Circular RNA and its preparation method
The DNA molecule-based one-step transesterification reaction simplifies the circularization of RNA, addressing the complexity and cost issues in existing methods by efficiently producing stable circular RNA.
Patent Information
- Application Number
- JP2025514767
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-17
- Filing Date
- 2023-09-09
- Publication Date
- 2025-09-11
AI Technical Summary
Current methods for preparing circular RNA are complex, require numerous enzymes, and face challenges in efficiently separating circular RNAs from linear RNAs due to minimal molecular weight differences, leading to high production costs and inefficiencies.
A DNA molecule is designed to generate circular RNA through a one-step transesterification reaction, comprising an intron fragment, a downstream exon, and an upstream exon, which self-circularizes during in vitro transcription, potentially including a target fragment and homology arms, to simplify the circularization process and improve purification efficiency.
This method reduces the complexity and cost of circular RNA production by enabling efficient self-circularization and purification, enhancing the stability and accuracy of circular RNA synthesis.
Smart Images

Figure 2025530303000001_ABST
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to the field of molecular biology, and in particular to uses and preparation methods for circular RNA.
[0002] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims priority to Chinese Patent Application No. 202211105849.6, filed on September 10, 2022, and Chinese Patent Application No. 202310557196.3, filed on May 17, 2023, the entire contents of each of which are incorporated herein by reference.
[0003] [Sequence table] This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy created on September 4, 2023, is titled "Sequence Listing-20917-0001WO00" and is 22,880 bytes in size. [Background technology]
[0004] Circular ribonucleic acids (circular RNAs) are an important class of regulatory non-coding RNAs. Circular RNAs typically contain closed circular structures and are generally resistant to RNA exonucleases. Circular RNAs are often stable in nature and can regulate gene expression through a variety of mechanisms.
[0005] Currently, circular RNAs can be classified into three categories: exonic circular RNAs, which are formed based on exons through backsplicing; intronic circular RNAs, which are formed based on intron regions through the debranching inhibitor process; and exon-intron circular RNAs, which are formed based on exons and introns. Researchers have discovered the existence of circular RNAs in viruses, yeast, fruit flies, nematodes, mice, monkeys, and humans. The closed structure of circular RNAs allows these molecules to accumulate continuously for stability and the ability to avoid degradation.
[0006] The circularization methods disclosed in the prior art are too complicated and require a large number of enzymes. For example, translatable or biologically active circular RNAs are generated in eukaryotic cells through two consecutive transesterification steps with the aid of homology arms. Furthermore, circular RNAs are primarily purified using size-exclusion chromatography (SEC) or other methods based on the molecular weight difference between reaction products (e.g., circular RNAs and their precursor linear RNAs). However, because the molecular weight difference between circular and linear RNAs is minimal, purifying circular RNAs poses significant challenges (e.g., inefficient separation of circular RNAs from linear RNAs present in the reaction products).
[0007] Therefore, it is desirable to provide a method for preparing circular RNA that can minimize the circularization procedure, reduce the need for raw materials, reduce production costs, improve circularization efficiency, and improve purification efficiency. Summary of the Invention [Means for solving the problem]
[0008] One aspect of the present disclosure provides a DNA molecule that generates a circular RNA, the DNA molecule comprising, in the 5' to 3' direction: (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing a downstream exon of the full-length intron; (c) It comprises an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0009] In some embodiments, the full-length intron, the downstream exon, and the upstream exon may be derived from the same gene, and the 3' end of the E1 fragment may be configured to generate a hydroxyl group in an in vitro transcription reaction, which may initiate splicing in a linear RNA generated from the DNA molecule in the in vitro transcription reaction at a splice site between the intron fragment and an RNA fragment transcribed from the E2 fragment in a one-step transesterification reaction, such that the linear RNA self-circularizes to generate the circular RNA.
[0010] In some embodiments, the DNA molecule may be free of any intron sequences at the 3' end of the E1 fragment.
[0011] In some embodiments, the DNA molecule further comprises a target fragment located between the E2 fragment and the E1 fragment, and the target fragment may comprise a target DNA sequence encoding a target peptide.
[0012] In some embodiments, the target fragment may be a gene of interest (GOI) fragment, the nucleotide sequence of which can be transcribed into a target RNA sequence.
[0013] In some embodiments, the GOI fragment encodes a protein-coding or non-coding RNA sequence.
[0014] In some embodiments, the DNA molecule further comprises an internal ribosome entry site (IRES) fragment located between the E2 fragment and the E1 fragment, which may be transcribed into an RNA molecule capable of recruiting ribosomes to obtain a target peptide for a translation reaction.
[0015] In some embodiments, the IRES fragment is selected from the group consisting of Taura syndrome virus, Assassin bug virus, Thayer's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhopalophis barbatus virus, Reticuloendotheliosis virus, Forman poliovirus 1, German winged stink bug enteric virus, Kashmir bee virus, human rhinovirus 2, Leafhopper virus-1, human immunodeficiency virus type 1, Leafhopper virus-1, Small kite P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis B virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinovirus, Oriental geometrid virus, Encephalomyocarditis virus (EMCV), Drosophila melanogaster virus, Cruciferae tobacco virus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen brood virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human The aptamer may be derived from human p53, human Pim-1, mouse Rbm3, Drosophila Reaper, Canis Camper, Drosophila Ubx, salivary virus, coxsackievirus, parechovirus, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila Hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian picornavirus, turnip crinkle virus, an aptamer against eIF4G, coxsackievirus B1, coxsackievirus B2, or coxsackievirus B3 (CVB3).
[0016] In some embodiments, the DNA molecule further comprises 5' and 3' homology arm sequences located between the E2 and E1 fragments.
[0017] In some embodiments, when the length of the target DNA sequence encoding the target peptide is less than 2000 nt, the DNA molecule may not include a 5' homology arm sequence or a 3' homology arm sequence located between the E2 fragment and the E1 fragment.
[0018] In some embodiments, the gene is the td gene of T4 phage or the pre-tRNA gene of Anabaena spp. Leu The td gene may have the nucleotide sequence shown in SEQ ID NO: 18, and the pre-tRNA Leu The gene has the nucleotide sequence shown in SEQ ID NO:19.
[0019] In some embodiments, the E2 fragment may be an exon sequence having a size of 8 to 51 bases, and the E1 fragment may be an exon sequence having a size of 2 to 15 bases.
[0020] In some embodiments, the E2 fragment is a pre-tRNA of the Anabaena sp. Leu The E1 fragment may be an exon sequence downstream of an intron of a gene, and the E1 fragment may be a pre-tRNA of the Anabaena genus. Leu It may also be an exon sequence upstream of said intron fragment of a gene.
[0021] In some embodiments, the nucleotide sequence of the intron fragment may be at least 95% similar to SEQ ID NO:1, the nucleotide sequence of the E2 fragment may be at least 95% similar to any one of SEQ ID NOs:2-5 and the sequences AAAATCCG, AAAATC, AAAA, and AA, and the nucleotide sequence of the E1 fragment may be at least 95% similar to any one of SEQ ID NOs:8-11 and the sequences GGACTT, ACTT, TT, and CTT.
[0022] In some embodiments, the nucleotide sequence of the intron fragment may have the sequence set forth in SEQ ID NO: 1, the nucleotide sequence of the E2 fragment may have the sequence set forth in any one of SEQ ID NOs: 2 to 5 and the sequences AAAATCCG, AAAATC, AAAA, and AA, and the nucleotide sequence of the E1 fragment may have the sequence set forth in any one of SEQ ID NOs: 8 to 11 and the sequences GGACTT, ACTT, TT, and CTT.
[0023] In some embodiments, the intron fragment may further be preceded by a promoter element, which may be one of a T7 promoter, a T3 promoter, and an SP6 promoter.
[0024] In some embodiments, the DNA molecule may further comprise a poly X fragment preceding the full-length intron fragment, wherein the poly X fragment may comprise at least 7 consecutive identical bases, and wherein X is one or two of A, C, G, T, and U.
[0025] In some embodiments, the DNA molecule may be a vector.
[0026] Another aspect of the present disclosure provides a method for preparing the circular RNA based on the DNA molecule according to the above embodiment, which may include performing the in vitro transcription reaction to obtain the linear RNA based on the DNA molecule, and self-circularizing the linear RNA to produce the circular RNA.
[0027] In some embodiments, the DNA molecule comprises a gene of interest (GOI) fragment that can be transcribed into a target RNA sequence.
[0028] In some embodiments, the DNA molecule may be produced by in vitro synthesis.
[0029] In some embodiments, producing the DNA molecule may include constructing a recombinant plasmid containing the sequence of the DNA molecule and obtaining the DNA molecule by PCR amplification using the recombinant plasmid as a template and forward and reverse primers at the ends of the E1 sequence.
[0030] In some embodiments, producing the DNA molecule may comprise constructing a recombinant plasmid comprising the sequence of the DNA molecule and digesting the recombinant plasmid with a Type IIS or Type II blunt restriction endonuclease to obtain the DNA molecule.
[0031] In some embodiments, the Type IIS restriction endonuclease may comprise BspQ I, Bsa I, or BsmB I, and the Type II blunt restriction endonuclease comprises Hpa I, Swa I, or Dra I.
[0032] In some embodiments, the reaction temperature of the in vitro transcription reaction may be 30° C. to 50° C., and the reaction time of the in vitro transcription reaction may be 0.5 hours to 16 hours.
[0033] In some embodiments, the in vitro transcription reaction may include the steps of preparing a mixture in an in vitro transcription system to obtain a mixed mixture, and performing an in vitro transcription reaction of the mixed mixture at 37°C for 2 hours to obtain a reaction product.
[0034] In some embodiments, the mixture may include nucleotides including ATP, CTP, GTP, and UTP, the DNA molecule, a buffer, T7 RNA polymerase, and nuclease-free water.
[0035] In some embodiments, the method may further comprise treating the reaction product with DNase I enzyme at 37°C for 15 minutes to remove the DNA molecules, followed by incubation at 50°C for 20 minutes.
[0036] In some embodiments, the buffer may contain Tris-HCl, MgCl, DTT, spermidine, and Mg 2+ may have a concentration of at least 32 mM.
[0037] In some embodiments, the DNA molecule may further comprise a poly X fragment preceding the full-length intron fragment, where X is one or two of A, C, G, T, and U, and the poly X fragment may comprise at least 7 consecutive identical bases, and the method may further comprise obtaining purified circular RNA using oligo dX affinity beads. In some embodiments, when the poly X fragment is poly A, oligo dT affinity beads are used; when the poly X fragment is poly T, oligo dA affinity beads are used; when the poly X fragment is poly C, oligo dG affinity beads are used; when the poly X fragment is poly G, oligo dC affinity beads are used; and when the poly X fragment is poly U, oligo dA affinity beads are used.
[0038] In some embodiments, the method further comprises adding a DNase I enzyme to the reaction product of the in vitro transcription reaction to remove the DNA molecules; and adding a chelating agent to the reaction product to remove Mg. 2+ and adding RNase R to the reaction product to digest the linear RNA.
[0039] Another aspect of the present disclosure provides a method for producing a target peptide by translation, which may include obtaining the circular RNA based on the method for preparing the circular RNA based on a DNA molecule according to the above embodiment, transfecting a cell with the circular RNA, and initiating a translation reaction based on the circular RNA to produce the target peptide.
