 bp, at least about 5000 bp, at least about 5500 bp, at least about 6000 bp, at least about 6500 bp, at least about 7000 bp, at least about 7500 bp, at least about 8000 bp, at least about 8500 bp, at least about 9000 bp, at least about 9500 bp or more), wherein the isolated nucleic acid molecule is integrated into the transfected cellular genome. For example, the size of the isolated nucleic acid molecule can be at least about 1 kb, e.g., at least about 1.5 kb, at least about 2 kb, at least about 2.5 kb, at least about 3 kb, at least about 3.5 kb, at least about 4 kb, at least about 4.5 kb, at least about 5 kb, at least about 5.5 kb, at least about 6 kb, at least about 6.5 kb, at least about 7 kb, at least about 7.5 kb, at least about 8 kb, at least about 8.5 kb, at least about 9 kb or more.

[0236] In the present application, the isolated nucleic acid molecule may include a circular nucleic acid molecule, a supercoiled nucleic acid molecule and / or a linear nucleic acid molecule. In the present application, the isolated nucleic acid molecule may include a DNA molecule and / or an RNA molecule. In the present application, the isolated nucleic acid molecule may include a single-stranded nucleic acid molecule and / or a double-stranded nucleic acid molecule.

[0237] The present application further provides a vector comprising the isolated nucleic acid molecule described herein. In certain cases, the vector is a non-viral vector (e.g., does not contain any viral components or any characteristic nucleic acid sequences derived from viruses). For example, the vector may be a plasmid.

[0238] In this application, the term "vector" refers to an isolated nucleic acid molecule into which a heterologous nucleic acid sequence can be inserted and which is used to introduce the heterologous nucleic acid sequence into a cell for replication and / or expression. The nucleic acid sequence may be "heterologous," meaning that the nucleic acid sequence is foreign to the cell being transfected or the nucleic acid sequence being inserted. Vectors include DNA, RNA, plasmids, cosmids, and artificial chromosomes (e.g., YACs), etc. Those skilled in the art can construct vectors using recombinant preparation techniques (e.g., Sambrook et al., 2001; Ausubel et al., 1996). Vectors can be used to transfect cells to produce antibodies or other exogenous proteins (e.g., CARs, cytokines, etc.).

[0239] In the present application, the vector may include a regulatory sequence such as a promoter. A promoter is typically a region of a nucleic acid sequence that controls the initiation and rate of transcription. A promoter may include genetic elements to which regulatory proteins and molecules (e.g., RNA polymerase and other transcription factors) can bind. A promoter may or may not be used in combination with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

[0240] A vector or construct typically contains at least one termination signal. A "termination signal" or "terminator" is composed of a DNA sequence involved in the specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments, a termination signal that terminates the production of an RNA transcript is considered. In eukaryotic systems, the terminator region may further contain a specific DNA sequence that site-specifically cleaves the new transcript to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a section of extension sequence of approximately 200 A residues (polyA) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear to be more stable and efficiently translated. Thus, in some other embodiments involving eukaryotes, the terminator can contain a signal used to cleave RNA; for example, the terminator signal can promote polyadenylation.

[0241] The isolated nucleic acid molecules or vectors of the present application can also include a polyadenylation signal to affect polyadenylation of the appropriate transcript.

[0242] In certain embodiments, the vector may contain one or more origin of replication sites (commonly referred to as "ori"), which are specific nucleic acid sequences at which replication is initiated. Alternatively, when the host cell is yeast, an autonomously replicating sequence (ARS) can be used.

[0243] In the present application, the plasmid may include a circular plasmid. For example, the plasmid can be enzymatically digested without the interference of the DNase treatment. For example, the plasmid may be a circular plasmid, a supercoiled plasmid, and / or a linearized plasmid. In the present application, the plasmid may include a multiple cloning site. For example, the isolated nucleic acid molecule can be extracted from the host cell. Commonly used methods for extracting plasmids are well known to those skilled in the art.

[0244] Method, kit and transfection composition for preparing immune cells In another aspect, the present application provides a method for preparing a modified immune cell, the method comprising transfecting (e.g., by electroporation transfection) the immune cell to be modified with an isolated nucleic acid molecule described herein (e.g., comprising a nucleic acid sequence encoding the chimeric antigen receptor (CAR), a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof) or a vector described herein (e.g., a plasmid vector comprising the nucleic acid molecules).

[0245] For example, the method can include transfecting (e.g., by electroporation transfection) an immune cell to be modified with an isolated nucleic acid molecule described herein (e.g., comprising, in 5' to 3' order, a nucleic acid sequence encoding the chimeric antigen receptor (CAR), a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof), or a vector described herein (e.g., a plasmid vector comprising the nucleic acid molecules).

[0246] In certain embodiments, the method can include transfecting the immune cells to be modified with a transfection composition comprising a nucleic acid molecule described herein, or a vector described herein, such that the cells contain and / or express the nucleic acid molecule, wherein at least a portion (e.g., at least 1 w / w%, at least 5 w / w%, at least 10 w / w%, at least 15 w / w%, at least 20 w / w%, at least 25 w / w%, at least 30 w / w%, at least 35 w / w%, at least 40 w / w%, at least 45 w / w%, at least 50 w / w%, at least 55 w / w%, at least 60 w / w%, at least 65 w / w%, at least 70 w / w%, at least 75 w / w%, at least 80 w / w%, at least 85 w / w%, at least 90 w / w%, at least 95 w / w%, at least 99 w / w%, at least 10 ... % (w / w) is obtained from a host cell (e.g., at least a portion of a plasmid is obtained from a microbial host cell), and the portion of the nucleic acid molecule or the portion of the vector obtained from the host cell contains genomic DNA from the host cell of about 10% (w / w) or less (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less). (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or less).

[0247] In certain embodiments, the method may include treating the isolated nucleic acid molecule with DNase. In certain embodiments, the DNase is capable of non-specifically cleaving linear DNA. In certain embodiments, the DNase comprises an exonuclease. In certain embodiments, the treatment may involve treatment with Mg 2+ and Ca 2+ contacting the isolated nucleic acid molecule with the DNase in the presence of

[0248] In certain embodiments, the method can include reducing the content of genomic DNA of the host cell in the isolated nucleic acid molecule portion obtained from the host cell. For example, after the reduction, the content of genomic DNA of the host cell can be about 10% (w / w) or less (e.g., about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4% or less, about 3% or less, about 2.5% or less, about 2% or less, about 1.5% or less, about 1% or less, about 9% or less, about 8% or less, about 7% or less). or less, about 6‰ or less, about 5.5‰ or less, about 5‰ or less, about 4.5‰ or less, about 4‰ or less, about 3.5‰ or less, about 3‰ or less, about 2.5‰ or less, about 2‰ or less, about 1.5‰ or less, about 1‰ or less, about 0.5‰ or less, about 0.3‰ or less, about 0.1‰ or less, about 0.01‰ or less, about 0.001‰ or less or less, all by mass percentage).

[0249] In certain embodiments, the method may include treating the isolated nucleic acid molecule portion obtained from the host cell with DNase. In certain embodiments, the DNase is capable of non-specifically cleaving linear DNA. In certain embodiments, the DNase comprises an exonuclease. In certain embodiments, the treatment may include treatment with Mg 2+ and Ca 2+ contacting the isolated nucleic acid molecule portion obtained from the host cell with the DNase in the presence of

[0250] In the present application, the transfection efficiency of cells transfected with the isolated nucleic acid molecule treated with DNase can be improved by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 1.0%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 1000% or more, compared to an isolated nucleic acid molecule that has not been treated with DNase. For example, the methods of the present application can be in vitro methods or in vivo methods.

[0251] In another aspect, the present application provides a kit for transfection (e.g., electroporation). The kit includes 1) an isolated nucleic acid molecule portion (e.g., a plasmid obtained from a microbial host cell) obtained from a host cell described in any aspect of the present application, and 2) a reagent capable of reducing or degrading genomic DNA of the host cell. In certain embodiments, the reagent in 2) includes one or more selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In certain embodiments, the DNase is capable of nonspecifically cleaving linear DNA. In certain embodiments, the DNase includes an exonuclease. In certain embodiments, the kit includes Mg 2+ and Ca 2+ The reagent further comprises:

[0252] In the present application, the kit may further include reagents and / or equipment necessary to obtain transformed cells necessary for performing the electroporation method. For example, the transformed cells may be stored under ultra-low temperature conditions (e.g., -70°C). In the present application, when performing the electroporation method, the voltage of the electroporator may be approximately 1500 to 2500 V. In the present application, the electroporation cup may be adapted to be placed under ultra-low temperature conditions to perform the electroporation method.

[0253] In the present application, the DNase can cleave single-stranded DNA and / or double-stranded DNA. For example, the DNase can non-specifically cleave linear DNA. For example, the DNase can include an exonuclease. For example, the DNase can be completely free of RNase. In certain embodiments, the DNase cannot cleave circular DNA. In certain embodiments, the DNase cannot cleave single-stranded DNA.

[0254] In the present application, the kit may further include a buffer solution, and the buffer solution may contain Mg 2+ and Ca 2+ For example, the buffer solution may be a reaction buffer corresponding to the DNase. In the present application, the kit may further include deionized water (e.g., treated with DEPC) necessary for DNase enzyme digestion of DNA.

[0255] In another aspect, the present application provides a kit comprising: 1) an isolated nucleic acid molecule portion obtained from a host cell described in any aspect of the present application; and 2) instructions for use, the instructions describing treating the isolated nucleic acid molecule portion obtained from the host cell (e.g., a plasmid obtained from a microbial host cell) in 1) using a method of the present application, and / or determining the quality of a transfection composition comprising the isolated nucleic acid molecule portion obtained from the host cell (e.g., a plasmid obtained from a microbial host cell) using a method of the present application.

[0256] In another aspect, the present application provides a transfection composition comprising an isolated nucleic acid molecule processed by the methods described herein.

[0257] In the present application, the transfection efficiency of the transfection composition (isolated nucleic acid molecule or vector, e.g., a plasmid) for cells can be determined by 1) measuring the proportion of cells expressing the isolated nucleic acid molecule in the transfected cells, if the transfection composition (or plasmid) comprises the isolated nucleic acid molecule, and / or 2) measuring the proportion of cells containing the isolated nucleic acid molecule in the transfected cells, if the transfection composition comprises the isolated nucleic acid molecule.

[0258] In another aspect, the present application provides an immune cell transfected with an isolated nucleic acid molecule, vector, or transfection composition described herein.

[0259] In another aspect, the present application provides immune cells prepared by the methods described herein.

[0260] In another aspect, the present application provides a cell population comprising the cells described herein and / or their progeny. For example, the cell population comprises at least 10 3 pieces (e.g., at least 10 4 Pieces, at least 10 5 Pieces, at least 10 6 Pieces, at least 10 7 Pieces, at least 10 8 Pieces, at least 10 9 Pieces, at least 10 10 The cell may comprise one or more of said cells.

[0261] In another aspect, the present application provides pharmaceutical compositions comprising the isolated nucleic acid molecules, vectors, transfection compositions, immune cells, and / or cell populations described herein. In certain embodiments, the pharmaceutical compositions further comprise a pharmaceutically acceptable adjuvant. Examples of pharmaceutically acceptable adjuvants include substances that do not cause significant irritation to an organism and do not significantly adversely affect the biological activity and properties of the administered active ingredient (e.g., modified cells or cell populations). For example, the pharmaceutically acceptable adjuvant may include, but is not limited to, a diluent, a buffer, a binder, a surfactant, a humectant, an adsorption vector, a lubricant, a filler, and / or a disintegrant.

[0262] In another aspect, the present application provides use of an isolated nucleic acid molecule described herein, a vector described herein, a cell described herein, a cell population described herein, and / or a pharmaceutical composition described herein for the preparation of a medicament. In certain embodiments, the medicament is used for the prevention, treatment, and / or alleviation of cancer.

[0263] In another aspect, the present application provides a method of preventing, treating, and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of an isolated nucleic acid molecule described herein, a vector described herein, a transfection composition described herein, a cell described herein, a cell population described herein, and / or a pharmaceutical composition described herein. In certain embodiments, the disease or condition is cancer.

[0264] In another aspect, the application provides an electroporation method (e.g., plasmid electroporation), the method comprising electroporating an immune cell (e.g., a T cell) with a plasmid comprising a nucleic acid sequence encoding a CAR, a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, such that the immune cell comprises and / or expresses the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof, wherein the plasmid is extracted from a host cell (e.g., a microbial host cell), and the content of genomic DNA of the host cell contained in the plasmid is less than or equal to 100% of the plasmid DNA. The content is about 10% (w / w) or less (for example, about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰(w / w) or less, about 6‰(w / w) or less, about 5‰(w / w) or less, about 4‰(w / w) or less, about 3‰(w / w) or less, about 2‰(w / w) or less, about 1.5‰(w / w) or less, about 1‰(w / w) or less, about 0.5‰(w / w) or less, about 0.1‰(w / w) or less, about 0.01‰(w / w) or less, about 0.001‰(w / w) or less or less).

