Methods for modulating the expression of complement factor B - Patent Application 20070122997
Administering a CFB-specific inhibitor addresses dysregulation of the alternative complement pathway, effectively reducing CFB protein and complement components to treat kidney and eye disorders like IgA nephropathy and age-related macular degeneration.
Patent Information
- Application Number
- JP2025525267
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-02
- Filing Date
- 2023-11-02
- Publication Date
- 2025-11-14
AI Technical Summary
Dysregulation of the alternative complement pathway leads to severe damage and diseases such as kidney and eye disorders, including IgA nephropathy and age-related macular degeneration, for which existing treatments are inadequate.
Administering a complement factor B (CFB)-specific inhibitor, such as a modified oligonucleotide, to inhibit CFB expression and reduce C3 deposits in the kidney or eye, using a therapeutically effective amount and dosing regimen.
Reduces CFB protein and complement component levels, ameliorating diseases associated with alternative complement pathway dysregulation by decreasing inflammation and tissue damage in the kidney and eye.
Smart Images

Figure 2025537139000001_ABST
Abstract
Description
Related Applications
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 382,057, filed November 2, 2022, which is incorporated herein by reference in its entirety.
[0002] Electronic Sequence Listing Reference This application contains an electronic sequence listing that has been submitted electronically and is incorporated herein by reference in its entirety. The sequence listing was created on September 29, 2023, is titled "BIOL0467USLSEQ.xml", and is 45,762 bytes in size. [Technical Field]
[0003] Provided herein are methods for ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway by administering a complement factor B (CFB)-specific inhibitor to a subject. [Background technology]
[0004] The complement system is part of the host's innate immune system and is involved in the lysis of foreign cells, enhancing the phagocytosis of antigens, agglutinating antigen-carrying agents, and attracting macrophages and neutrophils. The complement system is divided into three initiation pathways (classical, lectin, and alternative). These pathways converge on component C3 to generate an enzyme complex known as C3 convertase, which cleaves C3 into C3a and C3b. C3b binds to C3 convertase mediated by CFB, leading to the generation of C5 convertase, which cleaves C5 into C5a and C5b. This initiates the membrane attack pathway, resulting in the formation of the membrane attack complex (MAC), which contains components C5b, C6, C7, C8, and C9. The MAC forms a transmembrane channel, disrupting the phospholipid bilayer of the target cell and causing cell lysis.
[0005] Under homeostatic conditions, activation of the alternative pathway through spontaneous hydrolysis of C3 and generation of C3b leads to the production of C5 convertase, which continuously activates the alternative pathway at a "tickover" level. Dysregulation of the alternative complement pathway is associated with diseases and disorders, including those of the kidney and eye. [Brief explanation of the drawings]
[0006] [Figures 1A-1C] Figures 1A, 1B, and 1C show plasma CFB protein levels in healthy subjects after single or repeated subcutaneous injections of compound 696844 or placebo. The sample collection dates are indicated by the visit date on the x-axis, and the compound 696844 administration dates are indicated by arrows. Figure 1A shows the mean (+ / - SEM) percent change from baseline in plasma CFB levels (mcg / mL) after a single administration of placebo or 10, 20, or 40 mg of compound 696844 (N=6 / group). Figure 1B shows the mean CFB protein levels (mcg / mL) after repeated administration (8 doses within 6 weeks) of placebo or 10 or 20 mg of compound 696844 (N=6, 12, or 12 per group). LLNR, lower limit of normal range = 146 mcg / mL. Figure 1C shows the mean (+ / - SEM) percent change from baseline in plasma CFB levels (mcg / mL) after repeated dosing. Baseline (BL) is defined as the average of measurements on days -1 and 1 (pre-dose), including unscheduled measurements between days -1 and 1 (pre-dose). [Figures 2A-2C]Figures 2A, 2B, and 2C show the systemic levels of various components of the complement cascade (CFB protein levels, CH50 activity, AH50 activity, and factor B breakdown product (Bb)) in subjects receiving subcutaneous injections of either placebo or compound 696844. The date of sample collection is indicated by the visit date on the x-axis, and the date of administration by subcutaneous injection is indicated by the arrow. Figure 2A (placebo) and Figure 2B (20 mg of compound 696844) show the mean (+ / - SEM) percent change from baseline in plasma CFB protein (mcg / mL), plasma Bb (a breakdown product of CFB) (mcg / mL), serum AH50 (a biomarker of alternative complement pathway activity) (U / mL), and serum CH50 (a biomarker of classical complement pathway activity) (U / mL) levels, shown on the y-axis; baseline (BL) is defined as in Figures 1A and 1B. Figure 2C is a scatter plot of serum AH50 hemolytic activity (UmL) (x-axis) and CFB protein levels (mcg / ml) (y-axis) in subjects receiving placebo or compound 696844 before administration (group 1, pentagons) or after administration of compound 696844 (group 2, diamonds). [Figure 3A-3B] Figures 3A and 3B show the urinary protein / creatinine ratios in 24-hour urine samples from individual subjects before administration of compound 696844 (baseline) and at week 29. Figure 3A shows each subject's urinary protein / creatinine ratio, and Figure 3B shows each subject's percent change in urinary protein / creatinine ratio from baseline to week 29. [Figure 4A-4B] Figures 4A and 4B show urinary protein excretion rates (mcg / day) in 24-hour urine samples for individual subjects prior to administration of compound 696844 (baseline) and at week 29. Figure 4A shows the urinary protein excretion rate for each subject, and Figure 4B shows the percent change in urinary protein excretion rate for each subject from baseline to week 29. [Figure 5]Figure 5 shows the estimated glomerular filtration rate (eGFR) for each subject based on serum creatinine concentration (eGFR) from baseline to week 37 of compound 696844 administration. Values were adjusted using the CKD-EPI 2009 mL / min / 1.72 m2. Sample collection dates are indicated by week on the x-axis. Baseline (BL) is defined as in Figures 1A and 1B. [Figure 6] Figure 6 shows plasma CFB concentrations (mg / dL) in subjects from before administration of compound 696844 (baseline) to week 37. Sample collection dates are indicated by week on the x-axis, and the number of subjects who provided samples is indicated. The upper limit of normal (ULN) and lower limit of normal (LLN) are shown on the graph. Baseline is defined as the average of the last two measurements obtained before the first dose of study drug. [Figure 7] Figure 7 shows the concentration (micrograms / L) of urinary Ba (a breakdown product of factor B) in subjects from before administration of compound 696844 (baseline) through week 37. The date of sample collection is indicated by the week on the x-axis, and the number of subjects who provided samples is indicated. The upper limit of normal (ULN) and lower limit of normal (LLN) are shown on the graph. Baseline (BL) is defined as the average of the last two measurements obtained before the first administration of compound 696844. [Figure 8] Figure 8 shows the mean (+ / - v SEM) percent change in plasma CFB, plasma Bb, urinary Ba, serum AH50 activity, and serum CH50 activity from baseline to the mean at weeks 21, 25, and 27. Baseline (BL) is defined as in Figures 1A-1B. Summary of the Invention
[0007] The complement system mediates innate immunity and plays a key role in normal inflammatory responses to injury, but its dysregulation can cause severe damage. Dysregulation, such as overactivation of the classical, leptin, or alternative complement pathways, can lead to disease or disorders. Activation of the alternative complement pathway beyond its constitutive "tickover" level can result in uncontrolled hyperactivity, which can manifest as a disease or disorder of complement dysregulation.
[0008] Provided herein are methods for ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a subject by administering a complement factor B (CFB)-specific inhibitor. In some embodiments, provided herein are methods for ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a subject by administering a complement factor B (CFB)-specific inhibitor. Some embodiments provided herein relate to methods for inhibiting CFB expression in a subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway by administering a CFB-specific inhibitor to the subject. Certain embodiments provided herein relate to methods for reducing or inhibiting the accumulation of C3 deposits in the kidney or eye of a subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, the method comprising administering a CFB-specific inhibitor to the subject. In certain embodiments, the disease or disorder associated with dysregulation of the alternative complement pathway is a kidney disease or disorder. In certain embodiments, the kidney disease or disorder is nephropathy, and in certain embodiments, the nephropathy is IgA nephropathy (Berger's disease). In certain embodiments, the disease or disorder associated with dysregulation of the alternative complement pathway is an eye disease or disorder. In certain embodiments, the eye disease or disorder is age-related macular degeneration, and in certain embodiments, the eye disease or disorder is age-related macular degeneration-associated geographic atrophy.In certain embodiments, the CFB-specific inhibitor is an antisense compound.In certain embodiments, the CFB-specific inhibitor is a modified oligonucleotide.In certain embodiments, the CFB-specific inhibitor is a GalNAc-linked modified oligonucleotide.
[0009] In certain embodiments, the method comprises administering a therapeutically effective amount of compound 696844. In certain embodiments, the therapeutically effective amount is in the range of about 10 mg to about 100 mg. In certain embodiments, the therapeutically effective amount is in the range of about 40 mg to about 100 mg. In certain embodiments, the therapeutically effective amount is in the range of about 40 mg to about 70 mg. In certain embodiments, the therapeutically effective amount is in the range of about 70 mg to about 100 mg. In certain embodiments, the therapeutically effective amount is about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg. In certain embodiments, the therapeutically effective amount is administered once about every 4 weeks. In certain embodiments, the therapeutically effective amount is administered once about every 8 weeks. In certain embodiments, the therapeutically effective amount is administered once about every 12 weeks. In certain embodiments, the therapeutically effective amount is administered once about every 16 weeks. In certain embodiments, the therapeutically effective amount is administered once about every 24 weeks. In certain embodiments, the therapeutically effective amount is administered once about every 6 months. In certain embodiments, the therapeutically effective amount is administered monthly. In certain embodiments, the therapeutically effective amount is administered once every two months. In certain embodiments, the therapeutically effective amount is administered once every three months. In certain embodiments, the therapeutically effective amount is administered quarterly. In certain embodiments, the therapeutically effective amount is administered twice a year (semi-annually). In certain embodiments, the therapeutically effective amount is administered annually.
[0010] In certain embodiments, the methods comprise administering a loading dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 once about every two weeks, followed by a maintenance dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 once about every four weeks, once about every eight weeks, once about every 12 weeks, or once about every 24 weeks. In certain embodiments, the methods comprise administering a loading dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 about once every four weeks, followed by a maintenance dose of about 10 mg, about 20 mg, about 40 mg, about 70 mg, or about 100 mg of compound 696844 about once every four weeks, about once every eight weeks, about once every 12 weeks, or about once every 24 weeks. In some embodiments, the methods comprise administering at least two loading doses, at least three loading doses, at least four loading doses, at least five loading doses, or at least six loading doses.
[0011] In certain embodiments, the method comprises administering a loading dose of about 40 to about 100 mg of compound 696844 about once every two weeks, followed by a maintenance dose of about 40 to about 100 mg of compound 696844 about once every four weeks, about once every eight weeks, about once every 12 weeks, or about once every 24 weeks. In certain embodiments, the method comprises administering a loading dose of about 40 to about 100 mg of compound 696844 about once every four weeks, followed by a maintenance dose of about 40 to about 100 mg of compound 696844 about once every four weeks, about once every eight weeks, about once every 12 weeks, or about once every 24 weeks. In some embodiments, the method comprises administering at least two loading doses, at least three loading doses, at least four loading doses, at least five loading doses, or at least six loading doses.
[0012] In certain embodiments, the methods comprise administering a loading dose of about 40 to about 70 mg of compound 696844 about once every two weeks, followed by a maintenance dose of about 40 to about 70 mg of compound 696844 about once every four weeks, about once every eight weeks, about once every 12 weeks, or about once every 24 weeks. In certain embodiments, the methods comprise administering a loading dose of about 40 to about 70 mg of compound 696844 about once every four weeks, followed by a maintenance dose of about 40 to about 70 mg of compound 696844 about once every four weeks, about once every eight weeks, about once every 12 weeks, or about once every 24 weeks. In some embodiments, the methods comprise administering at least two loading doses, at least three loading doses, at least four loading doses, at least five loading doses, or at least six loading doses. DETAILED DESCRIPTION OF THE INVENTION
[0013] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless otherwise stated. As used herein, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components comprising multiple subunits unless otherwise specified.
[0014] Any section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, papers, books, and articles, are expressly incorporated herein by reference in their entirety and in the portions of the documents discussed herein.
[0015] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.
[0016] Unless otherwise indicated, the following terms have the following meanings:
[0017] As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside or a nucleoside containing an unmodified 2'-deoxyribosyl sugar moiety may contain a modified nucleobase or may contain an RNA nucleobase (uracil).
[0018] As used herein, "2'-MOE" refers to a 2'-OCH2CHOCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CHOCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.
[0019] As used herein, "2'-MOE nucleoside" or "2'-OCH2CH2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 ribosyl sugar moiety).
[0020] As used herein, "5-methylcytosine" means cytosine having a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.
[0021] As used herein, "about" means ±7% of the value provided.
[0022] As used herein, "administer" or "administration" means providing a pharmaceutical agent, pharmaceutical composition, or compound to a human subject.
[0023] As used herein, "ameliorating" in relation to treatment means an improvement in at least one symptom or characteristic relative to the same symptom or characteristic in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of a symptom or characteristic, or a delay in the onset or progression of the severity or frequency of a symptom or characteristic. The progression or severity of a symptom or characteristic can be determined by subjective or objective measures known to those skilled in the art.
[0024] " Antisense compound " refers to the compound that can be hybridized with target nucleic acid through hydrogen bond.Examples of antisense compound include single-stranded and double-stranded compounds, such as antisense oligonucleotide, siRNA, shRNA, ssRNA and occupancy-based compounds.Antisense compound can include modified oligonucleotide.Antisense compound can include modified oligonucleotide and binding group.
[0025] As used herein, "CFB nucleic acid" or "factor B nucleic acid" or "complement factor B nucleic acid" refers to any nucleic acid encoding complement factor B. For example, in certain embodiments, complement factor B nucleic acids include DNA sequences encoding complement factor B, RNA sequences transcribed from DNA encoding complement factor B (including genomic DNA containing introns and exons), and mRNA sequences encoding complement factor B. "Complement factor B mRNA" refers to mRNA encoding complement factor B protein.
[0026] As used herein, "complement factor B," "CFB," "factor B," "FB," "complement factor B protein," "CFB protein," or "factor B protein" refers to the polypeptide expression product of a CFB nucleic acid.
[0027] As used herein, "complement component" refers to a product, by-product, end product, final product, or activation product of a complement pathway. In certain embodiments, a complement component is a by-product. In certain embodiments, a complement component is an end product or final product. In certain embodiments, a complement component is a by-product, end product, final product, or activation product of the alternative complement pathway. In certain embodiments, a complement component is any of C3, C3a, C3b, C4b, C3dg, C5, C5a, C5b, C6, C7, C8, and C9.
[0028] "CFB-specific inhibitor" refers to any agent that can specifically inhibit the expression or activity of CFB RNA and / or CFB protein at the molecular level. For example, CFB-specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents that can inhibit the expression of CFB RNA and / or CFB protein. In certain embodiments, the CFB-specific inhibitor is compound 696844. CFB inhibitor activity, reduction of CFB RNA, or reduction of CFB protein can be assessed by the methods described in WO 2015 / 168635.
[0029] As used herein, "dose" refers to the amount of a pharmaceutical agent administered. In certain embodiments, the pharmaceutical agent is compound 696844, and in certain embodiments, the pharmaceutical agent is a compound having the chemical structure of compound 696844 or a pharmaceutically acceptable salt thereof.
[0030] As used herein, the term "internucleoside linkage" refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.
[0031] As used herein, "loading dose" refers to a therapeutically effective amount of a drug administered during an initial dosing phase in which a target concentration of the drug is achieved. "First loading dose" refers to the first loading dose administered. "Last loading dose" refers to the loading dose administered immediately prior to administration of the first maintenance dose.
[0032] As used herein, "maintenance dose" means a therapeutically effective amount of a drug administered during a dosing phase after a target concentration of the drug has been achieved and maintained.
[0033] As used herein, "FB-L" Rx " and "compound 696844" are interchangeable.
[0034] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
[0035] As used herein, "nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. "Linked nucleosides" are nucleosides linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).
[0036] As used herein, "oligonucleotide" means a polymer of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides.
[0037] As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.
[0038] As used herein, "pharmaceutically acceptable carrier or diluent" refers to any substance suitable for use in administering to animals. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0039] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects.
[0040] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution.
[0041] As used herein, "potassium salt" means a salt of a modified oligonucleotide or compound, wherein the cation of the salt is potassium.
[0042] As used herein, "reducing or inhibiting the amount or activity" refers to a decrease or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate complete elimination of transcriptional expression or activity.
[0043] As used herein, "RNA" means RNA transcripts, and unless otherwise specified, includes pre-mRNA and mature mRNA.
[0044] As used herein, "sodium salt" means a salt of a modified oligonucleotide or compound, wherein the cation of the salt is sodium.
[0045] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human subject. A "subject in need of benefit from administration of a compound" is a subject that would benefit from administration of a compound disclosed herein.
[0046] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" refers to a 2'-OH(H)β-D ribosyl moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D deoxyribosyl moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. "Modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.
[0047] As used herein, "symptom or feature" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or a medical professional examining or testing the subject. In certain embodiments, the feature is evident in an invasive diagnostic test, including but not limited to a postmortem examination. In certain embodiments, the feature is noticeable on a brain MRI scan.
[0048] As used herein, "CFB RNA" is equivalent to the RNA expression product of human Factor B, and "CFB RNA" may refer to pre-mRNA or mRNA.
[0049] As used herein, a "therapeutically effective amount" refers to an amount of an agent that provides a therapeutic benefit to a human subject, e.g., ameliorates a symptom or characteristic of a disease or disorder.
[0050] "Trough concentration" means the concentration of an analyte, e.g., a CFB protein, in a biological sample taken from a dosed human subject immediately before the subject receives a subsequent dose, or the concentration of the analyte on the last test day.
[0051] As used herein, a "week" means seven days.
[0052] Specific Embodiments Embodiment 1. A method of ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
[0053] Embodiment 2. The method of embodiment 1, wherein the compound is a sodium or potassium salt.
[0054] Embodiment 3. A method of ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: [ka] (SEQ ID NO: 4) to said human subject.
[0055] Embodiment 4. A method of ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a human subject in need thereof, comprising administering to said human subject a therapeutically effective amount of a compound, wherein the compound has the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds Tds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0056] Embodiment 5. A method of reducing expression of complement factor B (CFB) RNA in a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering to a human subject a therapeutically effective amount of the following chemical structure: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
[0057] Embodiment 6 The method of embodiment 5, wherein the compound is a sodium or potassium salt.
[0058] Embodiment 7. A method of reducing expression of complement factor B (CFB) RNA in a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of the following chemical structure: [ka] (SEQ ID NO: 4) to said human subject.
[0059] Embodiment 8. A method of reducing complement factor B (CFB) RNA in a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0060] Embodiment 9. The method of any one of embodiments 6 to 8, wherein CFB mRNA is reduced.
[0061] Embodiment 10. The method of any one of embodiments 6 to 8, wherein CFB protein is reduced.
[0062] Embodiment 11 The method of any one of embodiments 6-10, wherein administering the compound reduces CFB protein in one or both eyes.
[0063] Embodiment 12 The method of any one of embodiments 6-11, wherein administering the compound reduces CFB protein in one or both kidneys.
[0064] Embodiment 13 The method of embodiment 12, wherein administering the compound reduces CFB protein in the glomerulus.
[0065] Embodiment 14. A method of reducing levels of complement components in the eye or kidney of a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of one of the following chemical structures: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
[0066] Embodiment 15. The method of embodiment 14, wherein the compound is a sodium or potassium salt.
[0067] Embodiment 16. A method of reducing the level of a complement component in the eye or kidney of a human subject having or at risk of having a disease associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of one of the following chemical structures: [ka] (SEQ ID NO: 4) to said human subject.
[0068] Embodiment 17. A method of reducing the level of a complement component in the eye or kidney of a human subject having, or at risk of having, a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0069] Embodiment 18. The method of any one of embodiments 14 to 17, wherein the complement component is any of C3, C3a, C3b, C4b, C3dg, C5, C5a, C5b, C6, C7, C8 and C9.
[0070] Embodiment 19. A method of reducing Complement Factor B (CFB) protein in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
[0071] Embodiment 20 The method of embodiment 19, wherein the compound is a sodium or potassium salt.
[0072] Embodiment 21. A method of reducing Complement Factor B (CFB) protein in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: [ka] (SEQ ID NO: 4) to said human subject.
[0073] Embodiment 22. A method of reducing Complement Factor B (CFB) protein in a human subject in need thereof, comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es T es m C es m Ces m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0074] Embodiment 23 The method of any one of embodiments 19-22, wherein the human subject has a disease or disorder associated with dysregulation of the alternative complement pathway.
[0075] Embodiment 24. The method of any one of embodiments 1 to 23, wherein the activity of the complement pathway is increased.
[0076] Embodiment 25. The method of any one of embodiments 1 to 24, wherein the activity of an alternative complement activity is increased.
[0077] Embodiment 26 The method of embodiment 24 or embodiment 25, wherein the increased activity is associated with a disease or disorder in the human subject.
[0078] Embodiment 27 The method of any one of embodiments 1 to 26, wherein reducing the CFB protein ameliorates the disease or disorder.
[0079] Embodiment 28. The method of any one of embodiments 1-18 or 23-27, wherein the disease or disorder is an ocular disease or disorder.
[0080] Embodiment 29. The method of any one of embodiments 1-18 or 23-28, wherein the disease or disorder is macular degeneration, neuromyelitis optica, corneal disease, corneal inflammation, autoimmune uveitis, or diabetic retinopathy.
[0081] Embodiment 30. The method of embodiment 29, wherein the macular degeneration is age-related macular degeneration (AMD).
[0082] Embodiment 31. The method of embodiment 30, wherein the AMD is wet AMD or intermediate AMD.
[0083] Embodiment 32 The method of embodiment 30, wherein the AMD is dry AMD.
[0084] Embodiment 33 The method of any one of embodiments 1-18 or 23-32, wherein the disease or disorder is geographic atrophy associated with AMD.
[0085] Embodiment 34. The method of any one of embodiments 1-18 or 23-27, wherein the disease or disorder is a kidney disease or disorder.
[0086] Embodiment 35. The method of embodiment 34, wherein the kidney disease or disorder is IgA nephropathy.
[0087] Embodiment 36. The method of embodiment 34, wherein the disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposition disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS).
[0088] Embodiment 37 The method of embodiment 36, wherein the aHUS is characterized by a thrombotic microangiopathy.
[0089] Embodiment 38. The method of any one of embodiments 34 to 36, wherein the disease disorder is a kidney disease or a disorder associated with C3 deposits.
[0090] Embodiment 39. The method of embodiment 38, wherein the kidney disease or disorder is associated with C3 deposits in the glomeruli.
[0091] Embodiment 40. The method of any one of embodiments 34-39, wherein the disease or disorder is a kidney disease or disorder associated with lower than normal circulating C3 levels.
[0092] Embodiment 41. The method of embodiment 40, wherein the circulating C3 level is a serum or plasma C3 level.
[0093] Embodiment 42 The method of any one of embodiments 1 to 41, wherein administering the compound reduces the accumulation of C3 levels in the eye.
[0094] Embodiment 43 The method of embodiment 42, wherein the accumulation is within the vasculature.
[0095] Embodiment 44 The method of any one of embodiments 1 to 41, wherein administering the compound reduces C3 accumulation in the kidney.
[0096] Embodiment 45 The method of any one of embodiments 1-41 or 44, wherein administering the compound reduces the level of C3 in the kidney or reduces the accumulation of C3 deposits in the kidney.
[0097] Embodiment 46 The method of any one of embodiments 41, 44, or 45, wherein administering the compound reduces the level of C3 in the glomerulus or reduces the accumulation of C3.
[0098] Embodiment 47. The method of any one of embodiments 1-18 or 23-27, wherein the disease or disorder is ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, pre-eclampsia, or a metabolic disorder (such as NASH).
[0099] Embodiment 48 The method of any one of embodiments 1 to 47, wherein the subject is identified as having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway.
[0100] Embodiment 49. The method of embodiment 48, wherein identifying comprises detecting complement levels or membrane attack complex levels in the subject's blood.
[0101] Embodiment 50. The method of embodiment 49, wherein identifying comprises detecting complement levels or membrane attack complex levels in the subject's serum or plasma.
[0102] Embodiment 51. The method of embodiment 49, wherein identifying comprises performing genetic testing for a genetic mutation in a complement factor associated with the disease or disorder.
[0103] Embodiment 52 The method of any one of embodiments 1-18 or 23-51, wherein at least one symptom or feature of a disease or disorder associated with dysregulation of the alternative complement pathway is ameliorated.
