Non-human animals containing modified transferrin receptor loci

Genetically modified animals with humanized TfR and GAA knockout mutations address the inefficiencies in drug delivery across the blood-brain barrier, providing a robust model for testing and improving therapeutic delivery.

JP2025527122APending Publication Date: 2025-08-20REGENERON PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025500925
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-29
Filing Date
2023-07-28
Publication Date
2025-08-20

AI Technical Summary

Technical Problem

Existing drug delivery approaches for therapeutic agents across the blood-brain barrier face challenges due to compromised targeting efficiency, especially in disease states that alter the integrity of the barrier, necessitating the need for effective animal models to test the efficacy of biologics for transporting therapeutic agents across this barrier.

Method used

Genetically modified non-human animals, such as rodents, are engineered with a recombinant locus encoding a human transferrin receptor (TfR) protein and a knockout mutation in the alpha-glucosidase (GAA) locus, enabling the expression of human TfR on the surface of endothelial blood-brain barrier cells, facilitating the delivery and testing of therapeutic molecules across the blood-brain barrier.

Benefits of technology

The engineered animals provide a reliable model for testing the delivery of therapeutic agents across the blood-brain barrier, enhancing the efficiency of drug delivery systems and offering potential therapeutic applications for conditions like Pompe disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025527122000001_ABST
    Figure 2025527122000001_ABST
Patent Text Reader

Abstract

Non-human animal cells and animals containing a humanized Tfrc gene, for example, at the endogenous Tfrc locus, and methods of using such non-human animal cells and animals are provided. Non-human animal cells or animals containing a humanized Tfrc gene express a human TfR protein or a fragment thereof. Non-human animal cells and animals containing a humanized Tfrc gene and, for example, a knockout mutation of the Gaa gene at the endogenous Gaa locus, and methods of using such non-human animal cells and animals are also provided. Such animals are useful for screening anti-human TfR binding protein-based therapies, for example, for Pompe disease.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Genetically modified non-human animals (e.g., rodents, e.g., mice, or rats) are described that contain within their genome a nucleic acid encoding a human (h) transferrin receptor (TfR) protein or a portion thereof. Accordingly, genetically modified non-human animals that express the hTfR protein or a portion thereof on the surface of cells, such as endothelial blood-brain barrier (BBB) cells, are also described. Such genetically modified non-human animals that express the human TfR protein or a portion thereof on the surface of cells, such as BBB endothelial cells, can be used as models for preclinical testing of therapeutics, such as TfR-based binding proteins, that may be useful for mediating TfR-mediated internalization and / or transport of therapeutic molecules across the blood-brain barrier.

[0002] Sequence Listing The 140Kb sequence listing in xml format entitled "11297WO01_xml.xml", created on July 21, 2023, is incorporated herein by reference in its entirety. [Background technology]

[0003] Delivery of iron to the brain is achieved through the binding and intracellular transport of the iron-binding protein transferrin (Tf). The Tf receptor (TfR) is the target of several studies for delivering therapeutic agents to cells and / or the brain. However, many of these drug delivery approaches have drawbacks. Depending on the transport mechanism at the BBB and whether disease states in the CNS alter the integrity of the barrier, targeting efficiency can also be compromised.

[0004] A wide variety of medical conditions can benefit from successful cellular internalization of therapeutic agents and / or transport of therapeutic agents across the blood-brain barrier. Thus, there remains a need for animal models that can be useful in testing the efficacy of particular biologics for transporting therapeutic agents across the blood-brain barrier. Summary of the Invention [Means for solving the problem]

[0005] Provided herein are genetically modified non-human animals having a recombinant locus encoding a human transferrin receptor (TfR) protein. Also provided herein are compositions and methods for generating and using such modified non-human animals, including those having a recombinant locus encoding a human transferrin receptor (TfR) protein and a knockout mutation in the alpha-glucosidase (GAA) locus, which may be useful for testing delivery of therapeutic GAA across the blood-brain barrier using TfR.

[0006] Described herein are genomes of genetically engineered non-human animals (e.g., mammals, rodents, rats, mice), cells of engineered non-human animals (e.g., mammals, rodents, rats, mice), and non-human animals (e.g., mammals, rodents, rats, mice) that contain a heterologous (e.g., human) TFRC gene or a portion thereof. In some embodiments, the genetically engineered animals described herein express a heterologous (e.g., human) TfR protein from a desired locus (e.g., from an endogenous Tfrc segment). The non-human animal can be a mammal, such as a rodent (e.g., mouse or rat). The non-human animal cell can be a mammalian cell, such as a rodent cell (e.g., mouse cell or rat cell). The non-human animal genome can be a mammalian nucleic acid, such as a rodent nucleic acid (e.g., mouse nucleic acid or rat nucleic acid).

[0007] In some embodiments, the non-human animal, non-human animal cell, or non-human animal genome comprises a nucleic acid sequence encoding a heterologous (eg, human) TfR protein or portion thereof.

[0008] Also described herein are methods for producing non-human animal cells and / or animals comprising a heterologous TfR protein or portion thereof. In some embodiments, the methods comprise inserting a nucleic acid sequence encoding a heterologous TfR protein or portion thereof into the genome of a non-human animal cell. In some embodiments, the methods comprise inserting a nucleic acid sequence encoding a heterologous TfR protein or portion thereof described herein into the genome of a non-human animal cell or into a non-human animal. In some embodiments, the methods comprise inserting a nucleic acid sequence encoding a heterologous TfR protein or portion thereof into the genome of a non-human animal embryonic stem (ES) cell, where the inserting comprises inserting the nucleic acid sequence encoding the heterologous TfR protein or portion thereof into the genome of a non-human animal ES cell to form a modified non-human animal ES cell comprising in its genome the nucleic acid sequence encoding the heterologous TfR protein or portion thereof.

[0009] In some embodiments, the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof is (i) a nucleic acid sequence comprising exon 2 or a coding portion thereof of the human TFRC gene, (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene, (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene, (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene, (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene, (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene, (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene, (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene, (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene, (x (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 or a coding portion thereof of the human TFRC gene; or (xix) any combination of (i) to (xviii). In some embodiments, the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof is selected from the group consisting of: (i) a nucleic acid sequence comprising exon 2 or a coding portion thereof of the human TFRC gene and intron 2 or a portion thereof of the human TFRC gene; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene;(iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or or a portion thereof, (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene, (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene, (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene, (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 or a coding portion thereof of the human TFRC gene;or (xix) any combination of (i)-(xviii). In some embodiments, the nucleic acid sequence encoding the heterologous TfR protein or portion thereof comprises, consists essentially of, or consists of a nucleic acid sequence selected from the group consisting of the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, and the nucleic acid sequence set forth as SEQ ID NO:10. In some embodiments, the nucleic acid sequence encoding the heterologous TfR protein or portion thereof comprises, consists essentially of, or consists of the nucleic acid sequence set forth as SEQ ID NO:9. In some embodiments, the nucleic acid sequence encoding the heterologous TfR protein or portion thereof comprises, consists essentially of, or consists of the nucleic acid sequence set forth as SEQ ID NO:10.

[0010] In some embodiments, the nucleic acid sequence encoding the heterologous TfR protein or portion thereof is at the endogenous Tfrc locus and, in some embodiments, may replace the orthologous endogenous nucleic acid sequence encoding the endogenous TfR protein or portion thereof.

[0011] In some embodiments, the non-human animal cell, non-human animal, or non-human animal genome described herein comprises an endogenous Tfrc locus, wherein the endogenous Tfrc locus comprises a heterozygous or homozygous substitution of an endogenous nucleic acid sequence encoding the endogenous TfR protein or portion thereof with a nucleic acid sequence encoding a heterologous TfR protein or portion thereof, and wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or portion thereof are orthologous.

[0012] In some embodiments, the heterologous TfR protein or portion thereof (here, heterologous refers to a non-human animal) comprises the amino acid sequence of a human TfR protein or portion thereof. In some embodiments, the heterologous TfR protein or portion thereof comprises (i) the amino acid sequence set forth as SEQ ID NO:4, (ii) the amino acid sequence set forth as SEQ ID NO:25, (iii) the amino acid sequence set forth as SEQ ID NO:26, (iv) the amino acid sequence set forth as SEQ ID NO:27, (v) the amino acid sequence set forth as SEQ ID NO:28, or (vi) any combination of (i)-(v). In some embodiments, the heterologous TfR protein or portion thereof comprises the amino acid sequence set forth as SEQ ID NO:25. In some embodiments, the heterologous TfR protein is a full-length human TfR protein. In some embodiments, the heterologous TfR protein (e.g., a full-length human TfR protein) is expressed on the cell surface of a non-human animal cell described herein, e.g., a non-human animal cell isolated from a non-human animal described herein and / or a non-human animal cell identified in Table 1. In some embodiments, a heterologous TfR protein (e.g., a full-length human TfR protein) is expressed on the cell surface of blood-brain barrier (BBB) cells of the non-human animal, e.g., in a non-human animal described herein. In some embodiments, a heterologous TfR protein (e.g., a full-length human TfR protein) is not expressed on the cell surface of a non-human animal cell described herein, e.g., a non-human animal cell isolated from a non-human animal described herein, e.g., when the non-human animal cell is a pluripotent cell such as a germ cell. In some embodiments, the non-human animal cell does not express a heterologous TfR protein and may be, for example, an embryonic stem cell, which may be an embryonic stem cell line maintained in culture.

[0013] Also described herein are chimeric nucleic acid molecules that can be useful for generating the non-human animal cells, genomes, and / or genomes described herein. In some embodiments, the chimeric nucleic acid molecule comprises a nucleic acid sequence of a non-human animal Tfrc gene, which (a) encodes a TfR protein and (b) has been modified to include a replacement of the sequence encoding the TfR protein or a portion thereof with a homologous sequence encoding a heterologous TfR protein or a portion thereof, such that the chimeric nucleic acid molecule encodes a functional TfR protein. In some embodiments, the chimeric nucleic acid sequence further comprises a promoter and / or regulatory sequence of a non-human animal Tfrc gene.In some chimeric nucleic acid molecule embodiments, the homologous nucleic acid sequence is (i) a nucleic acid sequence comprising exon 2 or a coding portion thereof of the human TFRC gene, (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene, (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene, (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene, (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene, (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene, (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene, (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene, (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene, (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene, (xi) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene, (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene, (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene, (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene, (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene, (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene, (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene, (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene, (xviii) a nucleic acid sequence comprising exon 19 or a coding portion thereof of the human TFRC gene, or (xix) any combination of (i)-(xviii). In some chimeric nucleic acid embodiments, the modified non-human animal Tfrc gene further comprises a drug selection cassette. In some chimeric nucleic acid embodiments, the chimeric nucleic acid comprises (i) a 5' homology arm upstream of the modified non-human animal Tfrc gene, and (ii) a 3' homology arm downstream of the modified non-human animal Tfrc gene.In some embodiments, the 5' homology arm and the 3' homology arm undergo homologous recombination with a Tfrc locus of interest in the non-human animal, and after homologous recombination with the Tfrc locus of interest in the non-human animal, the modified non-human animal Tfc gene replaces the non-human animal Tfrc gene at the Tfrc locus of interest in the non-human animal and is operably linked to an endogenous promoter that drives expression of the non-human animal Tfrc gene at the Tfrc locus of interest in the non-human animal. In some embodiments, the 5' homology arm comprises the nucleic acid sequence set forth as SEQ ID NO:7 and / or the 3' homology arm comprises the nucleic acid sequence set forth as SEQ ID NO:8. In some embodiments, the nucleic acid sequence of a chimeric nucleic acid described herein comprises the nucleic acid sequence set forth as SEQ ID NO:5.

[0014] Also described herein are animal models of Pompe disease. Accordingly, described herein are non-human animals, non-human animal cells, or non-human animal genomes comprising a knockout mutation in an endogenous α-glucosidase (Gaa) gene. In some embodiments, the non-human animal or non-human animal cell comprising a knockout mutation in an endogenous Gaa gene exhibits glucose accumulation, e.g., in lysosomes, compared to a wild-type control non-human animal or non-human animal cell comprising a wild-type Gaa gene. In some embodiments, the knockout mutation comprises a deletion of the Gaa gene or a portion thereof. In some embodiments, the knockout mutation comprises a deletion of the entire coding sequence of the Gaa gene. In some embodiments, the non-human animal, non-human animal cell, or non-human animal genome in the Pompe disease model does not express GAA protein. In some Pompe disease model embodiments, the non-human animal, non-human animal cell, or non-human animal genome comprises an endogenous Gaa locus comprising the sequence set forth as SEQ ID NO: 50 or the sequence set forth as SEQ ID NO: 51. In some Pompe disease model embodiments, the non-human animal, non-human animal cell, or non-human animal genome comprising a knockout mutation of the endogenous Gaa gene further comprises a nucleic acid encoding a heterologous TfR protein or portion thereof described herein.

[0015] Also provided are methods for knocking out an endogenous Gaa gene. In some embodiments, the methods comprise modifying an endogenous Gaa locus of a non-human animal to contain a knockout mutation in the Gaa gene.

[0016] The non-human animals described herein that include a nucleic acid encoding a heterologous TfR protein or portion thereof described herein and / or a knockout mutation of the endogenous Gaa gene may be useful for testing anti-human TfR binding proteins, and thus may include anti-human TfR binding proteins that bind to human TfR. In some embodiments, the anti-human TfR binding protein is fused to a therapeutic agent, e.g., α-glucosidase.

[0017] In some embodiments, inserting the nucleic acid comprises contacting the genome of the non-human animal, the genome of a non-human animal cell, or the genome of the non-human animal with any of the chimeric nucleic acid molecules (e.g., targeting vectors) of the present disclosure.

[0018] This patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0019] [Figure 1A] The identity of the mouse and human transferrin receptor C (TFRC) gene and the transferrin receptor (TfR) protein encoded thereby is provided. [Figure 1B]Schematics (not to scale) of the mouse and human transferrin receptor C genes and the targeting vector for humanization of Tfrchum mice are provided. Asterisks indicate the location of (a) the upstream (7228mTU) and downstream (7228mTD) primers for the allele loss assay (top panel) and (b) the upstream (7228hTU) and downstream (7228hTD) primers for the allele gain assay (middle panel). A floxed self-deleting hygromycin cassette (SDC hUB Hygro) is shown downstream of the human sequence, followed by the remainder of the mouse 3'UTR (bottom panel).

[0020] [Figure 2]Schematics (not to scale) of the 7228 (top panel) and 7229 (bottom panel) variant alleles are provided. The sequences of the 7228 and 7229 alleles are shown as SEQ ID NO:9 and SEQ ID NO:10, respectively. Exon 1, intron 1, exon 2 (including the ATG start codon), part of intron 2, and the noncoding UTR of exon 19 remain mouse. Asterisks indicate the location of the upstream (7228hTU) and downstream (7228hTD) primers for allelic gain assays. A floxed self-deleting hygromycin cassette is shown downstream of the human sequence in the remainder of the mouse 3' UTR of exon 19 in the 7228 allele. The floxed self-deleting hygromycin cassette is shown deleted in the mouse 3' UTR of exon 19 in the 7229 allele.The 7228 allele (SEQ ID NO: 9) is annotated as follows: Mouse sequence: 1-5320 Human sequence: 5321-31560 Start codon: 4272-4274 Exon 1 (non-coding, mouse): 1-117 Intron 1 (mouse): 118-4248 Exon 2 (coding, mouse): 4249-4307 5' intron 2 (mouse): 4308-5238 3' intron 2 (human): 5239-5515 Exon 3 stop (human): 5516-28934 Stop codon: 28932-28934 Human 3' UTR: 28935-31560 Hygro self-deleting cassette: 31561-36778 SalI / XhoI hybrid site: 31561-31566 LoxP1: 31567-31600 LoxP2: 36708-36741 I_Ceu: 36747-36772 NheI: 36773-36778 Mouse sequence (Tfrc 3'UTR): 36779-38799 Annotation of the 7229 allele (SEQ ID NO: 10) lacking the hygromycin cassette is as follows: Mouse sequence: 1-5320 Human sequence: 5321-31560 Start codon: 4272-4274 Exon 1 (non-coding, mouse): 1-117 Intron 1 (mouse): 118-4248 Exon 2 (coding, mouse): 4249-4307 5' intron 2 (mouse): 4308-5238 3' intron 2 (human): 5239-5515 Exon 3 stop (human): 5516~28934 Stop codon: 28932~28934 Human 3'UTR: 28935~31560 SalI / XhoI hybrid site: 31561~31566 LoxP1: 31567~31600 I_Ceu: 31606~31631 NheI: 31632~31637 Mouse sequence (Tfrc 3'UTR): 31638~33658.

[0021] [Figure 3]1 shows an alignment of the mouse TfR protein (mTfR, SEQ ID NO: 2) with the human hTfR protein (hTfR, SEQ ID NO: 4), and the TfR protein (SEQ ID NO: 25) encoded by the 7228 allele (SEQ ID NO: 9) or the 7229 allele (SEQ ID NO: 10). The cytoplasmic domain, transmembrane domain, and extracellular domain are labeled.

[0022] [Figure 4] We provide the mouse α-glucosidase (Gaa) gene and the GAA protein encoded thereby, as well as the identity of four SpCas9 guide RNAs (gRNAs) used to disrupt the Gaa allele in mouse embryonic stem cells.

[0023] [Figure 5] A schematic diagram (not to scale) is provided of a Gaa knockout allele containing deletions of Gaa gene sequences using guide RNAs that directed SpCas9 cleavage near the Gaa initiation ATG (guide 9251mGU, cleavage site 38 bp upstream from the ATG; guide 9251mGU3, cleavage site 18 bp downstream of the ATG) and after the stop codon (guide 9251mGD3, cleavage site 677 bp downstream of the stop; guide 9251mGD4, cleavage site 705 bp downstream of the stop codon).

[0024] [Figure 6A] Western blot showing that anti-human TfR antibody clones deliver GAA to the cerebrum of Tfrchum mice. Each lane = 1 mouse. Anti-mouse mTfR:GAA in wild-type mice was used as a positive control. Anti-mouse mTfR:GAA in Tfrchum mice was used as a negative control. [Figure 6B] Western blot showing that anti-human TfR antibody clones deliver GAA to the cerebrum of Tfrchum mice. Each lane = 1 mouse. Anti-mouse mTfR:GAA in wild-type mice was used as a positive control. Anti-mouse mTfR:GAA in Tfrchum mice was used as a negative control. [Figure 6C]Western blot showing that anti-human TfR antibody clones deliver GAA to the cerebrum of Tfrchum mice. Each lane = 1 mouse. Anti-mouse mTfR:GAA in wild-type mice was used as a positive control. Anti-mouse mTfR:GAA in Tfrchum mice was used as a negative control.

[0025] [Figure 7] Western blot showing that a subset of anti-hTfR antibody clones deliver mature GAA to the brain parenchyma in the scfv:GAA format (delivered by HDD). Anti-mouse mTfR:GAA in Wt mice was used as a positive control. Anti-mouse mTfR:GAA in Tfrchum mice was used as a negative control. P = parenchymal (supernatant) fraction, E = endothelial (pellet) fraction.