[0265] In another aspect, the application provides an electroporation method (e.g., plasmid electroporation), the method comprising electroporating an immune cell (e.g., a T cell) with a plasmid comprising, sequentially in 5' to 3' order, a nucleic acid sequence encoding a CAR, a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, such that the immune cell comprises and / or expresses the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof, wherein the plasmid is extracted from a host cell, and the content of genomic DNA of the host cell contained in the plasmid is 0.01% of the plasmid DNA. The content is about 10% (w / w) or less (for example, about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰(w / w) or less, about 6‰(w / w) or less, about 5‰(w / w) or less, about 4‰(w / w) or less, about 3‰(w / w) or less, about 2‰(w / w) or less, about 1.5‰(w / w) or less, about 1‰(w / w) or less, about 0.5‰(w / w) or less, about 0.1‰(w / w) or less, about 0.01‰(w / w) or less, about 0.001‰(w / w) or less or less).

[0266] In another aspect, the application provides a one-step electroporation method, the method comprising electroporating an immune cell (e.g., a T cell) with a plasmid comprising a nucleic acid sequence encoding a CAR, a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, such that the immune cell comprises and / or expresses the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof (e.g., the coding sequences for the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof are knocked-in into the genome of the immune cell, and one or more endogenous genes in the genome of the immune cell are knocked out, e.g., the endogenous genes can include CD3, PD-1, CD95, TRBC, TRAC, AAVS1, or CCR5, etc.). The plasmid is extracted from a host cell, and the content of genomic DNA of the host cell contained in the plasmid is about 10% (w / w) or less (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less of the content of the plasmid DNA. (w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.3‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or less). For example, the position where the nucleic acid sequence is knocked in may not be the position of the gene that is desired to be knocked out.

[0267] In another aspect, the application provides a one-step electroporation method, the method comprising electroporating an immune cell (e.g., a T cell) with a plasmid comprising, sequentially, in 5' to 3' order, a nucleic acid sequence encoding a CAR, a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, such that the immune cell contains and / or expresses the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof (e.g., the coding sequences for the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof are knocked-in into the genome of the immune cell, and one or more endogenous genes in the immune cell genome are knocked-out), wherein the plasmid is a nucleic acid sequence encoding a host The content of the host cell genomic DNA extracted from the cells and contained in the plasmid is about 10% (w / w) or less (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less of the plasmid DNA content. ) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or less). For example, the position where the nucleic acid sequence is knocked in may not be the position of the gene that is desired to be knocked out.

[0268] In certain cases, the plasmid may further comprise a nucleic acid sequence encoding one or more other proteins (e.g., as described in other aspects of the present application), e.g., the one or more other proteins may comprise a multispecific antibody or antigen-binding fragment thereof (e.g., a BiTE).

[0269] In certain embodiments, the electroporation method of the present application is a one-step electroporation method, i.e., it completes the knock-in and / or knock-out of the exogenous gene in one electroporation transfection step. For example, the location where the nucleic acid sequence is knocked in may not be the location of the gene desired to be knocked out.

[0270] Host genomic DNA A host cell in this application can be any prokaryotic or eukaryotic cell, including transformable organisms, that can replicate a vector or express a heterologous gene encoded by a vector. In this application, the host cell is not or does not comprise an immune cell.

[0271] For example, the host may be a microbial host. For example, the host may be selected from the group consisting of one or more of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochetes. For example, the host may include gram-negative bacteria. For example, the host may include E. coli (e.g., competent E. coli cells).

[0272] In the present application, the genomic DNA of the host cell may not be included in the isolated nucleic acid molecule. In the present application, the genomic DNA content of the host cell can be measured by qPCR.

[0273] In the present application, the size of the genomic DNA of the host cell can be at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or more. For example, the size of the genomic DNA of the host cell can be at least about 10 kb. In the present application, the size of the genomic DNA derived from the host (e.g., microorganism) may be at least about 10 kb in size (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 50 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or more).

[0274] In the present application, the genomic DNA of the host cell may be derived from a microorganism, for example, the microorganism may be selected from the group consisting of one or more of bacteria, fungi, actinomycetes, mycoplasma, chlamydia, rickettsia, and spirochete.

[0275] In the present application, the microorganism may include a gram-negative bacterium. For example, the microorganism may be a microorganism suitable for preparing a backbone vector of a vector. For example, the microorganism may include Escherichia coli.

[0276] In the present application, the content of host cell genomic DNA having a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, or more) is about 10% (w / w) or less, about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less of the content of the isolated nucleic acid molecule (e.g., plasmid) of the present application derived from the host cell in the transfection composition. It can account for about 3(w / w)% or less, about 2.5(w / w)% or less, about 2(w / w)% or less, about 1.5(w / w)% or less, about 1(w / w)% or less, about 9(w / w)‰ or less, about 8(w / w)‰ or less, about 7(w / w)‰ or less, about 6(w / w)‰ or less, about 5(w / w)‰ or less, about 4(w / w)‰ or less, about 3(w / w)‰ or less, about 2(w / w)‰ or less, about 1(w / w)‰ or less, about 0.5‰(w / w) or less, about 0.3‰(w / w) or less, about 0.1(w / w)‰ or less, about 0.01(w / w)‰ or less, about 0.001(w / w)‰ or less or even less. For example, the content of host cell genomic DNA of a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or more) can account for less than about 2% of the plasmid content in the transfection composition, can account for less than about 5% of the plasmid content of the transfection composition, or can account for less than about 1% of the plasmid content of the transfection composition.

[0277] Transfection Transfection is a method of intentionally introducing nucleic acids into cells. In certain embodiments, the transfection is non-viral, meaning that the sequences used in the plasmid environment are non-viral and that the isolated nucleic acid molecule does not enter the cell via viral mechanisms. Transfection of animal cells usually involves creating a temporary hole or "hole" in the cell membrane to allow uptake of the material. Transfection can be performed using methods known in the art and described below.

[0278] In the present application, the transfection may include electroporation. For example, the transfection may include electroporating the cells to be modified. The electroporation may refer to cell electrofection or cell electroporation. Electroporation utilizes a powerful instantaneous battery to allow a charged substance to enter cells through a cell membrane with a certain permeability. The electroporation method can produce very little cytotoxicity. Compared with chemical transfection and / or viral transfection, the cytotoxicity produced by the electroporation method is significantly reduced. The electroporation method can be applied to almost all types of eukaryotic cells. The electroporation method can be used to transiently or stably express exogenous proteins.

[0279] In the present application, the transfection may include transfection of a transposon system, which may include, for example, the Sleeping Beauty transposon system or the PiggyBac (PB) transposon system.

[0280] In the present application, the transfection may include a transfected cell (e.g., a transfected or modified cell as described in the present application). In the present application, the cell may include a eukaryotic cell. The eukaryotic cell may be an animal cell. Here, the animal cell may include a mammalian cell (e.g., a human cell, e.g., an immune cell, e.g., a T cell, e.g., a human PBMC).

[0281] The present application may further include other transfection methods known in the art, such as chemical-based and non-chemical-based transfection methods. Chemical-based transfection methods may include methods such as calcium phosphate, dendrimers, lipofection, and cationic polymers (e.g., DEAE-dextrose or polyethyleneimine). Non-chemical methods may include cell squeezing, sonoporation, optical transfection, impalefection, and hydrodynamic delivery. Particle-based methods, such as transfection methods using a gene gun, magnetofection (i.e., magnetically assisted transfection), and particle bombardment, are also included.

[0282] In certain embodiments, electroporation is used to allow one or more isolated nucleic acid molecules to enter host cells. In this application, "electroporation" or "electroloading" generally refers to the application of an electric current or field to cells to allow isolated nucleic acid molecules to enter the cells. For example, flow electroporation can be performed using a flow electroporation device. In certain embodiments, electroporation can be employed.

[0283] In the methods of the present application, after transfection of cells by electroporation, transfection efficiencies of greater than about 35%, greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, or greater than about 90% (or any range derivable therein) can be achieved. Transfection efficiency can be measured by the percentage of cells expressing the gene product or the secretion level of the product expressed by the gene. During and after the electroporation process, cells maintain a high viability. Viability is typically greater than about 40% or more. The viability of the electroporated cells can be at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more of the viability of the starting non-electroporated cell population or the electroporated cell population transfected with a control construct.

[0284] Cell squeezing is a transfection method that delivers molecules into cells by gently squeezing the cell membrane. Cell squeezing is a high-throughput, vector-free microfluidic platform for intracellular delivery. Cell squeezing does not rely on exogenous materials or electric fields.

[0285] Sonoporation uses high-intensity ultrasound to induce the formation of holes in cell membranes, primarily through bubble cavitation and interaction with nearby cell membranes, which is enhanced by the addition of ultrasound contrast agents (a source of cavitation nuclei).

[0286] Optical transfection is a method that uses a highly focused laser to transiently create small (approximately 1 μm diameter) holes in the plasma membrane of cells. This technique treats cells one at a time, making it particularly suitable for single-cell analysis.

[0287] Chemical-based transfection can be classified into several types, such as cyclodextrin, polymer, liposome, or nanoparticle (with or without chemical or viral processes). For example, in the calcium phosphate method, a HEPES-buffered saline solution (HeBS) containing phosphate ions is combined with a calcium chloride solution containing the DNA to be transfected. When both are combined, a fine precipitate of positively charged calcium and negatively charged phosphate is formed, binding the transfected DNA to its surface. A suspension of the precipitate is then added to the cells to be transfected (usually a monolayer cell culture). The cells ingest part of the precipitate and the accompanying DNA. Other methods use highly branched organic compounds (so-called dendrimers) to bind to DNA and enter cells. A highly effective method is to encapsulate the transfected DNA in liposomes, small membrane-enclosed objects that in some morphologies resemble the structure of cells and can actually fuse with the cell membrane to release the DNA into the cell. In the case of eukaryotic cells, transfection is more appropriately achieved using cationic liposomes (or mixtures) since the cells are more sensitive to them. Another method is to use cationic polymers such as DEAE-dextrose or polyethyleneimine. The negatively charged DNA binds to the polycations, and the complex is taken up by the cell by endocytosis.

[0288] In certain embodiments, a direct transfection method is the use of a gene gun, where DNA is coupled to nanoparticles of an inert solid (usually gold), which are then "fired" directly into the nucleus of the target cell.

[0289] Magnetofection, or magnetically assisted transfection, is a transfection method that utilizes magnetic forces to deliver DNA to target cells. First, nucleic acids are attached to magnetic nanoparticles. Then, magnetic forces are applied to direct the nucleic acid-particle complexes to target cells, where they release their payload. Imparefection is performed by piercing cells with long nanostructures and arrays of such nanostructures, such as carbon nanofibers or silicon nanowires functionalized with plasmid DNA.

[0290] Another particle-based transfection method is called particle bombardment, which typically involves the rapid delivery of nucleic acids linked to microemitters through a membrane.

[0291] In the present application, the transfection may include stable transfection. For example, the transfection may enable the transfected cell to stably express an exogenous protein encoded by an exogenous gene (e.g., an isolated nucleic acid molecule of the present application). For example, the transfection may enable the exogenous gene to be integrated into the genome of the transfected cell (e.g., an immune cell such as a T cell). In the present application, the integration may occur at a specific location within the genome.

[0292] Transfected or modified cells In this application, the terms "cell," "cell line," and "cell culture" are used interchangeably. All of these terms further include freshly isolated cells and cells that have been cultured, activated, or expanded in vitro. All of these terms also include their progeny, i.e., all descendants and all progeny. It is understood that individual progeny cells may not be identical due to deliberate or inadvertent mutations.

[0293] In the present application, the cell to be modified or transfected can be a eukaryotic cell, such as an animal cell. For example, the cell can be a mammalian cell. For example, the cell can be a human cell.

[0294] In the present invention, the cells may preferably be immune effector cells. For example, the cells may be T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells. For example, the cells may be peripheral blood lymphocytes.

[0295] For example, the cells can be primary cells. For example, the cells can include allogeneic cells and / or autologous cells from the subject. For example, in certain cases, the cells are autologous cells from the subject. For example, in certain cases, the cells are allogeneic cells from another donor. For example, the cell can be an activated cell. For example, the activation can include contacting the cell to be modified with an activating composition. For example, the cells can include immune cells (e.g., immune effector cells, e.g., T cells or NK cells, e.g., PBMCs, e.g., primary or autologous T cells or NK cells, e.g., primary or autologous PBMCs), and the activating composition can include anti-CD3 and / or anti-CD28 antibodies (e.g., the antibodies can be provided on magnetic beads).

[0296] Reagents or kits for activating T cells are also commercially available. An exemplary kit includes anti-biotin particles (e.g., MACSiBeads or Dynabeads) and biotinylated antibodies against human CD2, CD3, and CD28. The anti-biotin particles loaded with biotinylated antibodies mimic antigen-presenting cells and are used to activate resting T cells and purified T cells derived from PBMCs. T cell proliferation is achieved by culture and reactivation on day 14 of culture. For example, T cells can also be activated with mitogens (e.g., ConA, PHA, and PWM).

[0297] For example, the activation can include contacting the cells to be modified with the activation composition for about 4 days or less (e.g., about 96 hours or less, about 90 hours or less, about 85 hours or less, about 80 hours or less, about 75 hours or less, about 72 hours or less, about 70 hours or less, about 65 hours or less, about 60 hours or less, about 55 hours or less, about 50 hours or less, about 48 hours or less, about 45 hours or less, about 40 hours or less, about 36 hours or less, about 30 hours or less, about 24 hours or less, about 20 hours or less, about 15 hours or less, about 12 hours or less, about 8 hours or less, or less). For example, the activation can include contacting the cells to be modified with the activation composition for about 10 hours to about 48 hours (e.g., about 12 hours to about 24 hours). For example, the method can include performing the transfection while contacting the cells to be transfected with the activation composition for about 2 days or less.