[0104] Embodiment 53. The method of embodiment 52, wherein the symptom or feature is proteinuria; progressive decline in renal function; C3 deposits in the kidney; hematuria; hypertension; renal inflammation; IgA deposits in the glomerular mesangium; a highly active alternative complement pathway; elevated plasma CFB protein; elevated serum, plasma, or urinary Bb; elevated serum, plasma, or urinary Ba; elevated serum, plasma, or urinary sC5b-9; elevated or decreased serum, plasma, or urinary C3; elevated serum, plasma, or urinary C4; or elevated serum AH50 activity.
[0105] Embodiment 54. The method of embodiment 52, wherein the symptom or feature is progressive decrease in visual acuity; progressive decrease in low-light visual acuity; progressive decrease in best-corrected visual acuity; progressive decrease in central visual acuity; morphological changes in the choriocapillaris; ocular geographic atrophy; ocular C3 deposits; hyperactive alternative complement pathway; elevated plasma CFB protein; elevated serum, plasma, or urinary Bb; elevated serum, plasma, or urinary Ba; elevated serum, plasma, or urinary sC5b-9; elevated or decreased serum, plasma, or urinary C3; elevated serum, plasma, or urinary C4; or elevated serum AH50 activity.
[0106] Embodiment 55. The method of any one of embodiments 1-54, wherein administering the compound delays or prevents visual acuity decline, delays or prevents low-light visual acuity decline; delays or prevents decline in best-corrected visual acuity; delays or prevents decline in central visual acuity; delays or prevents morphological changes in the choriocapillaris; delays or prevents ocular geographic atrophy; reduces ocular C3 deposits; reduces alternative complement pathway activity; reduces plasma CFB protein; reduces serum, plasma, or urinary Bb; reduces serum, plasma, or urinary Ba; reduces serum, plasma, or urinary sC5b-9; modulates, increases, or decreases serum, plasma, or urinary C3; reduces serum, plasma, or urinary C4; or reduces serum AH50 activity.
[0107] Embodiment 56. The method of any one of embodiments 1-53, wherein administering the compound reduces proteinuria; delays or prevents decline in renal function; reduces renal C3 deposits; reduces hematuria; reduces hypertension; reduces renal inflammation; reduces glomerular mesangial IgA deposits; reduces alternative complement pathway activity; reduces plasma CFB protein; reduces serum, plasma, or urinary Bb; reduces serum, plasma, or urinary Ba; reduces serum, plasma, or urinary sC5b-9; modulates, increases, or decreases serum, plasma, or urinary C3; reduces serum, plasma, or urinary C4; or reduces serum AH50 activity.
[0108] Embodiment 57. The method of any one of embodiments 1-56, wherein the urinary protein / creatine ratio is reduced following administration of the compound.
[0109] Embodiment 58 The method of any one of embodiments 1 to 57, wherein the level of urinary protein is reduced following administration of the compound.
[0110] Embodiment 59 The method of any one of embodiments 28-33, wherein administering the compound delays or prevents the progression or onset of geographic atrophy in the subject.
[0111] Embodiment 60 The method of any one of embodiments 28-33, wherein administering the compound slows the expansion of the area of geographic atrophy in the subject.
[0112] Embodiment 61 The method of embodiment 60, wherein administering the compound slows the spread of geographic atrophy to the foveal region.
[0113] Embodiment 62 The method of any one of embodiments 28-33, wherein administering the compound halts the expansion of geographic atrophy.
[0114] Embodiment 63. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is 10 mg.
[0115] Embodiment 64. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is 20 mg.
[0116] Embodiment 65. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is 40 mg.
[0117] Embodiment 66. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is 70 mg.
[0118] Embodiment 67. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is 100 mg.
[0119] Embodiment 68. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is about 10 mg.
[0120] Embodiment 69. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is about 20 mg.
[0121] Embodiment 70. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is about 40 mg.
[0122] Embodiment 71. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is about 70 mg.
[0123] Embodiment 72. The method of any one of embodiments 1 to 62, wherein the therapeutically effective amount is about 100 mg.
[0124] Embodiment 73. The therapeutically effective amount is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 400 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 430 mg, 440 mg, 445 mg, 450 63. The method of any one of embodiments 1-62, wherein the dose is any of 95 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, and 350 mg.
[0125] Embodiment 74. A therapeutically effective amount is about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg 63. The method of any one of embodiments 1-62, wherein the amount of the hydroxybenzoate is any of about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, about 300 mg, about 305 mg, about 310 mg, about 315 mg, about 320 mg, about 325 mg, about 330 mg, about 335 mg, about 340 mg, about 345 mg, and about 350 mg.
[0126] Embodiment 75. The therapeutically effective amount is 10 mg, 10.1 mg, 10.2 mg, 10.3 mg, 10.4 mg, 10.5 mg, 10.6 mg, 10.7 mg, 10.8 mg, 10.9 mg, 11 mg, 11.1 mg, 11.2 mg, 11.3 mg, 11.4 mg, 11.5 mg, 11.6 mg, 11.7 mg, 11.8 mg, 11.9 mg, 12 mg, 12.1 mg, 12.2 mg, 12.3 mg, 12.4 mg, 12.5 mg, 12.6 mg, 12.7 mg, 12.8 mg, 12.9 mg, 13 mg, 13.1 mg, 13.2 mg, 13.3 mg, 13.4 mg, 13.5 mg, 13.6 mg, 13.7 mg, 13.8 mg, 13.9 mg, 14.0 mg, 14.1 mg, 14.2 mg, 14.3 mg, 14.4 mg, 14.5 mg, 14.6 mg, 14.7 mg, 14.8 mg, 14.9 mg, 15.0 mg, 15.1 mg, 15.2 mg, 15.3 mg, 15.4 mg, 15.5 mg, 15.6 mg, 15.7 mg, 15.8 mg, 15.9 mg, 16.0 mg, 16.1 mg, 16.2 mg, 16.3 mg, 16.4 mg, 16.5 mg, 16.6 mg, 16.7 mg, 16.8 mg, 16.9 mg, 17.0 mg, 17.1 mg, 17. mg, 13.5mg, 13.6mg, 13.7mg, 13.8mg, 13.9mg, 14mg, 14.1mg, 14.2mg, 14.3mg, 14.4mg, 14.5mg, 14.6mg, 14.7mg, 14.8mg, 14.9mg, 15mg, 15.1mg, 15.2mg , 15.3mg, 15.4mg, 15.5mg, 15.6mg, 15.7mg, 15.8mg, 15.9mg, 16mg, 16.1mg, 16.2mg, 16.3mg, 16.4mg, 16.5mg, 16.6mg, 16.7mg, 16.8mg, 16.9mg, 17mg, 17 .1mg, 17.2mg, 17.3mg, 17.4mg, 17.5mg, 17.6mg, 17.7mg, 17.8mg, 17.9mg, 18mg, 18.1mg, 18.2mg, 18.3mg, 18.4mg, 18.5mg, 18.6mg, 18.7mg, 18.8mg, 18 .9mg, 19mg, 19.1mg, 19.2mg, 19.3mg, 19.4mg, 19.5mg, 19.6mg, 19.7mg, 19.8mg, 19.9mg, 20mg, 20.1mg, 20.2mg, 20.3mg, 20.4mg, 20.5mg, 20.6mg, 20.7m g, 20.8mg, 20.9mg, 21mg, 21.1mg, 21.2mg, 21.3mg, 21.4mg, 21.5mg, 21.6mg, 21.7mg, 21.8mg, 21.9mg, 22mg, 22.1mg, 22.2mg, 22.3mg, 22.4mg, 22.5mg, 22.6mg, 22.7mg, 22.8mg, 22.9mg, 23mg, 23.1mg, 23.2mg, 23.3mg, 23.4mg, 23.5mg, 23.6mg, 23.7mg, 23.8mg, 23.9mg, 24mg, 24.1mg, 24.2mg, 24.3mg, 24.4mg、24.5mg、24.6mg、24.7mg、24.8mg、24.9mg、25mg、25.1mg、25.2mg、25.3mg、25.4mg、25.5mg、25.6mg、25.7mg、25.8mg、25.9mg、26mg、26.1mg、26.2mg、26.3mg、26.4mg、26.5mg、26.6mg、26.7mg、26.8mg、26.9mg、27mg、27.1mg、27.2mg、27.3mg、27.4mg、27.5mg、27.6mg、27.7mg、27.8mg、27.9mg、28mg、28.1mg、28.2mg、28.3mg、28.4mg、28.5mg、28.6mg、28.7mg、28.8mg、28.9mg、29mg、29.1mg、29.2mg、29.3mg、29.4mg、29.5mg、29.6mg、29.7mg、29.8mg、29.9mg、30mg、30.1mg、30.2mg、30.3mg、30.4mg、30.5mg、30.6mg、30.7mg、30.8mg、30.9mg、31mg、31.1mg、31.2mg、31.3mg、31.4mg、31.5mg、31.6mg、31.7mg、31.8mg、31.9mg、32mg、32.1mg、32.2mg、32.3mg、32.4mg、32.5mg、32.6mg、32.7mg、32.8mg、32.9mg、33mg、33.1mg、33.2mg、33.3mg、33.4mg、33.5mg、33.6mg、33.7mg、33.8mg、33.9mg、34mg、34.1mg、34.2mg、34.3mg、34.4mg、34.5mg、34.6mg、34.7mg、34.8mg、34.9mg、35mg、35.1mg、35.2mg、35.3mg、35.4mg、35.5mg、35.6mg、35.7mg、35.8mg、35.9mg、36mg、36.1mg、36.2mg、36.3mg、36.4mg、36.5mg、36.6mg、36.7mg、36.8mg、36.9mg、37mg、37.1mg、37.2mg、37.3mg、37.4mg、37.5mg、37.6mg、37.7mg、37.8mg、37.9mg、38mg、38.1mg、38.2mg、38.3mg、38.4mg、38.5mg、38.6mg、38.7mg、38.8mg、38.9mg、39mg、39.1mg、39.2mg、39.3mg、39.4mg、39.5mg、39.6mg、39.7mg、39.8mg、39.9mg、40mg、40.1mg、40.2mg、40.3mg、40.4mg、40.5mg、40.6mg、40.7mg、40.8mg、40.9mg、41mg、41.1mg、41.2mg、41.3mg、41.4mg、41.5mg、41.6mg、41.7mg、41.8mg、41.9mg、42mg、42.1mg、42.2mg、42.3mg、42.4mg、42.5mg、42.6mg、42.7mg、42.8mg、42.9mg、43mg、43.1mg、43.2mg、43.3mg、43.4mg、43.5mg、43.6mg、43.7mg、43.8mg、43.9mg、44mg、44.1mg、44.2mg、44.3mg、44.4mg、44.5mg、44.6mg、44.7mg、44.8mg、44.9mg、45mg、45.1mg、45.2mg、45.3mg、45.4mg、45.5mg、45.6mg、45.7mg、45.8mg、45.9mg、46mg、46.1mg、46.2mg、46.3mg、46.4mg、46.5mg、46.6mg、46.7mg、46.8mg、46.9mg、47mg、47.1mg、47.2mg、47.3mg、47.4mg、47.5mg、47.6mg、47.7mg、47.8mg、47.9mg、48mg、48.1mg、48.2mg、48.3mg、48.4mg、48.5mg、48.6mg、48.7mg、48.8mg、48.9mg、49mg、49.1mg、49.2mg、49.3mg、49.4mg、49.5mg、49.6mg、49.7mg、49.8mg、49.9mg、50mg、50.1mg、50.2mg、50.3mg、50.4mg、50.5mg、50.6mg、50.7mg、50.8mg、50.9mg、51mg、51.1mg、51.2mg、51.3mg、51.4mg、51.5mg、51.6mg、51.7mg、51.8mg、51.9mg、52mg、52.1mg、52.2mg、52.3mg、52.4mg、52.5mg、52.6mg、52.7mg、52.8mg、52.9mg、53mg、53.1mg、53.2mg、53.3mg、53.4mg、53.5mg、53.6mg、53.7mg、53.8mg、53.9mg、54mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68mg、68.1mg、68.2mg、68.3mg、68.4mg、68.The method of any one of embodiments 1 to 62, wherein the dose is any one of 5 mg, 68.6 mg, 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, and 69.9 mg.
[0127] Embodiment 76. The therapeutically effective amount is about 10 mg, about 10.1 mg, about 10.2 mg, about 10.3 mg, about 10.4 mg, about 10.5 mg, about 10.6 mg, about 10.7 mg, about 10.8 mg, about 10.9 mg, about 11 mg, about 11.1 mg, about 11.2 mg, about 11.3 mg, about 11.4 mg, about 11.5 mg, about 11.6 mg, about 11.7 mg, about 11.8 mg, about 11.9 mg, about 12 mg, about 12.1 mg, about 12.2 mg, about 12.3 mg, about 12.4 mg, about 12.5 mg, about 12.6 mg, about 12.7 mg, about 12.8 mg, about 12.9 mg, or about 1 3mg, about 13.1mg, about 13.2mg, about 13.3mg, about 13.4mg, about 13.5mg, about 13.6mg, about 13.7mg, about 13.8mg, about 13.9mg, about 14mg, about 14.1mg, about 14.2mg, about 14.3mg, about 14.4mg, about 14.5mg, about 14 .6mg, about 14.7mg, about 14.8mg, about 14.9mg, about 15mg, about 15.1mg, about 15.2mg, about 15.3mg, about 15.4mg, about 15.5mg, about 15.6mg, about 15.7mg, about 15.8mg, about 15.9mg, about 16mg, about 16.1mg, about 16. 2mg, about 16.3mg, about 16.4mg, about 16.5mg, about 16.6mg, about 16.7mg, about 16.8mg, about 16.9mg, about 17mg, about 17.1mg, about 17.2mg, about 17.3mg, about 17.4mg, about 17.5mg, about 17.6mg, about 17.7mg, about 17 .8mg, about 17.9mg, about 18mg, about 18.1mg, about 18.2mg, about 18.3mg, about 18.4mg, about 18.5mg, about 18.6mg, about 18.7mg, about 18.8mg, about 18.9mg, about 19mg, about 19.1mg, about 19.2mg, about 19.3mg, about 19. 4mg, approx. 19.5mg, approx. 19.6mg, approx. 19.7mg, approx. 19.8mg, approx. 19.9mg, approx. 20mg, approx. 20.1mg, approx. 20.2mg, approx. 20.3mg, approx. 20.4mg, approx. mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, about 22.6mg, approximately 22.7mg, approximately 22.8mg, approximately 22.9mg, approximately 23mg, approximately 23.1mg, approximately 23.2mg, approximately 23.3mg, approximately 23.4mg, approximately 23.5mg, approximately 23.6mg, approximately 23.7mg, approximately 23.8mg, approximately 23.9mg, approximately 24mg, approximately 24.1mg, approximately 24.2mg, approximately 24.3mg, approximately 24.4mg, approximately 24.5mg, approximately 24.6mg, approximately 24.7mg, approximately 24.8mg, approximately 24.9mg, approximately 25mg, approximately 25.1mg, approximately 25.2mg, approximately 25.3mg, approximately 25.4mg, approximately 25.5mg, approximately 25.6mg, approximately 25.7mg, approximately 25 0.8mg, approximately 25.9mg, approximately 26mg, approximately 26.1mg, approximately 26.2mg, approximately 26.3mg, approximately 26.4mg, approximately 26.5mg, approximately 26.6mg, approximately 26.7mg, approximately 26.8mg, approximately 26.9mg, approximately 27mg, approximately 27.1mg, approximately 27.2mg, approximately 27.3mg, approximately 27.4mg, approximately 27.5mg, approximately 27.6mg, approximately 27.7mg, approximately 27.8mg, approximately 27.9mg, approximately 28mg, approximately 28.1mg, approximately 28.2mg, approximately 28.3mg, approximately 28.4mg, approximately 28.5mg, approximately 28.6mg, approximately 28.7mg, approximately 28.8mg, approximately 28.9mg, approximately 29mg mg, approximately 29.1 mg, approximately 29.2 mg, approximately 29.3 mg, approximately 29.4 mg, approximately 29.5 mg, approximately 29.6 mg, approximately 29.7 mg, approximately 29.8 mg, approximately 29.9 mg, approximately 30 mg, approximately 30.1 mg, approximately 30.2 mg, approximately 30.3 mg, approximately 30.4 mg, approximately 30.5 mg, approximately 30.6 mg, approximately 30.7 mg, approximately 30.8 mg, approximately 30.9 mg, approximately 31 mg, approximately 31.1 mg, approximately 31.2 mg, approximately 31.3 mg, approximately 31.4 mg, approximately 31.5 mg, approximately 31.6 mg, approximately 31.7 mg, approximately 31.8 mg, approximately 31.9 mg, approximately 32 mg, approximately 32.1 mg, approximately 32. 2mg, approximately 32.3mg, approximately 32.4mg, approximately 32.5mg, approximately 32.6mg, approximately 32.7mg, approximately 32.8mg, approximately 32.9mg, approximately 33mg, approximately 33.1mg, approximately 33.2mg, approximately 33.3mg, approximately 33.4mg, approximately 33.5mg, approximately 33.6mg, approximately 33.7mg, approximately 33.8mg, approximately 33.9mg, approximately 34mg, approximately 34.1mg, approximately 34.2mg, approximately 34.3mg, approximately 34.4mg, approximately 34.5mg, approximately 34.6mg, approximately 34.7mg, approximately 34.8mg, approximately 34.9mg, approximately 35mg, approximately 35.1mg, approximately 35.2mg, approximately 35.3mg, approximately 35mg.4mg, about 35.5mg, about 35.6mg, about 35.7mg, about 35.8mg, about 35.9mg, about 36mg, about 36.1mg, about 36.2mg, about 36.3mg, about 36.4mg, about 36.5mg, about 36.6mg, about 36.7mg, about 36.8mg, about 36.9mg, about 3 7mg, about 37.1mg, about 37.2mg, about 37.3mg, about 37.4mg, about 37.5mg, about 37.6mg, about 37.7mg, about 37.8mg, about 37.9mg, about 38mg, about 38.1mg, about 38.2mg, about 38.3mg, about 38.4mg, about 38.5mg, about 38 .6mg, approximately 38.7mg, approximately 38.8mg, approximately 38.9mg, approximately 39mg, approximately 39.1mg, approximately 39.2mg, approximately 39.3mg, approximately 39.4mg, approximately 39.5mg, approximately 39.6mg, approximately 39.7mg, approximately 39.8mg, approximately 39.9mg, approximately 40mg, approximately 40.1mg, approximately 40.2mg, approximately 40.3mg, approximately 40.4mg, approximately 40.5mg, approximately 40.6mg, approximately 40.7mg, approximately 40.8mg, approximately 40.9mg, approximately 41mg, approximately 41.1mg, approximately 41.2mg, approximately 41.3mg, approximately 41.4mg, approximately 41.5mg, approximately 41.6mg, approximately 41.7mg, approximately 41 .8mg, approximately 41.9mg, approximately 42mg, approximately 42.1mg, approximately 42.2mg, approximately 42.3mg, approximately 42.4mg, approximately 42.5mg, approximately 42.6mg, approximately 42.7mg, approximately 42.8mg, approximately 42.9mg, approximately 43mg, approximately 43.1mg, approximately 43.2mg, approximately 43.3mg, approximately 43.4mg, approximately 43.5mg, approximately 43.6mg, approximately 43.7mg, approximately 43.8mg, approximately 43.9mg, approximately 44mg, approximately 44.1mg, approximately 44.2mg, approximately 44.3mg, approximately 44.4mg, approximately 44.5mg, approximately 44.6mg, approximately 44.7mg, approximately 44.8mg, approximately 44.9mg, approximately 4 5mg, approximately 45.1mg, approximately 45.2mg, approximately 45.3mg, approximately 45.4mg, approximately 45.5mg, approximately 45.6mg, approximately 45.7mg, approximately 45.8mg, approximately 45.9mg, approximately 46mg, approximately 46.1mg, approximately 46.2mg, approximately 46.3mg, approximately 46.4mg, approximately 46.5mg, approximately 46.6mg, approximately 46.7mg, approximately 46.8mg, approximately 46.9mg, approximately 47mg, approximately 47.1mg, approximately 47.2mg, approximately 47.3mg, approximately 47.4mg, approximately 47.5mg, approximately 47.6mg, approximately 47.7mg, approximately 47.8mg, approximately 47.9mg, approximately 48mg, approximately 48.1mg, approximately 48.2mg, approximately 48.3mg, approximately 48.4mg, approximately 48.5mg, approximately 48.6mg, approximately 48.7mg, approximately 48.8mg, approximately 48.9mg, approximately 49mg, approximately 49.1mg, approximately 49.2mg, approximately 49.3mg, approximately 49.4mg, approximately 49.5mg, approximately 49.6mg, approximately 49.7mg, approximately 49.8mg, approximately 49.9mg, approximately 50mg, approximately 50.1mg, approximately 50.2mg, approximately 50.3mg, approximately 50.4mg, approximately 50.5mg, approximately 50.6mg, approximately 50.7mg, approximately 50.8mg, approximately 50.9mg, approximately 51mg, approximately 51.1mg, approximately 51.2mg, approximately 51.3mg, approximately 5 1.4mg, about 51.5mg, about 51.6mg, about 51.7mg, about 51.8mg, about 51.9mg, about 52mg, about 52.1mg, about 52.2mg, about 52.3mg, about 52.4mg, about 52.5mg, about 52.6mg, about 52.7mg, about 52.8mg, about 52.9mg, about 53mg, about 53.1mg, about 53.2mg, about 53.3mg, about 53.4mg, about 53.5mg, about 53.6mg, about 53.7mg, about 53.8mg, about 53.9mg, about 54mg, about 54.1mg, about 54.2mg, about 54.3mg, about 54.4mg, about 54.5mg, About 54.6mg, about 54.7mg, about 54.8mg, about 54.9mg, about 55mg, about 55.1mg, about 55.2mg, about 55.3mg, about 55.4mg, about 55.5mg, about 55.6mg, about 55.7mg, about 55.8mg, about 55.9mg, about 56mg, about 56.1mg, Approx. 56.2 mg, approx. 56.3 mg, approx. 56.4 mg, approx. 56.5 mg, approx. 56.6 mg, approx. 56.7 mg, approx. 56.8 mg, approx. 56.9 mg, approx. g, approx. 57.8 mg, approx. 57.9 mg, approx. 58 mg, approx. 58.1 mg, approx. 58.2 mg, approx. 58.3 mg, approx. 58.4 mg, approx. 58.5 mg, approx. g, approx. 59.4 mg, approx. 59.5 mg, approx. 59.6 mg, approx. 59.7 mg, approx. 59.8 mg, approx. 59.9 mg, approx. 60 mg, approx. 60.1 mg, approx.9mg, approximately 61mg, approximately 61.1mg, approximately 61.2mg, approximately 61.3mg, approximately 61.4mg, approximately 61.5mg, approximately 61.6mg, approximately 61.7mg, approximately 61.8mg, approximately 61.9mg, approximately 62mg, approximately 62.1mg, approximately 62.2mg, approximately 62.3mg, approximately 62.4mg, approximately 62.5mg, approximately 62.6mg, approximately 62.7mg, approximately 62.8mg, approximately 62.9mg, approximately 63mg, approximately 63.1mg, approximately 63.2mg, approximately 6 3.3mg, approximately 63.4mg, approximately 63.5mg, approximately 63.6mg, approximately 63.7mg, approximately 63.8mg, approximately 63.9mg, approximately 64mg, approximately 64.1mg, approximately 64.2mg, approximately 64.3mg, approximately 64.4mg, approximately 64.5mg, approximately 64.6mg, approximately 64.7mg, approximately 64.8mg, approximately 64.9mg, approximately 65mg, approximately 65.1mg, approximately 65.2mg, approximately 65.3mg, approximately 65.4mg, approximately 65.5mg, approximately 65.6mg , about 65.7mg, about 65.8mg, about 65.9mg, about 66mg, about 66.1mg, about 66.2mg, about 66.3mg, about 66.4mg, about 66.5mg, about 66.6mg, about 66.7mg, about 66.8mg, about 66.9mg, about 67mg, about 67.1mg, about 67.2mg, about 67.3mg, about 67.4mg, about 67.5mg, about 67.6mg, about 67.7mg, about 67.8mg, about 67.9mg, about 68m 63. The method of any one of embodiments 1-62, wherein the amount of the hydroxybenzoate is any of about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, and about 69.9 mg.