[0026] [Figure 8] Western blots show that four selected anti-hTfR antibody clones deliver mature GAA to the brain parenchyma in the scfv:GAA format (AAV8 episomal liver-depot gene therapy). Anti-mouse mTfR:GAA in wild-type mice was used as a positive control. Anti-mouse mTfR:GAA in Tfrchum mice was used as a negative control.

[0027] [Figure 9] Western blots showing that three selected episomal AAV8 liver-reserved anti-hTfR antibody clones deliver mature GAA to the CNS, heart, and muscle of Gaa- / - / Tfrchum mice.

[0028] [Figure 10] We show that three selected episomal AAV8 liver-reserved anti-hTfR antibody clones rescue glycogen stores in the CNS, heart, and muscle of Gaa- / - / Tfrchum mice. Wt naive mice served as a positive control, and Gaa- / - naive mice served as a negative control.

[0029] [Figure 11A] We show that three selected episomal AAV8 liver-reserved anti-hTfR antibody clones rescue glycogen stores in the thalamus (Fig. 11A), cerebral cortex (Fig. 11B), hippocampal CA1 (Fig. 11C), and quadriceps (Fig. 11D) of Gaa / Tfrchum mice. Wt naive mice served as a positive control, and Gaa- / - naive mice served as a negative control. [Figure 11B] We show that three selected episomal AAV8 liver-reserved anti-hTfR antibody clones rescue glycogen stores in the thalamus (Fig. 11A), cerebral cortex (Fig. 11B), hippocampal CA1 (Fig. 11C), and quadriceps (Fig. 11D) of Gaa / Tfrchum mice. Wt naive mice served as a positive control, and Gaa- / - naive mice served as a negative control. [Figure 11C] We show that three selected episomal AAV8 liver-reserved anti-hTfR antibody clones rescue glycogen stores in the thalamus (Fig. 11A), cerebral cortex (Fig. 11B), hippocampal CA1 (Fig. 11C), and quadriceps (Fig. 11D) of Gaa / Tfrchum mice. Wt naive mice served as a positive control, and Gaa- / - naive mice served as a negative control. [Figure 11D] We show that three selected episomal AAV8 liver-reserved anti-hTfR antibody clones rescue glycogen stores in the thalamus (Fig. 11A), cerebral cortex (Fig. 11B), hippocampal CA1 (Fig. 11C), and quadriceps (Fig. 11D) of Gaa / Tfrchum mice. Wt naive mice served as a positive control, and Gaa- / - naive mice served as a negative control.

[0030] [Figure 12A]Figure 12A shows GAA expression levels in the serum, liver, cerebrum, and quadriceps muscle of Pompe disease model mice (Tfrchum / GAA- / -) 3 weeks after intravenous injection of recombinant AAV8 anti-TfR:GAA insert template with LNP-gRNA, as well as glycogen levels in the cerebellum and quadriceps muscle (Figure 12B). Untreated Pompe disease model mice and wild-type mice were used as controls. Mice injected with the recombinant AAV8 anti-TfR:GAA episomal template were used as a positive control. Mice injected with the recombinant AAV8 anti-TfR:GAA insert template without LNP-gRNA were used as a negative control. [Figure 12B] Figure 12A shows GAA expression levels in the serum, liver, cerebrum, and quadriceps muscle of Pompe disease model mice (Tfrchum / GAA- / -) 3 weeks after intravenous injection of recombinant AAV8 anti-TfR:GAA insert template with LNP-gRNA, as well as glycogen levels in the cerebellum and quadriceps muscle (Figure 12B). Untreated Pompe disease model mice and wild-type mice were used as controls. Mice injected with the recombinant AAV8 anti-TfR:GAA episomal template were used as a positive control. Mice injected with the recombinant AAV8 anti-TfR:GAA insert template without LNP-gRNA were used as a negative control. DETAILED DESCRIPTION OF THE INVENTION

[0031] I. Overview Transferrin (Tf) and its receptor (TfR) are important in regulating iron metabolism. There are two types of transferrin receptors: TfR1, also known as cluster of differentiation 71 (CD71), which is widely expressed and binds to Tf with high affinity, and TfR2, which is less widely expressed and is primarily expressed on hepatocytes. As used herein, "TfR" refers to TfR1 (CD71) unless otherwise specified.

[0032] Uptake of Tf-bound iron via TfR1 is the primary source of iron import into cells. TfR1 is a 90 kDa type II transmembrane protein with 760 amino acids. TfR1 contains a cytoplasmic N-terminal domain (amino acids 1-67), a transmembrane domain (amino acids 68-88), and a large extracellular C-terminal domain (amino acids 89-763), which contains the Tf-binding site. TfR1 is generally found as a homodimer with a molecular weight of approximately 180 kDa, with the monomers linked by disulfide bonds on the cell surface.

[0033] TfR is present in both humans and non-human species (such as non-human primates and rodents). An example of the amino acid sequence of human (h)TfR1 is shown as SEQ ID NO: 4, which is identical to the amino acid sequence of the hTfR1 protein represented as Uniprot P02786. The gene encoding TfR, called TFRC, is found on human chromosome 3. TFRC contains 19 exons. An example of the gene sequence of TFRC, including annotated exons and introns, can be found in the NCBI database (Gene ID: 7037). An example of the coding sequence of hTfR is shown in SEQ ID NO: 3.

[0034] An example of the amino acid sequence of mouse (m)TfR1 is shown as SEQ ID NO: 2, which is identical to the amino acid sequence of the mTfR1 protein represented by Uniprot Q62351 and has approximately 77% amino acid sequence identity with hTfR1. The mouse Tfrc gene is found on mouse chromosome 16. The complete gene sequence of mouse Tfrc, including annotated exons and introns, can be found in the NCBI database (Gene ID: 22042). An example of the coding sequence of mTfR is shown in SEQ ID NO: 1. Disclosed herein are non-human animal cells, non-human animals, and non-human genomes (e.g., found in non-human animal cell nuclei) comprising exogenous TFRC sequences. In some embodiments, the exogenous sequence is integrated into the endogenous locus of the gene.

[0035] In some embodiments, provided herein are non-human animal cells and animals having a heterologous TFRC sequence in the genome (nucleus) of the non-human animal cells or animals provided herein. The heterologous TFRC sequence can be inserted into the endogenous Tfrc locus to provide non-human animal cells and animals having a genetically modified endogenous Tfrc locus.

[0036] In some embodiments, provided herein are nucleic acids encoding heterologous sequences encoding at least a portion of the TFRC sequence, as well as methods of producing non-human animal cells and animals using such nucleic acids. In some embodiments, such nucleic acids have sequences (e.g., loxP sites) that facilitate editing in non-human animals flanking the sequence encoding the TFRC gene.

[0037] In some embodiments, the present disclosure provides methods that can be used to generate such non-human animals (e.g., rodents, e.g., rats or mice), cells and / or tissues derived from such non-human animals, and nucleotides (e.g., targeting vectors, genomes, etc.).

[0038] In some embodiments, the present disclosure also provides a non-human animal genome comprising a genetically modified endogenous Tfrc locus with a heterologous TfR sequence. In some embodiments, the heterologous TfR sequence encodes a TfR human protein sequence. In some embodiments, the present disclosure provides a non-human animal, a non-human animal cell, or a non-human animal genome (e.g., a non-human animal cell nucleus) comprising a nucleic acid sequence encoding a heterologous TfR protein or a portion thereof. Such nucleic acid sequences encoding a heterologous TfR protein or a portion thereof include (i) a nucleic acid sequence comprising exon 1 or a portion thereof of the human TFRC gene, (ii) a nucleic acid sequence comprising exon 2 or a portion thereof of the human TFRC gene, (iii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene, (iv) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene, or (v) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene, (vi) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene, (vii) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene, (viii) a nucleic acid sequence comprising exon 8 of the human TFRC gene, (ix) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene, (x) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene, (xi) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene, (xii) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene, (xii) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene, or a portion thereof, (xiii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene, (xiv) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene, (xv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene, (xvi) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene, (xvii) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene, (xviii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene, (ixx) a nucleic acid sequence comprising exon 19 or a portion thereof of the human TFRC gene, (xx) or any combination of (i) to (ixx), and may include any introns between such exons, as appropriate.In some embodiments, a nucleic acid sequence encoding a heterologous TfR protein or portion thereof may comprise the nucleic acid sequence set forth in exons 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 of the human TFRC gene, and may optionally include any introns between such exons.

[0039] In some embodiments, all or part of a TfR domain is encoded by a segment of the endogenous Tfrc locus that has been deleted and replaced with a heterologous TfR sequence. In some embodiments, non-human animals are provided that comprise a humanized Tfrc locus and express a human or human / non-human chimeric TfR protein from the humanized Tfrc locus, as well as methods of using such non-human animals (e.g., rodents, e.g., rats or mice), cells and / or tissues derived from such non-human animals, and nucleotides (e.g., targeting vectors, genomes, etc.) useful for making such non-human animals.

[0040] In some embodiments, described herein are non-human animals that comprise a genetically modified Tfrc locus that encodes a modified TfR protein, the modified TfR protein comprising a domain of a human TfR sequence, all or part of which domain is encoded by a segment of the endogenous Tfrc locus that has been deleted and replaced with the orthologous human TfR sequence, and the non-human animal expresses the modified TfR protein.

[0041] In some embodiments, the segment of the endogenous Tfrc locus that is deleted and replaced with the heterologous sequence encodes a domain of the human TfR sequence. Such a domain can be the human TfR extracellular domain. Suitable sequences encoding the extracellular domain contemplated by the present disclosure include the human extracellular domain of the TfR protein upon translation in a cell (e.g., as set forth as SEQ ID NO: 28).

[0042] In some embodiments, at least two domains of the human TfR sequence are encoded by segments of the endogenous Tfrc locus in a humanized mouse model. Illustrative non-limiting examples of domains of the human TfR sequence include, but are not limited to, the cytoplasmic domain (see, e.g., SEQ ID NO: 26), the transmembrane domain (see, e.g., SEQ ID NO: 27), and the extracellular domain (see, e.g., SEQ ID NO: 28). In some embodiments, all or part of each domain can be encoded by a segment of the endogenous Tfrc locus that has been deleted and replaced with an orthologous human TfR sequence. In some embodiments, part or all of the cytoplasmic domain, transmembrane domain, or extracellular domain can be encoded by the endogenous genome. For example, a portion of the cytoplasmic domain can be encoded by the endogenous Tfrc gene. In some embodiments, a portion of the cytoplasmic domain can be encoded by the endogenous Tfrc gene, and the resulting cytoplasmic domain has an amino acid sequence identical to that of the cytoplasmic domain of the human TfR protein due to the degeneracy of the genetic code. In some embodiments, all or a portion of the cytoplasmic domain, all of the transmembrane domain, and all of the extracellular domain are encoded by the segment of the endogenous Tfrc gene that is deleted and replaced with the orthologous human TFRC sequence. In some embodiments, all of the cytoplasmic domain, transmembrane domain, and all of the extracellular domain are encoded by the segment of the endogenous Tfrc gene that is deleted and replaced with the orthologous human TFRC sequence. A suitable sequence encoding a cytoplasmic domain(s) of the present disclosure, upon translation in a cell, produces a human cytoplasmic domain corresponding to amino acids 1-67 of the human TfR protein (SEQ ID NO: 26). A suitable sequence encoding a transmembrane domain of the present disclosure, upon translation in a cell, produces a human transmembrane domain corresponding to amino acids 68-88 of the human TfR protein (SEQ ID NO: 27). Thus, in some alternative embodiments, all or a portion of the cytoplasmic domain or the transmembrane domain is encoded by an endogenous non-human animal Tfrc gene sequence.

[0043] In some embodiments, the non-human animal or non-human animal genome (e.g., non-human animal cell nucleus) described herein encodes an orthologous human TFRC sequence in place of the endogenous mouse Tfrc sequence. In some embodiments, the non-human animal or non-human animal genome comprises a sequence selected from the group consisting of the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, and the nucleic acid sequence set forth as SEQ ID NO:10.

[0044] In some embodiments, the human TfR amino acid sequence encoded by the endogenous Tfrc locus comprising a replacement of all or part of the endogenous Tfrc sequence with the corresponding human TFRC sequence comprises the full-length amino acid sequence of human TfR, e.g., as set forth as SEQ ID NO:4 or SEQ ID NO:25.

[0045] In some embodiments, the non-human animal, non-human animal cell, or non-human animal genome described herein is heterozygous for the genetically modified endogenous Tfrc locus.In some embodiments, the non-human animal or non-human animal genome is homozygous for the genetically modified endogenous Tfrc locus.

[0046] In some embodiments, a segment of the endogenous Tfrc locus is deleted and replaced with an exogenous TFRC sequence. In some embodiments, the endogenous Tfrc locus that is deleted and replaced with the orthologous human TFRC sequence is a segment or all of exon 1, a segment or all of intron 1, a segment or all of exon 2, a segment or all of intron 2, a segment or all of exon 3, a segment or all of intron 3, a segment or all of exon 4, a segment or all of intron 4, a segment or all of exon 5, a segment or all of intron 5, a segment or all of exon 6, a segment or all of intron 6, a segment or all of exon 7, a segment or all of intron 7, a segment or all of exon 8, a segment or all of intron 8, a segment or all of exon 9, a segment or all of intron 9, or an exon 10 of the endogenous Tfrc locus. segments or all of intron 10, segments or all of intron 11, segments or all of intron 11, segments or all of exon 12, segments or all of intron 12, segments or all of exon 13, segments or all of intron 13, segments or all of exon 14, segments or all of intron 14, segments or all of exon 15, segments or all of intron 15, segments or all of exon 16, segments or all of intron 16, segments or all of exon 17, segments or all of intron 17, segments or all of exon 18, segments or all of intron 18, segments or all of exon 19, segments of the 3' untranslated region, or a combination of the foregoing segments.In some embodiments, the endogenous Tfrc locus that is deleted and replaced with an orthologous TFRC sequence is part of or all of intron 2, all of exon 3, all of intron 3, all of exon 4, all of intron 4, all of exon 5, all of intron 5, all of exon 6, all of intron 6, all of exon 7, all of intron 7, all of exon 8, all of intron 8, all of exon 9, all of intron 9, or part of exon 10 of the endogenous Tfrc locus. The locus may include all of intron 10, all of intron 10, all of exon 11, all of intron 11, all of exon 12, all of intron 12, all of exon 13, all of intron 13, all of exon 14, all of intron 14, all of exon 15, all of intron 15, all of exon 16, all of intron 16, all of exon 17, all of intron 17, all of exon 18, all of intron 18, and part or all of exon 19. In some embodiments, all or a portion of the coding sequence of an endogenous Tfrc gene, including any intervening introns, is replaced with all or only a portion (e.g., no introns) of the coding sequence of a human TFRC gene, such that the locus encodes the human TfR protein amino acid sequence set forth, for example, in SEQ ID NO:4 or SEQ ID NO:25.

[0047] In some embodiments, a human TFRC sequence can be used to replace a locus in a non-human animal or cell. In some embodiments, the orthologous human TFRC sequence replacing a segment of the endogenous locus is a segment or all of exon 1, a segment or all of intron 1, a segment or all of exon 2, a segment or all of intron 2, a segment or all of exon 3, a segment or all of intron 3, a segment or all of exon 4, a segment or all of intron 4, a segment or all of exon 5, a segment or all of intron 5, a segment or all of exon 6, a segment or all of intron 6, a segment or all of exon 7, a segment or all of intron 7, a segment or all of exon 8, a segment or all of intron 8, a segment or all of exon 9, a segment or all of intron 9, a segment or all of exon 10, or a segment or all of exon 11 of the human TFRC gene. The fragment may comprise a segment or all of intron 10, a segment or all of intron 11, a segment or all of intron 11, a segment or all of exon 12, a segment or all of intron 12, a segment or all of exon 13, a segment or all of intron 13, a segment or all of exon 14, a segment or all of intron 14, a segment or all of exon 15, a segment or all of intron 15, a segment or all of exon 16, a segment or all of intron 16, a segment or all of exon 17, a segment or all of intron 17, a segment or all of exon 18, a segment or all of intron 18, a segment or all of exon 19, a segment of the 3' untranslated region, or a combination of the foregoing segments.In some embodiments, the orthologous human TFRC sequence replacing a segment of the endogenous locus is a segment or all of intron 2, all of exon 3, all of intron 3, all of exon 4, all of intron 4, all of exon 5, all of intron 5, all of exon 6, all of intron 6, all of exon 7, all of intron 7, all of exon 8, all of intron 8, all of exon 9, all of intron 9, or all of exon 10 of the human TFRC gene. The orthologous human TFRC sequence may include all of intron 10, all of intron 10, all of exon 11, all of intron 11, all of exon 12, all of intron 12, all of exon 13, all of intron 13, all of exon 14, all of intron 14, all of exon 15, all of intron 15, all of exon 16, all of intron 16, all of exon 17, all of intron 17, all of exon 18, all of intron 18, and part or all of exon 19. In some embodiments, the orthologous human TFRC sequence that replaces a segment of the endogenous locus may include all or part of the coding sequence in exons 3-19 of the human TFRC gene.

[0048] In some embodiments, the non-human animal, non-human animal cell, or non-human animal genome described herein encodes a humanized coding region of a TfR protein (i.e., some mouse regulatory regions and selected human non-coding / coding regions). In some embodiments, the nucleic acid sequence encoding a heterologous TfR protein or portion thereof can comprise, consist essentially of, or consist of a nucleic acid sequence encoding a human or mouse / human chimeric TfR protein, e.g., a nucleic acid sequence selected from the group consisting of the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, and the nucleic acid sequence set forth as SEQ ID NO:10. Any such nucleic acid can be integrated at the endogenous Tfrc locus. In some embodiments, the nucleic acid sequence encoding a heterologous TfR protein or portion thereof can replace an orthologous endogenous nucleic acid sequence encoding an endogenous TfR protein or portion thereof.

[0049] In some embodiments, the non-human animal is a mammal, or the non-human animal genome is a mammalian genome. In some embodiments, the non-human animal can be a rodent, or the non-human animal genome can be a rodent genome. In some embodiments, the non-human animal can be a rat or a mouse, or the non-human animal genome can be a rat genome or a mouse genome.

[0050] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein and include polymeric forms of amino acids of any length, including coded and non-coded amino acids, and amino acids that are chemically or biochemically modified or derivatized. The terms also include modified polymers, such as polypeptides with modified peptide backbones. The term domain can refer to any portion of a protein or polypeptide that has a specific function or structure.

[0051] Proteins are said to have an "N-terminus" and a "C-terminus." The term "N-terminus" refers to the beginning of a protein or polypeptide, which ends with the amino acid having a free amine group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (protein or polypeptide), which ends with a free carboxyl group (-COOH).

[0052] The terms "nucleic acid" and "polynucleotide," used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. Nucleic acids and polynucleotides can include single-, double-, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers that contain purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases.