[0040] The present disclosure will be further illustrated by exemplary embodiments, which will be described in detail with reference to the drawings, in which like numerals refer to like structures, and in which: [Brief explanation of the drawings]
[0041] [Figure 1] 1A and 1B are pattern diagrams showing exemplary empty vectors containing deoxyribonucleic acid (DNA) molecules capable of generating circular ribonucleic acid (RNA) in an in vitro transcription reaction according to some embodiments of the present disclosure, where FIG. 1A is a pattern diagram including homology arm sequences, and FIG. 1B is a pattern diagram without homology arm sequences. [Figure 2] 2A and 2B are pattern diagrams showing exemplary circular RNA vectors comprising DNA molecules capable of generating circular RNA in an in vitro transcription reaction according to some embodiments of the present disclosure, where FIG. 2A is a pattern diagram including homologous arm sequences, and FIG. 2B is a pattern diagram not including homologous arm sequences. [Figure 3] FIG. 1 is a schematic diagram illustrating an exemplary process for obtaining DNA molecules by PCR amplification, according to some embodiments of the present disclosure. [Figure 4] FIG. 1 is a schematic diagram illustrating an exemplary restriction endonuclease-based process for obtaining DNA molecules, according to some embodiments of the present disclosure. [Figure 5] FIG. 1 is a schematic diagram illustrating an exemplary model for generating circular RNA based on a DNA molecule, according to some embodiments of the present disclosure. [Figure 6] 6 shows exemplary results of obtaining DNA molecules, where FIG. 6A is the target band of PCR-specific amplification, and FIG. 6B is the DNA molecule obtained based on the restriction endonuclease HpaI. [Figure 7] 1 shows exemplary identification of reaction products in an in vitro transcription reaction according to some embodiments of the present disclosure, where the gene of interest (GOI) fragment of the DNA molecule has the nucleotide sequence shown in SEQ ID NO:6. [Figure 8]FIG. 1 shows exemplary identification results of reaction products in an in vitro transcription reaction using optimized in vitro transcription conditions according to some embodiments of the present disclosure, where the GOI fragment of the DNA molecule has the nucleotide sequence shown in SEQ ID NO:6. [Figure 9] FIG. 1 is a schematic diagram showing an exemplary optimized E2 fragment of an intron downstream exon of the pre-tRNALeu gene of Anabaena according to some embodiments of the present disclosure, wherein the GOI fragment of the DNA molecule has the nucleotide sequence shown in SEQ ID NO: 7. [Figure 10] FIG. 1 shows an exemplary effect on the percentage of circular RNA in the reaction product produced in an in vitro transcription reaction with different E2 fragments having different lengths, according to some embodiments of the present disclosure, wherein the GOI fragment of the DNA molecule has the nucleotide sequence shown in SEQ ID NO:7. [Figure 11] 1 shows exemplary circular RNA quantitative results of the effect of different E2 fragments with different lengths on the percentage of circular RNA in reaction products generated in in vitro transcription reactions, according to some embodiments of the present disclosure. [Figure 12] 1 shows exemplary Sanger sequencing results of the circularization site of the E2 fragment circular RNA, where the nucleotide sequence of the circular RNA is 8 nt in length, according to some embodiments of the present disclosure. [Figure 13] FIG. 1 is a schematic diagram showing an exemplary optimized E1 fragment of an upstream exon of an intron of the pre-tRNALeu gene of Anabaena, according to some embodiments of the present disclosure, wherein the GOI fragment of the DNA molecule has the nucleotide sequence shown in SEQ ID NO: 7. [Figure 14] FIG. 1 shows an exemplary effect on the percentage of circular RNA in the reaction product produced in an in vitro transcription reaction with different E1 fragments having different lengths, according to some embodiments of the present disclosure, wherein the GOI fragment of the DNA molecule has the nucleotide sequence shown in SEQ ID NO:7. [Figure 15]1 shows exemplary circular RNA quantitative results of the effect of different E1 fragments with different lengths on the percentage of circular RNA in reaction products generated in in vitro transcription reactions, according to some embodiments of the present disclosure. [Figure 16] FIG. 1 is a pattern diagram showing the process of optimizing the sequence at the 3′ end of the E1 fragment (CTT at the end of the sequence mutated to GTT or TTT, respectively) according to some embodiments of the present disclosure. [Figure 17] 17 shows exemplary results of an in vitro transcription reaction (transcription conditions: 37°C, 2 h; 50°C, 20 min) using a DNA molecule containing the optimized E1 fragment of FIG. 16 as a template, according to some embodiments of the present disclosure. [Figure 18] 17 shows quantitative results of exemplary circular RNAs of optimized E1 fragment circular RNAs in FIG. 16 after optimizing the sequence of the 3′ end, according to some embodiments of the present disclosure. [Figure 19] FIG. 1 is a pattern diagram showing DNA molecules with or without homology arm sequences according to some embodiments of the present disclosure. [Figure 20] FIG. 1 shows an exemplary effect on the proportion of circular RNA in reaction products produced in in vitro transcription reactions with DNA molecules with or without homology arm sequences, according to some embodiments of the present disclosure, wherein the GOI fragment of the DNA molecule has the nucleotide sequence set forth in SEQ ID NO:7. [Figure 21] 21 shows exemplary circular RNA quantitative results for the circular RNAs obtained in FIG. 20 according to some embodiments of the present disclosure. [Figure 22] FIG. 1 is a schematic diagram illustrating an exemplary application model for generating circular RNA based on linear RNA, according to some embodiments of the present disclosure. [Figure 23] 1 shows exemplary results of circular RNA obtained by the methods provided herein translating and producing green fluorescent protein (GFP) in cells, according to some embodiments of the present disclosure. [Figure 24] FIG. 1 is a pattern diagram showing the arrangement of an in vitro cyclization system according to some embodiments of the present disclosure. [Figure 25] FIG. 1 is a schematic diagram showing an exemplary vector with a polyA fragment according to some embodiments of the present disclosure. [Figure 26] FIG. 1 is a schematic diagram showing an exemplary vector having a polyA fragment and capable of expressing GFP, according to some embodiments of the present disclosure. [Figure 27] 1 shows exemplary optimization results of Mg2+ concentration in reaction products generated in in vitro transcription reactions, according to some embodiments of the present disclosure. [Figure 28] 1 shows the results of circular RNA purification according to some embodiments of the present disclosure. [Figure 29] 1 shows exemplary results of gel electrophoresis using RNase R digestion products, according to some embodiments of the present disclosure. [Figure 30] 1 shows exemplary quantitative results of RNase R digestion products according to some embodiments of the present disclosure. [Figure 31] 1 illustrates an exemplary Pareto effect according to some embodiments of the present disclosure. [Figure 32] 1 shows an exemplary process for chelating Mg2+ with EDTA according to some embodiments of the present disclosure. [Figure 33] 1 shows exemplary effects on RNase R digestion efficiency of adding different amounts of EDTA to reaction products generated in an in vitro transcription reaction, according to some embodiments of the present disclosure. [Figure 34] 1 shows an exemplary process for preparing circular RNA according to some embodiments of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION
[0042] In order to explain the technical solutions related to the embodiments of the present disclosure, a brief introduction to the drawings referred to in the description of the embodiments is provided below. Obviously, the drawings described below are only some examples or embodiments of the present disclosure. Those skilled in the art can apply the present disclosure to other similar scenarios through these drawings without further creative efforts. Unless otherwise specified or obvious from the context, the same reference numerals in the drawings refer to the same structures and operations.
[0043] As set forth in this disclosure and the claims, the words "a," "an," "one," and / or "the" may include the plural rather than specifically referring to the singular, unless the context clearly indicates otherwise. The terms "comprises" and "comprising" only suggest the inclusion of explicitly identified steps and elements, and do not constitute an exclusive list, and a method or device may include other steps or elements.
[0044] Flowcharts used in this disclosure may illustrate operations performed by systems according to embodiments of the present disclosure. It should be understood that previous or subsequent operations in the flowcharts may not be performed in precise order. Conversely, various operations may be performed in reverse order or simultaneously. Additionally, other operations may be added to the flowcharts, and one or more operations may be deleted from the flowcharts.
[0045] Embodiments of the present disclosure provide deoxyribonucleic acid (DNA) molecules that generate circular ribonucleic acid (RNA). The DNA molecules are composed of, in the 5' to 3' direction: (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing the downstream exon of the full-length intron; (c) It may contain an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0046] As used herein, "intron" refers to a non-coding segment in a DNA sequence. "Exon" refers to a coding segment in a DNA sequence that can be transcribed and translated into part of a protein. The DNA sequence of a gene may contain introns and exons. During the transcription process, a gene is transcribed into an intermediate molecule called pre-messenger RNA (or linear RNA). In pre-messenger RNA, introns are transcribed but are not retained in the mature mRNA.
[0047] As used herein, "splicing" refers to the process by which introns are removed from pre-messenger RNA and exons are joined to form mature mRNA molecules. Splicing plays an important role in regulating gene expression. The splicing method and selectivity can result in various combinations of exons, generating multiple different mature mRNAs. Therefore, this process affects the composition of proteins in transcription and translation.
[0048] As used herein, a "full length intron" refers to the complete intron sequence extending from the start boundary of an exon to the end boundary of the next exon in the DNA sequence of a gene.
[0049] Although introns do not directly code for proteins, they may play important roles in gene expression regulation, evolution, etc. Through regulation and splicing, cells produce a wide variety of proteins and thus adapt to different biological processes and environmental conditions.
[0050] As used herein, a "downstream exon" refers to an exon following an intron in the pre-messenger RNA sequence corresponding to the DNA sequence of a gene. An upstream exon is usually an exon preceding a downstream exon. "Upstream" and "downstream" are used herein to describe the spatial location of an element in a genome or RNA sequence. For example, "upstream" refers to a direction further away from the intron, and "downstream" refers to a direction closer to the intron.
[0051] As used herein, "transcription" refers to the process of synthesizing RNA using a DNA molecule as a template. Within the cellular structure, DNA carries encoded biological genetic information. To effectively execute the biological genetic information within the cell, the biological genetic information in the DNA must be copied into an RNA molecule. This copying allows for the production of proteins or the accomplishment of other functions in the translation process.
[0052] During the transcription process, an enzyme known as RNA polymerase recognizes and binds to specific genetic regions in a DNA molecule. This enzyme can then use the DNA molecule as a template to promote the synthesis of an RNA molecule. This RNA is called pre-messenger RNA (for eukaryotes). In a subsequent splicing process, the pre-messenger RNA can form a mature messenger RNA (mRNA) molecule by removing introns (i.e., non-coding sequences) and joining exons (i.e., coding sequences). Mature mRNA molecules carry protein-coding information and can be translated into proteins by ribosomes within the cell.
[0053] The transcription process can be divided into in vivo transcription and in vitro transcription based on the location of transcription. In vivo transcription refers to the transcription process that occurs in the cellular environment of an organism. In in vivo transcription, a DNA template can be recognized and combined by RNA polymerase to produce RNA molecules. In vitro transcription refers to the transcription process in a simulated organism, performed under artificially created experimental conditions in vitro. In vitro transcription can be used to generate large amounts of RNA molecules for research and applications such as preparing RNA probes and examining the function of RNA molecules.
[0054] Circular RNAs (circRNAs) are a class of single-stranded, closed RNA molecules generated by pre-messenger RNA through alternative splicing (AS, including exon circularization or intron circularization). Endogenous circular RNAs include coding and non-coding RNAs, lack a 5'-end cap structure and a 3'-end poly(A) tail, and lack free ends. Therefore, endogenous circular RNAs are less susceptible to degradation by nucleic acid exonucleases and are more stable than linear RNAs. Comprehensive exploration of circular RNAs relies on the use of in vitro preparation techniques to verify their biological functions. Among these methods, in vitro circularization techniques play an important role.
[0055] The current common method for synthesizing circular RNA in an in vitro transcription reaction using linear RNA as a precursor is to join the ends of two exons to form a covalently enclosed circular structure, which can be achieved by chemical linkage, enzymatic linkage, or ribozyme splicing.
[0056] Chemical coupling of linear RNA may be achieved with cyanogen bromide (BrCN) or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC).
[0057] Three enzymes are commonly used for enzymatic ligation of RNA: T4 DNA ligase 1 (T4 Dnl1), T4 RNA ligase 1 (T4 Rnl1), and T4 RNA ligase 2 (T4 Rnl2). These three enzymes for RNA circularization depend on ATP. They catalyze the attachment of a 5'-phosphate group and a 3'-hydroxyl group at the end of RNA via three nucleotide transfer steps, joining the two ends of exons in a linear RNA molecule to generate a circular RNA.