[0128] Embodiment 77. The therapeutically effective amount is 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 ... mg, 23.5mg, 23.6mg, 23.7mg, 23.8mg, 23.9mg, 24mg, 24.1mg, 24.2mg, 24.3mg, 24.4mg, 24.5mg, 24.6mg, 24.7mg, 24.8mg, 24.9mg, 25mg, 25.1mg, 25.2mg , 25.3mg, 25.4mg, 25.5mg, 25.6mg, 25.7mg, 25.8mg, 25.9mg, 26mg, 26.1mg, 26.2mg, 26.3mg, 26.4mg, 26.5mg, 26.6mg, 26.7mg, 26.8mg, 26.9mg, 27mg, 27 .1mg, 27.2mg, 27.3mg, 27.4mg, 27.5mg, 27.6mg, 27.7mg, 27.8mg, 27.9mg, 28mg, 28.1mg, 28.2mg, 28.3mg, 28.4mg, 28.5mg, 28.6mg, 28.7mg, 28.8mg, 28 .9mg, 29mg, 29.1mg, 29.2mg, 29.3mg, 29.4mg, 29.5mg, 29.6mg, 29.7mg, 29.8mg, 29.9mg, 30mg, 30.1mg, 30.2mg, 30.3mg, 30.4mg, 30.5mg, 30.6mg, 30.7m g, 30.8mg, 30.9mg, 31mg, 31.1mg, 31.2mg, 31.3mg, 31.4mg, 31.5mg, 31.6mg, 31.7mg, 31.8mg, 31.9mg, 32mg, 32.1mg, 32.2mg, 32.3mg, 32.4mg, 32.5mg, 32.6mg, 32.7mg, 32.8mg, 32.9mg, 33mg, 33.1mg, 33.2mg, 33.3mg, 33.4mg, 33.5mg, 33.6mg, 33.7mg, 33.8mg, 33.9mg, 34mg, 34.1mg, 34.2mg, 34.3mg, 34.4mg, 34.5mg, 34.6mg, 34.7mg, 34.8mg, 34.9mg, 35mg, 35.1mg, 35.2mg, 35.3mg, 35.4mg, 35.5mg, 35.6mg, 35.7mg, 35.8mg, 35.9 mg, 36mg, 36.1mg, 36.2mg, 36.3mg, 36.4mg, 36.5mg, 36.6mg, 36.7mg, 36.8mg, 36.9mg, 37mg, 37.1mg, 37.2mg, 37.3mg, 37.4mg, 63. The method of any one of embodiments 1-62, wherein the dose is any of 37.5 mg, 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg, and 40 mg.
[0129] Embodiment 78. The therapeutically effective amount is about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, about 22.6 mg, about 22.7 mg, about 22.8 mg, about 22.9 mg, or about 2 3mg, approx. 23.1mg, approx. 23.2mg, approx. 23.3mg, approx. 23.4mg, approx. 23.5mg, approx. 23.6mg, approx. 23.7mg, approx. 23.8mg, approx. 23.9mg, approx. 24mg, approx. .6mg, about 24.7mg, about 24.8mg, about 24.9mg, about 25mg, about 25.1mg, about 25.2mg, about 25.3mg, about 25.4mg, about 25.5mg, about 25.6mg, about 25.7mg, about 25.8mg, about 25.9mg, about 26mg, about 26.1mg, about 26. 2mg, about 26.3mg, about 26.4mg, about 26.5mg, about 26.6mg, about 26.7mg, about 26.8mg, about 26.9mg, about 27mg, about 27.1mg, about 27.2mg, about 27.3mg, about 27.4mg, about 27.5mg, about 27.6mg, about 27.7mg, about 27 .8mg, about 27.9mg, about 28mg, about 28.1mg, about 28.2mg, about 28.3mg, about 28.4mg, about 28.5mg, about 28.6mg, about 28.7mg, about 28.8mg, about 28.9mg, about 29mg, about 29.1mg, about 29.2mg, about 29.3mg, about 29. 4mg, approx. 29.5mg, approx. 29.6mg, approx. 29.7mg, approx. 29.8mg, approx. 29.9mg, approx. 30mg, approx. 30.1mg, approx. 30.2mg, approx. 30.3mg, approx. 30.4mg, approx. mg, about 31.1 mg, about 31.2 mg, about 31.3 mg, about 31.4 mg, about 31.5 mg, about 31.6 mg, about 31.7 mg, about 31.8 mg, about 31.9 mg, about 32 mg, about 32.1 mg, about 32.2 mg, about 32.3 mg, about 32.4 mg, about 32.5 mg, about 32.6mg, about 32.7mg, about 32.8mg, about 32.9mg, about 33mg, about 33.1mg, about 33.2mg, about 33.3mg, about 33.4mg, about 33.5mg, about 3 3.6mg, about 33.7mg, about 33.8mg, about 33.9mg, about 34mg, about 34.1mg, about 34.2mg, about 34.3mg, about 34.4mg, about 34.5mg, about 34.6mg, about 34.7mg, about 34.8mg, about 34.9mg, about 35mg, about 35.1mg, about 35.2mg, about 35.3mg, about 35.4mg, about 35.5mg , about 35.6mg, about 35.7mg, about 35.8mg, about 35.9mg, about 36mg, about 36.1mg, about 36.2mg, about 36.3mg, about 36.4mg, about 36.5m g, about 36.6 mg, about 36.7 mg, about 36.8 mg, about 36.9 mg, about 37 mg, about 37.1 mg, about 37.2 mg, about 37.3 mg, about 37.4 mg, about 37. 5mg, about 37.6mg, about 37.7mg, about 37.8mg, about 37.9mg, about 38mg, about 38.1mg, about 38.2mg, about 38.3mg, about 38.4mg, about 38 63. The method of any one of embodiments 1-62, wherein the dose is any of about 0.5 mg, about 38.6 mg, about 38.7 mg, about 38.8 mg, about 38.9 mg, about 39 mg, about 39.1 mg, about 39.2 mg, about 39.3 mg, about 39.4 mg, about 39.5 mg, about 39.6 mg, about 39.7 mg, about 39.8 mg, about 39.9 mg, and about 40 mg.
[0130] Embodiment 79. The therapeutically effective amount is 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44.0 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 ... mg, 43.5mg, 43.6mg, 43.7mg, 43.8mg, 43.9mg, 44mg, 44.1mg, 44.2mg, 44.3mg, 44.4mg, 44.5mg, 44.6mg, 44.7mg, 44.8mg, 44.9mg, 45mg, 45.1mg, 45.2mg , 45.3mg, 45.4mg, 45.5mg, 45.6mg, 45.7mg, 45.8mg, 45.9mg, 46mg, 46.1mg, 46.2mg, 46.3mg, 46.4mg, 46.5mg, 46.6mg, 46.7mg, 46.8mg, 46.9mg, 47mg, 47 .1mg, 47.2mg, 47.3mg, 47.4mg, 47.5mg, 47.6mg, 47.7mg, 47.8mg, 47.9mg, 48mg, 48.1mg, 48.2mg, 48.3mg, 48.4mg, 48.5mg, 48.6mg, 48.7mg, 48.8mg, 48 .9mg, 49mg, 49.1mg, 49.2mg, 49.3mg, 49.4mg, 49.5mg, 49.6mg, 49.7mg, 49.8mg, 49.9mg, 50mg, 50.1mg, 50.2mg, 50.3mg, 50.4mg, 50.5mg, 50.6mg, 50.7m g. 52.6mg, 52.7mg, 52.8mg, 52.9mg, 53mg, 53.1mg, 53.2mg, 53.3mg, 53.4mg, 53.5mg, 53.6mg, 53.7mg, 53.8mg, 53.9mg, 54mg, 54.1mg, 54.2mg, 54.3mg, 54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68mg、68.1mg、68.2mg、68.3mg、68.4mg、68.5mg、68.6mg、68.7mg、68.8mg、68.9mg、69mg、69.The method of any one of embodiments 1 to 62, wherein the dose is any of 1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, 69.9 mg, and 70 mg.
[0131] Embodiment 80. The therapeutically effective amount is about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, or about 43 mg. 3mg, approximately 43.1mg, approximately 43.2mg, approximately 43.3mg, approximately 43.4mg, approximately 43.5mg, approximately 43.6mg, approximately 43.7mg, approximately 43.8mg, approximately 43.9mg, approximately 44mg, approximately 44.1mg, approximately 44.2mg, approximately 44.3mg, approximately 44.4mg, approximately 44.5mg, approximately 44.6mg, approximately 44.7mg, approximately 44.8mg, approximately 44.9mg, approximately 45mg, approximately 45.1mg, approximately 45.2mg, approximately 45.3mg, approximately 45.4mg, approximately 45.5mg, approximately 45.6mg, approximately 45.7mg, approximately 45.8mg, approximately 45.9mg, approximately 46mg, approximately 46.1mg, approximately 46. 2mg, approximately 46.3mg, approximately 46.4mg, approximately 46.5mg, approximately 46.6mg, approximately 46.7mg, approximately 46.8mg, approximately 46.9mg, approximately 47mg, approximately 47.1mg, approximately 47.2mg, approximately 47.3mg, approximately 47.4mg, approximately 47.5mg, approximately 47.6mg, approximately 47.7mg, approximately 47.8mg, approximately 47.9mg, approximately 48mg, approximately 48.1mg, approximately 48.2mg, approximately 48.3mg, approximately 48.4mg, approximately 48.5mg, approximately 48.6mg, approximately 48.7mg, approximately 48.8mg, approximately 48.9mg, approximately 49mg, approximately 49.1mg, approximately 49.2mg, approximately 49.3mg, approximately 49. 4mg, approximately 49.5mg, approximately 49.6mg, approximately 49.7mg, approximately 49.8mg, approximately 49.9mg, approximately 50mg, approximately 50.1mg, approximately 50.2mg, approximately 50.3mg, approximately 50.4mg, approximately 50.5mg, approximately 50.6mg, approximately 50.7mg, approximately 50.8mg, approximately 50.9mg, approximately 51mg, approximately 51.1mg, approximately 51.2mg, approximately 51.3mg, approximately 51.4mg, approximately 51.5mg, approximately 51.6mg, approximately 51.7mg, approximately 51.8mg, approximately 51.9mg, approximately 52mg, approximately 52.1mg, approximately 52.2mg, approximately 52.3mg, approximately 52.4mg, approximately 52.5mg, approximately 52.6mg, about 52.7mg, about 52.8mg, about 52.9mg, about 53mg, about 53.1mg, about 53.2mg, about 53.3mg, about 53.4mg, about 53.5mg, about 53.6mg, about 53.7mg, about 53.8mg, about 53.9mg, about 54mg, about 54.1mg, about 54. 2mg, approx. 54.3mg, approx. 54.4mg, approx. 54.5mg, approx. 54.6mg, approx. 54.7mg, approx. 54.8mg, approx. 54.9mg, approx. 55mg, approx. 55.1mg, approx. .8mg, approximately 55.9mg, approximately 56mg, approximately 56.1mg, approximately 56.2mg, approximately 56.3mg, approximately 56.4mg, approximately 56.5mg, approximately 56.6mg, approximately 56.7mg, approximately 56.8mg, approximately 56.9mg, approximately 57mg, approximately 57.1mg, approximately 57.2mg, approximately 57.3mg, approximately 57.4mg, approximately 57.5mg, approximately 57.6mg, approximately 57.7mg, approximately 57.8mg, approximately 57.9mg, approximately 58mg, approximately 58.1mg, approximately 58.2mg, approximately 58.3mg, approximately 58.4mg, approximately 58.5mg, approximately 58.6mg, approximately 58.7mg, approximately 58.8mg, approximately 58.9mg, approximately 59 mg, approx. 59.1 mg, approx. 59.2 mg, approx. 59.3 mg, approx. 59.4 mg, approx. 59.5 mg, approx. 59.6 mg, approx. 59.7 mg, approx. .6mg, about 60.7mg, about 60.8mg, about 60.9mg, about 61mg, about 61.1mg, about 61.2mg, about 61.3mg, about 61.4mg, about 61.5mg, about 61.6mg, about 61.7mg, about 61.8mg, about 61.9mg, about 62mg, about 62.1mg, about 62. 2mg, approximately 62.3mg, approximately 62.4mg, approximately 62.5mg, approximately 62.6mg, approximately 62.7mg, approximately 62.8mg, approximately 62.9mg, approximately 63mg, approximately 63.1mg, approximately 63.2mg, approximately 63.3mg, approximately 63.4mg, approximately 63.5mg, approximately 63.6mg, approximately 63.7mg, approximately 63.8mg, approximately 63.9mg, approximately 64mg, approximately 64.1mg, approximately 64.2mg, approximately 64.3mg, approximately 64.4mg, approximately 64.5mg, approximately 64.6mg, approximately 64.7mg, approximately 64.8mg, approximately 64.9mg, approximately 65mg, approximately 65.1mg, approximately 65.2mg, approximately 65.3mg, approximately 65.4mg, approximately 65.5mg, approximately 65.6mg, approximately 65.7mg, approximately 65.8mg, approximately 65.9mg, approximately 66mg, approximately 66.1mg, approximately 66.2mg, approximately 66.3mg, approximately 66.4mg, approximately 66.5mg, approximately 66.6mg, approximately 66.7mg, approximately 66.8mg, approximately 66.9mg, approximately 67mg, approximately 67.1mg, approximately 67.2mg, approximately 67.3mg, approximately 67.4mg, approximately 67.5mg, approximately 67.6mg, approximately 67.7mg, approximately 67.8mg, approximately 67.9 63. The method of any one of embodiments 1-62, wherein the dose is any of about 68 mg, about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, about 69.9 mg, and about 70 mg.
[0132] Embodiment 81. The therapeutically effective amount is 70 mg, 70.1 mg, 70.2 mg, 70.3 mg, 70.4 mg, 70.5 mg, 70.6 mg, 70.7 mg, 70.8 mg, 70.9 mg, 71 mg, 71.1 mg, 71.2 mg, 71.3 mg, 71.4 mg, 71.5 mg, 71.6 mg, 71.7 mg, 71.8 mg, 71.9 mg, 72 mg, 72.1 mg, 72.2 mg, 72.3 mg, 72.4 mg, 72.5 mg, 72.6 mg, 72.7 mg, 72.8 mg, 72.9 mg, 73 mg, 73.1 mg, 73.2 mg, 73.3 mg, 73.4 mg, 73.5 mg, 73.6 mg, 73.7 mg, 73.8 mg, 73.9 mg, 74 mg, 74.1 mg, 74.2 mg, 74.3 mg, 74.4 mg, 74.5 mg, 74.6 mg, 74.7 mg, 74.8 mg, 74.9 mg, 75 ... mg, 73.5mg, 73.6mg, 73.7mg, 73.8mg, 73.9mg, 74mg, 74.1mg, 74.2mg, 74.3mg, 74.4mg, 74.5mg, 74.6mg, 74.7mg, 74.8mg, 74.9mg, 75mg, 75.1mg, 75.2mg , 75.3mg, 75.4mg, 75.5mg, 75.6mg, 75.7mg, 75.8mg, 75.9mg, 76mg, 76.1mg, 76.2mg, 76.3mg, 76.4mg, 76.5mg, 76.6mg, 76.7mg, 76.8mg, 76.9mg, 77mg, 77 .1mg, 77.2mg, 77.3mg, 77.4mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78mg, 78.1mg, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg, 78 .9mg, 79mg, 79.1mg, 79.2mg, 79.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9mg, 80mg, 80.1mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7m g, 80.8mg, 80.9mg, 81mg, 81.1mg, 81.2mg, 81.3mg, 81.4mg, 81.5mg, 81.6mg, 81.7mg, 81.8mg, 81.9mg, 82mg, 82.1mg, 82.2mg, 82.3mg, 82.4mg, 82.5mg, 82.6mg, 82.7mg, 82.8mg, 82.9mg, 83mg, 83.1mg, 83.2mg, 83.3mg, 83.4mg, 83.5mg, 83.6mg, 83.7mg, 83.8mg, 83.9mg, 84mg, 84.1mg, 84.2mg, 84.3mg, 84.4mg、84.5mg、84.6mg、84.7mg、84.8mg、84.9mg、85mg、85.1mg、85.2mg、85.3mg、85.4mg、85.5mg、85.6mg、85.7mg、85.8mg、85.9mg、86mg、86.1mg、86.2mg、86.3mg、86.4mg、86.5mg、86.6mg、86.7mg、86.8mg、86.9mg、87mg、87.1mg、87.2mg、87.3mg、87.4mg、87.5mg、87.6mg、87.7mg、87.8mg、87.9mg、88mg、88.1mg、88.2mg、88.3mg、88.4mg、88.5mg、88.6mg、88.7mg、88.8mg、88.9mg、89mg、89.1mg、89.2mg、89.3mg、89.4mg、89.5mg、89.6mg、89.7mg、89.8mg、89.9mg、90mg、90.1mg、90.2mg、90.3mg、90.4mg、90.5mg、90.6mg、90.7mg、90.8mg、90.9mg、91mg、91.1mg、91.2mg、91.3mg、91.4mg、91.5mg、91.6mg、91.7mg、91.8mg、91.9mg、92mg、92.1mg、92.2mg、92.3mg、92.4mg、92.5mg、92.6mg、92.7mg、92.8mg、92.9mg、93mg、93.1mg、93.2mg、93.3mg、93.4mg、93.5mg、93.6mg、93.7mg、93.8mg、93.9mg、94mg、94.1mg、94.2mg、94.3mg、94.4mg、94.5mg、94.6mg、94.7mg、94.8mg、94.9mg、95mg、95.1mg、95.2mg、95.3mg、95.4mg、95.5mg、95.6mg、95.7mg、95.8mg、95.9mg、96mg、96.1mg、96.2mg、96.3mg、96.4mg、96.5mg、96.6mg、96.7mg、96.8mg、96.9mg、97mg、97.1mg、97.2mg、97.3mg、97.4mg、97.5mg、97.6mg、97.7mg、97.8mg、97.9mg、98mg、98.1mg、98.2mg、98.3mg、98.4mg、98.5mg、98.6mg、98.7mg、98.8mg、98.9mg、99mg、99.The method of any one of embodiments 1 to 62, wherein the amount is any one of 1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, and 99.9 mg.
[0133] Embodiment 82. The therapeutically effective amount is about 70 mg, about 70.1 mg, about 70.2 mg, about 70.3 mg, about 70.4 mg, about 70.5 mg, about 70.6 mg, about 70.7 mg, about 70.8 mg, about 70.9 mg, about 71 mg, about 71.1 mg, about 71.2 mg, about 71.3 mg, about 71.4 mg, about 71.5 mg, about 71.6 mg, about 71.7 mg, about 71.8 mg, about 71.9 mg, about 72 mg, about 72.1 mg, about 72.2 mg, about 72.3 mg, about 72.4 mg, about 72.5 mg, about 72.6 mg, about 72.7 mg, about 72.8 mg, about 72.9 mg, or about 73 mg. 3mg, about 73.1mg, about 73.2mg, about 73.3mg, about 73.4mg, about 73.5mg, about 73.6mg, about 73.7mg, about 73.8mg, about 73.9mg, about 74mg, about 74.1mg, about 74.2mg, about 74.3mg, about 74.4mg, about 74.5mg, about 74 .6mg, about 74.7mg, about 74.8mg, about 74.9mg, about 75mg, about 75.1mg, about 75.2mg, about 75.3mg, about 75.4mg, about 75.5mg, about 75.6mg, about 75.7mg, about 75.8mg, about 75.9mg, about 76mg, about 76.1mg, about 76. 2mg, about 76.3mg, about 76.4mg, about 76.5mg, about 76.6mg, about 76.7mg, about 76.8mg, about 76.9mg, about 77mg, about 77.1mg, about 77.2mg, about 77.3mg, about 77.4mg, about 77.5mg, about 77.6mg, about 77.7mg, about 77 .8mg, about 77.9mg, about 78mg, about 78.1mg, about 78.2mg, about 78.3mg, about 78.4mg, about 78.5mg, about 78.6mg, about 78.7mg, about 78.8mg, about 78.9mg, about 79mg, about 79.1mg, about 79.2mg, about 79.3mg, about 79. 4mg, approximately 79.5mg, approximately 79.6mg, approximately 79.7mg, approximately 79.8mg, approximately 79.9mg, approximately 80mg, approximately 80.1mg, approximately 80.2mg, approximately 80.3mg, approximately 80.4mg, approximately 80.5mg, approximately 80.6mg, approximately 80.7mg, approximately 80.8mg, approximately 80.9mg, approximately 81mg, approximately 81.1mg, approximately 81.2mg, approximately 81.3mg, approximately 81.4mg, approximately 81.5mg, approximately 81.6mg, approximately 81.7mg, approximately 81.8mg, approximately 81.9mg, approximately 82mg, approximately 82.1mg, approximately 82.2mg, approximately 82.3mg, approximately 82.4mg, approximately 82.5mg, approximately 82.6mg, about 82.7mg, about 82.8mg, about 82.9mg, about 83mg, about 83.1mg, about 83.2mg, about 83.3mg, about 83.4mg, about 83.5mg, about 83.6mg, about 83.7mg, about 83.8mg, about 83.9mg, about 84mg, about 84.1mg, about 84.2mg, about 84.3mg, about 84.4mg, about 84.5mg, about 84.6mg, about 84.7mg, about 84.8mg, about 84.9mg, about 85mg, about 85.1mg, about 85.2mg, about 85.3mg, about 85.4mg, about 85.5mg, about 85.6mg, about 85.7mg, about 85 .8mg, approximately 85.9mg, approximately 86mg, approximately 86.1mg, approximately 86.2mg, approximately 86.3mg, approximately 86.4mg, approximately 86.5mg, approximately 86.6mg, approximately 86.7mg, approximately 86.8mg, approximately 86.9mg, approximately 87mg, approximately 87.1mg, approximately 87.2mg, approximately 87.3mg, approximately 87.4mg, approximately 87.5mg, approximately 87.6mg, approximately 87.7mg, approximately 87.8mg, approximately 87.9mg, approximately 88mg, approximately 88.1mg, approximately 88.2mg, approximately 88.3mg, approximately 88.4mg, approximately 88.5mg, approximately 88.6mg, approximately 88.7mg, approximately 88.8mg, approximately 88.9mg, approximately 89 mg, approx. 89.1 mg, approx. 89.2 mg, approx. 89.3 mg, approx. 89.4 mg, approx. 89.5 mg, approx. 89.6 mg, approx. 89.7 mg, approx. 89.8 mg, approx. 89.9 mg, approx. 90 mg, approx. .6mg, about 90.7mg, about 90.8mg, about 90.9mg, about 91mg, about 91.1mg, about 91.2mg, about 91.3mg, about 91.4mg, about 91.5mg, about 91.6mg, about 91.7mg, about 91.8mg, about 91.9mg, about 92mg, about 92.1mg, about 92. 2mg, about 92.3mg, about 92.4mg, about 92.5mg, about 92.6mg, about 92.7mg, about 92.8mg, about 92.9mg, about 93mg, about 93.1mg, about 93.2mg, about 93.3mg, about 93.4mg, about 93.5mg, about 93.6mg, about 93.7mg, about 93 .8mg, about 93.9mg, about 94mg, about 94.1mg, about 94.2mg, about 94.3mg, about 94.4mg, about 94.5mg, about 94.6mg, about 94.7mg, about 94.8mg, about 94.9mg, about 95mg, about 95.1mg, about 95.2mg, about 95.3mg, about 95.4mg, about 95.5mg, about 95.6mg, about 95.7mg, about 95.8mg, about 95.9mg, about 96mg, about 96.1mg, about 96.2mg, about 96.3mg, about 96.4mg, about 96.5mg, about 96.6mg, about 96.7mg, about 96.8mg, about 96.9mg, about 97mg, about 97.1mg, about 97.2mg, about 97.3mg, about 97.4mg, about 97.5mg, about 97.6mg, about 97.7mg, about 97.8mg, about 9 63. The method of any one of embodiments 1-62, wherein the amount of hydroxybenzoates is any of 7.9 mg, about 98 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg, about 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg, and about 99.9 mg.
