Method for delivering components to microorganospheres
The method of delivering gene-editing components to microorganospheres addresses the limitations of traditional 3D cell culture models by enabling rapid, high-efficiency formation and stable maintenance of patient-derived microenvironments for high-throughput drug screening and personalized medicine.
Patent Information
- Application Number
- JP2025508885
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-17
- Filing Date
- 2023-08-17
- Publication Date
- 2025-09-09
AI Technical Summary
Existing three-dimensional cell culture models, such as tumor spheroids and organoids, are limited by slow expansion, high variability, and difficulty in high-throughput drug screening, making them unsuitable for personalized medicine and rapid drug response testing.
Methods for delivering gene-editing components, such as CRISPR/Cas, to microorganospheres (MOS) with high efficiency, allowing for rapid formation and stable maintenance of patient-derived 3D microenvironments from small biopsies, enabling high-throughput drug screening.
Enables rapid generation of hundreds to thousands of uniformly sized MOSs from a single biopsy, maintaining cellular heterogeneity and viability, facilitating efficient drug screening and personalized treatment planning.
Smart Images

Figure 2025529807000007 
Figure 2025529807000008 
Figure 2025529807000009
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 371,693, filed August 17, 2022, which is incorporated herein by reference in its entirety. [Background technology]
[0002] Systems and methods consistent with the present disclosure generally relate to microorganospheres (MOS). More specifically, in some embodiments, the methods relate to delivering components to MOS. In particular, in some embodiments, the methods relate to delivering gene editing components to MOS for editing RNA or DNA contained within the MOS. The methods also relate to delivering components to MOS for screening drugs and biologics.
[0003] Field Considerations Model cell and tissue systems are useful in biological and medical research. The most common method is to derive immortalized cell lines from tissues and culture them in two-dimensional (2D) conditions (e.g., Petri dishes or well plates). However, while 2D cell lines are very useful for basic research, they do not correlate well with individual patient responses to therapy. In particular, three-dimensional cell culture models have proven particularly useful in developmental biology, disease pathology, regenerative medicine, drug toxicity and efficacy testing, and personalized medicine. For example, spheroids and organoids are three-dimensional cell aggregates that have been studied. However, both organoids and spheroids formed by traditional methods have limitations that limit their usefulness in certain applications.
[0004] Multicellular tumor spheroids were first described in the early 1970s and were obtained by culturing cancer cell lines under non-adherent conditions. Spheroids are typically formed from cancer cell lines as free-floating cell aggregates in ultra-low attachment plates. Spheroids have been shown to maintain more stem cell-associated properties than 2D cell cultures.
[0005] Organoids are in vitro-derived cell aggregates containing a population of stem cells capable of differentiating into cells of major cell lineages. Organoids typically have a diameter greater than 1 mm and are cultured through passage. Organoid cultures typically grow and expand more slowly than 2D cell cultures. Generating organoids from clinical samples requires starting with a sufficient number of viable cells (e.g., hundreds to thousands). Therefore, deriving organoids from small samples, such as biopsies, is often challenging, and even when successful, expanding the culture for applications such as drug testing can take a significant amount of time. Furthermore, organoid size, shape, and cell number vary widely. Organoids may require a complex cocktail of growth factors and culture conditions to grow and express desired cell types.
[0006] Neither tumor spheroids nor organoids are optimal for personalized medicine, such as conducting rapid and reliable screening (especially ex vivo testing of drug response). For example, oncology practices continually face the significant challenge of matching the correct treatment regimen to the correct patient, in addition to balancing the relative benefits and risks to achieve the most favorable outcome. Patient-derived cancer models (PDMCs) may involve the use of organoids (including patient-derived organoids) to facilitate the identification and development of more personalized therapeutic targets. However, while retrospective studies have shown that organoids derived from resected or biopsied patient tumors correlate with patient response to therapy, there are significant limitations to using organoids to guide therapy. As mentioned above, deriving and expanding organoids (especially patient-derived organoids) from tumor samples for drug sensitivity testing takes several months, reducing clinical applicability because patients cannot wait that long to receive treatment. Additionally, the number of organoids required to conduct drug screening with more than a dozen compounds cannot currently be obtained from core biopsy specimens in a clinically feasible timeframe. Core biopsy specimens are often the only available form of tissue from patients with metastatic or inoperable cancer. Significant failure rates in deriving organoids from biopsies also preclude their use as a reliable diagnostic assay. Furthermore, there can be a high degree of variability in organoid size (and potentially organoid response), especially over long culture times and therefore multiple passages.
[0007] Due to their better correlation with patient outcomes, PDMCs have also been utilized to replace 2D cell lines as a high-throughput screening platform for drug discovery, including RNAi, CRISPR, and pharmacological small molecule screening. However, compared to cell lines, these PDMC models (including spheroids and organoids) are typically much slower to expand and manipulate, making them difficult and expensive for high-throughput applications. As the time required to expand these models and amplify cell numbers increases, the fastest-growing clones tend to overwhelm and outcompete other clones in the plastic, thus making the models more homogeneous and losing the original tissue composition and clonal diversity. Furthermore, their relatively large, heterogeneous size and limited diffusivity make them challenging for many automated fluorescence- and imaging-based readout assays.
[0008] Methods, compositions, and devices for generating MOSs, which are patient-derived tissue models (e.g., tumor and / or non-tumor tissue models) from resections or biopsies, have been previously described. In particular, the methods and devices described thus far enable the generation of numerous patient-derived tissue models with predictable and clinically relevant properties from a single biopsy, such as an 18-gauge core biopsy, and can be completed within 7–10 days after biopsy acquisition. This allows for robust and reliable testing and minimizes delays in guiding patient-tailored therapies. Furthermore, such MOSs expand quickly in a highly parallel manner, producing smaller, more uniformly sized units, allowing for better control of cell numbers per unit for high-throughput screening applications and achieving better diffusion (e.g., by increasing the surface-to-volume ratio). Such MOSs are useful models for drug and biopharmaceutical testing, providing a more accurate indication of individual patient responses to such therapies.
[0009] What is further needed are methods for delivering components to MOS, particularly components useful in further assays and drug screening methods, particularly for high throughput screening. Summary of the Invention
[0010] Provided herein are methods for delivering one or more components to MOS. In particular, in some embodiments, the methods relate to delivering gene-editing components to MOS. The methods also relate to editing DNA or RNA contained within MOS. Additional methods include methods for drug screening in MOS and methods for drug screening in MOS containing edited DNA or RNA, particularly high-throughput methods. Also provided herein are methods for delivering components to MOS, and MOS obtained by the methods.
[0011] As shown in Figure 43A, conventional methods are based on introducing components, such as gene editing components, into individual dissociated cells and then generating a 3D tissue model. Figure 43B shows the method provided herein in which the 3D tissue model is generated as an MOS and components are introduced into the MOS.
[0012] Also provided herein are methods for high throughput screening, as shown in Figure 44. MOS are loaded into a high throughput format, for example, a multi-well plate, where each well can contain a different component.
[0013] Furthermore, when delivering components to existing 3D tissue models, such as patient-derived organoids (PDOs), it is difficult to introduce the components in a way that allows them to fully penetrate the tissue model; however, the methods provided herein overcome this challenge.
[0014] Tissues and organs are multicellular structures that self-organize in three dimensions (3D). Cells within tissues interact with neighboring cells and the extracellular matrix (ECM) through biochemical and mechanical signals that maintain tissue specificity and homeostasis. While traditional 2D culture on rigid surfaces fails to replicate in vivo cell behavior, 3D matrices have become increasingly popular as cell culture supports because they can mimic the complex environment that supports cell physiological function, better predict in vivo responses, and thereby reduce the need for animal models.
[0015] RNA interference (RNAi) and plasmid transfection have been widely used as powerful tools for altering the expression of specific genes and observing the resulting phenotypic changes. While nucleic acid transfection is highly effective in the majority of mammalian cells cultured under standard 2D conditions, transfection into solid tissues and 3D models presents additional obstacles. Indeed, one limitation is that organoids are embedded in an extracellular matrix (ECM), which poses a barrier to efficient transfection. Furthermore, organoids grow into dense, compact structures that inhibit the diffusion, penetration, and intracellular accumulation of genetic material, making transfection by conventional techniques challenging. In addition, cells located in the center of 3D structures are often difficult to transfect, making direct transfection of already formed organoids challenging. This poses particular challenges when introducing CRISPR / Cas components, which are larger and have complex three-dimensional structures that must be maintained.
[0016] The present invention provides methods for delivering components, including gene editing components such as CRISPR / Cas, to MOS, which allow gene editing at approximately 80%, or greater than 80%, or greater than 90% efficiency, while maintaining cell viability and allowing for the generation of 3D microenvironments and / or development into organoid and / or tissue models.
[0017] MOS formation and applications Described herein are microorganospheres (MOS), devices and methods for making MOS, and devices and methods for using MOS. Also described herein are methods and systems for using these MOS to screen patients, including for personalized treatment methods.
[0018] Generally, described herein are methods and devices for forming and expanding MOS comprising patient-derived cells, such as cells extracted from a small patient biopsy (e.g., for rapid diagnosis to guide treatment), extracted from resected patient tissue, including resected primary tumors or portions of dysfunctional organs (e.g., for high-throughput screening), and / or extracted from already established PDMCs, including patient-derived xenografts (PDXs) and organoids (e.g., to generate MOS for high-throughput screening).
[0019] These MOSs can be formed from primary cells that are normal (e.g., normal organ tissue) or from tumor tissue. For example, these methods and devices can form MOSs from cancerous tumor biopsy tissue, enabling customized treatments that can be selected using the specific tumor tissue examined. Surprisingly, these methods and devices enable the formation of hundreds, thousands, or tens of thousands (e.g., 500, 750, 1000, 2000, 5000, 10,000, or more) of MOSs from a single tissue biopsy within hours of the biopsy being removed from the patient. Primary cells isolated from a patient biopsy can be combined with a fluid matrix material, such as a substrate basement membrane matrix (e.g., MATRIGEL), to form MOSs. The resulting multiple MOSs can have a predetermined size range (e.g., diameter, e.g., 10 μm to 700 μm, and any subranges therein) and initial number of primary cells (e.g., 1 to 1000, and particularly fewer, such as 1 to 200 cells). Cell number and / or diameter can be controlled, for example, within + / - 5%, 10%, 15%, 20%, 25%, 30%, etc. These MOSs, when formed as described herein, have very high viability (>75%, >80%, >85%, >90%, >95%) and are stable for use and testing within a very short period of time, including within the first 1-10 days after formation (e.g., within 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, etc.). This allows for the rapid testing of potentially vast numbers of patient-specific, biologically relevant MOSs, saving critical time in the development and deployment of patient therapies, such as cancer treatment plans. The MOSs described herein rapidly form three-dimensional (3D) microenvironments, which are 3D cellular structures that recapitulate and correspond to the biopsied tissue environment, such as a 3D tumor microenvironment (tumorspheres with organoid characteristics contained within the MOS). The MOSs described herein may also be referred to as "droplets." Each MOS may include, for example, as part of the fluid matrix material, growth factors and structural proteins (e.g., collagen, laminin, nidogen, etc.) that can mimic the original tissue (e.g., tumor) environment. Each MOS may also include immune cells of the original tissue.Virtually any primary cell tissue can be used, including virtually any tumor tissue.
[0020] For example, to date, MOS have been successfully produced in all tumor types and sites examined (e.g., current success rate of 100%, n=32, including colon cancer, esophageal cancer, skin cancer (melanoma), uterine cancer, bone cancer (sarcoma), kidney cancer, ovarian cancer, lung cancer, and breast cancer from primary and metastatic sites including liver, omentum, diaphragm, etc.). Tissue types used to successfully generate MOS can be metastasized from other locations. The MOS described herein can be grown from fine needle aspirates (FNAs) or from circulating tumor cells (CTCs), e.g., from liquid biopsies. Proliferation and growth are typically seen in as little as 3-4 days, and MOS can be maintained and passaged for several months, or they can be immediately (e.g., within the first 7-10 days) cryopreserved and / or used for assays.
[0021] In particular, methods for forming patient-derived MOS are described herein. These methods may include combining dissociated primary tissue cells (including, but not limited to, cancer / abnormal tissue, normal tissue, etc.) with a liquid matrix material to form an unpolymerized material, and then polymerizing the unpolymerized material to form a MOS in which the dissociated primary tissue cells are typically distributed less than about 1000 μm in diameter (e.g., less than about 900 μm, less than about 800 μm, less than about 700 μm, less than about 600 μm, and particularly less than about 500 μm). The number of dissociated cells can be within a predetermined range, as described above (e.g., about 1 to 500 cells, about 1 to 200 cells, about 1 to 150 cells, about 100 cells, about 1 to 75 cells, about 1 to 50 cells, about 1 to 30 cells, about 1 to 20 cells, about 1 to 10 cells, about 5 to 15 cells, about 20 to 30 cells, about 30 to 50 cells, about 40 to 60 cells, about 50 to 70 cells, about 60 to 80 cells, about 70 to 90 cells, about 80 to 100 cells, about 90 to 110 cells, etc., including ranges such as about 1 cell, about 10 cells, about 20 cells, about 30 cells, about 40 cells, about 50 cells, about 60 cells, and about 70 cells).
[0022] Any of these methods, as described herein, can be configured to produce MOS of reproducible size (e.g., with a narrow size distribution) and MOS containing immune cells. Dissociated cells may be freshly biopsied or dissociated in any suitable manner, including mechanical and / or chemical dissociation (e.g., enzymatic degradation using one or more enzymes, such as collagenase, trypsin, etc.). Dissociated cells may optionally be treated, selected, and / or modified. For example, cells may be sorted or selected to identify and / or isolate cells with one or more characteristics (e.g., size, morphology, etc.). Cells may be marked (e.g., with one or more markers) that can be used to aid in selection. Cells may be sorted by known cell sorting techniques, including, but not limited to, microfluidic cell sorting, fluorescence-activated cell sorting, magnetic-activated cell sorting, etc. Alternatively, cells may be used without sorting.
[0023] Dissociated cells can be modified by treatment with one or more drugs prior to MOS formation. For example, cells can be genetically modified. Cells can be modified using CRISPR / Cas9 or other gene editing techniques. Cells can be transfected by any suitable method (e.g., electroporation, cell squeezing, nanoparticle injection, magnetofection, chemical transfection, viral transfection, etc.), including transfection with plasmids, RNA, siRNA, etc. Alternatively, cells can be used without modification.
[0024] One or more additional materials may be combined with the dissociated cells and fluid (e.g., liquid) matrix material to form an unpolymerized mixture. For example, the unpolymerized mixture may include additional cell or tissue types, including support cells. The additional cells or tissues may be derived from a different biopsy (e.g., primary cells from a different dissociated tissue) and / or cultured cells. The additional cells may be, for example, immune cells, stromal cells, endothelial cells, etc. The additional materials may include media (e.g., growth medium, freezing medium, etc.), growth factors, support network molecules (e.g., collagen, glycoproteins, extracellular matrix, etc.), etc. The additional materials may include drug compositions. The unpolymerized mixture includes only the dissociated tissue sample (e.g., primary cells) and fluid matrix material.
[0025] The method can rapidly generate multiple MOSs from a single tissue biopsy, resulting in the formation of greater than about 500 patient-derived MOSs per biopsy (e.g., greater than about 600, greater than about 700, greater than about 800, greater than about 900, greater than about 1000, greater than about 2000, greater than about 2500, greater than about 3000, greater than about 4000, greater than about 5000, greater than about 6000, greater than about 7000, greater than about 8000, greater than about 9000, greater than about 10,000, greater than about 11,000, greater than about 12,000, etc.). The biopsies can be standard-sized biopsies, such as 18G (e.g., 14G, 16G, 18G, etc.) core biopsies. For example, the volume of tissue removed by biopsy and used to form the multiple MOSs can be a small cylinder (collected with a biopsy needle) about 1 / 32 to 1 / 8 inch in diameter and about 3 / 4 to 1 / 4 inch in length, e.g., about 1 / 16 inch diameter by 1 / 2 inch in length. The biopsy can be obtained by needle biopsy, e.g., core needle biopsy. The biopsy can be performed by fine needle aspiration. Other biopsy types that can be used include shave biopsy, punch biopsy, incisional biopsy, excisional biopsy, etc. Typically, material from a single patient biopsy can be used to generate multiple MOSs (e.g., greater than about 2000, greater than about 5000, greater than about 7500, greater than about 10,000, etc.) as described above. Multiple patient MOSs can be formed using an apparatus (described herein) that can be configured to generate this large number of highly regular (size, cell count, etc.) MOSs. These methods and apparatus can generate multiple MOSs at high speeds (e.g., greater than about 1 MOS per minute, greater than about 1 MOS per 10 seconds, greater than about 1 MOS per 5 seconds, greater than about 1 MOS per 2 seconds, greater than about 1 MOS per second, greater than about 2 MOS per second, greater than about 3 MOS per second, greater than about 4 MOS per second, greater than about 5 MOS per second, greater than about 10 MOS per second, greater than 50 MOS per second, greater than 100 MOS per second, greater than 125 MOS per second, etc.).
[0026] For example, these methods can be performed by combining the unpolymerized mixture with a material (e.g., a liquid material) that is immiscible with the unpolymerized material. The methods and devices can control the size and / or cell density of the MOS by, at least in part, controlling the flow of one or more of the unpolymerized mixture (and / or dissociated tissue and fluid matrix) and a material (e.g., a hydrophobic material, oil, etc.) that is immiscible with the unpolymerized mixture. For example, these methods can be performed using a microfluidic device. Multiple MOSs can be formed in parallel (e.g., two in parallel, three in parallel, four in parallel, etc.). Thus, the same device can include multiple parallel channels that can be coupled to the same source of unpolymerized material, or the same source of dissociated primary tissue and / or fluid matrix.
[0027] The unpolymerized material can be polymerized to form the MOS in a variety of different ways. In some embodiments, the method can include polymerizing the MOS by changing the temperature (e.g., increasing the temperature above a threshold value, such as above about 20° C., above about 25° C., above about 30° C., above about 35° C., etc.).
[0028] Once polymerized, the MOS may be grown, for example, in culture, and / or assayed either before or after culture, and / or cryopreserved either before or after culture. The MOS may be cultured for any suitable period of time. In particular, it may be cultured for 1 to 10 days (e.g., 1 to 9 days, 1 to 8 days, 1 to 7 days, 1 to 6 days, 3 to 9 days, 3 to 8 days, 3 to 7 days, etc.). The MOS may be cryopreserved or assayed before six passages, which may maintain cellular heterogeneity within the MOS and may prevent faster-dividing cells from outcompeting slower-dividing cells by limiting the number of passages.
[0029] Generally, biopsies from the same patient can provide high numbers of cells (e.g., more than 2,000, more than 3,000, more than 4,000, more than 5,000, more than 6,000, more than 7,000, more than 8,000, more than 9,000, more than 10,000, etc.), so that a portion of the MOS can be cultured and / or assayed while a portion (e.g., more than half) is cryopreserved.
[0030] As described in more detail herein, cryopreserved MOS can be banked and later used (e.g., assayed and passaged). Accordingly, methods are described herein, including methods for forming a plurality of MOS. For example, a method for forming a plurality of MOS can include combining a dissociated tissue sample and a fluid matrix material to form an unpolymerized mixture, forming a plurality of droplets of the unpolymerized mixture, and polymerizing the droplets to form a plurality of MOSs, each having a diameter of 50-500 μm and containing 1-200 dissociated cells distributed therein.
[0031] For example, a method of forming a plurality of MOSs may include combining a dissociated tissue sample and a fluid matrix material to form an unpolymerized mixture; forming a plurality of droplets from a continuous stream of the unpolymerized mixture, wherein the droplets have a size of less than 25% of the embodiments; and polymerizing the droplets by heating to form a plurality of MOSs, each MOS having 1-200 dissociated cells dispersed within the MOS.
[0032] Methods described herein for forming a plurality of MOSs may include combining a dissociated tissue sample and a fluid matrix material to form an unpolymerized mixture; converging a stream of the unpolymerized mixture with one or more streams of a fluid that is immiscible with the unpolymerized mixture to form a plurality of droplets having a size of less than 25% of the droplet size; polymerizing the droplets to form a plurality of MOSs having a diameter of 50-500 μm and having 1-200 dissociated cells distributed therein; and separating the plurality of MOSs from the immiscible fluid.
[0033] Any of these methods may involve modifying the cells within the dissociated tissue sample prior to forming the droplets.
[0034] Forming the plurality of droplets can include forming a plurality of uniformly sized droplets of the unpolymerized mixture having a size of less than about 25% of an embodiment (e.g., a size of less than about 20% of an embodiment, a size of less than about 15% of an embodiment, a size of less than about 10% of an embodiment, a size of less than about 8% of an embodiment, a size of less than about 5% of an embodiment, etc.). Size embodiments can also be described as narrowly distributed size embodiments. For example, the size distribution can include a MOS size distribution (e.g., MOS diameter vs. number of MOS formed) having a low standard deviation (e.g., a standard deviation of 15% or less, a standard deviation of 12% or less, a standard deviation of 10% or less, a standard deviation of 8% or less, a standard deviation of 6% or less, a standard deviation of 5% or less, etc.).
[0035] Any of these methods may also include seeding or dispensing the MOS. For example, the methods may include combining MOS from various sources into a receptacle prior to assaying. For example, the MOS may be placed in a multiwell plate. Thus, any of these methods may include dispensing the MOS into a multiwell plate prior to assaying the MOS. One or more (or equal amounts) of MOS may be included per well.