[0058] Ribozymes are a class of RNA with catalytic enzyme activity and are used in replacement intron-exon (PIE) systems based on type I or type II introns, which can achieve RNA circularization. The PIE system utilizes either type I or type II introns with self-splicing function to promote splicing. In the presence of magnesium ions and free GTP, this process results in the circularization of the intron and fusion of the intermediate sequence, ultimately generating a circular RNA.
[0059] The self-splicing process of the PIE system, particularly type I intron self-splicing, involves splitting an intron fragment and an auxiliary exon fragment into two parts within an RNA molecule. The 5'-terminal sequence of the intron is transferred to one end of the target sequence, and the 3'-terminal sequence is inserted into the other end of the target sequence. In the presence of GTP, the 3'-hydroxyl group of GTP initiates an attack on the splice site located at the 5' end of the intron sequence. This attack exposes the newly generated 3'-free hydroxyl group. The free hydroxyl group then attacks the splice site at the 3' end of the intron sequence, generating a circular RNA. The PIE structure contributes to the self-circularization of the entire sequence, excluding the intron portion.
[0060] The self-splicing process of the PIE system, particularly type II intron self-splicing, shares similarities with type I intron self-splicing. However, there are notable differences. In type II intron self-splicing, a 2'-hydroxyl group within the intron sequence initiates an attack on the splice site located at the 5' end of the intron sequence. This attack exposes a newly generated 3'-free hydroxyl group, which then attacks the splice site at the 3' end of the intron sequence, ultimately generating a circular RNA.
[0061] In other words, the splicing reaction involving the type I or type II intron PIE system can occur through two energy-independent transesterification steps. In the first step, the 3'-hydroxyl group of the cofactor guanosine or a 2'-hydroxyl group within the intron sequence initiates the reaction by acting on the 5' end of the intron to expose a 3'-hydroxyl group at the end of the first exon. In the second step, the 3'-hydroxyl group generated at the end of the first exon acts on the splice site between the 3' end of the intron and the second exon.
[0062] This disclosure describes that during an in vitro transcription reaction, an RNA sequence corresponding to an E1 fragment transcribed by a DNA molecule can generate a hydroxyl group at one end. This hydroxyl group has the ability to initiate splicing in a one-step transesterification reaction at the splice site between the intron fragment and the RNA fragment transcribed from the E2 fragment. This process occurs within a linear RNA molecule generated from the DNA molecule during the in vitro transcription reaction. As a result, the linear RNA molecule is structured so that it can self-circularize to generate a circular RNA. The formation of the circular RNA does not require any additional steps; only one transesterification step is required to complete the circularization and obtain the desired circular RNA. This streamlined process reduces the complexity and number of operations involved in circularization.
[0063] In some embodiments, the full-length intron, downstream exon, and upstream exon may be derived from the same gene, and a hydroxyl group may be generated at the 3' end of the E1 fragment in an in vitro transcription reaction. The hydroxyl group may initiate splicing in a one-step transesterification reaction at a splice site between the intron fragment and the RNA fragment transcribed from the E2 fragment in a linear RNA generated from a DNA molecule in an in vitro transcription reaction, such that the linear RNA may be configured to self-circularize to generate a circular RNA.
[0064] In some embodiments, the gene of the full-length intron, downstream exon, and upstream exon is a td gene of T4 phage or a pre-tRNA of Anabaena spp. Leu The td gene may have the nucleotide sequence shown in SEQ ID NO: 18, and may contain a pre-tRNA Leu The gene may have the nucleotide sequence shown in SEQ ID NO:19.
[0065] Longer exons can reduce splicing efficiency because splicing enzymes take longer to process introns when dealing with longer exons, thus increasing the risk of incorrect or inaccurate splicing. In addition, longer exons can cause splicing complexity because more splicing factors and proteins may be required to regulate the splicing process. Conversely, because introns are shorter, shorter exons are easier to process by splicing enzymes, and processing is faster and more efficient, which can improve the accuracy and efficiency of splicing. Therefore, exon length is one of the factors that affect splicing efficiency.
[0066] In some embodiments, the E2 fragment may be an exon sequence having a size of 8 to 51 bases, and the E1 fragment may be an exon sequence having a size of 2 to 15 bases. In some embodiments, the E2 fragment may be an exon sequence having a size of 20 to 51 bases. In some embodiments, the E2 fragment may be an exon sequence having a size of 40 to 51 bases. In some embodiments, the E2 fragment may be an exon sequence having a size of 8 to 40 bases. In some embodiments, the E2 fragment may be an exon sequence having a size of 20 to 40 bases. In some embodiments, the E2 fragment may be an exon sequence having a size of 8 to 20 bases. In some embodiments, the E2 fragment may be an exon sequence having a size of 8, 10, 15, 20, 30, 40, or 50 bases.
[0067] In some embodiments, the E1 fragment may be an exon sequence having a size of 2 to 10 bases. In some embodiments, the E1 fragment may be an exon sequence having a size of 2 to 8 bases. In some embodiments, the E1 fragment may be an exon sequence having a size of 2 to 6 bases. In some embodiments, the E1 fragment may be an exon sequence having a size of 2 to 4 bases. In some embodiments, the E1 fragment may be an exon sequence having a size of 4 to 8 bases. In some embodiments, the E1 fragment may be an exon sequence having a size of 2, 4, 6, 8, 10, 12, or 15 bases.
[0068] In some embodiments, the E2 fragment is a pre-tRNA of Anabaena sp. Leu The E1 fragment may be an exon sequence downstream of an intron of a gene, and the E1 fragment may be a pre-tRNA fragment of the Anabaena genus. Leu It is the exon sequence upstream of the intron fragment of a gene.
[0069] In some embodiments, the nucleotide sequence of the intron fragment may have at least 95% similarity to SEQ ID NO:1, the nucleotide sequence of the E2 fragment may have at least 95% similarity to any one of SEQ ID NOs:2-5 and the sequences AAAATCCG, AAAATC, AAAA, and AA, and the nucleotide sequence of the E1 fragment may have at least 95% similarity to any one of SEQ ID NOs:8-11 and the sequences GGACTT, ACTT, TT, and CTT. In some embodiments, the nucleotide sequence of the intron fragment may have 95%, 97%, 98%, or 99% similarity to SEQ ID NO:1; the nucleotide sequence of the E2 fragment may have 95%, 97%, 98%, or 99% similarity to any one of SEQ ID NOs:2-5 and the sequences AAAATCCG, AAAATC, AAAA, and AA; and the nucleotide sequence of the E1 fragment may have 95%, 97%, 98%, or 99% similarity to any one of SEQ ID NOs:8-11 and the sequences GGACTT, ACTT, TT, and CTT.
[0070] In some embodiments, the nucleotide sequence of the E2 fragment may have at least 95% similarity to any one of SEQ ID NO:2-5 and the sequence AAAATCCG. In some embodiments, the nucleotide sequence of the E2 fragment may have 95%, 97%, 98%, or 99% similarity to any one of SEQ ID NO:2-5 and the sequence AAAATCCG.
[0071] In some embodiments, the nucleotide sequence of the intron fragment may have the sequence set forth in SEQ ID NO: 1, the nucleotide sequence of the E2 fragment may have the sequence set forth in any one of SEQ ID NOs: 2 to 5 and the sequences AAAATCCG, AAAATC, AAAA, and AA, and the nucleotide sequence of the E1 fragment may have the sequence set forth in any one of SEQ ID NOs: 8 to 11 and the sequences GGACTT, ACTT, TT, and CTT.
[0072] In some embodiments, the nucleotide sequence of the E2 fragment may have the sequence shown in any one of SEQ ID NO: 2 to SEQ ID NO: 5 and the sequence AAAATCCG.
[0073] In some embodiments, the DNA molecule may not contain any intron sequences at the 3' end of the E1 fragment.
[0074] In some embodiments, the DNA molecule may further comprise a target fragment located between the E2 fragment and the E1 fragment. The target fragment may comprise a target DNA sequence encoding a target peptide. In some embodiments, the target peptide may be a target protein. A target protein refers to a specific protein molecule that is being studied, analyzed, or processed in a study.
[0075] In some embodiments, after inserting a target fragment between the E2 fragment and the E1 fragment, the in vitro transcription template obtained based on the DNA molecule can form a circular RNA in an in vitro transcription reaction.
[0076] In some embodiments, the DNA molecule is (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing the downstream exon of the full-length intron; (c) a gene of interest (GOI) fragment; (d) It may contain an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0077] In some embodiments, the target fragment may be a GOI fragment, and the nucleotide sequence of the GOI fragment may be transcribed into a target RNA sequence. In some embodiments, the nucleotide sequence of the GOI fragment may have at least 95% similarity to SEQ ID NO:6 or SEQ ID NO:7. In some embodiments, the nucleotide sequence of the GOI fragment may have 95%, 97%, 98%, or 99% similarity to any one of SEQ ID NO:6 or SEQ ID NO:7.
[0078] In some embodiments, the GOI fragment encodes a protein-coding or non-coding RNA sequence. In some embodiments, the nucleotide sequence of the GOI fragment may have the nucleotide sequence set forth in SEQ ID NO:6 or SEQ ID NO:7.
[0079] In some embodiments, the DNA molecule may further comprise an internal ribosome entry site (IRES) fragment located between the E2 and E1 fragments, which may be transcribed into an RNA molecule capable of recruiting ribosomes to obtain the target peptide for a translation reaction.
[0080] In some embodiments, the IRES fragment is selected from the group consisting of Taura syndrome virus, Assassin bug virus, Thayer's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhopalophis barbatus virus, Reticuloendotheliosis virus, Forman poliovirus 1, German winged stink bug enteric virus, Kashmir bee virus, human rhinovirus 2, Leafhopper virus-1, human immunodeficiency virus type 1, Leafhopper virus-1, Small kite P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis B virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinovirus, Oriental geometrid virus, Encephalomyocarditis virus (EMCV), Drosophila melanogaster virus, Cruciferae tobacco virus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen brood virus, aphid fatal paralysis virus, avian encephalomyelitis virus, acute paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis , human p53, human Pim-1, mouse Rbm3, Drosophila Reaper, Dog Camper, Drosophila Ubx, salivary virus, coxsackievirus, parechovirus, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila Hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian picornavirus, turnip crinkle virus, an aptamer against eIF4G, coxsackievirus B1, coxsackievirus B2, or coxsackievirus B3 (CVB3).
[0081] In some embodiments, the IRES fragment may be derived from the IRES fragment of CVB3. In some embodiments, CVB3 may have the IRES fragment set forth in SEQ ID NO:14.
[0082] In some embodiments, the DNA molecule is (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing the downstream exon of the full-length intron; (c) an IRES fragment; (d) It may contain an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0083] In some embodiments, after inserting a target fragment between the E1 fragment and the IRES fragment, the in vitro transcription template obtained based on the DNA molecule can form a circular RNA in an in vitro transcription reaction.
[0084] In some embodiments, the DNA molecule may further comprise 5' and 3' homology arm sequences located between the E2 and E1 fragments.
[0085] The 5' homology arm sequence may be a sequence that corresponds to a specific region in the target fragment. The 5' homology arm sequence may usually be located at the 5' end of the DNA molecule and may undergo homologous recombination with a region in the target fragment.
[0086] The 3' homology arm sequence may be a sequence that matches another specific region in the target fragment. The 3' homology arm sequence may usually be located at the 3' end of the DNA molecule and may undergo homologous recombination with another region in the target fragment.
[0087] In some embodiments, the DNA molecule is (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing the downstream exon of the full-length intron; (c) a 5' homology arm sequence; (d) a 3' homology arm sequence; (e) It may contain an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0088] In some embodiments, after inserting a target fragment between the 5' homology arm sequence and the 3' homology arm sequence, the in vitro transcription template obtained based on the DNA molecule can form a circular RNA in an in vitro transcription reaction.