[0134] Embodiment 83. The therapeutically effective amount is 100 mg, 100.1 mg, 100.2 mg, 100.3 mg, 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102 mg, 102.1 mg, 102.2 mg, 102.3 mg, 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 mg, 102.10 mg, 102.20 mg, 102.30 mg, 102.40 mg, 102.5 mg, 102.60 ... 3mg, 103.1mg, 103.2mg, 103.3mg, 103.4mg, 103.5mg, 103.6mg, 103.7mg, 103.8mg, 103.9mg, 104mg, 104.1mg, 104.2mg, 104.3mg, 104.4mg, 104.5mg, 104 .6mg, 104.7mg, 104.8mg, 104.9mg, 105mg, 105.1mg, 105.2mg, 105.3mg, 105.4mg, 105.5mg, 105.6mg, 105.7mg, 105.8mg, 105.9mg, 106mg, 106.1mg, 106. 2mg, 106.3mg, 106.4mg, 106.5mg, 106.6mg, 106.7mg, 106.8mg, 106.9mg, 107mg, 107.1mg, 107.2mg, 107.3mg, 107.4mg, 107.5mg, 107.6mg, 107.7mg, 107 .8mg, 107.9mg, 108mg, 108.1mg, 108.2mg, 108.3mg, 108.4mg, 108.5mg, 108.6mg, 108.7mg, 108.8mg, 108.9mg, 109mg, 109.1mg, 109.2mg, 109.3mg, 109. 4mg, 109.5mg, 109.6mg, 109.7mg, 109.8mg, 109.9mg, 110mg, 110.1mg, 110.2mg, 110.3mg, 110.4mg, 110.5mg, 110.6mg, 110.7mg, 110.8mg, 110.9mg, 111 mg, 111.1mg, 111.2mg, 111.3mg, 111.4mg, 111.5mg, 111.6mg, 111.7mg, 111.8mg, 111.9mg, 112mg, 112.1mg, 112.2mg, 112.3mg, 112.4mg, 112.5mg, 112.6mg、112.7mg、112.8mg、112.9mg、113mg、113.1mg、113.2mg、113.3mg、113.4mg、113.5mg、113.6mg、113.7mg、113.8mg、113.9mg、114mg、114.1mg、114.2mg、114.3mg、114.4mg、114.5mg、114.6mg、114.7mg、114.8mg、114.9mg、115mg、115.1mg、115.2mg、115.3mg、115.4mg、115.5mg、115.6mg、115.7mg、115.8mg、115.9mg、116mg、116.1mg、116.2mg、116.3mg、116.4mg、116.5mg、116.6mg、116.7mg、116.8mg、116.9mg、117mg、117.1mg、117.2mg、117.3mg、117.4mg、117.5mg、117.6mg、117.7mg、117.8mg、117.9mg、118mg、118.1mg、118.2mg、118.3mg、118.4mg、118.5mg、118.6mg、118.7mg、118.8mg、118.9mg、119mg、119.1mg、119.2mg、119.3mg、119.4mg、119.5mg、119.6mg、119.7mg、119.8mg、119.9mg、120mg、120.1mg、120.2mg、120.3mg、120.4mg、120.5mg、120.6mg、120.7mg、120.8mg、120.9mg、121mg、121.1mg、121.2mg、121.3mg、121.4mg、121.5mg、121.6mg、121.7mg、121.8mg、121.9mg、122mg、122.1mg、122.2mg、122.3mg、122.4mg、122.5mg、122.6mg、122.7mg、122.8mg、122.9mg、123mg、123.1mg、123.2mg、123.3mg、123.4mg、123.5mg、123.6mg、123.7mg、123.8mg、123.9mg、124mg、124.1mg、124.2mg、124.3mg、124.4mg、124.5mg、124.6mg、124.7mg、124.8mg、124.The method of any one of embodiments 1 to 62, wherein the dose is either 9 mg or 125 mg.
[0135] Embodiment 84. The therapeutically effective amount is about 100 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg, about 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg, about 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 102.10 mg, about 102.20 mg, about 102.30 mg, about 102.40 mg, about 102.50 mg, about 102.60 mg, about 102.70 mg, about 102.80 mg, about 102.90 mg, about 102.1 ... mg, approx. 102.7 mg, approx. 102.8 mg, approx. 102.9 mg, approx. 103 mg, approx. 103.1 mg, approx. 103.2 mg, approx. 103.3 mg, approx. 103.4 mg, approx. , about 104.1mg, about 104.2mg, about 104.3mg, about 104.4mg, about 104.5mg, about 104.6mg, about 104.7mg, about 104.8mg, about 104.9mg, about 105mg, about 105.1mg, about 105.2mg, about 105.3mg, about 105.4mg, Approximately 105.5 mg, approximately 105.6 mg, approximately 105.7 mg, approximately 105.8 mg, approximately 105.9 mg, approximately 106 mg, approximately 106.1 mg, approximately 106.2 mg, approximately 106.3 mg, approximately 106.4 mg, approximately 106.5 mg, approximately 106.6 mg, approximately 106.7 mg, approximately 106.8 mg, approximately 106.9 mg, approximately 107 mg, approximately 107.1 mg, approximately 107.2 mg, approximately 107.3 mg, approximately 107.4 mg, approximately 107.5 mg, approximately 107.6 mg, approximately 107.7 mg, approximately 107.8 mg, approximately 107.9 mg, approximately 108 mg, approximately 108.1 mg, approximately 108.2 mg, approximately 1 08.3mg, approximately 108.4mg, approximately 108.5mg, approximately 108.6mg, approximately 108.7mg, approximately 108.8mg, approximately 108.9mg, approximately 109mg, approximately 109.1mg, approximately 109.2mg, approximately 109.3mg, approximately 109.4mg, approximately 109.5mg, approximately 109.6mg, approximately 109.7mg, approximately 109.8mg, approximately 109.9mg, approximately 110mg, approximately 110.1mg, approximately 110.2mg, approximately 110.3mg, approximately 110.4mg, approximately 110.5mg, approximately 110.6mg, approximately 110.7mg, approximately 110.8mg, approximately 110.9mg, approximately 111mg, approximately 111.1mg, approximately 111.2mg, approximately 111.3mg, approximately 111.4mg, approximately 111.5mg, approximately 111.6mg, approximately 111.7mg, approximately 111.8mg, approximately 111.9mg, approximately 112mg, approximately 112.1mg, approximately 112.2mg, approximately 112.3mg, approximately 112.4mg, approximately 112.5mg, approximately 112.6mg, approximately 112.7mg, approximately 112.8mg, approximately 112.9mg, approximately 113mg, approximately 113.1mg, approximately 113.2mg, approximately 113.3mg, approximately 113.4mg, approximately 113.5mg, approximately 113.6mg, approximately 113.7mg, approximately 113.8mg, approximately 113. 9mg, approximately 114mg, approximately 114.1mg, approximately 114.2mg, approximately 114.3mg, approximately 114.4mg, approximately 114.5mg, approximately 114.6mg, approximately 114.7mg, approximately 114.8mg, approximately 114.9mg, approximately 115mg, approximately 115.1mg, approximately 115.2mg, approximately 115.3mg, approximately 115.4mg, approximately 115.5mg, approximately 115.6mg, approximately 115.7mg, approximately 115.8mg, approximately 115.9mg, approximately 116mg, approximately 116.1mg, approximately 116.2mg, approximately 116.3mg, approximately 116.4mg, approximately 116.5mg, approximately 116.6mg, approximately 116.7mg Approximately 116.8 mg, approximately 116.9 mg, approximately 117 mg, approximately 117.1 mg, approximately 117.2 mg, approximately 117.3 mg, approximately 117.4 mg, approximately 117.5 mg, approximately 117.6 mg, approximately 117.7 mg, approximately 117.8 mg, approximately 117.9 mg, approximately 118 mg, approximately 118.1 mg, approximately 118.2 mg, approximately 118.3 mg, approximately 118.4 mg, approximately 118.5 mg, approximately 118.6 mg, approximately 118.7 mg, approximately 118.8 mg, approximately 118.9 mg, approximately 119 mg, approximately 119.1 mg, approximately 119.2 mg, approximately 119.3 mg, approximately 119.4 mg, approximately 119.5 mg, approximately 1... 19.6mg, approximately 119.7mg, approximately 119.8mg, approximately 119.9mg, approximately 120mg, approximately 120.1mg, approximately 120.2mg, approximately 120.3mg, approximately 120.4mg, approximately 120.5mg, approximately 120.6mg, approximately 120.7mg, approximately 120.8mg, approximately 120.9mg, approximately 121mg, approximately 121.1mg, approximately 121.2mg, approximately 121.3mg, approximately 121.4mg, approximately 121.5mg, approximately 121.6mg, approximately 121.7mg, approximately 121.8mg, approximately 121.9mg, approximately 122mg, approximately 122.1mg, approximately 122.2mg, approximately 122.3mg, approximately 122mg.63. The method of any one of embodiments 1-62, wherein the amount of hydroxybenzoates is any of about 4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, about 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg, and about 125 mg.
[0136] Embodiment 85. The therapeutically effective amount is 10 mg to 200 mg, 10 mg to 190 mg, 10 mg to 180 mg, 10 mg to 170 mg, 10 mg to 160 mg, 10 mg to 150 mg, 10 mg to 140 mg, 10 mg to 120 mg, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 200 mg, 20 mg to 190 mg, 20 mg to 180 mg, 20 mg to 170 mg, 20 mg to 160 mg, 20mg~150mg, 20mg~140mg, 20mg~120mg, 20mg~110mg, 20mg~100mg, 20mg~80mg, 20mg~70mg, 20mg~60mg, 20mg~50mg, 20mg~10mg, 20mg~30mg, 30mg~200mg , 30mg~190mg, 30mg~180mg, 30mg~170mg, 30mg~160mg, 30mg~150mg, 30mg~140mg, 30mg~120mg, 30mg~110mg, 30mg~100mg, 30mg~80mg, 30mg~70mg, 30mg~ 60mg, 30mg~50mg, 30mg~20mg, 40mg~200mg, 40mg~190mg, 40mg~180mg, 40mg~170mg, 40mg~160mg, 40mg~150mg, 40mg~140mg, 40mg~120mg, 40mg~110mg, 4 0mg~100mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~200mg, 50mg~190mg, 50mg~180mg, 50mg~170mg, 50mg~160mg, 50mg~150mg, 50mg~140m g, 50mg~120mg, 50mg~110mg, 50mg~100mg, 50mg~80mg, 50mg~70mg, 50mg~60mg, 60mg~200mg, 60mg~190mg, 60mg~180mg, 60mg~170mg, 60mg~160mg, 60mg~ 150mg, 60mg~140mg, 60mg~120mg, 60mg~110mg, 60mg~100mg, 60mg~80mg, 60mg~70mg, 70mg~200mg, 70mg~190mg, 70mg~180mg, 70mg~170mg, 70mg~160mg,70mg~150mg、70mg~140mg、70mg~120mg、70mg~110mg、70mg~100mg、70mg~80mg、80mg~200mg、80mg~190mg、80mg~180mg、80mg~170mg、80mg~160mg、80mg~150mg、80mg~140mg、80mg~120mg、80mg~110mg、80mg~100mg、80mg~90mg、90mg~200mg、90mg~190mg、90mg~180mg、90mg~170mg、90mg~160mg、90mg~150mg、90mg~140mg、90mg~120mg、90mg~110mg、90mg~100mg、100mg~200mg、100mg~190mg、100mg~180mg、100mg~170mg、100mg~160mg、100mg~150mg、100mg~140mg、100mg~120mg、100mg~110mg、110mg~200mg、110mg~190mg、110mg~180mg、110mg~170mg、110mg~160mg、110mg~150mg、110mg~140mg、110mg~130mg、110mg~120mg、120mg~200mg、120mg~190mg、120mg~180mg、120mg~170mg、120mg~160mg、120mg~150mg、120mg~140mg、120mg~130mg、130mg~200mg、130mg~190mg、130mg~180mg、130mg~170mg、130mg~160mg、130mg~150mg、130mg~140mg、140mg~200mg、140mg~190mg、140mg~180mg、140mg~170mg、140mg~160mg、140mg~150mg、150mg~200mg、150mg~190mg、150mg~180mg、150mg~170mg、150mg~160mg、160mg~200mg、160mg~190mg、160mg~180mg、160mg~170mg、180mg~200mg、180mg~190mg、190mg~200mg、105mg~135mg、105mg~130mg、105mg~125mg、105mg~120mg、110mg~135mg、110mg~130mg、110mg~125mg、110mg~120mg, 115mg~135mg, 115mg~130mg, 115mg~125mg, 115mg~120mg, 115mg~125mg, 115mg~120mg, 120m g~135mg, 120mg~125mg, 125mg~140mg, 125mg~130mg, 130mg~135mg, 135mg~140mg, 120mg~129mg, 120mg~128 mg, 120mg~127mg, 120mg~86mg, 120mg~124mg, 120mg~123mg, 120mg~122mg, 120mg~121mg, 121mg~130mg, 12 2mg~129mg, 122mg~128mg, 122mg~127mg, 122mg~126mg, 122mg~125mg, 122mg~124mg, 122mg~123mg, 123mg~1 30mg, 123mg~129mg, 123mg~128mg, 123mg~127mg, 123mg~126mg, 123mg~125mg, 123mg~124mg, 124mg~130mg , 124mg~129mg, 124mg~128mg, 124mg~127mg, 124mg~126mg, 124mg~125mg, 125mg~129mg, 125mg~128mg, 125m 63. The method of any one of embodiments 1 to 62, wherein the amount of hydroxybenzoates is within any of the following ranges: 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, ...7 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.
[0137] Embodiment 86. The therapeutically effective amount is from 1 mg to less than 350 mg, less than 345 mg, less than 340 mg, less than 335 mg, less than 330 mg, less than 325 mg, less than 320 mg, less than 315 mg, less than 310 mg, less than 305 mg, less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, 63. The method of any one of embodiments 1-62, wherein the amount of hydroxybenzoates is any of less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
[0138] Embodiment 87. The therapeutically effective amount is from 1 mg to less than about 350 mg, less than about 345 mg, less than about 340 mg, less than about 335 mg, less than about 330 mg, less than about 325 mg, less than about 320 mg, less than about 315 mg, less than about 310 mg, less than about 305 mg, less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, or less than about 275 mg. , less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, 63. The method of any one of embodiments 1-62, wherein the saturation dose is any of less than 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
[0139] Embodiment 88. The method of any one of embodiments 1-62, wherein the therapeutically effective amount is any of at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
[0140] Embodiment 89. The therapeutically effective amount is from 1 mg to at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or any of at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
[0141] Embodiment 90 The method of any one of embodiments 1 to 89, comprising administering the compound once every two weeks.
[0142] Embodiment 91 The method of any one of embodiments 1 to 89, comprising administering the compound once every four weeks.
[0143] Embodiment 92 The method of any one of embodiments 1 to 89, comprising administering the compound once every 8 weeks.
[0144] Embodiment 93 The method of any one of embodiments 1 to 89, comprising administering the compound once every 12 weeks.
[0145] Embodiment 94 The method of any one of embodiments 1 to 89, comprising administering the compound once every 16 weeks.
[0146] Embodiment 95 The method of any one of embodiments 1-89, comprising administering the compound once every 20 weeks.
[0147] Embodiment 96 The method of any one of embodiments 1 to 89, comprising administering the compound once every 24 weeks.
[0148] Embodiment 97 The method of any one of embodiments 1 to 89, comprising administering the compound once every six months.
[0149] Embodiment 98 The method of any one of embodiments 1 to 89, comprising administering the compound once every two weeks.
[0150] Embodiment 99 The method of any one of embodiments 1 to 89, comprising administering the compound once every four weeks.
[0151] Embodiment 100. The method of any one of embodiments 1-89, comprising administering the compound once every eight weeks.
[0152] Embodiment 101 The method of any one of embodiments 1 to 89, comprising administering the compound once every 12 weeks.
[0153] Embodiment 102 The method of any one of embodiments 1 to 89, comprising administering the compound once every 16 weeks.
[0154] Embodiment 103 The method of any one of embodiments 1 to 89, comprising administering the compound once every 20 weeks.
[0155] Embodiment 104 The method of any one of embodiments 1 to 89, comprising administering the compound once every 24 weeks.
[0156] Embodiment 105 The method of any one of embodiments 1 to 89, comprising administering the compound once every six months.
[0157] Embodiment 106 The method of any one of embodiments 1-89, comprising administering the compound about once every 6 months, about once every 7 months, about once every 8 months, about once every 9 months, about once every 10 months, about once every 11 months, or about once every 12 months.
[0158] Embodiment 107 The method of any one of embodiments 1 to 89, comprising administering the compound monthly.
[0159] Embodiment 108 The method of any one of embodiments 1 to 89, comprising administering the compound once every two months.
[0160] Embodiment 109 The method of any one of embodiments 1 to 89, comprising administering the compound once every three months.
[0161] Embodiment 110. The method of any one of embodiments 1 to 89, comprising administering the compound once per quarter.
[0162] Embodiment 111 The method of any one of embodiments 1 to 89, comprising administering the compound semi-annually.
[0163] Embodiment 112 The method of any one of embodiments 1 to 89, comprising administering the compound once a year.
[0164] Embodiment 113 The method of any one of embodiments 1 to 89, comprising administering the compound once every two years.
[0165] Embodiment 114. The compound is administered once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, once per 16 weeks, once per 17 weeks, once per 18 weeks, once per 19 weeks, once per 20 weeks, once per 21 weeks, once per 22 weeks, once per 23 weeks, once per 24 weeks, once per 25 weeks, once per 26 weeks, once per 27 weeks, once per 28 weeks, once per 29 weeks, once per 30 weeks, once per 31 weeks, once per 32 weeks, once per 33 weeks, once per 34 weeks, once per 35 weeks, once per 36 weeks, once per 37 weeks, once per 38 weeks, once per 39 weeks, once per 40 weeks, once per 41 weeks, once per 42 weeks, once per 43 weeks, once per 44 weeks, once per 45 weeks, once per 46 weeks, once per 47 weeks, once per 48 weeks, once per 49 weeks, once per 50 weeks, once per 51 weeks, once per 52 weeks, once per 53 weeks, once per 54 weeks, once per 55 weeks, once per 56 weeks, once per 57 weeks, once per 58 weeks, once per 59 weeks, once per 60 weeks, once per 61 weeks, once per 62 weeks, once per 63 weeks, once per 64 weeks, once per 65 weeks, once per 66 weeks, once per 67 weeks, once per 68 weeks, once per 69 weeks, once per 70 weeks, once per 71 weeks, once per 72 weeks, once per 73 weeks, once 90. The method of any one of embodiments 1-89, comprising administering once every week, once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, once every month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months, or once every year.
[0166] Embodiment 115. The compound is administered about once every week, about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, about once every 10 weeks, about once every 11 weeks, about once every 12 weeks, about once every 13 weeks, about once every 14 weeks, about once every 15 weeks, about once every 16 weeks, about once every 17 weeks, about once every 18 weeks, about once every 19 weeks, or about once every 20 weeks. 90. The method of any one of embodiments 1-89, comprising administering the compound once every about 21 weeks, once every about 22 weeks, once every about 23 weeks, once every about 24 weeks, once every month, once every about 2 months, once every about 3 months, once every 4 months, once every about 5 months, once every about 6 months, once every about 7 months, once every 8 months, once every 9 months, once every about 10 months, once every 11 months, or once every year.
[0167] Embodiment 116. The method of any one of embodiments 1-89, comprising administering to a human subject a dose of 20 mg of the compound once every four weeks.
[0168] Embodiment 117. The method of any one of embodiments 1-89, comprising administering to a human subject a 40 mg dose of the compound once every four weeks.
[0169] Embodiment 11 The method of any one of embodiments 1-89, comprising administering to a human subject a dose of 8.70 mg of the compound once every four weeks.
[0170] Embodiment 119. The method of any one of embodiments 1-89, comprising administering to a human subject a 100 mg dose of the compound once every four weeks.
[0171] Embodiment 120. The method of any one of embodiments 1-89, comprising administering to a human subject a 20 mg dose of the compound once every 8 weeks.
[0172] Embodiment 12 The method of any one of embodiments 1-89, comprising administering to a human subject a dose of 1.40 mg of the compound once every 8 weeks.
[0173] Embodiment 12 The method of any one of embodiments 1-89, comprising administering to a human subject a dose of 2.70 mg of the compound once every 8 weeks.
[0174] Embodiment 123. The method of any one of embodiments 1-89, comprising administering to a human subject a 100 mg dose of the compound once every 8 weeks.
[0175] Embodiment 124. The method of any one of embodiments 1-89, comprising administering to a human subject a 20 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
[0176] Embodiment 12 The method of any one of embodiments 1-89, comprising administering to a human subject a 40 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
[0177] Embodiment 126. The method of any one of embodiments 1-89, comprising administering a 70 mg dose of the compound to a human subject once every 12 weeks, once every three months, or once quarterly.
[0178] Embodiment 127. The method of any one of embodiments 1-89, comprising administering to a human subject a 100 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
[0179] Embodiment 128. The method of any one of embodiments 1-89, comprising administering to a human subject a 20 mg dose of the compound once every six months or twice a year.
[0180] Embodiment 129. The method of any one of embodiments 1-89, comprising administering to a human subject a 40 mg dose of the compound once every six months or twice a year.
[0181] Embodiment 13 The method of any one of embodiments 1-89, comprising administering to a human subject a 0.70 mg dose of the compound once every six months or twice a year.
[0182] Embodiment 131. The method of any one of embodiments 1-89, comprising administering to a human subject a 100 mg dose of the compound once every six months or twice a year.
[0183] Embodiment 132. The method of any one of embodiments 1 to 131, wherein two doses of the compound are administered.
[0184] Embodiment 133. The method of any one of embodiments 1 to 131, wherein four doses of the compound are administered.
[0185] Embodiment 134. The method of any one of embodiments 1-89, comprising administering to a human subject a 100 mg dose of the compound once every two weeks for a total of three doses, followed by administering a 100 mg dose of the compound once every four weeks thereafter.
[0186] Embodiment 135. The method of any one of embodiments 1-89, comprising administering to a human subject a 70 mg dose of the compound once every two weeks for a total of three doses, followed by administering a 70 mg dose of the compound once every four weeks thereafter.
[0187] Embodiment 136. The method of any one of embodiments 1-89, comprising administering a 40 mg dose of the compound to a human subject once every two weeks for a total of three doses, followed by administering a 40 mg dose of the compound once every four weeks thereafter.
[0188] Embodiment 137. The method of any one of embodiments 1 to 89, comprising administering to a human subject a dose of 40 mg to 70 mg of the compound once every four weeks.
[0189] Embodiment 138. The method of any one of embodiments 1 to 89, comprising administering to a human subject a dose of about 40 mg to about 70 mg of the compound once every four weeks.
[0190] Embodiment 139. The method of any one of embodiments 1-89, comprising administering to a human subject a dose of 40 mg to 70 mg of the compound once every two weeks for a total of three doses, followed by administration of a dose of 40 mg to 70 mg of the compound once every four weeks thereafter.
[0191] Embodiment 140. The method of any one of embodiments 1-89, comprising administering to a human subject a dose of about 40 mg to about 70 mg of the compound once every two weeks for a total of three doses, followed by administration of a dose of about 40 mg to about 70 mg of the compound once every four weeks thereafter.
[0192] Embodiment 141. The method of embodiment 139 or embodiment 140, wherein the same amount of compound is administered for the first six administrations.
[0193] Embodiment 142. The method of any one of embodiments 1-89, comprising administering to a human subject a 70 mg dose of the compound once every four weeks for a total of three doses, followed by administering a 40 mg dose of the compound once every four weeks thereafter.
[0194] Embodiment 143. The method of any one of embodiments 1-89, comprising administering a 70 mg dose of the compound to a human subject once every four weeks for a total of three doses, followed by administering a 70 mg dose of the compound once every eight weeks thereafter.
[0195] Embodiment 144. The method of any one of embodiments 1-89, wherein the human subject is suffering from IgA nephropathy, comprising administering to the subject a first dosing regimen comprising administering a 100 mg dose of the compound once every two weeks for a total of three doses, then once every four weeks.
[0196] Embodiment 145. The method of embodiment 128, further comprising monitoring the safety or effectiveness of the dosing regimen, discontinuing administration of the first dosing regimen, and then administering to the subject a second dosing regimen comprising administering a dose of 70 mg of the compound every four weeks.
[0197] Embodiment 146. The method of any one of embodiments 90 to 145, wherein 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 doses are administered.
[0198] Embodiment 147. The method of any one of embodiments 1-89, comprising administering to the human subject an initial loading dose of 70 mg of the compound.
[0199] Embodiment 148. The method of embodiment 147, comprising administering to the human subject a second loading dose of 70 mg of the compound 4 weeks after administration of the initial loading dose.
[0200] Embodiment 149. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 40 mg of the compound 4 weeks after administration of the second loading dose.
[0201] Embodiment 150. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 40 mg of the compound 8 weeks after administration of the second loading dose.
[0202] Embodiment 151. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 40 mg of the compound 12 weeks after administration of the second loading dose.
[0203] Embodiment 152. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg, or 100 mg of the compound 4 weeks after administration of the second loading dose and every 4 weeks thereafter.
[0204] Embodiment 153. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg, or 100 mg of the compound 8 weeks after administration of the second loading dose and every 8 weeks thereafter.
[0205] Embodiment 154. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg, or 100 mg of the compound 12 weeks after administration of the second loading dose and every 12 weeks thereafter.
[0206] Embodiment 155. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg, or 100 mg of the compound 16 weeks after administration of the second loading dose and every 16 weeks thereafter.