[0036] Applying the MOS to the receptacle may include disposing the MOS into multiple chambers separated by at least partially permeable membranes to allow circulation of supernatant material between the chambers, which may allow the MOS to share the same supernatant.
[0037] In any of these methods, MOS can be assayed. Assays generally involve exposing or treating individual MOS to a condition (e.g., a drug composition or combination of drug compositions, including, but not limited to, any of the drug compositions described herein) to determine whether (and, in some cases, what effect) the condition has on the cells of the MOS. Assays can involve exposing a subset of MOS (individually or in groups) to one or more concentrations of a drug composition and allowing the MOS to remain exposed for a predetermined period of time (minutes, hours, days, etc.), and / or exposing and removing the drug composition, then culturing the MOS for a predetermined period of time. The MOS can then be examined to identify any effects, including toxicity to the cells in the MOS, or changes in the morphology and / or growth of the cells in the MOS. Assaying can include marking live or fixed cells within the MOS (e.g., by immunohistochemistry). Cells can be assayed (e.g., examined) manually or automatically. For example, an automated reader device can be used to examine the cells to determine any toxicity (cell death). Assaying multiple MOS can include sampling one or more of the supernatant, environment, and microenvironment of the MOS for secreted factors and other effects. MOS can be recovered after assay for further assay, expansion, or storage (e.g., cryopreservation, fixation, etc.) for subsequent testing.
[0038] As mentioned above, virtually any assay can be used. For example, genomic, transcriptomic, proteomic, or metagenomic markers (such as methylation) can be assayed using the MOS described herein. Thus, any of these compositions and methods described herein can be used to identify or examine one or more markers and biological / physiological pathways (including, for example, exosomes), which can help identify drugs and / or therapies for treating patients.
[0039] Any suitable tissue sample may be used. The tissue sample may include a biopsy sample from a metastatic tumor. For example, the tissue sample may include a clinical tumor sample, which may include both cancer cells and stromal cells. The tissue sample may include tumor cells and one or more of mesenchymal cells, endothelial cells, and immune cells.
[0040] Any of the methods described herein may include initially dissociating dissociated cells from a tissue biopsy at any suitable concentration, either uniformly or non-uniformly, throughout a fluid matrix material. For example, the methods described herein may include combining a dissociated tissue sample with a fluid matrix material to dissociate the dissociated tissue cells at a concentration of 1×10 6 or more within the fluid matrix material. 7 Density of less than 9 x 10 cells / ml (e.g., 6 cells / ml, 7×10 6 cells / ml, 5×10 6 cells / ml, 3×10 6 cells / ml, 1×10 6 cells / ml, 9×10 5 cells / ml, 7×10 5 cells / ml, 5×10 5 This may include distributing the cells at a density less than 10 ...
[0041] Generally, forming droplets can include forming droplets from a continuous stream of unpolymerized mixture. For example, forming droplets can include applying one or more converging streams of a fluid immiscible with the unpolymerized mixture to the stream of unpolymerized mixture. The streams can be combined in a microfluidic device, such as a device with multiple converging channels in which the unpolymerized mixture and the immiscible fluid interact to form droplets with precisely controlled volumes. Droplets can be formed (e.g., pinched off) in an excess of immiscible material, and the droplets can polymerize simultaneously and / or subsequently to form a MOS. For example, the region where the streams converge can be configured to polymerize the unpolymerized mixture after the droplets are formed, e.g., by heating, and / or a downstream region can be configured to polymerize the unpolymerized mixture after the droplets are formed and surrounded by the immiscible material. The immiscible material can be heated (or alternatively cooled) to a temperature that promotes polymerization of the unpolymerized material to form a MOS. For example, polymerization can include heating the droplets to above 35°C.
[0042] Thus, in any of these methods, forming the droplets may include forming the droplets in a fluid that is immiscible with the unpolymerized mixture. Further, any of these methods may include separating the immiscible fluid from the MOS. Further, any of these methods may include removing the immiscible fluid from the MOS. Generally, the immiscible fluid may include a material that is immiscible with the unpolymerized (e.g., aqueous) material, such as a liquid (e.g., oil, polymer, etc.), particularly a hydrophobic material.
[0043] The fluid matrix material can be a synthetic or non-synthetic unpolymerized basement membrane material. The unpolymerized basement membrane material can include a polymeric hydrogel. The fluid matrix material can include MATRIGEL. Thus, combining the dissociated tissue sample and the fluid matrix material can include combining the dissociated tissue sample with a basement membrane matrix.
[0044] The tissue sample may be combined with the fluid matrix material within 6 hours or sooner (e.g., within about 5 hours, within about 4 hours, within about 3 hours, within about 2 hours, within about 1 hour, etc.) after the tissue sample is removed from the patient.
[0045] Also described herein are methods for assaying or storing MOS. For example, the methods can include combining a dissociated tissue sample and a fluid matrix material to form an unpolymerized mixture, forming a plurality of droplets of the unpolymerized mixture, the droplets having a size of less than 25% of the embodiment, polymerizing the droplets to form a plurality of MOSs having diameters of 50-700 μm and having 1-1000 dissociated cells distributed therein, and assaying or cryopreserving the plurality of MOSs.
[0046] The method may include combining a dissociated tissue sample and a fluid matrix material to form an unpolymerized mixture; forming a plurality of droplets of the unpolymerized mixture; polymerizing the droplets to form a plurality of MOSs, each having a diameter of 50-500 μm and having 1-200 dissociated cells distributed therein; and cryopreserving or assaying the plurality of MOSs within 15 days, wherein assaying the MOSs to determine the effect of one or more agents on cells within the MOSs.
[0047] For example, the method may include combining a dissociated tissue sample and a fluid matrix material to form an unpolymerized mixture; converging a stream of the unpolymerized mixture with one or more streams of a fluid that is immiscible with the unpolymerized mixture to form a plurality of droplets, each droplet having a size of less than 25% of the size of the droplets; polymerizing the droplets by warming them to form MOSs, each MOS having a diameter of 50-500 μm and having 1-200 dissociated cells distributed therein; and assaying or cryopreserving the MOSs prior to six passages, thereby maintaining cellular heterogeneity within the MOSs; and further comprising assaying to determine the effect of one or more agents on the cells within the MOSs.
[0048] In any of these methods, the plurality of MOSs may be cryopreserved or assayed prior to the sixth passage, thereby maintaining cellular heterogeneity within the MOS. Any of these methods may further include modifying the cells within the dissociated tissue sample prior to forming the droplets.
[0049] Forming the droplets can include forming a plurality of uniformly sized droplets of the unpolymerized mixture having a size of less than about 25% of the embodiments (e.g., less than about 20%, less than about 15%, less than about 10%, less than about 7%, less than about 5%, etc.).
[0050] Any of these methods may include culturing the MOS for an appropriate length of time (e.g., culturing the MOS for 2-14 days prior to assay), as described above. For example, these methods may include removing the immiscible fluid from the MOS prior to culturing. Culturing the MOS may include culturing the MOS in suspension.
[0051] Generally, assaying a MOS can include genomic, transcriptional, epigenomic, and / or metabolic analysis of cells in the MOS before and / or after assaying or cryopreserving the MOS. Any of these methods can include assaying the MOS by exposing the MOS to a drug (e.g., a drug composition).
[0052] In any of these methods, assaying can include manually and / or automatically visually assaying the effect of one or more agents on the cells in the MOS. Any of these methods can include marking or labeling the cells in the MOS for visualization. For example, assaying can include fluorescently assaying the effect of one or more agents on the cells.
[0053] The MOS described herein is novel and may be characterized as a composition of matter. For example, the composition of matter may include a plurality of cryopreserved MOS, each MOS having a spherical shape with a diameter of 50 μm to 500 μm, comprising a polymerized substrate and approximately 1 to 1,000 dissociated primary cells distributed within the substrate that have been passaged less than six times, thereby maintaining cellular heterogeneity within the MOS. The MOS may include cells of the immune system ("immune cells").
[0054] Also described herein is a composition of matter comprising a plurality of cryopreserved MOSs, each MOS having a spherical shape with a diameter of 50 μm to 500 μm, the MOS having a size of less than 25% of the embodiment, each MOS comprising a polymerized substrate, and approximately 1 to 500 dissociated primary cells that have been passaged less than 6 times distributed within the substrate, thereby maintaining cellular heterogeneity within the MOSs. The MOS may contain immune cells of the tissue of origin.
[0055] The primary cells may be primary tumor cells. For example, dissociated primary cells may be genetically or biochemically modified. The plurality of cryopreserved MOSs may be uniform in size, in embodiments where the size is less than 25%. The plurality of cryopreserved MOSs may include MOSs from various sources. Any of these MOSs may include a majority of cells in each MOS that are not stem cells. The primary cells may include metastatic tumor cells. The primary cells may include both cancer cells and stromal cells. The primary cells include tumor cells and one or more of mesenchymal cells, endothelial cells, and immune cells.
[0056] Primary cells are plated in polymerized substrate at, for example, 5 x 10 7 cells / ml, 1×10 7 cells / ml, 9×10 6 cells / ml, 7×10 6 10 cells / ml, 5×10 6 cells / ml, 1×10 6 cells / ml, 9×10 5 cells / ml, 7×10 5 cells / ml, 5×10 5 cells / ml, 1×10 5It may be distributed at a density less than, for example, cells / ml.
[0057] Generally, the polymerized substrate may comprise a basement membrane matrix (e.g., MATRIGEL). The polymerized substrate may comprise a synthetic material.
[0058] Microorganoids may have a diameter of 50 μm to 1000 μm, or more preferably 50 μm to 700 μm, or more preferably 50 μm to 500 μm, or 50 μm to 400 μm, or 50 μm to 300 μm, or 50 μm to 250 μm, etc. (e.g., less than about 500 μm, less than about 400 μm, less than about 300 μm, less than about 250 μm, less than about 200 μm, etc.).
[0059] As mentioned above, the MOSs described herein can initially include any suitable number of primary tissue cells in each MOS (e.g., less than about 200 primary cells, or more preferably less than about 150 primary cells, or more preferably less than about 100 primary cells, or more preferably less than about 75 primary cells, or less than about 50 cells, or less than about 30 cells, or less than about 25 cells, or less than about 20 cells, or less than about 10 cells, or less than about 5 cells, etc.). Each MOS can include about 1-500 cells, about 1-400 cells, about 1-300 cells, about 1-200 cells, about 1-150 cells, about 1-100 cells, about 1-75 cells, about 30-50 cells, about 1-30 cells, about 1-25 cells, about 1-20 cells, etc.
[0060] Also described herein are devices for forming MOSs and methods of operating these devices to form MOSs. For example, a method of operating a MOS-forming device is described herein, the method including receiving, at a first port, an unpolymerized mixture including a cooled mixture of a dissociated tissue sample and a first fluid matrix material, receiving, at a second port, a second fluid that is immiscible with the unpolymerized mixture, combining the stream of unpolymerized mixture with one or more streams of the second fluid to form droplets of the unpolymerized mixture having uniform sizes that vary by less than 25%, and polymerizing the droplets of the unpolymerized mixture to form a plurality of MOSs.
[0061] A method of operating a MOS forming apparatus includes receiving, at a first port, an unpolymerized mixture comprising a cooled mixture of a dissociated tissue sample and a first fluid matrix material; receiving, at a second port, a second fluid that is immiscible with the unpolymerized mixture; combining the flow of the unpolymerized mixture at a first rate with one or more flows of the second fluid at a second rate to form droplets of the unpolymerized mixture having uniform sizes that vary by less than 25%, wherein the droplets are between 50 μm and 500 μm in diameter; and polymerizing the droplets of the unpolymerized mixture to form a plurality of MOSs.
[0062] Any of these methods may include coupling a first reservoir containing an unpolymerized mixture in fluid communication with a first port. For example, the method may include combining a dissociated tissue sample and a first fluid matrix material to form an unpolymerized mixture. The method may include adding the unpolymerized mixture to a first reservoir in fluid communication with the first port. Any of these methods may include coupling a second reservoir containing a second fluid in fluid communication with a second port. Any of these methods may include adding the second fluid to a second reservoir in fluid communication with the second port. Receiving the second fluid may include receiving an oil.
[0063] Generally, these methods can include separating a second fluid (e.g., an immiscible fluid) from the plurality of MOS. This fluid can be separated manually or automatically. For example, the second (immiscible) fluid can be removed by washing, filtering, or any other suitable method.
[0064] Combining the flows can include driving a flow of the unpolymerized mixture at a first flow rate across one or more flows of a second fluid moving at a second flow rate. The first flow rate can be greater than the second flow rate. Either or both of the flow rate and / or the amount of material (e.g., the unpolymerized mixture) can be present in a lesser amount than the second fluid such that the unpolymerized mixture is encapsulated in precisely controlled droplets, as described herein, that can then be polymerized (e.g., within the second fluid).
[0065] Combining the streams can include driving the stream of the unpolymerized mixture across a junction where one or more streams of the second fluid also converge. Polymerizing the droplets can include heating the droplets to a temperature above a temperature at which the unpolymerized material polymerizes (e.g., greater than about 25°C, greater than about 30°C, greater than about 35°C, etc.).
[0066] Any of these methods may involve aliquoting multiple MOS, for example, into a multi-well dish.
[0067] Also described herein are methods for treating patients with these MOSs and methods for assaying them. For example, the method may include obtaining a patient biopsy from a tumor; forming a plurality of MOSs from the patient biopsy within two weeks of taking the biopsy, the MOSs having a diameter of 50-500 μm and including 1-200 dissociated tumor cells distributed through a polymerized matrix; exposing at least a portion of the MOSs to a drug formulation before the dissociated tumor cells have undergone more than five passages to determine that the tumor will respond to the drug formulation; and measuring the effect of the drug formulation on cells within at least a portion of the MOS and determining whether the drug will treat the tumor based on the determined effect.
[0068] These methods may include obtaining a second patient biopsy after the patient has been treated with the drug formulation, forming a second plurality of MOSs from the second patient biopsy, exposing at least a portion of the second plurality of MOSs to the drug formulation, and measuring the effect of the drug formulation on cells within at least a portion of the second plurality of MOSs, thereby determining that the tumor remains responsive to the drug formulation after one or more administrations of the drug to the patient.
[0069] Determining that the tumor will respond to a drug formulation can include exposing at least a portion of the MOS to a plurality of drug formulations and reporting a measured effect for each of the drug formulations. Determining can further include dispensing the MOS into a multi-well plate before assaying the MOS.
[0070] Any of these methods may include biopsying the patient to collect a patient biopsy (or otherwise obtaining a tissue sample from the patient or a sample of tissue or cells derived from the patient), and / or treating the patient with a drug formulation or assisting a physician in treating the patient (e.g., making a recommendation to the physician as to which drug formulation would be effective). Generally, the time from taking the biopsy to reporting can be less than about 21 days (e.g., less than about 15 days, less than about 14 days, less than about 13 days, less than about 12 days, less than about 11 days, less than about 10 days, less than about 9 days, less than about 8 days, less than about 7 days, etc.).
[0071] MOS can be used to test specific therapies that were previously difficult to test. Unlike traditional bulk organoid formation, immune system cells ("immune cells") present in biopsied patient-derived tissue (e.g., from a tumor) can be present and persist in the MOS upon their formation, even after extensive processing for MOS formation as described herein. Immune cells in MOS prepared as described herein can persist for 7 days or more, and in some cases, 14 days or more. Immune cells may persist for 21 days or more. Furthermore, when using traditional bulk organoids, some therapies, such as certain immuno-oncology therapies and T cell biopharmaceuticals, can have difficulty penetrating, reaching, and interacting with patient-derived tissue (e.g., from a tumor). In contrast, MOS allows these drugs to penetrate more easily.
[0072] Because the MOS formation described herein allows for the incorporation of immune cells from patient-derived tissues, the accuracy of testing the aforementioned drug formulations in MOS is superior to testing in conventional bulk organoids. In addition, patient-derived immune cells can be introduced separately into already formed MOS due to their ease of penetration. Patient-derived tissues (e.g., tumor-derived) contain various immune cells naturally produced by the patient's body. A patient's response to a particular drug formulation (e.g., immuno-oncology drugs and biologics) may be directly influenced by immune cells present at the target site. MOS produced as described herein may be advantageous for such drug testing, and the drugs described herein can be tested in MOS containing immune cells from the tissue of origin at the time of formation, or in MOS containing immune cells introduced after the MOS is formed.
[0073] In some cases, it may be desirable to utilize therapies derived from a patient's own immune cells. For example, in autologous immune-enhancing therapies, immune cells are (i) removed from the patient's body, (ii) cultured and treated until they are activated, e.g., to resist cancer, and (iii) returned to the patient. Because such enhanced immune cells are difficult to infiltrate into traditional bulk organoids, testing the efficacy of the enhanced immune cells in vitro can be challenging. However, the size and composition of MOS allows for the incorporation of such enhanced immune cells. Therefore, MOS can be used to test the efficacy of the enhanced immune cells in patients, reducing the risk of ineffective immune cell infusions or requiring supplemental immune cell harvesting for additional infusions.