[0089] In some embodiments, the DNA molecule is (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing the downstream exon of the full-length intron; (c) a 5' homology arm sequence; (d) an IRES fragment; (e) a GOI fragment; (f) a 3' homology arm sequence; (g) It may contain an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0090] In some embodiments, the 5' and 3' homology arm sequences can help ensure the precise localization of the DNA molecule in the target genome or improve the efficiency of the circularization reaction of long RNA sequences. In transgenic technology, these homology arm sequences can be used to insert a specific gene or DNA fragment into the genome at a specific location in the target organism, thereby achieving regulation of gene expression and function.
[0091] In some embodiments, when the length of the target DNA sequence encoding the target peptide is less than 2000 nt, the DNA molecule may not include the 5' homology arm sequence or the 3' homology arm sequence located between the E2 fragment and the E1 fragment.
[0092] In some embodiments, the DNA molecule is (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing the downstream exon of the full-length intron; (c) an IRES fragment; (d) a GOI fragment; (e) It may contain an element operably linked and arranged in order with the E1 fragment containing the upstream exon of the full-length intron.
[0093] In some embodiments of the present disclosure, the in vitro transcription template obtained based on the DNA molecule can form circular RNA in an in vitro transcription reaction without the need for additional homologous arm sequences, while ensuring circularization efficiency, reducing the raw materials required for the in vitro circularization process, and reducing production costs.
[0094] In some embodiments, the intron fragment may further be preceded by a promoter element, which may be one of a T7 promoter, a T3 promoter, and an SP6 promoter.
[0095] In some embodiments, the DNA molecule may further comprise a poly X fragment preceding the full-length intron fragment. The poly X fragment may comprise at least 7 consecutive identical bases, where X is one or two of A, C, G, T, and U.
[0096] In some embodiments, polyX fragments are used for affinity adsorption with oligo dX affinity beads to purify circular RNA generated in an in vitro transcription reaction, and thus high purity circular RNA can be obtained by using oligo dX affinity beads.
[0097] In some embodiments, the DNA molecule may be a vector.
[0098] As used herein, "vector" refers to a tool used to carry, replicate, and express exogenous DNA or RNA molecules. In the context of transcription in this disclosure, vector refers to a molecule used to carry exogenous DNA fragments and undergo a transcription reaction within a cell to produce RNA.
[0099] Vectors are usually circular DNA molecules such as plasmids or viruses (e.g., adenoviruses, adeno-associated viruses, etc.), bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), etc. These vectors have the ability to self-replicate and can independently replicate within cells, and can also carry exogenous genes such as protein-coding genes and RNA genes.
[0100] In some embodiments, vectors can be designed to contain specific promoters, regulatory elements, and terminators to enable the exogenous DNA within the cell to transcribe and produce RNA. These RNA molecules can be protein-coding mRNA or other non-coding RNA.
[0101] In some embodiments, an in vitro transcription template can be obtained based on the above-mentioned vector, and a circular RNA can be formed in an in vitro transcription reaction based on the in vitro transcription template.
[0102] The in vitro transcription template can be obtained by various methods. For example, the in vitro transcription template can be obtained directly by artificial in vitro synthesis. In some embodiments, the in vitro transcription template can be obtained by constructing a plasmid for PCR amplification or by cleaving a plasmid with a restriction endonuclease.
[0103] Embodiments of the present disclosure provide a method for preparing circular RNA based on the above-mentioned DNA molecule. In some embodiments, the method may include performing an in vitro transcription reaction to obtain linear RNA based on the DNA molecule, and allowing the linear RNA to self-circularize to produce circular RNA.
[0104] In some embodiments, the DNA molecule is produced by in vitro synthesis.
[0105] In some embodiments, producing the DNA molecule comprises constructing a recombinant plasmid containing the sequence of the DNA molecule and obtaining the DNA molecule by PCR amplification using the recombinant plasmid as a template and forward and reverse primers at the ends of the E1 sequence.
[0106] In some embodiments, producing the DNA molecule comprises constructing a recombinant plasmid containing the sequence of the DNA molecule and digesting the recombinant plasmid with a Type IIS or Type II blunt restriction endonuclease to obtain the DNA molecule.
[0107] In some embodiments, the Type IIS restriction endonuclease may comprise BspQ I, Bsa I, or BsmB I, and the Type II blunt restriction endonuclease may comprise Hpa I, Swa I, or Dra I.
[0108] In some embodiments, the reaction temperature of the in vitro transcription reaction may be 30° C. to 50° C., and the reaction time of the in vitro transcription reaction may be 0.5 hours to 16 hours.
[0109] In some embodiments, the reaction temperature of the in vitro transcription reaction may be 30°C to 40°C. In some embodiments, the reaction temperature of the in vitro transcription reaction may be 37°C, 40°C, or 50°C. In some embodiments, the reaction temperature of the in vitro transcription reaction may be 37°C. In some embodiments, the reaction time of the in vitro transcription reaction may be 0.5 hours to 8 hours. In some embodiments, the reaction time of the in vitro transcription reaction may be 0.5 hours to 4 hours. In some embodiments, the reaction time of the in vitro transcription reaction may be 0.5 hours, 1 hour, 3 hours, 6 hours, 8 hours, or 12 hours. In some embodiments, the reaction time of the in vitro transcription reaction may be 2.5 hours.
[0110] In some embodiments, the reaction temperature of the in vitro transcription reaction may not be constant. For example, the in vitro transcription reaction may be performed at a first temperature for a first time period, and then at a second temperature for a second time period, to obtain a reaction product of the in vitro transcription reaction. In some embodiments, the first temperature may be 30°C to 40°C, and the second temperature may be 40°C to 50°C. In some embodiments, the first temperature may be 37°C ± 2°C, and the second temperature may be 50°C ± 2°C. In some embodiments, the first time period may be 0.5 hours to 5 hours, and the second time period may be 0.1 hours to 1 hour. In some embodiments, the first time period may be 2 hours, and the second time period may be 20 minutes.
[0111] In some embodiments, the in vitro transcription reaction may include the steps of preparing a mixture in an in vitro transcription system to obtain a mixed mixture, and performing an in vitro transcription reaction of the mixed mixture at 37°C ± 2°C for 2 hours to obtain a reaction product.
[0112] In some embodiments, the in vitro transcription reaction may include the steps of preparing a mixture in an in vitro transcription system to obtain a mixed mixture, performing an in vitro transcription reaction of the mixed mixture at 37°C ± 2°C for 2 hours, and further performing an in vitro transcription reaction of the mixed mixture at 50°C ± 2°C for 20 minutes to obtain a reaction product.
[0113] In some embodiments, the mixture may include nucleotides including ATP, CTP, GTP, and UTP, DNA molecules, a buffer, T7 RNA polymerase, and nuclease-free water.
[0114] In some embodiments, the method may further comprise treating the reaction product with DNase I enzyme at 37°C ± 2°C for 15 minutes, followed by incubation at 50°C ± 2°C for 20 minutes to remove DNA molecules.
[0115] In some embodiments, the in vitro transcription reaction may include the steps of preparing a mixture in an in vitro transcription system to obtain a mixed mixture, performing an in vitro transcription reaction of the mixed mixture at 37°C ± 2°C for 2 hours, treating the reaction product with DNase I enzyme at 37°C ± 2°C for 15 minutes to remove DNA molecules, and further performing an in vitro transcription reaction of the mixed mixture at 50°C ± 2°C for 20 minutes to obtain a reaction product.
[0116] In some embodiments, the buffer may contain Tris-HCl, MgCl, DTT, spermidine, and Mg 2+ may have a concentration of at least 32 mM.
[0117] In some embodiments, the DNA molecule may further comprise a poly X fragment preceding the full-length intron fragment, where X may be one or two of A, C, G, T, and U. The poly X fragment may comprise at least 7 consecutive identical bases.
[0118] In some embodiments, the method may further comprise obtaining purified circular RNA using oligo dX affinity beads. When the poly X fragment is poly A, oligo dT affinity beads may be used; when the poly X fragment is poly T, oligo dA affinity beads may be used; when the poly X fragment is poly C, oligo dG affinity beads may be used; when the poly X fragment is poly G, oligo dC affinity beads may be used; and when the poly X fragment is poly U, oligo dA affinity beads may be used.
[0119] In some embodiments, poly X fragments may comprise 14 to 40 consecutive identical bases. In some embodiments, poly X fragments may comprise 14 to 20 consecutive identical bases. In some embodiments, poly X fragments may comprise 20 to 29 consecutive identical bases. In some embodiments, poly X fragments may comprise 14, 20, 25, 29, 31, 35, or 39 consecutive identical bases. In some embodiments, poly X fragments may comprise 39 consecutive identical bases.
[0120] Because the circular RNA produced by one-step circularization does not contain polyX fragments, the circular RNA is not adsorbed by oligo dX affinity beads, whereas linear RNA or other RNA fragments containing polyX in the reaction product can be enriched in the oligo dX affinity beads by affinity adsorption.
[0121] In embodiments of the present disclosure, because the sequences of polyX fragments and their corresponding complementary sequences in oligo dX have high affinity, circular RNAs can be separated from reaction products by the principle of affinity adsorption. In this process, oligo dX affinity beads can bind to linear RNAs or other RNA fragments, including polyX fragments. A magnetic field can then be used to separate the affinity beads that bind to linear RNAs or other RNA fragments, including polyX fragments, thereby obtaining purified circular RNA. In some embodiments, oligo dT affinity beads can be used when the polyX fragment is polyA; oligo dA affinity beads can be used when the polyX fragment is polyT; oligo dG affinity beads can be used when the polyX fragment is polyC; and oligo dC affinity beads can be used when the polyX fragment is polyG.
[0122] In some embodiments, the method further comprises adding a DNase I enzyme to the reaction products of the in vitro transcription reaction to remove DNA molecules; and adding a chelating agent to the reaction products to remove Mg. 2+ and adding RNase R to the reaction product to digest linear RNA and further purify circular RNA in the reaction product.
[0123] In some embodiments, the chelating agent is EDTA or Mg 2+ The reaction mixture may also include other chelating agents having the function of chelating the chelating agent. In some embodiments, the amount of chelating agent added to the reaction product may be 30 to 10 mM. In some embodiments, the amount of chelating agent added to the reaction product may be 30 mM, 20 mM, or 10 mM.
[0124] In some embodiments, the amount of RNase R added to the reaction product may be between 10 U and 30 U. In some embodiments, the amount of RNase R added to the reaction product may be 10 U, 20 U, or 30 U.
[0125] Embodiments of the present disclosure provide a method for producing a target peptide by translation. In some embodiments, the method may include obtaining a circular RNA according to the above method, transfecting a cell with the circular RNA, and initiating a translation reaction in the transfected cell based on the circular RNA to produce the target peptide.
[0126] The following description, together with the embodiments, clearly and completely describes the technical solutions of the present disclosure. Obviously, the described embodiments are only a portion, not all, of the embodiments of the present disclosure. Some of these embodiments can be substituted or combined with the corresponding content of other embodiments to form new embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present disclosure without creative labor are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, all experimental materials used in the following embodiments are purchased from conventional biochemical reagent companies. All quantitative tests in the following examples are set up in triplicate experiments, and the results are averaged. It should be understood that the following embodiments are intended to better illustrate the present disclosure and are not intended to limit the scope of the present disclosure. Example
[0127] Example 1: DNA molecules (e.g., vectors) that generate circular RNA
[0128] As shown in Figure 1, A represents a DNA molecule (e.g., a vector) containing homologous arms, and B represents a DNA molecule (e.g., a vector) not containing homologous arms. In this example, a pre-tRNA of Anabaena genus was used to design an intron fragment, an E2 fragment, and an E1 fragment. Leu Although the gene was used as an example, the present disclosure also relates to the pre-tRNA Leu It is not limited to the gene, but other intron fragments, E2 fragments and E1 fragments from the same gene may also be used.