[0298] In certain embodiments, transfection can be performed on any prokaryotic or eukaryotic cell. In some aspects, electroporation involves the transfection of human cells. In other aspects, electroporation involves the transfection of animal cells. In certain aspects, transfection involves the transfection of cell lines or hybrid cell types. In some aspects, the transfected cells are cancer cells, tumor cells, or immortalized cells. In some situations, tumors, cancers, immortalized cells, or cell lines are induced, while in other situations, tumors, cancers, immortalized cells, or cell lines naturally enter the respective state or condition. In certain embodiments, the cell or cell line is A549, B cell, B16, BHK-21, C2C12, C6, CaCo-2, CAP / , CAP-T, CHO, CHO2, CHO-DG44, CHO-K1, COS-1, Cos-7, CV-1, dendritic cell, DLD-1, Embryonic Stem, ES) cells or derivatives, H1299, HEK, 293, 293T, 293FT, Hep G2, hematopoietic stem cells, HOS, Huh-7, induced pluripotent stem cells cell, iPSC) or its derivative, Jurkat, K562, L5278Y, LNCaP, MCF7, MDA-MB-231, MDCK, mesenchymal cell, Min-6, mononuclear cell, Neuro2a, NIH The cells may be 3T3, NIH3T3L1, K562, NK cells, NS0, Panc-1, PC12, PC-3, peripheral blood cells, plasma cells, primary fibroblasts, RBL, Renca, RLE, SF21, SF9, SH-SY5Y, SK-MES-1, SK-N-SH, SL3, SW403, Stimulus-triggered Acquisition of Pluripotency (STAP) cells or their derivatives SW403, T cells, THP-1, tumor cells, U2OS, U937, peripheral blood lymphocytes, expanded T cells, hematopoietic stem cells, or Vero cells. In some specific embodiments, the cells are peripheral blood lymphocytes, expanded T cells, natural killer cells (NK cells), stem cells, hematopoietic stem cells, or primary cells. In certain specific embodiments, the cells are hematopoietic stem cells.In some other specific embodiments, the cells are peripheral blood lymphocytes and / or peripheral blood mononuclear cells (PBMCs).

[0299] In certain embodiments, the cell is a difficult-to-transfect cell known in the art. Such cells are known in the art and include, for example, primary cells, insect cells, SF9 cells, Jurkat cells, CHO cells, stem cells, slowly dividing cells, T cells, and non-dividing cells. In some embodiments, the cell is a T cell. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell, including myeloid and lymphoid progenitor cells. In some embodiments, the cell is a mesenchymal stem cell. In some embodiments, the cell is a germ cell, such as an egg cell or a sperm cell.

[0300] In some embodiments, cells can be cultured before or after transfection. For example, cells can be cultured after transfection for a selection stage, for maintenance and clonal selection and initial expansion stages, for screening stages, and / or for large-scale production stages. Methods for culturing suspension and adherent cells are known to those skilled in the art. In some embodiments, cells can be cultured using commercially available cell culture vessels and cell culture media. In the present application, the stem cells may include hematopoietic stem cells and / or mesenchymal stem cells. The hematopoietic stem cells can differentiate into blood cells (e.g., blood cells of the myeloid lineage and blood cells of the lymphoid lineage). The hematopoietic stem cells may be characterized by pluripotency and self-renewal. The hematopoietic stem cells can be differentiated into cells selected from the group consisting of monocytes, macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes, platelets, T cells, B cells, and NK cells.

[0301] The mesenchymal stem cells are adult stem cells derived from the mesoderm in the early stages of embryonic development, possessing self-renewal, pluripotent differentiation potential, and capable of maintaining their biological characteristics even after extensive in vitro proliferation. The mesenchymal stem cells can express HLA-I class antigens. The mesenchymal stem cells may not express or may express low levels of HLA-II class antigens. The mesenchymal stem cells can differentiate into adipocytes, osteoblasts, and chondrocytes, and can also support the differentiation of hematopoietic stem cells into granulocytes, macrophages, and megakaryocytes. The mesenchymal stem cells can secrete cytokines, such as CSF-1, GM-CSF, G-CSF, IL-6, c-kit ligand, and / or IL-3.

[0302] In the present application, the immune cells may include immune effector cells. For example, the immune effector cells may include lymphocytes (e.g., cytotoxic T cells, memory T cells), macrophages, dendritic cells, and NK cells. For example, the immune cells may be selected from the group consisting of T lymphocytes (e.g., activated or non-activated T lymphocytes), B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and mast cells.

[0303] Transfection Composition In the present application, the transfection composition may include the isolated nucleic acid molecule (e.g., a plasmid). For example, the plasmid may be a circular plasmid, a supercoiled plasmid, or a linear plasmid. In the present application, the plasmid (e.g., a linear plasmid) is treated (e.g., with a deoxyribonuclease, e.g., an exonuclease, e.g., Exonuclease V) so that the content of host genomic DNA of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, or more) in size meets the conditions described herein. In the present application, the treatment may not affect the structure or function of the isolated nucleic acid molecule of the present application having a circular structure.

[0304] For example, the transfection compositions described herein can be substantially or completely free of any viral vectors, e.g., containing less than about 2% (w / w), less than about 1% (w / w), less than about 0.9% (w / w), less than about 0.8% (w / w), less than about 0.7% (w / w), less than about 0.6% (w / w), less than about 0.5% (w / w), less than about 0.4% (w / w), less than about 0.3% (w / w), less than about 0.2% (w / w), less than about 0.1% (w / w) or less.

[0305] In the present application, the plasmid may be a DNA plasmid. For example, the DNA plasmid may be a double-stranded, closed circular DNA molecule. For example, the DNA plasmid may be a double-stranded, linear DNA molecule.

[0306] In the present application, the host's genomic DNA (e.g., a size of at least about 10 kb, e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about The host genomic DNA can be present in the transfection composition as an episome (e.g., at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb, or more), and the plasmid can be present on different nucleic acid molecules. For example, the host genomic DNA can be present as an episome in the transfection composition. For example, the host genomic DNA can be episomal from the plasmid. The episome can be present in a form that is separate and not linked to the plasmid.

[0307] In the present application, the concentration of the isolated nucleic acid molecule (e.g., the plasmid) in the transfection composition is about 5 μg / mL to about 3000 μg / mL (e.g., about 5 μg / mL to about 2500 μg / mL, about 10 μg / mL to about 2000 μg / mL, about 10 μg / mL to about 1500 μg / mL, about 5 μg / mL to about 1000 μg / mL, about 10 μg / mL to about 1200 μg / mL). / mL, about 8μg / mL to about 1000μg / mL, about 15μg / mL to about 950μg / mL, about 20μg / mL to about 900μg / mL, about 30μg / mL to about 900μg / mL, about 40μg / m L ~ approx. 950 μg / mL, approx. 50 μg / mL ~ approx. 950 μg / mL, approx. 60 μg / mL ~ approx. 950 μg / mL, approx. 70 μg / mL ~ approx. 950 μg / mL, approx. 80 μg / mL ~ approx. 950 μg / mL , about 90μg / mL to about 950μg / mL, about 100μg / mL to about 950μg / mL, about 110μg / mL to about 950μg / mL, about 120μg / mL to about 950μg / mL, about 130μg / mL ~ approx. 950 μg / mL, approx. 140 μg / mL ~ approx. 950 μg / mL, approx. 150 μg / mL ~ approx. 950 μg / mL, approx. 180 μg / mL ~ approx. 950 μg / mL, approx. 200 μg / mL ~ approx. 95 The transfection composition may have a concentration of about 0 μg / mL, about 200 μg / mL to about 850 μg / mL, about 200 μg / mL to about 800 μg / mL, about 250 μg / mL to about 850 μg / mL, about 300 μg / mL to about 750 μg / mL, about 350 μg / mL to about 700 μg / mL, about 400 μg / mL to about 650 μg / mL, about 450 μg / mL to about 600 μg / mL, about 500 μg / mL to about 550 μg / mL, etc. In a specific embodiment of the transfection composition, the concentration of the isolated nucleic acid molecule (e.g., the plasmid) is about 200 μg / mL to about 800 μg / mL.

[0308] In another aspect, the present application provides a transfection composition prepared using the methods described herein.

[0309] In the present application, the transfection composition can significantly improve transfection efficiency, particularly the transfection efficiency of the nucleic acid molecule of the present invention in immune cells. The transfection composition can significantly reduce cytotoxicity caused by transfection. The transfection composition can be directly used for cell transfection. The method described in the present application can be used as a quality control method for preparing and / or testing the transfection composition.

[0310] Nucleic acid molecule optimization For example, the method can include treating an isolated nucleic acid molecule (eg, a plasmid) from the host cell to reduce the content of genomic DNA of the host cell.

[0311] For example, the treatment may include contacting the isolated nucleic acid molecule (e.g., a plasmid) from the host cell with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. For example, the DNase may be capable of nonspecifically cleaving linear DNA. For example, the DNase may include an exonuclease. For example, the treatment may include contacting the isolated nucleic acid molecule (e.g., a plasmid) from the host cell with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. 2+ and Ca 2+ contacting an isolated nucleic acid molecule (e.g., a plasmid) from the host cell with the reagent in the presence of

[0312] The method of the present application may include a step of reducing the content of host genomic DNA in the transfection composition. In the present application, the reduction may refer to reducing the content of host genomic DNA in the transfection composition so as to meet the requirements of the method of the present application.

[0313] In the present application, the reduction may include purifying the isolated nucleic acid molecule. That is, the purification may reduce the content of host cell-derived genomic DNA in the isolated nucleic acid molecule (e.g., a plasmid) to meet the requirements of the method described in the present application. In the present application, the purification may remove host genomic DNA of a size of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, or more) and / or remove genomic DNA derived from the host (e.g., a microorganism). For example, the purification may include reducing the content of host cell genomic DNA in the isolated nucleic acid molecule (e.g., a plasmid) using a DNA purification method well known to those skilled in the art. In the present application, the purification may not affect the DNA integrity and / or activity of the isolated nucleic acid molecule (e.g., a plasmid). In the present application, the reduction may include purifying the isolated nucleic acid molecule (e.g., a plasmid) using a reagent selected from the group consisting of DNase, SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. For example, the reduction may use DNase. For example, the DNase may not affect the integrity and / or activity of the DNA of the circular plasmid.

[0314] In the present application, the DNase is capable of cleaving double-stranded DNA, for example, the DNase is capable of non-specifically cleaving linear DNA.

[0315] In the present application, the DNase can cleave linear (e.g., double-stranded linear) DNA (e.g., non-specifically). For example, the DNase may not affect the structure and / or activity of the plasmid (e.g., a circular plasmid). In the present application, the DNase may include a deoxyribonuclease. In the present application, the DNase may include a DNA exonuclease. In the present application, the DNase may include Exonuclease V. In the present application, the DNase may include an ATP-dependent DNase, such as Plasmid-Safe™ ATP-dependent DNase.

[0316] For example, the method described herein may include contacting the DNase with a plasmid (or isolated nucleic acid molecule) described herein. In the present application, the contacting may include contacting in the presence of a buffer (e.g., the buffer may be a buffer in a kit sold together with the DNase). In the present application, the buffer may contain Mg 2+ and Ca 2+ For example, the buffer may contain Mg without any other cations. 2+ and Ca 2+ The buffer solution can improve the enzymatic cleavage efficiency of the DNase.

[0317] In the methods of the present application, the DNase treatment may comprise a step of purifying the contacted plasmid or isolated nucleic acid molecule.

[0318] After the DNase treatment, the content of host genomic DNA in the isolated nucleic acid molecule (or vector such as a plasmid) that is at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or more) can be about 10% or less of the total content of the isolated nucleic acid molecule (or vector such as a plasmid).

[0319] In the present application, the contacting may further include contacting with an RNase.

[0320] In this application, a nuclease or DNase is an enzyme that hydrolyzes nucleic acids. For example, the DNase may be an exonuclease. An exonuclease is any of a group of enzymes that catalyze the hydrolysis of a single nucleotide from the end of a DNA or RNA strand. Nucleases can also be classified according to whether they specifically digest DNA or RNA. Nucleases that specifically catalyze the hydrolysis of DNA can be called deoxyribonucleases or DNases, while nucleases that specifically catalyze the hydrolysis of RNA can be called ribonucleases or RNases. Some nucleases are specific for single-stranded or double-stranded nucleic acid sequences. Some enzymes have both exonuclease and endonuclease properties. Furthermore, some enzymes can digest both DNA and RNA sequences.