[0053] Nucleic acids are said to have a "5' end" and a "3' end." This is because mononucleotides react to form oligonucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is unidirectionally linked to the 3' oxygen of the next via a phosphodiester bond. An end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of the mononucleotide pentose ring. An end of an oligonucleotide is referred to as the "3' end" if its 3' oxygen is not linked to the 5' phosphate of another mononucleotide pentose ring. A nucleic acid sequence can also be said to have a 5' end and a 3' end, even if it is internal to a larger oligonucleotide. In either a linear or circular DNA molecule, individual elements are referred to as being "upstream" or 5' of the "downstream" or 3' element.

[0054] The term "genomically integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence can be incorporated into the genome of the cell and passed on to its progeny. Any protocol can be used for stable integration of a nucleic acid into the genome of a cell.

[0055] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced into a target location in the genome of a cell by homologous recombination, ligation by non-homologous end joining, or any other recombinant means.

[0056] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient for or that allow packaging into a viral vector particle. The vector and / or particle can be used to transfer DNA, RNA, or other nucleic acids into cells, either ex vivo or in vivo. Many forms of viral vectors are known.

[0057] The term "wild-type" includes entities having a structure and / or activity found in a normal state or context (as opposed to a mutant, diseased, altered, etc.). Wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0058] The phrase "gross mutant phenotype" refers to a significant difference or variation in phenotype between an engineered non-human mouse of the present disclosure and a "wild type."

[0059] The term "endogenous" refers to a nucleic acid sequence that occurs naturally in a cell or a non-human animal. For example, an endogenous Tfrc sequence of a non-human animal refers to the native Tfrc sequence that occurs naturally at the Tfrc locus of that non-human animal.

[0060] An "exogenous" molecule or sequence includes a molecule or sequence that is not normally present in a cell in that form. Normal presence includes presence with respect to a particular developmental stage and environmental conditions of the cell. An exogenous molecule or sequence can include a mutated version of a corresponding endogenous sequence in the cell, e.g., a humanized version of an endogenous sequence, or it can include a sequence that corresponds to an endogenous sequence in the cell but in a different form (i.e., not within the chromosome). In contrast, an "endogenous" molecule or sequence includes a molecule or sequence that is normally present in that form in a particular cell at a particular developmental stage under particular environmental conditions.

[0061] The term "heterologous" when used with respect to a nucleic acid or a protein indicates that the nucleic acid or protein contains at least two moieties that do not naturally occur together in the same molecule. For example, the term "heterologous" when used with respect to a portion of a nucleic acid or a portion of a protein indicates that the nucleic acid or protein contains two or more subsequences that are not found in the same relationship to each other (e.g., joined together) in nature. As an example, a "heterologous" region of a nucleic acid vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a nucleic acid vector can include a coding sequence flanked by sequences not found in association with the coding sequence in nature. Similarly, a "heterologous" region of a protein is a segment of amino acids within or attached to another peptide molecule that is not found in association with the other peptide molecule in nature (e.g., a fusion protein or a tagged protein). Similarly, a nucleic acid or protein can contain a heterologous tag or a heterologous secretion or localization sequence.

[0062] "Codon optimization" involves modifying a nucleic acid sequence to enhance expression in a particular host cell by taking advantage of codon degeneracy, as indicated by the multiplicity of three-base pair codon combinations that specify an amino acid, generally by replacing at least one codon in the native sequence with a codon that is relatively or most frequently used in the host cell's genes while maintaining the native amino acid sequence. For example, a nucleic acid encoding a Cas9 protein can be modified to replace a codon with a higher frequency of use compared to the nucleic acid sequence naturally occurring in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell. Codon usage tables are readily available, for example, from the "Codon Usage Database." These tables can be adapted in a variety of ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292, the entire contents of which are incorporated herein by reference for all purposes. Computer algorithms are also available for codon optimization of a particular sequence for expression in a particular host (see, e.g., Gene Forge). As will be understood by those of skill in the art, the nucleic acid sequences disclosed herein encompass variants thereof, including variants that differ due to degeneracy of the genetic code and / or codon optimization, which encode the same or substantially similar amino acid sequences as biologically active polypeptides.

[0063] The term "locus" refers to the specific location of a gene (or key sequence), DNA sequence, polypeptide-coding sequence, or location on a chromosome in the genome of an organism. For example, a "Tfrc locus" can refer to the specific location of a Tfrc gene, Tfrc DNA sequence, Tfrc coding sequence, or Tfrc location on a chromosome in the genome of an organism that is identified with respect to where such a sequence is located. A "Tfrc locus" can include regulatory elements of the Tfrc gene, including, for example, an enhancer, promoter, 5' and / or 3' untranslated regions (UTRs), or a combination thereof.

[0064] The term "gene" refers to a DNA sequence within a chromosome that encodes a product (e.g., an RNA product and / or a polypeptide product), including the coding region interrupted by non-coding introns and sequences located adjacent to the coding region at both the 5' and 3' ends, such that the gene corresponds to the full-length mRNA (including 5' and 3' untranslated sequences). The term "gene" also includes other non-coding sequences, including regulatory sequences (e.g., promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions. These sequences may be located near (e.g., within 10 kb) or at distant sites within the coding region of a gene and influence the level or rate of transcription and translation of the gene.

[0065] The term "allele" refers to a variant form of a gene. Some genes have different forms that exist at the same location, or locus, on a chromosome. Diploid organisms have two alleles at each locus. Each pair of alleles represents a genotype at a particular locus. A genotype is described as homozygous if two identical alleles are present at a particular locus, and heterozygous if the two alleles are different.

[0066] A "promoter" is a regulatory region of DNA that typically contains a TATA box that can direct RNA polymerase II to begin RNA synthesis at the appropriate transcription start site of a particular polynucleotide sequence. Promoters may further contain other regions that affect the rate of transcription initiation. The promoter sequences disclosed herein modulate the transcription of an operably linked polynucleotide. The promoters may be active in one or more of the cell types disclosed herein (e.g., eukaryotic cells, non-human mammalian cells, human cells, rodent cells, pluripotent cells, one-cell stage embryos, differentiated cells, or combinations thereof). The promoters may be, for example, constitutively active, conditional, inducible, temporally restricted (e.g., developmentally regulated), or spatially restricted (e.g., cell-specific or tissue-specific). Examples of promoters can be found, for example, in WO2013 / 176772, the entire contents of which are incorporated herein by reference for all purposes.

[0067] "Operable linkage" or "operably linked" includes juxtaposition of two or more components (e.g., a promoter and another sequence element) that allows for the normal functioning of both components and the potential for at least one of the components to mediate the function of at least one of the other components. For example, a promoter may be operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage can include such sequences being contiguous to each other or acting in trans (e.g., regulatory sequences may act at a distance to control transcription of a coding sequence).

[0068] The term "variant" refers to a nucleotide sequence that differs (e.g., by one nucleotide) from the sequence most prevalent in a population, or a protein sequence that differs (e.g., by one amino acid) from the sequence most prevalent in a population.

[0069] The term "fragment" with respect to a protein means a protein that is shorter or has fewer amino acids than the full-length protein. The term "fragment" with respect to a nucleic acid means a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, an N-terminal fragment (i.e., removal of a portion of the C-terminus of the protein), a C-terminal fragment (i.e., removal of a portion of the N-terminus of the protein), or an internal fragment.

[0070] "Sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to residues that are the same in two sequences when aligned to maximize correspondence over a defined comparison window. When percentage sequence identity is used in the context of proteins, non-identical residue positions often differ by conservative amino acid substitutions. In conservative amino acid substitutions, an amino acid residue is replaced with another amino acid residue that has similar chemical properties (e.g., charge or hydrophobicity) and thus does not alter the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity can be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known. This typically involves scoring conservative substitutions as partial rather than full mismatches, thereby increasing the percentage of sequence identity. Thus, for example, if identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, conservative substitutions would be given a score of 0-1. Scoring of conservative substitutions is calculated, for example, as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).

[0071] "Percentage of sequence identity" includes values determined by comparing two optimally aligned sequences in a comparison window (the maximum number of perfectly matched residues), and the portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. This percentage is calculated by determining the number of positions in both sequences where the same nucleic acid base or amino acid residue occurs to determine the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to determine the percentage of sequence identity. Unless otherwise specified (e.g., including heterologous sequences to which the shorter sequence is linked), the comparison window is the full length of the shorter of the two sequences being compared.

[0072] Unless otherwise specified, sequence identity / similarity values include those obtained using GAP version 10 with the following parameters: for nucleotide sequence % identity and % similarity, a GAP weight of 50 and a length weight of 3, and the nwsgapdna.cmp scoring matrix; for amino acid sequence % identity and % similarity, a GAP weight of 8 and a length weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. "Equivalent program" includes any sequence comparison program that produces alignments with identical nucleotide or amino acid residue matches and identical percent sequence identity for two sequences, when compared to corresponding alignments produced by GAP version 10.

[0073] The term "conservative amino acid substitution" refers to the substitution of an amino acid normally present in a sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a nonpolar (hydrophobic) residue, such as isoleucine, valine, or leucine, for another nonpolar residue. Similarly, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another, such as arginine for lysine, glutamine for asparagine, or glycine for serine. Furthermore, the substitution of a basic residue, such as lysine, arginine, or histidine, for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid, for another, are further examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a nonpolar (hydrophobic) amino acid residue, such as isoleucine, valine, leucine, alanine, or methionine, for a polar (hydrophilic) residue, such as cysteine, glutamine, glutamic acid, or lysine, and / or the substitution of a polar residue for a nonpolar residue. Typical amino acid classifications are summarized below. [Table 21]

[0074] A "homologous" sequence (e.g., a nucleic acid sequence) includes a sequence that is identical or substantially similar to a known reference sequence, e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the known reference sequence. Homologous sequences can include, for example, orthologous and paralogous sequences. For example, homologous genes typically derive from a common ancestral DNA sequence through either a speciation event (orthologous genes) or a gene duplication event (paralogous genes). "Orthologous" genes include genes from different species that evolved from a common ancestral gene through speciation. Orthologs typically retain the same function during evolution. "Paralogous" genes include genes that are related by duplication within a genome. Paralogs can evolve new functions during evolution.

[0075] The term "in vitro" includes an artificial environment and processes or reactions that occur within an artificial environment (e.g., a test tube). The term "in vivo" includes a natural environment (e.g., a cell or organism or body) and processes or reactions that occur within a natural environment. The term "ex vivo" includes cells removed from an individual's body and processes or reactions that occur within such cells.

[0076] The term "reporter gene" refers to a nucleic acid having a sequence encoding a gene product (typically an enzyme) that is easily and quantitatively assayed when a construct containing the reporter gene sequence operably linked to a heterologous promoter and / or enhancer element is introduced into a cell that contains (or can be made to contain) the factors necessary for activation of the promoter and / or enhancer element. Examples of reporter genes include, but are not limited to, the gene encoding β-galactosidase (lacZ), the bacterial chloramphenicol acetyltransferase (cat) gene, the firefly luciferase gene, the gene encoding β-glucuronidase (GUS), and genes encoding fluorescent proteins. "Reporter protein" refers to the protein encoded by the reporter gene.

[0077] As used herein, the term "fluorescent reporter protein" refers to a reporter protein that is detectable based on fluorescence, whether this fluorescence arises directly from the reporter protein, from the activity of the reporter protein on a fluorogenic substrate, or from the protein having binding affinity for a fluorescently tagged compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami), and the like. Green, CopGFP, AceGFP, and ZsGreen1), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellow1), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, and T-Sapphire), cyan fluorescent proteins (e.g., CFP, eCFP, Cerulean, CyPet, AmCyan1, and Midoriishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, m Examples of suitable fluorescent proteins include Plum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, and tdTomato), and any other suitable fluorescent proteins whose presence in a cell can be detected by flow cytometry.

[0078] The term "recombination" includes all processes of genetic information exchange between two polynucleotides, regardless of the mechanism. Recombination in response to double-strand breaks (DSBs) occurs primarily through two conserved DNA repair pathways: non-homologous end joining (NHEJ) and homologous recombination (HR). See Kasparek & Humphrey (2011) Seminars in Cell & Dev. Biol. 22:886-897, the entire contents of which are incorporated herein by reference for all purposes. Similarly, repair of a target nucleic acid mediated by an exogenous donor nucleic acid can include all processes of genetic information exchange between two polynucleotides.

[0079] NHEJ involves the repair of double-strand breaks in nucleic acids by directly ligating the cut ends to each other or to an exogenous sequence without the need for a homologous template. Ligation of non-contiguous sequences by NHEJ can often result in deletions, insertions, or translocations near the double-strand break site. For example, NHEJ can also result in targeted integration of an exogenous donor nucleic acid through direct ligation of the cut end to the end of the exogenous donor nucleic acid (i.e., NHEJ-based capture). Such targeted integration by NHEJ can be preferable for the insertion of an exogenous donor nucleic acid when the homology-directed repair (HDR) pathway is not readily available (e.g., in non-dividing cells, primary cells, and cells that perform poorly on homology-based DNA repair). Furthermore, unlike homology-directed repair, knowledge of large regions of sequence identity flanking the break site is not required, which can be beneficial when attempting targeted insertion into an organism with a genome with limited knowledge of the genome sequence. This integration can proceed via blunt-end ligation between the exogenous donor nucleic acid and the cleaved genomic sequence, or via cohesive-end (i.e., with 5' or 3' overhangs) ligation using an exogenous donor nucleic acid flanked by overhangs compatible with those generated by the nuclease agent in the cleaved genomic sequence. See, e.g., US2011 / 020722, WO2014 / 033644, WO2014 / 089290, and Maresca et al. (2013) Genome Res. 23(3):539-546, each of which is incorporated herein by reference in its entirety for all purposes. When blunt-end ligation is used, excision of the target and / or donor may be required to generate regions of microhomology necessary for fragment joining, which may result in undesired alterations in the target sequence.

[0080] Recombination can also occur through homology-directed repair (HDR) or homologous recombination (HR). HDR or HR involves a form of nucleic acid repair that may require nucleotide sequence homology and uses a "donor" molecule as a template for repair of a "target" molecule (i.e., a molecule that has undergone a double-strand break), resulting in the transfer of genetic information from the donor to the target. Without wishing to be bound by any particular theory, such transfer may involve mismatch correction of heteroduplex DNA that occurs between the cleaved target and the donor, and / or synthesis-dependent strand annealing, which uses the donor to resynthesize the genetic information that becomes part of the target, and / or related processes. In some cases, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is integrated into the target DNA. See Wang et al. (2013) Cell 153:910-918, Mandalos et al. (2012) PLOS ONE 7:e45768:1-9, and Wang et al. (2013) Nat Biotechnol. 31:530-532, each of which is incorporated by reference in its entirety for all purposes.

[0081] The term "binding protein" includes all proteins that bind to their cognate partner. A binding protein's cognate partner is often referred to in the binding protein's name, e.g., "anti-X binding protein" refers to a protein that binds to "X," where X refers to the name of an antigen. Examples of binding proteins include antibodies, antibody fragments that bind to their cognate partner, multispecific antibodies (e.g., bispecific antibodies), scFVs, bis-scFVs, diabodies, triabodies, tetrabodies, V-NARs, VHHs, VLs, F(ab)s, F(ab)2s, DVDs (dual variable domain binding proteins), SVDs (single variable domain binding proteins), bispecific T cell engagers (BiTEs), or Davisbodies (U.S. Pat. No. 8,586,713, incorporated herein by reference in its entirety for all purposes).Examples of binding proteins that bind to TfR, e.g., anti-TfR antibodies (including anti-hTfR antibodies), include anti-transferrin receptor antibodies (e.g., US20170174778, US20150196663, US9629801, US20180002433, WO2016081643, US20180134797, WO2014189973, US20150110791, US9708406, US20170260292, WO201608164 0, US20180057604, US9611323, WO2012075037, WO2018210898, US20180344869, US20180282408, US20170051071, WO2016 207240, WO2015101588, US20160324984, US20180222993, WO2017055542, US20180222992, WO2017055540, Cabezon,I.,et al. Mol Pharm. 2015 Nov 2;12(11):4137-45, Yu YJ,et al. Sci Transl Med(2014)6:261ra154, Couch,et al. Sci Transl Med. 2013 May 1;5(183):183ra57,1-12), CH3 domains mutated to specifically bind to TfR (see, e.g., WO2023114499, WO2019032955, WO2018152326, WO2019140050, WO2019140050 in particular).

[0082] The terms "multispecific" or "bispecific" with respect to a binding protein mean that the protein recognizes different epitopes on either the same antigen or different antigens. A multispecific binding protein can be a single multifunctional polypeptide or a multimeric complex in which two or more polypeptides are covalently or noncovalently associated with one another. For example, an antibody or fragment thereof can be operatively linked (e.g., by chemical coupling, genetic fusion, noncovalent association, or otherwise) to one or more other molecular entities, such as a protein or fragment thereof, to produce a bispecific or multispecific binding molecule having a second binding specificity.

[0083] The term "antigen" refers to a substance, whether an entire molecule or a domain within a molecule, that is capable of eliciting the production of antibodies or other cognate binding proteins with binding specificity for that substance. The term "antigen" also includes substances that do not elicit the production of antibodies or other cognate binding proteins through self-recognition in a wild-type host organism, but that can elicit such a response in a host animal that has been appropriately genetically engineered to break immune tolerance.

[0084] The term "epitope" refers to a site on an antigen to which a binding protein (e.g., an antibody) binds. Epitopes can be formed from contiguous amino acids or noncontiguous amino acids juxtaposed by one or more tertiary folding of a protein. Epitopes formed from contiguous amino acids (also known as linear epitopes) typically are retained upon exposure to denaturing solvents, whereas epitopes formed by tertiary folding (also known as conformational epitopes) are typically lost upon treatment with denaturing solvents. An epitope typically comprises at least three, more usually at least five, or 8-10 amino acids in a unique spatial conformation. Methods for determining the spatial conformation of an epitope include, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. See, for example, "Epitope Mapping Protocols," in "Methods in Molecular Biology," Vol. 66, Glenn E. Morris, Ed. (1996), the entire contents of which are incorporated herein by reference for all purposes.

[0085] An "antibody paratope" as described herein generally comprises at least a complementarity determining region (CDR) (e.g., the CDR3 region of the heavy and / or light chain variable domain) that specifically recognizes a heterologous epitope.

[0086] The term "antibody" includes immunoglobulin molecules comprising four polypeptide chains, two heavy (H) chains and two light (L) chains, interconnected by disulfide bonds. Each heavy chain contains a heavy chain variable domain and a heavy chain constant region (C H The heavy chain constant region comprises C H 1. C H 2, and C H Each light chain contains three domains: a light chain variable domain and a light chain constant region (C L). The variable domains of the heavy and light chains can be further subdivided into regions of hypervariability called complementarity-determining regions (CDRs), which are flanked by highly conserved regions called framework regions (FRs). Each heavy and light chain variable domain contains three CDRs and four FRs arranged in the following order from amino-terminus to carboxy-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 (heavy chain CDRs may be abbreviated as HCDR1, HCDR2, and HCDR3, and light chain CDRs may be abbreviated as LCDR1, LCDR2, and LCDR3). The term "high affinity" antibody refers to an antibody that binds to its target epitope with approximately 10 -9 M or less (e.g., about 1 × 10 -9 M, 1 x 10 -10 M, 1 x 10 -11 M, or approximately 1 x 10 -12 M)'s K D In one embodiment, K D is measured by surface plasmon resonance, e.g., BIACORE™. D is measured by ELISA.