[0129] DNA molecule A or vector A is, from left to right, an intron fragment (in this example, the intron fragment is a pre-tRNA fragment of Anabaena spp. Leu The intron fragment of the gene, the intron fragment having the nucleotide sequence shown in SEQ ID NO: 1), and the E2 fragment (in this example, the E2 fragment is a pre-tRNA fragment of the Anabaena genus). Leu The sequence of the 5' homology arm in this example was the sequence shown in SEQ ID NO: 12), the sequence of the 3' homology arm in this example was the sequence shown in SEQ ID NO: 13), and the E1 fragment (the E1 fragment in this example was the pre-tRNA Leu The E1 fragments contained elements operably linked and arranged in the order of exon sequences (which were exon sequences upstream of the intron fragment of the gene). Five E1 fragments with different sizes were designed based on exon sequences with lengths of 15 nt, 10 nt, 6 nt, 4 nt, and 2 nt (the nucleotide sequences are shown in SEQ ID NOS: 8-9 and in the sequences GGACTT, ACTT, and TT, respectively), as shown in Figure 13. Eight E2 fragments with different sizes were designed based on exon sequences with lengths of 51 nt, 40 nt, 30 nt, 20 nt, 8 nt, 6 nt, 4 nt, and 2 nt (the nucleotide sequences are shown in SEQ ID NOS: 2-5 and in the sequences AAAATCCG, AAAATC, AAAA, and AA, respectively), as shown in Figure 9.
[0130] By genetic engineering techniques, a DNA molecule (e.g., a vector) can be constructed in the presence of a promoter after inserting the target gene (also known as GOI) sequence that needs to be circularized into a circular RNA between the 5' and 3' homology arm sequences of vector A or between the E2 and E1 fragments of vector B.
[0131] In this example, a GOI fragment (nucleotide sequence of GOI shown in SEQ ID NO: 6 or 7) was used as the target gene sequence that needed to be circularized into a circular RNA to prepare a DNA molecule (e.g., a vector) of the circular RNA. As shown in Figure 2, A was a vector containing homology arms, and B was a vector without homology arms.
[0132] Example 2: Preparation of circular RNA
[0133] 1. Vector Preparation
[0134] In this example, a non-ligase-dependent single fragment rapid cloning kit from Vazyme was used to synthesize DNA molecules (e.g., vectors) that can be used in in vitro transcription reactions to prepare circular RNAs. To prepare the different circular RNAs, gene synthesis methods were used to synthesize GOI fragments.
[0135] 2. Preparation of In Vitro Transcription Template
[0136] The in vitro transcription template consists of an intron fragment, an E2 fragment, a 5' homology arm sequence, a GOI fragment, a 3' homology arm sequence, and an E1 fragment, or an intron fragment, an E2 fragment, a GOI fragment, and an E1 fragment. The in vitro transcription template may be directly synthesized, obtained by constructing a plasmid for PCR amplification, or obtained by cleaving a plasmid using a restriction endonuclease.
[0137] In this example, PCR amplification or restriction endonuclease cleavage was used to obtain high quality in vitro transcription templates, respectively.
[0138] The process of obtaining an in vitro transcription template using PCR amplification is shown in Figure 3. The contractor imported a DNA molecule containing an intron fragment, E2 fragment, 5' homology arm sequence, GOI fragment, 3' homology arm sequence, and E1 fragment, or an intron fragment, E2 fragment, GOI fragment, and E1 fragment, into a plasmid backbone containing a promoter (in this example, a plasmid backbone containing a T7 promoter was used; however, the plasmid backbone is not limited to the T7 promoter; other promoters capable of initiating transcription may be used). This resulted in a recombinant plasmid. A forward primer was designed before the T7 promoter sequence, and a reverse primer was designed exactly at the end of the nucleotide sequence of the E1 fragment. PCR amplification was performed using the recombinant plasmid as a template to obtain an in vitro transcription template. The forward primer used in this example was PCR-F:GGCCAGTGAATTGTTAATACG (SEQ ID NO: 16), and the reverse primer used in this example was PCR-R:AACTCCGTAGCGTCTCGCCG (SEQ ID NO: 17).
[0139] The reaction system is shown below: PCR-F 0.5 μL PCR-R 0.5μL Vector 0.1μg 2 x Takara primeSTAR 10μL RNase-free water up to 20 μL
[0140] The reaction conditions were as follows: [ka]
[0141] PCR products were recovered using a DNA gel. 2% DNA agarose gel was provided. Electrophoresis was performed at 120 V for at least 30 minutes. PCR products were recovered using the Omega Gel Recovery Kit, and the template was eluted by adding 30 μL of RNase-free water. The template concentration was then determined.
[0142] The process for obtaining an in vitro transcription template using the restriction endonuclease method is shown in Figure 4. The contractor imported a DNA molecule consisting of an intron fragment, E2 fragment, 5' homology arm sequence, GOI fragment, 3' homology arm sequence, and E1 fragment, or an intron fragment, E2 fragment, GOI fragment, and E1 fragment, into a promoter-containing plasmid backbone (in this example, a plasmid backbone containing a T7 promoter was used; however, the plasmid backbone is not limited to the T7 promoter and other promoters capable of initiating transcription may be used). This resulted in a recombinant plasmid. The vector was cleaved using a type IIS restriction endonuclease (e.g., BspQI) or a type II blunt restriction endonuclease (e.g., HpaI), with the selected restriction endonuclease site corresponding to the terminal sequence of the E1 fragment. After enzyme cleavage, the ends of the in vitro transcription template were the exact ends of the E1 fragment.
[0143] The reaction conditions were as follows: RNase-free water up to 20 μL Plasmid 10μg BspQ I (or Hpa I) 2 μL 10x reaction buffer 2 μL Total volume 20 μL
[0144] After mixing uniformly, the mixture is reacted in a water bath at 50°C (or 37°C) for 1 hour.
[0145] PCR products were recovered using a DNA gel. 2% DNA agarose gel was provided. Electrophoresis was performed at 120 V for at least 30 minutes. PCR products were recovered using the Omega Gel Recovery Kit, and the template was eluted by adding 30 μL of RNase-free water. The template concentration was then determined.
[0146] 3. In Vitro Transcription Reaction
[0147] 3.1 Principle of obtaining stable circular RNA in in vitro transcription reaction
[0148] As shown in Figure 5, under the action of RNA polymerase (T7 promoter corresponding to T7 RNA polymerase), a linear RNA sequence (RNA-OH) bearing a free hydroxyl group at the end of the E1 fragment was obtained by reacting it with the in vitro transcription template obtained in step 2 as a substrate. At the same time, the linear RNA itself formed a stable secondary structure, and the free hydroxyl group (U-OH) at the end of the RNA attacked the combined region of the intron fragment and the E2 fragment for a one-step transesterification reaction. Thus, the ends of the E2 fragment and the E1 fragment were ligated to form a stable circular RNA.
[0149] 3.2 Method
[0150] (1) In vitro transcription reaction
[0151] Using the in vitro transcription template obtained in step 2 as a substrate, an in vitro transcription reaction with an RNA transcriptase kit (T7 RNA transcriptase kit) is performed to generate a mixture (containing linear RNA and circular RNA), of which circular RNA is the major component.
[0152] Reaction conditions for each tube: ATP / CTP / GTP / UTP mix 8 μL In vitro transcription template 1 μg 10x reaction buffer 2 μL T7 enzyme mix 2 μL RNase-free water up to 20 μL
[0153] The above materials were mixed uniformly, and then the in vitro transcription reaction was carried out at 37°C.
[0154] (2) Digestion with DNase I enzyme
[0155] The in vitro transcription reaction product was treated with DNase I enzyme for 15 minutes to remove the DNA template. The reaction conditions for each tube were as follows: 1 μL of DNase I enzyme (1 U / μL) was added to the centrifuge tube in step (1), the DNase I enzyme was mixed evenly with the reaction product, and then the reaction was allowed to proceed at 37°C for 15 minutes.
[0156] (3) Recovery of RNA molecules
[0157] The RNA molecules were purified using a column purification kit, and the concentration of the purified RNA molecules was measured.
[0158] (4) Verification by gel electrophoresis
[0159] The size and integrity of the long-fragment RNA were verified using DNA agarose gel electrophoresis. Specifically, a 2% agarose gel was provided, and electrophoresis was performed for 45 min at 120 V for 1 μg of RNA molecules, and the stripe size of the RNA molecules was confirmed using a gel imaging system (the results are shown in Figures 10, 14, 17, and 20).
[0160] The size and integrity of the long-fragment RNA were verified using denaturing urea-polyacrylamide gel electrophoresis. Specifically, a 5% PAGE gel was prepared, and electrophoresis was performed on 400 ng of RNA molecules at 120 V for 1 h. The stripe size of the RNA molecules was then confirmed using a gel imaging system (the results are shown in Figures 7 and 8).
[0161] The composition of the DNA molecules or vectors included in this example is shown in Table 1.
[0162] [Table 1]
[0163] 4.Results
[0164] The results of obtaining in vitro transcription templates are shown in Figure 6. PCR amplification was used to generate sufficient amounts of circular RNA transcription templates (shown as A in Figure 6; the resulting in vitro transcription template had the correct ends of the E1 fragment, while the end of the E1 fragment of the linear RNA formed by the in vitro transcription reaction had a free hydroxyl group). Alternatively, a restriction endonuclease was used to cleave the plasmid containing the target fragment (shown as B in Figure 6; the resulting in vitro transcription template had the correct ends of the E1 fragment, while the end of the linear RNA formed by in vitro transcription had a free hydroxyl group). The restriction endonucleases used for cleavage were either type IIS restriction enzymes or type II restriction enzymes capable of generating flat ends.
[0165] The templates obtained by PCR amplification were used in in vitro transcription reactions, and the products generated in the in vitro transcription reactions were subjected to circularization and digestion with RNase R, respectively. The products obtained from these three reactions were identified using a denaturing urea polyacrylamide gel. The results of the identification of the reaction products in the in vitro transcription reactions are shown in Figure 7. In the reaction products of the in vitro transcription (IVT) reaction, the content of circular RNA was higher than the content of linear RNA, indicating that most linear RNA undergoes circularization during the in vitro transcription process.
[0166] As shown in Figures 7 and 8, compared with the transcription results obtained under in vitro transcription conditions of 37°C and 2 hours (shown in serial number 2 in Table 1), the proportion of circular RNA further increased under in vitro transcription conditions of 37°C, 2 hours and 50°C, 20 minutes (shown in serial number 3 in Table 1).
[0167] E2 fragments of different lengths (shown in Figure 9) were reacted under normal in vitro transcription conditions (37°C, 2 h) and optimized in vitro transcription conditions (37°C, 2 h; 50°C, 20 min), which are designated serial numbers 2 to 17 in Table 1, respectively. The circular RNA and linear RNA ratios in the reaction products were quantified using Image J software. The quantitative results are shown in Figures 10 and 11. The length of the E2 fragment may affect the proportion of circular RNA in the in vitro transcription reaction products. When the length of the E2 fragment is between 8 and 51 nt, the proportion of circular RNA in the in vitro transcription reaction products may be approximately 85% to 90%, i.e., the proportion of circular RNA in the in vitro transcription reaction products may not be affected. When the length of the E2 fragment is less than 8 nt, the proportion of circular RNA is severely affected, and the proportion of circular RNA in the in vitro transcription reaction products may be less than 80%. An 8-nt E2 fragment contained in the template was used to perform an in vitro transcription reaction, and the reaction product was digested with RNase R, followed by RT-PCR. The RT-PCR product was ligated into a T vector for Sanger sequencing, and the results of Sanger sequencing are shown in Figure 12. The results of Sanger sequencing indicate that the circularization site of the circular RNA is single and accurate.