[0321] Optimal reaction conditions vary for different nucleases. Factors to consider include temperature, pH, enzyme cofactors, salt composition, ionic strength, and stabilizers. Commercially available nuclease suppliers (e.g., Promega Corp., New England Biolabs, Inc.) provide information on the optimal conditions for various enzymes. When measuring incubation temperature, most nucleases are used between pH 7.2 and pH 8.5. Furthermore, most nucleases exhibit maximal activity at 37°C; however, a few enzymes require higher or lower temperatures to achieve optimal activity (e.g., Taq I, 65°C; Sma I, 25°C). DNA concentration is also a factor; high DNA concentrations can reduce enzyme activity, while dilute DNA concentrations can be below the enzyme's Km and affect enzyme activity. Non-limiting examples of nucleases include DNase I, Benzonase, Exonuclease I, Exonuclease III, Mung Bean Nuclease, Nuclease BAL 31, RNase I, S1 Nuclease, Lambda Exonuclease, RecJ, and T7 Exonuclease. DNase I is an endonuclease that nonspecifically cleaves DNA to release dinucleotide, trinucleotide, and oligonucleotide products with 5'-phosphorylated and 3'-hydroxylated ends. DNase I acts on single- and double-stranded DNA, chromatin, and RNA:DNA hybrids. Exonuclease I catalyzes the removal of nucleotides from single-stranded DNA in a 3' to 5' direction. Exonuclease III catalyzes the stepwise removal of single nucleotides from the 3'-hydroxy end of double-stranded DNA. Exonuclease III also acts at breaks in double-stranded DNA, creating single-stranded gaps. Single-stranded DNA is resistant to exonuclease III. Mung bean nuclease degrades single-stranded extensions from DNA ends. Mung bean nuclease is also an RNA endonuclease. Nuclease BAL 31 degrades both the 3' and 5' ends of double-stranded DNA.Nuclease BAL 31 is also a highly specific single-stranded endonuclease that cleaves breaks, gaps, and single-stranded regions of double-stranded DNA and RNA. RNase I is a single-strand-specific RNA endonuclease that cleaves all RNA dinucleotides. S1 nuclease degrades single-stranded DNA and RNA by endonucleases, generating 5'-phosphoryl-terminated products. Double-stranded nucleic acids (DNA:DNA, DNA:RNA, or RNA:RNA) are resistant to degradation by S1 nuclease except at very high enzyme concentrations. λ exonuclease catalyzes the removal of 5' mononucleotides from double-stranded DNA. Its preferred substrate is 5'-phosphorylated double-stranded DNA, but λ exonuclease also degrades single-stranded and unphosphorylated substrates at a significantly reduced rate. Lambda exonuclease cannot initiate DNA digestion at the site of a break or gap, and RecJ is a single-stranded DNA-specific exonuclease that catalyzes the removal of deoxynucleotide monophosphates from DNA in the 5' to 3' direction. T7 exonuclease catalyzes the removal of 5' single nucleotides from double-stranded DNA. T7 exonuclease catalyzes the removal of nucleotides from the 5' end or from breaks and gaps in double-stranded DNA.

[0322] Gene editing system In the present application, the transfection composition may further comprise a gene editing system that enables the isolated nucleic acid molecule to be integrated into a specific location in the genome of the cell (e.g., an immune cell such as a T cell). For example, the gene editing system may comprise a site-specific enzyme (also called a localized nuclease) or an isolated nucleic acid molecule encoding it (e.g., a DNA molecule or RNA molecule, such as an mRNA encoding the enzyme). For example, the site-specific enzyme is selected from a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a transposase, an integrase, and a Cas protein. For example, the Cas protein is a Cas9 protein. For example, the gene editing system may further comprise one or more guide RNAs. For example, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome.

[0323] For example, the gene editing system may further comprise one or more guide RNAs that target the gene or genes to be knocked out.

[0324] In the methods and compositions of the present application, the site-specific enzyme can be provided in the form of a protein or a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule). The site-specific enzyme and the guide RNA can be provided simultaneously (e.g., in the same molecule, complex, or composition), or separately (e.g., in different molecules or compositions).

[0325] For example, the gene editing system can include a ribonucleoprotein complex RNP, and the RNP includes the Cas protein and the guide RNA.

[0326] For example, the gene editing system and method may be any known system and method for those skilled in the art, as long as it can achieve the purpose of gene editing, and is not limited to a specific method. In the present application, the gene editing method may be selected from the group consisting of one or more of the CRISPR / Cas system, the RNA editing system ADAR, RNA-guided endonucleases, zinc finger proteases, Mega-TAL nucleases, TALENs, and Meganucleases. For example, the gene editing method may use the CRISPR / Cas system.

[0327] In the present application, the gene editing may include gene editing knockout and / or gene editing knockin. For example, the gene editing may include gene editing knockin. For example, the gene editing knockin can be performed using a CRISPR / Cas system.

[0328] For example, the CRISPR / Cas system may include a class of clustered regularly interspaced short palindromic repeats (CRISPRs) and several functionally related proteins (CRISPR-associated, Cas). Here, genes encoding the Cas proteins may include Cas9, Cas1, Cas2, and Csn2. For example, the Cas protein may be Cas9. The CRISPR / Cas system (e.g., a CRISPR / Cas9 system) may have cleavage specificity for targeting DNA molecules.

[0329] For example, the gene editing knock-in is a process of inserting a DNA sequence by targeting a Cas protein to a specific DNA sequence in a cell. The gene editing knock-in can be a process mediated by a Cas protein (e.g., a Cas9 protein) to cause homologous recombination between the exogenous gene to be knocked in the donor plasmid and the specific DNA sequence in the cell that it targets.

[0330] In the present application, the isolated nucleic acid molecule (e.g., a plasmid) can be used as a donor plasmid in the gene editing knock-in. For example, the donor plasmid can be double-stranded DNA or single-stranded DNA. The donor plasmid serves as a donor template for the HDR repair mechanism.

[0331] The site-specific enzymes of the present application can cleave bonds (i.e., phosphodiester bonds) between specific nucleotide subunits in a nucleic acid sequence. In specific embodiments, the site-specific enzyme is encoded on RNA. In other embodiments, the site-specific enzyme is a protein, enzyme, or small molecule mimetic having enzymatic activity. In some embodiments, the site-specific enzyme is encoded on DNA. In specific embodiments, the site-specific enzyme is encoded on plasmid DNA. In some embodiments, the site-specific enzyme and donor DNA are encoded on the same plasmid.

[0332] In one embodiment, the site-specific enzyme is a transposase. The transposase may be a Sleeping Beauty transposase. In certain cases, the transposase may be a PiggyBac (PB) transposase.

[0333] For example, synthetic DNA transposons (e.g., the "Sleeping Beauty" transposon system) designed to introduce precisely defined DNA sequences into vertebrate chromosomes can be used. The Sleeping Beauty transposon system consists of Sleeping Beauty (SB) transposase and a transposon designed to insert a specific DNA sequence into a vertebrate genome. DNA transposons move from one DNA site to another in a simple cut-and-paste fashion. Transposition is a precise process in which a defined DNA fragment is excised from one DNA molecule and moved to another site within the same or a different DNA molecule or genome. The SB transposase inserts the transposon into the TA dinucleotide base pair of the recipient DNA sequence. The insertion site can be elsewhere on the same DNA molecule or on another DNA molecule (or chromosome). There are approximately 200 million TA sites in the mammalian (including human) genome. The TA insertion site is duplicated during the transposon integration process. Duplication of the TA sequence is a marker of transposition and is used in some experiments to determine the mechanism. The transposase can be encoded within the transposon, or it can be provided from another source, in which case the transposon becomes a non-autonomous element. Non-autonomous transposons are the most useful genetic tools because they cannot continue to independently excise and reinsert after insertion. All DNA transposons identified in the human genome and other mammalian genomes are non-autonomous because they contain transposase genes, but these genes are non-functional and cannot produce the transposase that can mobilize the transposon.

[0334] In the present application, the transposon system may include a transposon. The transposon may include an isolated nucleic acid molecule that can be integrated into a nucleic acid by a transposase. The transposon may include two transposon ends (also called "arms") connected by a sequence of sufficient length to form a loop in the presence of the transposase. The transposon may be double-stranded, single-stranded, or a mixed type containing both single-stranded and double-stranded regions, depending on the transposase used to insert the transposon. The transposase may include Mu, Tn3, Tn5, Tn7, and / or Tn10. The ends of the transposon may be double-stranded. In the present application, the transposon can be inserted into double-stranded DNA through a transposition event. In the present application, the transposon can be considered the exogenous gene. The plasmid may include the transposon. The plasmid may further include an isolated nucleic acid molecule required for a transposition event. For example, the transposon system may include the Sleeping Beauty transposon system, which is a member of the Tc1 / mariner transposon superfamily. For example, the transposon system may include the PiggyBac transposon system.

[0335] In another embodiment, the site-specific enzyme is an integrase. For example, phiC31 integrase is a sequence-specific recombinase encoded within the genome of the bacteriophage phiC31. phiC31 integrase mediates recombination between two 34-base pair sequences called attachment sites (att), one obtained from a bacteriophage and the other from a bacterial host. This serine integrase has been shown to function efficiently in many different cell types, including mammalian cells. In the presence of phiC31 integrase, an attB-containing donor plasmid can be directionally integrated into a target genome by recombination at a site with a sequence similar to the natural attP site (called a pseudo-attP site). phiC31 integrase can integrate plasmids of any size as a single copy and does not require cofactors. The integrated transgene can be stably expressed and inherited.

[0336] In one embodiment, the localized nuclease is a Cas nuclease. In a related embodiment, the Cas nuclease is Cas9. In another embodiment, the nuclease is Cas9 and the composition further comprises a guide RNA. Another example of a sequence-specific nuclease system that can be used with the methods and compositions described herein includes the Cas9 / CRISPR system (Wiedenheft, B. et al., Nature 482, 331-338 (2012); Jinek, M. et al., Science 337, 816-821 (2012); Mali, P. et al., Science 339, 823-826 (2013); Cong, L. et al., Science 339, 819-823 (2013)). The Cas9 / CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) system utilizes RNA-guided DNA binding and sequence-specific cleavage of target DNA. The guide RNA / Cas9 combination confers site specificity to the nuclease. The guide RNA (gRNA) contains approximately 20 nucleotides complementary to the target genomic DNA sequence, which is upstream of a genomic PAM (protospacer adjacent motif) site (NNG) and a constant RNA scaffold. The Cas (CRISPR-associated) 9 protein binds to the gRNA and the target DNA bound to the gRNA and introduces a double-strand break at a defined location upstream of the PAM site. Cas9 has two independent nuclease domains homologous to HNH endonuclease and RuvC endonuclease, and by mutating either of the two domains, the Cas9 protein can be transformed into a nickase that introduces single-strand breaks (Cong, L. et al., Science 339, 819-823 (2013)). It is specifically contemplated that the methods and compositions of the present invention can be used with single- or double-stranded inducible forms of Cas9, as well as other RNA-guided DNA nucleases (e.g., Cas9-like systems from other bacteria).

[0337] The site-specific nucleases of the methods and compositions described herein can be engineered, chimerized, or isolated from an organism. The sequence-specific nuclease can be introduced into a cell in the form of RNA (e.g., mRNA) encoding the sequence-specific nuclease.

[0338] In one embodiment, the site-specific enzyme is a site-specific nuclease, such as a zinc finger nuclease. Zinc finger nucleases typically contain a DNA-binding domain (i.e., zinc finger) and a cleavage domain (i.e., nuclease). The zinc finger binding domain can be engineered to recognize and bind to any selected nucleic acid sequence. Compared to naturally occurring zinc finger proteins, engineered zinc finger binding domains can have new binding specificities. Engineering methods include, but are not limited to, rational design and various types of selection. In some embodiments, zinc finger nucleases contain a nuclear localization signal or sequence (NLSS). L The zinc finger nuclease may further comprise a cleavage domain (S). The NLS is an amino acid sequence that is advantageous for targeting the zinc finger nuclease protein to the nucleus and introducing a double-strand break at the target sequence in the chromosome. Nuclear localization signals are known in the art. See, for example, Makkerh et al. (1996) Current Biology 6:1025-1027. The zinc finger nuclease may further comprise a cleavage domain. The cleavage domain portion of the zinc finger nuclease can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which the cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases.

[0339] In another embodiment, the endonuclease can be a meganuclease. Meganucleases are endodeoxyribonucleases characterized by large recognition sites, i.e., the recognition site is typically about 12 to about 40 base pairs. As a result of this requirement, the recognition site typically occurs only once within any particular genome. Naturally occurring meganucleases recognize cleavage sites of 15 to 40 base pairs and are typically classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family, and the HNH family. Meganucleases can be targeted to specific chromosomal sequences by modifying their recognition sequences using techniques well known to those skilled in the art.

[0340] In another embodiment, the targeting endonuclease can be a transcription activator-like effector (TALE) nuclease. TALEs are transcription factors from the plant pathogen Xanthomonas that can be easily modified to bind to new DNA targets. TALEs, or truncated forms thereof, can be linked to the catalytic domain of an endonuclease (e.g., Fok1) to generate a targeting endonuclease called a TALE nuclease or TALEN.

[0341] In another embodiment, the nuclease can be a homing nuclease. Homing endonucleases include I-5'cel, I-Ceul, I-Pspl, Vl-Sce, I-SceTV, I-Csml, I-Panl, I-Scell, I-Ppol, I-Scellll, I-Crel, I-Tevl, I-Tev, and I-7evIII. Their recognition sequences are known. See U.S. Patent No. 5,420,032 and U.S. Patent No. 6,833,252.