[0074] The accompanying drawings, which are incorporated in and constitute a part of this disclosure, illustrate various methods, embodiments, and aspects of the present invention and background of the invention. [Brief explanation of the drawings]
[0075] [Figure 1] Figures A-C show patient-derived MOSs formed as described herein containing a single dissociated primary tissue cell per MOS, cultured for 1 day (A), 3 days (B), and 7 days (C). The cells were derived from colorectal cancer (CRC) tissue. [Figure 2] Figures A-C show patient-derived MOSs formed as described herein containing five dissociated primary tissue cells per MOS, cultured for one day (A), three days (B), and seven days (C). The cells were derived from colorectal cancer (CRC) tissue. [Figure 3] Figures A-C show patient-derived MOSs formed as described herein containing 20 dissociated primary tissue cells per MOS, cultured for 1 day (A), 3 days (B), and 7 days (C). As in Figures 1A-1C and 2A-2C, the cells were derived from colorectal cancer (CRC) tissue. [Figure 4]A-E show examples of patient-derived MOSs formed as described herein to contain 10 dissociated primary tissue cells per MOS. A shows a MOS (at low magnification) immediately after formation. B shows a higher magnification view of a portion of the MOS in A taken after 2 days of culture. C shows a MOS after 3 days of culture. D shows a MOS after 4 days of culture. E shows a MOS after 5 days of culture. [Figure 5] Figures A-B show examples of MOSs formed from hepatocytes of normal mouse liver as described herein and cultured for 1 day (A) or 10 days (B). Mouse hepatocytes are harvested from normal (e.g., non-diseased) mouse liver. [Figure 6] 1 illustrates a method for forming a patient-derived MOS from a primary tissue (eg, biopsy) sample, as described herein. [Figure 7A] 1 shows a schematic diagram of an example of an apparatus for forming a patient-derived MOS as described herein, including a microfluidic chip as part of the assembly. [Figure 7B] FIG. 7B is a perspective view of an example of a microfluidic chip portion of the device as shown in FIG. 7A. [Figure 7C] 7B shows a schematic representation of a portion of a microfluidic assembly for an apparatus for forming patient-derived MOS as shown in FIG. 7A. [Figure 8] FIG. 7B shows an example image showing multiple patient-derived MOS formed using a device such as that shown in FIG. 7A, where the immediately post-polymerized patient-derived MOS are suspended in a channel containing an immiscible fluid (e.g., oil) before being aliquoted from the device. [Figure 9] 7C is an image of a portion of a prototype microfluidic assembly of an apparatus for forming patient-derived MOS, similar to that shown in FIG. 7C, showing the formation of patient-derived MOS. [Figure 10] 1 shows a plurality of patient-derived MOS described herein immediately after polymerization, wherein the patient-derived MOS is suspended in an immiscible fluid. [Figure 11]AB show another example of multiple patient-derived MOSs immediately after formation suspended in an immiscible fluid (e.g., oil) at low (A) and high (B) magnification. [Figure 12] AB show multiple patient-derived MOS at low (A) and high (B) magnification after separation from the immiscible fluid within hours of their formation. [Figure 13] 10 shows images of another example of multiple patient-derived MOSs formed as described herein. [Figure 14] 1 shows a chart of diameter size distribution from multiple patient-derived MOSs formed from exemplary biopsy samples. [Figure 15] Figures AB show low-magnification (A) and high-magnification (B) views, respectively, of an example of multiple patient-derived MOS formed from dissociated tissue biopsy samples and fluid matrix material after polymerization. A is an unstained image, while in B, the MOS has been stained with trypan blue, indicating that the dissociated cells in the MOS are viable. [Figure 16] 15A-B show another example showing low-magnification (A) and high-magnification (B) views, respectively, of an example of multiple patient-derived MOS. A is an unstained image, while B shows the MOS stained with trypan blue (arrows), indicating dissociated cells within the MOS, indicating that the cells are viable (e.g., alive) within the MOS. [Figure 17] Figures A-E show an example of a method for assaying multiple patient-derived MOSs generated from patient tumor biopsies to determine drug response profiles to multiple drug formulations. The procedure shown takes less than two weeks (e.g., approximately one week) from biopsy to results. [Figure 18] 1 illustrates, in schematic form, an example method for treating a patient, including the formation and use of multiple patient-derived MOSs as part of a treatment procedure. [Figure 19] 10A-10C are schematic diagrams illustrating exemplary methods for treating patients that involve the rapid generation and assay of multiple patient-derived MOSs multiple times as part of a treatment protocol. [Figure 20]1A and 1B are schematic diagrams illustrating portions of an apparatus for forming multiple patient-derived MOSs as described herein. [Figure 21] 21 shows a schematic diagram of a method for operating an apparatus for forming multiple patient-derived MOSs similar to that shown in FIG. 20. [Figure 22] A-D show an example of validation of the method described herein for identifying drug resistance using multiple patient-derived MOS. A shows the use of a conventional ("2D") tumor cell assay method to predict drug resistance. B shows the use of an example of the patient-derived MOS method described herein to assay drug resistance to predict drug sensitivity. C shows that the patient-derived MOS-based method, unlike conventional cultured cells, accurately predicted the tumor's actual response (drug responsiveness). D shows that the patient-derived MOS-based method, unlike conventional cultured cells, accurately predicted the tumor's actual response (drug responsiveness). [Figure 23] A-D show another example validating the use of the patient-derived MOS described herein to identify drug resistance, showing predicted drug responses to both oxaliplatin and irinotecan, consistent with actual tumor responses following treatment with these drugs. [Figure 24] An example of a drug screen using the patient-derived MOS described herein is shown, where a single tumor biopsy can generate a large number of nearly identical MOS very quickly (e.g., within 2 weeks) and rapidly test them against numerous drug formulations (e.g., 27 shown) in parallel. [Figure 25] A-B show examples of mouse liver MOS formed from mouse liver tissue, each with a diameter of 300 μm and one cell per MOS. A shows a day 1 MOS, and B shows a day 10 MOS. [Figure 26] Figures 25A-B show examples of mouse liver MOS formed from partially hepatectomized mouse liver tissue, similar to those shown in Figures 25A-B, with a diameter of 300 μm and 25 cells per MOS. A shows MOS on day 1, and B shows MOS on day 10. [Figure 27]Figures A to C show examples of human liver MOS formed from human liver tissue. Figure A shows MOS on day 1 seeded at 40 cells / droplet. Figures B and C show MOS on day 18. In Figure B, the MOS has a hepatocyte-like structure, while Figure C shows cholangiocyte-like MOS. [Figure 28] A-D show examples of MOS generated from a patient-derived xenograft tumor line with a diameter of 300 μm and one cell per MOS. A shows MOS on day 1, B shows MOS on day 3, C shows MOS on day 5, and D shows MOS on day 7. [Figure 29] A-D show examples of MOS generated from a patient-derived xenograft model with a diameter of 300 μm and 5 cells per MOS. A shows MOS on day 1, B shows MOS on day 3, C shows MOS on day 5, and D shows MOS on day 7. [Figure 30] A graph comparing the response of MOS formed from conventional organoids and colon cancer patient-derived organoids to oxaliplatin, showing comparable responses for conventional organoids and MOS. [Figure 31] Graph comparing the response of MOS formed from conventional organoids and two colon cancer patient-derived xenograft models to SN38 (7-ethyl-10-hydroxy-camptothecin), showing comparable responses. [Figure 32] Graph comparing the response of MOS formed from conventional organoids and colon cancer patient-derived xenograft models to 5-FU (fluorouracil), showing comparable responses. [Figure 33] A and B show an example of a toxicity assay using mouse liver MOS. A shows that the size of the tissue in the mouse liver MOS of the control group is relatively large (indicated by the arrow). In contrast, B shows the acetaminophen (10 mM)-treated group, where the tissue in most of the MOS is smaller and contains many dead cells. [Figure 34]A and B show examples of toxicity assays using human liver MOS. A shows typical human liver MOS observed in the control group, including histology (indicated by arrows). B shows MOS in the acetaminophen (10 mM)-treated group, demonstrating atypical histology (arrows) and debris. [Figure 35A] We demonstrate the effect of nivolumab on immuno-oncological assays of lung tumor-based MOS, demonstrating that nivolumab induces apoptosis in lung tumors via the Annexin V marker. [Figure 35B] We demonstrate the effect of nivolumab on immuno-oncological assays of renal tumor-based MOS, demonstrating that nivolumab induces apoptosis in renal tumors via the annexin V marker. [Figure 36] Figures 1A and 1B show the effect of lenalidomine and bortezoid on the IO assay of MOS based on multiple myeloma (MM) biopsies. Figures 1A and 1B show that lenalidomine induces apoptosis in MM biopsies via caspase 3 / 7 dye, whereas bortezoid does not. [Figure 37] 1 shows the effect of ESK1 on lung tumor MOS organoid death. [Figure 38] 1 shows the effect of ESK1 added to PBMCs on organoid death of lung tumor MOS. [Figure 39] The effect of patient TILs on tumor cells in MOS is shown. [Figure 40] The effect of PBMCs on tumor cells in MOS is shown. [Figure 41] The combined effect of nivolumab treatment and TIL is shown. [Figure 42] This figure compares the ability of patient T cells to infiltrate into conventional bulk organoids and MOS. [Figure 43A]We demonstrate a conventional method for introducing CRISPR / Cas complex components into 3D tissue models by first generating a cell suspension (i), then introducing CRISPR / Cas complex components into single cells or spheroid structures to perform gene editing (ii), and then developing the edited cells into a 3D matrix. [Figure 43B] An example of the method provided herein involves generating MOS (i), introducing gene editing components into the MOS (ii), and genetically modifying cells within the MOS (iii). The difference between these methods is throughput: the first method requires 100 MOS generation steps for 100 arrayed libraries, whereas the method provided herein allows libraries to be tested in a single MOS generation step. [Figure 44] We demonstrate how the methods provided herein enable arrayed library screening in 3D models: MOS can be loaded into an array plate, such as a multi-well plate (i), different guide RNAs added to each well and electroporated (ii), and assays performed with edited cells pre-packaged in MOS (iii). [Figure 45] 1 shows the results of gene editing when gene editing components are introduced into MOS using a viral vector-based delivery method. [Figure 46] We demonstrate how the electroporation method was optimized to deliver gene-editing components into MOS. A total of 120 electroporation conditions were tested using eight different buffers and 15 different pulse conditions. [Figure 47] Figure 1 shows an individual MOS where cells were edited to express GFP after electroporation. The arrow indicates the outline of the MOS. [Figure 48] The number of GFP-positive cells after electroporation is shown for four combinations of buffer and pulse conditions. [Figure 49] Gene editing of MOS after delivery of CRISPR / Cas9 complex components is shown. The difference between scrambled and knockout is the editing efficiency of MOS. [Figure 50]This figure shows the process of selecting electroporation conditions for CRISPR / Cas9 transfection into MOS. The x-axis represents the results of various optimized protocols. To develop a reliable protocol with high editing efficiency, we varied the diameter of the MOS, the composition of Matrigel, incubation time, and cell concentration. [Figure 51] This figure shows the results of gene editing when a certain electroporation method was used to deliver gene editing components to MOS. This figure combines three different experiments by three different operators using the same protocol for gene editing in MOS. These results demonstrate that this method is consistent in achieving high editing efficiency in MOS. [Figure 52] Cas9-GFP diffusion into MOS is shown. [Figure 53] FACS analysis of RNP MOS delivery. DETAILED DESCRIPTION OF THE INVENTION
[0076] Provided herein are methods for delivering one or more components to microorganospheres (MOS), the methods comprising introducing one or more components into the MOS by a delivery method.
[0077] This method involves the delivery of components introduced after the formation of the MOS, an example of which is shown in Figure 43B.
[0078] The one or more components can include any component that can be introduced into or tested in a MOS, for example, the one or more components can be a protein, a peptide, a polypeptide, DNA, RNA, siRNA, RNAi, a plasmid DNA, a viral particle, an antibody, or a fragment thereof.
[0079] In particular, one or more components are CRISPR / Cas complex components. In some embodiments, the CRISPR / Cas complex components comprise a ribonucleoprotein comprising a guide RNA complexed with a Cas protein. In some embodiments, the components of the CRISPR / Cas9 complex can be encoded by DNA. In particular, the CRISPR / Cas complex components can be CRISPR / Cas9 complex components.
[0080] In some embodiments, one or more components are viral particles. The one or more components can include any viral particle. In some embodiments, the viral particle can be derived from an AAV, lentivirus, retrovirus, SARS-CoV, SARS-CoV-2, influenza, or other type of virus.
[0081] The small size and large surface-to-volume ratio of MOS allow direct infection with viral particles. As a non-limiting example, MOS can be directly infected with viral particles. In some embodiments, the viral particles can be derived from AAV, lentivirus, retrovirus, SARS-CoV, SARS-CoV-2, influenza, or other types of viruses. Advantageously, MOS cultures exhibit much higher viral transduction efficiency than traditional bulk organoid cultures. Viral transduction efficiency can be adjusted by varying the MOI of the virus used for infection (e.g., 0.1-50 MOI). There are several methods for achieving MOS infection. For example, for infection, MOS droplets can be spun down at 200 g for 3 minutes, the supernatant removed, and then 200 μL of virus-containing buffer can be added to the MOS pellet, resuspended, and then incubated at 37°C for 2-4 hours. In one embodiment, 0.4% BSA 1X PBS containing Ca+ and Mg+ can be used. In other embodiments, serum-free medium can be used. After incubation, the virus-containing supernatant can be removed and replaced with complete medium. 24 to 72 hours after infection, the efficiency of viral infection can be monitored by fluorescent imaging or other approaches (e.g., PCR, Western blot, antibiotic selection).
[0082] Because MOS can be highly efficient at directly infecting viral particles, there are many potential applications for MOS-based viral delivery systems. By way of non-limiting examples, introducing viral particles into MOS can be used to study host-pathogen interactions, screen antiviral drugs, implement any viral delivery-based genome editing approach (e.g., CRISPR / Cas9, transgenes, gene knockdown), and generate reporter strains for drug screening.
[0083] In some embodiments, the MOS comprises one or more cells. The MOS may comprise any cell type or combination thereof. The cell type may be selected from any tissue origin. The cell type may be selected from, but is not limited to, cancer cells (from solid tumors or cancers of the blood or bone marrow), non-cancerous cells of any tissue origin, immune cells, stromal cells, liver cells, airway cells, lung cancer cells, colon cancer cells, melanoma cells, and genetically engineered cells (such as CAR T cells).
[0084] As used herein, a tumorsphere is a collection of tumor-like living cells derived from a patient that recapitulates the in vivo tumor environment.
[0085] As used herein, airway cells include, but are not limited to, cells of the sinus mucosa, trachea, proximal lung, and distal lung.
[0086] Suitable delivery methods for delivering components to MOS may be selected from electroporation methods, lipid-based delivery methods, and viral vector-based delivery methods, including lentivirus, AAV, and retrovirus-based vectors.
[0087] The electroporation method may be performed using any suitable means or device for electroporation. The electroporation method may be performed using standard laboratory equipment, including any electroporation system or instrument. In some embodiments, the electroporation method utilizes a Lonza Nucleofector 4D system. In some embodiments, the electroporation method utilizes Lonza buffer. In some embodiments, the Lonza buffer is P1. In some embodiments, the Lonza buffer is P3. Lonza buffer P3 consists of: 5 mM KCl, 15 mM MgCl; 15 mM HEPES; 150 mM NaHPO / NaHPO pH 7.2; 50 mM sodium succinate. In some embodiments, the electroporation method utilizes specific pulse conditions. In some embodiments, the pulse conditions are selected from one of the following Lonza programs: CA-137, CM-138, CM-137, CM-150, DN-100, DS-138, DS-137, DS-130, DS-150, DS-120, EH-100, EO-100, EN-138, EN-150, and EW-113. In some embodiments, the pulse conditions are selected from Lonza programs CA-137, DS-150, CM-137, and EN-138. In one embodiment, the buffer is P1 and the pulse conditions are CA-137. In another embodiment, the buffer is P3 and the pulse conditions are EN-138.
[0088] One or more components may be incubated with MOS prior to electroporation. One or more components may be incubated with MOS for less than 1 minute to 60 minutes prior to electroporation. In some embodiments, one or more components may be incubated with MOS for 10 minutes prior to electroporation. In some embodiments, one or more components may be incubated with MOS for 20 minutes prior to electroporation. In some embodiments, no incubation is required.
[0089] One or more components may be incubated with MOS at a temperature of 20-40° C. In some embodiments, one or more components may be incubated with MOS at a temperature of 37° C.
[0090] In some embodiments, MOS is dispensed into a multiwell plate. In some embodiments, each well of the multiwell plate contains 20 MOS droplets. In some embodiments, each well of the multiwell plate contains 40-80 MOS droplets. In some embodiments, each well of the multiwell plate contains 100-200 MOS droplets. In some embodiments, the number of MOS droplets in each well depends on the size of the multiwell plate; larger multiwell plates with more wells contain fewer MOS droplets per well. For example, a 384-well plate may contain 40-80 MOS droplets per well, a 96-well plate may contain 100-200 MOS droplets per well, and a 24-well plate may contain 1,000 MOS droplets per well. In some embodiments, the methods are high-throughput, allowing an array of MOSs and conditions to be investigated in a single assay. The methods herein maintain cell viability of one or more cells within the MOS so that a 3D microenvironment can develop and / or the MOS and tumorspheres therein can develop into organoids and / or tissue models.
[0091] Provided herein are methods of editing DNA or RNA contained within a MOS, comprising: a) delivering one or more CRISPR / Cas complex components into the MOS via a delivery method; and b) incubating the MOS under conditions suitable for CRISPR / Cas-mediated editing of the DNA or RNA. In some embodiments, the efficiency of editing the DNA or RNA is between 25% and 99%, or between 50% and 99%, about 80%, greater than 80%, or greater than 90%.
[0092] The CRISPR / Cas complex components may be delivered by any method. In some embodiments, the CRISPR / Cas complex components are delivered by a method described herein. In some embodiments, the CRISPR / Cas complex components are delivered by a delivery method comprising electroporation. In some embodiments, the electroporation method is an electroporation method described herein.
[0093] Provided herein are methods of drug screening that include: a) delivering a drug and one or more additional components to a MOS; and b) evaluating the effectiveness of the drug. In some embodiments, the one or more additional components are introduced into the MOS before delivering the drug. In some embodiments, the drug is delivered to the MOS before delivery, or the one or more additional components are delivered.
[0094] In some embodiments, the one or more additional components are DNA editing components or RNA editing components. In some embodiments, the DNA or RNA editing components are CRISPR / Cas complex components. In some embodiments, the DNA or RNA contained within the MOS is edited by CRISPR / Cas, and the efficacy of a drug in the MOS containing the edited DNA or RNA is compared to the efficacy of the drug in the MOS containing unedited DNA or RNA.
[0095] Provided herein is MOS produced by the methods provided herein.
[0096] Provided herein are MOSs that include one or more CRISPR / Cas9 complex components.
[0097] The MOS gene editing technology described herein has numerous applications. By way of example only, this method can be used for high-throughput testing of cells in MOS, where each well is specifically edited. Potential applications of this approach include testing the mutation-specific effects of drugs, examining drug mechanisms of action in 3D tissue systems, and defining which genes are desirable drug targets for specific patients or patient populations. In particular, high-throughput genetic modifications can be used to screen for proteins that attenuate immune responses to cancer in multiple patients with the goal of identifying novel drug targets. While this technology can be applied to all types of drug discovery and development, it is particularly useful for determining and evaluating drug targets for immuno-oncology drugs by examining the effects of various mutations.
[0098] A detailed description of MOS formation and applications Generally, described herein are MOSs, methods and devices for forming them, and methods and devices for using them to assay the response of, for example, tissue (including, but not limited to, cancerous tissue).
[0099] The MOS described herein are typically spheres formed from dissociated primary cells distributed within a substrate. These MOS may have a diameter of about 50 μm to about 500 μm (e.g., about 50 μm to about 400 μm, about 50 μm to about 300 μm, about 50 μm to about 250 μm, etc.) and may initially contain about 1 to 1,000 dissociated primary cells (e.g., about 1 to 750, about 1 to 500, about 1 to 400, about 1 to 300, about 1 to 200, about 1 to 150, about 1 to 100, about 1 to 75, about 1 to 50, about 1 to 40, about 1 to 30, about 1 to 20, etc.) distributed within the substrate.
[0100] Surprisingly, despite their small size (often approximately 50-250 μm) and low cell density (e.g., less than 100 cells per MOS), these MOS can be used immediately or cultured for very short periods (e.g., within 14 days, 10 days, 7 days, 5 days, etc.), allowing the cells within the MOS to survive while maintaining many, if not all, characteristics of the tissue, including tumor tissue, from which they were extracted. Cell viability within MOS is remarkably high, and MOS can be cultured for days (or even weeks) through multiple passages during which the cells divide, cluster, and form structures similar to the parent tissue. Also surprisingly, cells from dissociated tissue within MOS can form morphological structures even within the smallest MOS. While the presence of such structures is not necessary for the usefulness of these MOS (e.g., they can be used before substantial structural reorganization has occurred), they can be particularly useful.
[0101] The methods and devices described herein for forming and using MOSs can be used to generate many (e.g., more than 10,000) MOSs from a single biopsy. These MOSs can be used to screen for drug compositions that can predict therapies that may be effectively applied to the patient from whom the biopsy was taken. This may be useful, for example, for toxicity screening of drugs or other chemical compositions from healthy normal tissue and / or from cancerous (e.g., tumor) tissue. In particular, MOSs, methods, and devices for forming them, as well as methods and devices for testing them, can be used for screening to identify one or more drug compositions or combinations of drug compositions that can effectively treat patients (e.g., cancer patients) before they undergo drug therapy. This may enable, for example, very rapid screening of cancer patients before they undergo months of chemotherapy that may not otherwise be effective.
[0102] Thus, described herein are high-throughput drug screening methods (and devices for performing these methods) using a single patient-specific biopsy (or other suitable tissue / cell source). Described herein are droplet-forming MOSs that can be formed from patient-derived tumor samples that have been dissociated and suspended in a basement matrix (e.g., MATRIGEL). The MOSs can be patterned onto microfluidic microwell arrays, incubated, and administered with drug compounds. This miniaturized assay maximizes tumor sample utilization, allowing many more drug compounds to be screened from a single core biopsy at a much lower cost per sample.
[0103] Patient-derived cancer models (PDMCs), such as cell lines, organoids, and patient-derived xenografts (PDXs), are increasingly accepted as the "standard" preclinical models for facilitating the identification and development of new therapies. For example, large-scale drug screening of cell lines and organoids derived from cancer patients has been used to identify sensitivity to numerous candidate therapies. PDXs are also used to predict drug response and identify novel drug combinations. While precision medicine strategies are being developed through the exploration of these various PDMC models, substantial barriers remain to their effective use. For example, studies have shown that phenotypic and genotypic profiling of organoids often exhibits a high degree of similarity to the original patient tumor, making patient-derived organoids (PDOs) considered the most accurate way to represent a patient's tumor. Unfortunately, at least two limitations hinder the use of PDOs to guide therapy. First, it takes several months to develop and test drug sensitivity in organoids, which reduces their clinical applicability. Second, the number of organoids obtained from clinically relevant 18-gauge core biopsies is not sufficient to perform high-throughput drug screening. Ideally, assays should be performed from a single core biopsy within 7-10 days. The MOSs described herein, as well as methods for producing and using them, may address these clinical limitations.
[0104] Details of one or more embodiments of the subject matter of this disclosure are set forth herein. Modifications to the embodiments described herein, as well as other embodiments, will be apparent to those skilled in the art upon review of the information provided herein. The information provided herein, particularly the specific details of the exemplary embodiments described, is provided primarily for clarity of understanding, and no unnecessary limitations should be understood therefrom. In the case of conflict, the present specification, including definitions, will control.
[0105] Although the terms used herein are believed to be well understood by those of ordinary skill in the art, definitions are provided herein to facilitate explanation of the subject matter of the present disclosure.
[0106] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently disclosed subject matter, the preferred methods, devices, and materials are described herein.
[0107] The term "unpolymerized mixture" is used herein to refer to a composition containing biologically relevant materials, including a dissociated tissue sample and a first fluid matrix material. The fluid matrix material is typically a material that can be polymerized to form a support or support network within which the dissociated tissue (cells) are dispersed. Upon polymerization, the polymerized material can form a hydrogel, which can form and / or contain proteins in addition to cells that form a biocompatible medium. Suitable biocompatible media for use in accordance with the presently disclosed subject matter can typically be formed at room temperature (e.g., 25°C) from any biocompatible material that is a gel, semi-solid, or liquid (e.g., a low-viscosity liquid) and can be used as a three-dimensional substrate for cells, tissues, proteins, and other biomaterials of interest. Exemplary materials that can be used to form a biocompatible medium in accordance with the presently disclosed subject matter include, but are not limited to, polymers and hydrogels, including collagen, fibrin, chitosan, MATRIGEL™ (BD Biosciences, San Jose, Calif.), polyethylene glycol, dextran (including chemically or photocrosslinkable dextran, etc.), and electrospun bio, synthetic, or biosynthetic blends. The biocompatible medium may also be comprised of a hydrogel.