[0207] Embodiment 156. The method of embodiment 147 or embodiment 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg, or 100 mg of the compound 24 weeks after administration of the second loading dose and every 24 weeks thereafter.
[0208] Embodiment 157. The method of any one of embodiments 149 to 156, wherein at least 2, at least 3, at least 4, at least 5, or at least 6 maintenance doses are administered to the human subject.
[0209] Embodiment 158. The method of any one of embodiments 1 to 157, wherein the compound is administered subcutaneously.
[0210] Embodiment 159. The method of embodiment 145, wherein the compound is administered by injection.
[0211] Embodiment 160. The method of any one of embodiments 1 to 159, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
[0212] Embodiment 161. The method of embodiment 160, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline, or sterile phosphate-buffered saline.
[0213] Embodiment 162. The method of any one of embodiments 1 to 161, wherein the compound is co-administered with an angiotensin-converting enzyme inhibitor, an angiotensin receptor blocker, a sodium / glucose cotransporter-2 inhibitor, an anticomplement agent, or a complement inhibitor.
[0214] Embodiment 163. A method of ameliorating IgA nephropathy, ameliorating geographic atrophy, reducing CFB protein, or reducing CFB RNA in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, subcutaneously administering to said human subject.
[0215] Embodiment 164. The method of embodiment 163, wherein the compound is a sodium salt or a potassium salt.
[0216] Embodiment 165. A method of improving IgA nephropathy, improving geographic atrophy, reducing CFB protein, or reducing CFB RNA in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: [ka] (SEQ ID NO: 4) to a human subject.
[0217] Embodiment 166. A method for ameliorating IgA nephropathy, ameliorating geographic atrophy, reducing CFB protein, or reducing CFB RNA in a human subject in need thereof, comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg, or about 70 mg of a compound having the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, mC=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0218] Embodiment 167. A method of ameliorating IgA nephropathy in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg or about 70 mg of the following chemical structure: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, subcutaneously administering to a human subject.
[0219] Embodiment 168. The method of embodiment 167, wherein the compound is a sodium salt or a potassium salt.
[0220] Embodiment 169. A method of ameliorating IgA nephropathy in a human subject in need thereof, comprising administering 70 mg or about 70 mg of the following chemical structure: [ka] (SEQ ID NO: 4) to a human subject.
[0221] Embodiment 170. A method of ameliorating IgA nephropathy in a human subject in need thereof, comprising subcutaneously administering to the human subject 70 mg or about 70 mg of a compound having the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es Tes m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0222] Embodiment 171. A method of ameliorating geographic atrophy in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: [ka] (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, subcutaneously administering to a human subject.
[0223] Embodiment 172. The method of embodiment 171, wherein the compound is a sodium salt or a potassium salt.
[0224] Embodiment 173. A method of ameliorating geographic atrophy in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: [ka] (SEQ ID NO: 4) to a human subject.
[0225] Embodiment 174. A method of ameliorating geographic atrophy in a human subject in need thereof, comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg, or about 70 mg of a compound having the following chemical designation (5' to 3'): GalNAc3-7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (wherein
[0226] Embodiment 175. The method of any one of embodiments 163-174, comprising administering the compound once every four weeks.
[0227] Embodiment 176. The method of any one of embodiments 163-174, comprising administering the compound once every 8 weeks.
[0228] Embodiment 177. The method of any one of embodiments 163-174, comprising administering the compound once every 12 weeks.
[0229] Embodiment 178. The method of any one of embodiments 163-174, comprising administering the compound once every 16 weeks.
[0230] Embodiment 179. The method of any one of embodiments 163-174, comprising administering the compound once every 24 weeks.
[0231] Embodiment 180. The method of any one of embodiments 163-174, comprising administering the compound once every six months.
[0232] Embodiment 181 The method of any one of embodiments 163-174, comprising administering the compound once every about four weeks.
[0233] Embodiment 182 The method of any one of embodiments 163-174, comprising administering the compound once every about 8 weeks.
[0234] Embodiment 183 The method of any one of embodiments 163-174, comprising administering the compound once every about 12 weeks.
[0235] Embodiment 184 The method of any one of embodiments 163-174, comprising administering the compound once every about 16 weeks.
[0236] Embodiment 185. The method of any one of embodiments 163-174, comprising administering the compound once every about 24 weeks.
[0237] Embodiment 186 The method of any one of embodiments 163-174, comprising administering the compound once every six months.
[0238] Embodiment 187. The method of any one of embodiments 163-174, comprising administering to a human subject a 40 mg dose of the compound once every four weeks.
[0239] Embodiment 188. The method of any one of 163-174, in embodiments, comprising administering to a human subject a 70 mg dose of the compound once every four weeks.
[0240] Embodiment 189. The method of any one of embodiments 163-174, comprising administering to a human subject a 100 mg dose of the compound once every four weeks.
[0241] Embodiment 190. The method of any one of embodiments 163-174, wherein the compound is administered by injection.
[0242] Embodiment 191. The method of any one of embodiments 163-190, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
[0243] Embodiment 192. The method of embodiment 191, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline, or sterile phosphate-buffered saline.
[0244] Embodiment 193. The method of any one of embodiments 163-192, wherein administering the compound reduces the level of ocular C3 deposits, reduces the accumulation of ocular C3 deposits, or slows the progression of geographic atrophy in the subject.
[0245] Embodiment 194. The method of any one of embodiments 163-192, wherein administering the compound reduces the level of plasma CFB protein, reduces serum AP activity, reduces the level of serum functional CFB, reduces the level of urinary factor B breakdown products (Ba), or reduces the level of proteinuria in the subject.
[0246] Embodiment 195. The method of embodiment 194, wherein the urinary protein / creatine ratio is reduced after administration of the compound.
[0247] Embodiment 196. The method of embodiment 194, wherein the level of urinary protein is reduced after administration of the compound.
[0248] Embodiment 197 The method of any one of embodiments 163-192, wherein administering the compound slows the progression of geographic atrophy in the subject.
[0249] Embodiment 198 The method of any one of embodiments 163-193, wherein administering the compound slows the expansion of the area of geographic atrophy.
[0250] Embodiment 199. The method of any one of embodiments 163-193, wherein administering the compound slows the spread of geographic atrophy to the foveal region.
[0251] Embodiment 200 The method of any one of embodiments 163-193, wherein administering the compound halts the expansion of geographic atrophy.
[0252] Embodiment 201. The method of any one of embodiments 1 to 200, comprising detecting the amount of CFB protein or CFB RNA in a biological sample from a human subject.
[0253] Embodiment 202. The method of embodiment 201, wherein the biological sample is blood.
[0254] Embodiment 203. The method of embodiment 102, wherein the biological sample is serum or plasma.
[0255] Embodiment 204. The method of embodiment 201, wherein the biological sample is urine.
[0256] Embodiment 205. The method of any one of embodiments 201 to 204, wherein the detection is performed before administering the compound.
[0257] Embodiment 206. The method of any one of embodiments 201 to 204 to 178, wherein the detection is performed after administering the compound.
[0258] Embodiment 207 The method of any one of embodiments 201 to 204, wherein the detection is performed before and after administering the compound.
[0259] Embodiment 208. The method of any one of embodiments 201-207, comprising adjusting the initial loading dose, loading dose, maintenance dose, or therapeutically effective amount of the compound administered after detecting the amount of CFB RNA, CFB protein, or a combination thereof.
[0260] Embodiment 209. The method of any one of embodiments 1 to 208, comprising analyzing the subject's plasma CFB protein level, serum AP activity level, serum functional CFB level, urinary factor B degradation product (Ba) level, or urinary protein level.
[0261] Embodiment 210. The method of embodiment 209, wherein the urinary protein / creatine ratio in a urine sample from the subject is analyzed after administering the compound.
[0262] Embodiment 211 The method of embodiment 209, wherein the level of urinary protein in a urine sample from the subject is analyzed after administering the compound.
[0263] Embodiment 212. The method of embodiment 210 or 211, wherein the analysis is performed before administering the compound, or after administering the compound, or a combination thereof.
[0264] Embodiment 213. The method of embodiment 212, comprising determining or adjusting the therapeutically effective amount of the compound after performing the analysis.
[0265] Embodiment 214 The method of embodiment 212 or embodiment 213, comprising administering a compound followed by performing an analysis, and adjusting the frequency of administering said compound following the analysis.
[0266] I. Complement factor B (CFB) In certain embodiments, methods for reducing CFB RNA and / or CFB protein in cells or body fluids of a subject are described herein. CFB RNA is located at 31913721-31919861 on human chromosome 6 and is encoded by the human CFB gene. CFB protein is highly expressed in the liver compared to other cell types. A representative nucleobase sequence of human CFB RNA is provided in GENBANK Accession No. NM_001710.5 (incorporated herein as SEQ ID NO: 1). A representative nucleobase sequence of the human CFB gene is provided in GENBANK Accession No. NT_007592.15, spanning nucleotides 31852000 to 31861000 (incorporated herein as SEQ ID NO: 2). A representative nucleobase sequence of the human CFB gene is provided in GENBANK Accession No. NC_000006.12, spanning nucleotides 31943001 to 31955000 (SEQ ID NO: 5). A representative nucleic acid sequence of the human CFB gene is provided in ENSEMBL Gene ID ENSG 00000243649.10, Ensembl Release 108 (October 2022) (SEQ ID NO: 6).
[0267] II. Compound 696844 In certain embodiments, compound 696844 (FB-L Rx Described herein are methods for administering 696844 to a subject in need thereof. In certain embodiments, compound 696844 is characterized as a 5-10-5 MOE gapmer covalently linked at the 5' end to a triantennary N-acetylgalactosamine (GalNAc3). Compound 696844 has the sequence (5' to 3') ATCCCACGCCCCTGTCCAGC (SEQ ID NO: 3), wherein each of nucleosides 1-5 and 16-20 is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, all of the internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0268] In certain embodiments, compound 696844 is characterized by the following chemical designation (5'-3'): GalNAc3-7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase; e=2'-MOE sugar moiety; d=2'-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc3-7 a-o’= [ka] (It is).
[0269] In certain embodiments, compound 696844 has the following chemical structure: [ka] (SEQ ID NO: 4) to a human subject.
[0270] Structure 1. Compound 696844 In certain embodiments, the sodium salt of compound 696844 has the following chemical structure: [ka] (SEQ ID NO: 4).
[0271] Structure 2. Sodium salt of compound 696844 In a specific embodiment, compound 696844 is characterized as the sodium salt of a 20-base (20-mer) oligonucleotide linked at its 5'-end to a GalNAc THA cluster via an aminohexyl phosphate linker. Each of the 19 internucleotide linkages is a 3'-O to 5'-O-phosphorothioate diester. Ten of the 20 sugar residues are 2-deoxy-D-ribose, and the remaining are 2'-O-(2-methoxyethyl)-D-ribose (MOE). The residues are arranged such that five MOE nucleosides are present at the 5' and 3' ends of the molecule flanking a gap of 10 2'-deoxynucleosides. The cytosine base is methylated at the 5-position. The sequence may be represented abbreviated as follows: 5'-THA-AH O A Me U Me C Me C Me C A Me CG Me C Me C Me C Me CTGT Me C Me CAG Me C -3'
[0272] The underlined residues are 2'-MOE nucleosides. AH indicates the position of the aminohexyl linker; o indicates a phosphodiester bond; THA is 5-N-[tris({6-[(2-acetamido-2-deoxy-β-D-galactopyranosyl)oxy]-hexylamino}-3-oxopropoxymethyl)methyl]amino-5-oxopentanoyl. 2'-O-(2-methoxyethyl)-methyluridine (2'-MOE Me U) The nucleoside may be referred to as 2'-O-(2-methoxyethyl)-ribothymidine (2'-MOET).
[0273] In certain embodiments, compound 696844 is characterized by the following nomenclature, which indicates each 3'-O-linked phosphorothioate diester internucleotide linkage as follows:
[0274] 5'-O-(6-{5-N-[tris({6-[(2-acetamido-2-deoxy-β-D-galactopyranosyl)oxy]-hexylamino}-3-oxopropoxymethyl)methyl]amino-5-oxopentanoyl}aminohexyl-1-phosphatyl)-2-O-(2-methoxyethyl)-P-thioadenylyl-(3-O5-O)-2-(2-methoxyethyl)-5-methyl-P-thiouridyl-(3-O5-O)- 2-(2-Methoxyethyl)-5-methyl-P-thiocytidylyl-(3-O5-O)-2-(2-methoxyethyl)-5-methyl-P-thiocytidylyl-(3-O5-O)-2-(2-methoxyethyl)-5-methyl-P-thiocytidylyl-(3-O5-O)-2-deoxy-P-thioadenylyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidylyl-(3-O5-O)-2-deoxy-P-thioguanyl ly-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidylyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidylyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidylyl-(3-O5-O)-2-deoxy-5-methyl-P-thiocytidylyl-(3-O5-O)-P-thiothymidylyl-(3-O5-O)-2-deoxy-P-thioguanylyl-(3-O5-O)-P-thiothymidylyl -(3-O5-O)-2-(2-methoxyethyl)-5-methyl-P-thiocytidylyl-(3-O5-O)-2-(2-methoxyethyl)-5-methyl-P-thiocytidylyl-(3-O5-O)-2-O-(2-methoxyethyl)-P-thioadenylyl-(3-O5-O)-2-(2-methoxyethyl)-P-thioguanylyl-(3-O5-O)-2-(2-methoxyethyl)-5-methylcytidine, 20 sodium salt.
[0275] In certain embodiments, the pharmaceutical composition of compound 696844 is a sterile parenteral solution of 100 mg / mL of compound 696844 in phosphate-buffered saline. The formulation contains 100 mg / mL of compound 696844, adjusted to approximately pH 7.4 using acid or base during compounding. The solution is clear, colorless to pale yellow. In certain embodiments, the pharmaceutical composition is packaged in a 0.8 mL deliverable volume in an ISO 2R Type I clear glass vial stoppered with a butyl rubber closure and sealed with an aluminum overseal. In certain embodiments, each vial is filled with approximately 1.0 mL to ensure that the labeled 0.8 mL volume is available for administration. In certain embodiments, the pharmaceutical composition is single-use and does not contain a preservative. In certain embodiments, the pharmaceutical composition is reliably stored at 2-8°C and protected from light.
[0276] Compound 696844 and pharmaceutical compositions comprising compound 696844 are described in WO 2015 / 168635.
[0277] III. CERTAIN PHARMACEUTICAL COMPOSITIONS In certain embodiments, methods are described herein for administering a pharmaceutical composition comprising compound 696844 to a subject. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists essentially of sterile saline and compound 696844. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists essentially of sterile water and compound 696844. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists essentially of phosphate-buffered saline (PBS) and compound 696844. In certain embodiments, the PBS is pharmaceutical-grade. In certain embodiments, the pharmaceutical composition comprises a specific concentration of compound 696844 in PBS and is diluted with a diluent to achieve the intended clinical dose. In certain embodiments, the diluent is sterile saline, sterile water, or PBS. In certain embodiments, the pharmaceutical composition comprises a specific concentration of compound 696844 in PBS and is diluted with PBS to achieve the intended clinical dose. In certain embodiments, compound 696844 is formulated in 100 mg / mL phosphate buffered saline (PBS). In certain embodiments, compound 696844 is formulated in 100 mg / mL PBS and is in a stoppered and sealed glass vial. In certain embodiments, compound 696844 is formulated in 100 mg / mL PBS and provided for clinical use in a deliverable volume of 0.8 mL. In certain embodiments, compound 696844 is formulated in 100 mg / mL PBS and provided for clinical use in a deliverable volume of 0.8 mL in a stoppered and sealed glass vial. In certain embodiments, compound 696844 is formulated in 100 mg / mL PBS and diluted with PBS to achieve the intended clinical dose. The term "deliverable amount" may include an additional amount of formulation to ensure a deliverable amount is available for administration. In certain embodiments, the glass vial contains 1.0 mL of formulation for a deliverable volume of 0.8 mL.
[0278] In certain embodiments, the pharmaceutical composition comprises one or more excipients and compound 696844. In certain embodiments, the excipient is selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0279] In certain embodiments, pharmaceutical compositions comprising compound 696844 include any pharmaceutically acceptable salt of compound 696844, an ester of compound 696844, or a salt of such an ester. In certain embodiments, the pharmaceutically acceptable salt comprises sodium, potassium, calcium, or magnesium. In certain embodiments, the pharmaceutically acceptable salt comprises sodium or magnesium. In certain embodiments, the pharmaceutical composition comprises one or more of sodium, potassium, calcium, or magnesium. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable salt of the compound represented by Structure 1, comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, pharmaceutical compositions comprising compound 696844 may provide (directly or indirectly) a biologically active metabolite or residue thereof upon administration to a human subject. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of compound 696844, prodrugs of compound 696844, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
[0280] In certain embodiments, pharmaceutical compositions comprise one or more lipid moieties and compound 696844. In certain embodiments, lipid moieties are used to increase distribution of compound 696844 to specific cells or tissues. In certain such methods, compound 696844 is incorporated into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed in the absence of neutral lipids.
[0281] In certain embodiments, the pharmaceutical compositions disclosed herein comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0282] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the compounds described herein to a particular tissue or cell type, for example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.
[0283] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Some such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components can be varied: for example, other surfactants can be substituted for Polysorbate 80™; the fraction size of polyethylene glycol can be changed; other biocompatible polymers can replace polyethylene glycol, e.g., polyvinylpyrrolidone; or other sugars or polysaccharides can replace dextrose.
[0284] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV)). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water, or a physiologically compatible buffer, such as phosphate-buffered saline (PBS), Hank's solution, Ringer's solution, saline buffer, or artificial CSF. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, an injectable suspension is prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are provided in unit dosage form in pre-filled syringes. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulating agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular vehicles suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
[0285] Under certain conditions, compound 696844 behaves as an acid. Although compound 696844 may be depicted or described in a protonated (free acid) form or in an ionized, cationic (salt) form, aqueous solutions of compound 696844 exist in equilibrium between such forms. For example, the phosphate bridge of compound 696844 in aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the term "compound 696844" is intended to include all such forms. Furthermore, compound 696844 has several such bonds, each in equilibrium. Thus, compound 696844 exists in solution as a collection of multiple forms in equilibrium at multiple locations. The term "compound 696844" is intended to include all such forms. Drawn structures always show a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include corresponding forms as well. As used herein, the structure of compound 696844 shown as the free acid followed by the term "or a salt thereof" expressly includes all such forms, whether fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.
[0286] In certain embodiments, compound 696844 is in an aqueous solution comprising sodium. In certain embodiments, compound 696844 is in an aqueous solution comprising potassium. In certain embodiments, compound 696844 is in PBS. In certain embodiments, compound 696844 is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0287] Specific doses are described herein. For clarity, the dose of compound 696844 in milligrams refers to the mass of the free acid form of compound 696844. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dose, compound 696844 is assumed to exist as an anhydrous free acid without solvent or sodium acetate. For example, when compound 696844 is in a sodium-containing solution (e.g., saline), compound 696844 may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still counted toward the dose weight, and the mass of the Na+ ions is not. Thus, for example, a dose of 40 mg of compound 696844 is equal to the number of fully protonated molecules weighing 40 mg. This is equivalent to 40.93 mg of solvent-free, sodium acetate-free anhydrous sodiated compound 696844. Similarly, a dose of 70 mg of Compound 696844 is equal to the number of fully protonated molecules weighing 70 mg, which is equivalent to 73.37 mg of neat, sodium acetate-free anhydrous sodiated Compound 696844.
[0288] IV. Fixed Dosage In certain embodiments, methods are described herein for administering a therapeutically effective amount of compound 696844 to a subject. In certain embodiments, the therapeutically effective amount is 10 mg. In certain embodiments, the therapeutically effective amount is 20 mg. In certain embodiments, the therapeutically effective amount is 40 mg. In certain embodiments, the therapeutically effective amount is 70 mg. In certain embodiments, the therapeutically effective amount is 100 mg.
[0289] In certain embodiments, the therapeutically effective amount is 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 200 mg, 210 mg, 220 mg, 230 mg, 240 mg, 250 mg, 260 mg, 270 mg, 280 mg, 290 mg, 300 mg, 310 mg, 320 mg, 330 mg, 340 mg, 350 mg, 360 mg, 370 mg, 380 mg, 390 mg, 400 mg, 410 mg, 420 mg, 430 mg, 440 mg, 450 mg, 460 mg, 470 mg, 480 mg, 490 mg, 500 mg, 510 mg, 520 mg, 530 mg, 540 mg, 550 mg, 560 mg, 570 mg, 580 mg, 590 mg, 600 mg, 610 mg, 620 mg, 630 mg, 640 mg, 650 mg, 660 mg, 670 mg, 680 mg 85mg, 190mg, 195mg, 200mg, 205mg, 210mg, 215mg, 220mg, 225mg, 230mg, 235mg, 240mg, 245mg, 250mg, 255mg, 260mg, 265mg, 270mg, 275mg, 280mg, 285mg, 290mg, 295mg, 300mg, 305mg, 310mg, 315mg, 320mg, 325mg, 330mg, 335mg, 340mg, 345mg, and 350mg.
[0290] In certain embodiments, the therapeutically effective amount is about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, The amount is any of about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, about 300 mg, about 305 mg, about 310 mg, about 315 mg, about 320 mg, about 325 mg, about 330 mg, about 335 mg, about 340 mg, about 345 mg, and about 350 mg.