[0342] In certain embodiments, the site-specific enzyme comprises an engineered (non-naturally occurring) homing endonuclease (meganuclease). Identification sequences for homing endonucleases and meganucleases (e.g., l-Scel, l-Ceul, VI-Pspl, Vl-Sce, l-ScelN, l-Csml, l-Panl, l-Scell, l-Ppol, l-Scellll, l-Crel, l-Tevl, l-Tevll, and I-7evIII) are known. See U.S. Patent No. 5,420,032 and U.S. Patent No. 6,833,252. Furthermore, the DNA binding specificity of homing endonucleases and meganucleases can be engineered to bind to non-natural target sites. See, e.g., U.S. Patent Publication No. 20070117128. The DNA binding domain of homing endonucleases and meganucleases can be modified in the context of the entire nuclease (ie, the nuclease comprises a homologous cleavage domain) or can be fused to a heterologous cleavage domain.

[0343] In one embodiment, the site-specific enzyme is selected from the group consisting of omega, zinc finger, TALE and CRISPR / Cas9, or is a site-specific nuclease selected from the group.

[0344] Transfected cells or cell populations In another aspect, the present application provides a cell (e.g., an immune cell) or cell population prepared by the methods described herein.

[0345] In another aspect, the present application provides modified cells (e.g., immune cells) that can include an isolated nucleic acid molecule described herein or a vector described herein.

[0346] In another aspect, the present application provides a cell population, which can comprise a cell described herein and / or its progeny.

[0347] For example, the isolated nucleic acid molecule can be integrated into the genome of the cell (eg, an immune cell).

[0348] For example, the isolated nucleic acid molecule can be integrated into a target gene in the genome of the cell (e.g., an immune cell). For example, the isolated nucleic acid molecule can be expressed under the control of the endogenous regulatory sequence of the target gene. The target gene can be selected from TRBC, TRAC, PD-1, AAVS1, and CCR5.

[0349] The cells may include immune cells such as immune effector cells. For example, the immune cells may include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells. For example, the immune cells may include peripheral blood lymphocytes.

[0350] For example, the cells can be primary cells. For example, the cells can include allogeneic cells and / or autologous cells from the subject. For example, in certain cases, the cells are allogeneic cells from another donor. For example, in certain cases, the cells are autologous cells from the subject. For example, in certain cases, the cells include autologous cells from the subject and allogeneic cells from another donor.

[0351] For example, the cell can be an activated cell. In certain embodiments, the cell comprises an activatable immune cell (e.g., a T cell), and the activation can include contacting the cell with an activating composition. For example, the activating composition may include anti-CD3 and / or anti-CD28 antibodies.

[0352] In certain embodiments, the activation may include contacting the modified immune cells with the activation composition for up to about four days.

[0353] In certain cases, the cells of the present application are isolated cells.

[0354] For example, the present application provides cells and / or cell lines prepared by the methods described herein.

[0355] In the present application, the cells and / or cell lines may exhibit significantly improved transfection positivity rates (e.g., may exhibit significantly improved gene editing knock-in positivity rates (e.g., improved positivity rates of CAR, antibody, cytokine, and / or chemokine knock-in upon activation of target cells), significantly improved DNA homologous recombination efficiency, and / or significantly improved cell viability). The cell lines described in the present application may maintain the ability to exhibit significantly improved transfection positivity rates during a multi-generational expansion process (e.g., passaged for at least about 5 generations, at least about 10 generations, at least about 15 generations, at least about 20 generations, or more).

[0356] In some embodiments, the transfection positivity rate is greater than about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%. The positivity rates of the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof can be measured by determining the number of modified cells and dividing by the total number of cells. For example, the integration of exogenous genes in cellular genomic DNA can be determined by methods known in the art, such as direct genomic DNA sequencing, differential restriction digestion (when the gene editing is the addition, deletion, or modification of a restriction enzyme site), gel electrophoresis, array capillary electrophoresis, MALDI-TOF MS, dynamic allele-specific hybridization, molecular beacons, restriction fragment length polymorphism, primer extension, temperature gradient gel electrophoresis, etc.

[0357] In certain embodiments, the cells (e.g., immune cells such as T cells) can express appropriate amounts of the IL-15 (or functionally active fragment thereof) and the IL-21 (or functionally active fragment thereof). For example, the expression levels of the IL-15 (or functionally active fragment thereof) and the IL-21 (or functionally active fragment thereof) are not so high as to raise safety concerns related to cytokine expression. Furthermore, the expression levels of the IL-15 (or functionally active fragment thereof) and the IL-21 (or functionally active fragment thereof) are not too low to produce a therapeutic effect.

[0358] For example, the cells (e.g., immune cells such as T cells) or cell populations described in the present application can express the IL-15 or a functionally active fragment thereof at a concentration of about 4 pg / mL to about 100 pg / mL (e.g., about 5 pg / mL to about 90 pg / mL, about 5 pg / mL to about 80 pg / mL, about 5 pg / mL to about 70 pg / mL, about 5 pg / mL to about 60 pg / mL, about 5 pg / mL to about 50 pg / mL, about 6 pg / mL to about 50 pg / mL, about 7 pg / mL to about 45 pg / mL, about 8 pg / mL to about 40 pg / mL, about 9 pg / mL to about 35 pg / mL, about 10 pg / mL to about 30 pg / mL, about 15 pg / mL to about 25 pg / mL, or about 20 pg / mL to about 60 pg / mL) or more. For example, 1×10 6 / mL ~ 2 × 10 6 The cells described in the present application, after culturing for about 2 to 4 days (e.g., about 3 days), have a concentration of about 4 pg / mL to about 100 pg / mL (e.g., about 5 pg / mL to about 90 pg / mL, about 5 pg / mL to about 80 pg / mL, about 5 pg / mL to about 70 pg / mL, about 5 pg / mL to about 60 pg / mL, about 5 pg / mL to about 50 pg / mL, about 6 pg / mL to about 50 pg / mL, The IL-15 or a functionally active fragment thereof can be expressed in an amount of about 10 pg / mL, about 7 pg / mL to about 45 pg / mL, about 8 pg / mL to about 40 pg / mL, about 9 pg / mL to about 35 pg / mL, about 10 pg / mL to about 30 pg / mL, about 15 pg / mL to about 25 pg / mL, or about 20 pg / mL to about 60 pg / mL) or more.

[0359] For example, the cells (e.g., immune cells such as T cells) or cell populations described in the present application may have a concentration of about 4 pg / mL to about 300 pg / mL (e.g., about 5 pg / mL to about 290 pg / mL, about 5 pg / mL to about 280 pg / mL, about 5 pg / mL to about 270 pg / mL, about 5 pg / mL to about 260 pg / mL, about 5 pg / mL to about 250 pg / mL, about 6 pg / mL to about 250 pg / mL, about 7 pg / mL to about 300 pg / mL). pg / mL ~ approx. 245 pg / mL, approx. 8 pg / mL ~ approx. 240 pg / mL, approx. 9 pg / mL ~ approx. 235 pg / mL, approx. 10 pg / mL ~ approx. 230 pg / mL, approx. 15 pg / mL ~ approx. 225 pg / mL, about 20 pg / mL to about 220 pg / mL, about 20 pg / mL to about 210 pg / mL, about 20 pg / mL to about 200 pg / mL, about 20 pg / mL to about 180 pg / mL, about 2 0pg / mL to about 170pg / mL, about 20pg / mL to about 160pg / mL, about 20pg / mL to about 150pg / mL, about 20pg / mL to about 140pg / mL, about 20pg / mL to about 130pg / mL, about 20pg / mL to about 120pg / mL, about 20pg / mL to about 110pg / mL, about 20pg / mL to about 100pg / mL, about 20pg / mL to about 90pg / mL, The IL-21 or functionally active fragment thereof can be expressed in an amount of about 10 pg / mL to about 80 pg / mL, about 10 pg / mL to about 70 pg / mL, about 10 pg / mL to about 60 pg / mL, about 10 pg / mL to about 50 pg / mL, about 10 pg / mL to about 40 pg / mL, about 10 pg / mL to about 30 pg / mL, or about 5 pg / mL to about 25 pg / mL) or more. 6 / mL ~ 2 × 10 6After culturing the cells described herein for about 2 to 4 days (e.g., about 3 days), the concentration of IgG1 is about 4 pg / mL to about 300 pg / mL (e.g., about 5 pg / mL to about 290 pg / mL, about 5 pg / mL to about 280 pg / mL, about 5 pg / mL to about 270 pg / mL, about 5 pg / mL to about 260 pg / mL, about 5 pg / mL to about 250 pg / mL, about 6 pg / mL to about 250 pg / mL, about 7 ...) g / mL~about 245pg / mL, about 8pg / mL~about 240pg / mL, about 9pg / mL~about 235pg / mL, about 10pg / mL~about 230pg / mL, about 15pg / mL~about 225p g / mL, about 20 pg / mL to about 220 pg / mL, about 20 pg / mL to about 210 pg / mL, about 20 pg / mL to about 200 pg / mL, about 20 pg / mL to about 180 pg / mL, about 20 pg / mL ~ approx. 170 pg / mL, approx. 20 pg / mL ~ approx. 160 pg / mL, approx. 20 pg / mL ~ approx. 150 pg / mL, approx. 20 pg / mL ~ approx. 140 pg / mL, approx. 20 pg / mL ~ approx. 1 30pg / mL, about 20pg / mL to about 120pg / mL, about 20pg / mL to about 110pg / mL, about 20pg / mL to about 100pg / mL, about 20pg / mL to about 90pg / mL, about The IL-21 or a functionally active fragment thereof can be expressed in an amount of 10 pg / mL to about 80 pg / mL, about 10 pg / mL to about 70 pg / mL, about 10 pg / mL to about 60 pg / mL, about 10 pg / mL to about 50 pg / mL, about 10 pg / mL to about 40 pg / mL, about 10 pg / mL to about 30 pg / mL, or about 5 pg / mL to about 25 pg / mL) or more.

[0360] In some other embodiments, cell viability after electroporation is at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%. Cell viability can be measured by methods known in the art. For example, cells can be counted before and after electroporation using a cell counter device. In other embodiments, apoptosis can be measured. The introduction of large amounts of nucleic acid is believed to induce apoptosis. The methods described herein are believed to result in less apoptosis than other methods in the art. In certain embodiments, the amount of cells exhibiting apoptosis after electroporation is less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%. Apoptosis refers to the specific process of programmed cell death and can be measured by methods known in the art. For example, apoptosis can be measured using Annexin V.

[0361] therapeutic use In another aspect, the present application provides a pharmaceutical composition comprising the nucleic acid molecule described herein, the vector described herein, the cell described herein, and / or the cell population described herein, which may further comprise a pharmaceutically acceptable adjuvant.

[0362] In another aspect, the present application provides use of a nucleic acid molecule described in the present application, a vector described in the present application, a cell described in the present application, a cell population described in the present application, and / or a pharmaceutical composition described in the present application for use in preparing a medicament. The medicament can be used for the prevention, treatment, and / or alleviation of cancer. The cancer can include tumor-associated antigen-positive cancer cells. For example, the tumor-associated antigen can be selected from GPC3, CD19, BCMA, Claudin 18.2, and Mesothelin. For example, the tumor-associated antigen can be GPC3. The cancer can be liver cancer or hepatocellular carcinoma.

[0363] In another aspect, the present application provides a method for preventing, treating, and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of a nucleic acid molecule described herein, a vector described herein, a cell described herein, a cell population described herein, and / or a pharmaceutical composition described herein.

[0364] In another aspect, the present application provides a nucleic acid molecule described herein, a vector described herein, a cell described herein, a cell population described herein, and / or a pharmaceutical composition described herein for use in the prevention, treatment, and / or amelioration of a disease or condition in a subject.

[0365] In the present application, the disease or condition may be cancer. The cancer may include tumor-associated antigen-positive cancer cells. The tumor-associated antigen may be selected from GPC3, CD19, BCMA, Claudin 18.2, and mesothelin. For example, the tumor-associated antigen may be GPC3 or BCMA. The cancer may be liver cancer, hepatocellular carcinoma, or multiple myeloma.

[0366] In certain embodiments, the cells and cell lines generated by the methods described herein are cells and cell lines that provide a therapeutic effect after editing the genomic DNA of the cells. Primary cells can be isolated and modified by the methods described herein and used in vitro for reintroduction into a subject. Suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subsets (e.g., but not limited to, CD4+ T cells or CD8+ T cells). Other suitable primary cells include progenitor cells, such as myeloid or lymphoid progenitor cells. Suitable cells further include stem cells, such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neural stem cells, mesenchymal stem cells, muscle stem cells, and skin stem cells. For example, iPSCs can be obtained in vitro from a patient with a known genetic mutation, and the mutation can be modified to a wild-type allele using the methods described herein. The modified iPSCs are then differentiated into dopaminergic neurons and reimplanted into the patient. In another in vitro therapeutic application, hematopoietic stem cells can be isolated from patients with known genetic mutations and then modified to correct the genetic mutation. The HSCs can then be readministered to the patient for therapeutic benefit, or they can be intermediately differentiated from culture into more mature hematopoietic cells before being administered to the patient.