[0108] The term "hydrogel" is used herein to refer to a two- or multi-component gel comprising a three-dimensional network of polymer chains in which water acts as the dispersion medium and fills the spaces between the polymer chains. Hydrogels used in accordance with the presently disclosed subject matter are generally selected for a particular application based on the intended use of the structure, taking into consideration the parameters used to form the MOS and the effect the selected hydrogel will have on the behavior and activity of biomaterials (e.g., cells) incorporated into a biological suspension disposed within the structure. Exemplary hydrogels of the presently disclosed subject matter may be composed of polymeric materials, including, but not limited to, alginate, collagen (including types I and VI), elastin, keratin, fibronectin, proteoglycans, glycoproteins, polylactides, polyethylene glycols, polycaprolactones, polycolides, polydioxanones, polyacrylates, polyurethanes, polysulfones, peptide sequences, proteins and derivatives, oligopeptides, gelatin, elastin, fibrin, laminin, polymethacrylates, polyacetates, polyesters, polyamides, polycarbonates, polyanhydrides, polyamino acids, carbohydrates, polysaccharides and modified polysaccharides, and derivatives and copolymers thereof, and inorganic materials (e.g., glasses such as bioactive glasses, ceramics, silica, alumina, calcite, hydroxyapatite, calcium phosphate, bone, and combinations of all of the foregoing).
[0109] With regard to the hydrogels used to produce the MOS described herein, the hydrogels may be composed of a material selected from the group consisting of agarose, alginate, type I collagen, polyoxyethylene-polyoxypropylene block copolymers (e.g., Pluronic® F127 (BASF Corporation, Mount Olive, NJ)), silicone, polysaccharides, polyethylene glycol, and polyurethane. The hydrogel may be composed of alginate.
[0110] The MOS described herein may also include biologically relevant materials. The phrase "biologically relevant materials" may describe materials that can be included in a biocompatible medium, as defined herein, and subsequently interact with and / or affect a biological system. For example, in some embodiments, the biologically relevant materials are magnetic beads (i.e., beads that are magnetic or contain a material that responds to a magnetic field, such as iron particles), which can be combined as part of the unpolymerized material to produce MOS that can be used in the methods and compositions (e.g., for the isolation and purification of MOS). As another example, in other embodiments, the biologically relevant materials may include additional cells in addition to the dissociated tissue sample (e.g., biopsy) material. In the unpolymerized mixture, the dissociated tissue sample and the additional biologically relevant materials can be present in a homogeneous mixture or as a dispersed mixture (e.g., in just one half or other portion of the MOS, including within the core or outer region of the formed MOS). The additional biologically relevant materials in the unpolymerized material can be suspended with the dissociated tissue sample in the suspension, for example, before the droplets that form the MOS are polymerized.
[0111] In some embodiments, biologically relevant material that may be contained in dissociated tissue sample (e.g., biopsy) material may include several cell types, including preadipocytes, mesenchymal stem cells (MSCs), endothelial progenitor cells, T cells, B cells, mast cells, and adipose tissue macrophages, as well as fragments of small blood vessels or microvessels found within the stromal vascular fraction.
[0112] Generally, with regard to the dissociated tissue sample (e.g., biopsy) material included in the MOS described herein, these tissues can be any suitable tissue from a patient, typically obtained by biopsy. While non-biopsy tissues can also be used, these tissues (and resulting dissociated cells) generally can be primary cells obtained from a patient biopsy, as described above, e.g., by needle biopsy. The tissues can be derived from healthy tissue biopsies or cancerous (e.g., tumor) cell biopsies. Dissociated cells can be incorporated into the MOS of the presently disclosed subject matter based on the intended use of the MOS. For example, the relevant tissue (e.g., dissociated biopsy tissue) can typically include cells commonly found in that tissue or organ (or tumor, etc.). In this regard, exemplary associated cells that can be incorporated into the MOS of the presently disclosed subject matter include neurons, cardiomyocytes, myocytes, chondrocytes, pancreatic acinar cells, islets of Langerhans, osteocytes, hepatocytes, Kupffer cells, fibroblasts, myoblasts, satellite cells, endothelial cells, adipocytes, preadipocytes, biliary epithelial cells, and the like. These types of tissues can be dissociated by conventional techniques known in the art. Suitable biopsy tissues can be derived from bone marrow, skin, cartilage, tendon, bone, muscle (including cardiac muscle), vascular, corneal, neural, brain, gastrointestinal, renal, liver, pancreas (including pancreatic islet cells), lung, pituitary, thyroid, adrenal, lymphatic, salivary, ovarian, testicular, cervical, bladder, endometrial, prostate, vulvar, and esophageal tissues. Normal or diseased (e.g., cancerous) tissues can be used. Tissues can originate from tumor tissue, including tumors originating from any of these normal tissues.
[0113] Once MOS is formed, it can be cryopreserved and / or cultured. Cultured MOS can be maintained in suspension, either statically (e.g., in wells, vials, etc.) or in motion (e.g., by rolling or agitation). MOS can be cultured using known culture techniques. Exemplary techniques can be found in various places, including, among others: Freshney, Culture of Animal Cells, A Manual of Basic Techniques, 4th ed., Wiley Liss, John Wiley & Sons, 2000; Basic Cell Culture: A Practical Approach, Davis, ed., Oxford University Press, 2002; Animal Cell Culture: A Practical Approach, Masters, ed., 2000; and US Pat. Nos. 5,516,681 and 5,559,022.
[0114] MOSs can be formed by forming droplets of an unpolymerized mixture (e.g., a cooled mixture) of a dissociated tissue sample and a fluid matrix material in an immiscible material, such as a fluid hydrophobic material (e.g., oil). For example, MOSs can be formed by combining a stream of unpolymerized material with one or more streams of immiscible materials to form droplets. The density of cells present in the droplets can be determined by the dilution of the dissociated material (e.g., cells) in the unpolymerized material. The size of the MOS can be correlated to the size of the droplets formed. Generally, MOSs are spherical structures with stable geometric shapes.
[0115] The practice of the presently disclosed subject matter may employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art, and such techniques are fully explained in the literature.
[0116] For example, see: Molecular Cloning A Laboratory Manual (1989), 2nd Ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory Press, Chapter 16 and 17; U.S. Patent No. 4,683,195; DNA Cloning, Volumes I and II, Glover, ed., 1985; Oligonucleotide Synthesis, M.J. Gait, ed., 1984; Nucleic Acid Hybridization, 15 D.Hames & S.J. Higgins, eds., 1984; Transcription and Translation, B.D. Hames & S.J. Higgins, eds., 1984; Culture Of Animal Cells, R.I. Freshney, Alan R. Liss, Inc., 1987; Immobilized Cells And Enzymes, IRL Press, 1986; Perbal (1984), A Practical Guide To Molecular Cloning; See Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells, J.H. Miller and M.P. Calos, eds., Cold Spring Harbor 20 Laboratory, 1987; Methods In Enzymology, Vols. 154 and 155, Wu et al., eds., Academic Press Inc., N.Y.; Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987; Handbook Of Experimental Immunology, Volumes I-IV, D.M. Weir and C.C. Blackwell, eds., 1986.
[0117] As used herein, a drug composition may include any drug, drug dilution, drug formulation, composition containing multiple drugs (e.g., multiple active ingredients), drug formulation, drug form, drug concentration, combination therapy, etc. A drug formulation may refer to a formulation containing a mixture of a drug and one or more inactive ingredients. As used herein, the term "passage" may refer to the average number of doublings of cells within a MOS. While traditional passage number refers to the transfer or subculture of cells from one culture vessel to another, cells within a MOS may be stably maintained within the same MOS and continue to grow and divide. Thus, as used herein, passage number typically refers to the average number of doublings by dissociated cells from biopsy tissue within a MOS. Population doubling number is the approximate number of doublings a cell population has undergone since isolation (e.g., since the formation of a MOS from freshly dissociated biopsy tissue). Generally, the MOS described herein can be cultured for a short period of time to grow, e.g., doubling (e.g., less than 10 passages, less than 9 passages, less than 8 passages, less than 7 passages, less than 6 passages, less than 5 passages, less than 4 passages, less than 3 passages, etc.), some or all of the cells within the MOS.
[0118] During culture, cells from dissociated biopsy tissue in MOS may aggregate, cluster, or aggregate within the MOS. The cell aggregates may be highly organized and form a defined morphology, or may be clumps of cells clustered or attached together. The tissue may reflect the tissue of origin. MOS may contain a single cell type (homotypic), but more typically, MOS may contain two or more cell types (heterotypic).
[0119] As previously mentioned, the tissue (e.g., biopsy) used to form the MOS (e.g., dissociated tissue) can be derived from normal or healthy biological tissue, or from diseased or affected biological tissue (e.g., tissue or fluid derived from a tumor). The tissue used in the MOS can contain cells of the immune system, such as T lymphocytes, B lymphocytes, polymorphonuclear leukocytes, macrophages, and dendritic cells. The cells can be stem cells, progenitor cells, or somatic cells. As described in further detail below, the presence of these immune cells can be used to enhance the efficacy and accuracy of drug / biologic testing. The tissue can be mammalian cells, such as human cells, or cells derived from animals, such as mice, rats, or rabbits.
[0120] Generally, tissue (and resulting cells) can be harvested to form an MOS, often from a biopsy. Thus, tissue can be derived from a biopsy, surgical specimen, aspirate, drainage, or cell-containing fluid. Suitable cell-containing fluids include blood, lymph, sebaceous fluid, urine, cerebrospinal fluid, or ascites. For example, in patients with transcatheterized metastases, ovarian or colon cancer cells can be isolated from ascites. Similarly, in patients with cervical cancer, cervical cancer cells can be removed from the cervix, for example, by extensive excision of the transformation zone or by cone biopsy. Typically, such MOS will contain multiple cell types present in the tissue or fluid of origin. Cells can be obtained directly from a subject without an intermediate step of subculture, or can first undergo an intermediate culture step to produce a primary culture. Methods for harvesting cells from biological tissue and / or cell-containing fluids are well known in the art. For example, techniques used to obtain cells from biological tissue include those described by R. Mahesparan (Extracellular matrix-induced cell migration from glioblastoma biopsy specimens in vitro. Acta Neuropathol (1999) 97:231-239).
[0121] Generally, cells are first dissociated or separated from one another before forming MOS. Dissociation of cells can be achieved by any conventional means known in the art. Preferably, cells are treated mechanically and / or chemically, such as by treatment with an enzyme. "Mechanically" refers to disrupting the connections between associated cells, for example, by using a scalpel or scissors, or by using a machine such as a homogenizer. "Enzymatically" refers to treating cells with one or more enzymes that disrupt the connections between associated cells, including, for example, any of collagenase, dispase, DNAse, and / or hyaluronidase. The one or more enzymes can be used under different reaction conditions, such as incubation in a water bath at 37°C or at room temperature.
[0122] Dissociated tissues may be treated to remove dead and / or dying cells and / or cell debris.Removal of such dead and / or dying cells can be achieved by any conventional means known to those skilled in the art, for example, using beads and / or antibody methods.For example, it is known that phosphatidylserine redistributes from the inside to the outside of the plasma membrane leaflet in apoptotic or dead cells.The use of Annexin V-biotin binding, followed by the binding of biotin to streptavidin magnetic beads, allows the separation of apoptotic cells from live cells.Similarly, removal of cell debris can be achieved by any suitable technique in the art, including, for example, filtration.
[0123] The dissociated cells may be suspended in a carrier material and / or a fluid matrix material (which may be referred to as a carrier material) prior to combination with the fluid matrix material. The carrier material may have a viscosity level that retards the settling of cells in the cell suspension prior to polymerization and formation of the MOS. The carrier material may have sufficient viscosity to allow the dissociated biopsy tissue cells to remain suspended in suspension until polymerization. The viscosity required to achieve this can be optimized by one skilled in the art by monitoring the settling rate at various viscosities and selecting a viscosity that provides an appropriate settling rate for the expected time delay between loading the cell suspension into the device that forms the MOS by polymerizing droplets of unpolymerized material containing the cells. The unpolymerized material may be flowed or agitated by the device to maintain and / or distribute the cells as desired, even when a lower viscosity material is used.
[0124] As described above, the unpolymerized mixture containing the dissociated tissue sample and the fluid matrix material may contain one or more components (e.g., biologically relevant materials). For example, biologically relevant materials may be extracellular matrix proteins (e.g., fibronectin), drugs (e.g., small molecules), peptides, or antibodies (e.g., for regulating cell survival, proliferation, or differentiation), and / or inhibitors of specific cellular functions. Such biologically relevant materials may be used, for example, to increase cell viability by reducing cell death and / or activation of cell growth / replication, or to otherwise mimic an in vivo environment. Biologically relevant materials may include or mimic one or more of the following components: serum, interleukins, chemokines, growth factors, glucose, physiological salts, amino acids, and hormones. For example, the biologically relevant material may supplement one or more drugs in the fluid matrix material. The fluid matrix material may be a synthetic gel (hydrogel) and supplemented with one or more biologically relevant materials. The fluid matrix may be a natural gel. Thus, gels can be composed of one or more extracellular matrix components, such as collagen, fibrinogen, laminin, fibronectin, vitronectin, hyaluronic acid, fibrin, alginate, agarose, and chitosan. For example, MATRIGEL™ contains bioactive polymers important for cell viability, proliferation, development, and migration. For example, the matrix material can be a gel containing type 1 collagen, such as type 1 collagen obtained from rat tail. The gel can be a pure type 1 collagen gel or a gel containing type 1 collagen in addition to other components, such as other extracellular matrix proteins. Synthetic gels can refer to gels that do not exist in nature. Examples of synthetic gels include gels derived from polyethylene glycol (PEG), polyhydroxyethyl methacrylate (PHEMA), polyvinyl alcohol (PVA), and polyethylene oxide (PEO).
[0125] MOS Examples of MOSs are shown in Figures 1A-1C, 2A-2C, 3A-3C, and 4A-4E. For example, Figures 1A-1C show MOSs formed with a single cell per MOS. As shown, the MOSs are all approximately the same size (e.g., approximately 300 μm in diameter). Figure 1B shows MOSs formed simultaneously after 3 days of culture. The cells have expanded in size and, in some cases, have doubled and / or grown. As shown in Figure 1C, by day 7 of culture, the cells have doubled multiple times and exhibit clusters or clumps of cells.
[0126] Similar results are shown in Figures 2A-2C and 3A-3C. MOSs formed from 5 cells per MOS or 20 cells per MOS, respectively, are shown. Figures 4A-4E show MOSs immediately after formation and MOSs cultured for 5 days. The MOSs are nearly identical (e.g., have the same diameter) and each contain 10 cells per MOS. Figure 4A shows MOSs immediately after formation, still surrounded by an immiscible fluid (oil in this case) on day 0. The MOSs are removed from the immiscible fluid, washed, and cultured for 5 days. Figure 4B shows MOSs after 2 days, Figure 4C shows MOSs after 3 days, and Figures 4D and 4E show MOSs after 4 and 5 days, respectively. Figures 4A-4E demonstrate that the dissociated tissue (cells) from the biopsy within the MOSs survives and grows at comparable rates within nearly all MOSs. As described in further detail therein, these MOSs can be generated in large quantities even from a single average-sized biopsy, resulting in the generation of hundreds or thousands (e.g., 500, 750, 1000, 2000, 5000, 10,000 or more) of MOSs containing large numbers of viable cells, allowing multiple rapid assays to be performed in parallel.
[0127] Figures 5A and 5B show examples of MOSs formed as described herein from dissociated biopsies of mouse liver, e.g., showing mouse hepatocytes distributed within a polymerized fluid matrix material (in this example, MATRIGEL). Each MOS comprises polymerized matrix material 503 formed into spheres, e.g., approximately 300 μm in diameter, with a set number of hepatocytes 507 dispersed within. Figure 5A shows MOSs one day after biopsy, dissociation, and MOS formation. These MOSs were then cultured for 10 days. During that time, the cells (hepatocytes) continued to survive and grow, often doubling multiple times and forming structures 505, as shown in Figure 5B.
[0128] The MOS may generally include dissociated (e.g., biopsied) tissue (e.g., cells) at a fixed or known number of cells and / or concentration (cells / ml or cells / mm) within the MOS. As previously mentioned, the matrix material may be a natural polymer such as one or more of alginate, agarose, hyaluronic acid, collagen, gelatin, fibrin, elastin, or a synthetic polymer such as one or more of polyethylene glycol (PEG) and polyacrylamide. Both organic and inorganic synthetic polymers may be used.
[0129] The number of cells initially included in a MOS can be selected from one cell to several hundred cells. In particular, for some assays (e.g., drug toxicity assays), it may be beneficial to include approximately 1-75 or approximately 1-50 cells (e.g., a smaller number of cells). The number of cells per MOS can be set or selected by the user. As described below, the device may include one or more controls for setting the number of cells from the primary tissue included in each MOS. The number of cells can be selected or set based on how the user intends to use the MOS. For example, MOSs with very few cells (e.g., one cell per MOS, one to five cells per MOS, etc.) may be particularly suitable for studying clonal diversity (e.g., tumor heterogeneity). Because each MOS grows from a single cell, it is possible to observe which clones are drug-resistant, and these specific MOSs can be examined (e.g., by genome sequencing) to determine the genomic (mutational) diversity associated with specific clones. Low to moderate numbers of cells per MOS (e.g., about 3-30 cells, 5-30 cells, 5-25 cells, 5-20 cells, 10-25 cells, etc.) may be particularly useful for rapid drug testing (including toxicity testing) because these MOS typically grow rapidly. Because MOSs may contain different lineages, potentially including epithelial (e.g., cancer) and mesenchymal (e.g., stromal, immune, vascular) cells, larger numbers of cells per MOS (e.g., about 20-100 cells, e.g., 30-100 cells, 40-100 cells, greater than 50 cells, etc.) may be particularly suitable for mimicking tissue composition in each MOS.
[0130] MOSs may be formed in any suitable size, which may correspond to the number of cells contained therein. For example, the size may be as small as about 20 μm in diameter and up to 500 μm (e.g., an average of 50 or 100 μm, such as about 100-200 μm). The size may be about 300 μm, with each MOS containing about 10-50 cells (e.g., about 10-30 cells). The number and size of cells may be varied and / or controlled. The number and / or size of cells in a MOS may be set by one or more controls on the device forming the MOS. For example, the size of the MOS and / or the density of cells within the MOS may be adjusted by adjusting the flow rate and / or concentration of the dissociated tissue sample (e.g., cells from a biopsy).
[0131] As shown in Figures 1A-5B, even after culturing the MOS described herein, viable, healthy cells remain throughout the entire volume of the MOS. The size of the MOS and / or the number of cells contained in the MOS can be selected based on how the MOS is expected or intended to be used. For example, if the MOS is to be used to examine the relationships between cells in a biopsy, the MOS may be formed with multiple cells and cultured for extended periods of time (e.g., up to one week or longer).
[0132] The MOS described herein can be made by combining a dissociated tissue sample (e.g., a biopsy sample) with a fluid matrix that can polymerize in a controlled manner to form a MOS. FIG. 6 illustrates one method of forming a MOS. Optionally, the method can include obtaining a sample from a patient, such as taking a biopsy from patient tissue 601. As described above, the biopsy can be performed, for example, using a biopsy needle or punch. For example, a biopsy can be obtained using a 14-gauge, 16-gauge, 18-gauge, etc. needle inserted into the patient tissue to remove the biopsy. After removing the tissue from the patient, the tissue can be processed to mechanically and / or chemically dissociate material. Dissociated cells can be used immediately to form a MOS, as described, or all or a portion of the cells can be modified, for example, by genetically modifying the cells 603 by transfection, electroporation, etc.
[0133] The dissociated tissue sample from the biopsy may be combined with a fluid (e.g., liquid) matrix material to form an unpolymerized mixture 605. This unpolymerized mixture may be kept in an unpolymerized state so that cells from the dissociated tissue may remain suspended within the mixture. The cells may remain suspended and unpolymerized, for example, by keeping the mixture chilled at room temperature or below (e.g., 1-25°C).
[0134] The unpolymerized mixture can then be dispensed as droplets into an immiscible material, such as oil, in a manner that controls the size of the droplet formation (and thus the size of the formed MOS 607). For example, uniformly sized droplets can be formed by combining (e.g., the two converge) a stream of unpolymerized material with one or more streams of immiscible material (e.g., oil), such that the flow rates and / or pressures of the two streams can determine how the droplets of unpolymerized material form when they meet the immiscible material. The droplets can be polymerized 609 to form a MOS in the immiscible material. The immiscible material can be heated or warmed to a temperature that polymerizes the unpolymerized mixture (e.g., the fluid matrix material in the unpolymerized material). Once formed, the MOS can be separated from the immiscible fluid, e.g., by washing the MOS to remove the immiscible fluid 611 and placing it in culture medium to grow cells within the MOS. The MOS can be cultured for any desired time, cryopreserved, and / or immediately assayed. MOS may be cultured for a short period of time (e.g., 1-3 days, 1-4 days, 1-5 days, 1-6 days, 1-7 days, 1-8 days, 1-9 days, 1-10 days, 1-11 days, 1-14 days). This may allow cells derived from dissociated biopsy tissue to grow and / or divide (e.g., 2 times) for up to 5 or 6 passages. After culture, the cells may be either cryopreserved 615 and / or assayed 617, or both. Examples of assays that may be used are also described herein.
[0135] In any of the methods and devices described herein, the MOS can be recovered from the immiscible fluid (e.g., oil) after polymerization. For example, the MOS can be recovered by demulsification and / or demulsification, e.g., to form emulsified droplets and recovering the MOS after the droplets are formed to remove any oil (and other contaminants). This allows cells to grow within the polymerized droplets (MOS) without being inhibited by the immiscible fluid.