[0087] The term "bispecific antibody" includes antibodies capable of selectively binding to two or more epitopes. Bispecific antibodies generally comprise two different heavy chains, each of which specifically binds to a different epitope on two different molecules (e.g., two different antigens) or on the same molecule (e.g., the same antigen). When a bispecific antibody is capable of selectively binding to two different epitopes (a first epitope and a second epitope), the affinity of the first heavy chain for the first epitope is generally at least one to two orders of magnitude lower, or three to four orders of magnitude lower, than the affinity of the first heavy chain for the second epitope, or vice versa. The epitopes recognized by a bispecific antibody can be present on the same or different targets (e.g., the same or different proteins). Bispecific antibodies can be generated, for example, by combining heavy chains that recognize different epitopes of the same antigen. For example, nucleic acid sequences encoding heavy chain variable sequences that recognize different epitopes of the same antigen can be fused to nucleic acid sequences encoding different heavy chain constant regions, and such sequences can be expressed in cells that express immunoglobulin light chains. A typical bispecific antibody has two heavy chains (each of which has three heavy chain CDRs followed (N- to C-terminally) by a CH1 domain, hinge, CH2 domain, and CH3 domain) and an immunoglobulin light chain, which does not confer binding specificity but can associate with each heavy chain, or can associate with each heavy chain and bind to one or more of the epitopes bound by the heavy chain binding region, or can associate with each heavy chain and enable binding of one or both heavy chains to one or both epitopes.

[0088] The term "heavy chain" or "immunoglobulin heavy chain" includes immunoglobulin heavy chain sequences, including immunoglobulin heavy chain constant region sequences, derived from any organism. Unless otherwise specified, a heavy chain variable domain contains three heavy chain CDRs and four FR regions. Fragments of heavy chains include CDRs, CDRs and FRs, and combinations thereof. A typical heavy chain contains (from N- to C-terminus) the variable domain followed by a C H1 domain, hinge, C H 2 domain, and C H A functional fragment of a heavy chain has three domains. The functional fragment of a heavy chain has the ability to specifically recognize an epitope (e.g., a K in the micromolar, nanomolar, or picomolar range). D The heavy chain variable domain is encoded by a variable region nucleotide sequence, which typically includes a V domain present in the germline. H , D H , and J H V derived from segmental repertoire H , D H , and J H The sequences, locations, and nomenclature of the V, D, and J heavy chain segments of various organisms can be found in the IMGT database, accessible via the Internet on the World Wide Web (www) at the URL "imgt.org."

[0089] The term "light chain" includes immunoglobulin light chain sequences from any organism, and includes human kappa (κ) and lambda (λ) light chains, as well as VpreB and surrogate light chains, unless otherwise specified. Except as otherwise specified, a light chain variable domain typically includes three light chain CDRs and four framework (FR) regions. Generally, a full-length light chain includes, from the amino terminus to the carboxyl terminus, a variable domain including FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and a light chain constant region amino acid sequence. The light chain variable domain is encoded by a light chain variable region nucleotide sequence, which typically includes a light chain V and J gene segment derived from a repertoire of light chain V and J gene segments present in the germline. L and light chain J LLight chains include gene segments. The sequences, locations, and nomenclature of light chain V and J gene segments from various organisms can be found in the IMGT database, accessible via the Internet on the World Wide Web (www) at the URL "imgt.org." Light chains include, for example, those that do not selectively bind to either the first or second epitope selectively bound by the epitope-binding protein in which the light chain appears. Light chains also include those that bind and recognize, or assist the heavy chain in binding and recognizing, one or more epitopes selectively bound by the epitope-binding protein in which the light chain appears.

[0090] The term "complementarity-determining region" or "CDR," as used herein, includes an amino acid sequence encoded by the nucleic acid sequence of an organism's immunoglobulin genes that normally (i.e., in a wild-type animal) appears between two framework regions within the variable region of a light or heavy chain of an immunoglobulin molecule (e.g., an antibody or T-cell receptor). CDRs may be encoded, for example, by germline or rearranged sequences, and may be encoded, for example, by naive or mature B or T cells. CDRs may be somatically mutated (e.g., different from the sequence encoded in the animal's germline), humanized, and / or modified by amino acid substitution, addition, or deletion. In some situations (e.g., in the case of a CDR3), a CDR may be encoded by two or more sequences (e.g., germline sequences) that are not contiguous (e.g., in an unrearranged nucleic acid sequence) but are contiguous in a B-cell nucleic acid sequence, for example, as a result of splicing or joining of sequences (e.g., VDJ recombination to form a heavy chain CDR3).

[0091] The specific binding of the binding protein to its target antigen is at least 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 M -1Specific binding includes binding with an affinity of at least 100%. Specific binding is detectably large and distinguishable from nonspecific binding that occurs to at least one unrelated target. Specific binding can be the result of bond formation between specific functional groups or a specific spatial fit (e.g., lock-and-key type), whereas nonspecific binding is usually the result of van der Waals forces. However, specific binding does not necessarily mean that a binding protein binds to only one target.

[0092] "Optionally" or "as appropriate" means that the subsequently described event or circumstance may or may not occur, and both the occurrence and non-occurrence of the event or circumstance are included in the description.

[0093] Designation of a range of values includes all integers within or defining the range, and all subranges defined by integers within the range.

[0094] Unless otherwise clear from the context, the term "about" encompasses values within the standard error of measurement (eg, SEM) of the stated value.

[0095] The term "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, and the lack of combinations when interpreted as alternatives ("or").

[0096] The term "or" refers to any one member of a particular list and also includes any combination of members of that list.

[0097] Unless the context clearly dictates otherwise, the singular articles "a," "an," and "the" include plural referents. For example, the term "a protein" or "at least one protein" can include a plurality of proteins (including mixtures thereof).

[0098] Statistically significant means p≦0.05.

[0099] II. Non-human cells and animals containing a humanized Tfrc locus Provided herein are non-human animal cells, non-human animal genomes (e.g., non-human animal cell nuclei), and non-human animals comprising the human or humanized Tfrc locus described herein. The cells, genomes (nuclei), or non-human animals can be heterozygous or homozygous for the humanized Tfrc locus. Diploid organisms have two alleles at each locus. Each pair of alleles represents a genotype at a particular locus. A genotype is described as homozygous when two identical alleles are present at a particular locus and as heterozygous when the two alleles are different. In some embodiments, provided herein are non-human animal cells or genomes (nuclei) comprising a genetically modified endogenous Tfrc locus encoding a modified TfR protein, wherein the modified TfR protein comprises a domain of the human TFR sequence, all or part of which is encoded by a segment of the endogenous Tfrc locus that has been deleted and replaced with the orthologous human TFR sequence.

[0100] The non-human animal cells can be blood-brain barrier (BBB) endothelial cells, pluripotent cells, ES cells, or germ cells.

[0101] In some embodiments, the present disclosure further provides methods for producing any of the non-human animals or reagents necessary to produce the non-human animals described herein.

[0102] The non-human animal cells and genomes (e.g., nuclei) provided herein can be, for example, any non-human cell containing a Tfrc locus or genomic Tfrc locus that is homologous or orthologous to the human TFRC locus. The cells and genomes (e.g., nuclei) can be eukaryotic, including, for example, fungal (e.g., yeast) cells and genomes, plant cells and genomes, animal cells and genomes, mammalian cells and genomes, non-human mammalian cells and genomes, etc. The non-human animal can be, for example, a mammal, a fish, or a bird. The mammalian cell can be, for example, a non-human mammalian cell, a rodent cell, a rat cell, a mouse cell, or a hamster cell. Other non-human mammals include, for example, non-human primates, monkeys, apes, orangutans, cats, dogs, rabbits, horses, bulls, deer, bison, and livestock (e.g., cattle breeds such as cows and steers, sheep breeds such as sheep and goats, and swine breeds such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, ducks, etc. Domestic and agricultural animals are also included. The term "non-human" excludes humans.

[0103] Cells can also be of any type, undifferentiated or differentiated. For example, cells can be totipotent cells, pluripotent cells (e.g., human pluripotent cells or non-human pluripotent cells such as mouse embryonic stem (ES) cells or rat ES cells), or non-pluripotent cells. Totipotent cells include undifferentiated cells that can give rise to any cell type, while pluripotent cells include undifferentiated cells that have the ability to develop into multiple differentiated cell types. Such pluripotent and / or totipotent cells can be, for example, ES cells or ES-like cells such as induced pluripotent stem (iPS) cells. ES cells include embryo-derived totipotent or pluripotent cells that, when introduced into an embryo, can contribute to any tissue of the developing embryo. ES cells can be derived from the inner cell mass of a blastocyst and can differentiate into cells of any of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[0104] The cells provided herein can also be germ cells (e.g., sperm or oocytes). The cells can be mitotically competent or mitotically inactive, meiotically competent or meiotically inactive. Similarly, the cells disclosed herein can also be primary somatic cells or cells that are not primary somatic cells. Somatic cells include any cell that is not a gamete, germ cell, gamete cell, or undifferentiated stem cell. Suitable cells provided herein also include primary cells. Primary cells include cells or cultures of cells directly isolated from an organism, organ, or tissue. Primary cells include cells that are not transformed or immortal. Primary cells include any cells obtained from an organism, organ, or tissue that have not previously been passaged in tissue culture, or that have previously been passaged in tissue culture but cannot be passaged indefinitely in tissue culture. Such cells can be isolated by conventional techniques. Table 1 provides a non-limiting list of tissues and associated cells that can express the heterologous TfR proteins described herein. Any one or any combination of the non-human animal tissues / cell types listed in Table 1 may express a heterologous TfR protein. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0105] Other suitable cells provided herein include immortalized cells. Immortalized cells include cells derived from multicellular organisms that do not normally proliferate indefinitely, but which, due to mutations or alterations, can avoid normal cellular aging and instead continue to divide. Such mutations or alterations can occur naturally or can be intentionally induced. An example of an immortalized cell line is a myofiber cell line. Immortalized or primary cells include cells that can be used to culture or express recombinant genes or proteins.

[0106] The cells provided herein also include one-cell embryos (i.e., fertilized oocytes or zygotes). Such one-cell embryos may be of any genetic background (e.g., in the case of mice, BALB / c, C57BL / 6, 129, or combinations thereof), may be fresh or frozen, and may be derived from natural mating or in vitro fertilization.

[0107] The cells provided herein can be normal, healthy cells, or cells that have a disease or mutation.

[0108] Non-human animals comprising the humanized Tfrc locus described herein can be produced by methods described elsewhere herein. The animals can be, for example, mammals, fish, or birds. Non-human mammals include, for example, non-human primates, monkeys, apes, orangutans, cats, dogs, horses, bulls, deer, bison, sheep, rabbits, rodents (e.g., mice, rats, hamsters, and guinea pigs), and livestock (e.g., cattle breeds such as cows and steers, ovine breeds such as sheep and goats, and porcine breeds such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Domestic and agricultural animals are also included. The term "non-human animal" excludes humans. Preferred non-human animals include, for example, rodents such as mice and rats.

[0109] Non-human animals may be of any genetic background. For example, suitable mice may be of the 129 strain, C57BL / 6 strain, a mix of 129 and C57BL / 6, BALB / c strain, or Swiss Webster strain. Examples of 129 strains include 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, and 129T2. See, e.g., Festing et al. (1999) Mammalian Genome 10:836, the entire contents of which are incorporated herein by reference for all purposes. Examples of C57BL strains include C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal_wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. Suitable mice can also be a mix of the aforementioned 129 strain and the aforementioned C57BL / 6 strain (e.g., 50% 129 and 50% C57BL / 6). Similarly, suitable mice can be a mix of the aforementioned 129 strains or a mix of the aforementioned BL / 6 strains (e.g., 129S6 (129 / SvEvTac) strain).

[0110] Similarly, rats can be of any rat strain, including, for example, the ACI rat strain, the Dark Agouti (DA) rat strain, the Wistar rat strain, the LEA rat strain, the Sprague Dawley (SD) rat strain, or the Fischer rat strain, such as Fisher F344 or Fisher F6. Rats can also be obtained from strains derived from a mix of two or more of the above strains. For example, suitable rats can be of the DA strain or the ACI strain. The ACI rat strain has a white abdomen and legs and RT1 av1The dark agouti (DA) rat strain is characterized as having the black agouti coat and RT1 haplotype. Such strains are available from a variety of sources, including Harlan Laboratories. av1 The rats are characterized as having a haplotype. Such rats are available from a variety of sources, including Charles River and Harlan Laboratories. Some suitable rats may be from inbred rat strains. See, e.g., US2014 / 0235933, the entire contents of which are incorporated herein by reference for all purposes.

[0111] III. Methods for generating non-human animals containing heterologous Tfrc loci Various methods are provided for producing non-human animals containing heterologous Tfrc loci as disclosed elsewhere herein. Any convenient method or protocol for producing genetically modified organisms is suitable for producing such genetically modified non-human animals. See, for example, Cho et al. (2009) Current Protocols in Cell Biology 42:19.11:19.11.1-19.11.22 and Gama Sosa et al. (2010) Brain Struct. Funct. 214(2-3):91-109, each of which is incorporated herein by reference in its entirety for all purposes. Such genetically modified non-human animals can be generated, for example, through targeted gene knock-in at the Tfrc locus.

[0112] For example, a method for producing a non-human animal comprising a humanized Tfrc locus can include (1) modifying the genome of a pluripotent cell to comprise a humanized Tfrc locus, (2) identifying or selecting a genetically modified pluripotent cell comprising a humanized Tfrc locus, (3) introducing the genetically modified pluripotent cell into a non-human animal host embryonic cell in vitro, and (4) implanting the host embryonic cell into a surrogate mother for gestation. Optionally, the host embryo comprising the modified pluripotent cell (e.g., a non-human ES cell) can be incubated to the blastocyst stage and then implanted into a surrogate mother for gestation to produce an F0 non-human animal. The surrogate mother can then produce an F0 generation non-human animal comprising a humanized Tfrc locus.

[0113] The method can further include identifying cells or animals that have the modified target genomic locus. A variety of methods can be used to identify cells and animals that have the targeted genetic modification.

[0114] The screening step can include, for example, a quantitative assay for evaluating the allele modification (MOA) of parent chromosomes. For example, the quantitative assay can be carried out through quantitative PCR, such as real-time PCR (qPCR). The real-time PCR can utilize a first primer set that recognizes the target locus and a second primer set that recognizes the non-target reference locus. The primer set can include a fluorescent probe that recognizes the amplified sequence.

[0115] Other examples of suitable quantitative assays include fluorescence in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization to immobilized probe(s), INVADER® probe, TAQMAN® molecular beacon probe, or ECLIPSE™ probe technology (see, e.g., US2005 / 0144655, the entire contents of which are incorporated herein by reference for all purposes).

[0116] An example of a suitable pluripotent cell is an embryonic stem (ES) cell (e.g., a mouse ES cell or a rat ES cell). Modified pluripotent cells can be generated, for example, by (a) recombination by introducing into a cell one or more targeting vectors containing an insert nucleic acid flanked by 5' and 3' homology arms corresponding to the 5' and 3' target sites (the insert nucleic acid comprises a heterologous Tfrc locus), and (b) identifying at least one cell whose genome contains the insert nucleic acid integrated at the target genomic locus. Alternatively, modified pluripotent cells can be generated by (a) introducing into a cell (i) a nuclease locus (the nuclease locus that introduces a nick or double-stranded break at a recognition site within a target genomic locus) and (ii) one or more targeting vectors containing an insert nucleic acid flanked by 5' and 3' homology arms corresponding to the 5' and 3' target site present in sufficient proximity to the recognition site (the insert nucleic acid comprises a heterologous Tfrc locus), and (c) identifying at least one cell containing a modification at the target genomic locus (e.g., integration of the insert nucleic acid). Any nuclease agent that induces a nick or double-stranded break in the desired recognition sequence can be used. Examples of suitable nucleases include transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), meganucleases, and CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) / CRISPR-associated (Cas) systems or components of such systems (e.g., CRISPR / Cas9).See, for example, US2013 / 0309670 and US2015 / 0159175, each of which is incorporated herein by reference in its entirety for all purposes.

[0117] Donor cells can be introduced into host embryos at any stage, such as blastocyst stage or pre-morula stage (i.e., 4-cell stage or 8-cell stage).Generate offspring that can transmit genetic modification through germline.See, for example, U.S. Patent No. 7,294,754.Its entirety is incorporated herein by reference for all purposes.

[0118] Alternatively, the methods for producing non-human animals described elsewhere herein may include (1) modifying the genome of a one-cell stage embryo to contain a heterologous Tfrc locus using the methods described above for modifying pluripotent cells, (2) selecting the genetically modified embryo, and (3) implanting the genetically modified embryo into a surrogate mother to gestate, producing offspring capable of transmitting the genetic modification through the germline.

[0119] Nuclear transfer techniques can also be used to generate non-human mammals. Briefly, methods for nuclear transfer can include the steps of: (1) enucleating an oocyte or preparing an enucleated oocyte; (2) isolating or preparing a donor cell or nucleus to be combined with the enucleated oocyte; (3) inserting the cell or nucleus into the enucleated oocyte to form a reconstituted cell; (4) implanting the reconstituted cell into the uterus of an animal to form an embryo; and (5) allowing the embryo to develop. In such methods, oocytes are typically retrieved from deceased animals, but may also be isolated from either the oviduct and / or ovary of a living animal. Insertion of the donor cell or nucleus into the enucleated oocyte to form the reconstituted cell can be accomplished by microinjecting the donor cell beneath the zona pellucida prior to fusion. Fusion can be induced by applying a DC electrical pulse across the contact / fusion surface (electrofusion), exposing the cells to a fusion-promoting chemical such as polyethylene glycol, or by an inactivated virus such as Sendai virus. The reconstituted cells can be activated by electrical and / or non-electrical means before, during, and / or after fusion of the nuclear donor with the recipient oocyte. Activation methods include electrical pulses, chemically induced shocks, sperm penetration, increasing the level of divalent cations in the oocyte, and reducing the phosphorylation of cellular proteins in the oocyte (via kinase inhibitors). The activated reconstituted cells or embryos can be cultured in a medium and then transferred to the uterus of an animal. See, e.g., US2008 / 0092249, WO1999 / 005266, US2004 / 0177390, WO2008 / 017234, and U.S. Patent No. 7,612,250, each of which is incorporated herein by reference in its entirety for all purposes.