[0367] Another example of a therapeutic application of the methods of the present application involves the site-specific integration of chimeric antigen receptors (CARs). The term "chimeric antigen receptor" or "CAR" refers to engineered receptors, such as those used to transfer specificity to immune effector cells. These receptors are used to transfer the specificity of monoclonal antibodies to T cells. These receptors are called chimeric because they are composed of portions from different sources. The most common form of these molecules is a fusion of a single-chain variable fragment (scFv) derived from a monoclonal antibody with the CD3ζ transmembrane and intracellular domains (endodomains), the CD28 or 41BB intracellular domains, or a combination thereof. Such molecules trigger signal transduction in response to target recognition of the scFv. An example of such a construct is GPC3-CAR, which recognizes Glypican 3 (GPC3), which is specifically expressed on the surface of liver cancer cells. When T cells express this molecule, they recognize and kill target cells expressing GPC3 (e.g., liver cancer cells). To target malignant B cells, researchers have used chimeric immunoreceptors specific for the B-lineage molecule CD19 to redirect T cell specificity. The variable portions of immunoglobulin heavy and light chains are fused via a flexible linker to form scFvs. The scFvs are preceded by a signal peptide, which directs the initial protein to the endoplasmic reticulum and subsequent surface expression (which is cleavage). A flexible spacing region allows the scFv to orient in various directions to achieve antigen binding. The transmembrane domain is a typical hydrophobic α-helix, derived from the original molecule, which is the signaling intracellular domain that usually protrudes into the cell and transmits the desired signal.

[0368] Artificial T cell receptors are being studied as cancer treatments using a technique called adoptive cell transfer. T cells are removed from a patient and modified to express receptors specific to a particular form of cancer. The T cells, capable of recognizing and killing cancer cells, are then reintroduced into the patient. Modification of T cells from donors other than the patient is also under investigation.

[0369] These engineered CAR T cells can be expanded in vitro, and the expanded CAR T cell population can then be infused into patients. After infusion, the T cells proliferate in the patient's body and, through the induction of their engineered receptors, recognize and kill cancer cells bearing antigens on their surface. Many existing therapies involve the introduction of CARs via viral infection. However, safety concerns always exist when using viral infection as a treatment. Therefore, the methods described herein are non-viral approaches to gene therapy and genome engineering. Until now, it was not possible to transfect immune cells with plasmid DNA because doing so would cause severe toxicity to the cells. The inventors of the present application have discovered that by treating the transfection composition (e.g., reducing the content of host genomic DNA) prior to cell transfection, they can overcome problems affecting cell viability and transfect long DNA segments (and / or high concentrations) into cells while maintaining a high level of viability. Using the methods described herein, CARs can be integrated into specific sites in immune cells. In some embodiments, the cells are autologous immune cells. Long-term expression of CARs in T cells or natural killer (NK) cells can be used to treat leukemia or certain antigen-associated tumors.

[0370] In certain embodiments, when the method of the present application is used, modified cells (e.g., immune cells such as T cells) obtained by non-viral transfection (e.g., plasmid electroporation) of the isolated nucleic acid molecules of the present application (encoding a CAR described in the present application, e.g., GPC3-CAR, IL-15 or a functionally active fragment thereof, and IL-21 or a functionally active fragment thereof) surprisingly have both favorable safety and tumor cell-killing ability. For example, in certain embodiments, after the isolated nucleic acid molecule is introduced into the cell, it is inserted into a specific site (e.g., a TRAC site) in the genomic DNA of the cell, and thereby the exogenous protein (e.g., the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof) is expressed in a specific manner (e.g., timing and expression level) under the regulation of an endogenous regulatory sequence (e.g., an endogenous promoter) at the insertion site. Therefore, the modified cells simultaneously have both safety and therapeutic effect.

[0371] In certain embodiments, the methods described herein relate to improved methods for in vitro therapy. A cell population is isolated from a subject, and then the cells are activated by methods known in the art and / or described herein, and the genomic DNA of the cells can be modified to correct a defect or site-specifically integrate a target gene. The cell population can then be transplanted into a subject for therapeutic use. Under certain circumstances, the isolated cell population can include a cell subset that is sensitive to a particular in vitro manipulation (e.g., conventional transfection and / or electroporation), or the cell subset can be resistant to conventional transfection and / or electroporation or genomic DNA manipulation. Modifying genomic DNA using the methods described herein is believed to improve the efficiency of sequence modification in such groups.

[0372] Furthermore, cells and cell lines generated by the methods used herein can be used in drug development and / or reverse genetics studies. Such cells and animals may exhibit phenotypes associated with specific mutations or their sequence modifications and can also be used to screen for drugs that specifically interact with the mutations or mutant proteins discussed or that can be used to treat diseases in diseased animals. These cell lines provide a tool for studying the effects of specific mutations, as the cell line and its corresponding "modified" cell line serve as "genetically identical" controls, providing a powerful tool for specific mutation correction of disease, drug screening and discovery, and studying disease mechanisms.

[0373] Routes of administration of immune cells of the present application include, for example, intratumoral, intradermal, subcutaneous, intravenous, intralymphatic, and intraperitoneal administration. In some embodiments, administration is intratumoral or intralymphatic. In some embodiments, immune cells are administered directly into cancer tissue or lymph nodes.

[0374] In some embodiments, the immune cells are T cells. T cells can be cells that have been in contact with an antigen or antigen-presenting cells. For example, APCs can be cultured with tumor antigens specific to the patient's cancer and differentiated into, for example, CD8-positive cytotoxic T lymphocytes (CTLs) or CD4-positive helper T cells. These established T cells can be administered to individuals with cancer.

[0375] The source of naive T cells is not particularly limited and can be derived from, for example, peripheral blood of a vertebrate. The naive T cells used can be CD8+ or CD4+ cells isolated from a PBMC fraction. In some embodiments, in terms of CTL induction efficiency, the naive T cells are CD8+ or CD4+ cells that are not isolated from the PBMC fraction but are mixed with other cells and components. For example, when cells of the PBMC fraction are cultured in a medium supplemented with serum and tumor antigens, the PBMCs differentiate into dendritic cell precursors. The dendritic cell precursors then differentiate into dendritic cells that function as antigen-presenting cells that bind to peptides and present the peptides / tumor antigens. The antigen-presenting cells stimulate CD8+ T cells in the PBMCs to differentiate into CTLs. Thus, CTLs that can recognize the added peptide are obtained. The CTLs thus obtained can be isolated and directly used as a cancer vaccine. Alternatively, before being used as a cancer vaccine, they can be further cultured in the presence of interleukin (e.g., IL-2), antigen-presenting cells, and tumor antigens. The route of administration is not particularly limited, and examples include intradermal, subcutaneous, intravenous, and intratumoral administration. The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are used only to illustrate the present invention and do not limit the scope of the present invention. In the following examples, experimental methods without specific conditions are generally in accordance with conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or conditions suggested by manufacturers. Unless otherwise specified, percentages and parts are calculated as weight percentages and weight parts.

[0376] Example A description of each plasmid used in the following examples is provided in the table below. [Table 1] Here, in the GPC3 CAR, the amino acid sequence of the scFv targeting GPC3 is as shown in SEQ ID NO: 1. IL7 / 15 represents IL15 bound to the IL7 signal peptide. CCR19 / IL21 represents IL21 bound to the CCR19 signal peptide.

[0377] Example 1. Effect of host genomic DNA content on immune cell performance after electroporation Plasmid molecules 2 (referred to as plasmid 2-1, plasmid 2-2, and plasmid 2-3, respectively) were obtained from different sources, and the content of genomic DNA from the microorganisms that produced the plasmids was detected. The results (μg of host genomic DNA contained in 1 mg of total DNA) are shown in the table below. [Table 2] Plasmids 2-1, 2-2, and 2-3 were used. A synthetic sgRNA (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25), with three thio and three oxymethyl modifications at the 5' and 3' ends, respectively, of the sgRNA, was designed to target the human TRAC gene. Cas9 protein was purchased from Sino Biological (product number: 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cell modification.

[0378] By electroporation, 2-1, 2-2, and 2-3 were introduced into two donor human T cells activated for two days with Dynabeads (manufactured by Thermofisher, containing anti-CD3 and anti-CD28 antibodies), respectively, and the prepared RNP was simultaneously introduced into the cells. The nucleic acid molecule encoding molecule 2 was integrated into the TRAC gene of the human T cells and could be expressed via the endogenous promoter of the TRAC gene.

[0379] The viability and total number of viable cells of T cells transfected with plasmid 2-1, 2-2, or 2-3 were detected using an NC-200 cell counter, and the expression level of CAR in the transfected T cells was detected using flow cytometry and GPC3 protein.

[0380] The results are shown in Figures 12A to 12C. The results in Figure 12A show that plasmids 2-2 and 2-3 significantly improved T cell survival after transfection compared to plasmid 2-1, which contains nucleic acid molecules or fragments thereof derived from more host (e.g., microbial) genomes, where the lower the content of host genomic DNA, the higher the T cell survival after transfection. The results in Figure 12B show that the total number of viable T cells after transfection with plasmids 2-2 or 2-3 was significantly improved compared to plasmid 2-1, which contained more host genomic DNA, where the lower the content of host genomic DNA, the higher the total number of viable T cells after transfection. The results in Figure 12C show that compared with plasmid 2-1, which contains more host genomic DNA, plasmids 2-2 or 2-3 significantly improved the expression level of CAR expressed by T cells after transfection, where the lower the content of host genomic DNA, the higher the expression level of CAR expressed by T cells after transfection.

[0381] Example 2. Performance of engineered immune cells A synthetic sgRNA (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25), with three thio and three oxymethyl modifications at the 5' and 3' ends, respectively, of the sgRNA, was designed to target the human TRAC gene. Cas9 protein was purchased from Sino Biological (product number: 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cellular modification.

[0382] Plasmid molecule 2 is introduced into human T cells activated for 2 to 3 days with Dynabeads (manufactured by Thermofisher, containing anti-CD3 and anti-CD28 antibodies) by electroporation, and simultaneously prepared RNP is introduced into the cells. The nucleic acid molecule encoding molecule 2 is incorporated into the TRAC gene of the human T cells and can be expressed via the endogenous promoter of the TRAC gene. The obtained cells are molecule 2 cells. The obtained cells are detected.

[0383] The results are shown in Figures 1A to 1D. Figure 1A shows that the Molecule 2 cells increased in number by at least 50-fold after 7 days of growth in Xvivo-15 medium (5% SR + 100 IU / ml rhIL-2, 10 ng / mL rhIL-7, and 5 ng / mL rhIL-15). Figure 1B shows that the Molecule 2 cells had a stable CAR molecule-positive expression rate. Figure 1C shows that CD3 expression in the Molecule 2 cells was effectively knocked out after TRAC knockout. Figure 1D shows that the Molecule 2 cells had a high percentage of CD8-positive cells.

[0384] Example 3. Performance of modified immune cells after cryopreservation and recovery The survival rate, phenotypic characteristics, and tumor cell killing ability of the molecule 2 cells after cryopreservation and recovery were determined as described in Example 1. The results are shown in Figures 2A to 2C. Figure 2A shows the cell viability of five different batches of Molecule 2 cells (referred to as CART-1, CART-2, CART-3, CART-4, and CART-5, respectively) after cryopreservation and recovery. Here, the Molecule 2 cells were cryopreserved using a CryoStor CS10 centrifuge 7 days after electroporation. Cell viability after cryopreservation and recovery was measured using an NC-200 centrifuge centrifuge 0, 1, and 2 days after cryopreservation and recovery, respectively. The results show that Molecule 2 cells have at least 70% cell viability after cryopreservation and recovery within 0 to 2 days.

[0385] Furthermore, the proportions of CAR-positive cells and memory cells after recovery were detected, and the results are shown in Figure 2B. As can be seen from the results in Figure 2B, the CAR-positive rate and memory cell proportion of the cells were not significantly altered during the recovery process, where TSM are CD62L+ / CD45RO- cells and TCM are CD62L+ / CD45RO+ cells. Furthermore, the killing ability of the recovered cells is detected. Briefly, the molecule 2 cells are co-incubated with Huh-7 cells, and the mortality of the target cells generated by T cells killing the target cells after incubation is calculated. Mortality rate = N D / N L ×100%, where N L is the number of target cells collected in 20 seconds during FACS detection, and N D is the number of target cells killed.

[0386] The mortality results are shown in Figure 2C. Figure 2C shows the mortality results for target cells Huh-7, where the horizontal axis E:T represents the ratio of effector cells (molecular 2 cells) to target cells (tumor cells). As can be seen from the results in Figure 2C, the recovered cells still maintained their ability to kill target cells.

[0387] Furthermore, the proliferation ability of the molecule 2 cells described in Example 1 after cryopreservation and recovery was further examined, and the results are shown in Figures 3A and 3B. Briefly, the cells were cultured in Xvivo-15 medium (containing 5% SR + 100 IU / ml rhIL-2) and activated by co-incubation with Huh-7 target cells and the molecule 2 cells on days 0, 5, 6, and 7, respectively. As can be seen from the results in Figures 3A and 3B, the molecule 2 cells after recovery could still be continuously activated and expanded. Here, Figure 3A shows the cell number after expanding a portion of the cells (approximately 5 x 10 cells) before each activation, and Figure 3B shows the calculated total number of expanded cells.

[0388] Example 4. Expression of engineered immune cells in response to cytokines The effect of IL-21 and / or IL-15 on the expression of these molecules on cell survival was further investigated. The results are shown in Figure 4. Four different batches of cells were detected, designated CART1, CART2, CART3, and CART4, respectively. "+Resti" indicates co-incubation with target cells (Huh-7 cells expressing GPC3), "-Resti" indicates no co-incubation with target cells, "+IL2" indicates the addition of additional recombinant human IL-2 (rhIL-2) to the culture medium, and "-IL2" indicates the addition of additional IL-2 to the culture medium.