[0136] Although the methods and apparatus described herein illustrate forming multiple droplets, and thus multiple MOSs, by flowing the unpolymerized mixture into one or more streams of an immiscible fluid (e.g., oil or other hydrophobic material), the droplets can be formed by other methods, which may allow for controlling the size of the droplets, as described herein. For example, the droplets can be formed by printing (e.g., by printing the droplets onto a surface). This may reduce or eliminate the need for an additional recovery step of emulsification / demulsification. For example, the droplets can be printed onto a surface, such as a flat surface or a shaped surface, and polymerized. The droplets can be dispensed using pressure, sound, electric charge, etc. In some embodiments, the droplets can be formed using an automated dispenser (e.g., a pipetting device) adapted to release small amounts of the unpolymerized mixture onto a surface, into air, and / or into a liquid medium (including an immiscible fluid).
[0137] The method for forming a MOS may be automated or may be performed using one or more apparatus. In particular, the method for forming a MOS may be performed by an apparatus that allows for selection and / or control of the size (and therefore the density of cell numbers) of the MOS. For example, FIG. 7A shows an example of an apparatus 700 for forming a MOS, as described.
[0138] In FIG. 7A, the device typically includes an input for inputting either an unpolymerized mixture (already combined) of a dissociated tissue sample and a fluid matrix material, or may receive the dissociated tissue sample and the fluid matrix material separately (e.g., in a holding solution). The device may include a holding chamber 706 for holding the unpolymerized mixture, and / or holding chambers (not shown) for holding the dissociated tissue (e.g., biopsy) sample and for holding the fluid matrix material. Any or all of these holding chambers can be pressurized to control and / or accelerate the flow of fluid out of the chambers and into the device. The device may receive the unpolymerized mixture or may receive and mix the components. The device can control the concentration of cells in the unpolymerized mixture and can dilute the mixture (e.g., to achieve a desired density by adding additional fluid matrix material). For example, the device may include a sensor (e.g., an optical reader) for reading the density (e.g., optical density) of the cells in the unpolymerized mixture (not shown). The sensor may also be coupled to a controller 724, which can control the dilution of the cells in the unpolymerized mixture automatically or semi-automatically (e.g., by prompting the user). The apparatus may also include a port for receiving the unpolymerized mixture, which may include or be coupled to a valve, which may be controlled by controller 724 (or a separate controller).
[0139] The device 700 may include chambers 708 and / or ports for holding and / or receiving immiscible fluids. The immiscible fluids may be held in pressurized chambers so that the flow rate may be controlled. Any of the pressurized chambers may be controlled by a controller 724, which may use one or more pumps 726 to control the pressure, and therefore the flow, through the device. One or more pressure and / or flow sensors may be included in the system to monitor the flow through the device.
[0140] 7A, the entire apparatus 700 may be contained within a housing 702, or a portion of the apparatus 704 may be contained within a housing. The housing may include one or more openings or access points on the device, for example, for adding immiscible fluids and / or unpolymerized mixtures.
[0141] As mentioned above, any of these apparatus 700 may also include one or more sensors 728 for monitoring all or key portions of the manufacturing process. Sensors may include optical sensors, mechanical sensors, voltage and / or resistance (or capacitance or inductance) sensors, force sensors, etc. These sensors may be used to monitor the ongoing operation of the assembly, including the formation of MOS. Apparatus 700 may also include one or more heat / temperature regulators 718 for controlling the temperature of either or both of the immiscible fluid and / or unpolymerized mixture (and / or fluid matrix material).
[0142] Any of these devices may include one or more droplet forming assemblies 720 that may be monitored (e.g., using one or more sensors), as shown below in Figures 7C and 9. The droplet MOS forming assemblies may include (or be coupled to) a dispenser (e.g., a MOS dispenser) 722. The dispenser may dispense, for example, into a multiwell plate 716.
[0143] Generally, droplet MOS formation assembly 720 can include one or more microfluidic chips 730, or structures that form and control the flow of unpolymerized mixture and form the actual droplets. FIG. 7B shows an example of a microfluidic chip for forming MOS 730. In FIG. 7B, chip 730 includes a pair of parallel structures for forming MOS. FIG. 7C shows the droplet formation region of a microfluidic chip for forming MOS. This includes unpolymerized channel outlet 741, which opens (in this example, at a right angle) the "+" junction or region of intersection 737 to channel outlet 741 and immiscible fluid outlet(s) 743, 743'. The input from the immiscible fluid channel(s) may be at an angle relative to the angle (and intersection) with the unpolymerized material. In FIG. 7C, as with all figures in this description that show dimensions, the dimensions shown are merely exemplary and are not intended to be limiting unless they are otherwise specified.
[0144] In Figure 7A, microfluidic chip 730 includes an inlet (input port) 733 for immiscible fluid into the chip (e.g., from the inlet port or storage chamber shown in Figure 7A). A second inlet port 735 into the chip can be configured to receive unpolymerized material and transport it to the junction region in a semi-serpentine path. Similarly, the immiscible fluid inlet port can be securely coupled to the immiscible fluid chamber or inlet-to-outlet described above.
[0145] An inlet port 735 for unpolymerized material into the chip may be coupled via a delivery pathway 741 connecting the inlet to the junction region (as shown in FIG. 7C). Similarly, an inlet 733 for an immiscible fluid may connect to two (or more) connecting pathways 743, 743′ to the junction region 737. A channel leaving the junction region 737 may pass the formed MOS (in the immiscible fluid) down the channel to an outlet 731. The outlet 731 may connect to a dispenser (not shown) for dispensing from the MOS into one or more chambers (e.g., for incubation and / or assay).
[0146] In the example shown in Figures 7B and 7C, the formed droplets can polymerize into MOSs and can be transferred to a temperature-controlled microfluidic environment before being dispensed from a device (not shown). For example, Figure 8 shows an example of a channel region 839 (e.g., element 739 in Figure 7B) shown transparent, containing multiple MOSs 803, each containing a predetermined number of cells 805.
[0147] In Figure 9, the junction region 937 is shaped as described above so that a channel carrying the unpolymerized mixture 911 intersects one or more (e.g., two) channels 909 carrying a fluid (e.g., oil) that is immiscible with the unpolymerized mixture. When the unpolymerized mixture is pressurized to flow from the first channel 911 at a first velocity, the immiscible fluid flowing through the intersecting channels 909, 909' allows a predetermined amount of the unpolymerized mixture to pass through, after which the unpolymerized mixture breaks off to form droplets 903 (which are sent to the outlet channel 939). Thus, a pulverized (e.g., dissociated) clinical (e.g., biopsy or resection) sample of tissue, such as one having a diameter of <1 mm, can be mixed with a temperature-sensitive gel (i.e., MATRIGEL at 4°C) to form an unpolymerized mixture. This unpolymerized mixture can be placed in a microfluidic device. This can generate droplets (e.g., water-in-oil droplets) that are uniform in volume and material composition. Simultaneously, dissociated tumor cells can be fractionated into these droplets. The gel in the unpolymerized material can solidify upon heating (e.g., at 37°C), resulting in the formation of a MOS. This method can be used to produce 10,000 or more uniform droplets (MOS) (e.g., 20,000 or more, 30,000 or more, 40,000 or more, 50,000 or more, 60,000 or more, 70,000 or more, 80,000 or more, 90,000 or more, 100,000 or more) from tissue (e.g., biopsy material). These MOS are compatible with conventional 3D cell culture techniques. Figure 10 shows multiple MOSs 1005 formed as described above and suspended in an immiscible material 1008 (e.g., oil).
[0148] In the exemplary microfluidic chip illustrated above, the junctions are shown as T-junctions or X-junctions, where microfluidic flow focusing creates controllable sizes of MOSs. Droplets can be formed, for example, in immiscible fluids and / or on solid or gel substrates by robotic micropipetting instead of a microfluidic chip. Alternatively, droplets of unpolymerized material can be formed with the required dimensions and reproducibility by microcapillary generation. Other examples of techniques that can be used to create MOSs in a specified size range and reproducibly from unpolymerized materials include colloidal manipulation by external forces, such as acoustic, magnetic, inertial, electrowetting, or gravity.
[0149] Figures 11A and 11B show examples of MOS in oil formed as described above. As shown in Figures 15A-15B and 16A-16B, the cells in these MOS from a single biopsy sample are viable, as seen by vital dye staining. For example, Figures 12A-12B show MOS with tumor cells (similar to those shown in Figures 11A-11B) that can be washed to remove immiscible materials (e.g., oil). This immiscible material can be removed relatively quickly after MOS formation to prevent damage to the cells within the MOS.
[0150] As described in the Examples below, the MOS described herein provides a good model for the effects of various drug formulations. A variety of IO drugs can be used and may interact with the MOS. Examples of IO agents include MAPK inhibitors (e.g., vemurafenib, dabrafenib, PLX8349, cobimetinib, trametinib, selumetinib, BVD-523), checkpoint inhibitors (e.g., T-cell-targeted immunomodulators, pembrolizumab, avelumab, durvalumab, ipilimumab, TSR-022, MGB453, BMS-986016, LAG525), other immunomodulators (e.g., anti-CD47 antibodies, ADCC therapies), apoptosis inhibitors (e.g., ABT-737, WEHI-539, ABT-199), potentially contributing pathways (e.g., afuresertib, idasanutlin, infliximab), chemotherapeutics (e.g., cytarabine), cell therapies, cancer vaccines, oncolytic viruses, and bispecific antibodies.
[0151] Figures 35A and 35B show the efficacy of nivolumab on MOS from lung and kidney tumor biopsies. IO assays of MOS from these lung and kidney tumor biopsies were performed using Annexin V, a marker for cell apoptosis. As can be seen in Figures 35A and 35B, MOS respond favorably to nivolumab (in the form of tumor cell apoptosis). If this test were performed on conventional bulk organoids, for example, the results would be meaningless (due to the absence of patient immune cells), making the best course of treatment for the patient unclear.
[0152] Figures 36A and 36B show the efficacy of lenalidomide and bortezoid on multiple myeloma (MM) bone marrow biopsy-derived MOS. MM MOS (day 11) were treated with lenalidomide (5 μM) or bortezoid (2 nM). Caspase 3 / 7 green dye was added to the assay to monitor apoptosis. Incucyte images were taken every 2 hours for 4 days. As can be seen in Figures 36A and 36B, MOS responded well to lenalidomide (in the form of tumor cell apoptosis) but not to bortezoid. This result should give medical professionals confidence that lenalidomide is a better choice than bortezoid for treating this particular MM patient. If this study were performed on traditional bulk organoids, for example, the results would be unreliable (due to the lack of patient immune cells), and the best course of treatment for the patient would be unclear.
[0153] Figure 37 shows the efficacy of ESK1 (a T cell receptor mimetic antibody) against MOS derived from a lung biopsy. An IO assay of MOS from this lung tumor biopsy was prepared using Annexin V, a marker for cell apoptosis. As can be seen in Figure 37, MOS respond well to ESK1 (in the form of tumor cell apoptosis). If this test were performed on conventional bulk organoids, for example, the results would be inaccurate (because ESK1 cannot reach its target), and the best course of treatment for patients would be unclear.
[0154] As described in the Examples below, MOS readily take up infused immune cells, providing a good model for the effects of various immune cell therapies.
[0155] Figure 38 shows the efficacy of ESK1 in combination with peripheral blood mononuclear cells (PBMCs) on MOS derived from lung tumor biopsies. IO assays of MOS from these lung tumor biopsies were prepared using the Annexin V marker, which indicates cell apoptosis, and Cytolite Red dye, which indicates tumor-infiltrating lymphocytes (TILs). As can be seen in Figure 38, MOS respond well (in the form of tumor cell apoptosis) to ESK1 in combination with PBMCs. If this test were performed with conventional bulk organoids, for example, the results would be less accurate (because PBMCs cannot penetrate conventional bulk organoids), and the best course of treatment for patients would be unclear.
[0156] Figure 39 shows the efficacy of TILs against MOS from lung tumor biopsies. IO assays of MOS from lung tumor biopsies were prepared using Annexin V, a marker that indicates cell apoptosis. As can be seen in Figure 28, MOS responded well to TILs (in the form of tumor cell apoptosis). This indicates that TILs can penetrate MOS and kill tumor cells.
[0157] Figure 40 shows the efficacy of PBMCs against MOS from lung tumor biopsies. IO assays of MOS from lung tumor biopsies were prepared using Annexin V markers, which indicate cell apoptosis, and Cytolite Red dye, which indicates tumor-infiltrating lymphocytes (TILs). As can be seen in Figure 40, MOS respond well to PBMCs (in the form of tumor cell apoptosis).
[0158] Figure 41 shows the efficacy of anti-PD1 (e.g., nivolumab) combined with TILs against MOS. As can be seen from Figure 41, MOS responds well (in the form of tumor cell apoptosis) to anti-PD1 combined with TILs. If this test were performed using, for example, conventional bulk organoids, the results would be less accurate (because TILs and nivolumab cannot penetrate conventional bulk organoids), and the best course of treatment for patients would be unclear.
[0159] Figure 42 shows the difference in the ability of infused patient-derived T cells to penetrate bulk organoids versus MOS. As mentioned above, immune cells have difficulty penetrating traditional bulk organoids. This can be directly confirmed in Figure 42, where T cells can penetrate MOS but not bulk organoids.
[0160] The gel droplets can be recovered from the oil phase and resuspended in, for example, PBS via PFO (perfluorooctanol) and centrifugation, which can separate the immiscible fluid from the MOS. Thus, as shown above in Figures 1A-1C, 2A-2C, 3A-3C, and 4A-4E, as well as in Figure 13, these MOSs, including tumor-based MOSs, can grow normally. This is a significant improvement because, to predict patient outcomes, drug screening must be performed on viable, growing primary tumor cells that retain characteristics from the patient's tumor. The large number and uniformity of these MOSs makes screening feasible and reliable, as described below.
[0161] In any of the microfluidic chips or devices described herein, the channels may be coated, for example, the channels of the microfluidic device may be coated with a hydrophobic material.
[0162] Generally, the MOSs described herein can have very uniform diameters and very small sizes (e.g., diameter distributions), as shown, for example, in Figure 14, which shows an example distribution of droplet diameter sizes.
[0163] As previously mentioned, Figures 15A-15B show MOSs formed as described herein. In Figures 16A-16B, these MOSs are stained with trypan blue (arrows), demonstrating their viability. MOSs formed as droplets in this manner can contain growth factors and matrices to mimic the biological environment in which the tissue originated. Patient samples (e.g., biopsy samples) can be formed into MOSs (containing hundreds, thousands, or tens of thousands of MOSs) within hours of obtaining the tissue. MOSs can have as few as one or four to six cells per MOS (e.g., cancer cells when sampling a tumor) or as many as several hundred cells. These methods have been shown to work for virtually every type of cancer and non-cancerous tissue tested to date (n=32), including colon cancer, esophageal cancer, melanoma, uterine cancer, sarcoma cancer, kidney cancer, liver cancer, ovarian cancer, lung cancer, diaphragm cancer, omentum cancer, diaphragm cancer, and breast cancer tissue. MOS can be cultured for any desired period of time, typically demonstrating proliferation and growth in as little as 3-4 days. They can be maintained and passaged for several months. As described in more detail below, they can be used to screen thousands of drug compositions within as little as 4-6 days of tissue collection (e.g., biopsy).
[0164] The MOS described herein can be banked at any time after their formation, for example, by cryopreserving them. Tumor MOS can be collected from many different patients and used individually or collectively to screen multiple drug formulations to determine toxicity and / or efficacy. Non-tumor cells (healthy tissue) can also be biopsied, banded, and / or screened in parallel. Thus, these methods and devices can enable high-throughput screening. MOS can be formed, passaged twice (e.g., doubling twice), and cryopreserved. As described above, these same MOS can be formed using normal healthy tissue to generate hundreds, thousands, or tens of thousands of MOS. These can be used to assay drug effects, drug responses, biomarkers, proteomic signals, genomic signals, and the like.
[0165] It is particularly important that these MOS survive in a biologically meaningful manner, allowing for the provision of clinically and physiologically relevant data, particularly regarding drug response, as shown in Figures 22A-22D and 23A-23D. In particular, the MOS described herein allow cells of tissue extract / biopsy origin to grow significantly better and provide more representative data, especially compared to organoids or spheroids. Without being bound by any particular theory, this may be because cells may have a more constrained cell density in MOS, allowing cells to communicate with each other without inhibiting each other while sharing signals. MOS also have a significantly larger surface area-to-volume ratio, allowing the transduction of growth factors and other signals to more easily penetrate MOS (e.g., MOS are less diffusion-restricted).
[0166] Assay The MOS described herein can be used in a variety of different assays, particularly to determine the effects (including toxicity) of drug formulations on normal and / or abnormal (e.g., cancerous) tissues. For example, drug screening can involve applying MOS to all or some of the wells of a multiwell (e.g., 96-well) plate. Alternatively, custom plates can be used (e.g., a 10,000-microwell array can be formed from 100 x 100 wells). MOS (e.g., gel droplets) can be applied to or onto multiple microwell arrays and incubated with culture medium. MOS can be cultured for 3 to 5 days. Then, in some situations, on day 5, wells (e.g., microreactors) can be dosed with drug compounds to examine the effects of a panel of drugs, e.g., based on a set of FDA-approved anticancer drugs. For example, the texted drugs can be based on the National Cancer Institute (Division of Cancer Treatment and Diagnosis) screen of 147 drugs intended to enable cancer research, drug discovery, and combination drug testing. On day 7, MOS may be imaged via standard fluorescent microscopy and ranked based on drug response.
[0167] An example of this assay technique is shown in Figures 17A-17E.
[0168] In this example, the screening assay can be automated. This can enable a repeatable, automated workflow, which can increase the number of drugs screened from a few to hundreds. Figures 17A-17E show an example of this workflow. In Figure 17A, a tumor biopsy is taken, and multiple (e.g., over 10,000) MOSs are formed as described above (Figure 17A illustrates the junctional regions that form the MOS). The MOSs can then be harvested and washed (e.g., to remove immiscible (e.g., oil) materials from which they formed). The MOSs can then be seeded into one or more microwell plates. As shown in Figure 17C, the MOSs can be cultured for one or more generations (e.g., one or more passages). This is shown to occur from day 0 to day 3, day 4, or day 5. The MOSs can then be screened, for example, by applying drugs to a subset of replicant wells, as shown in Figure 17D. Thereafter, as shown in Figure 17E, on day 7, cells in the MOS may be imaged and / or scored automatically or manually to identify drug effects (e.g., drug screening and growth profiling).
[0169] The workflow shown in Figures 17A-17E may enable the use of an integrated device for the growth, dosing, and / or screening of MOS. In one exemplary device, a freshly biopsied or resected patient tumor sample can be dissociated and seeded into a gel with reagents to form MOS (as described above). A portion of the formed MOS can be cryopreserved. The remainder can be harvested and incubated until seeded into microwell plates for drug testing or screening, as previously described. Growth and viability assays can be performed on the MOS, which can be imaged and tracked. Their response to drug treatment, such as IC50, cytotoxicity, and growth curves, can be measured to identify effective therapies for the patient's tumor.
[0170] The methods and devices described herein have many advantages, including reproducibility. The sample preparation process can be automated through microfluidic sample fractionation, potentially reducing the need for specialized personnel for diagnostic testing and manual pipetting. This may be particularly useful in clinical settings. Furthermore, this may enable uniformity among signal droplets, increasing assay sensitivity. Additionally, these assays may minimize the time required to generate MOS. Based on preliminary data, these methods may be capable of generating a library of over 100,000 MATRIGEL-tumor droplets (MOSs) in less than approximately 15 minutes. These methods are also highly scalable and can be multiplexed to perform multiple patient biopsies in parallel.
[0171] Finally, these methods are flexible and compatible with other techniques. As a research tool, droplet-based microfluidics is generally compatible with a wide range of hydrogel materials, including agarose, alginate, PEG, and hyaluronic acid. Therefore, the starting gel composition can be easily modified to accompany and promote MOS growth. Furthermore, droplet size can be adjusted by modifying the size of the microfluidic device. Taken together, these allow for a wide selection of gel material compositions and microreactor sizes.
[0172] For example, using MOS, the miniaturized assays described herein may maximize patient tumor biopsies, enabling the screening of more drug compounds. For example, a 600 μL tumor sample can be fractionated into approximately 143,000 individual microreactors, each approximately 4 nL in volume. By maximizing tissue sample size, multiple experimental replicates can be examined, increasing power. These techniques may enable the examination of intratumor heterogeneity, drug perturbations, and identify rare cellular events such as drug resistance. MOS may generally be compatible with downstream assays, including single-cell RNA transcriptome analysis and epigenetic profiling. Additionally, by maximizing the efficiency of tissue (e.g., biopsy) samples provided by MOS, a portion of MOS may be banked (e.g., by cryopreservation for biobanking) for future novel drug assays and / or confirmatory analyses, including genetic screening.
[0173] For example, Figures 18 and 19 illustrate a treatment method using methods and devices including the MOS described herein. In the context of precision medicine and personalized medicine, these methods and devices can be used as clinical indicators for appropriate drug selection to improve clinical outcomes and drug response. As an example, a patient diagnosed with metastatic cancer undergoes a biopsy for histopathology and screening of multiple MOSs formed from the biopsy as described herein. Within 7-10 days, screening may be performed from the biopsy to identify the most effective standard of care regimen, allowing the patient to begin treatment in approximately 14 days.