[0120] The various methods provided herein enable the generation of genetically modified non-human F0 animals, whose cells contain a humanized Tfrc locus. Naturally, the number of cells containing a heterologous Tfrc locus in an F0 animal will vary depending on the method used to generate the F0 animal. Introducing donor ES cells into pre-morula embryos (e.g., 8-cell mouse embryos) from the corresponding organism, for example, via the VELOCIMOUSE® method, can increase the percentage of the cell population of the F0 animal containing cells containing the desired nucleotide sequence containing the targeted genetic modification. For example, at least 50%, 60%, 65%, 70%, 75%, 85%, 86%, 87%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cell contribution of the non-human F0 animal can contain a cell population containing the targeted modification.

[0121] The cells of the genetically modified F0 animal can be heterozygous for the heterologous Tfrc locus. In some embodiments, heterozygous F0 mice can be bred to produce offspring that are homozygous for the heterologous Tfrc locus.

[0122] In some embodiments, the present disclosure provides methods of making a non-human animal, non-human animal cell, or non-human animal genome described herein, comprising inserting a nucleic acid sequence encoding a heterologous TfR protein or a portion thereof into the genome of the non-human animal, the genome of the non-human animal cell, or the genome of the non-human animal.

[0123] For such purposes, various nucleic acids (e.g., targeting vectors) can be particularly used. In some embodiments, the nucleic acid molecule encoding a functional TfR protein comprises the nucleic acid sequence of a modified non-human animal Tfrc gene, which comprises replacing a nucleic acid sequence encoding a portion of the non-human animal TfR protein with a homologous nucleic acid sequence encoding a heterologous TfR protein or a portion thereof, and can be used in gene editing of cells or genomes as described herein.In some cases, such a nucleic acid molecule (e.g., a targeting molecule) may be selected from the group consisting of: (i) a nucleic acid sequence comprising exon 1 or a portion thereof of the human TFRC gene, (ii) a nucleic acid sequence comprising exon 2 or a portion thereof of the human TFRC gene, (iii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene, (iv) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene, or (v) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene, (vi) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene, (vii) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene, (viii) a nucleic acid sequence comprising exon 8 of the human TFRC gene, (ix) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene, (x) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene, (xi) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene, (xii) a nucleic acid sequence comprising exon 11 or a portion thereof, (xii) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene, or a portion thereof, (xiii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene, (xiv) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene, (xv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene, (xvi) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene, (xvii) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene, (xviii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene, (ixx) a nucleic acid sequence comprising exon 19 or a portion thereof of the human TFRC gene, (xx) or any combination of (i) to (ixx), and may, where appropriate, include any introns between any of the included exons or portions thereof. In some embodiments, a nucleic acid sequence encoding a heterologous TfR protein or portion thereof may comprise the nucleic acid sequence set forth in exons 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 (or the coding portion of exon 19) of the human TFRC gene, and may include any introns between such exons, as appropriate.

[0124] In some embodiments, a nucleic acid molecule (e.g., a targeting vector) described herein comprises (i) a 5' homology arm upstream of a modified non-human animal Tfrc gene and (ii) a 3' homology arm downstream of the modified non-human animal Tfrc gene. In some embodiments, the 5' homology arm and the 3' homology arm are configured to undergo homologous recombination with a Tfrc locus of interest in the non-human animal, such that after homologous recombination with the Tfrc locus of interest in the non-human animal, the modified Tfrc gene replaces the non-human animal Tfrc gene at the Tfrc locus of interest in the non-human animal and is operably linked to an endogenous promoter that drives expression of the modified non-human animal Tfrc gene at the Tfrc locus of interest in the non-human animal. In some embodiments, the nucleic acid molecule (e.g., a targeting vector) comprises the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, or the nucleic acid sequence set forth as SEQ ID NO:10.

[0125] IV. Methods for Using Mouse Models / Non-Human Animals Containing Heterologous Tfrc Loci to Test Human Therapeutics The non-human animals and cells described herein can be useful as models for preclinical testing of TfR-based therapeutic modalities (e.g., the use of TfR as an internalization effector for cellular uptake of therapeutic agents and / or as a "molecular trojan horse" to transport macromolecules across the human blood-brain barrier). See, e.g., WO2013 / 138400, WO2017 / 007796, WO2018 / 226861, WO2018 / 226861, and WO2019 / 157224, each of which is incorporated by reference in its entirety. See also Pardridge (2007) J. Control Release 122(3):345-348.

[0126] In some embodiments, described herein are non-human animal models for testing anti-human (h)-TfR binding proteins, such as anti-human (h)-TfR antibodies. In some such embodiments, described are non-human animal models for testing multidomain therapeutics comprising an anti-human (h)-TfR binding protein fused to a therapeutic agent. Thus, a test anti-human (h)-TfR binding protein described herein (including a multidomain therapeutic comprising an anti-human (h)-TfR binding protein fused to a therapeutic agent) can target or specifically bind to the human (h)TfR protein or a portion thereof in a non-human animal or presented by a non-human animal cell described herein, and the efficacy of the anti-human (h)-TfR binding protein (or a multidomain therapeutic comprising an anti-human TfR binding protein fused to a therapeutic agent) can be assessed by monitoring internalization of the anti-human (h)-TfR binding protein by non-human animal cells expressing the human TfR protein or a portion thereof and / or transport of the anti-human TfR binding protein across the blood-brain barrier.

[0127] In some embodiments, testing the anti-human TfR binding protein comprises conducting an assay or study that allows for the determination of the effect of the anti-human TfR binding protein on cells that express the human TfR protein or a portion thereof. In some embodiments, determining the effect of the anti-human TfR binding protein comprises measuring intracellular levels of the anti-human TfR binding protein (and / or a therapeutic agent fused to or carried by the anti-human TfR binding protein). In some embodiments, determining the effect of the anti-human TfR binding protein comprises measuring levels of the anti-human TfR binding protein (and / or a therapeutic agent fused to or carried by the anti-human TfR binding protein) in, for example, the central nervous system, particularly when the anti-human TfR binding protein (and / or a therapeutic agent fused to or carried by the anti-human TfR binding protein) is administered to the non-human animal parenterally and / or via intravenous injection.

[0128] In some embodiments, determining the effect of the anti-human TfR antigen protein comprises administering a candidate human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused to a therapeutic agent) to a non-human animal that has been genetically modified to express a human TfR protein described herein and further modified to exhibit one or more symptoms of a human disease, and evaluating the effectiveness of the candidate human TfR binding protein fused to the therapeutic agent in reducing, preventing, reducing the likelihood of, and / or inhibiting one or more symptoms of the human disease.

[0129] In some embodiments, in such non-human animal models, an anti-human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused with a therapeutic agent) can be introduced into the non-human animals described herein. The anti-human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused with a therapeutic agent) or a gene encoding the anti-human TfR binding protein can be introduced into the non-human animals described herein by several methods known to those skilled in the art. Some non-limiting methods include gene transfer, hydrodynamic delivery (HDD), lipid nanoparticle (LNP) delivery, intravenous injection, parenteral administration, tissue transplantation, or cell transplantation. The nucleotide encoding the anti-human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused with a therapeutic agent) can be targeted to be expressed by a specific cell type, such as the liver, or by a specific locus, such as a safe harbor locus, according to well-known methods. As a non-limiting example, when a nucleotide encoding an anti-human TfR binding protein is administered by LNP delivery, the LNP may contain one or more or all of the following: (i) lipids for encapsulation and endosomal escape, (ii) neutral lipids for stabilization, (iii) helper lipids for stabilization, and (iv) stealth lipids. In certain LNPs, the cargo may include a guide RNA or a nucleic acid encoding the guide RNA. In certain LNPs, the cargo may include an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA or a nucleic acid encoding the guide RNA. In certain LNPs, the cargo may include an exogenous donor sequence (e.g., encoding an anti-human TfR binding protein). In certain LNPs, the cargo may include a nuclease agent (or a nucleic acid encoding a nuclease agent, or one or more nucleic acids encoding a nuclease agent) and an exogenous donor sequence (e.g., encoding an anti-human TfR binding protein).In certain LNPs, the cargo may include an mRNA encoding a Cas nuclease, such as Cas9, a guide RNA or a nucleic acid encoding the guide RNA, and an exogenous donor sequence (e.g., encoding an anti-human TfR binding protein) for CRISPR insertion of the exogenous donor sequence (e.g., encoding an anti-human TfR binding protein) into a safe harbor locus in an animal (e.g., a safe harbor locus, such as, but not limited to, albumin, e.g., the first intron of the albumin locus). See, e.g., WO2020206162, incorporated herein by reference in its entirety.

[0130] In some embodiments, the non-human animals described herein can be used as models for determining the efficacy of using an anti-human TfR binding protein to deliver a therapeutic protein to a tissue or cell of a subject listed in Table 1, e.g., the central nervous system (CNS), by administering the anti-human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused to a therapeutic agent) or a nucleotide composition encoding same to the non-human animal, and then measuring the level of the anti-human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused to a therapeutic agent) or the therapeutic agent in the tissue or cell of the subject listed in Table 1, e.g., the CNS. Methods for measuring the level of an anti-human TfR binding protein (e.g., a multidomain therapeutic comprising an anti-human TfR binding protein fused to a therapeutic agent) are well known in the art and include, but are not limited to, Western blotting, enzyme-linked immunoassays, etc.

[0131] Certain disorders may benefit from preclinical testing of anti-human TfR binding proteins (e.g., multidomain therapeutics comprising anti-human TfR binding proteins fused to therapeutic agents), particularly as candidates for trafficking therapeutic agents across cell membranes (e.g., into lysosomes) and / or transporting therapeutic agents across the blood-brain barrier. Table 2 provides a non-limiting list of disorders that may benefit from the use of anti-TfR antibodies for TfR-mediated internalization of therapeutic agents into organelles or tissues and / or TfR-mediated crossing of the blood-brain barrier by therapeutic agents. Thus, in some embodiments, the non-human animals described herein provide a drug screening platform for screening candidate anti-TfR binding proteins (optionally fused to a therapeutic agent) that may be useful in treating human diseases, and for methods of evaluating the effectiveness of candidate human TfR binding proteins fused to a therapeutic agent for reducing, preventing, reducing the likelihood of, and / or inhibiting one or more symptoms of the human disease (where the disease is selected from the group consisting of diseases listed in Table 2). [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9]

Table 2-10

Table 2-11

Table 2-12

Table 2-13

Table 2-14

Table 2-15

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

[0132] CNS disorders and disorders with neurological symptoms amenable to protein therapy (e.g., fusions of anti-human TfR binding proteins with therapeutic proteins) include, but are not limited to, Alzheimer's disease, brain cancer, Behcet's disease, cerebral lupus, Creutzfeldt-Jakob disease, dementia, epilepsy, encephalitis, Friedreich's ataxia, Guillain-Barré syndrome, Gaucher disease, headache, hydrocephalus, Huntington's disease, increased intracranial pressure, leukodystrophy, migraine, myasthenia gravis, muscular dystrophy, multiple sclerosis, narcolepsy, neuropathy, Prader-Willi syndrome, Parkinson's disease, Rett syndrome, restless legs syndrome, sleep disorders, subarachnoid hemorrhage, stroke, traumatic brain injury, trigeminal neuralgia, transient ischemic attack, and von Hippel-Lindau syndrome (angiomatosis).

[0133] In some embodiments, the non-human animals described herein, in addition to expressing a heterologous (e.g., human) TfR protein, exhibit one or more symptoms of an enzyme deficiency disease and / or a disease selected from the group consisting of Fabry disease, Gaucher disease, MPS I, MPS II, MPS IIIA, MPS IIIB, MPS IIID, MPS IVB, MPS VI, MPS VII, MPS IX, Pompe disease, lysosomal acid lipase deficiency, metachromatic leukodystrophy, Niemann-Pick disease types A, B, and C2, alpha-mannosidosis, neuraminidase deficiency, sialidosis, aspartylglycosaminuria, combined saposin deficiency, variant Gaucher disease, Farber lipogranulomatosis, fucosidosis, and beta-mannosidosis.

[0134] Enzyme deficiency disorders include non-lysosomal storage disorders such as Krabbe disease (galactosylceramidase), phenylketonuria, galactosemia, maple syrup urine disease, mitochondrial disorders, Friedreich's ataxia, Zellweger syndrome, adrenoleukodystrophy, Wilson's disease, hemochromatosis, ornithine transcarbamylase deficiency, methylmalonic acidemia, and propionic acidemia, as well as lysosomal storage disorders. The term "lysosomal storage disorders" encompasses all disorders resulting from defects in lysosomal function. Currently, approximately 50 lysosomal storage disorders have been identified, the most well-known of which include Tay-Sachs disease, Gaucher disease, and Niemann-Pick disease. The pathogenesis of these disorders is the accumulation of incomplete degradation products within lysosomes, usually due to loss of protein function. Lysosomal storage disorders are caused by loss-of-function or attenuated variants of proteins whose normal function is to degrade or regulate the degradation of lysosomal contents. Proteins associated with lysosomal storage diseases include enzymes, receptors and other transmembrane proteins (e.g., NPC1), post-translationally modified proteins (e.g., sulfatases), membrane transport proteins, and non-enzyme cofactors and other soluble proteins (e.g., GM2 ganglioside activator). Thus, lysosomal storage diseases encompass not only disorders caused by defective enzymes themselves, but also disorders caused by any molecular defect. Thus, as used herein, the term "enzyme" is meant to encompass other proteins associated with lysosomal storage diseases.

[0135] The nature of the molecular damage often influences the severity of the disease: complete loss of function tends to be associated with prenatal or neonatal onset and severe symptoms, whereas partial loss of function is associated with milder, later-onset disease. Generally, only a small percentage of activity needs to be restored to correct the metabolic defect of the defective cells.

[0136] Lysosomal storage diseases are a class of rare disorders that affect the degradation of a wide variety of substrates in lysosomes. These substrates include sphingolipids, mucopolysaccharides, glycoproteins, glycogen, and oligosaccharides, which can accumulate in the cells of disease carriers, leading to cell death. Organs affected by lysosomal storage diseases include the central nervous system (CNS), peripheral nervous system (PNS), lung, liver, bone, skeletal and cardiac muscle, and reticuloendothelial system.

[0137] Treatment options for lysosomal storage diseases include enzyme replacement therapy (ERT), substrate reduction therapy, pharmacological chaperone-mediated therapy, hematopoietic stem cell transplantation, and gene therapy. An example of substrate reduction therapy is the use of miglustat or eliglustat to treat Gaucher type 1. These drugs act by blocking synthase activity, subsequently reducing substrate production. For example, hematopoietic stem cell therapy (HSCT) is used to improve and slow the negative central nervous system phenotype in patients with some forms of MPS. See R.M. Boustany, "Lysosomal storage diseases—the horizon expands," 9(10) Nat. Rev. Neurol. 583-98, October 2013; this reference is incorporated herein by reference in its entirety.

[0138] Two of the most common LSDs are Pompe disease and Fabry disease. Pompe disease, with an estimated incidence of 1 in 10,000, is caused by a defect in the lysosomal enzyme alpha-glucosidase (GAA). GAA hydrolyzes terminal non-reducing (1→4)-linked alpha-glucose residues, liberating a single alpha-glucose molecule. GAA is a carbohydrate hydrolase that liberates α-glucose rather than β-glucose due to the affinity of the active site of GAA. GAA is encoded by the Gaa gene, and non-limiting examples of the amino acid and nucleic acid molecules of the mouse GAA enzyme and mouse Gaa gene are set forth as SEQ ID NO: 48 and SEQ ID NO: 49, respectively.

[0139] GAA dysfunction is involved in Pompe disease, in which GAA deficiency leads to abnormal lysosomal glycogen processing. Lysosomal glycogen accumulation occurs primarily in skeletal, central nervous system, cardiac, and hepatic tissues. Infantile-onset Pompe causes cardiac hypertrophy, hypotonia, hepatomegaly, and death from cardiopulmonary failure, usually before the age of two. Adult-onset Pompe develops in the teens to fifties and usually involves only skeletal muscle. Currently available treatments include Genzyme's MYOZYME® / LUMIZYME® (alglucosidase alpha), a recombinant human alpha-glucosidase produced in CHO cells and administered by intravenous infusion.

[0140] Fabry disease, which has an estimated overall incidence of 1 in 3,000 people, including milder, later-onset cases, is caused by a defect in the lysosomal enzyme alpha-galactosidase A (GLA), leading to the accumulation of globotriaosylceramide in blood vessels and other tissues and organs. Symptoms associated with Fabry disease include pain due to nerve damage and / or small-vessel occlusion, renal dysfunction and eventual failure, cardiac complications (such as hypertension and cardiomyopathy), dermatological symptoms (such as angiokeratoma formation, anhidrosis or hyperhidrosis), and ocular problems (such as cornea verticillata, spoke-like cataracts, and conjunctival and retinal vascular abnormalities). Currently available treatments include Genzyme's FABRAZYME® (agalsidase beta) (recombinant human alpha-galactosidase A produced in CHO cells and administered by intravenous infusion), Shire's REPLAGAL™ (agalsidase alpha) (recombinant human alpha-galactosidase A produced in human fibroblasts and administered by intravenous infusion), and Amicus' GALAFOLD™ (migalastat or 1-deoxygalactonojirimycin), an orally administered small molecule chaperone that alters the aberrant folding of alpha-galactosidase A into a functional conformation.

[0141] Example 3 describes animal models useful for measuring the efficacy of multidomain therapeutics comprising anti-human TfR binding proteins fused to a therapeutic agent in reducing glycogen accumulation in tissues, particularly CNS tissues. In some embodiments, such animal models include non-human animals that have been modified to express a human TfR protein described herein and further modified to contain a knockout mutation in a gene encoding a lysosomal enzyme involved in a lysosomal disorder, such as GAA in Pompe disease.

[0142] Thus, in some embodiments, the animal models disclosed herein are modified to express a human TfR protein as described herein, and are further modified to contain one or more additional genetic mutations such that the non-human animal further exhibits one or more symptoms of a disorder listed in Table 2. Methods for further modifying the non-human animals described herein include, for example, CRISPR-mediated deletion of a gene associated with the disorder, and other well-known recombinant DNA techniques.

[0143] For example, in methods of screening for anti-human TfR binding protein-based therapeutics using the non-human animals disclosed herein (which may be further modified to exhibit one or more symptoms of a disease, e.g., as listed in Table 2), a CRISPR / Cas system can be used, e.g., to insert a candidate anti-TfR binding protein into a locus for expression and / or gene knockout to create an animal model of the disease, whereby the animal disease model also expresses the human TfR protein or a portion thereof. The methods and compositions disclosed herein may utilize nuclease agents, such as a CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) / CRISPR-associated (Cas) system, a zinc finger nuclease (ZFN) system, or a transcription activator-like effector nuclease (TALEN) system, or components of such systems, to modify the target genomic locus of a target gene, such as a safe harbor gene (e.g., ALB), for insertion of a nucleic acid construct disclosed herein. Generally, nuclease agents require the use of an engineered cleavage system to induce a double-stranded break or nick (i.e., a single-stranded break) at the nuclease target site. Cleavage or nicking can occur by using a specific nuclease, such as an engineered ZFN, TALEN, or CRISPR / Cas system, along with an engineered guide RNA to guide the specific cleavage or nicking of the nuclease target site. Any nuclease agent that induces a nick or double-stranded break in a desired target sequence can be used in the methods and compositions disclosed herein. The nuclease agent can be used to create an insertion site at a desired locus (target gene) within the host genome, at which a nucleic acid construct is inserted to express a polypeptide of interest (e.g., a multidomain therapeutic protein). The polypeptide of interest (e.g., a multidomain therapeutic protein) can be exogenous with respect to the insertion site or the locus (target gene), such as a safe harbor locus where the polypeptide of interest is not normally expressed.Alternatively, the polypeptide of interest may be non-exogenous with respect to its site of insertion, such as insertion into an endogenous locus encoding the polypeptide of interest to correct a defective gene encoding the polypeptide of interest.