[0389] As can be seen from the results in Figure 4, when the cells are cultured in vitro in a medium without rhIL-2 and are not co-incubated with target cells, the molecule 2 cells die immediately. When the cells are cultured in vitro in a medium supplemented with 100 IU / ml of rhIL-2 but are not co-incubated with target cells, the proliferation ability and viability of the cells can only be slightly increased. However, when the cells are co-incubated with target cells, the proliferation ability and viability of the cells can still be increased without adding additional rhIL-2 to the medium.

[0390] The above results demonstrate that after specific nucleic acid molecules of the present invention are transfected and integrated into the genome of T cells, the prepared CAR-T cells not only express CARs targeting tumor-associated antigens, but also express exogenous IL-21 and IL-15. Surprisingly, compared with conventional CAR-T cells, the CAR-T cells of the present invention exhibit superior proliferation ability and survival rate in the presence of target cells without the need for IL-2 addition. On day 14, the cell number of the CAR-T cells of the present invention in the presence of target cells alone without the addition of exogenous IL-2 was approximately 1 to 2 orders of magnitude higher than the cell number in the absence of target cells but with the addition of exogenous IL-2.

[0391] Furthermore, although the CAR-T cells of the present invention express IL-21 and IL-15, their expansion ability is limited in the absence of target cells, demonstrating their safety and the absence or extremely low risk of tumor formation.

[0392] Example 5. Engineered immune cells that effectively kill tumor cells in vitro NCG mice (GemPharmatech) were treated with 1 × 10 7 HepG-2 cells (PharmaLegacy, Shanghai) were subcutaneously injected to establish a subcutaneous tumor mouse model. Approximately 14 days later, the tumor was removed to approximately 100 mm 3 In a mouse animal model, the cells were grown to a volume of 1 x 10 and placed in three mice. 8 100 μl of Molecule 2 cells at a concentration of 1 × 10 / mL were injected into the tail vein, and these mice are called the treatment group. 8 100 μl of control T cells were injected intravenously into the tail vein at a concentration of 1 / mL (the control T cells express a CAR targeting CD19, where the scFv portion targeting CD19 is derived from the previously reported antibody FMC63), referred to as the irrelevant CAR control group. Additionally, two model mice were injected with vehicle only, referred to as the vehicle control group.

[0393] Eighteen days after cell or vehicle injection, two mice from each group were selected, peripheral blood cells were collected, and the cells were co-incubated with Huh-7 target cells in vitro. The results are shown in Figure 5A. Cells from the treatment group had a significant killing effect on Huh-7 target cells, while cells from the unrelated CART control group or the vehicle control group had no killing effect on Huh-7 target cells.

[0394] Furthermore, the levels of each cytokine in the cell culture supernatant after the co-incubation were measured. The results are shown in Figure 5B. After the co-incubation of cells from the treatment group, the expression levels of each detected cytokine were all upregulated. Conversely, after the co-incubation of cells from the unrelated CART control group or the solvent control group, the content of each cytokine detected in the culture supernatant was almost zero.

[0395] Example 6. Engineered immune cells capable of effectively inhibiting tumors in vivo NCG mice (GemPharmatech) were treated with 1 × 10 7 HepG-2 cells (PharmaLegacy, Shanghai) were subcutaneously injected to establish a subcutaneous tumor mouse model. Approximately 14 days later, the tumor was removed to approximately 100 mm 3 In a mouse animal model, the cells were grown to a volume of 1 x 10 and placed in three mice. 8 100 μl of Molecule 2 cells at a concentration of 1 × 10 / mL were injected into the tail vein, and these mice were called treatment groups (three batch groups, 3 mice / group, total 9 mice). Another two model mice were injected with 1 × 10 8 100 μl of control T cells (CD19 CART cells) at a concentration of 1 / mL were injected intravenously into the tail vein and referred to as the irrelevant CART control group. Additionally, two model mice were injected with vehicle only and referred to as the vehicle control group.

[0396] Human cells (hCD45) in the peripheral blood of mice in each group + The effectiveness of transplantation was assessed by detecting the percentage of human cells, and the results are shown in Figure 6A. As can be seen from Figure 6A, in the three treatment groups, the percentage of human cells was lower on day 7, peaked on day 18, and then dropped from day 41 to day 69. The CAR expression status of peripheral blood human cells in three mice in the third treatment group was then detected, and the results are shown in Figure 6B. Most of the human cells (hCD45 + ) all express CAR.

[0397] Furthermore, tumor growth in treated, unrelated CART control, and vehicle control mice (Figures 6C and 6D), mouse survival rate (Figure 6E), and mouse weight change (Figure 6F) were monitored.

[0398] As can be seen from the results in Figure 6D, tumor volume rapidly increases in the irrelevant CART control and vehicle control mice. In the nine treated mice, tumor volume is not significantly different from that of the control group 7 days after cell injection, but starting from day 11, the tumor volume growth rate rapidly declines. Of the nine treated mice, the tumor volume of seven mice shrinks to zero on day 28 and remains at zero until at least day 159 after cell injection.

[0399] Fluorescence was detected on days 88, 116, and 145 after cell injection. As can be seen from the results in Figure 6C, one mouse in each of the first and second treatment groups had tumor recurrence and died on day 145 (first treatment group) or showed very strong fluorescence (second treatment group), while the other seven mice in the treatment groups showed zero fluorescence on day 145. Surprisingly, one mouse in the first treatment group showed a small amount of fluorescence on day 116 (despite having zero tumor volume), but showed zero fluorescence on day 145, suggesting that the recurrent tumor activated memory T cells, which could eliminate the recurrent tumor cells.

[0400] As can be seen from the results in Figure 6E, mice in the irrelevant CART control and vehicle control groups died on day 41 after injection. Conversely, mice in treatment groups 1, 2, and 3 exhibited survival rates of 66%, 66%, and 100%, respectively, on day 148 after cell injection. As can be seen from the results in Figure 6F, in the nine mice in the treatment group, except for two mice that died, the weights of the remaining seven mice all steadily increased.

[0401] Example 7. Context of engineered immune cells expressing cytokines in vitro NCG mice (GemPharmatech) were treated with 1 × 107 HepG-2 cells (PharmaLegacy, Shanghai) were subcutaneously injected to establish a subcutaneous tumor mouse model. Approximately 14 days later, the tumor was removed to approximately 100 mm 3 The mice were grown to a volume of 1 × 10 cells / mL and 36 mice (9 groups, G1-G9, 4 mice / group) in the mouse animal model were inoculated with 1 × 10 cells / mL of the ... 8 100 μl of Molecule 2 cells at a concentration of 1 / mL were injected into the tail vein of the mice, and these mice were designated as the treatment group. In addition, four model mice were injected with the vehicle alone, and designated as the vehicle control group.

[0402] The expression of IFNγ, IL-15, and IL-21 in the peripheral blood of mice from each group was detected. The results are shown in Figures 7A and 7B. Ten days after the cell injection, peripheral blood was collected from the mice, and the contents of IFNγ, IL-15, and IL-21 in each peripheral blood sample were detected by ELISA. As can be seen from the results in Figure 7A, IFNγ expression was detectable in the peripheral blood of all mice, but the solvent control group did not express IFNγ. As can be seen from the results in Figure 7B, except for the positive control group (derived from a kit containing IL-15 and IL-21 in a known supernatant), no IL-15 or IL-21 expression was detected in the peripheral blood of mice from each group, indicating that the modified immune cells of the present application do not express large amounts of IL-15 or IL-21 in vivo, and therefore are highly safe.

[0403] Example 8. Tumor-inhibitory effects of engineered immune cells in vivo Hepatocellular carcinoma PDX mouse model LI1035-R16P8 (Crown Bioscience, Taicang) was used. After tumor inoculation for 37 days, the subcutaneous tumor volume was approximately 100 mm 3 ~150mm 3 The mice were randomly divided into three groups, each with four mice. Two groups of mice were selected, each with 1 x 10 8100 μl of Molecule 2 cells (two different batches) at a concentration of 1 × 10 / mL were injected into the tail vein, and these mice are called the first treatment group and the second treatment group. 8 100 μl of control T cells (expressing a CAR targeting CD19, i.e., expressing CD19-CART) at a concentration of 100 μl / mL were injected intravenously into the tail vein and referred to as the irrelevant CART control group. The results are shown in Figure 8A. As can be seen from Figure 8A, the tumor volume of the mice in the irrelevant CART control group increased rapidly, and the mice died around day 45. In the mice in the first and second treatment groups, tumor volume was controlled from day 3, and by day 17, tumor volume had shrunk to zero and remained so until day 135.

[0404] Additionally, the weight of the mice was measured, and the results are shown in Figure 8B, which shows that the weight of the mice in each group steadily increased.

[0405] Example 9. Immune cells without knocked-in exogenous nucleic acid sequences that cannot kill target cells A synthetic sgRNA (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25), with three thio and three oxymethyl modifications at the 5' and 3' ends, respectively, of the sgRNA, was designed to target the human TRAC gene. Cas9 protein was purchased from Sino Biological (product number: 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cellular modification.

[0406] Plasmid molecule 2 was introduced into human T cells activated for 2 days with Dynabeads (Thermofisher, containing anti-CD3 and anti-CD28 antibodies) using electroporation, and DNA-Cas9-sgRNA cells (i.e., containing only the plasmid) were obtained without introducing Cas9 or sgRNA.

[0407] Plasmid molecule 2 was introduced into human T cells activated with Dynabeads (manufactured by Thermofisher, containing anti-CD3 and anti-CD28 antibodies) for 2 days, and Cas9 was simultaneously introduced into the cells to obtain DNA+Cas9-sgRNA group cells (i.e., containing the plasmid and Cas9 but not the sgRNA).

[0408] Plasmid molecule 2 was introduced into human T cells activated with Dynabeads (Thermofisher, containing anti-CD3 and anti-CD28 antibodies) for 2 days, and sgRNA was simultaneously introduced into the cells to obtain DNA-Cas9+sgRNA group cells (i.e., containing the plasmid and sgRNA but not Cas9).

[0409] Plasmid molecule 2 is introduced into human T cells activated for two days with Dynabeads (manufactured by Thermofisher, containing anti-CD3 and anti-CD28 antibodies), and simultaneously prepared RNP is introduced into the cells to obtain DNA+Cas9+sgRNA group cells.

[0410] CAR expression in cells in each group was measured on days 5, 6, and 9 after electroporation, respectively. The results are shown in Figure 9A, which shows that only cells co-transfected with the plasmid, Cas9, and sgRNA had a high percentage of CAR-positive cells. This indicates that the plasmid cannot stably express exogenous nucleic acid molecules for long periods of time unless they are integrated into the T cell genome.

[0411] In addition, the killing ability of the cells in each group is further measured. Briefly, the cells in each group are co-incubated with Huh-7 cells, and the death rate of the target cells generated by T cells killing the target cells after incubation is calculated. Death rate = N D / N L ×100%, where N L is the number of target cells collected in 20 seconds during FACS detection, and N D is the number of target cells killed.

[0412] The mortality results are shown in Figure 9B. Figure 9B shows the mortality results for the target cells Huh-7, with the horizontal axis E:T representing the ratio of effector cells to target tumor cells. As can be seen from the results in Figure 9B, only cells co-transfected with the plasmid, Cas9, and sgRNA had better killing ability against target cells.

[0413] Example 10. Performance of engineered immune cells A synthetic sgRNA (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25), with three thio and three oxymethyl modifications at the 5' and 3' ends, respectively, of the sgRNA, was designed to target the human TRAC gene. Cas9 protein was purchased from Sino Biological (product number: 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cellular modification.

[0414] Plasmid molecule 3 is introduced into human T cells activated for 3 days with Dynabeads (manufactured by Thermofisher, containing anti-CD3 and anti-CD28 antibodies) by electroporation, and simultaneously prepared RNP is introduced into the cells. The nucleic acid molecule encoding molecule 3 is incorporated into the TRAC gene of the human T cells and can be expressed via the endogenous promoter of the TRAC gene. The obtained cells are molecule 3 cells. The obtained cells are detected.

[0415] The performance of the molecule 2 cells and molecule 3 cells after cryopreservation and recovery was compared in terms of viability, in vitro tumor cell killing ability, proliferation ability, cytokine expression, etc. The results are shown in Figure 10.

[0416] FIG. 10A shows that the viability of molecule 2 and molecule 3 cells after cryopreservation and recovery is comparable. FIG. 10B shows that the proliferation capacity of molecule 2 and molecule 3 cells is comparable when co-incubated with and activated by target cells Huh-7. FIG. 10C shows that when co-incubated with target cells Huh-7, molecule 2 cells and molecule 3 cells have comparable killing abilities against target cells Huh-7.