[0168] E1 fragments of different lengths (shown in Figure 13) were used in reactions under normal in vitro transcription conditions (37°C, 2 h) and optimized in vitro transcription conditions (37°C, 2 h; 50°C, 20 min), which are designated serial numbers 10, 11, and 18–27 in Table 1, respectively. The proportions of circular and linear RNA in the reaction products were quantified using the software Image J. The quantitative results are shown in Figures 14 and 15. E1 fragments of different lengths were tested under normal in vitro transcription conditions (37°C, 2 h, Figure 14A) and optimized in vitro transcription conditions (37°C, 2 h; 50°C, 20 min, Figure 14B), respectively. The results indicate that the length of the E1 fragment has little effect on the proportion of circular RNA in the in vitro transcription reaction.
[0169] After mutating the 3'-terminal sequence of the 15-nt E1 fragment from CTT to GTT or TTT (see Figure 16), the proportion of circular RNA in the in vitro transcription reaction products (37°C, 2 h; 50°C, 20 min, as shown in serial numbers 28-29 in Table 1) was detected (quantified using Image J software). The quantitative results are shown in Figures 17 and 18, which indicate that mutating the E1 fragment's terminal sequence from CTT to GTT or TTT did not affect the proportion of circular RNA in the in vitro transcription reaction products.
[0170] When the homology arm sequences (shown in Figure 19) were omitted, the proportion of circular RNA in the reaction product after in vitro transcription (37°C, 2 h; 50°C, 20 min) was quantified using Image J software. The quantitative results are shown in Figures 20 and 21. As shown in serial number 11 in Table 1, removing the 5' and 3' homology arm sequences (homology (-), see serial number 30 in Table 1) from the sequence did not affect the proportion of circular RNA in the reaction product compared to including homology arms (homology (+)). This indicates that the circularization results without homology arm sequences were equivalent to those with homology arm sequences, and that circularization of linear RNA was not affected. Furthermore, the cost of preparing DNA molecules or vectors without homology arm sequences can be reduced, while the introduction of other foreign genes into the circular RNA products can be avoided.
[0171] Example 3: Method for preparing a translatable circular RNA vector and translating it to produce a protein
[0172] Take the example of the process of translating and detecting circular RNA capable of expressing green fluorescent protein (GFP).
[0173] An application model for producing circular RNA via linear RNA is shown in Figure 22. The structure of the RNA from the 5' end to the 3' end is an intron fragment (in this example, the intron fragment is a pre-tRNA of the genus Anabaena). LeuThe intron fragment had the nucleotide sequence shown in SEQ ID NO: 1), an E2 fragment (in this example, the E2 fragment was a pre-tRNA fragment of the Anabaena genus). Leu The sequence of the exon having a length of 8 nt downstream of the intron of the gene was AAAATCCG), 5' homology arm sequence (the 5' homology arm sequence in this example was the sequence shown in SEQ ID NO: 12), IRES fragment (the IRES fragment in this example was an IRES fragment of CVB3, and the IRES fragment had the nucleotide sequence shown in SEQ ID NO: 14), open reading frame (ORF) having the complete target gene that needs to be expressed in cells or animals (the ORF in this example was the ORF of GFP having the nucleotide sequence shown in SEQ ID NO: 15), 3' homology arm sequence (the 3' homology arm sequence in this example was the sequence shown in SEQ ID NO: 13), E1 fragment (the E1 fragment in this example was the pre-tRNA Leu The sequence was an exon sequence ACTT with a length of 4 nt downstream of the intron of the gene.
[0174] In vitro transcription reaction: The procedure of the in vitro transcription reaction in Example 3 was the same as that of the in vitro transcription reaction in Example 2. The circular RNA obtained in the in vitro transcription reaction was transfected into cells or animals, and ribosomes were recruited for translation under the action of IRES to obtain the target peptide.
[0175] 1. Method
[0176] Purified circular RNA digested with RNase R was transfected into HEK293T cells in 6-well plates using Lipofectamine MessengerMAX liposome transfection reagent. Approximately 1 × 10 cells per well were transfected. 6A mixture of 3.75 μL of Lipofectamine MessengerMAX and 1 μg of circular RNA was diluted with 125 μL of Opti-MEM. The diluted Lipofectamine MessengerMAX and circular RNA were mixed and incubated at room temperature for 15 min. The incubation product was then added to the cell culture medium. After 6 h, the cell culture medium was replaced with fresh medium. Cells grown in the replaced medium were harvested after 48 h of culture. After removing the medium, the cells were rinsed with 1x PBS buffer, and total cellular protein was lysed and collected using 1x SDS-PAGE gel electrophoresis. Specifically, a 10% SDS-PAGE gel was prepared, and protein markers and 10 μL of sample were added to each of six wells and marked. Electrophoresis was performed at 120 V for 70 min. A 0.45 μm PVDF membrane was used for implantation, followed by incubation with α-ACTB and α-GFP antibodies, respectively. This was followed by secondary antibody incubation and ECL luminescence detection photography. Using ACTB as an internal reference protein, the relative expression level of GFP was analyzed and the produced protein was detected.
[0177] 2.Results
[0178] The efficiency of GFP protein expression by various circular RNAs containing a GFP coding sequence in HEK293T cell lines was compared using protein imprinting technology. The results are shown in Figure 23. Specifically, a blank plasmid was in lane 1. Circular CVB3-GFP molecules obtained by conventional PIE circularization were in lane 2. Circular CVB3-GFP molecules obtained under optimized in vitro transcription conditions, using the techniques described in this disclosure, by digestion with RNase R and purification, were in lane 3. Circular CVB3-GFP molecules obtained under normal in vitro transcription conditions, using the techniques described in this disclosure, by digestion with RNase R and purification, were in lane 4. The above four molecules were transfected into HEK293T cells for 48 hours using Lipo3000, and cell lysates were collected. GFP expression was detected using protein blotting. The results demonstrated that the circular RNA molecules obtained using the techniques described in this disclosure were successfully expressed in cells and capable of producing active protein.
[0179] In summary, the DNA molecule or vector for in vitro transcription reaction to generate circular RNA in the present disclosure includes, from left to right, an intron fragment (in this example, the intron fragment is a pre-tRNA fragment of Anabaena spp.) Leu The intron fragment of the gene, the intron fragment having the nucleotide sequence shown in SEQ ID NO: 1), and the E2 fragment (in this example, the E2 fragment is a pre-tRNA fragment of the Anabaena genus Leu The GOI fragment (the RNA sequence that needs to be circularized; different sequences were selected based on different purposes of circularization) and the E1 fragment (the E1 fragment in this example was a pre-tRNA of the Anabaena genus). LeuThe E1 fragment contained elements operably linked and positioned in the order of exon sequence CTT downstream of the intron of the gene. The above composition formed the transcription template, and the linear RNA sequence formed in the promoter-driven in vitro transcription reaction is shown in Figure 24. A free hydroxyl group was retained at the end of the E1 fragment. The linear RNA was further circularized to form a circular RNA. If the length of the RNA sequence to be circularized was longer than 2000 nt, a 5' homology arm sequence was inserted after the E2 fragment and a 3' homology arm sequence was inserted before the E1 fragment.
[0180] Example 4: Preparation of a vector to generate circular RNA for affinity purification
[0181] As shown in FIG. 25, in this example, the intron fragment, E2 fragment, and E1 fragment were derived from the pre-tRNA of Anabaena genus. Leu Although designed using the gene, pre-tRNA of Anabaena sp. Leu Without being limited to the gene, the intron fragment, E2 fragment, and E1 fragment may be derived from other sources of the same gene.
[0182] The vector contains, from left to right, 29 consecutive A bases and an intron fragment (in this example, the intron fragment is a pre-tRNA fragment of the Anabaena genus). Leu The intron fragment of the gene, the intron fragment having the nucleotide sequence shown in SEQ ID NO: 1), and the E2 fragment (in this example, the E2 fragment is a pre-tRNA fragment of the Anabaena genus). Leu The exon sequence downstream of the intron of the gene, which was 51 nt and had the nucleotide sequence shown in SEQ ID NO: 2), a 5' homology arm sequence (the 5' homology arm sequence in this example was the sequence shown in SEQ ID NO: 12), a 3' homology arm sequence (the 3' homology arm sequence in this example was the sequence shown in SEQ ID NO: 13), and an E1 fragment (the E1 fragment in this example was a pre-tRNA LeuThe exon sequence upstream of the intron fragment of the gene, which was 15 nt and had the nucleotide sequence shown in SEQ ID NO:8, was operably linked and arranged in this order.
[0183] After inserting a target gene sequence (shown in Figure 25) between the 5' and 3' homology arm sequences of a vector by genetic engineering techniques, the constructed DNA molecule (e.g., a vector) can be used as a transcription template in an in vitro transcription reaction in the presence of a promoter to circularize and generate circular RNA.
[0184] Example 5: Preparation of DNA molecules (e.g., vectors) and circular RNA for affinity purification
[0185] 1. DNA molecules (e.g., vectors)
[0186] In this example, GFP (having the nucleotide sequence set forth in SEQ ID NO: 15) was designated as the target gene sequence that needed to be circularized into RNA to prepare a DNA molecule (e.g., a vector) that would generate circular RNA for affinity purification, as shown in Figure 26.
[0187] The vector contains, from left to right, 29 consecutive A bases and an intron fragment (in this example, the intron fragment is a pre-tRNA fragment of the Anabaena genus). Leu The intron fragment of the gene, the intron fragment having the nucleotide sequence shown in SEQ ID NO: 1), and the E2 fragment (in this example, the E2 fragment is a pre-tRNA fragment of the Anabaena genus). LeuThe exon sequence downstream of the intron of the gene, which was 51 nt and had the nucleotide sequence shown in SEQ ID NO: 2), a 5' homology arm sequence (the 5' homology arm sequence in this example was the sequence shown in SEQ ID NO: 12), a CVB3 IRES sequence (the CVB3 IRES sequence in this example was the sequence shown in SEQ ID NO: 14), a 3' homology arm sequence (the 3' homology arm sequence in this example was the sequence shown in SEQ ID NO: 13), and an E1 fragment (the E1 fragment in this example was a pre-tRNA Leu The DNA molecule (e.g., a vector) was used as a transcription template in the presence of a promoter to circularize in vitro to generate circular RNA.
[0188] Vector preparation: To prepare different circular RNAs based on the empty vector described in this example, target GFPs were synthesized using gene synthesis. The GFP sequence was inserted into the empty vector containing the homology arms mentioned in the example (in this example, the vector was synthesized using the non-ligase-dependent single fragment rapid cloning kit manufactured by Vazyme) to synthesize a vector that could be used in an in vitro transcription reaction to form circular RNAs.
[0189] 2. Preparation of In Vitro Transcription Template
[0190] The in vitro transcription template consisted of 29 nt of consecutive A bases, an intron fragment, an E2 fragment, a 5' homology arm sequence, a CVB3 IRES sequence, a GFP sequence, a 3' homology arm sequence, and an E1 fragment. The in vitro transcription template could be directly synthesized, obtained by constructing a plasmid for PCR amplification, or obtained by cleaving a plasmid using a restriction endonuclease.
[0191] In this example, a high-quality in vitro transcription template was obtained using restriction endonuclease cleavage. The contractor imported a DNA molecule consisting of 29 nt consecutive A bases, an intron fragment, an E2 fragment, a 5' homology arm sequence, a CVB3 IRES sequence, a GFP sequence, a 3' homology arm sequence, and an E1 fragment into a promoter-containing plasmid backbone (in this example, a plasmid backbone containing a T7 promoter was used; however, the plasmid backbone is not limited to the T7 promoter; other promoters capable of initiating transcription may be used). This resulted in a recombinant plasmid (containing a T7 promoter, a 29 nt poly(A), an intron fragment, an E2 fragment, a 5' homology arm sequence, a CVB3 IRES sequence, a GFP sequence, a 3' homology arm sequence, and an E1 fragment). The circular RNA vector was cleaved using a type IIS restriction endonuclease (e.g., BspQI), with the selected restriction enzyme cleavage site encompassing the terminal sequence of the E1 fragment. After enzymatic cleavage with the restriction endonuclease, the ends of the in vitro transcription template were the exact terminal sequences of the E1 fragment. The reaction conditions were as follows:
[0192] RNase-free water up to 20 μL Plasmid 10μg BspQ I 2 μL 10x reaction buffer 2 μL Total volume 20 μL
[0193] After mixing uniformly, the mixture was reacted in a water bath at 50°C for 1 hour.