[0291] In certain embodiments, the therapeutically effective amount is 10 mg, 10.1 mg, 10.2 mg, 10.3 mg, 10.4 mg, 10.5 mg, 10.6 mg, 10.7 mg, 10.8 mg, 10.9 mg, 11 mg, 11.1 mg, 11.2 mg, 11.3 mg, 11.4 mg, 11.5 mg, 11.6 mg, 11.7 mg, 11.8 mg, 11.9 mg, 12 mg, 12.1 mg, 12.2 mg, 12.3 mg, 12.4 mg, 12.5 mg, 12.6 mg, 12.7 mg, 12.8 mg, 12.9 mg, 13 mg, 13.1 mg, 13.2 mg, 13.3 mg, 13.4 mg, 13.5 mg, 13.6 mg, 13.7 mg, 13.8 mg, 13.9 mg, 14.0 mg, 14.1 mg, 14.2 mg, 14.3 mg, 14.4 mg, 14.5 mg, 14.6 mg, 14.7 mg, 14.8 mg, 14.9 mg, 15.0 mg, 15.1 mg, 15.2 mg, 15.3 mg, 15.4 mg, 15.5 mg, 15.6 mg, 15.7 mg, 15.8 mg, 15.9 mg, 16.1 mg, 16.2 mg, 16.3 mg, 16.4 mg, 16.5 mg, 16.6 mg, 16.7 mg, 16.8 mg, 16.9 mg, 17.1 mg, 17.2 mg, 17.3 mg, 17.4 .4mg, 13.5mg, 13.6mg, 13.7mg, 13.8mg, 13.9mg, 14mg, 14.1mg, 14.2mg, 14.3mg, 14.4mg, 14.5mg, 14.6mg, 14.7mg, 14.8mg, 14.9mg, 15mg, 15.1mg, 15.2m g, 15.3mg, 15.4mg, 15.5mg, 15.6mg, 15.7mg, 15.8mg, 15.9mg, 16mg, 16.1mg, 16.2mg, 16.3mg, 16.4mg, 16.5mg, 16.6mg, 16.7mg, 16.8mg, 16.9mg, 17mg, 1 7.1mg, 17.2mg, 17.3mg, 17.4mg, 17.5mg, 17.6mg, 17.7mg, 17.8mg, 17.9mg, 18mg, 18.1mg, 18.2mg, 18.3mg, 18.4mg, 18.5mg, 18.6mg, 18.7mg, 18.8mg, 1 8.9mg, 19mg, 19.1mg, 19.2mg, 19.3mg, 19.4mg, 19.5mg, 19.6mg, 19.7mg, 19.8mg, 19.9mg, 20mg, 20.1mg, 20.2mg, 20.3mg, 20.4mg, 20.5mg, 20.6mg, 20.7 mg, 20.8mg, 20.9mg, 21mg, 21.1mg, 21.2mg, 21.3mg, 21.4mg, 21.5mg, 21.6mg, 21.7mg, 21.8mg, 21.9mg, 22mg, 22.1mg, 22.2mg, 22.3mg, 22.4mg, 22.5mg, 22.6mg, 22.7mg, 22.8mg, 22.9mg, 23mg, 23.1mg, 23.2mg, 23.3mg, 23.4mg, 23.5mg, 23.6mg, 23.7mg, 23.8mg, 23.9mg, 24mg, 24.1mg, 24.2mg, 24.3mg, 24.4mg、24.5mg、24.6mg、24.7mg、24.8mg、24.9mg、25mg、25.1mg、25.2mg、25.3mg、25.4mg、25.5mg、25.6mg、25.7mg、25.8mg、25.9mg、26mg、26.1mg、26.2mg、26.3mg、26.4mg、26.5mg、26.6mg、26.7mg、26.8mg、26.9mg、27mg、27.1mg、27.2mg、27.3mg、27.4mg、27.5mg、27.6mg、27.7mg、27.8mg、27.9mg、28mg、28.1mg、28.2mg、28.3mg、28.4mg、28.5mg、28.6mg、28.7mg、28.8mg、28.9mg、29mg、29.1mg、29.2mg、29.3mg、29.4mg、29.5mg、29.6mg、29.7mg、29.8mg、29.9mg、30mg、30.1mg、30.2mg、30.3mg、30.4mg、30.5mg、30.6mg、30.7mg、30.8mg、30.9mg、31mg、31.1mg、31.2mg、31.3mg、31.4mg、31.5mg、31.6mg、31.7mg、31.8mg、31.9mg、32mg、32.1mg、32.2mg、32.3mg、32.4mg、32.5mg、32.6mg、32.7mg、32.8mg、32.9mg、33mg、33.1mg、33.2mg、33.3mg、33.4mg、33.5mg、33.6mg、33.7mg、33.8mg、33.9mg、34mg、34.1mg、34.2mg、34.3mg、34.4mg、34.5mg、34.6mg、34.7mg、34.8mg、34.9mg、35mg、35.1mg、35.2mg、35.3mg、35.4mg、35.5mg、35.6mg、35.7mg、35.8mg、35.9mg、36mg、36.1mg、36.2mg、36.3mg、36.4mg、36.5mg、36.6mg、36.7mg、36.8mg、36.9mg、37mg、37.1mg、37.2mg、37.3mg、37.4mg、37.5mg、37.6mg、37.7mg、37.8mg、37.9mg、38mg、38.1mg、38.2mg、38.3mg、38.4mg、38.5mg、38.6mg、38.7mg、38.8mg、38.9mg、39mg、39.1mg、39.2mg、39.3mg、39.4mg、39.5mg、39.6mg、39.7mg、39.8mg、39.9mg、40mg、40.1mg、40.2mg、40.3mg、40.4mg、40.5mg、40.6mg、40.7mg、40.8mg、40.9mg、41mg、41.1mg、41.2mg、41.3mg、41.4mg、41.5mg、41.6mg、41.7mg、41.8mg、41.9mg、42mg、42.1mg、42.2mg、42.3mg、42.4mg、42.5mg、42.6mg、42.7mg、42.8mg、42.9mg、43mg、43.1mg、43.2mg、43.3mg、43.4mg、43.5mg、43.6mg、43.7mg、43.8mg、43.9mg、44mg、44.1mg、44.2mg、44.3mg、44.4mg、44.5mg、44.6mg、44.7mg、44.8mg、44.9mg、45mg、45.1mg、45.2mg、45.3mg、45.4mg、45.5mg、45.6mg、45.7mg、45.8mg、45.9mg、46mg、46.1mg、46.2mg、46.3mg、46.4mg、46.5mg、46.6mg、46.7mg、46.8mg、46.9mg、47mg、47.1mg、47.2mg、47.3mg、47.4mg、47.5mg、47.6mg、47.7mg、47.8mg、47.9mg、48mg、48.1mg、48.2mg、48.3mg、48.4mg、48.5mg、48.6mg、48.7mg、48.8mg、48.9mg、49mg、49.1mg、49.2mg、49.3mg、49.4mg、49.5mg、49.6mg、49.7mg、49.8mg、49.9mg、50mg、50.1mg、50.2mg、50.3mg、50.4mg、50.5mg、50.6mg、50.7mg、50.8mg、50.9mg、51mg、51.1mg、51.2mg、51.3mg、51.4mg、51.5mg、51.6mg、51.7mg、51.8mg、51.9mg、52mg、52.1mg、52.2mg、52.3mg、52.4mg、52.5mg、52.6mg、52.7mg、52.8mg、52.9mg、53mg、53.1mg、53.2mg、53.3mg、53.4mg、53.5mg、53.6mg、53.7mg、53.8mg、53.9mg、54mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68mg、68.1mg、68.2mg、68.3mg、68.4mg、68.The dosages are 5mg, 68.6mg, 68.7mg, 68.8mg, 68.9mg, 69mg, 69.1mg, 69.2mg, 69.3mg, 69.4mg, 69.5mg, 69.6mg, 69.7mg, 69.8mg, 69.9mg, and 70mg.
[0292] In certain embodiments, the therapeutically effective amount is about 10 mg, about 10.1 mg, about 10.2 mg, about 10.3 mg, about 10.4 mg, about 10.5 mg, about 10.6 mg, about 10.7 mg, about 10.8 mg, about 10.9 mg, about 11 mg, about 11.1 mg, about 11.2 mg, about 11.3 mg, about 11.4 mg, about 11.5 mg, about 11.6 mg, about 11.7 mg, about 11.8 mg, about 11.9 mg, about 12 mg, about 12.1 mg, about 12.2 mg, about 12.3 mg, about 12.4 mg, about 12.5 mg, about 12.6 mg, about 12.7 mg, about 12.8 mg, about 12.9 mg, about 13.0 mg, about 13.1 mg, about 13.2 mg, about 13.4 mg, about 13.5 mg, about 13.6 mg, about 13.7 mg, about 13.8 mg, about 13.9 mg, about 14.0 mg, about 14.1 mg, about 14.2 mg, about 14.3 mg, about 14.4 mg, about 14.5 mg, about 14.6 mg, about 14.7 mg, about 14.8 mg, about 14.9 ... mg, approx. 13mg, approx. 13.1mg, approx. 13.2mg, approx. 13.3mg, approx. 13.4mg, approx. 13.5mg, approx. 13.6mg, approx. 13.7mg, approx. mg, approx. 14.6 mg, approx. 14.7 mg, approx. 14.8 mg, approx. 14.9 mg, approx. 15 mg, approx. 15.1 mg, approx. 15.2 mg, approx. 15.3 mg, approx. 15.4 mg, approx. g, approx. 16.2 mg, approx. 16.3 mg, approx. 16.4 mg, approx. 16.5 mg, approx. 16.6 mg, approx. 16.7 mg, approx. 16.8 mg, approx. 16.9 mg, approx. 17 mg, approx. 7mg, about 17.8mg, about 17.9mg, about 18mg, about 18.1mg, about 18.2mg, about 18.3mg, about 18.4mg, about 18.5mg, about 18.6mg, about 18.7mg, about 18.8mg, about 18.9mg, about 19mg, about 19.1mg, about 19.2mg, about 19.3 mg, approx. 19.4 mg, approx. 19.5 mg, approx. 19.6 mg, approx. 19.7 mg, approx. 19.8 mg, approx. 19.9 mg, approx. 20 mg, approx. 20.1 mg, approx. .9mg, about 21mg, about 21.1mg, about 21.2mg, about 21.3mg, about 21.4mg, about 21.5mg, about 21.6mg, about 21.7mg, about 21.8mg, about 21.9mg, about 22mg, about 22.1mg, about 22.2mg, about 22.3mg, about 22.4mg, about 22.5mg, approximately 22.6mg, approximately 22.7mg, approximately 22.8mg, approximately 22.9mg, approximately 23mg, approximately 23.1mg, approximately 23.2mg, approximately 23.3mg, approximately 23.4mg, approximately 23.5mg, approximately 23.6mg, approximately 23.7mg, approximately 23.8mg, approximately 23.9mg, approximately 24mg, approximately 24.1mg, approximately 24.2mg, approximately 24.3mg, approximately 24.4mg, approximately 24.5mg, approximately 24.6mg, approximately 24.7mg, approximately 24.8mg, approximately 24.9mg, approximately 25mg, approximately 25.1mg, approximately 25.2mg, approximately 25.3mg, approximately 25.4mg, approximately 25.5mg, approximately 25.6mg, approximately 25 0.7mg, approximately 25.8mg, approximately 25.9mg, approximately 26mg, approximately 26.1mg, approximately 26.2mg, approximately 26.3mg, approximately 26.4mg, approximately 26.5mg, approximately 26.6mg, approximately 26.7mg, approximately 26.8mg, approximately 26.9mg, approximately 27mg, approximately 27.1mg, approximately 27.2mg, approximately 27.3mg, approximately 27.4mg, approximately 27.5mg, approximately 27.6mg, approximately 27.7mg, approximately 27.8mg, approximately 27.9mg, approximately 28mg, approximately 28.1mg, approximately 28.2mg, approximately 28.3mg, approximately 28.4mg, approximately 28.5mg, approximately 28.6mg, approximately 28.7mg, approximately 28.8mg, approximately 28 0.9mg, approximately 29mg, approximately 29.1mg, approximately 29.2mg, approximately 29.3mg, approximately 29.4mg, approximately 29.5mg, approximately 29.6mg, approximately 29.7mg, approximately 29.8mg, approximately 29.9mg, approximately 30mg, approximately 30.1mg, approximately 30.2mg, approximately 30.3mg, approximately 30.4mg, approximately 30.5mg, approximately 30.6mg, approximately 30.7mg, approximately 30.8mg, approximately 30.9mg, approximately 31mg, approximately 31.1mg, approximately 31.2mg, approximately 31.3mg, approximately 31.4mg, approximately 31.5mg, approximately 31.6mg, approximately 31.7mg, approximately 31.8mg, approximately 31.9mg, approximately 32mg, approximately 32mg. 1mg, approximately 32.2mg, approximately 32.3mg, approximately 32.4mg, approximately 32.5mg, approximately 32.6mg, approximately 32.7mg, approximately 32.8mg, approximately 32.9mg, approximately 33mg, approximately 33.1mg, approximately 33.2mg, approximately 33.3mg, approximately 33.4mg, approximately 33.5mg, approximately 33.6mg, approximately 33.7mg, approximately 33.8mg, approximately 33.9mg, approximately 34mg, approximately 34.1mg, approximately 34.2mg, approximately 34.3mg, approximately 34.4mg, approximately 34.5mg, approximately 34.6mg, approximately 34.7mg, approximately 34.8mg, approximately 34.9mg, approximately 35mg, approximately 35.1mg, approximately 35.2mg, approximately 35mg.3mg, about 35.4mg, about 35.5mg, about 35.6mg, about 35.7mg, about 35.8mg, about 35.9mg, about 36mg, about 36.1mg, about 36.2mg, about 36.3mg, about 36.4mg, about 36.5mg, about 36.6mg, about 36.7mg, about 36.8mg, about 3 6.9mg, about 37mg, about 37.1mg, about 37.2mg, about 37.3mg, about 37.4mg, about 37.5mg, about 37.6mg, about 37.7mg, about 37.8mg, about 37.9mg, about 38mg, about 38.1mg, about 38.2mg, about 38.3mg, about 38.4mg, about 38 .5mg, about 38.6mg, about 38.7mg, about 38.8mg, about 38.9mg, about 39mg, about 39.1mg, about 39.2mg, about 39.3mg, about 39.4mg, about 39.5mg, about 39.6mg, about 39.7mg, about 39.8mg, about 39.9mg, about 40mg, about 40.1mg, about 40.2mg, about 40.3mg, about 40.4mg, about 40.5mg, about 40.6mg, about 40.7mg, about 40.8mg, about 40.9mg, about 41mg, about 41.1mg, about 41.2mg, about 41.3mg, about 41.4mg, about 41.5mg, about 41.6mg, about 41 .7mg, approximately 41.8mg, approximately 41.9mg, approximately 42mg, approximately 42.1mg, approximately 42.2mg, approximately 42.3mg, approximately 42.4mg, approximately 42.5mg, approximately 42.6mg, approximately 42.7mg, approximately 42.8mg, approximately 42.9mg, approximately 43mg, approximately 43.1mg, approximately 43.2mg, approximately 43.3mg, approximately 43.4mg, approximately 43.5mg, approximately 43.6mg, approximately 43.7mg, approximately 43.8mg, approximately 43.9mg, approximately 44mg, approximately 44.1mg, approximately 44.2mg, approximately 44.3mg, approximately 44.4mg, approximately 44.5mg, approximately 44.6mg, approximately 44.7mg, approximately 44.8mg, approximately 4 4.9mg, approximately 45mg, approximately 45.1mg, approximately 45.2mg, approximately 45.3mg, approximately 45.4mg, approximately 45.5mg, approximately 45.6mg, approximately 45.7mg, approximately 45.8mg, approximately 45.9mg, approximately 46mg, approximately 46.1mg, approximately 46.2mg, approximately 46.3mg, approximately 46.4mg, approximately 46.5mg, approximately 46.6mg, approximately 46.7mg, approximately 46.8mg, approximately 46.9mg, approximately 47mg, approximately 47.1mg, approximately 47.2mg, approximately 47.3mg, approximately 47.4mg, approximately 47.5mg, approximately 47.6mg, approximately 47.7mg, approximately 47.8mg, approximately 47.9mg, approximately 48mg, approximately 48.1mg, approximately 48.2mg, approximately 48.3mg, approximately 48.4mg, approximately 48.5mg, approximately 48.6mg, approximately 48.7mg, approximately 48.8mg, approximately 48.9mg, approximately 49mg, approximately 49.1mg, approximately 49.2mg, approximately 49.3mg, approximately 49.4mg, approximately 49.5mg, approximately 49.6mg, approximately 49.7mg, approximately 49.8mg, approximately 49.9mg, approximately 50mg, approximately 50.1mg, approximately 50.2mg, approximately 50.3mg, approximately 50.4mg, approximately 50.5mg, approximately 50.6mg, approximately 50.7mg, approximately 50.8mg, approximately 50.9mg, approximately 51mg, approximately 51.1mg, approximately 51.2mg, approximately 51. 51.4mg, 51.5mg, 51.6mg, 51.7mg, 51.8mg, 51.9mg, 52mg, 52.1mg, 52.2mg, 52.3mg, 52.4mg, 52.5mg, 52.6mg, 52.7mg, 52.8mg, 52 .9mg, 53mg, 53.1mg, 53.2mg, 53.3mg, 53.4mg, 53.5mg, 53.6mg, 53.7mg, 53.8mg, 53.9mg, 54mg, 54.1mg, 54.2mg, 54.3mg, 54.4mg, 54. 5mg, approximately 54.6mg, approximately 54.7mg, approximately 54.8mg, approximately 54.9mg, approximately 55mg, approximately 55.1mg, approximately 55.2mg, approximately 55.3mg, approximately 55.4mg, approximately 55.5mg, approximately 55.6mg, approximately 55.7mg, approximately 55.8mg, approximately 55.9mg, approximately 56mg, approximately 56.1mg, approximately 56.2mg, approximately 56.3mg, approximately 56.4mg, approximately 56.5mg, approximately 56.6mg, approximately 56.7mg, approximately 56.8mg, approximately 56.9mg, approximately 57mg, approximately 57.1mg, approximately 57.2mg, approximately 57.3mg, approximately 57.4mg, approximately 57.5mg, approximately 57.6mg, approximately 57. 7mg, approximately 57.8mg, approximately 57.9mg, approximately 58mg, approximately 58.1mg, approximately 58.2mg, approximately 58.3mg, approximately 58.4mg, approximately 58.5mg, approximately 58.6mg, approximately 58.7mg, approximately 58.8mg, approximately 58.9mg, approximately 59mg, approximately 59.1mg, approximately 59.2mg, approximately 59.3mg, approximately 59.4mg, approximately 59.5mg, approximately 59.6mg, approximately 59.7mg, approximately 59.8mg, approximately 59.9mg, approximately 60mg, approximately 60.1mg, approximately 60.2mg, approximately 60.3mg, approximately 60.4mg, approximately 60.5mg, approximately 60.6mg, approximately 60.7mg, approximately 60.8mg, approximately 60.9mg, approximately 61mg, approximately 61.1mg, approximately 61.2mg, approximately 61.3mg, approximately 61.4mg, approximately 61.5mg, approximately 61.6mg, approximately 61.7mg, approximately 61.8mg, approximately 61.9mg, approximately 62mg, approximately 62.1mg, approximately 62.2mg, approximately 62.3mg, approximately 62.4mg, approximately 62.5mg, approximately 62.6mg, approximately 62.7mg, approximately 62.8mg, approximately 62.9mg, approximately 63mg, approximately 63.1mg, approximately 63.2 mg, about 63.3mg, about 63.4mg, about 63.5mg, about 63.6mg, about 63.7mg, about 63.8mg, about 63.9mg, about 64mg, about 64.1mg, about 64.2mg, about 64.3mg, About 64.4mg, about 64.5mg, about 64.6mg, about 64.7mg, about 64.8mg, about 64.9mg, about 65mg, about 65.1mg, about 65.2mg, about 65.3mg, about 65.4mg, about 65. 5mg, about 65.6mg, about 65.7mg, about 65.8mg, about 65.9mg, about 66mg, about 66.1mg, about 66.2mg, about 66.3mg, about 66.4mg, about 66.5mg, about 66.6mg , about 66.7mg, about 66.8mg, about 66.9mg, about 67mg, about 67.1mg, about 67.2mg, about 67.3mg, about 67.4mg, about 67.5mg, about 67.6mg, about 67.7mg, about 67 0.8 mg, about 67.9 mg, about 68 mg, about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, and about 69.9 mg.
[0293] In certain embodiments, the therapeutically effective amount is 70 mg, 70.1 mg, 70.2 mg, 70.3 mg, 70.4 mg, 70.5 mg, 70.6 mg, 70.7 mg, 70.8 mg, 70.9 mg, 71 mg, 71.1 mg, 71.2 mg, 71.3 mg, 71.4 mg, 71.5 mg, 71.6 mg, 71.7 mg, 71.8 mg, 71.9 mg, 72 mg, 72.1 mg, 72.2 mg, 72.3 mg, 72.4 mg, 72.5 mg, 72.6 mg, 72.7 mg, 72.8 mg, 72.9 mg, 73 mg, 73.1 mg, 73.2 mg, 73.3 mg, 73.4 mg, 73.5 mg, 73.6 mg, 73.7 mg, 73.8 mg, 73.9 mg, 74 mg, 74.10 mg, 74.11 mg, 74.12 mg, 74.13 mg, 74.14 mg, 74.15 mg, 74.16 mg, 74.17 mg, 74.18 mg, 74.19 mg, 74.20 mg, 74.21 mg, 74.22 mg, 74.23 mg, 74.24 mg, 74.25 mg, 74.26 mg, 74.27 mg, 74.28 mg, 74.29 mg, 75 ... .4mg, 73.5mg, 73.6mg, 73.7mg, 73.8mg, 73.9mg, 74mg, 74.1mg, 74.2mg, 74.3mg, 74.4mg, 74.5mg, 74.6mg, 74.7mg, 74.8mg, 74.9mg, 75mg, 75.1mg, 75.2m g, 75.3mg, 75.4mg, 75.5mg, 75.6mg, 75.7mg, 75.8mg, 75.9mg, 76mg, 76.1mg, 76.2mg, 76.3mg, 76.4mg, 76.5mg, 76.6mg, 76.7mg, 76.8mg, 76.9mg, 77mg, 7 7.1mg, 77.2mg, 77.3mg, 77.4mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78mg, 78.1mg, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg, 7 8.9mg, 79mg, 79.1mg, 79.2mg, 79.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9mg, 80mg, 80.1mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7 mg, 80.8mg, 80.9mg, 81mg, 81.1mg, 81.2mg, 81.3mg, 81.4mg, 81.5mg, 81.6mg, 81.7mg, 81.8mg, 81.9mg, 82mg, 82.1mg, 82.2mg, 82.3mg, 82.4mg, 82.5mg, 82.6mg, 82.7mg, 82.8mg, 82.9mg, 83mg, 83.1mg, 83.2mg, 83.3mg, 83.4mg, 83.5mg, 83.6mg, 83.7mg, 83.8mg, 83.9mg, 84mg, 84.1mg, 84.2mg, 84.3mg, 84.4mg、84.5mg、84.6mg、84.7mg、84.8mg、84.9mg、85mg、85.1mg、85.2mg、85.3mg、85.4mg、85.5mg、85.6mg、85.7mg、85.8mg、85.9mg、86mg、86.1mg、86.2mg、86.3mg、86.4mg、86.5mg、86.6mg、86.7mg、86.8mg、86.9mg、87mg、87.1mg、87.2mg、87.3mg、87.4mg、87.5mg、87.6mg、87.7mg、87.8mg、87.9mg、88mg、88.1mg、88.2mg、88.3mg、88.4mg、88.5mg、88.6mg、88.7mg、88.8mg、88.9mg、89mg、89.1mg、89.2mg、89.3mg、89.4mg、89.5mg、89.6mg、89.7mg、89.8mg、89.9mg、90mg、90.1mg、90.2mg、90.3mg、90.4mg、90.5mg、90.6mg、90.7mg、90.8mg、90.9mg、91mg、91.1mg、91.2mg、91.3mg、91.4mg、91.5mg、91.6mg、91.7mg、91.8mg、91.9mg、92mg、92.1mg、92.2mg、92.3mg、92.4mg、92.5mg、92.6mg、92.7mg、92.8mg、92.9mg、93mg、93.1mg、93.2mg、93.3mg、93.4mg、93.5mg、93.6mg、93.7mg、93.8mg、93.9mg、94mg、94.1mg、94.2mg、94.3mg、94.4mg、94.5mg、94.6mg、94.7mg、94.8mg、94.9mg、95mg、95.1mg、95.2mg、95.3mg、95.4mg、95.5mg、95.6mg、95.7mg、95.8mg、95.9mg、96mg、96.1mg、96.2mg、96.3mg、96.4mg、96.5mg、96.6mg、96.7mg、96.8mg、96.9mg、97mg、97.1mg、97.2mg、97.3mg、97.4mg、97.5mg、97.6mg、97.7mg、97.8mg、97.9mg、98mg、98.1mg、98.2mg、98.3mg、98.4mg、98.5mg、98.6mg、98.7mg、98.8mg、98.9mg、99mg、99.The dosages are 1mg, 99.2mg, 99.3mg, 99.4mg, 99.5mg, 99.6mg, 99.7mg, 99.8mg, and 99.9mg.