[0174] An example of this is shown in FIG. 18. In this example, a tumor may be identified 1801 (e.g., by CT scan) on day 0, a biopsy may be taken 1805 on day 5, and hundreds, thousands, or tens of thousands of MOSs may be formed the same day, cultured for 1-5 days, and screened 1805 to identify one or more drug compositions that may be used. This same step (forming and screening MOSs) can be used to guide precision medicine at multiple clinical decision points throughout disease progression. In this example, therapy using the identified one or more drug compositions may be initiated on day 14 (1809), and the patient may be monitored later during the course of treatment (e.g., with a follow-up CT scan at about day 90) to confirm that the tumor is responding to treatment 1811. The therapy may then be continued 1813, and ongoing progression monitored 1815.
[0175] As previously mentioned, the use of MOS assays can be repeated at multiple time points throughout and during the course of treatment. This is illustrated in FIG. 19. For example, if a patient is initially diagnosed 1907 with a resectable primary tumor, this technology (e.g., generating and screening 1905 MOS) can be used to determine the most effective neoadjuvant therapy 1921. Thus, biopsies can be taken, and hundreds, thousands, or tens of thousands of MOS can be generated and screened with a panel of candidate drug compositions. Once the primary tumor is resected 1923, this technology 1905' can indicate whether and which adjuvant therapy should be selected 1925. If recurrence or metastasis occurs after surgical removal of the primary tumor 1927, the same technology (e.g., generating and screening MOS from fresh biopsies 1905'', 1905''', 195''') can be used to guide standard of care regimens, including first-line 1929, second-line 1931, and third-line 1933 therapies. If a patient eventually becomes tolerant or resistant to all standard of care therapies, this technique 1905 can be performed to identify off-label drugs to treat the resistant tumor 1935. This technique can also be used as a companion diagnostic to identify patients who are eligible for specific treatments. Finally, this technology can be used to derive and store patient-derived MOS to establish organosphere-based living cancer banks for screening, genomic profiling, drug discovery, drug testing, and clinical trial design.
[0176] Because these techniques, and the generation of vast numbers of MOSs, can be performed relatively minimally invasively (e.g., by excision or biopsy) to provide reasonably rapid results from screening, these methods can be easily adapted to standard of care. For example, the volume of cellular material from tissue (e.g., biopsy) input is very small, e.g., dissociated into volumes of 10 μL to 5 mL.
[0177] Generally, the use of the MOS described herein for screening can be automated or performed manually. Virtually any screening technique can be used, including imaging by one or more of confocal microscopy, fluorescence microscopy, liquid lenses, holography, sonar, bright-field and dark-field imaging, lasers, and planar laser sheets (including, for example, high-throughput embodiments of image-based analysis methods using computer vision and / or supervised or unsupervised models, e.g., CNNs). Downstream screening can include sampling the culture medium and / or performing gene or protein screening (e.g., scRNA-seq, ATAC-seq, proteomics, etc.) on cells from the MOS. [Example]
[0178] Example 1 20 and 21 show another example of an apparatus for forming multiple MOSs as described herein. In FIG. 20, the apparatus may include multiple MOS-forming junctions where immiscible materials (e.g., oil) 2002 can be added to reservoirs and / or ports 2004 in the device. Similarly, unpolymerized materials 2006 (which in this example include dissociated biopsy cells and fluid matrix material) can be added to reservoirs or ports 2008 in the device. A second or additional material (e.g., a biologically active agent) can be added through a third set of ports 2010. These components can be combined at junctions (similar to those described above) to form droplets in the immiscible material that can be polymerized into MOSs. In FIG. 20, three (or more) parallel junctions with corresponding inputs and outputs are shown.
[0179] Figure 21 illustrates a method of forming a MOS using the apparatus shown in Figure 20. In this example, the resulting MOS contains both target (e.g., tumor) biopsy cells and one or more additional biologically active agents that combine to form the MOS. For example, a first channel 2103 can contain unpolymerized material (including dissociated biopsy cells and a matrix material), a second channel 2107 can contain additional active biomaterials, and a pair of intersecting channels 2109, 2109' carrying immiscible materials (e.g., oil) converge at a junction to form size-controlled droplets that are polymerized to form the MOS 2107.
[0180] In this example, the additional active biomaterial may be, for example, a freezing medium (e.g., to support banking of MOS), and / or additional cells (e.g., immune cells, stromal cells, endothelial cells, etc.), additional support network molecules (e.g., ECM, collagen, enzymes, glycoproteins, biomimetic scaffolds, etc.), additional growth factors, and / or co-culture with drug compounds.
[0181] Example 2: Screening Results As described above, MOS and methods of using it to screen drug compositions can be used to accurately predict a patient's tumor response to one or more drug therapies. In some cases, the use of MOS can provide accurate results even when traditional culture drug screens cannot accurately predict drug response. For example, in Figures 22A-22D, MOS, but not cell line, was able to correlate with patient response. In Figure 22A, a traditional cell line treated with a drug (e.g., oxaliparidine) was tested. This cell line showed no effect, predicting that the tumor would be resistant to the drug across the entire dose range tested.
[0182] For comparison, multiple MOSs were generated from patient biopsies, as shown in Figure 22B. In this example, the MOS showed a significant decrease in cell survival from the tumor MOS and predicted drug sensitivity. Indeed, when treated with the drug, the tumor responded to treatment, as shown in Figure 22C (pre-treatment) and Figure 22D (post-treatment).
[0183] Example 3: Correlation between MOS and patient response In a similar set of experiments, MOSs were generated from biopsies (Figure 23A) and used to perform drug efficacy screening. Figure 23B shows the effect of the first drug (oxaliparatide) on these MOSs. There was no change in % survival of MOS in the presence of the drug, predicting drug resistance. Similarly, treatment with a second drug, irinotecan, showed a lack of effect on MOS, as shown in Figure 23C, predicting drug resistance. A patient treated with both oxaliparatide and irinotecan showed no response after 6 months of treatment. Thus, MOSs strongly correlated with the patient's response to standard of care. In this case, the patient endured 6 months of side effects and toxicity that could have been avoided by the predicted response from MOS, demonstrating (within 7–10 days of biopsy) that the tumor was unresponsive to these drugs.
[0184] Example 4: Multi-drug screening Figure 24 shows an example of a panel of drugs (e.g., chemotherapeutic agents) that can be generated using multiple patient-derived MOSs described herein. In this example, drug screening using patient-derived MOSs was performed by administering multiple replicates of each of multiple (27) drugs. A single tumor biopsy was used to generate a large number of multiple MOSs very quickly (e.g., within less than two weeks), and these MOSs were tested against a panel of drug formulations (e.g., 27 formulations are shown). This testing is performed in parallel and can be automatically quantified (e.g., by optical detection and quantification). In this example, the drug exhibiting the greatest toxicity against this particular tumor was pazopanib.
[0185] Drug combinations, as well as different drug concentrations, can be examined in parallel. This type of array testing is made practical by the methods and apparatus described herein, as hundreds, thousands, or tens of thousands of MOSs can be generated from the same tumor biopsy.
[0186] Example 5: Preparation of biopsy samples Materials: Apparatus containing a droplet microfluidic chip (200 um) for forming MOSs as described above, Bio-rad droplet generation oil for EvaGreen (catalog #186-4006), 3-5 mL per run, perfluorooctanol (PFO), Sigma, 10% perfluorooctanol (PFO) in Novec HFE7500, PBS, cell media (i.e., RPMI with 10% FBS and 1% PenStrep), 70 um or 100 um filters, 50 mL conicals, Petri dishes.
[0187] Biopsy sample dissociation: Use a biopsy sample (human / animal) to generate a dissociated sample (i.e., single-cell tissue) from the patient. Coat the microfluidic chip and assemble the microfluidic chip and holder. Connect the microfluidic tubing and fittings to the MOS and waste oil outputs (e.g., multi-wall plate, 15 mL Eppendorf).
[0188] Run the device to form a MOS. Remove the output (plate, Eppendorf tube, etc.) containing the droplets from the incubator (after at least 15 minutes). Remove excess oil from the output. The droplets should be buoyant, so the oil should be at the bottom of the vial. Be careful not to remove the droplets from the tube. Add 100uL of 10% (v / v) PFO to the output. Carefully swirl to mix and wait approximately 1 minute. Do not pipette or agitate the sample. Centrifuge at 300g for 60 seconds. Remove the supernatant (excess oil / PFO). Do not pipette or agitate the sample. Remove as much PFO as possible, as this chemical can reduce cell viability during incubation. Add 1mL of cell culture medium. Do not pipette or agitate the sample. Centrifuge at 300g for 60 seconds. Remove the supernatant and excess oil / PFO. Add 1mL of cell culture medium. Using a 1 mL pipette tip, carefully pipette the sample up and down (approximately 30 times). Be careful not to overpipette or disturb the droplet sample. Using a 1 mL pipette tip, pass the droplet medium solution through a 70 μm or 100 μm filter (connected to a 50 mL conical). Some droplets will adhere to the inside of the output (e.g., a 15 mL Eppendorf). Rinse each tube with 2-3 mL of PBS and pipette up and down. Pass the rinsed PBS and droplets through the filter. Repeat this step twice, or until the tubes are clear and the droplets have been transferred to the filter. Using a 1 mL pipette tip, carefully wash the filter containing the droplets with approximately 5 mL of PBS. Be sure to cover the entire surface of the filter. This washing step removes excess oil and PFO from the sample, allowing for the eventual recovery of the gel droplets into cell culture medium.
[0189] Once properly drained (approximately 1-2 minutes), carefully remove the filter from the 50 mL conical. Turn the filter upside down and wash the backside with fresh cell culture medium, then collect the solution in a fresh Petri dish. This will separate the droplet from the filter and place it in the cell culture medium. It is recommended to use a 1 mL pipette tip and wash with approximately 5 mL of medium.
[0190] Check the quality of the droplets under a microscope. Most / all of the oil should be removed. If recovery is low, the sample may be re-filtered. The density of the recovered MOS may be confirmed by hemocytometer.
[0191] Example 6: Renal tissue MOS In another example, MOS can be formed from biopsied kidney tissue. For example, the equipment used can include a tube rotator or 100 μm and 70 μm cell strainers, 15 mL conical tubes, 50 mL conical tubes, razor blades, tweezers and surgical scissors, Petri dishes (100 × 15 mm), or tissue culture dishes. Reagents can include the following: EBM-2 medium, collagenase (5 mg / mL stock), Hank's balanced salt solution (HBSS), calcium chloride (10 mM stock solution), phosphate buffer solution (1 × PBS), MATRIGEL, 0.4% trypan blue solution, and trypsin.
[0192] Renal tissue should always be kept in cold transport media and on ice. 2 mL of enzyme digestion solution can be placed in a 15 mL conical tube. Add 600 μL of calcium chloride (final concentration: 3 mM) and 200 μL of collagenase (final: 0.5 mg / mL). Transfer the kidney sample to a Petri / culture dish. Remove any excess or non-tumor tissue with a sterile tissue or razor blade. Add 1 mL of enzyme solution to the tissue. Cut the sample into small pieces (<2 mm2) with a sterile razor blade. Hold the plate with tweezers or by hand. Return the chopped tissue and enzyme solution to the 15 mL tube containing the enzyme solution. Place the tube on a tube rotator or a 15 mL tube rotator in a 37°C incubator for 30-60 minutes. Remove the tube from the incubator. Quench the enzymatic digestion with at least 6 mL of EBM-2 (at least 3 times the volume of the enzymatic digestion solution). Pipette to mix. Place a 100 μm or 70 μm cell strainer on a 50 mL conical tube. Transfer the sample through the strainer. Transfer the solution to a new 15 mL conical tube. Centrifuge the sample at 1500 rpm for 5 minutes. Discard the supernatant, leaving the cell pellet. Resuspend the pellet in 1 mL of EBM-2 medium. Add 10 μL of the cell mixture to 10 μL of trypan blue on a piece of parafilm and transfer to a cell counting plate or hemocytometer. Calculate the cell concentration (# / mL). Centrifuge at 1500 RPM for 5 minutes, discard the supernatant, leaving the pellet. The cell pellet will be 1.25 x 10 5 Resuspend in 50uL of MATRIGEL per cell. Keep on ice. Plate a 50uL dome of MATRIGEL cell suspension in the center of a well in a pre-warmed 24-well flat-bottom plate. Transfer the plate to a 37°C cell incubator and incubate for at least 20 minutes. Ensure the dome is polymerized. Gently add 500uL of pre-warmed EBM-2 medium along the side of the well. Incubate in a 37°C incubator. To expand MOS, perform a complete medium change every 2 days.
[0193] Example 7: Liver microorganospheres As previously described, MOSs can be formed from normal (e.g., non-cancerous) and / or abnormal tissue. For example, FIGS. 25A-25B and 26A-26B show an example of a MOS formed from dislocated mouse liver tissue. The mouse liver tissue was combined with a fluid matrix material to form an unpolymerized mixture, and then droplets of the unpolymerized mixture were polymerized to form the MOS. In this example, the MOS has a diameter of approximately 300 μm. In FIGS. 25A-25B, the MOS was formed with a single cell per droplet. In FIGS. 26A-26B, the MOS was formed with 25 cells per droplet. In FIG. 25A, the MOS is shown one day after formation; FIG. 25B shows the MOS after 10 days in culture. Cells in some MOSs have divided, forming clusters that exhibit structure. Other MOSs contained cells that divided slowly or did not divide. Similarly, in FIGS. 26A-26B, the MOSs initially contain approximately 25 cells per MOS. After 10 days in culture, some MOS showed extensive cell growth and formed structures, while others showed only minimal growth. In both cases, the cells within the MOS were found to exhibit properties characteristic of the tissue from which they were derived (e.g., hepatocytes).
[0194] The same procedure was successfully performed on human liver tissue, as shown in Figures 27A-27C. In this example, MOSs were initially formed with approximately 50 cells, as shown in Figure 27A. By day 18 of culture, some MOSs had clusters and showed cells forming structures, while others had smaller structures or the cells did not divide.
[0195] Example 8: Cultured Cell Microorganospheres In addition to primary tissue, for example, primary tissue removed from a patient immediately before or shortly before forming the MOS, MOS can be formed from cultured cells or cells, including either 2D cultured cells or 3D cultured cells.
[0196] MOS can be formed from cell lines grown as part of a patient-derived xenograft (PDX). For example, Figures 28A-28D show MOS formed from cultured PDX240 cells. PDX240 cells are a patient-derived xenograft (PDX) tumor cell line (numbered 240 based on the patient source), a human tumor grown in immunodeficient mice (PDX) to form tumors in vivo. The xenograft tissue was extracted, dissociated, and used to form MOS as described above. In this example, each MOS contained a single cell at the time of formation. Figure 28A shows a MOS after 1 day of culture, Figure 28B shows a MOS after 3 days of culture, and Figures 28C and 28D show MOS after 5 and 7 days of culture, respectively. Over time in culture, at least some MOS demonstrate that the cells divide and form structures.
[0197] Figures 29A-29D show a similar experiment, where each droplet forming each MOS initially contained five PDX240 cells. Over time in culture (e.g., from days 1, 3, 5, and 7, as shown in Figures 29A-29D, respectively), the cells can divide and form structures.
[0198] Example 9: Comparison of MOS with conventional organoids Organoids were formed from patient-derived xenograft cells (including the PDX240 cells described above and a second PDX cell line, PDX19187) and compared with MOS formed using the same cells. Organoids were formed using conventional techniques, in which large amounts of MATRIGEL were seeded into wells or dishes with cells and cultured until growth was observed. MOS were generated from conventional organoids.
[0199] Both conventional ("bulk") organoids and MOS were then treated with the same drug (e.g., oxaliplatin or SN38), and cell viability was measured three days after treatment. The drug response curves shown in Figures 30 and 31 were generated and show similar response curves. For example, in Figure 30, the drug response curves for PDX19187 bulk organoids and MOS, as well as PDX240 bulk organoids and MOS, showed similar response curves to oxaliplatin concentrations. In Figure 31, the drug response curves for both PDX19187 and PDX240 also showed similar results to SN38 for both bulk organoids and MOS. Figure 32 shows the response curve for another anticancer drug, 5-FU (fluorouracil), again showing similar drug response curves for both PDZ-19187 and PDX-240 conventional organoids and MOS.
[0200] Therefore, MOS described herein can be formed more quickly and reliably, and can have a higher overall survival rate compared to conventional organoids, and can provide drug responses comparable to bulk organoids formed using the same cells.However, as described herein, MOS can be used more quickly and can be formed in much larger numbers.
[0201] Example 10: Effect of drugs on MOS Generally, the MOS described herein can be used to perform one or more assays, including toxicity assays. Any suitable assay can be performed, and the results determined by analyzing the tissue (e.g., cells, tissue structures) suspended within the MOS. The MOS described herein can be assayed or analyzed optically, chemically, electrically, genetically, or in any other manner known in the art.
[0202] Optical (either manual or automated) detection can be particularly useful and can include optically analyzing the effect of one or more drug formulations on tissues (including cells, cell clusters, cell structures, etc.) within the MOS. As described above, drug formulations can be assayed for cell death (e.g., tissue number and / or size) within the MOS being tested. MOS can be assayed for cell growth, including a decrease in size, type, and / or rate of growth. MOS can be assayed for changes in the tissue structures formed.
[0203] For example, Figures 33A-33B show the effect of one drug formulation (in this example, acetaminophen (10 mM)) on mouse liver MOS. Figure 33A shows a control group in which MOS was not treated, and shows tissue within the MOS (arrows) that grew in culture. Figure 33B shows a similar set of MOS formed from mouse livers treated with 10 mM acetaminophen instead. In the control group, the tissue structures within the MOS are relatively large compared to the treated group. Most MOS tissues in the acetaminophen group are smaller and contain many dead cells.
[0204] Similarly, Figures 34A-34B also show toxicity assays using human liver MOS. Figure 34A shows typical human liver MOS observed in the control group, including tissue structures formed within it (indicated by arrows). Figure 34B shows a treatment group in which human liver MOS was treated with acetaminophen (10 mM). Tissue in the treated MOS showed atypical tissue structures (arrows) and a significant increase in debris compared to the control group.
[0205] Any of these assays, including optical assays, may be scored, graded, ranked, or otherwise quantified. For example, in Figures 33A-33B and 34A-34B, the results of these two assays may be quantified to show size differences, number of live / dead cells / tissue, etc. Scoring may be automated.
[0206] Example 11: Viral vector-based delivery of components to MOS Generally, any viral vector-based method, including those described herein, may be utilized to deliver components to the MOS. In this example, the following protocol was followed: - MOS were generated using colorectal cancer (CRC) patient-derived organoid cells in 70% MATRIGEL at 10 cells per MOS. - Transduce cells with a lentivirus encoding GFP (LentiArray™ CRISPR Negative Control Lentivirus, human, not targeting GFP) at an MOI of 10 using polybrene. - Centrifuge the MOS and virus at 200 x g for 2 hours at 37°C. - Transfer cells to plates and incubate overnight - Wash the plate to remove extracellular viruses After two days, MOS were imaged. Single cells were then obtained by MOS dissociation and fixed in 4% paraformaldehyde solution. Successful transfection was confirmed by flow cytometry.
[0207] Figure 45 shows the results of delivering components to MOS using lentiviral vectors. Cells can be edited using viruses as a delivery mechanism.
[0208] Example 12: Electroporation method for delivering components to the MOS A GFP plasmid (Lonza pMaxGFP) was used as a readout to test the electroporation method used to deliver components to the MOS. Because the GFP-containing DNA plasmid is large, several times larger than the CRISPR / Cas9 complex, it was expected to be more difficult to deliver to MOS, but it had the advantage of providing a visual readout that could be quantified in a simple manner.
[0209] The GFP plasmid was delivered to MOS according to the following protocol: - Generate MOS using organoid cells from CRC patients in 70% MATRIGEL one day before nucleofection, with 10-15 cells per MOS. In an initial optimization experiment, 80 parallel reactions were performed using five different primary cell lines, 4D-Nucleofector Solutions P1–P5, in combination with 15 Nucleofector Programs (i.e., CA-137, CM-138, CM-137, CM-150, DN-100, DS-138, DS-137, DS-130, DS-150, DS-120, EH-100, EO-100, EN-138, EN150, and EW-113), plus one control. Each reaction consisted of 20uL of P1 / P2 / P3 / P4 / P5 4D-Nucleofector X Solution, 0.4ug of pmaxGFP vector, and 75-100 MOS. The reaction mixture was transferred to the corresponding well of a 16-well Nucleocuvette Strip, and then nucleofection was performed using the 4D-Nucleofector X Unit with the Nucleofector Program preset for each well. - After the run, the Nucleocuvette Strip was incubated at room temperature for 10 minutes. - The MOS were resuspended in 180uL of pre-warmed medium by gently pipetting 2-3 times and replated into a 96-well plate. After 4 days, MOS were imaged, followed by dissociation of MOS and confirmation of nucleofection efficiency by flow cytometry.
[0210] 120 different electroporation conditions were tested, as shown in Figure 46. The conditions were based on 8 different buffers and 15 different pulse conditions.
[0211] Four combinations of buffer and pulse conditions were effective in producing GFP expression in individual MOSs, as shown in Figure 47. Figure 48 shows the percentage of cells that took up the GFP plasmid and expressed GFP. Pulse conditions and buffers are indicated on the x-axis.