[0194] The enzymatic cleavage products were recovered using a DNA gel. 2% DNA agarose gel was provided. Electrophoresis was performed at 120 V for at least 30 minutes. The enzymatic cleavage products were recovered using the Omega Gel Gel Recovery Kit, and the template was eluted by adding 30 μL of RNase-free water. The template concentration was then determined.
[0195] 3. In Vitro Transcription Reaction
[0196] 3.1. In vitro transcription reaction
[0197] Using the in vitro transcription template obtained in step 2 as a substrate, an in vitro transcription reaction with an RNA transcriptase kit (T7 RNA transcriptase kit) is performed to generate a mixture (containing linear RNA and circular RNA), of which circular RNA is the major component.
[0198] Reaction conditions for each tube: ATP / CTP / GTP / UTP mix 8 μL In vitro transcription template 1 μg 10x reaction buffer 2 μL T7 enzyme mix 2 μL RNase-free water up to 20 μL
[0199] The above materials were mixed uniformly, and then an in vitro transcription reaction was carried out at 37°C for 2 hours.
[0200] 3.2. Digestion with DNase I enzyme
[0201] The in vitro transcription reaction product was treated with DNase I enzyme for 15 minutes to remove the DNA template. The reaction conditions for each tube were as follows: 1 μL of DNase I enzyme (1 U / μL) was added to the centrifuge tube in step (1), the DNase I enzyme was mixed evenly with the reaction product, and then the reaction was allowed to proceed at 37°C for 15 minutes.
[0202] 3.3 Recovery of RNA molecules
[0203] RNA was precipitated using 7.5 M LiCl, RNase-free water was added to dissolve the RNA, and the concentration of RNA was determined.
[0204] 3.4 Verification by gel electrophoresis
[0205] A 2% agarose gel was provided, and electrophoresis was performed for 1 μg of RNA molecules at 120 V for 45 min, and the stripe size of the RNA molecules was therefore confirmed by a gel imaging system.
[0206] 4. Optimization of the In Vitro Transcription (IVT) System
[0207] In in vitro transcription reactions, the composition of the 10x transcription buffer may determine the amount of IVT product and the proportion of components in the IVT product. Therefore, optimizing the 10x transcription buffer is important. The main components of the 10x transcription buffer include Tris HCl, MgCl2, DTT, spermidine, etc. Among these components, Mg 2+ The concentration of Mg directly affects the amount of IVT product. 2+ may also be directly involved in the transesterification and RNA hydrolysis processes. 2+ The concentration of was examined.
[0208] T7 RNA polymerase mixes from NEB and Yearson were used with 4, 10, 16, 32, 35, 38, 41, and 44 mM Mg, respectively. 2+ The reaction conditions and system may refer to the in vitro transcription system section in this example.
[0209] The result is Mg 2+ It was shown that when the Mg concentration was less than 32 mM, almost no RNA was produced in the IVT reaction (see Figure 27). 2+ When the Mg concentration was between 32 and 44 mM, RNA was produced in the IVT reaction, and in a 20 μl IVT reaction, the percentage of circular RNA was 160 to 200 μg, with the percentage of circular RNA ranging from 65% to 80%. 2+ With increasing concentrations of , the proportion of circular RNA gradually increased (see Figure 28).
[0210] Example 6: Affinity purification of circular RNA
[0211] In this example, circular RNA was purified using oligo-dT affinity beads. Circular RNA purification is typically performed using SEC or other methods based on molecular weight differences. However, due to the small molecular weight difference between circular RNA and precursor linear RNA, the circular RNA and precursor linear RNA cannot be sufficiently separated, resulting in poor circular RNA purification efficiency. In this study, a 29-nt polyA sequence was added to the front fragment of the intron fragment. After the in vitro transcription and circularization reaction was completed, both the intron fragments, which were by-products of the linearization and circularization of the precursor linear RNA, contained 29-nt polyA sequences and could be combined with affinity beads or fillers containing oligo-dT, while circular RNA molecules without oligo-dT could not be combined with affinity beads or fillers. Due to the interaction between oligo-dT and polyA, affinity purification was performed to obtain highly purified circular RNA in flow cytometry. The specific steps are shown below.
[0212] (1) 50 μg of the IVT product was made up into 100 μl, and the 100 μl IVT product was denatured at 70°C for 5 minutes and immediately cooled on ice.
[0213] (2) The oligo dT affinity beads were gently mixed, 100 μl of oligo dT affinity beads were added to a 1.5 ml EP tube, and the liquid was removed using a magnetic holder.
[0214] (3) 200 μl of the combined liquid was added to the affinity beads, mixed well and gently, and excess liquid was absorbed using a magnetic holder.
[0215] (4) Step (3) was repeated once.
[0216] (5) 100 μl of the combined liquid was added to the affinity beads, and the denatured RNA obtained from step (1) was added to the affinity bead suspension and gently incubated on a vertical mixer at room temperature for 30 min.
[0217] (6) The EP tube was placed on a magnetic holder, and the mixture (flow-through) was drawn into a new EP tube. The liquid in the new EP tube contained the circular RNA component. 100 μl of 7.5 M LiCl was added, mixed well, and then precipitated at −20° C. for 30 min.
[0218] (7) The affinity beads were washed twice using 200 μl of washing solution.
[0219] (8) Residual liquid was removed from the EP tube by aspiration.
[0220] (9) 15 μl of RNase-free water was added to the affinity beads, and the RNA bound to the affinity beads was eluted at 70°C. The RNA in this tube consisted mainly of essential linear RNA and circularized by-product intron fragments.
[0221] (10) The liquid obtained in step (6) was centrifuged at 12,000 rpm at 4°C for 10 minutes, and the supernatant was discarded.
[0222] (11) The product obtained in step (10) was washed using 75% ethanol, the waste liquid was discarded, and the precipitate was dried at room temperature.
[0223] (12) 30 μl of RNase-free water was added to the precipitate to dissolve the RNA.
[0224] Following the above steps, affinity beads containing oligo-dT were used in the test in this example. The test results are shown in Figure 28. When the DNA molecules contained a 29-nt poly(A) fragment preceding the intron fragment (GFP-poly(A)), linear RNA and intron fragments in the reaction products of the in vitro transcription reaction were enriched by the oligo-dT affinity beads, but circular RNA molecules were not affinity-adsorbed by the oligo-dT affinity beads, and no circular RNA molecules were present in the affinity column. The content of linear RNA and intron fragments in the flow-through (FT) (liquid) from the affinity column was significantly reduced, and thus circular RNA was enriched in the FT. When the DNA molecules did not contain a 29-nt poly(A) fragment preceding the intron fragment, linear RNA and intron fragment RNA in the reaction products of the in vitro transcription reaction were not affinity-adsorbed by the oligo-dT affinity beads, and as a result, circular RNA was not enriched in the FT. The above results demonstrate that circular RNA can be purified by inserting a poly(A) fragment into DNA molecules and obtaining highly purified circular RNA using affinity chromatography (AC, also known as affinity adsorption).
[0225] Example 7: Enrichment of circular RNA using RNase R enzyme
[0226] 1. Enrichment of circular RNA using RNase R enzyme
[0227] RNase R enzyme is a 3'-5' ribonuclease that can digest almost all linear RNAs. The system for generating circular RNA mediated by a one-step transesterification reaction included precursor linear RNA, circular RNA, and a by-product intron fragment. Because both the precursor linear RNA and the by-product intron fragment were linear RNAs, RNase R enzyme could be used to degrade these two linear RNA components, thereby enriching the circular RNA.
[0228] In this example, the step of enriching the circular RNA component using RNase R enzyme is described based on 30 μg of IVT product.
[0229] The reaction system is shown below. IVT product 30μg 10x reaction buffer 10 μl RNase R enzyme (20U / μl) 1μl H2O up to 100 μl
[0230] The material was mixed well using a pipette, and the mixture was digested at 42°C for 30 min.
[0231] Recovery of circular RNA
[0232] The concentrated RNA was recovered using an RNA recovery kit, eluted by adding RNase-free water, and the RNA concentration was measured.
[0233] 1. Conducting Design of Experiments (DoE) with the RNase R Reaction System
[0234] Factors that affect RNase R digestion mainly include the amount of input RNA, the amount of RNase R enzyme used, the reaction time, and the reaction temperature. Therefore, we performed DoE using these four factors and selected half of the DoE.
[0235] Based on experience, the amounts of RNA used in this example were 30 μg and 100 μg. For the test, the reaction time was determined to be 30 min and 60 min, the reaction temperature was selected to be 37° C. and 42° C., and the amount of RNase R used was selected to be 10 U and 30 U.
[0236] A factorial design was conducted using Minitab 19 software, and half of the DoE was carried out. A total of eight sets of tests were conducted, as shown in Table 2.
[0237] [Table 2]
[0238] Gel electrophoresis was used to detect the quality of the generated RNA (shown in Figure 29), and Image J was used to identify the proportion of circular RNA (shown in Figures 29 and 30). In this example, two methods were used to quantify the effect of RNase R enzyme, namely, the residual amount of RNA and the digestion efficiency of RNase R. The residual amount of RNA reflects the relative amount of residual RNA after digestion with RNase R enzyme, calculated as follows: RNA recovery after digestion / total digested RNA amount * 100%. The digestion efficiency of RNase R reflects the proportion of circular RNA after digestion with RNase R enzyme, calculated as follows (grayscale quantification): circular RNA / (linear RNA + circular RNA) * 100%.
[0239] The results showed that more RNA remained for samples 1, 3, 6, and 8, indicating that RNase R degraded less RNA and retained more RNA in the system. The digestion efficiency of RNase R was higher after the reactions of samples 5, 6, and 7 (shown in Figures 29 and 30).
[0240] Through factor analysis of the two results, the Pareto diagram of the effects showed that the amount of RNase R input and reaction temperature mainly affected the amount of RNA remaining after digestion with RNase R enzyme. The amount of RNase R input mainly affected the digestion efficiency of RNase R. There was a significant positive correlation between the input of RNase R and the results of these four factors (see Figure 31).
[0241] Example 8: Optimization of the purification process
[0242] In the above process, the IVT product needs to be purified or liquid exchanged before digestion with RNase R, which introduces redundancy into the process and affects the yield of circular RNA (adding one step to the route can result in RNA loss). When RNase R is used to directly digest the linear RNA in the IVT product, the Mg content in the reaction system for RNase R is reduced. 2+It is necessary to consider the effects of factors such as Mg 2+ The optimal concentration of Mg in the IVT system may be 0.1-1 mM. 2+ The final concentration of Mg was 46 mM. 2+ Chelation of is required to facilitate digestion by RNase R (see Figure 32).
[0243] In this example, EDTA was added directly to the IVT product to 2+ The concentrations of EDTA were 44, 30, 20, 10, and 0 mM, respectively. RNase R was then added to the system for digestion, and the digestion products were analyzed after collection.
[0244] The gel plot (see Figure 33) showed that when 30 to 10 mM EDTA was added to the IVT system, the activity of RNase R was not affected, but when the EDTA concentration was 44 mM or no EDTA was added, RNase R was unable to effectively degrade linear RNA (see Figure 33).
[0245] Finally, based on the above optimization of the operations in each process (see Figure 34), we summarized the following steps to obtain highly pure circular RNA: plasmid linearization, purification of linearized plasmid, in vitro transcription, digestion with RNase R, purification of circular RNA by affinity chromatography, etc.