[0417] Furthermore, we examined the ability of molecule 2 cells and molecule 3 cells to express the cytokines IL-15 and IL-21. The results are shown in Figures 10D and 10E, respectively. When not co-incubated with target cells, both molecule 2 cells and molecule 3 cells were able to express IL-21, and the levels of IL-21 expression by both cells were similar. However, after co-incubation with Huh-7 target cells and activation, the levels of IL-21 expression by both molecule 2 cells and molecule 3 cells increased, while the level of IL-21 expression by molecule 3 cells increased significantly (Figure 10D). When not co-incubated with target cells, both molecule 2 cells and molecule 3 cells were able to express IL-15, and the levels at which they expressed IL-15 were similar. However, after co-incubation with Huh-7 target cells and activation, the levels at which both molecule 2 cells and molecule 3 cells expressed IL-15 increased, but the level at which molecule 3 cells expressed IL-15 increased significantly (Figure 10E).

[0418] Example 11. Comparison of the in vivo tumor-inhibitory effects of engineered immune cells Additionally, the in vivo tumor-inhibiting abilities of molecule 2 cells and molecule 3 cells as described in Example 10 are compared. NCG mice (GemPharmatech) were treated with 1 × 10 7 HepG-2 cells (PharmaLegacy, Shanghai) were subcutaneously injected to establish a subcutaneous tumor mouse model. Approximately 14 days later, the tumor was removed to approximately 100 mm 3 In a mouse animal model, the cells were grown to a volume of 1 x 10 and placed in three mice. 8 100 μl of molecule 2 cells at a concentration of 1×10 / mL were injected into the tail vein, and these mice are referred to as the CAR molecule 2 cell treatment group. Another three mice received 1×10 8100 μl of molecule 3 cells at a concentration of 1 / mL were injected into the tail vein, and these mice are referred to as the CAR molecule 3 cell treatment group. The results are shown in Figures 11A and 11B (fitted data lines for each cell and each group). It can be seen that the in vivo inhibitory effects of the CAR molecule 2 cell treatment group and the CAR molecule 3 cell treatment group on tumors are comparable.

[0419] Example 12. In vivo tumor-inhibitory effect under the control of an exogenous promoter Using the same plasmid backbone and homologous arms as plasmid molecules 2 and 3, construct plasmids containing the following exogenous protein-encoding genes: BCMA CAR-2A-IL15(SEQ ID NO:27), BCMA CAR-2A-IL15-2A-IL21(SEQ ID NO:28), PGK-BCMA CAR-2A-IL15-2A-IL21(SEQ ID NO:29), PGK-GPC3 CAR-2A-IL15-2A-IL21(SEQ ID NO:30), GPC3 CAR-2A-IL15-2A-IL21, where BCMA CAR is a chimeric antigen receptor that targets BCMA, PGK is the exogenous PGK promoter (SEQ ID NO:26), and other elements are as defined above.

[0420] Using the experimental method described above, the plasmids were transfected into T cells by electroporation to prepare the corresponding CAR-T cells. The in vivo tumor inhibition experimental method was the same as in Example 11, and the inhibitory effects of each CAR-T on RPMI-8226 multiple myeloma and HepG2 liver cancer were tested, respectively.

[0421] The results are shown in Figures 13A and 13B. In an in vivo tumor inhibition experiment against RPMI-8226 multiple myeloma, CAR-T cells expressing IL-15 and IL-21 under the exogenous PGK promoter (PGK-BCMA CAR-2A-IL15-2A-IL21) showed optimal tumor-killing efficacy, superior to that of CAR-T cells expressing only IL15 or simultaneously expressing IL15 and IL21 under the control of endogenous promoters. In an in vivo tumor inhibition experiment against HepG2 liver cancer, CAR-T cells expressing GPC3 CAR, IL-15, and IL-21 under the control of the exogenous PGK promoter (PGK-GPC3 CAR-2A-IL15-2A-IL21) showed essentially the same tumor-killing efficacy as those under the control of endogenous promoters. These results suggest that the nucleic acid molecules of the present invention can be expressed using exogenous promoters.

[0422] The foregoing detailed description has been provided by way of illustration and example, and is not intended to limit the scope of the appended claims. Various modifications of the embodiments recited hereinabove will be apparent to those skilled in the art and remain within the scope of the appended claims and their equivalents.

Claims

1. 1. An isolated nucleic acid molecule comprising: The isolated nucleic acid molecule comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR), a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

2. The nucleic acid molecule further comprises a nucleic acid sequence encoding an additional exogenous protein selected from the group consisting of IL2 or a functionally active fragment thereof, IL7 or a functionally active fragment thereof, a cytokine, a BiTE, an additional chimeric antigen receptor, or a combination thereof. The nucleic acid molecule of claim 1.

3. The nucleic acid molecule comprises a tandem expression unit, the expression unit comprising: (E1) a first expression unit for expressing the chimeric antigen receptor; (E2) a second expression unit for expressing the IL-15, or a functionally active fragment thereof, or a fusion protein thereof; (E3) a third expression unit for expressing the IL-21, or a functionally active fragment thereof, or a fusion protein thereof; and (E4) optionally a fourth expression unit for expressing an additional exogenous protein; The positions of the first, second, third and fourth expression units can be arbitrarily interchanged. A nucleic acid molecule according to claim 1 or 2.

4. Each independent expression unit is driven by an exogenous promoter or an endogenous promoter operably linked thereto, or by a promoter further upstream, and is characterized in that its 5' end is a nucleic acid sequence of a thermodegradable portion (e.g., a 2A nucleic acid sequence, an IRES nucleic acid sequence). The nucleic acid molecule of claim 3.

5. The number of the first expression unit, the second expression unit, and the third expression unit is independently 1, 2, or 3. The nucleic acid molecule of claim 3.

6. The number of the fourth expression units is 0, 1, 2, 3, 4, or 5. The nucleic acid molecule of claim 3.

7. The nucleic acid molecule is characterized in that it encodes one, two, or three identical or different CAR molecules. The nucleic acid molecule of claim 3.

8. The nucleic acid molecule has the structure of Formula I: ARM5-P1-CAR1-P2 / L1-Z1-P3 / L2-Z2-(P4 / L3-Z3)m--ARM3(I) In each formula, ARM5 is either absent or a 5' homologous arm; ARM3 is either absent or a 3' homologous arm, P1 is a promoterless, splicing acceptor, or first exogenous promoter; CAR1 is a nucleic acid sequence encoding the first chimeric antigen receptor (CAR), P2 / L1 is a second exogenous promoter P2 or a nucleic acid sequence L1 encoding a thermolytic moiety; one of Z1 and Z2 is a nucleic acid sequence encoding IL-15, or a functionally active fragment thereof, or a fusion protein thereof, and the other is a nucleic acid sequence encoding IL-21, or a functionally active fragment thereof, or a fusion protein thereof; L2 is a nucleic acid sequence L2 encoding a thermolytic moiety, P3 is the third exogenous promoter, P4 / L3 are each independently a fourth exogenous promoter P4 or a nucleic acid sequence encoding a thermolyzable moiety L3; Z3 is a nucleic acid sequence encoding an additional exogenous protein, m is 0, 1, 2, 3, 4 or 5 A nucleic acid molecule according to any one of claims 1 to 7.

9. The nucleic acid molecule has the structure of Formula II: ARM5-P1-CAR1-L1-Z1-L2-Z2-ARM3(II) wherein ARM5, P1, CAR1, L1, Z1, L2, Z2, ARM3 and P2 are as defined above. The nucleic acid molecule of claim 8.

10. P1 is an exogenous promoter such as the PGK promoter, and / or P2 is a PGK promoter. A nucleic acid molecule according to claim 8 or 9.

11. The 5' homologous arm and the 3' homologous arm are homologous to a target region in the immune cell genome, thereby localizing and knocking in the nucleic acid sequence between the homologous arms to a predetermined site. The nucleic acid molecule according to any one of claims 8 to 10.

12. The CAR is characterized in that it comprises a target-binding domain that targets a tumor-associated antigen, a target-binding domain that targets a viral antigen, a target-binding domain that targets an immune-associated antigen, or a combination thereof. A nucleic acid molecule according to any one of claims 1 to 11.

13. The tumor-associated antigen is selected from GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2, and Mesothelin, and the viral antigen is selected from EBV-gp350 and HBV s protein. The nucleic acid molecule of claim 12.

14. A vector comprising: A vector comprising the nucleic acid molecule according to any one of claims 1 to 13.

15. Characterized by being a plasmid The vector of claim 14.

16. The plasmid is derived from a microorganism, and the content of the microbiome DNA in the plasmid is <10 wt %, preferably ≦5 wt %, more preferably ≦1 wt % of total DNA. The vector of claim 14.

17. 1. A method for preparing modified immune cells, comprising: The method comprises a step of transfecting immune cells modified with a nucleic acid molecule according to any one of claims 1 to 13 or a vector according to any one of claims 14 to 16, characterized in that the method is electroporation based on the combination of a donor plasmid and a localized nuclease or donor plasmid-based electroporation.

18. The method comprises: (a) providing a donor plasmid, the donor plasmid comprising the nucleic acid molecule of claim 1, the plasmid being derived from a microorganism, and the content of the microbiome DNA in the plasmid being <10 wt% (preferably ≦5 wt%, more preferably ≦1 wt%) of total DNA; and (b) transfecting the modified immune cells with the plasmid, whereby the cells contain and / or express the nucleic acid molecule.

18. The method of claim 17.

19. In step (b), the transfection comprises electrofection.

20. The method of claim 18.

20. In step (b), transfection is carried out in the presence of a gene editing system, thereby integrating the nucleic acid molecule into a specific location in the cell genome.

20. The method of claim 18.

21. The gene editing system is characterized in that it comprises a localized nuclease and a guide RNA.

21. The method of claim 20.

22. The localized nucleases include transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), transposases, integrases, and Cas proteins, preferably Cas 9 proteins.

22. The method of claim 21.

23. The transposase is characterized by including PiggyBac (PB) transposase and / or Sleeping Beauty (SB) transposase.

23. The method of claim 22.

24. The gene editing system includes a ribonucleoprotein complex (RNP), wherein the RNP includes the Cas protein and the guide RNA.

21. The method of claim 20.

25. transfecting the immune cells to be modified with a transfection composition comprising the nucleic acid molecule of any one of claims 1 to 13 or the vector of any one of claims 14 to 16, so that the cells contain and / or express the nucleic acid molecule, wherein at least a portion of the nucleic acid molecule or the vector is obtained from a host cell, and the portion of the nucleic acid molecule or the portion of the vector obtained from the host cell contains less than about 10% (w / w) (preferably ≦5 wt %, more preferably ≦1 wt %) of genomic DNA from the host cell.

18. The method of claim 17.

26. The immune cells include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes, and / or mast cells.

26. The method of claim 25.

27. The immune cells include peripheral blood lymphocytes.

27. The method of claim 25 or 26.

28. The immune cells are primary cells. The method according to any one of claims 25 to 27.

29. The host cell is characterized in that the genomic DNA content is about 1% (w / w) or less. The method according to any one of claims 25 to 28.

30. The genomic DNA content of the host cell is measured by qPCR.

30. The method according to any one of claims 25 to 29.

31. A transfection composition comprising the nucleic acid molecule according to any one of claims 1 to 13 or the vector according to any one of claims 14 to 16, The transfection composition, characterized in that at least a portion of the nucleic acid molecule or the vector is obtained from a host cell, and the portion of the nucleic acid molecule or the portion of the vector obtained from the host cell contains less than about 10% (w / w) of genomic DNA from the host cell.

32. The host cell is characterized in that the genomic DNA content is about 1% (w / w) or less. The transfection composition of claim 31.

33. The host cell has a genomic DNA content of about 9% (w / w) or less. The transfection composition of claim 31.

34. An immune cell prepared by the method according to any one of claims 17 to 30.

35. A modified immune cell comprising or expressing a nucleic acid molecule according to any one of claims 1 to 13 or a vector according to any one of claims 14 to 16.

36. One or more additional genes are characterized by being knocked down or knocked out. The immune cell of claim 35.

37. The additional gene is different from the target gene into which the nucleic acid molecule or a functionally active fragment thereof is integrated. The immune cell of claim 36.

38. The one or more additional genes include an immune checkpoint gene.

38. An immune cell according to claim 36 or 37.

39. The one or more additional genes include PD-1, CD95, and / or CD52. The immune cell according to any one of claims 36 to 38.

40. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 1 to 13, a vector according to any one of claims 14 to 16, and / or a cell according to any one of claims 34 to 39.

41. Use of a nucleic acid molecule according to any one of claims 1 to 13, a vector according to any one of claims 14 to 16, a cell according to any one of claims 34 to 39, and / or a pharmaceutical composition according to claim 40 for use in the preparation of a medicament.

42. The drug is characterized in that it is used for the prevention, treatment and / or alleviation of cancer.

42. The use according to claim 41.

43. 1. A method for preventing, treating, and / or ameliorating a disease or condition in a subject, comprising: The method, characterized in that it comprises administering to the subject an effective amount of a nucleic acid molecule according to any one of claims 1 to 13, a vector according to any one of claims 14 to 16, a cell according to any one of claims 34 to 39, and / or a pharmaceutical composition according to claim 40.

44. The disease or condition is cancer or a viral infection.

44. The method of claim 43.

45. 41. A nucleic acid molecule according to any one of claims 1 to 13, a vector according to any one of claims 14 to 16, a cell according to any one of claims 34 to 39, and / or a pharmaceutical composition according to claim 40 for use in the prevention, treatment and / or alleviation of a disease or condition in a subject.

Citation Information

Patent Citations

  • Car t cells with one or more interleukins

    WO2019210293A1