[0144] In one example, the nuclease agent is a CRISPR / Cas system. In another example, the nuclease agent comprises one or more ZFNs. In yet another example, the nuclease agent comprises one or more TALENs. In a specific example, the CRISPR / Cas system or a component of such a system targets an ALB gene or locus (e.g., an ALB genomic locus) in a cell, or intron 1 of an ALB gene or locus in a cell. In a more specific example, the CRISPR / Cas system or a component of such a system targets a human ALB gene or locus in a cell, or intron 1 of a human ALB gene or locus.

[0145] A CRISPR / Cas system includes transcripts and other elements involved in the expression of or directing the activity of Cas genes. CRISPR / Cas systems can be, for example, Type I, Type II, Type III, or Type V systems (e.g., subtypes VA or VB). The methods and compositions disclosed herein employ CRISPR / Cas systems by utilizing a CRISPR complex (comprising a guide RNA (gRNA) complexed with a Cas protein) for site-directed binding or cleavage of nucleic acids. A CRISPR / Cas system targeting an ALB gene or locus includes a Cas protein (or a nucleic acid encoding a Cas protein) and one or more guide RNAs (or DNA encoding one or more guide RNAs), each of which targets a different guide RNA target sequence in a target genomic locus (e.g., an ALB gene or locus).

[0146] The CRISPR / Cas systems used in the compositions and methods disclosed herein may not be naturally occurring. Non-naturally occurring systems include any that exhibit human involvement, such as being altered or mutated from their naturally occurring state, or being at least substantially free of at least one other component with which they are naturally associated, or one or more components of the system that are associated with at least one other component not naturally associated. For example, some CRISPR / Cas systems use non-naturally occurring CRISPR complexes that include gRNAs and Cas proteins that do not occur together in nature, use non-naturally occurring Cas proteins, or use non-naturally occurring gRNAs.

[0147] In some embodiments, a non-human animal expressing a human TfR protein or portion thereof described herein is further modified with the CRISPR / Cas system described herein to insert an anti-human TfR antibody for expression in the non-human animal and / or to modify a gene associated with a disease listed in Table 2, such that the non-human animal expresses a human TfR protein or portion thereof and exhibits one or more symptoms of the disease.

[0148] In some embodiments, toxicity in animals can be measured as adverse events in the animal, such as changes in body weight, appetite, digestion, changes in blood counts, splenomegaly, histological changes in organs, changes in liver enzyme function, changes in urinalysis results, organ toxicity, bleeding, dehydration, loss and slovenliness of fur, or other signs of pathology. One measure can be determination of cross-reactivity of the binding protein with unrelated antigens, which in one embodiment can be detected by organ histology, specifically detection of the binding protein in tissues or cell types not known to express the antigen of interest.

[0149] Also described are various methods of using the genetically modified non-human animals described herein.

[0150] A brief description of arrays The nucleotide and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and three-letter codes for amino acids. The nucleotide sequences follow the standard convention of starting at the 5'-terminus of the sequence and proceeding toward the 3'-terminus (i.e., from left to right in each column). Only one strand of each nucleotide sequence is shown, but the complementary strand is understood to be included by any reference to the shown strand. The amino acid sequences follow the standard convention of starting at the amino-terminus of the sequence and proceeding toward the carboxy-terminus (i.e., from left to right in each column). [Table 3-1] [Table 3-2] [Example]

[0151] Example 1. TfR-humanized mice (Tfrc hum ) generation and analysis FIG. 1A provides identifying information for the mouse and human transferrin receptor genes (TfR), and FIG. 1B provides an illustrative schematic diagram (not to scale) of the mouse and human transferrin receptor genes and a humanized mouse transferrin receptor targeting vector. As shown in FIG. 1B, exon 1 of both human and mouse TFRC is non-coding. Exon 2 of human and mouse TFRC contains the coding sequence and can be considered coding exon 1. Because exon 2 / coding exon 1 of mouse and human TFRC encodes the same amino acid sequence, exon 2 / coding exon 1 of the mouse TFRC locus may or may not be included in humanization.

[0152] The Tfrc targeting construct was designed as follows. A bacterial artificial chromosome containing the complete mouse Tfrc genomic sequence was modified to humanize the Tfrc locus. As shown in Figure 1B, the mouse Tfrc locus was deleted from within intron 2 to a portion of the Tfrc 3'UTR, preserving noncoding exon 1, intron 1, exon 2 (coding exon 1), and the 5' end of intron 2. This deletion removed the 3'-most 326 bp of mouse intron 2, exons 3 to 18 (and the intervening intron), intron 18, and the coding sequence of mouse exon 19, along with a portion of the 3'UTR. The 3'-most 2021 bp of the mouse 3'UTR was left intact. In place of this deletion, human TFRC genomic sequence was inserted, including the 3'-end 195 bp of human intron 2, exons 3-18 (and the intervening intron), intron 19, the coding sequence of exon 19, and all but the last 32 bp of the human 3' UTR. Part of coding exon 2, intron 2, coding exons 3-18 (and the intervening intron), and 82 bp of the 3' untranslated region (UTR) of mouse Tfrc were replaced with the described human TFRC sequence, including coding exon 1 sequence excluding the first 15 bp (this start sequence remains mouse), intron 1, coding exons 2-4 (and the intervening intron), the complete 3' UTR, and an additional 158 bp after the 3' UTR of human Tfrc (see Figures 1A-1B). A self-deleting hygromycin resistance cassette was inserted downstream of the human sequence, followed by the remainder of the mouse 3' UTR. This targeting vector was then electroporated into a 50% C57Bl / 6NTac / 50% 129SvEvTac embryonic stem cell line. Successfully targeted clones were identified by TaqMan analysis. Tfrc clones were transfected using the VelociGene (c) method (Valenzuela 2003 Nat Biotech PMID: 12730667, Poueymirou 2007 Nat Biotech PMID: 17187059). humMice were generated and backcrossed to C57B1 / 6NTac as needed. The antibiotic resistance cassette was removed in the F0 male germline using a self-deletion technique. Allele loss assays were performed to detect loss of the endogenous mouse allele, and allele gain assays were performed to detect gain of the humanized allele, using primers and probes to detect the absence or presence of the 7228mTU, 7728mTD, 7228hTU, and 7728hTD sequences in the 7228 allele (TfR humanization with the hygromycin self-deletion cassette) or the 7229 allele (TfR humanization after deletion of the hygromycin self-deletion cassette). See Table 4. [Table 4]

[0153] Figure 2 provides a schematic representation (not to scale) of the modified alleles before and after deletion of the self-deleting hygromycin resistance cassette. F0 mice were bred to homozygosity to produce Tfrc hum / hum Tfrc mice were generated, which are referred to herein as Tfrc hum Also called a mouse.

[0154] Gene expression analysis:

[0155] Tfrc hum To verify that mice express TfR at physiological levels and have normal iron homeostasis, we cultured Tfrc mice. hum Tissue TfR expression, serum markers, tissue iron content, and tissue transferrin quantification were compared with wild-type (WT) mice. Overall, the results showed that TfR expression was significantly elevated in the TfR-positive mice compared with wild-type (WT) mice. hum We demonstrated that TfR expression and iron homeostasis were normal in mice.

[0156] Specifically, 6-month-old WT mice (11 males, 4 females) and Tfrc mice were used. hum Mice (10 males, 8 females) were analyzed. Tissues were dissected from mice immediately after death by CO2 asphyxiation, flash-frozen in liquid nitrogen, and stored at -80°C.

[0157] Quantification of Tfr RNA by qPCR:

[0158] Total RNA was isolated from tissues using Trizol according to the manufacturer's protocol (ThermoFisher 15596026). hum Tfr RNA was quantified by Taqman qPCR (ThermoFisher) according to standard protocols using universal primers for exon 1 (GCTGCATTGCGGACTGTAGA; SEQ ID NO: 23 / TCCATCATTCTCAGCTGCTACAA; SEQ ID NO: 24) that amplify from both mice. ΔΔCT values were calculated relative to the WT male group. See Table 5. The results show that Tfr RNA was detected in the humanized Tfr mice.

[0159] Serum assays:

[0160] Blood was collected from mice by cardiac puncture immediately after CO2 asphyxiation, and serum was separated using serum separator tubes (BD Biosciences, 365967). Serum iron and total iron-binding capacity (TIBC) were quantified using standard protocols. Serum hepcidin was quantified by ELISA kit (Intrinsic Life Sciences SKU HMC-001). See Table 6. The results show that humanized Tfr mice exhibited iron homeostasis similar to that of wild-type mice.

[0161] Iron content in tissue:

[0162] The wet tissue was weighed, homogenized, and then dried in an open tube at 56°C for 72 hours. The tissue was then placed in digestion buffer (10% trichloroacetic acid and 37% HCl) and heated at 65°C for 48 hours. To assay iron content, the supernatant was placed in a 96-well plate and incubated in a color development solution (thioglycolic acid, bathophenanthrophosphate, and sodium acetate). Absorbance was read using a Molecular Devices Spectramax i3, and the iron content in the whole tissue piece was calculated by interpolating the absorbance readings of the samples against a standard curve using Graph Pad Prism. Iron content was then calculated based on dry weight. See Table 7. The results indicate that humanized Tfr mice exhibited iron homeostasis similar to that of wild-type mice.

[0163] Transferrin ELISA:

[0164] All tissues were homogenized using a Fastprep-24 5G (MP Biomedicals). Prior to homogenization, tissues were placed in RIPA buffer containing phosphatase and HALT protease inhibitors (ThermoFisher) and homogenized using the organ-specific protocol, followed by centrifugation to pellet debris. Supernatants were collected and assayed for total protein using the Pierce BCA Protein Assay Kit. Absorbance was measured using a Molecular Devices Spectramax i3. After measuring total protein, all samples were diluted to match the lowest concentration sample to ensure uniform ELISA loading. The presence of total transferrin in tissue homogenates was measured using a kit obtained from Abcam (Abcam ab157724). Plates were run according to the supplied protocol using the provided reagents, and absorbance was read using a Molecular Devices Spectramax i3. Sample absorbance readings were interpolated against a standard curve using Graph Pad Prism. See Table 8. The results show that Tfr protein was detected in the humanized Tfr mice. [Table 5] [Table 6] [Table 7] [Table 8]

[0165] Tfrc hum or Tfrc hum Gaa - / - To verify the functionality of the mouse-expressed human TfR protein, an anti-hTfR binding protein fused to the mature peptide of human acid alpha-glucosidase (GAA) was used. Acid alpha-glucosidase hydrolyzes the alpha-1,4 bond between the D-glucose units of glycogen, maltose, and isomaltose. The amino acid sequence of the mature peptide of human alpha-glucosidase used in the fusion protein is shown as SEQ ID NO:52.

[0166] DNA plasmids expressing various anti-hTFRC antibodies in the anti-hTFRCscfv:2xG4S:hGAA format under the liver-specific mouse TTR promoter were transfected into Tfrc. hum Mice were injected with 50 μg of DNA in 0.9% sterile saline diluted to 10% of their body weight (0.1 mL / g body weight). 48 hours after injection, tissues were dissected from mice immediately after death by CO2 asphyxiation, flash-frozen in liquid nitrogen, and stored at -80°C.

[0167] Tissue lysates were prepared by lysis in RIPA buffer containing protease inhibitors (1861282, Thermo Fisher Scientific, Waltham, MA, USA). Tissue lysates were homogenized using a bead homogenizer (FastPrep5, MP Biomedicals, Santa Ana, CA, USA). Cell or tissue lysates were run on SDS-PAGE gels using a Novex system (LifeTech Thermo, XPO4200BOX, LC2675, LC3675, LC2676). The gels were transferred to low-fluorescence polyvinylidene fluoride (PVDF) membranes (IPFL07810, LI-COR, Lincoln, NE, USA) and stained with Revert 700 Total Protein Stain (TPS; 926-11010, LI-COR, Lincoln, NE, USA). Afterwards, the gels were blocked with Odyssey blocking buffer (927-500000, LI-COR, Lincoln, NE, USA) in Tris-buffered saline containing 0.1% Tween® 20. The gels were then stained with antibodies against GAA (ab137068, Abcam, Cambridge, MA, USA) or anti-GAPDH (ab9484, Abcam, Cambridge, MA, USA) and the appropriate secondary antibodies (926-32213 or 925-68070, LI-COR, Lincoln, NE, USA). Blots were imaged on a LI-COR Odyssey CLx.

[0168] Protein band intensity was quantified using LI-COR Image Studio software. Quantitation of the 77 kDa mature GAA band for each sample was determined by first normalizing to the TPS signal of the lane and then normalizing to the GAA level in serum (loading control and liver expression control, respectively). Then, positive control groups, anti-mouse TFRCScfv:hGAA and Tfrc, were used in WT mice. hum The values were compared with those of the negative control group, anti-mTFRCscfv:hGAA, in mice (Figures 6A-6C, Table 9). The results showed that the anti-human TfR antibody clone inhibited Tfrc hum 1 shows delivery of GAA to the mouse cerebrum. [Table 9]

[0169] Capillary depletion of brain samples after hydrodynamic delivery (HDD) of anti-hTFRCscfv:hGAA plasmid. Selective anti-hTFRCscfv:hGAA (see, e.g., Table 9) was administered to Tfrc hum To determine whether hGAA was present in the brain parenchyma without being trapped by BBB endothelial cells, four scFvs (12799, 12839, 12843, and 12847) were selected from this secondary screen based on their high affinity for mature hGAA and cynomolgus monkey TFRC in the parenchymal fraction by Western blot.

[0170] Forty-eight hours after HDD, mice were killed by CO2 asphyxiation and immediately perfused with 30 mL of 0.9% saline. 2 mm coronal sections were collected from the cerebral bregma to -2 mm from bregma and placed in 700 μL of 0.9% saline pH 7.4 containing 10 mM HEPES, 4 mM KCl, 2.8 mM CaCl2, 1 mM MgSO4, 1 mM NaH2PO4, and 10 mM D-glucose on ice. Brain sections were gently homogenized on ice using a glass Dounce homogenizer. An equal volume of 26% dextran (MW 70,000 Da) in physiological buffer was added (final dextran concentration: 13%) and homogenized with 10 additional strokes. Parenchymal (supernatant) and endothelial (pellet) fractions were separated by centrifugation at 5,400 x g for 15 min at 4°C. Fractions were subjected to anti-hGAA Western blots as detailed above (Figure 7, Table 10). Blots were also probed with anti-CD31 endothelial marker (Abcam ab182982). The data indicate that a subset of anti-hTfR antibody clones deliver mature GAA to the brain parenchyma in the scfv:GAA format. [Table 10] [Table 11]

[0171] Capillary depletion of mouse brain samples after liver-reserved AAV8 anti-hTFRCscfv:hGAA treatment. To confirm the findings of the HDD screening in a longer-term treatment model, we targeted Tfrc with selective anti-hTFRCscfv:GAA delivered as episomal liver-reserved AAV8 anti-hTFRCscfv:GAA under the TTR promoter. hum When delivered as AAV8, all four anti-hTFRCscfv:GAA delivered mature hGAA to the brain parenchyma (Figure 8).

[0172] AAV production and in vivo transduction. Recombinant AAV8 (AAV2 / 8) was produced in HEK293 cells. Cells were transfected with three plasmids encoding adenovirus helper genes, AAV8 rep and cap genes, and a recombinant AAV genome flanked by AAV2 inverted terminal repeats (ITRs). On day 5, cells and media were collected, centrifuged, and processed for AAV purification. Cell pellets were lysed by freeze-thawing and clarified by centrifugation. The processed cell lysate and media were layered on an iodixanol gradient column and centrifuged in an ultracentrifuge. The viral fraction was removed from the interface between the 40% and 60% iodixanol solutions and exchanged into 1x PBS using a desalting column. AAV vg was quantified by ddPCR. AAV was diluted with PBS + 0.001% F-68 Pluronic® immediately before injection. Tfrc hum Mice were dosed at 3e12vg / kg body weight in a volume of approximately 100 μL. Four weeks after injection, mice were sacrificed, and capillary removal and Western blotting were performed as described above (Figure 8, Table 12). The data demonstrate that the four selected anti-hTfR antibody clones deliver mature GAA to the brain parenchyma in the scfv:GAA format (AAV8 episomal liver-depot gene therapy). [Table 12]

[0173] Example 2. Tfrc hum GAA - Creation of animals To investigate the efficacy of the human TfR expressed by the modified mice generated in Example 1 as a mouse model for testing anti-TfR binding protein-based therapeutics, for example, to test the ability of the human TfR expressed by these mice to transport macromolecules across the blood-brain barrier, Tfrc hum The genetically modified embryonic stem cells containing at least one allele containing the genetic modification were further modified to disrupt the GAA gene in these embryonic stem cells, thereby creating a Pompe disease model.

[0174] Disruption of both Gaa alleles was achieved using a combination of four SpCas9 guide RNAs (gRNAs), each consisting of an invariant tracrRNA, a scaffold for binding to the SpCas9 enzyme, and a 20-bp guide sequence specific to Gaa, which enables precise double-strand cleavage. The guides direct SpCas9 cleavage near the Gaa initiation ATG (guide 9251mGU (SEQ ID NO: 29), cleavage site 38 bp upstream from the ATG; guide 9251mGU3 (SEQ ID NO: 30), cleavage site 18 bp downstream from the ATG) and after the stop codon (guide 9251mGD3 (SEQ ID NO: 31), cleavage site 677 bp downstream from the stop; guide 9251mGD4 (SEQ ID NO: 32), cleavage site 705 bp downstream from the stop). See, for example, Figures 4 and 5.

[0175] Specifically, a mixture of 125 pmol of each guide complexed with 31.25 pmol of SpCas9 was injected into 2 x 10 ribosomal DNA containing one allele of humanized mouse Tfrc. 6 Hybrid 129S6 / SvEvTac:C57B1 / 6NTac F1 embryonic stem cells (ESCs) were electroporated. Resulting clonal colonies were first screened for loss of both copies of Gaa using an allelic loss assay by TaqMan. See Table 13. [Table 13]

[0176] The deletion size was limited to the region indicated by the retention TaqMan assay. Clones with both Gaa copies deleted were then subjected to Illumina technology to fully characterize the knockout sequence using primers mm_Gaa_AmpF3 and mm_Gaa_AmpR1. See Table 14. [Table 14]

[0177] F0 mice were bred to homozygosity for Tfrc hum / hum Gaa - / - Tfrc mice were generated, which are referred to herein as Tfrc hum Gaa - Mouse, Gaa - / - Tfrc hum Also called a mouse.