[0294] In certain embodiments, the therapeutically effective amount is about 70 mg, about 70.1 mg, about 70.2 mg, about 70.3 mg, about 70.4 mg, about 70.5 mg, about 70.6 mg, about 70.7 mg, about 70.8 mg, about 70.9 mg, about 71 mg, about 71.1 mg, about 71.2 mg, about 71.3 mg, about 71.4 mg, about 71.5 mg, about 71.6 mg, about 71.7 mg, about 71.8 mg, about 71.9 mg, about 72 mg, about 72.1 mg, about 72.2 mg, about 72.3 mg, about 72.4 mg, about 72.5 mg, about 72.6 mg, about 72.7 mg, about 72.8 mg, about 72.9 ... mg, approx. 73 mg, approx. 73.1 mg, approx. 73.2 mg, approx. 73.3 mg, approx. 73.4 mg, approx. 73.5 mg, approx. 73.6 mg, approx. 73.7 mg, approx. 73.8 mg, approx. mg, approx. 74.6 mg, approx. 74.7 mg, approx. 74.8 mg, approx. 74.9 mg, approx. 75 mg, approx. 75.1 mg, approx. 75.2 mg, approx. 75.3 mg, approx. 75.4 mg, approx. g, approx. 76.2 mg, approx. 76.3 mg, approx. 76.4 mg, approx. 76.5 mg, approx. 76.6 mg, approx. 76.7 mg, approx. 76.8 mg, approx. 76.9 mg, approx. 77 mg, approx. 7mg, about 77.8mg, about 77.9mg, about 78mg, about 78.1mg, about 78.2mg, about 78.3mg, about 78.4mg, about 78.5mg, about 78.6mg, about 78.7mg, about 78.8mg, about 78.9mg, about 79mg, about 79.1mg, about 79.2mg, about 79.3 mg, approx. 79.4 mg, approx. 79.5 mg, approx. 79.6 mg, approx. 79.7 mg, approx. 79.8 mg, approx. 79.9 mg, approx. 80 mg, approx. 80.1 mg, approx. .9mg, about 81mg, about 81.1mg, about 81.2mg, about 81.3mg, about 81.4mg, about 81.5mg, about 81.6mg, about 81.7mg, about 81.8mg, about 81.9mg, about 82mg, about 82.1mg, about 82.2mg, about 82.3mg, about 82.4mg, about 82.5mg, about 82.6mg, about 82.7mg, about 82.8mg, about 82.9mg, about 83mg, about 83.1mg, about 83.2mg, about 83.3mg, about 83.4mg, about 83.5mg, about 83.6mg, about 83.7mg, about 83.8mg, about 83.9mg, about 84mg, about 84.1mg, about 84.2mg, about 84.3mg, about 84.4mg, about 84.5mg, about 84.6mg, about 84.7mg, about 84.8mg, about 84.9mg, about 85mg, about 85.1mg, about 85.2mg, about 85.3mg, about 85.4mg, about 85.5mg, about 85.6mg, about 85 .7mg, approximately 85.8mg, approximately 85.9mg, approximately 86mg, approximately 86.1mg, approximately 86.2mg, approximately 86.3mg, approximately 86.4mg, approximately 86.5mg, approximately 86.6mg, approximately 86.7mg, approximately 86.8mg, approximately 86.9mg, approximately 87mg, approximately 87.1mg, approximately 87.2mg, approximately 87.3mg, approximately 87.4mg, approximately 87.5mg, approximately 87.6mg, approximately 87.7mg, approximately 87.8mg, approximately 87.9mg, approximately 88mg, approximately 88.1mg, approximately 88.2mg, approximately 88.3mg, approximately 88.4mg, approximately 88.5mg, approximately 88.6mg, approximately 88.7mg, approximately 88.8mg, approximately 88 .9mg, approximately 89mg, approximately 89.1mg, approximately 89.2mg, approximately 89.3mg, approximately 89.4mg, approximately 89.5mg, approximately 89.6mg, approximately 89.7mg, approximately 89.8mg, approximately 89.9mg, approximately 90mg, approximately 90.1mg, approximately 90.2mg, approximately 90.3mg, approximately 90.4mg, approximately 90.5mg, approximately 90.6mg, approximately 90.7mg, approximately 90.8mg, approximately 90.9mg, approximately 91mg, approximately 91.1mg, approximately 91.2mg, approximately 91.3mg, approximately 91.4mg, approximately 91.5mg, approximately 91.6mg, approximately 91.7mg, approximately 91.8mg, approximately 91.9mg, approximately 92mg, approximately 92. 1mg, about 92.2mg, about 92.3mg, about 92.4mg, about 92.5mg, about 92.6mg, about 92.7mg, about 92.8mg, about 92.9mg, about 93mg, about 93.1mg, about 93.2mg, about 93.3mg, about 93.4mg, about 93.5mg, about 93.6mg, about 93 .7mg, about 93.8mg, about 93.9mg, about 94mg, about 94.1mg, about 94.2mg, about 94.3mg, about 94.4mg, about 94.5mg, about 94.6mg, about 94.7mg, about 94.8mg, about 94.9mg, about 95mg, about 95.1mg, about 95.2mg, about 95.3mg, about 95.4mg, about 95.5mg, about 95.6mg, about 95.7mg, about 95.8mg, about 95.9mg, about 96mg, about 96.1mg, about 96.2mg, about 96.3mg, about 96.4mg, about 96 .5mg, about 96.6mg, about 96.7mg, about 96.8mg, about 96.9mg, about 97mg, about 97.1mg, about 97.2mg, about 97.3mg, about 97.4mg, about 97.5mg, about 97.6mg, about 97 0.7 mg, about 97.8 mg, about 97.9 mg, about 98 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg, about 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg, and about 99.9 mg.
[0295] In certain embodiments, the therapeutically effective amount is 100 mg, 100.1 mg, 100.2 mg, 100.3 mg, 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102 mg, 102.1 mg, 102.2 mg, 102.3 mg, 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 ... mg, 103mg, 103.1mg, 103.2mg, 103.3mg, 103.4mg, 103.5mg, 103.6mg, 103.7mg, 103.8mg, 103.9mg, 104mg, 104.1mg, 104.2mg, 104.3mg, 104.4mg, 104.5 mg, 104.6mg, 104.7mg, 104.8mg, 104.9mg, 105mg, 105.1mg, 105.2mg, 105.3mg, 105.4mg, 105.5mg, 105.6mg, 105.7mg, 105.8mg, 105.9mg, 106mg, 106.1m g. 7mg, 107.8mg, 107.9mg, 108mg, 108.1mg, 108.2mg, 108.3mg, 108.4mg, 108.5mg, 108.6mg, 108.7mg, 108.8mg, 108.9mg, 109mg, 109.1mg, 109.2mg, 109.3 mg, 109.4mg, 109.5mg, 109.6mg, 109.7mg, 109.8mg, 109.9mg, 110mg, 110.1mg, 110.2mg, 110.3mg, 110.4mg, 110.5mg, 110.6mg, 110.7mg, 110.8mg, 110 .9mg, 111mg, 111.1mg, 111.2mg, 111.3mg, 111.4mg, 111.5mg, 111.6mg, 111.7mg, 111.8mg, 111.9mg, 112mg, 112.1mg, 112.2mg, 112.3mg, 112.4mg, 112.5mg, 112.6mg, 112.7mg, 112.8mg, 112.9mg, 113mg, 113.1mg, 113.2mg, 113.3mg, 113.4mg, 113.5mg, 113.6mg, 113.7mg, 113.8mg, 113.9mg, 114mg, 114 .1mg, 114.2mg, 114.3mg, 114.4mg, 114.5mg, 114.6mg, 114.7mg, 114.8mg, 114.9mg, 115mg, 115.1mg, 115.2mg, 115.3mg, 115.4mg, 115.5mg, 115.6mg, 1 15.7mg, 115.8mg, 115.9mg, 116mg, 116.1mg, 116.2mg, 116.3mg, 116.4mg, 116.5mg, 116.6mg, 116.7mg, 116.8mg, 116.9mg, 117mg, 117.1mg, 117.2mg, 117.3mg, 117.4mg, 117.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118mg, 118.1mg, 118.2mg, 118.3mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8m g, 118.9mg, 119mg, 119.1mg, 119.2mg, 119.3mg, 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg, 119.9mg, 120mg, 120.1mg, 120.2mg, 120.3mg, 120.4 mg, 120.5mg, 120.6mg, 120.7mg, 120.8mg, 120.9mg, 121mg, 121.1mg, 121.2mg, 121.3mg, 121.4mg, 121.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122 mg, 122.1mg, 122.2mg, 122.3mg, 122.4mg, 122.5mg, 122.6mg, 122.7mg, 122.8mg, 122.9mg, 123mg, 123.1mg, 123.2mg, 123.3mg, 123.4mg, 123.5mg, 123.6mg, 123.7mg, 123.8mg, 123.9mg, 124mg, 124.1mg, 124.2mg, 124.3mg, 124.4mg, 124.5mg, 124.6mg, 124.7mg, 124.8mg, 124.9mg, and 125mg.
[0296] In certain embodiments, the therapeutically effective amount is about 100 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg, about 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg, about 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 102.10 mg, about 102.20 mg, about 102.30 mg, about 102.40 mg, about 102.50 mg, about 102.60 mg, about 102.70 mg, about 102.80 mg, about 102.90 ...10 mg, about 102.20 mg, about 102.30 mg, about 102.40 mg, about 102.5 .6mg, approx. 102.7mg, approx. 102.8mg, approx. 102.9mg, approx. 103mg, approx. 103.1mg, approx. 103.2mg, approx. 103.3mg, approx. 103.4mg, approx. mg, approx. 104.1 mg, approx. 104.2 mg, approx. 104.3 mg, approx. 104.4 mg, approx. 104.5 mg, approx. 104.6 mg, approx. 104.7 mg, approx. 104.8 mg, approx. 104.9 mg, approx. g, approx. 105.5 mg, approx. 105.6 mg, approx. 105.7 mg, approx. 105.8 mg, approx. 105.9 mg, approx. 106 mg, approx. 106.1 mg, approx. 106.2 mg, approx. g, approx. 106.9 mg, approx. 107 mg, approx. 107.1 mg, approx. 107.2 mg, approx. 107.3 mg, approx. 107.4 mg, approx. 107.5 mg, approx. 108.3mg, approximately 108.4mg, approximately 108.5mg, approximately 108.6mg, approximately 108.7mg, approximately 108.8mg, approximately 108.9mg, approximately 109mg, approximately 109.1mg, approximately 109.2mg, approximately 109.3mg, approximately 109.4mg, approximately 109.5mg, approximately 109.6mg, approximately 109.7mg, approximately 109.8mg, approximately 109.9mg, approximately 110mg, approximately 110.1mg, approximately 110.2mg, approximately 110.3mg, approximately 110.4mg, approximately 110.5mg, approximately 110.6mg, approximately 110.7mg, approximately 110.8mg, approximately 110.9mg, approximately 111mg, approximately 111.1mg, approximately 111.2mg, approximately 111.3mg, approximately 111.4mg, approximately 111.5mg, approximately 111.6mg, approximately 111.7mg, approximately 111.8mg, approximately 111.9mg, approximately 112mg, approximately 112.1mg, approximately 112.2mg, approximately 112.3mg, approximately 112.4mg, approximately 112.5mg, approximately 112.6mg, approximately 112.7mg, approximately 112.8mg, approximately 112.9mg, approximately 113mg, approximately 113.1mg, approximately 113.2mg, approximately 113.3mg, approximately 113.4mg, approximately 113.5mg, approximately 113.6mg, approximately 113.7mg, approximately 113.8mg, approximately 113. 9mg, approximately 114mg, approximately 114.1mg, approximately 114.2mg, approximately 114.3mg, approximately 114.4mg, approximately 114.5mg, approximately 114.6mg, approximately 114.7mg, approximately 114.8mg, approximately 114.9mg, approximately 115mg, approximately 115.1mg, approximately 115.2mg, approximately 115.3mg, approximately 115.4mg, approximately 115.5mg, approximately 115.6mg, approximately 115.7mg, approximately 115.8mg, approximately 115.9mg, approximately 116mg, approximately 116.1mg, approximately 116.2mg, approximately 116.3mg, approximately 116.4mg, approximately 116.5mg, approximately 116.6mg, approximately 116.7mg Approximately 116.8 mg, approximately 116.9 mg, approximately 117 mg, approximately 117.1 mg, approximately 117.2 mg, approximately 117.3 mg, approximately 117.4 mg, approximately 117.5 mg, approximately 117.6 mg, approximately 117.7 mg, approximately 117.8 mg, approximately 117.9 mg, approximately 118 mg, approximately 118.1 mg, approximately 118.2 mg, approximately 118.3 mg, approximately 118.4 mg, approximately 118.5 mg, approximately 118.6 mg, approximately 118.7 mg, approximately 118.8 mg, approximately 118.9 mg, approximately 119 mg, approximately 119.1 mg, approximately 119.2 mg, approximately 119.3 mg, approximately 119.4 mg, approximately 119.5 mg, approximately 1... 19.6mg, approximately 119.7mg, approximately 119.8mg, approximately 119.9mg, approximately 120mg, approximately 120.1mg, approximately 120.2mg, approximately 120.3mg, approximately 120.4mg, approximately 120.5mg, approximately 120.6mg, approximately 120.7mg, approximately 120.8mg, approximately 120.9mg, approximately 121mg, approximately 121.1mg, approximately 121.2mg, approximately 121.3mg, approximately 121.4mg, approximately 121.5mg, approximately 121.6mg, approximately 121.7mg, approximately 121.8mg, approximately 121.9mg, approximately 122mg, approximately 122.1mg, approximately 122.2mg, approximately 122.3mg, approximately 122mg.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, about 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg, and about 125 mg.
[0297] In certain embodiments, the therapeutically effective amount is 10 mg to 200 mg, 10 mg to 190 mg, 10 mg to 180 mg, 10 mg to 170 mg, 10 mg to 160 mg, 10 mg to 150 mg, 10 mg to 140 mg, 10 mg to 120 mg, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 200 mg, 20 mg to 190 mg, 20 mg to 180 mg, 20 mg to 170 mg, 20 mg to 1 60mg, 20mg~150mg, 20mg~140mg, 20mg~120mg, 20mg~110mg, 20mg~100mg, 20mg~80mg, 20mg~70mg, 20mg~60mg, 20mg~50mg, 20mg~10mg, 20mg~30mg, 30mg ~200mg, 30mg~190mg, 30mg~180mg, 30mg~170mg, 30mg~160mg, 30mg~150mg, 30mg~140mg, 30mg~120mg, 30mg~110mg, 30mg~100mg, 30mg~80mg, 30mg~70m g, 30mg~60mg, 30mg~50mg, 30mg~20mg, 40mg~200mg, 40mg~190mg, 40mg~180mg, 40mg~170mg, 40mg~160mg, 40mg~150mg, 40mg~140mg, 40mg~120mg, 40mg ~110mg, 40mg~100mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~200mg, 50mg~190mg, 50mg~180mg, 50mg~170mg, 50mg~160mg, 50mg~150mg, 50mg~140mg, 50mg~120mg, 50mg~110mg, 50mg~100mg, 50mg~80mg, 50mg~70mg, 50mg~60mg, 60mg~200mg, 60mg~190mg, 60mg~180mg, 60mg~170mg, 60mg~1 60mg, 60mg~150mg, 60mg~140mg, 60mg~120mg, 60mg~115mg, 60mg~110mg, 60mg~100mg, 60mg~80mg, 60mg~70mg, 70mg~200mg, 70mg~190mg, 70mg~180mg,70mg~170mg、70mg~160mg、70mg~150mg、70mg~140mg、70mg~120mg、70mg~110mg、70mg~100mg、70mg~80mg、80mg~200mg、80mg~190mg、80mg~180mg、80mg~170mg、80mg~160mg、80mg~150mg、80mg~140mg、80mg~120mg、80mg~110mg、80mg~100mg、80mg~90mg、90mg~200mg、90mg~190mg、90mg~180mg、90mg~170mg、90mg~160mg、90mg~150mg、90mg~140mg、90mg~120mg、90mg~110mg、90mg~100mg、100mg~200mg、100mg~190mg、100mg~180mg、100mg~170mg、100mg~160mg、100mg~150mg、100mg~140mg、100mg~120mg、100mg~110mg、110mg~200mg、110mg~190mg、110mg~180mg、110mg~170mg、110mg~160mg、110mg~150mg、110mg~140mg、110mg~130mg、110mg~120mg、120mg~200mg、120mg~190mg、120mg~180mg、120mg~170mg、120mg~160mg、120mg~150mg、120mg~140mg、120mg~130mg、130mg~200mg、130mg~190mg、130mg~180mg、130mg~170mg、130mg~160mg、130mg~150mg、130mg~140mg、140mg~200mg、140mg~190mg、140mg~180mg、140mg~170mg、140mg~160mg、140mg~150mg、150mg~200mg、150mg~190mg、150mg~180mg、150mg~170mg、150mg~160mg、160mg~200mg、160mg~190mg、160mg~180mg、160mg~170mg、180mg~200mg、180mg~190mg、190mg~200mg、105mg~135mg、105mg~130mg、105mg~125mg、105mg~120mg、110mg~135mg、110mg~130mg、110mg~125mg, 110mg~120mg, 115mg~135mg, 115mg~130mg, 115mg~125mg, 115mg~120mg, 115mg~125mg, 11 5mg~120mg, 120mg~135mg, 120mg~125mg, 125mg~140mg, 125mg~130mg, 130mg~135mg, 135mg~140mg, 120mg ~129mg, 120mg~128mg, 120mg~127mg, 120mg~86mg, 120mg~124mg, 120mg~123mg, 120mg~122mg, 120mg~121 mg, 121mg~130mg, 122mg~129mg, 122mg~128mg, 122mg~127mg, 122mg~126mg, 122mg~125mg, 122mg~124mg, 122mg~123mg, 123mg~130mg, 123mg~129mg, 123mg~128mg, 123mg~127mg, 123mg~126mg, 123mg~125mg, 12 3mg~124mg, 124mg~130mg, 124mg~129mg, 124mg~128mg, 124mg~127mg, 124mg~126mg, 124mg~125mg, 125mg 129mg, 125mg to 128mg, 125mg to 127mg, 125mg to 126mg, 126mg to 130mg, 126mg to 129mg, 126mg to 128mg, 126mg to 127mg, 127mg to 130mg, 127mg to 129mg, 127mg to 128mg, 128mg to 130mg, 128mg to 129mg, and 129mg to 130mg.
[0298] In certain embodiments, the therapeutically effective amount is less than 350 mg, less than 345 mg, less than 340 mg, less than 335 mg, less than 330 mg, less than 325 mg, less than 320 mg, less than 315 mg, less than 310 mg, less than 305 mg, less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg , less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
[0299] In certain embodiments, a therapeutically effective amount is less than about 350 mg, less than about 345 mg, less than about 340 mg, less than about 335 mg, less than about 330 mg, less than about 325 mg, less than about 320 mg, less than about 315 mg, less than about 310 mg, less than about 305 mg, less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, The amount is any of less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
[0300] In certain embodiments, the therapeutically effective amount is any of at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
[0301] In certain embodiments, a therapeutically effective amount is at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 120 mg, at least about 140 mg, at least about 160 mg, at least about 180 mg, at least about 190 mg, at least about 200 mg, at least about 220 mg, at least about 240 mg, at least about 250 mg, at least about 260 mg, at least about 280 mg, at least about 290 mg, at least about 300 mg, at least about 310 mg, at least about 320 mg, at least about 330 mg, at least about 340 mg, at least about 350 mg, at least about 350 mg, at least about 350 mg, at least about 360 mg, at least about 370 mg, at least about 380 mg, at least about 390 mg, at least about 400 mg, at least about 450 mg, at least about 400 mg, at least about 450 mg, at least about 500 mg, at least about 550 mg, at least about 600 mg, at least about 650 mg, at least about 700 mg, at least about 750 mg, at least about 800 mg, at least about 850 mg, at least about 900 mg, at least about 950 mg at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or any of at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
[0302] V. Dosage Regimen In certain embodiments, described herein are methods of administering a therapeutically effective amount of compound 696844 to a subject one or more times. In certain embodiments, the methods include administering a therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 50, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 times. In certain embodiments, the method comprises administering a therapeutically effective amount once per week. In certain embodiments, the method comprises administering a therapeutically effective amount once every two weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every three weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every four weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every eight weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every twelve weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every sixteen weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every twenty weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every twenty-four weeks. In certain embodiments, the method comprises administering a therapeutically effective amount once every six months. In certain embodiments, the method comprises administering a therapeutically effective amount monthly. In certain embodiments, the method comprises administering a therapeutically effective amount once every two months. In certain embodiments, the method comprises administering a therapeutically effective amount once every three months. In certain embodiments, the method comprises administering a therapeutically effective amount quarterly. In certain embodiments, the method comprises administering a therapeutically effective amount semi-annually. In certain embodiments, the method comprises administering a therapeutically effective amount annually. In certain embodiments, the method comprises administering a therapeutically effective amount once every two years.
[0303] In certain embodiments, the method comprises administering a therapeutically effective amount about once a week, about every two weeks, about every three weeks, about every four weeks, about every five weeks, about every six weeks, about every seven weeks, about every eight weeks, about every nine weeks, about every ten weeks, about every eleven weeks, about every 12 weeks, about every 13 weeks, about every 14 weeks, about every 15 weeks, about every 16 weeks, about every 17 weeks, about every 18 weeks, about every 19 weeks, about every 20 weeks, about every 21 weeks, about every 22 weeks, about every 23 weeks, about every 24 weeks, or about every six months. In certain embodiments, the method comprises administering a therapeutically effective amount about once every two months. In certain embodiments, the method comprises administering a therapeutically effective amount about once every three months. In certain embodiments, the method comprises administering a therapeutically effective amount about once quarterly. In certain embodiments, the method comprises administering a therapeutically effective amount about once every six months. In certain embodiments, the method comprises administering a therapeutically effective amount about once every year. In certain embodiments, the method comprises administering a therapeutically effective amount about once every two years.
[0304] In certain embodiments, the methods comprise administering a therapeutically effective amount at a therapeutically effective frequency for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.
[0305] Loading and maintenance doses In certain embodiments, the therapeutically effective amount is administered as a loading dose and / or a maintenance dose. In certain embodiments, the loading dose is at a different dose level than the maintenance dose. In certain embodiments, the loading dose is at a higher dose level than the maintenance dose. In certain embodiments, the loading dose and the maintenance dose are at the same dose level. In certain embodiments, the method comprises administering one or more loading doses, followed by one or more maintenance doses. In certain aspects, the method comprises administering a loading dose once about every 4 weeks, followed by a maintenance dose once about every 4 weeks, about every 8 weeks, about every 12 weeks, about every 16 weeks, about every 20 weeks, about every 24 weeks, or about every 6 months. In certain embodiments, the method comprises administering a loading dose once about every 4 weeks, followed by a maintenance dose once about every 6 months. In certain embodiments, the method comprises administering a loading dose once about every 12 weeks, followed by a maintenance dose once about every 6 months.
[0306] In certain embodiments, the methods include administering at least 2 loading doses, at least 3 loading doses, at least 4 loading doses, at least 5 loading doses, or at least 6 loading doses. In certain embodiments, the methods include administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 loading doses. In certain embodiments, the methods include administering a loading dose or doses about every 1 week, about every 2 weeks, about every 3 weeks, about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, or about every 12 weeks. In certain embodiments, the methods include administering an initial loading dose and administering a second loading dose about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks after administering the initial loading dose.
[0307] In certain embodiments, the methods include administering at least 2 maintenance doses, at least 3 maintenance doses, at least 4 maintenance doses, at least 5 maintenance doses, or at least 6 maintenance doses. In certain embodiments, the methods include administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 maintenance doses. In some cases, the methods include administering the maintenance dose or doses about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, about every 12 weeks, about every 13 weeks, about every 14 weeks, about every 15 weeks, about every 16 weeks, about every 17 weeks, about every 18 weeks, about every 19 weeks, about every 20 weeks, about every 21 weeks, about every 22 weeks, about every 23 weeks, about every 24 weeks, or about every 6 months. In certain embodiments, the method comprises administering a first maintenance dose and administering a second maintenance dose about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, or about 6 months after administering the first maintenance dose.
[0308] In certain embodiments, the methods include administering the first maintenance dose or dose about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, or about 24 weeks after the last loading dose.
[0309] VI. Efficacy and Effectiveness In certain embodiments, described herein are methods for reducing CFB RNA and / or CFB protein in cells or bodily fluids of a human subject, comprising administering a therapeutically effective amount of compound 696844 to the subject. In certain embodiments, the method reduces CFB RNA and / or CFB protein in the serum or plasma of the human subject. Whether the method reduces CFB RNA and / or CFB protein can be determined, for example, by detecting / quantifying a first amount of CFB RNA or CFB protein in a first biological sample obtained before administration, detecting / quantifying a second amount of CFB RNA or CFB protein in a second biological sample obtained after administration, and comparing the first amount to the second amount to detect or quantify the reduction in CFB RNA or CFB protein.
[0310] In certain embodiments, the methods involve reducing CFB RNA and / or CFB protein by 1-100%, or a range defined by any two of these values. RNA and / or CFB protein at 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51% %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% decrease.
[0311] In certain embodiments, the methods comprise reducing CFB RNA or CFB protein by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.
[0312] In certain embodiments, the methods comprise reducing CFB RNA or CFB protein by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100%.
[0313] In certain embodiments, the method includes administering compound 696844 to a subject and detecting or quantifying the amount of CFB RNA or CFB protein in the subject's cells or bodily fluids. In certain embodiments, the method includes detecting / quantifying a first amount of CFB RNA or CFB protein in a first biological sample obtained before administration, detecting / quantifying a second amount of CFB RNA or CFB protein in a second biological sample obtained after administration, and detecting or quantifying a decrease in CFB RNA or CFB protein by comparing the first amount with the second amount. In certain embodiments, the second biological sample is obtained less than about 24 hours after administration. In certain embodiments, the second biological sample is obtained less than about one week after administration. In certain embodiments, the second biological sample is obtained about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, or about 18 weeks after administration. In certain embodiments, the method includes increasing or decreasing the dose after comparing the first amount to the second amount. In certain embodiments, the method includes administering more or less frequently after comparing the first amount to the second amount. In certain embodiments, the biological sample is plasma. In certain embodiments, the bodily fluid is serum.
[0314] VII. Overview of Diseases and Disorders Associated with Dysregulation of the Alternative Complement Pathway Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a subject by administering a therapeutically effective amount of compound 696844.