[0212] Example 13: Gene editing in MOS using CRISPR / Cas9 complex components Gene editing in MOS was assessed by electroporation delivery of CRISPR / Cas9 ribonucleoproteins.
[0213] Figure 49 shows the results of testing different buffers. P1 buffer resulted in a higher percentage of edited cells compared to P3 buffer.
[0214] Figure 50 shows the effect of various parameters on gene editing and MOS stability. Test No. 6 is a repeat of Test No. 5.
[0215] Figure 51 shows the results of gene editing of MOS using the following protocol: The PDO was split into new domes 3 days before use. MOS were generated using organoid cells derived from CRC patients in 60% MATRIGEL at 10 cells per MOS. Before electroporation, MOS were seeded overnight.
[0216] the next day CRISPR / Cas9 ribonucleoprotein complexes (RNPs) were generated by combining the following in the order listed: 16.4ul P1 buffer / sample 3.6ul sample
[0217] 2.2ul 30pmol / ul of sgRNA (B2M-CGGAGCGAGAGAGCACAGCG, GGCCGAGAUGUCUCGCUCCG, ACUCACGCUGGAUAGCCUCC) 1.6ul Cas9 (Synthego, 20pmol / ul) Pre-incubate for 20 minutes before use to allow RNP formation → Warm to 37°C before adding to MOS If a longitudinal study was performed, sufficient RNP was generated for all time points. RNPs were stored at 4°C for daily use during the time course and allowed to warm to room temperature before electroporation.
[0218] MOS collection The collected MOS was centrifuged at 200 x g for 3 minutes at 25°C. The centrifuge should not be used at 4°C.
[0219] Remove as much supernatant as possible → Resuspend if using samples containing different RNPs
[0220] MOS were counted using the EVOS Cell Imaging System, and 100 MOS were added per well.
[0221] Resuspend the MOS in 20 μl of RNP solution (for 16-well strip tubes) and incubate at 37°C for 20 minutes.
[0222] MOS are electroporated with CA-137 setting 6 days after MOS generation.
[0223] Samples were harvested, triple digested, and stained with the relevant antibodies (live / dead V450 and APC B2M (1:200 dilution)) for 30 minutes on ice. Results were analyzed by flow cytometry using standard protocols.
[0224] Figure 52 shows Cas9-GFP on the edge of the MOS.
[0225] The green CRISPR / Cas9 signal throughout the MOS indicates that CRISPR / Cas9 penetrates the entire MOS within 20 minutes of protein addition. Except for the high concentration at the border of the MOS, no clear green ring is observed, indicating a large concentration gradient of CRISPR / Cas9 within the MOS. This data implies that gene editing can occur in any cell within the MOS, regardless of location.
[0226] FIG. 53 shows an analysis of RNP MOS delivery.
[0227] As described above, MOS cells were transformed using CRISPR / Cas9 complexes with guide RNAs targeting β2-microglobulin. The goal of this experiment was to knock out a gene in the cells and evaluate downstream outcomes. After transformation, cells were assessed for surface expression of β2-microglobulin by flow cytometry, and the number of cells that lost B2M protein was determined. In this representative example, 91.4% of cells did not express B2M protein. The loss of B2M indicates that both copies of the gene were successfully edited. The scrambled guide RNA sample used a guide RNA that does not target β2-microglobulin in the CRISPR / Cas9 complex, demonstrating the specificity of the knockout for the specific guide RNA used.
[0228] conclusion The method allows for the delivery of CRISPR-CAS gene editing components to one or more cells within a MOS, and can obtain editing efficiencies of about 80%, greater than 80%, or greater than 90%.
[0229] Although specific conditions for electroporating MOS are described, electroporation can be performed in any setting conventionally suitable for electroporating cells. For example, any suitable cuvette or similar vessel capable of holding MOS and configured to receive electricity for electroporation can be used.
[0230] Any of the methods (including user interfaces) described herein may be implemented as software, hardware, or firmware and may be described as a non-transitory computer-readable storage medium storing a set of instructions that may be executed by a processor (e.g., a computer, a tablet, a smartphone, etc.) and that, when executed by the processor, cause the processor to control / perform any of the steps including, but not limited to, displaying, communicating with a user, analyzing, changing parameters (including timing, frequency, intensity, etc.), making decisions, alerting, etc.
[0231] When a feature or element is referred to herein as being on another feature or element, it may be directly on the other feature or element, or intervening features and / or elements may also be present. In contrast, when a feature or element is referred to as being "directly on" another feature or element, there are no intervening features or elements present. It will also be understood that when a feature or element is referred to as being "connected," "attached," or "coupled" to another feature or element, it may be directly connected, attached, or coupled to the other feature or element, or there may be intervening features or elements present. In contrast, when a feature or element is referred to as being "directly connected," "directly attached," or "directly coupled" to another feature or element, there are no intervening features or elements present. Although features and elements are described or illustrated with respect to one embodiment, the features and elements so described or illustrated may also apply to other embodiments. Those skilled in the art will also understand that a reference to a structure or feature located "adjacent" to another feature may have portions that overlap with or underlie the adjacent feature.
[0232] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. For example, as used herein, the singular forms "a," "an," and "the" are intended to include the plural forms unless the context clearly dictates otherwise. It will be further understood that the terms "comprises" and / or "comprising," as used herein, specify the presence of stated features, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items (sometimes abbreviated as " / ").
[0233] Spatially relative terms, such as "below," "lower," "above," "above," etc., may be used herein for ease of description to describe the relationship of an element or feature shown in the figures to another element(s) or feature(s). It will be understood that spatially relative terms are intended to encompass different orientations of the device in use or operation in addition to the orientation shown in the figures. For example, if the device in the figures were inverted, an element described as "below" or "directly below" another element or feature would be oriented "above" the other element or feature. Thus, the exemplary term "below" can encompass both an orientation above and below. The device may be otherwise oriented (rotated 90 degrees or at other orientations), and the spatially relative descriptors used herein will be interpreted accordingly. Similarly, terms such as "upward," "downward," "vertically," "horizontally," etc. are used herein for descriptive purposes only, unless otherwise specified.
[0234] The terms "first" and "second" may be used herein to describe various features / elements (including steps), but these features / elements should not be limited by these terms unless the context dictates otherwise. These terms may be used to distinguish one feature / element from another. Thus, a first feature / element discussed herein could be referred to as a second feature / element, and similarly, a second feature / element discussed herein could be referred to as a first feature / element, without departing from the teachings of the present invention.
[0235] Throughout this specification, unless the context requires otherwise, the word "comprise," and embodiments such as "comprises" and "comprising," mean that various components can be used together in methods and articles (e.g., compositions and apparatuses, including devices and methods). For example, it will be understood that the term "comprising" implies the inclusion of any stated elements or steps, but not the exclusion of any other elements or steps.
[0236] Generally, any of the apparatus and methods described herein should be understood to be inclusive; alternatively, all or a subset of the components and / or steps may be exclusive and may be expressed as "consisting of" or alternatively "consisting essentially of" the various components, steps, subcomponents, or substeps.
[0237] As used herein, including in the examples, unless expressly specified otherwise, all numbers may be read as if preceded by the word "about" or "approximately," even if the term is not explicitly indicated. The phrase "about" or "approximately," when describing a size and / or location, may be used to indicate that the stated value and / or location is within a reasonably expected range of values and / or locations. For example, a numerical value may have a value of + / - 0.1% of the stated value (or range of values), + / - 1% of the stated value (or range of values), + / - 2% of the stated value (or range of values), + / - 5% of the stated value (or range of values), + / - 10% of the stated value (or range of values), etc. Unless the context dictates otherwise, any numerical value given herein should also be understood to include "about" or "approximately" that value. For example, if the value "10" is disclosed, "about 10" is also disclosed. Any numerical ranges described herein are intended to include all subranges subsumed therein. As will be appreciated by those of ordinary skill in the art, when a value is disclosed as "less than or equal to," it is understood that "greater than or equal to" and possible ranges therebetween are also disclosed. For example, when a value "X" is disclosed, "less than or equal to X" as well as "greater than or equal to X" (e.g., X is a numerical value) are also disclosed. It is also understood that throughout this application, data is provided in several different formats, and this data represents endpoints and starting points, as well as ranges for any combination of the data points. For example, when a specific data point "10" and a specific data point "15" are disclosed, it is understood that values greater than 10, greater than or equal to 10, less than 10, less than or equal to 10, and equal to 10, greater than 15, greater than or equal to 15, less than 15, less than or equal to 15, and equal to 15 are considered to be disclosed, in addition to values between 10 and 15. It is also understood that each unit between two specified units is disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0238] While various exemplary embodiments have been described above, any of several modifications may be made to the various embodiments without departing from the scope of the invention as set forth in the claims. For example, the order in which the various method steps described are performed may often be changed in alternative embodiments, and in other alternative embodiments, one or more method steps may be omitted entirely. Optional features of the various device and system embodiments may be included in some embodiments but not in other embodiments. Accordingly, the foregoing description has been provided primarily for illustrative purposes and should not be construed as limiting the scope of the invention as set forth in the claims.
[0239] The examples and figures included herein illustrate, by way of illustration, not limitation, specific embodiments in which the subject matter may be practiced. As noted above, other embodiments may be utilized and derived therefrom, such that structural and logical substitutions and changes may be made without departing from the scope of the present disclosure. Such embodiments of the inventive subject matter may be individually or collectively referred to herein by the term "the present invention" merely for convenience, and where more than one is actually disclosed, without intending to intentionally limit the scope of this application to any single invention or inventive concept. Thus, while specific embodiments have been illustrated and described herein, any embodiment calculated to achieve the same purpose may be substituted for the specific embodiment shown. The present disclosure is intended to cover all adaptations or embodiments of the various embodiments. Combinations of the above embodiments with other embodiments not specifically described herein will be apparent to those skilled in the art upon reviewing the above description.
[0240] Supplementary Experimental Procedures Immunofluorescence staining. Immunofluorescence staining was performed according to a previously published protocol (Dekkers et al., 2019). Briefly, bulk organoids or MOS were spun down, washed with PBS + 5% BSA, and removed from Matrigel by digestion using cell recovery solution (Corning #354253) for 30–60 min. They were then incubated in 4% PFA for 45 min at 4°C. Next, bulk organoids or MOS were transferred to 200 μl of wash buffer (OWB) (0.1% Triton X-100, 2 g of BSA per liter of PBS) in a 24-well low-binding plate, and incubated for 15 min at 4°C. Primary antibodies were then added and incubated overnight at 4°C. Primary antibodies were diluted to 2x working concentration in OWB and added in 200 μl volumes to each well. On day 2, the primary antibodies were removed and washed three times with 1 ml of OWB, with 2-hour intervals between each wash. The secondary antibody was added at 2x the working concentration (200 μl per well) during the third wash and incubated overnight at 4°C. On day 3, the cells were washed three times under the same conditions as the primary antibody. Nuclei were stained with DAPI, and organoids or MOS were cleared using fructose-glycerol clearing solution at room temperature for 20 minutes. Organoids or MOS (20 μl) in the clearing solution were mounted on slides and photographed using a Leica SP5 or Leica SP8 confocal microscope. A list of the reagents used is provided in Supplementary Table 1.
[0241] Gene expression analysis of human colon organoids or MOS. Human colon organoids or MOS were collected in RLT lysis buffer, and RNA was extracted using the Qiagen RNeasy Mini kit (catalog no. 74104) according to the manufacturer's instructions. Total RNA (1 μg) was used to generate complementary DNA (cDNA) using the Promega GoScript Reverse Transcriptase kit (catalog no. A5003), and the expression of the following genes was analyzed: AXIN2, CCNB1, FABP1, LGR5, MCM2, MUC2, CHGA, and EPHB2; expression levels were normalized to those of GAPDH. A list of the primers used can be found in Supplementary Table 1.
[0242] Generation of Ezrin Reporter Strains. Ezrin fluorescent reporter strains were established using a previously described strategy (Artegiani et al., 2020). Briefly, cells were transfected with Cas9 delivered from a targeting plasmid containing a tdTomato sequence linearized at a base position defined by a specific sgRNA (Supplementary Table 1) and a second plasmid encoding mCherry (Schmid-Burgk et al., 2016). These two plasmids were cotransfected with a plasmid encoding an sgRNA specific to the ezrin C-terminus. All three plasmids were transfected at 5 μg. Transfection was performed using a NEPA21 electroporator and a previously developed protocol (Fujii et al., 2015). Transfected cells were sorted based on mCherry expression. Clonal organoids with correct targeting were then selected based on ezrin-tdTomato fluorescence.
[0243] Radiation and chemotherapy. PDOs established from head and neck cancer patients were passaged to single cells using TrypL E and suspended in 70% Cultrex reduced growth factor BME type II (R&D systems, catalog no. 3533-010-02). For bulk organoids, the suspension was replated in GF medium plus rho-kinase inhibitor (Rhkl) (AbMole, catalog no. M1817) as per normal passage. MOS were generated using the same single cell / BME suspension as above, with 10–20 cells per MOS droplet. After 2 days, PDO organoids were harvested by removing the BME by adding 1 mg / ml Dispase II (Sigma-Aldrich, catalog no. D4693) and incubating at 37°C for 30 minutes. Organoids were harvested, washed twice with AdDF+++ (Advanced DMEM / F12, 1x Glutamax, 10 mM HEPES, 100 / 100 U / ml PenStrep) medium, filtered through a 70 mm nylon strainer, and counted. Organoid density was calculated at 25,000 organoids / ml and resuspended in 5% BME / GF medium without Rhkl. For MOS, the medium was refreshed with GF medium to remove Rhkl. PDO suspension or MOS (40 μl each) was dispensed per well into an ultra-low attachment 384-well plate (Corning, catalog no. CORN4588) using a multidrop combi reagent dispenser. The plate was sealed with Breath-Easy plate seals (Sigma, catalog no. Z380059) and incubated at 37°C. Cetuximab (obtained from the hospital pharmacy), gefitinib (Selleckchem, catalog number S1025), and afatinib (Selleckchem, catalog number S1011) were added to the MOS using a Tecan D300e digital dispenser. Cetuximab was dissolved in PBS + 0.3% Tween-20, and afatinib and gefitinib were dissolved in DMSO. All wells were normalized to the appropriate solvent used, never exceeding 1% for DMSO or 2% for PBS-Tween-20. Drug exposures were performed in triplicate, and irradiation was performed in quadruplicate.Staurosporine (Sigma, Cat. No. S5921) was used as a positive control at 1 μM.
[0244] The day after PDO / MOS dispensing, each plate was fixed onto a 2 cm polystyrene box and irradiated submerged in water at 37°C. Plates were irradiated at doses ranging from 2 Gray to 10 Gray in 2 Gray increments, with a 0 Gray plate used as a control. Plates were returned to the incubator, and on day 5, CellTiter-Glo® 3-D Reagent (Promega, catalog number G9681) was added according to the manufacturer's instructions. Luminescence was read using a Spark multimode microplate reader (Tecan).
[0245] For targeted therapy, results were normalized to vehicle (100%) and baseline control (staurosporine, 0%). For irradiation, viability calculations were performed by normalizing each irradiation dose to unirradiated (0 Gray). Dose-response curves were plotted using GraphPad Prism software (version 9.0.1).
[0246] Histological staining. Organoids or MOS were harvested from the wells and washed twice with AdDF+++ medium to remove residual BME. Subsequently, organoids or MOS were fixed in formaldehyde for 24 hours and dehydrated in 25–70% ethanol before embedding in paraffin. Slides were cut at a thickness of 5 μm. Organoids or MOS were stained with hematoxylin and eosin for H&E staining or with primary antibodies for IHC. Details of the primary antibodies for IHC are listed in the Supplementary Table.
[0247] Establishment and maintenance of human airway organoids from autopsy tissue. Airway organoids were generated as previously described (Sachs et al., 2019). Briefly, specimens collected immediately after death were minced with a sterile scalpel and cultured in sterile tissue culture dishes to 1 mm diameter. 3The cells were minced into 100-μm fragments. The minced specimens were transferred to an orbital shaker and incubated for 1–2 hours at 37°C in 10 ml of digestion medium AdDF* (Advanced DMEM / F12 containing 1× Glutamax, 10 mM HEPES, and 100 / 100 U / ml PenStrep, supplemented with 2.5 mg / ml Collagenase D, 0.1 mg / ml DNase I, 10 μM Y-27632, and 100 μg / ml primocin). After incubation, remaining fragments were removed by filtration through a 70 μm filter. The isolated cells were centrifuged and washed twice with AdDF+++ (Advanced DMEM / F12 containing 1× Glutamax, 10 mM HEPES, and 100 / 100 U / ml PenStrep). For a visible red pellet, red blood cells were lysed with 2 ml of erythrocyte lysis buffer (Roche, catalog number 11814389001) for 5-8 minutes at room temperature. Then, 10 ml of AdDF+++ was added, and the cell suspension was centrifuged at 300 × g. Cells were embedded in ice-cold BME and seeded into 24-well plates. After at least 15 minutes at 37 °C, the BME polymerized. Airway culture medium (AdDF+++ supplemented with 500 ng / ml human recombinant R-spondin, 25 ng / ml human recombinant FGF 7, 100 ng / ml human recombinant FGF 10, 100 ng / ml human recombinant noggin, 500 nM A83-01, 10 μM Y-27632, 500 nM SB202190, 1× B27 supplement, 1.25 mM N-acetylcysteine, 5 mM nicotinamide, and 100 μg / ml primocin) was added and refreshed every 2–3 days. To passage the organoid culture, the airway culture medium was removed, and the BME domes were mechanically sheared in PBS. The mixture of PBS and BME organoids was then collected and centrifuged at 300 × g for 5 min. After centrifugation, the PBS was removed; 2–5 ml of TrypLE™ express enzyme was added, and the organoids were incubated at 37 °C for 10 min. The cell suspension was centrifuged, washed once with PBS, and then seeded into a 24-well plate with BME. Airway culture medium (Supplementary Table 1) was added after BME polymerization.
[0248] Infection of human airway MOS with SARS-CoV-2 and influenza. Human airway MOS were generated at a density of 20 cells / droplet. After 3–5 days of culture in airway culture medium, SARS-CoV-2 was inoculated into the airway MOS at an MOI of 2 in airway culture medium without Y-27632. SARS-CoV-2 virus was deposited by the Centers for Disease Control and Prevention and acquired through BEi Resources, NIAID, NIH: SARS-associated coronavirus 2, Isolate USA-WA1 / 2020, NR-52281. Biosafety Level 3 SARS-CoV-2 research was conducted at the Duke Regional Biocontainment Laboratory with partial support from the National Institutes of Health, National Institute of Allergy and Infectious Diseases (UC6-AI058607). Human airway MOS and virus were incubated at 37°C for 3 hours. The virus was removed and fresh airway medium without Y-27632 was added. Infection continued for 48 hours. Human airway MOS were then washed twice with PBS and collected for downstream analysis. Virus was inactivated according to SOP#308-Method#7 and Method#17 (Hume et al., 2016). All samples were stored at -80°C. The influenza strain used in this study was an influenza A virus derived from the 2009 pandemic swine influenza isolate, genetically engineered to express GFP as previously described (Froggatt et al., 2021). Bulk organoids and MOS were infected at an MOI of 10. For infection, MOS droplets were spun down at 200g for 3 minutes, and 200 μL of virus-containing buffer (0.4% BSA 1X PBS containing Ca+ and Mg+) was added to the MOS droplets and incubated at 37°C for 2 hours. The virus-containing supernatant was then removed and replaced with complete medium. The efficiency of influenza infection was monitored by fluorescence imaging.
[0249] Quantitative RT-qPCR of human airway MOS from SARS-CoV-2-infected humans. Total RNA was extracted using Direct-zol™ RNA Mini Prep (Zymo) according to the manufacturer's instructions. cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™). PCR reactions were prepared using the TaqMan Gene Expression Assay for ACTB (Thermo Fisher) and the nCOV_N1 Probe (IDT). RT-qPCR was performed using an Applied Biosystems StepOnePlus™ Real-Time PCR System with a two-step cycling protocol combining a denaturation step at 120°C and an annealing / extension step at 85°C. RT-qPCR measurements represent the average of three independent experiments normalized to β-actin expression. Primers listed in the Supplementary Table were purchased from Integrated DNA Technologies.
[0250] Lentivirus production. HEK293T cells were transfected with plasmids encoding second-generation anti-HER2 CAR (pHR-SFFV backbone, H3B1) or HER2-mCherry expression (pHR-SFFV backbone) and pDelta, Vsvg, or pAdv viral packaging plasmids at a ratio of 15:5:2 in 10 cm cell culture dishes using TranslT-lT1 transfection reagent (catalog no. MIR2300). Cells were cultured for 48 h posttransfection, and viral supernatants were harvested and concentrated using a LentiX Concentrator (catalog no. 631231). The resulting concentrated virus was filtered through a 0.45 μm filter, aliquoted, flash-frozen, and stored at -80°C until further use. All lentiviral plasmid constructs were kindly provided by Wilson Wong.