[0178] Example 3. Tfrc hum GAA - Animal analysis AAV8 episome liver-reserved anti-hTFRCscfv:GAA using GAA - / - / Tfrc hum Rescue of the glycogen storage phenotype in mice. Three anti-hTFRCscfv:GAA fusion proteins (12839, 12843, and 12847) were tested in a Pompe disease model to determine whether hTFRCscfv:GAA rescued the glycogen storage phenotype. All three normalized glycogen to wild-type levels (Figures 9 and 10).

[0179] AAV production and in vivo transduction were performed as described above. - / - / Tfrc hum Mice were dosed with 2e12vg / kg AAV8. Tissues were harvested 4 weeks post-injection and flash frozen as above. hGAA Western blots were performed as above (Figure 11, Table 15).

[0180] Glycogen quantification (Table 16, Figure 13). Tissues were dissected from mice immediately after CO2 asphyxiation, flash-frozen in liquid nitrogen, and stored at -80°C. Tissues were lysed in distilled water for glycogen determination or in RIPA buffer for protein analysis using a benchtop homogenizer equipped with stainless steel beads. Lysates for glycogen analysis were boiled and centrifuged to remove debris. Glycogen determination was performed by fluorometric analysis using a commercially available kit (K646, BioVision, Milpitas, CA, USA) according to the manufacturer's instructions. The data show that three selected episomal AAV8 liver-retaining anti-hTfR antibody clones significantly increased the GAA - / - / Tfrc hum 1 shows delivery of mature GAA to the CNS, heart, and muscle of mice. [Table 15] [Table 16]

[0181] AAV8 episome liver-reserved anti-hTFRCscfv:GAA using GAA - / - / Tfrc hum Rescue of glycogen storage in mouse brain and muscle. Three selected anti-hTFRCscfv:GAA fusion proteins (12799, 12843, and 12847) were tested in a Pompe disease model mouse to determine whether hTFRCscfv:GAA rescued the glycogen storage phenotype. In this experiment, histology of brain and muscle sections was performed to visualize glycogen in the tissues. All three selected anti-hTFRCscfv:GAA proteins reduced glycogen staining in brain and muscle.

[0182] AAV production and in vivo transduction were performed as described above. - / - / Tfrc humMice were dosed with 4e11vg / kg of AAV8. Four weeks after injection, tissues were frozen for glycogen analysis as described above (Table 17). For histological analysis, animals were perfused with saline (0.9% NaCl) and tissues were drop-fixed overnight in 10% standard-buffered formalin. Tissues were washed three times with PBS and stored in PBS / 0.01% sodium azide until embedding. Tissues were embedded in paraffin, and 5-um sections were cut from the brain (coronal, -2 mm from bregma) and quadriceps muscle (fiber cross-section). Sections were stained with periodic acid-Schiff and hematoxylin using standard protocols (Figures 11A-11D). [Table 17]

[0183] Gaa- / - / Tfrc hum Anti-hTFRC 12847scfv:GAA insertion at the albumin locus in mice

[0184] To determine whether the results seen with episomal AAV8 liver pool expression were reproducible, anti-hTFRC 12847scfv:GAA was further tested in the Pompe disease mouse model described herein with albumin insertion. - / - / Tfrc hum In mice, albumin insertion of 12847scfv:GAA delivered mature hGAA protein to brain and muscle and rescued the glycogen storage phenotype.

[0185] AAV production: A promoterless AAV genome plasmid was created using the 12847scfv:GAA sequence and a mouse albumin exon 1 splice acceptor site at the 3' end. Recombinant AAV8 (AAV2 / 8) was produced in HEK293 cells. Cells were transfected with three plasmids encoding the adenovirus helper genes, the AAV8 rep and cap genes, and the recombinant AAV genome flanked by AAV2 inverted terminal repeats (ITRs). On day 5, cells and media were harvested, centrifuged, and processed for AAV purification. Cell pellets were lysed by freeze-thawing and clarified by centrifugation. The processed cell lysate and media were layered on an iodixanol gradient column and centrifuged in an ultracentrifuge. The viral fraction was removed from the interface between the 40% and 60% iodixanol solutions and exchanged into 1x PBS using a desalting column. AAV vg was quantified by ddPCR.

[0186] In vivo CRISPR / Cas9 insertion into the albumin locus: 3-month-old Gaa - / - / Tfrc hum Mice were dosed via tail vein injection with 3e12vg / kg AAV8 12847scfv:GAA and 3mg / kg LNP gRNA / Cas9 mRNA diluted in PBS + 0.001% F-68 Pluronic®. Mice were sacrificed 3 weeks after injection. Negative control mice received inserted AAV8 without LNP. Positive control mice received 4e11vg / kg episomal liver-depot AAV8 12847scfv:GAA under the TTR promoter (phenotypic rescue data previously shown). Tissues were dissected from mice immediately after CO2 asphyxiation, flash-frozen in liquid nitrogen, and stored at -80°C. Blood was collected from mice by cardiac puncture immediately after CO2 asphyxiation, and serum was separated using serum separator tubes (BD Biosciences, 365967). [Table 18]

[0187] Western Blot: (Table 19, Figure 12A)

[0188] Tissue lysates were prepared by lysis in RIPA buffer containing protease inhibitors (1861282, Thermo Fisher Scientific, Waltham, MA, USA). Tissue lysates were homogenized using a bead homogenizer (FastPrep5, MP Biomedicals, Santa Ana, CA, USA). Cell or tissue lysates were run on SDS-PAGE gels using a Novex system (LifeTech).

[0189] Thermo, XPO4200BOX, LC2675, LC3675, LC2676). The gels were transferred to low-fluorescence polyvinylidene fluoride (PVDF) membranes (IPFL07810, LI-COR, Lincoln, NE, USA) and stained with Revert 700 Total Protein Stain (TPS; 926-11010, LI-COR, Lincoln, NE, USA). Afterwards, the gels were blocked with Odyssey blocking buffer (927-500000, LI-COR, Lincoln, NE, USA) in Tris-buffered saline containing 0.1% Tween® 20. The gels were then stained with antibodies against GAA (ab137068, Abcam, Cambridge, MA, USA) or anti-GAPDH (ab9484, Abcam, Cambridge, MA, USA) and the appropriate secondary antibodies (926-32213 or 925-68070, LI-COR, Lincoln, NE, USA). Blots were imaged on a LI-COR Odyssey CLx.

[0190] Protein band intensity was quantified using LI-COR Image Studio software. Quantitation of the 77 kDa mature GAA band for each sample was determined by normalizing to the TPS signal of the lane (loading control).

[0191] Glycogen Quantitation: (Table 19, Figure 12B)

[0192] Tissues were dissected from mice immediately after death by CO2 asphyxiation, flash-frozen in liquid nitrogen, and stored at -80°C. Tissues were lysed using a benchtop homogenizer equipped with stainless steel beads in distilled water for glycogen assays or RIPA buffer for protein assays. Lysates for glycogen assays were boiled and centrifuged to remove debris. Glycogen assays were performed by fluorometric analysis using a commercially available kit (K646, BioVision, Milpitas, CA, USA) according to the manufacturer's instructions. [Table 19] [Table 20]

[0193] In summary, anti-TfR:GAA protein expressed from hepatocytes was successfully delivered to muscle and CNS cells of test mice, and these mice demonstrated efficient internalization and transport of the human TfR protein expressed therein across the blood-brain barrier.

[0194] All references cited herein are incorporated by reference to the same extent as if each individual publication, database entry (e.g., Genbank sequence or GeneID entry), patent application, or patent were specifically and individually indicated to be incorporated by reference. It is the intent of the applicant that this incorporation-by-reference statement relate to any and all individual publications, database entries (e.g., Genbank sequence or GeneID entry), patent applications, or patents, each of which is clearly identified even if such citation is not in the immediate vicinity of the specific incorporation-by-reference statement. If a specific incorporation-by-reference statement is included herein, this does not in any way diminish the general statement of incorporation-by-reference. The citation of references herein is not intended as an admission that the references are relevant prior art, nor does it constitute any admission as to the content or date of these publications or documents.

Claims

1. A non-human animal cell comprising a nucleic acid sequence encoding a heterologous transferrin receptor (TfR) protein or a portion thereof.

2. 2. The non-human animal cell of claim 1, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal cell comprising:

3. 3. The non-human animal cell of claim 1 or claim 2, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof and intron 2 of the human TFRC gene or a portion thereof; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene; (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or a portion thereof of the human TFRC gene; (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene; (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene; (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene; (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and intron 12 or a portion thereof of the human TFRC gene; (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene and intron 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal cell comprising:

4. 10. The non-human animal cell of claim 1, wherein the nucleic acid sequence encoding the heterologous TfR protein or the portion thereof comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence shown as SEQ ID NO:5, the nucleic acid sequence shown as SEQ ID NO:6, the nucleic acid sequence shown as SEQ ID NO:9, and the nucleic acid sequence shown as SEQ ID NO:

10.

5. The non-human animal cell according to any one of claims 1 to 0, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof is located at the endogenous TfR locus.

6. The non-human animal cell according to any one of claims 1 to 0, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof replaces an orthologous endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof.

7. 7. The non-human animal cell according to any one of claims 1 to 6, wherein the non-human animal cell comprises an endogenous Tfrc locus, the endogenous Tfrc locus comprising an endogenous Tfrc gene comprising a heterozygous or homozygous substitution of an endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof with the nucleic acid sequence encoding the heterologous TfR protein or the portion thereof, The non-human animal cell, wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or said portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof are orthologous.

8. The non-human animal cell according to any one of claims 1 to 7, wherein the heterologous TfR protein or the portion thereof comprises the amino acid sequence of a human TfR protein or a portion thereof.

9. 10. The non-human animal cell according to any one of claims 1 to 0, wherein the heterologous TfR protein or said portion thereof is (i) the amino acid sequence shown as SEQ ID NO: 4; (ii) the amino acid sequence set forth as SEQ ID NO: 25; (iii) the amino acid sequence set forth as SEQ ID NO: 26; (iv) the amino acid sequence set forth as SEQ ID NO: 27; (v) the amino acid sequence set forth as SEQ ID NO: 28, or (vi) Any combination of (i) to (v). The non-human animal cell comprising:

10. The non-human animal cell of any one of claims 1 to 0, wherein the heterologous TfR protein or the portion thereof comprises the amino acid sequence shown as SEQ ID NO:

25.

11. The non-human animal cell according to any one of claims 1 to 0, wherein the non-human animal cell is a mammalian cell.

12. The non-human animal cell according to any one of claims 1 to 0, wherein the non-human animal cell is a rodent cell.

13. The non-human animal cell according to any one of claims 1 to 0, wherein the non-human animal cell is a rat cell or a mouse cell.

14. 10. The non-human animal cell according to claim 1, wherein the heterologous TfR protein is a full-length human TfR protein; The non-human animal cell, wherein the full-length human TfR protein is expressed on the cell surface of the non-human animal cell.

15. The non-human animal cell according to any one of claims 1 to 0, wherein the non-human animal cell is a non-human animal cell identified in Table 1; The non-human animal cell identified in Table 1, wherein the heterologous TfR protein or a portion thereof is expressed on the cell surface of the non-human animal cell.

16. The non-human animal cell according to any one of claims 1 to 13, wherein the non-human animal cell does not express the heterologous TfR protein or a portion thereof on the cell surface of the non-human animal cell.

17. 17. The non-human animal cell of any one of claims 1 to 13 and 16, wherein the non-human animal cell does not express the heterologous TfR protein or said portion thereof on the cell surface, and the non-human animal cell is not a cell identified in Table 1.

18. The non-human animal cell according to any one of claims 1 to 13 and 16 to 17, wherein the non-human animal cell does not express the heterologous TfR protein or a portion thereof on the cell surface, and the non-human animal cell is a pluripotent cell.

19. The non-human animal cell according to any one of claims 1 to 13 and 16 to 18, wherein the non-human animal cell does not express the heterologous TfR protein or a portion thereof on the cell surface, and the non-human animal cell is an embryonic stem cell.

20. The non-human animal cell according to any one of claims 1 to 13 and 16 to 18, wherein the non-human animal cell does not express the heterologous TfR protein or a portion thereof on the cell surface, and the non-human animal cell is a germ cell.

21. The non-human animal cell according to any one of claims 1 to 20, wherein the non-human animal cell is a mouse cell.

22. 21. The non-human animal cell of any one of claims 1 to 20, wherein the non-human animal cell is a mouse cell and the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises the nucleic acid sequence shown as SEQ ID NO:9 or SEQ ID NO:

10.

23. A non-human animal comprising a nucleic acid sequence encoding a heterologous transferrin receptor (TfR) protein or a portion thereof.

24. 24. The non-human animal of claim 23, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal.

25. 25. The non-human animal of claim 23 or claim 24, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof and intron 2 of the human TFRC gene or a portion thereof; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene; (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or a portion thereof of the human TFRC gene; (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene; (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene; (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene; (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and intron 12 or a portion thereof of the human TFRC gene; (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene and intron 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal.

26. 26. The non-human animal of any one of claims 23 to 25, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence shown as SEQ ID NO:5, the nucleic acid sequence shown as SEQ ID NO:6, the nucleic acid sequence shown as SEQ ID NO:9, and the nucleic acid sequence shown as SEQ ID NO:

10.

27. 27. The non-human animal of any one of claims 23 to 26, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof is located at the endogenous TfR locus.

28. 28. The non-human animal of any one of claims 23 to 27, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof replaces an orthologous endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof.

29. 29. The non-human animal of any one of claims 23 to 28, wherein the non-human animal comprises an endogenous Tfrc locus, wherein the endogenous Tfrc locus comprises an endogenous Tfrc gene comprising a heterozygous or homozygous substitution of an endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof with the nucleic acid sequence encoding the heterologous TfR protein or the portion thereof, The non-human animal, wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or said portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof are orthologous.

30. 30. The non-human animal of any one of claims 23 to 29, wherein the heterologous TfR protein or said portion thereof comprises the amino acid sequence of a human TfR protein or portion thereof.

31. 31. The non-human animal of any one of claims 23 to 30, wherein the heterologous TfR protein or said portion thereof is (i) the amino acid sequence shown as SEQ ID NO: 4; (ii) the amino acid sequence set forth as SEQ ID NO: 25; (iii) the amino acid sequence set forth as SEQ ID NO: 26; (iv) the amino acid sequence set forth as SEQ ID NO: 27; (v) the amino acid sequence set forth as SEQ ID NO: 28, or (vi) Any combination of (i) to (v). The non-human animal.

32. The non-human animal of any one of claims 23 to 31, wherein the heterologous TfR protein or said portion thereof comprises the amino acid sequence shown as SEQ ID NO:

25.

33. The non-human animal according to any one of claims 23 to 32, wherein the non-human animal is a mammal.

34. The non-human animal according to any one of claims 23 to 33, wherein the non-human animal is a rodent.

35. The non-human animal according to any one of claims 23 to 34, wherein the non-human animal is a rat or a mouse.

36. 36. The non-human animal of any one of claims 23 to 35, wherein the non-human animal comprises a non-human animal cell identified in Table 1 that expresses the heterologous TfR protein or a portion thereof on its cell surface.

37. The non-human animal according to any one of claims 23 to 36, wherein the non-human animal comprises blood-brain barrier endothelial cells of the non-human animal that express the heterologous TfR protein or a portion thereof on the cell surface.

38. 38. The non-human animal of any one of claims 23 to 37, wherein the heterologous TfR protein comprises a full-length human TfR protein; The non-human animal comprises a non-human animal cell identified in Table 1, which expresses the full-length human TfR protein on its cell surface.

39. The non-human animal according to any one of claims 23 to 38, wherein the non-human animal comprises a non-human animal cell that does not express the heterologous TfR protein or a portion thereof on the cell surface.

40. 40. The non-human animal of any one of claims 0 to 39, wherein the non-human animal comprises germ cells of the non-human animal that do not express the heterologous TfR protein or said portion thereof.

41. The non-human animal according to any one of claims 23 to 40, wherein the non-human animal is a mouse.

42. 1. A non-human animal genome or a non-human animal cell nucleus, wherein said non-human animal genome or said non-human animal cell nucleus comprises a nucleic acid sequence encoding a heterologous transferrin receptor (TfR) protein or a portion thereof.

43. 43. The non-human animal genome or non-human animal cell nucleus of claim 42, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal genome or the non-human animal cell nucleus, comprising:

44. 44. The non-human animal genome or non-human animal cell nucleus of claim 42 or claim 43, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof is (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof and intron 2 of the human TFRC gene or a portion thereof; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene; (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or a portion thereof of the human TFRC gene; (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene; (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene; (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene; (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and intron 12 or a portion thereof of the human TFRC gene; (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene and intron 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal genome or the non-human animal cell nucleus, comprising:

45. 45. The non-human animal genome or non-human animal cell nucleus of any one of claims 42 to 44, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence shown as SEQ ID NO:5, the nucleic acid sequence shown as SEQ ID NO:6, the nucleic acid sequence shown as SEQ ID NO:9, and the nucleic acid sequence shown as SEQ ID NO:

10.

46. 46. The non-human animal genome or non-human animal cell nucleus of any one of claims 42 to 45, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof is located at the endogenous TfR locus.

47. 47. The non-human animal genome or non-human animal cell nucleus of any one of claims 42 to 46, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof replaces an orthologous endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof.

48. 48. The non-human animal genome or non-human animal cell nucleus according to any one of claims 42 to 47, wherein the non-human animal genome comprises an endogenous Tfrc locus, the endogenous Tfrc locus comprising an endogenous Tfrc gene comprising a heterozygous or homozygous substitution of an endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof with the nucleic acid sequence encoding the heterologous TfR protein or the portion thereof; The non-human animal genome or the non-human animal cell nucleus, wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or said portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof are orthologous.

49. 49. The non-human animal genome or non-human animal cell nucleus of any one of claims 42 to 48, wherein the heterologous TfR protein or said portion thereof comprises the amino acid sequence of a human TfR protein or a portion thereof.

50. 50. A non-human animal genome or a non-human animal cell nucleus according to any one of claims 42 to 49, wherein the heterologous TfR protein or said part thereof comprises: (i) the amino acid sequence shown as SEQ ID NO: 4; (ii) the amino acid sequence set forth as SEQ ID NO: 25; (iii) the amino acid sequence set forth as SEQ ID NO: 26; (iv) the amino acid sequence set forth as SEQ ID NO: 27; (v) the amino acid sequence set forth as SEQ ID NO: 28, or (vi) Any combination of (i) to (v). The non-human animal genome or the non-human animal cell nucleus, comprising:

51. 51. The non-human animal genome or non-human animal cell nucleus of any one of claims 42 to 50, wherein the heterologous TfR protein or said portion thereof comprises the amino acid sequence shown as SEQ ID NO:

25.