[0246] Potential beneficial effects of embodiments of the present disclosure may include, but are not limited to, the following: (1) By providing a DNA molecule (e.g., a vector) for in vitro transcription to generate circular RNA and a method for preparing circular RNA by in vitro transcription through a one-step esterification reaction of the DNA molecule or vector, direct circularization can be achieved without homologous arm sequences, thereby reducing the raw materials required for in vitro circularization, reducing costs, and improving circularization efficiency. The main component produced by in vitro transcription reactions is circular RNA, which may not cause changes in the structural conformation of RNA after circularization. (2) By providing a DNA molecule (e.g., a vector) to generate circular RNA, circular RNA can be purified by affinity purification using oligo-dT affinity beads, and such a method has high purification efficiency.
[0247] It should be noted that different embodiments may provide different beneficial effects, which may be any one or combination of the above, or any other possible beneficial effect.
[0248] Having thus described the basic concepts, it will be apparent to those skilled in the art after reading the detailed disclosure herein that the foregoing detailed disclosure is intended to be presented by way of example only and is not limiting. Although not expressly stated herein, various changes, improvements, and modifications are possible and contemplated by those skilled in the art. These changes, improvements, and modifications are intended to be suggested by this disclosure and are within the spirit and scope of the exemplary embodiments of the disclosure.
[0249] Furthermore, certain terms are used to describe embodiments of the present disclosure. For example, the terms "one embodiment," "one embodiment," and / or "some embodiments" mean that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least one embodiment of the present disclosure. Thus, it is emphasized and should be understood that two or more references to "one embodiment" or "one embodiment" or "alternative embodiments" in various parts of this disclosure do not necessarily all refer to the same embodiment. Furthermore, certain features, structures, or characteristics may be suitably combined in one or more embodiments of the present disclosure.
[0250] Furthermore, the described order of processing elements or sequences, or the use of numbers, letters, or other designations, is not intended to limit the claimed processes and methods to any order, unless specified in the claims.
[0251] In some embodiments, numerical values expressing quantities, properties, and the like used to describe particular embodiments of the present application are understood to be modified in some cases by the terms "about," "approximate," or "substantially." For example, "about," "approximate," or "substantially" may indicate a variation of ±20% of the stated value, unless otherwise specified. Thus, in some embodiments, the numerical parameters set forth in the specification and appended claims are approximations that may vary depending on the desired properties to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the present application are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.
[0252] Each of the patents, patent applications, published patent applications, and other materials, such as articles, books, specifications, publications, literature, articles, etc., referenced herein is incorporated herein by this reference in its entirety for all purposes, except for any prosecution history documents related thereto, any of which are inconsistent with or contradictory to this document, or any of which may have a limiting effect on the broadest scope of any claims now or later associated with this document. By way of example, in the event of a conflict or inconsistency between the descriptions, definitions, and / or term usage associated with any of the incorporated materials and the descriptions, definitions, and / or term usage associated with this document, the descriptions, definitions, and / or term usage in this document shall control.
[0253] Finally, it should be understood that the embodiments of the present application disclosed herein are illustrative of the principles of the present embodiments. Other variations that may be utilized may be within the scope of the present application. Thus, by way of example, but not of limitation, alternative configurations of the present embodiments may be utilized in accordance with the teachings herein. Thus, the present embodiments are not limited to those precisely as shown and described.
Claims
1. A DNA molecule that produces a circular RNA, comprising, in the 5' to 3' direction: (a) an intron fragment containing a full-length intron; (b) an E2 fragment containing a downstream exon of the full-length intron; (c) an element operably linked and arranged in order with an E1 fragment containing an upstream exon of the full-length intron; the full-length intron, the downstream exon, and the upstream exon are derived from the same gene; the 3' end of the E1 fragment is configured to generate a hydroxyl group in an in vitro transcription reaction; The hydroxyl group is capable of initiating splicing in a one-step transesterification reaction at a splice site between the intron fragment and the RNA fragment transcribed from the E2 fragment in a linear RNA produced from the DNA molecule in the in vitro transcription reaction, such that the linear RNA self-circularizes to produce the circular RNA.
2. The DNA molecule of claim 1, which does not contain any intron sequences at the 3' end of the E1 fragment.
3. The DNA molecule of claim 1 , further comprising a target fragment located between the E2 fragment and the E1 fragment, the target fragment comprising a target DNA sequence encoding a target peptide.
4. 4. The DNA molecule of claim 3, wherein the target fragment is a gene of interest (GOI) fragment, the nucleotide sequence of the GOI fragment being capable of being transcribed into a target RNA sequence.
5. The DNA molecule of claim 4 , wherein the GOI fragment encodes a protein-coding or non-coding RNA sequence.
6. The DNA molecule of claim 1, further comprising an internal ribosome entry site (IRES) fragment located between the E2 fragment and the E1 fragment, wherein the IRES fragment is transcribed into an RNA molecule capable of recruiting ribosomes for a translation reaction to obtain a target peptide.
7. The IRES fragment may be any of those selected from the group consisting of taura syndrome virus, assassin bug virus, Thayer's encephalomyelitis virus, simian virus 40, fire ant (Solenopsis invicta) virus 1, wheat aphid virus, reticuloendotheliosis virus, Forman poliovirus 1, German winged stink bug enteric virus, Kashmir bee virus, human rhinovirus 2, small leafhopper virus-1, human immunodeficiency virus type 1, small leafhopper virus-1, small kite P virus, hepatitis C virus, hepatitis A virus, hepatitis B virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinovirus, white-spotted geometrie-like virus, encephalomyocarditis virus (EMCV), Drosophila melanogaster virus C, and Cruciferae tobacco (Cruciferae). tobacco virus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen brood virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.
7. The DNA molecule of claim 6, which is derived from myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog scamper, Drosophila Ubx, salivary virus, coxsackievirus, parechovirus, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian picornavirus, turnip crinkle virus, an aptamer against eIF4G, coxsackievirus B1, coxsackievirus B2, or coxsackievirus B3 (CVB3).
8. 2. The DNA molecule of claim 1, further comprising a 5' homology arm sequence and a 3' homology arm sequence located between the E2 fragment and the E1 fragment.
9. The DNA molecule of claim 3, wherein when the length of the target DNA sequence encoding the target peptide is less than 2000 nt, the DNA molecule does not contain a 5' homology arm sequence or a 3' homology arm sequence located between the E2 fragment and the E1 fragment.
10. The gene is the td gene of T4 phage or the pre-tRNA of Anabaena genus. Leu The td gene has a nucleotide sequence shown in SEQ ID NO: 18, and the pre-tRNA Leu The DNA molecule of claim 1, wherein the gene has the nucleotide sequence set forth in SEQ ID NO:
19.
11. The DNA molecule according to claim 10, wherein the E2 fragment is an exon sequence having a size of 8 to 51 bases, and the E1 fragment is an exon sequence having a size of 2 to 15 bases.
12. The E2 fragment is a pre-tRNA of the Anabaena genus. Leu the exon sequence downstream of the intron of the gene, and the E1 fragment is a pre-tRNA of the Anabaena genus. Leu The DNA molecule of claim 10, which is an exon sequence upstream of the intron fragment of a gene.
13. The DNA molecule of claim 1, wherein the nucleotide sequence of the intron fragment has at least 95% similarity to SEQ ID NO:1, the nucleotide sequence of the E2 fragment has at least 95% similarity to any one of SEQ ID NOs:2 to 5 and the sequences AAATCCG, AAAATC, AAAA, and AA, and the nucleotide sequence of the E1 fragment has at least 95% similarity to any one of SEQ ID NOs:8 to 11 and the sequences GGACTT, ACTT, TT, and CTT.
14. The DNA molecule of claim 13, wherein the nucleotide sequence of the intron fragment has the sequence set forth in SEQ ID NO:1, the nucleotide sequence of the E2 fragment has the sequence set forth in any one of SEQ ID NOs:2 to 5 and the sequences AAAATCCCG, AAAATC, AAAA, and AA, and the nucleotide sequence of the E1 fragment has the sequence set forth in any one of SEQ ID NOs:8 to 11 and the sequences GGACTT, ACTT, TT, and CTT.
15. 2. The DNA molecule of claim 1, wherein the intron fragment is preceded by a promoter element, the promoter element being one of a T7 promoter, a T3 promoter, and an SP6 promoter.
16. 2. The DNA molecule of claim 1, further comprising a polyX fragment preceding the full-length intron fragment, wherein the polyX fragment comprises at least 7 consecutive identical bases, and wherein X is one or two of A, C, G, T, and U.
17. The DNA molecule according to any one of claims 1 to 15, wherein the DNA molecule is a vector.
18. A method for preparing circular RNA based on the DNA molecule according to any one of claims 1 to 17, comprising: performing an in vitro transcription reaction to obtain linear RNA based on the DNA molecule; and self-circularizing the linear RNA to produce the circular RNA.
19. 19. The method of claim 18, wherein the DNA molecule comprises a gene of interest (GOI) fragment as described in claim 5.
20. 20. The method of claim 19, wherein the DNA molecule is produced by in vitro synthesis.
21. The production of the DNA molecule constructing a recombinant plasmid containing the sequence of said DNA molecule; and obtaining the DNA molecule by PCR amplification using the recombinant plasmid as a template and forward and reverse primers at the ends of the E1 sequence.
22. The production of the DNA molecule constructing a recombinant plasmid containing the sequence of said DNA molecule; and digesting said recombinant plasmid with a Type IIS or Type II blunt restriction endonuclease to obtain said DNA molecule.
23. 23. The method of claim 22, wherein the Type IIS restriction endonuclease comprises BspQ I, Bsa I, or BsmB I, and the Type II blunt restriction endonuclease comprises Hpa I, Swa I, or Dra I.
24. The method according to claim 18, wherein the reaction temperature of the in vitro transcription reaction is 30°C to 50°C, and the reaction time of the in vitro transcription reaction is 0.5 hours to 16 hours.
25. The in vitro transcription reaction generating the mixture in an in vitro transcription system to obtain a mixed mixture; The method of claim 24, further comprising: performing an in vitro transcription reaction of the mixed mixture at 37°C for 2 hours to obtain a reaction product.
26. 26. The method of claim 25, wherein the mixture comprises nucleotides including ATP, CTP, GTP, and UTP, the DNA molecule, a buffer, T7 RNA polymerase, and nuclease-free water.
27. 26. The method of claim 25, further comprising treating the reaction product with DNase I enzyme at 37°C for 15 minutes to remove the DNA molecules, followed by incubation at 50°C for 20 minutes.
28. The buffer solution contains Tris-HCl, MgCl 2 , DTT, spermidine, Mg 2+ 27. The method of claim 26, wherein the concentration of is at least 32 mM.
29. the DNA molecule further comprises a polyX fragment preceding the full-length intron fragment, wherein X is one or two of A, C, G, T, and U; the poly X fragment comprises at least 7 consecutive identical bases; The method further comprises obtaining purified circular RNA using oligo dX affinity beads; 19. The method of claim 18, wherein oligo dT affinity beads are used when the poly X fragment is poly A, oligo dA affinity beads are used when the poly X fragment is poly T, oligo dG affinity beads are used when the poly X fragment is poly C, oligo dC affinity beads are used when the poly X fragment is poly G, and oligo dA affinity beads are used when the poly X fragment is poly U.
30. adding DNase I enzyme to the reaction product of the in vitro transcription reaction to remove the DNA molecules; A chelating agent is added to the reaction product to obtain Mg 2+ and removing 30. The method of claim 29, further comprising adding RNase R to the reaction product to digest the linear RNA.
31. 1. A method for producing a target peptide by translation, comprising: Obtaining circular RNA according to the method of any one of claims 18 to 30; transfecting a cell with the circular RNA; and initiating a translation reaction in the transfected cell based on the circular RNA to produce a target peptide.
Citation Information
Patent Citations
Methods and compositions for circular RNA molecules
JP2021502086A
Circular RNA for translation in eukaryotic cells
JP2021526792A