[0251] Generation of HER2+ CRC MOS and anti-HER2 CART cells. A CRC PDO model was transduced with lentivirus encoding mCherry-HER2. Briefly, organoid domes were collected and centrifuged at 300 x g for 10 minutes. The pellet was resuspended in 1 ml of TryplE Express and incubated at 37°C for 15 minutes to dissociate into single cells. After washing with basal medium and centrifuging at 300 x g for 10 minutes, single cells were resuspended in concentrated lentivirus and incubated at 37°C for 1 hour. Transduced cells were resuspended in BME and seeded in 50 μl domes in 24-well plates. After allowing sufficient time for organoid growth and red fluorescence observation, organoid cells were sorted by flow cytometry and replated in 50 μl BME domes. Sorted mCherry+ organoids were passaged once before use in coculture experiments. Human PBMCs collected from blood were transduced with lentivirus encoding the expression of a second-generation chimeric antigen receptor (CAR) targeting HER2. Briefly, lentiviral concentrate was added to a non-TC-treated 6-well tissue culture plate coated with retronectin. The plate was then spun at 1200 x g for 90 minutes at 32°C. PBMCs activated 24 hours prior with ImmunoCult Human CD2 / CD3 / CD28 Activation Reagent (Cat. No. 10970) were seeded into each well at 250,000 cells / ml in RPM1-1640 (PBMC medium) supplemented with 10% FBS and 100 U / ml II-2. The plate was then spun at 1200 x g for 60 minutes. Using flow cytometry, transduction efficiency was characterized using a low-expressing mCherry reporter within the lentiviral construct, with a positive result of 43% or less. Transduced T cells were cultured at 1 million cells per ml in PBMC medium until used for coculture.
[0252] IncuCyte® Imaging. Five images per well were taken every 2 hours for 2 days using an IncuCyte® S3 live-cell microscope. Quantification of the red fluorescent signal was performed using a minimum area of 500 μm to ignore CART cell signals. 2The analysis was performed using Incucyte® S3 software in . The red fluorescent signal output was the average of five images, and post-processing to show fold change relative to baseline time 0 was performed in Microsoft Excel. Plots of the time series data were generated in JMP.
[0253] MOS polarity assay. Ezrin-tdTomato-expressing cells were cultured in MOS (20 cells / droplet) for 3–5 days, and organoid polarity was assessed by Ezrin-tdTomato localization. To reverse MOS polarity, MOS were spun down in a 15 ml conical tube at 300 g for 5 min and resuspended in 10 ml of ice-cold 5 mM EDTA / PBS. The conical tube was then incubated on a rotating platform at 4 °C for 1 h. The MOS droplets were then pelleted at 300 g for 3 min at 4 °C and washed once with ice-cold AdDF+++ (Advanced DMEM / F12 containing 1x Glutamax, 10 mM HEPES, and 100 / 100 U / ml PenStrep) to form BME. After aspirating the supernatant, MOS were resuspended in the desired complete medium, and MOS polarity changes were assessed by confocal or fluorescent imaging. For confocal imaging, MOS were seeded onto glass-bottom imaging plates. 3D imaging of MOS was performed using a Zeiss ISM 880 confocal microscope with a 10x or 20x dry objective. 3D rendering of images was performed using Imaris imaging software (Bitplane).
[0254] Glucose vs. fructose tolerance assay. Duodenal intestinal MOS were generated and seeded in 96-well glass-bottom plates (Greiner Bio-One #655892). The next day, growth medium was replaced with 200 μL of SILAC growth medium or EN medium containing glucose (17.5 mM) or fructose (17.5 mM). Then, 150 μL of regular growth medium was replaced with 150 μL of SILAC glucose / fructose three times (see Supplementary Table for medium preparation). Medium was changed every 2–4 days. On day 7, 0.2 μL of Calcein AM (Biolegend #425201) was added to each well. MOS were imaged after 30 minutes of incubation using an EVOS FL Auto Imaging System (ThermoFisher). Image analysis was performed using Fiji (Supplementary Table for protocol). Data were plotted using GraphPad Prism.
[0255] Drug treatment of human airway MOS infected with SARS-CoV-2. Human airway MOS were treated with drugs 2 hours before infection. All samples were then inoculated with SARS-CoV-2 at an MOI of 0.1. After 3 hours of incubation, excess virus in the medium was removed and replaced with drug-containing medium (remdesivir, camostat, or chloroquine) for an additional 48 hours of incubation. All MOS were washed twice with PBS and lysed for RT-qPCR analysis. Virus was inactivated according to SOP#308-Method#7. Drug information is provided in Supplementary Table 1.
[0256] Deep learning for organoid / tumorsphere identification. The organoid detector was trained using the Mask-RCNN (He et al., 2017) implementation in Detectron2 (Kirillov et al., 2020). The configuration used in this study includes a ResNet-50 backbone and FPN. The training dataset consists of paired samples of established CRC MOS brightfield and CAM fluorescence images collected using a Celigo Imaging Cytometer. Ground truth instance segmentation labels are derived from the fluorescence images by binarizing and identifying each isolated active region as an individual organoid instance. Because some of the fluorescence images in this training set are not fully saturated, binarization is performed using a sliding threshold. First, a saturation offset of 8 is calculated as 255 minus the maximum pixel value in the fluorescence image. Next, the threshold is calculated as max(30,90-8). Finally, each pixel is set to either 255 (if its intensity is greater than this threshold) or 0 (if it is less). The network is trained on the resulting labels for 20 epochs with a learning rate of 0.00025.
[0257] The advantage of the Mask-RCNN architecture is that for each detected organoid / tumor sphere, it outputs a mask indicating which pixels represent part of the organoid / tumor sphere and which do not. When wells are imaged in one or more fluorescent channels and in bright field, the fluorescent activity from a given organoid can be easily measured by simply performing a bitwise "and" between this mask and the fluorescent image and then summing. However, because the network is trained to predict active regions of the CAM, the mask predicted by the network is biased toward live cells. This means that dead cells are often underrepresented in the regions selected by the network. In practice, when the MOS contains both live and dead cells, the dead cells are most likely located on the outer surface of the organoid / tumor sphere or scattered around it, and the network's mask prediction excludes some of these dead cells. Therefore, in studies involving the ratio of live to dead cell stains, the size of the predicted target mask should be increased to capture all of the fluorescent signal from the dead cell stain. The size expansion is performed using one iteration of the OpenCV "dilate" algorithm with a kernel size of 10x10. Any other organoids / tumorspheres detected by the network that overlap this expanded region are removed before the fluorescence integration is calculated.
[0258] Imaging-Based Drug Assay Pipeline. For most drug assays, MOS were generated at a density of 20 to 40 cells / droplet. After initial colonization (2–9 days) in 24-well non-TC plates, MOS were automatically dispensed into microwell plates (96-well plates, 384-well plates, etc.) using a SpinVessel® coupled with a MANTIS® Liquid Handler. After drug dispensing, brightfield images of all wells (images on day 0 of treatment) were acquired using a Celigo Imaging Cytometer (Nexcelom Bioscience). Stitched images of all wells were exported as tiff files and automatically segmented using our proprietary AI algorithm. Microwell plates were scanned daily to track changes in growth and morphology throughout the treatment period. On the day of the CTG assay, the live cell dye, Calcein AM (Thermo Fisher, catalog number C3100MP), and the dead cell dye, ethidium homodimer-2 (Thermo Fisher, catalog number E3599), were spiked into each well at working concentrations of 0.5 μM and 2 μM, respectively. After 45 min of incubation at 37 °C, the stained plate was scanned using a Celigo Imaging Cytometer. Images were acquired in brightfield, green, and red fluorescence channels. To avoid overexposure, the gain parameter was set to 0, and the exposure time for the green (live cell) fluorescence channel was adjusted so that the maximum pixel intensity of the MOS of untreated wells was below 200. The same strategy was applied for the red (dead cell) fluorescence channel, but the positive sterilization condition wells were used as a guide for setting the exposure time. After scanning, CellTiter-Glo® 3-D Reagent (Promega, Cat. No. G9681) was added at a 1:1 ratio to the initial well volume (100 μl or 40 μl of CTG reagent for 96-well and 384-well plates, respectively). The plates were placed on a shaker at room temperature for 20 minutes. Luminescence was then measured using a plate reader.
[0259] For data analysis, the total surface area (tSA) of segmented objects in each well was measured using an AI algorithm and used to calculate initial seeding variability. The CTG value for each well was then divided by these tSA ratios to calculate adjusted CTG values, which were then used to generate viability curves for each drug condition. For imaging assays using live and dead cell stains, the integrated fluorescence intensity of CAM and Eth was calculated for each segmented object. To evaluate drug response at the individual organoid / tumorsphere level, the relative size of surface area, integrated intensity, or CAM / Eth ratio was plotted on a scatter plot or histogram. Additionally, the median ratio of integrated live / dead cell staining intensity for each well was used to plot dose-dependent drug responses.
[0260] Supplementary Figure (Figure S1) JPEG2025529807000001.jpg129160 Figure S1. Comparison of demulsification methods. Related to Figure 1. A) Representative image of freshly generated, unemulsified droplets (top) and a representative image of MOS droplets after demulsification (bottom); B) Comparison of three different demulsification methods. Top left: Unemulsified; Top right: Anti-static gun; Bottom left: PFO; Bottom right: PVDF membrane. Red asterisks indicate some residual oil droplets after demulsification. Red circles indicate large clumps of unseparated droplets that failed to emulsify. Note the absence of residual oil / surfactant droplets in the image of MOS droplets after membrane demulsification (bottom right panel); C) Left panel, representative image of iPSC MOS after PFO demulsification. Red asterisks indicate MOS containing dead iPSCs. The bottom right box shows a close-up of one droplet containing a cluster of dead iPSCs. Right panel, iPSC MOS after PVDF membrane demulsification. The box on the bottom right shows a close-up of one droplet containing several established, viable iPSC colonies. D) Bar graph showing the mortality rate of iPSC MOS after 3 days of culture using PVDF membranes or the PFO method (bars represent the mean ± standard deviation of 5 randomly selected fields). Scale bar: 250 μm.
[0261] (Figure S2) JPEG2025529807000002.jpg182134 Figure S2. Characterization of human organoids generated as MOS. Related to Figure 1. A) Immunofluorescence staining of albumin (left panel) and qPCR analysis of albumin and HNF4A expression (right panel) in human fetal liver under bulk and MOS culture conditions (bars indicate the mean ± standard deviation of two biological replicates; each experiment contained two technical replicates) (Scale bar: 50 μm). B) Representative staining images of human duodenal organoids cultured as bulk or MOS in proliferation and differentiation medium. After 5 days of ENR+Dapt culture, the organoids showed typical differentiation features, such as the presence of columnar cells and a thickened appearance with increased expression of MUC2, VILLIN, and CHGA. Mouse small intestine was used as a staining control; Scale bar: 100 μm. C) Representative staining images of small intestine-derived human organoids cultured as bulk or MOS in proliferation and differentiation medium. After 5 days in ENR+Dapt culture, organoids showed increased expression of MUC2 (indicative of goblet cells) and CHGA (indicative of neuroendocrine cells). Scale bar: 100 μm.
[0262] (Figure S3) JPEG2025529807000003.jpg85166 Figure S3. Characterization of MOS differentiation. Related to Figure 2. Representative images of CHGA, VILLIN, and EPHB2 IHC staining of human colon bulk organoids and MOS cultured in WENR and EN medium, showing comparable differentiation. Mouse small intestine was used as a staining control. Scale bar: 100 μm.
[0263] (Figure S4) JPEG2025529807000004.jpg202167 Figure S4. Characterization of human endometrial MOS. Related to Figure 2. A) Schematic of the differentiation protocol for human endometrial organoids; B) Representative brightfield photograph of organoids subjected to differentiation. C) Representative photograph of human endometrial organoids showing differentiation into ciliated cells (Ac. α-tubulin) in both bulk and MOS cultures upon exposure to progesterone. Scale bar: 100 μm.
[0264] (Figure S5) JPEG2025529807000005.jpg139167 Figure S5. Comparison of viral infection efficiency between MOS and bulk organoids. Related to Figure 4. A) Representative images of CRC bulk organoids and MOS 36 hours after AAV or influenza infection. GFP-positive dots indicate successful viral infection (scale bar: 100 μm). B) Cell viability of distal lung MOS measured by CTG after 48 hours of treatment with remdesivir, camostat, or CQ (bars indicate the mean ± standard error of three different sample wells). C) Representative images showing proximal and distal lung-derived MOS infected with Flu A / California / 2009_GFP (scale bar: 100 μm).
[0265] (Figure S6) JPEG2025529807000006.jpg182148 Figure S6. Compatibility of MOS for high-throughput imaging. Related to Figures 6 and 7. A) Representative image of MOS after dispensing into a 96-well plate. The right panel shows a close-up of several MOS (scale bar: 1000 μm). B) Representative image of MOS after dispensing into a 384-well plate. The right panel shows a close-up of several MOS (scale bar: 1000 μm). C) Linear correlation between raw RLU of CTG and tSA measured by a machine learning algorithm in a cystic CRC MOS model. D) Linear correlation between raw RLU of CTG and tSA measured by a machine learning algorithm in a dense CRC MOS model. E) Representative images (with segmentation) of MOS from primary CRC, lung, and breast tumor tissues. The right panel shows a close-up of the MOS shown in the left panel. F) Representative image of MOS from primary sarcoma tissue. Scale bar: 1000 μm.
[0266] Supplementary references Artegiani, B., Hndriks, D, Beumer, J., Kok, R., Zheng, X., Joore, I., Chuva de Sousa Lopes, S., van Zon, J., Tans, S., and Clevers, H. (2020). Fast and efficient generation of knock-in human organoids using homology-independent CRISPR-Cas9 precision genome editing. Nat Cell Biol 22, 321-331. 10.1038 / s415560020-0472-5. Dekkers, J.F., Alieva., M., Wellens, L.M., Ariese, H.C.R., Jamieson, P.R., Vonk, A.M., Amatngalim, G.D., Hu, H. Oost, K.C., Snippert, H.J.G., et al. (2019). Hight-resolution 3D imaging of fixed and cleared organoids. Nat Protoc 14, 1756-1711. 10 1038 / s41596-019-0160-8. Froggatt, H.M., Harding, A.T., Chaparian, R.R., and Heaton, N.S.(2021). ETV7 limits antiviral gene expression and control and influenza viruses. Sci Signal 14. 10.1126 / scisignal abe1194. Fujii, M., Matano, M., Nanki, K., and Sato, T.(2015). Efficient genetic engineering of human intestinal organoids using electroporation. Nature protocols 10, 1474-1485. He, K., Gkioxari, G., Dollar, P., and Girshick, R.(2017). Mask r-cnn. pp. 2961-2969. Hume, A.J., Ames, J., Rennick, L.J., Duprex, W.P., Marzi, A. Tonkiss, J., and Muhlberger, E.(2016). Inactivation of RNA viruses by gamma irradiation: a study on mitigating factors. Viruses 8, 204. Kirillov, A., Wu, Y., He, K., and Girshick, R.(2020). Pointrend: Image segmentation as redering. pp. 9799-9808. Sachs, N., Papaspyropoulos, A., Zomer-van Ommen, D.D., Heo, I., Bottinger, L., Klay, D., Weeber, F., Heulsz-Prince, G., lakobachvili, N., Amatngalim, G.D., et al.(2019). Long-term expanding human airway organoids for disease modeling. EMBO J 38. 10. 15252 / embj. 2018100300. Schmid-Burgk, J.L., Honing, K., Ebert, T.S., and Hornung, V. (2016). CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism.Nat Commun 7, 12338. 10.1038 / ncomms 12338.
Claims
1. A method for delivering one or more components to a microorganosphere (MOS), comprising introducing one or more components into said MOS by a delivery method.
2. 2. The method of claim 1, wherein the one or more components are selected from a protein, peptide, polypeptide, DNA, RNA, siRNA, RNAi, plasmid DNA, a viral particle, an antibody, or a fragment thereof.
3. 10. The method of any one of the preceding claims, wherein said components are one or more CRISPR / Cas complex components.
4. 4. The method of claim 3, wherein the CRISPR / Cas complex component comprises a ribonucleoprotein.
5. 10. The method of any one of the preceding claims, wherein the one or more components are one or more CRISPR / Cas9 complex components.
6. 6. The method of claim 5, wherein the CRISPR / Cas9 complex component comprises a ribonucleoprotein.
7. 10. The method of any one of the preceding claims, wherein the MOS comprises one or more cells.
8. 8. The method of claim 7, wherein the one or more cells are selected from tumor spheres, hepatocytes, airway cells, and CAR T cells.
9. 10. The method of any one of the preceding claims, wherein the MOS comprises a tumor sphere.
10. 10. The method of any one of the preceding claims, wherein the delivery method comprises one or more of electroporation and viral vector-based delivery methods.
11. The method of claim 10, wherein the viral vector is a lentiviral vector.
12. 10. The method of any one of the preceding claims, wherein the MOS are droplets having a diameter of between 100uM and 500uM.
13. 10. The method of any one of the preceding claims, wherein the MOS is a droplet having a diameter of 260 uM.
14. 10. The method of any one of the preceding claims, wherein the delivery method comprises electroporation.
15. 15. The method of claim 14, wherein said method utilizes a Lonza Nucleofector 4D system.
16. 16. The method of claim 14 or 15, wherein the method utilizes Lonza buffer P1.
17. 16. The method of claim 14 or 15, wherein the method utilizes Lonza buffer P3.
18. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program CA-137.
19. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program CM-138.
20. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program CM-137.
21. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program CM-150.
22. The method of any one of claims 14 to 17, wherein the electroporation method comprises applying the pulse conditions of Lonza program DN-100.
23. The method of any one of claims 14 to 17, wherein the electroporation method comprises applying the pulse conditions of Lonza program DS-138.
24. The method of any one of claims 14 to 17, wherein the electroporation method comprises applying the pulse conditions of Lonza program DS-137.
25. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program DS-130.
26. The method of any one of claims 14 to 17, wherein the electroporation method comprises applying the pulse conditions of Lonza program DS-150.
27. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program DS-120.
28. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program EH-100.
29. The method of any one of claims 14 to 17, wherein the electroporation method comprises applying the pulse conditions of Lonza program EO-100.
30. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program EN-138.
31. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program EN-150.
32. The method of any one of claims 14 to 17, wherein the electroporation method comprises application of the pulse conditions of Lonza program EW-113.
33. The method of claim 14 or 15, wherein the buffer is P1 and the pulse condition is CA-137.
34. The method of claim 14 or 15, wherein the buffer is P3 and the pulse condition is EN-138.
35. 10. The method of any one of the preceding claims, wherein the one or more components are incubated with the MOS for less than 1 minute to 60 minutes prior to electroporation.
36. 10. The method of any one of the preceding claims, wherein the one or more components are incubated with the MOS for 20 minutes prior to electroporation.
37. 10. The method of any preceding claim, wherein the one or more ingredients are incubated with the MOS at a temperature of 20-40°C.
38. 10. The method of any one of the preceding claims, wherein the one or more components are incubated with the MOS at a temperature of 37°C.
39. 10. The method of any one of the preceding claims, wherein the MOS is dispensed into a multi-well plate.
40. 10. The method of any one of the preceding claims, wherein the method is high-throughput.
41. 10. The method of any one of the preceding claims, wherein cell viability of the one or more cells within the MOS is maintained such that a 3D microenvironment is generated.
42. 10. The method of any one of the preceding claims, wherein cell viability of the one or more cells within the MOS is maintained so that the MOS develops into an organoid.
43. 10. The method of any one of the preceding claims, wherein cell viability of the one or more cells within the MOS is maintained so that the MOS develops into a tissue model.
44. 1. A method for editing DNA or RNA contained within a microorganosphere (MOS), comprising: a) delivering one or more CRISPR / Cas complex components to the MOS by a method according to any one of claims 3 to 42; b) incubating the MOS under conditions suitable for CRISPR / Cas-mediated editing of DNA or RNA.
45. 45. The method of claim 44, wherein the DNA or RNA editing efficiency is between 50% and 99%.
46. 46. The method of claim 44 or 45, wherein the DNA or RNA editing efficiency is about 80%.
47. The method of claims 44 to 46, wherein the DNA or RNA editing efficiency is greater than 80%.
48. The method of claims 44 to 47, wherein the DNA or RNA editing efficiency is greater than 90%.
49. 1. A method of drug screening, comprising: a) delivering a drug and one or more additional ingredients into microorganospheres (MOS) according to any one of the preceding claims; b) assessing the efficacy of the drug.
50. 50. The method of claim 49, wherein DNA or RNA contained within a MOS is edited by the method of claim 44, and the effectiveness of the drug in the MOS containing the edited DNA or RNA is compared to the effectiveness of the drug in a MOS containing non-edited DNA or RNA.
51. 10. Microorganospheres (MOS) produced by the method of any one of the preceding claims.
52. Microorganospheres (MOS) containing one or more CRISPR / Cas complex components.
53. 53. The MOS of claim 52, wherein the CRISPR / Cas complex component comprises a ribonucleoprotein.
54. 54. The MOS of claim 52 or 53, wherein the one or more components are one or more CRISPR / Cas9 complex components.
55. 55. The MOS of claim 54, wherein the CRISPR / Cas9 complex component comprises a ribonucleoprotein.
56. 56. The MOS of any one of claims 51 to 55, wherein the MOS comprises one or more cells.
57. 57. The MOS of claim 56, wherein the one or more cells are selected from tumor spheres, hepatocytes, airway cells, and CAR T cells.
58. 58. The MOS of claim 57, wherein the MOS comprises a tumor sphere.
59. The MOS of any one of claims 51 to 58, wherein the MOS is a droplet having a diameter of 100uM to 500uM.
60. 60. The MOS of any one of claims 51 to 59, wherein the MOS is a droplet having a diameter of 260 uM.