52. The non-human animal genome or non-human animal cell nucleus according to any one of claims 42 to 51, wherein the non-human animal genome is a mammalian genome or the non-human animal cell nucleus is a mammalian cell nucleus.

53. The non-human animal genome or non-human animal cell nucleus according to any one of claims 42 to 52, wherein the non-human animal genome is a rodent genome or the non-human animal cell nucleus is a rodent cell nucleus.

54. The non-human animal genome or non-human animal cell nucleus according to any one of claims 42 to 53, wherein the non-human animal genome is a rat genome or a mouse genome, or the non-human animal cell nucleus is a rat cell nucleus or a mouse cell nucleus.

55. The non-human animal genome or non-human animal cell nucleus according to any one of claims 42 to 54, wherein the non-human animal genome is a mouse genome or the non-human animal cell nucleus is a mouse cell nucleus.

56. A chimeric nucleic acid molecule comprising a nucleic acid sequence of a modified non-human animal TfR gene, wherein the nucleic acid sequence (a) encodes a TfR protein, and (b) comprises a substitution of the sequence encoding the TfR protein or a portion thereof with a homologous sequence encoding a heterologous TfR protein or a portion thereof; The chimeric nucleic acid molecule, wherein the chimeric nucleic acid molecule encodes a functional TfR protein.

57. 57. The chimeric nucleic acid molecule of claim 56, wherein the chimeric nucleic acid sequence further comprises a promoter and / or regulatory sequence of a non-human animal Tfrc gene.

58. 58. The chimeric nucleic acid molecule of claim 57, wherein the homologous nucleic acid sequence is: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The chimeric nucleic acid molecule comprising:

59. 59. The chimeric nucleic acid molecule of claim 57 or claim 58, wherein the chimeric nucleic acid molecule further comprises a drug selection cassette.

60. 60. The chimeric nucleic acid molecule according to any one of claims 57 to 59, wherein the chimeric nucleic acid molecule comprises: (i) a 5' homology arm upstream of the modified non-human animal Tfrc gene; and (ii) a 3′ homology arm downstream of the modified non-human animal Tfrc gene The chimeric nucleic acid molecule comprising:

61. 61. The chimeric nucleic acid molecule of claim 60, wherein the 5' homology arm and the 3' homology arm undergo homologous recombination with a non-human animal Tfrc gene at a Tfrc locus of interest; the chimeric nucleic acid molecule, wherein after homologous recombination with the non-human animal Tfrc gene at the target Tfrc locus, the modified non-human animal Tfrc gene replaces the non-human animal Tfrc gene at the target Tfrc locus of the non-human animal and is operably linked to an endogenous promoter that drives expression of the modified non-human animal Tfrc gene at the target Tfrc locus of the non-human animal.

62. 62. The chimeric nucleic acid of claim 60 or claim 61, (i) the 5' homology arm comprises the nucleic acid sequence set forth as SEQ ID NO:7; or (i) the 3' homology arm comprises the nucleic acid sequence set forth as SEQ ID NO:8; The chimeric nucleic acid.

63. 63. The chimeric nucleic acid molecule of any one of claims 57 to 62, wherein the nucleic acid sequence of the chimeric nucleic acid comprises the nucleic acid sequence shown as SEQ ID NO:

5.

64. 23. A method for producing a non-human animal cell according to any one of claims 1 to 22, comprising inserting the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof into the genome of the non-human animal cell.

65. 65. The method of claim 64, wherein the non-human animal cell is a non-human animal embryonic stem (ES) cell; The method, wherein the inserting comprises inserting the nucleic acid sequence encoding the heterologous TfR protein or the portion thereof into the genome of the non-human animal ES cell to form a modified non-human animal ES cell comprising the nucleic acid sequence encoding the heterologous TfR protein or the portion thereof in the genome of the non-human animal ES cell.

66. 66. The method of claim 64 or claim 65, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof is inserted into the endogenous Tfrc gene at the endogenous Tfrc locus.

67. 67. The method of any one of claims 64 to 66, wherein said inserting comprises replacing an endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof with said nucleic acid sequence encoding said heterologous TfR protein or a portion thereof; The method, wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or a portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof are orthologous.

68. 68. The method of any one of claims 64 to 67, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The method comprising:

69. 69. The method of any one of claims 64 to 68, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof and intron 2 of the human TFRC gene or a portion thereof; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene; (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or a portion thereof of the human TFRC gene; (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene; (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene; (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene; (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and intron 12 or a portion thereof of the human TFRC gene; (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene and intron 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The method comprising:

70. 70. The method of any one of claims 64 to 69, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, and the nucleic acid sequence set forth as SEQ ID NO:

10.

71. 71. The method of any one of claims 64 to 70, wherein the heterologous TfR protein or portion thereof comprises the amino acid sequence of a human TfR protein or portion thereof.

72. 72. The method of any one of claims 64 to 71, wherein the heterologous TfR protein or portion thereof is (i) the amino acid sequence shown as SEQ ID NO: 4; (ii) the amino acid sequence set forth as SEQ ID NO: 25; (iii) the amino acid sequence set forth as SEQ ID NO: 26; (iv) the amino acid sequence set forth as SEQ ID NO: 27; (v) the amino acid sequence set forth as SEQ ID NO: 28, or (vi) Any combination of (i) to (v). The method comprising:

73. 73. The method of any one of claims 64 to 72, wherein the heterologous TfR protein comprises the amino acid sequence shown as SEQ ID NO:

25.

74. The method according to any one of claims 64 to 73, wherein the non-human animal cell is a mammalian cell.

75. 75. The method of any one of claims 64 to 74, wherein the non-human animal cell is a rodent cell.

76. The method according to any one of claims 64 to 75, wherein the non-human animal cell is a mouse cell or a rat cell.

77. 77. The method of any one of claims 64 to 76, wherein the non-human animal cell is a mouse cell and the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises, consists essentially of, or consists of the nucleic acid sequence set forth as SEQ ID NO:5 or SEQ ID NO:

6.

78. 78. The method of any one of claims 64 to 77, wherein inserting comprises contacting the genome of the non-human animal cell with the chimeric nucleic acid molecule of any one of claims 0 to 63.

79. 79. The method of any one of claims 64 to 78, wherein inserting comprises contacting the genome of said non-human animal cell with the chimeric nucleic acid molecule of any one of claims 56 to 63.

80. A method for producing the non-human animal according to any one of claims 23 to 41, comprising: inserting the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof into the genome of a non-human animal embryonic stem (ES) cell to form a modified non-human animal ES cell comprising the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof in the genome of the non-human animal ES cell; introducing the modified non-human animal ES cells into host embryonic cells in vitro; and gestating the host embryonic cell, which comprises the modified non-human animal ES cell, in a non-human surrogate mother animal, wherein after said gestation, the non-human surrogate mother animal gives birth to a non-human animal offspring, which comprises germ cells comprising the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof.

81. 81. The method of claim 80, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof is inserted into the endogenous Tfrc gene at the endogenous Tfrc locus.

82. 82. The method of claim 80 or claim 81, wherein said inserting comprises replacing an endogenous nucleic acid sequence encoding an endogenous TfR protein or portion thereof with the nucleic acid sequence encoding the heterologous TfR protein or portion thereof; The method, wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or a portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof are orthologous.

83. 83. The method of any one of claims 80 to 82, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The method comprising:

84. 84. The method of any one of claims 80 to 83, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof and intron 2 of the human TFRC gene or a portion thereof; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene; (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or a portion thereof of the human TFRC gene; (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene; (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene; (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene; (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and intron 12 or a portion thereof of the human TFRC gene; (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene and intron 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The method comprising:

85. 85. The method of any one of claims 80 to 84, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, and the nucleic acid sequence set forth as SEQ ID NO:

10.

86. 86. The method of any one of claims 80 to 85, wherein the heterologous TfR protein or portion thereof comprises the amino acid sequence of a human TfR protein or portion thereof.

87. 87. The method of any one of claims 80 to 86, wherein the heterologous TfR protein or portion thereof is (i) the amino acid sequence shown as SEQ ID NO: 4; (ii) the amino acid sequence set forth as SEQ ID NO: 25; (iii) the amino acid sequence set forth as SEQ ID NO: 26; (iv) the amino acid sequence set forth as SEQ ID NO: 27; (v) the amino acid sequence set forth as SEQ ID NO: 28, or (vi) Any combination of (i) to (v). The method comprising:

88. 88. The method of any one of claims 80 to 87, wherein the heterologous TfR protein comprises the amino acid sequence shown as SEQ ID NO:

25.

89. 89. The method of any one of claims 80 to 88, wherein the non-human animal is a mammal.

90. 90. The method of any one of claims 80 to 89, wherein the non-human animal is a rodent.

91. The method of any one of claims 80 to 90, wherein the non-human animal is a mouse or a rat.

92. 92. The method of any one of claims 80 to 91, wherein the non-human animal is a mouse and the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises, consists essentially of, or consists of the nucleic acid sequence set forth as SEQ ID NO:9 or the nucleic acid sequence set forth as SEQ ID NO:

10.

93. 93. A non-human animal according to any one of claims 0 to 0, comprising a binding protein that binds to the heterologous TfR protein, or a non-human animal produced according to the method of any one of claims 80 to 92, wherein the non-human animal expresses the heterologous TfR protein or an extracellular domain thereof on the surface of its cells.

94. 94. The non-human animal of claim 93, wherein the heterologous TfR protein is a human TfR protein.

95. 95. The non-human animal of claim 93 or claim 94, wherein the non-human animal is a mouse.

96. A non-human animal, a non-human animal cell, or a non-human animal genome comprising a knockout mutation of an endogenous α-glucosidase (Gaa) gene.

97. 97. The non-human animal, non-human animal cell, or non-human animal genome of claim 96, wherein the knockout mutation comprises a deletion of the Gaa gene or a portion thereof.

98. 98. The non-human animal, non-human animal cell, or non-human animal genome of claim 96 or claim 97, wherein the knockout mutation comprises a deletion of the entire coding sequence of the Gaa gene.

99. 99. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 96 to 98, wherein the non-human animal, non-human animal cell, or non-human animal genome does not express GAA protein.

100. 100. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 96 to 99, wherein the non-human animal, non-human animal cell, or non-human animal genome comprises an endogenous Gaa gene at an endogenous Gaa locus comprising the sequence set forth as SEQ ID NO: 50 or the sequence set forth as SEQ ID NO:

51.

101. 100. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 96 to 99, further comprising a nucleic acid encoding a heterologous TfR protein or a portion thereof.

102. 102. The non-human animal, non-human animal cell, or non-human animal genome of claim 101, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof; (ii) a nucleic acid sequence comprising exon 3 of the human TFRC gene or a portion thereof; (iii) a nucleic acid sequence comprising exon 4 of the human TFRC gene or a portion thereof; (iv) a nucleic acid sequence comprising exon 5 of the human TFRC gene or a portion thereof; (v) a nucleic acid sequence comprising exon 6 of the human TFRC gene or a portion thereof; (vi) a nucleic acid sequence comprising exon 7 of the human TFRC gene or a portion thereof; (vii) a nucleic acid sequence comprising exon 8 of the human TFRC gene or a portion thereof; (viii) a nucleic acid sequence comprising exon 9 of the human TFRC gene or a portion thereof; (ix) a nucleic acid sequence comprising exon 10 of the human TFRC gene or a portion thereof; (x) a nucleic acid sequence comprising exon 11 of the human TFRC gene or a portion thereof; (xi) a nucleic acid sequence comprising exon 12 of the human TFRC gene or a portion thereof; (xii) a nucleic acid sequence comprising exon 13 of the human TFRC gene or a portion thereof; (xiii) a nucleic acid sequence comprising exon 14 of the human TFRC gene or a portion thereof; (xiv) a nucleic acid sequence comprising exon 15 of the human TFRC gene or a portion thereof; (xv) a nucleic acid sequence comprising exon 16 of the human TFRC gene or a portion thereof; (xvi) a nucleic acid sequence comprising exon 17 of the human TFRC gene or a portion thereof; (xvii) a nucleic acid sequence comprising exon 18 of the human TFRC gene or a portion thereof; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal, the non-human animal cell, or the non-human animal genome, comprising:

103. 103. The non-human animal, non-human animal cell, or non-human animal genome of claim 101 or claim 102, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises: (i) a nucleic acid sequence comprising exon 2 of the human TFRC gene or a coding portion thereof and intron 2 of the human TFRC gene or a portion thereof; (ii) a nucleic acid sequence comprising exon 3 or a portion thereof of the human TFRC gene and intron 3 or a portion thereof of the human TFRC gene; (iii) a nucleic acid sequence comprising exon 4 or a portion thereof of the human TFRC gene and intron 4 or a portion thereof of the human TFRC gene; (iv) a nucleic acid sequence comprising exon 5 or a portion thereof of the human TFRC gene and intron 5 or a portion thereof of the human TFRC gene; (v) a nucleic acid sequence comprising exon 6 or a portion thereof of the human TFRC gene and intron 6 or a portion thereof of the human TFRC gene; (vi) a nucleic acid sequence comprising exon 7 or a portion thereof of the human TFRC gene and intron 7 or a portion thereof of the human TFRC gene; (vii) a nucleic acid sequence comprising exon 8 or a portion thereof of the human TFRC gene and intron 8 or a portion thereof of the human TFRC gene; (viii) a nucleic acid sequence comprising exon 9 or a portion thereof of the human TFRC gene and intron 9 or a portion thereof of the human TFRC gene; (ix) a nucleic acid sequence comprising exon 10 or a portion thereof of the human TFRC gene and intron 10 or a portion thereof of the human TFRC gene; (x) a nucleic acid sequence comprising exon 11 or a portion thereof of the human TFRC gene and intron 11 or a portion thereof of the human TFRC gene; (xi) a nucleic acid sequence comprising exon 12 or a portion thereof of the human TFRC gene and intron 12 or a portion thereof of the human TFRC gene; (xii) a nucleic acid sequence comprising exon 13 or a portion thereof of the human TFRC gene and intron 13 or a portion thereof of the human TFRC gene; (xiii) a nucleic acid sequence comprising exon 14 or a portion thereof of the human TFRC gene and intron 14 or a portion thereof of the human TFRC gene; (xiv) a nucleic acid sequence comprising exon 15 or a portion thereof of the human TFRC gene and intron 15 or a portion thereof of the human TFRC gene; (xv) a nucleic acid sequence comprising exon 16 or a portion thereof of the human TFRC gene and intron 16 or a portion thereof of the human TFRC gene; (xvi) a nucleic acid sequence comprising exon 17 or a portion thereof of the human TFRC gene and intron 17 or a portion thereof of the human TFRC gene; (xvii) a nucleic acid sequence comprising exon 18 or a portion thereof of the human TFRC gene and intron 18 or a portion thereof of the human TFRC gene; (xviii) a nucleic acid sequence comprising exon 19 of the human TFRC gene or a coding portion thereof; or (xix) Any combination of (i) to (xviii) The non-human animal, the non-human animal cell, or the non-human animal genome, comprising:

104. 101. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 101 to 100, wherein the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence set forth as SEQ ID NO:5, the nucleic acid sequence set forth as SEQ ID NO:6, the nucleic acid sequence set forth as SEQ ID NO:9, and the nucleic acid sequence set forth as SEQ ID NO:

10.

105. 101. The non-human animal, non-human animal cell, or non-human animal genome of claims 101 to 100, wherein the nucleic acid sequence encoding the heterologous TfR protein or a portion thereof is located at the endogenous TfR locus.

106. 101. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 101 to 100, wherein the nucleic acid sequence encoding the heterologous TfR protein or portion thereof replaces an orthologous endogenous nucleic acid sequence encoding an endogenous TfR protein or portion thereof.

107. 107. The non-human animal, non-human animal cell, or non-human animal genome according to any one of claims 101 to 106, wherein the non-human animal cell comprises an endogenous Tfrc locus, the endogenous Tfrc locus comprising an endogenous Tfrc gene comprising a heterozygous or homozygous substitution of an endogenous nucleic acid sequence encoding an endogenous TfR protein or a portion thereof with the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof, The non-human animal, the non-human animal cell, or the non-human animal genome, wherein the endogenous nucleic acid sequence encoding the endogenous TfR protein or said portion thereof and the nucleic acid sequence encoding the heterologous TfR protein or said portion thereof are orthologous.

108. 101. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 101 to 100, wherein the heterologous TfR protein or said portion thereof comprises the amino acid sequence of a human TfR protein or portion thereof.

109. 101. The non-human animal, non-human animal cell, or non-human animal genome according to any one of claims 101 to 100, wherein the heterologous TfR protein or said portion thereof comprises: (i) the amino acid sequence shown as SEQ ID NO: 4; (ii) the amino acid sequence set forth as SEQ ID NO: 25; (iii) the amino acid sequence set forth as SEQ ID NO: 26; (iv) the amino acid sequence set forth as SEQ ID NO: 27; (v) the amino acid sequence set forth as SEQ ID NO: 28, or (vi) Any combination of (i) to (v). The non-human animal, the non-human animal cell, or the non-human animal genome, comprising:

110. 101. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 101 to 100, wherein the heterologous TfR protein or said portion thereof comprises the amino acid sequence shown as SEQ ID NO:

25.

111. The non-human animal, non-human animal cell, or non-human animal genome according to any one of claims 101 to 100, wherein the non-human animal is a mammal, the non-human animal cell is a mammalian cell, or the non-human animal genome is a mammalian genome.

112. The non-human animal, non-human animal cell, or non-human animal genome according to any one of claims 101 to 100, wherein the non-human animal is a rodent, the non-human animal cell is a rodent cell, or the non-human animal genome is a rodent genome.

113. The non-human animal, non-human animal cell, or non-human animal genome according to any one of claims 101 to 100, wherein the non-human animal is a rat or a mouse, the non-human animal cell is a rat cell or a mouse cell, or the non-human animal genome is a rat genome or a mouse genome.

114. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 101 to 100, wherein the heterologous TfR protein is a full-length human TfR protein.

115. the non-human animal is a mouse, the non-human animal cell is a mouse cell, or the non-human animal genome is a mouse genome; 115. The non-human animal, non-human animal cell, or non-human animal genome of any one of claims 101 to 114, wherein the nucleic acid sequence encoding a heterologous TfR protein or a portion thereof comprises, consists essentially of, or consists of the nucleic acid sequence set forth as SEQ ID NO:9 or SEQ ID NO:

10.

116. 1. A non-human animal model for testing anti-human TfR binding proteins, comprising: A non-human animal according to any one of claims 23 to 41 and 101 to 114, and The non-human animal model comprises an anti-human TfR binding protein that binds to human TfR.

117. The non-human animal model of claim 116, wherein the anti-human TfR binding protein is fused to a therapeutic agent.

118. The non-human animal model of claim 117, wherein the therapeutic agent is α-glucosidase.

119. A method for producing a Gaa knockout non-human animal, comprising modifying an endogenous Gaa gene at the endogenous Gaa locus of the non-human animal so that the endogenous Gaa gene comprises a knockout mutation of said Gaa gene.

120. A non-human animal, non-human animal cell, or non-human animal genome produced according to any of the methods described herein.