[0315] Studies have shown that the kidney and eye share pathogenesis and structural features, including the collagen IV protomer composition of the basement membrane and vasculature (Savige et al., J Am Soc Nephrol. (2011) 22(8):1403-15). Genetic complement regulatory protein deficiency causes atypical hemolytic uremic syndrome and predisposition to AMD (Richards A et al., Adv Immunol. (2007) 96:141-77). Furthermore, chronic kidney disease is associated with AMD (Nitsch, D. et al., Ophthalmic Epidemiol. (2009) 16(3):181-6; Choi, J. et al., Ophthalmic Epidemiol. (2011) 18(6):259-63). Dense deposit disease (DDD), a kidney disease associated with dysregulation of the alternative complement pathway, is characterized by acute nephritic syndrome and ocular drusen (Martin B, Smith RJH, C3 Glomerulopathy. 2007 Jul 20 [Updated April 5, 2018]. In: Adam MP, Everman DB, Mirzaa GM, et al., eds. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2022; ncbi.nlm.nih.gov / books / NBK1425 / Cruz and Smith, GeneReviews(2007) Jul 20). Furthermore, mice with genetic deletions of components of the alternative complement pathway develop combined kidney and eye disease phenotypes. It has been reported that CFH homozygous null mice develop DDD and exhibit retinal abnormalities and visual dysfunction (Pickering et al., Nat Genet. (2002) 31 (4): 424-8). Mouse models of kidney disease associated with dysregulation of the alternative complement pathway are also accepted as models of AMD (Pennesi ME et al., Mol Aspects Med (2012) 33: 487-509). For example, CFH null mice are accepted models for kidney diseases such as DDD and AMD.Furthermore, AMD has been reported to be associated with systemic sources of complement factors that accumulate locally within the eye to drive alternative pathway complement activation (Loyet et al., Invest Ophthalmol Vis Sci. (2012) 53(10):6628-37).
[0316] Certain embodiments provided herein relate to the method for treating, preventing or ameliorating the ophthalmic disease or disorder associated with the dysregulation of alternative complement pathway in a subject by administering a CFB-specific inhibitor, such as an antisense compound targeted to CFB.In certain aspects, the ophthalmic disease or disorder is macular degeneration, age-related macular degeneration (AMD), including wet AMD, intermediate AMD, and dry AMD, including geographic atrophy; neuromyelitis optica; corneal disease, such as corneal inflammation; autoimmune uveitis; or diabetic retinopathy; or combinations thereof.In certain embodiments, the antisense compound is compound 696844.
[0317] Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating renal diseases or disorders associated with dysregulation of the alternative complement pathway in a subject by administering a CFB-specific inhibitor, such as an antisense compound targeted to CFB. In certain aspects, the renal disease or disorder is C3 glomerulopathy; atypical hemolytic uremic syndrome (aHUS); dense deposit disease (DDD, also known as MPGN type II or C3Neph); CFHR5 nephropathy; IgA nephropathy (IgAN); medium capillary (membranoproliferative) glomerulonephritis (MPGN); autoimmune disorders including lupus nephritis and systemic lupus erythematosus (SLE); dense deposit disease (DDD); infection-induced glomerulonephritis (also known as post-infectious glomerulonephritis); C3 glomerulonephritis (C3GN); CFHR5 nephropathy; atypical hemolytic uremic syndrome (aHUS); renal ischemia-reperfusion injury, such as post-transplant renal ischemia-reperfusion injury, or a combination thereof. In a specific embodiment, the antisense compound is compound 696844.
[0318] Certain embodiments provided herein relate to a method for treating, preventing, or ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a subject by administering a CFB-specific inhibitor, such as an antisense compound that targets CFB. In certain aspects, the disease or disorder is ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, preeclampsia, or a metabolic disorder (such as nonalcoholic steatohepatitis (NASH)). In certain embodiments, the antisense compound is compound 696844.
[0319] Age-related macular degeneration Age-related macular degeneration (AMD) is a progressive disease of the macula and is the leading cause of central vision loss in people over 50 years of age in developed countries (Ratnapriya and Chew 2013, Clinical Genet. 2:160-166). The disease is characterized by progressive loss of central vision, distortion of images and lines, and the presence of blurred, dark areas in central vision (Cascella et al. 2014, Ophthalmol. 582842). AMD is associated with dysregulation of the alternative complement pathway. Complement components are common components of ocular drusen, extracellular materials that accumulate in the macula of AMD patients. Furthermore, CFH and CFB variants have been reported to account for nearly 75% of AMD cases in northern Europe and North America. Specific CFB polymorphisms have also been found to confer protection against AMD (Patel, N. et al., Eye (2008) 22(6):768-76). Furthermore, CFB homozygous null mice have reduced complement pathway activity, smaller ocular lesions, and show choroidal neovascularization (CNV) after laser photocoagulation (Rohrer, B. et al., Invest Ophthalmol Vis Sci. (2009) 50(7):3056-64). Administration of siRNA targeting CFB protects mice from laser-induced CNV (Bora, NS et al., J Immunol. (2006) 177(3):1872-8). Administration of single-stranded antisense oligonucleotides reduces CFB levels in the eyes and plasma of C57BL / 6 mice, and suppresses CFH. + / -CFB RNA and plasma C3 levels are reduced in mice, and plasma levels of CFB and CFB RNA are reduced in cynomolgus monkeys (WO 2015 / 168635).
[0320] The underlying pathophysiological factors of AMD are complex, and symptoms manifest in multiple, related but distinct forms. In the early and intermediate stages of AMD, the disease is characterized by the deposition of dresen, extracellular deposits rich in proteins and lipids, between retinal pigment epithelial (RPE) cells and Bruch's membrane (Bird et al., 1995, Ophthalmol 39:367-374; van Lookeren Campagne et al., 2014, J Pathol 232:151-164). As part of the natural history of the disease, continuously expanding areas of atrophy develop, corresponding to absolute scotoma / geographic atrophy (Lindblad et al., 2009, Arch Ophthalmol 127:1168-1174; Grunwald et al., 2017, Ophthalmology 124:97-104). This area of geographic atrophy associated with late-stage AMD corresponds to the retinal region of visual dysfunction resulting from atrophy of photoreceptors and RPE cells (Klein et al. 1991, 98:1128-1134; Sunness et al. 2007, Ophthalmology 114:271-277; Schmitz-Valckenberg et al. 2016, Ophthalmology 123:361-368).
[0321] The complement system, a key component of innate immunity, is the most widely accepted pathogenic pathway of the immune system involved in AMD. Genome-wide association studies (GWAS) and rare variant analyses suggest that the alternative complement pathway (AP) is overactivated in AMD (Kijlstra et al. 2005, Ocul Immunol Inflamm 13:3-11; Donoso et al. 2006, Surv Ophthalmol 51:137-152; Anderson et al. 2010, Prog Retin Eye Res 29:95-112; Whitmore et al. 2015, Prog Retin Eye Res 45:1-29; Cao et al. 2016, Br J Ophthalmol 100:713-718; Geerlings et al. 2017, Mol Immunol 84:65-76). Specific polymorphisms in complement factor H (CFH), a negative regulator of AP, confer an increased risk of AMD (Donoso et al. 2010, Surv Ophthalmol 55:227-246; Heurich et al. 2011, Proc Natl Acad Sci USA 108:8761-8766). In contrast, specific polymorphisms in factor B, a positive regulator, confer protection against AMD (Gold et al. 2006 Nat Genet 38:458-462; Montes et al. 2009, Proc Natl Acad Sci USA 106:4366-4371; Heurich et al. 2011; Mantel et al. 2014, Ophthalmic Genetics 35:12-17).
[0322] CFB is synthesized primarily by the liver (Koskimies et al., Complement Inflamm 1991;8:257-260; Morgan and Gasque Clin Exp Immunol 1997;107:1-7; Marsh et al., Atherosclerosis 2002;162:227-244), and at very low levels in several extrahepatic sites (Whaley J Exp Med 1980;151:501-516; Ripoche et al., J Exp Med 1988;168:1917-1922; Strunk et al., J Clin Invest 1988;81:1419-1426; Matsumoto et al., Proc Natl Acad Sci USA 1997;94:8720-8725). Ocular CFB is primarily located in the choriocapillaris and Bruch's membrane regions, with no clear involvement of the neural retina (Loyet et al. Invest Ophthalmol Vis Sci 2012;53:6628-6637). Therefore, choroidal CFB appears to be of systemic origin. Plasma concentrations of alternative complement pathway activation products have been found to be significantly elevated in patients with AMD compared with controls (Scholl et al. PLoS One 2008;3:e2593; Reynolds et al. Invest Ophthalmol Vis Sci 2009;50:5818-5827; Loyet et al. 2012; Paun et al. Sci Rep 2016;6:26568; PLoS One 2016;11:e0144367). This suggests ongoing systemic activation of the alternative complement pathway in the pathogenesis of AMD and adds to the evidence that AMD is a systemic disease with localized disease manifestations in the age-related macula (Smailhodzic et al. 2012, Ophthalmology 119:339-346; Br J Ophthalmol 2016;100:713-718).
[0323] IgA nephropathy IgA nephropathy (IgAN) is the most common primary chronic glomerulonephritis worldwide and an important cause of chronic renal failure (Maillard et al. 2015, J Am Soc Nephrol 26:1503-1512). IgAN is characterized by immune deposits with dominant or codominant IgA in the glomerular mesangium of the kidney, leading to inflammation and tissue damage (Maillard et al. 2015). IgAN can occur at any age, but typically develops in the 20s or 30s. Clinical symptoms, disease progression, and histological findings are highly variable among affected individuals.
[0324] IgAN is characterized by microscopic and / or gross hematuria, sometimes in the setting of acute illnesses such as respiratory tract infections or gastroenteritis. Over time, affected individuals may develop proteinuria and hypertension. Up to 40% of affected individuals experience a progressive decline in renal function and develop end-stage kidney disease (ESKD) by 20 years from the date of renal biopsy at diagnosis (Maillard et al. 2015). Patients with ESKD require dialysis or kidney transplantation, and ESKD is associated with a significant risk of premature death and a reduced quality of life comparable to the risk of certain cancers and heart disease (Chen et al. 2016, Blood Purif. 41(1-3):218-24).
[0325] IgAN is broadly classified as primary or secondary (i.e., associated with systemic disease) (Rizk et al. 2019, Frontiers Immunol 10:504). IgAN can occur without extrarenal involvement or as part of a systemic vasculitis phenotype now referred to as IgA vasculitis (formerly Henoch-Schönlein pupillonephritis) with nephritis. IgAN can be diagnosed by renal biopsy. A hallmark of IgA nephropathy is IgA deposition in the glomerular mesangium. 90% of renal biopsies from IgAN patients also contain C3 in the same distribution as IgA deposits (Maillard et al. 2015). Plasma C3 levels are usually within the normal range; however, complement activation products may be elevated in plasma, supporting the role of the alternative pathway in IgAN. In renal biopsies, in addition to IgA deposits, there are glomerular deposits resulting from the overactivation of the alternative pathway (C3 and properdin), the lectin pathway (C4d), and the end product of the complement cascade (membrane attack complex C5b-9C) (Wyatt and Julian 2013, N Engl J Med 368:2402-2414). C1q deposition is generally not observed (Wyatt and Julian 2013). Thus, the data support the role of both the alternative and lectin complement pathways in inducing renal injury in IgAN.
[0326] CFB circulates in the blood as a proenzyme and is a key protease in the alternative complement pathway (AP). It binds to C3 in the fluid phase through continuous production or spontaneous hydrolysis of C3, or associates with the target-bound complement protein C3b (C3b) (the activated form of C3), and its cleavage by factor D into Ba and Bb results in activation of CFB (Maillard et al. 2015). This leads to the formation of C3Bb or amplification of the C3 convertase (C3bBb), which then triggers the AP amplification loop. As a result, C3b molecules bind to target surfaces and activate the terminal complement cascade, leading to the formation of C5b-9 (Maillard et al. 2015; Thurman 2017, Nephrol Dial Transplant 32:i57-i64). The C5b-9 membrane attack complex forms pores in the cell membrane, allowing calcium influx, cell activation, and glomerular injury. Notably, membrane attack complex deposits have been observed in renal biopsies of individuals with IgAN (Maillard et al. 2015). Reducing CFB potentially reduces the formation of complement protein C3a (C3a), complement factor C5a (C5a), and the membrane attack complex, potentially alleviating the resulting inflammatory damage to the kidney.
[0327] In certain embodiments, provided herein are methods for improving IgA nephropathy and / or slowing the progression of renal failure associated with primary IgA nephropathy through systemic administration of compound 696844. Compound 696844 targets CFB messenger ribonucleic acid (mRNA) in the liver and reduces plasma CFB levels. Reduction of plasma CFB, an essential component of AP, reduces AP overactivation, which contributes to the pathology of primary IgA nephropathy. As demonstrated in Example 2, reducing plasma CFB levels in subjects with IgAN reduced AP overactivation and reduced proteinuria. Administration of a single-stranded antisense oligonucleotide reduced plasma CFB levels in C57BL / 6 mice, CFB RNA and plasma C3 levels in CFH+ / - mice, reduced renal C3 accumulation in a mouse lupus model, and reduced plasma CFB and CFB RNA levels in cynomolgus monkeys (WO 2015 / 168635).
[0328] VIII. Evaluating the Efficacy of Compound 696844 Decreased plasma CFB In certain embodiments, the methods described herein are sufficiently effective to reduce the level of plasma CFB in a subject. In certain embodiments, the methods described herein are sufficiently effective to reduce the level of plasma CFB in a subject, as assessed by the rate of decrease in plasma CFB between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the rate of decrease in plasma CFB level is assessed by comparing the plasma CFB level measured before the first administration of compound 696844 (baseline) with the plasma CFB level measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percent reduction in plasma CFB levels is calculated as the percent reduction in 24-hour protein excretion from baseline after the first dose of compound 696844 at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks. In some embodiments, the percent reduction is calculated as the percent reduction in plasma CFB levels between one time point after administration of one or more doses of compound 696844 and a second time point that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In certain embodiments, CFB levels may be measured by radial immunodiffusion assay, ELISA assay, or turbidimetry.
[0329] Decreased serum AH50 activity In certain embodiments, the methods described herein are sufficiently effective to reduce serum AH50 activity in a subject. In certain embodiments, the methods described herein are sufficiently effective to reduce serum AH50 activity in a subject, as assessed by the percentage decrease in serum AH50 activity between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the percentage decrease in serum AH50 activity is assessed by comparing the level of serum AH50 activity measured before the first administration of compound 696844 (baseline) with the level of serum AH50 activity measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percentage reduction is calculated as the percentage reduction in serum AH50 activity from baseline, comparing serum AH50 activity after 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks to the baseline value at the time of the first administration of compound 696844. In some embodiments, the percentage reduction is calculated as the percentage reduction in serum AH50 activity between one time point after administration of one or more doses of compound 696844 and a second time point 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In certain embodiments, AH50 activity can be measured by using a hemolytic assay (AH50 hemolytic). In some embodiments, AH50 activity can be measured by using the WIESLAB Complement System Alternative Pathway Assay (SVAR LIFE SCIENCE) (AH50 WAP).
[0330] Decreased urinary protein excretion In certain embodiments, the methods described herein are sufficiently effective to reduce urinary protein excretion (proteinuria) in a subject. In certain embodiments, the methods described herein are sufficiently effective to reduce urinary protein excretion in a subject, as assessed by the percentage reduction in 24-hour urinary protein excretion between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the percentage reduction in 24-hour protein excretion is assessed by comparing the 24-hour protein excretion measured before the first administration of compound 696844 (baseline) with the 24-hour urinary protein excretion measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percent reduction in 24-hour protein excretion is calculated as the percent reduction in 24-hour protein excretion from baseline at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first dose of compound 696844. In some embodiments, the percent reduction is calculated as the percent reduction in 24-hour protein excretion between one time point after administration of one or more doses of compound 696844 and a second time point that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point.
[0331] In certain embodiments, the methods described herein are sufficient to reduce a subject's urinary protein excretion after one or more administrations of compound 696844, as assessed by the absolute reduction in urinary protein excretion between baseline and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after administration. In certain embodiments, the methods described herein are sufficient to reduce albumin excretion in a subject, as assessed by absolute reduction in albuminuria ("urine albumin / creatinine" or "UAC ratio") from baseline at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after one or more administrations of compound 696844. In certain embodiments, the methods described herein are sufficient to reduce albumin excretion in a subject, as assessed by absolute reduction in proteinuria (UPC ratio) from baseline at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after one or more administrations of compound 696844.
[0332] In certain embodiments, the methods described herein are sufficient to reduce protein excretion in a subject, as assessed by an absolute reduction in urinary protein excretion between one time point after administration of one or more doses of compound 696844 and a second time point that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In certain embodiments, the methods described herein are sufficient to reduce albumin excretion in a subject, as assessed by the absolute reduction in albuminuria (UAC ratio) between one time point after administration of one or more doses of compound 696844 and a second time point that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point.
[0333] In some embodiments, urinary protein excretion can be measured on a single sample (spot sample), such as a first voided sample, or an early morning sample, or an aliquot of a collection of multiple samples, such as from a 24-hour collection. Urinary protein excretion is measured as urinary protein ((grams / day)2(g / day) 2 ) and urine protein-to-creatinine ratio (UPCr) 2 It can be measured by
[0334] Decreased serum CH50 activity In certain embodiments, the methods described herein are sufficiently effective to reduce serum CH50 activity in a subject. In certain embodiments, the methods described herein are sufficiently effective to reduce serum CH50 activity in a subject, as assessed by the percentage or absolute reduction in serum CH50 activity between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the percentage reduction in serum CH50 activity is assessed by comparing the level of serum CH50 activity measured before the first administration of compound 696844 (baseline) with the level of serum CH50 activity measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percentage reduction is calculated as the percentage reduction or absolute percentage reduction in serum CH50 activity from baseline serum CH50 activity at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844. In some embodiments, the percent or absolute reduction is calculated as the percent or absolute reduction in serum CH50 activity between one time point after administration of one or more doses of compound 696844 and a second time point that is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In some embodiments, the level of CH50 activity may be determined by hemolytic assay.
[0335] Decreased urinary Ba and sC5b-9 In certain embodiments, the methods described herein are sufficiently effective to reduce a subject's urinary Ba or sC5b-9 levels. In certain embodiments, the methods described herein are sufficiently effective to reduce the subject's urinary Ba or sC5b-9 levels after administration of compound 696844, as assessed by a percentage decrease or absolute decrease in the level of sC5b-9 compared to the level of sC5b-9 at any time point before and after administration. In some embodiments, the percentage decrease in urinary Ba or sC5b-9 levels is assessed by comparing the level of urinary Ba or sC5b-9 measured before the first administration of compound 696844 (baseline) with the level of urinary Ba or sC5b-9 measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percent reduction in urinary Ba or sC5b-9 is calculated as the percent reduction or absolute reduction from baseline in urinary Ba or sC5b-9 levels 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844. In some embodiments, the percent reduction or absolute reduction is calculated as the percent reduction or absolute reduction in urinary Ba or sC5b-9 levels between one time point after administration of one or more doses of compound 696844 and a second time point that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In certain embodiments, Bb levels may be measured using an assay such as the QUIDEL MICROVUE sC5b-9 PLUS EIA.
[0336] Bb decrease In certain embodiments, the methods described herein are sufficiently effective to reduce Bb levels in the serum, plasma, or urine of a subject. In certain embodiments, the methods described herein are sufficiently effective to reduce the level of Bb in a subject, as assessed by the percentage reduction in Bb between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the percentage reduction in Bb levels is assessed by comparing the Bb level measured before the first administration of compound 696844 (baseline) to the Bb level measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percent reduction in Bb levels is calculated as the percent reduction in 24-hour protein excretion at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks from baseline after the first dose of compound 696844. In some embodiments, the percent reduction is calculated as the percent reduction in Bb levels between one time point after administration of one or more doses of compound 696844 and a second time point that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first time point. In certain embodiments, Bb levels may be measured using an assay such as the QUIDEL MICROVUE Bb PLUS EIA.
[0337] Slowing progression of geographic atrophy areas In certain embodiments, the methods described herein are sufficiently effective to slow the progression of areas of geographic atrophy in a subject. In certain embodiments, administration of compound 696844 slows the progression of the overall area of geographic atrophy in the eye, and in certain embodiments, administration of compound 696844 slows the appearance of additional areas of geographic atrophy in the eye. In certain embodiments, the methods described herein are sufficiently effective to slow the progression of areas of geographic atrophy in a subject, as assessed by the percentage reduction in the rate of change in the area of GA measured by fundus autofluorescence (FAF) or spectral-domain optical coherence tomography (SD-OCT) between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the rate of change in the area of GA is assessed by comparing the area of GA measured before the first administration of compound 696844 (baseline) with the area of GA measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percent change in GA area is assessed by comparing the percent change in GA area calculated from two or more measurements at two or more time points before the first administration of compound 696844 (baseline) to the percent change in GA area calculated from two or more measurements at two or more time points after administration of one or more doses of compound 696844. In some embodiments, the percent reduction is calculated as the percent decrease or change in GA area from baseline or percent change in GA area at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844.
[0338] Delayed decline in low-light visual acuity (LLVA). In certain embodiments, the methods described herein are sufficiently effective to delay the decline in LLVA in a subject. In certain embodiments, administering compound 696844 delays the decline in LLVA in the eye. In certain embodiments, the methods described herein are sufficiently effective to delay the decline in LLVA in a subject, as assessed by the percentage decline in LLVA score measured between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the rate of change in LLVA score is assessed by comparing the LLVA measured before the first administration of compound 696844 (baseline) with the LLVA measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the rate of change in LLVA is assessed by comparing the rate of change in LLVA score (baseline) calculated from two or more measurements at two or more time points before the first administration of compound 696844 with the rate of change in LLVA score calculated from two or more measurements at two or more time points after administration of one or more doses of compound 696844. In some embodiments, the percent reduction is calculated as the percent reduction in LLVA score or percent change in LLVA score from baseline or percent change in LLVA score at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844.
[0339] Delayed morphological changes in the choriocapillaris In certain embodiments, the methods described herein are sufficiently effective to slow the progression of morphological changes in the choriocapillaris in a subject. In certain embodiments, administering compound 696844 slows the progression of morphological changes in the choriocapillaris in the eye. In certain embodiments, the methods described herein are sufficiently effective to slow the progression of morphological changes in the choriocapillaris in a subject, as assessed by the rate of morphological change in the choriocapillaris measured by optical coherence tomography angiography (OCTA) between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the rate of change in morphological change in the choriocapillaris is assessed by comparing the morphological change in the choriocapillaris measured before the first administration of compound 696844 (baseline) with the morphological change in the choriocapillaris measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the percent change in choriocapillaris morphological change is assessed by comparing the percent change in choriocapillaris morphological change calculated from two or more measurements at two or more time points before the first administration of compound 696844 (baseline) to the percent change in choriocapillaris morphological change calculated from two or more measurements at two or more time points after administration of one or more doses of compound 696844. In some embodiments, the percent reduction is calculated as the percent reduction in choriocapillaris morphological change or percent change in choriocapillaris morphology at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first administration of compound 696844 from the baseline choriocapillaris morphological change or percent change in choriocapillaris morphology.
[0340] Delayed decline in best corrected visual acuity (BCVA) In certain embodiments, the methods described herein are sufficiently effective to delay the decline in BCVA in a subject. In certain embodiments, administration of compound 696844 delays the decline in BCVA in the eye. In certain embodiments, the methods described herein are sufficiently effective to delay the decline in BCVA in a subject, as assessed by an eye chart or computer, between a time point after administration of compound 696844 and a subsequent time point. In some embodiments, the rate of change in BCVA is assessed by comparing the BCVA measured before the first administration of compound 696844 (baseline) with the BCVA measured at a time point after administration of one or more doses of compound 696844. In some embodiments, the rate of change in BCVA is assessed by comparing the rate of change in BCVA (baseline) calculated from two or more measurements at two or more time points before the first administration of compound 696844 with the rate of change in BCVA calculated from two or more measurements at two or more time points after administration of one or more doses of compound 696844. In some embodiments, the percent decline in BCVA or percent decline in change in BCVA 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 weeks after the first dose of compound 696844 is calculated as a value calculated from baseline BCVA or percent change in BCVA.
[0341] In certain embodiments, the methods described herein are sufficiently effective to improve at least one symptom or characteristic of a disease or disorder associated with a CFB protein in a human subject. In certain embodiments, the methods described herein are sufficiently effective to prevent, reduce, or delay the onset of at least one symptom or characteristic associated with a CFB protein in a human subject. In certain embodiments, the disease or disorder is an eye disease or disorder, or a kidney disease or disorder. In certain embodiments, the disease or disorder is age-related macular degeneration (AMD), wet AMD, intermediate AMD, dry AMD, AMD-associated geographic atrophy (GA), IgA nephropathy (IgAN), systemic lupus erythematosus (SLE), deposit density disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, atypical hemolytic uremic syndrome (aHUS), aHUS characterized by thrombotic microangiopathy, ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, pre-eclampsia, or a metabolic disorder (such as NASH). In certain embodiments, the at least one symptom or feature is proteinuria, decreased renal function, renal C3 deposits, urine, hypertension, renal inflammation, glomerular mesangial IgA deposits, overactive alternative complement pathway, elevated plasma CFB, elevated serum, plasma or urine Bb, elevated serum, plasma or urine Ba, elevated serum, plasma or urine sC5b-9, elevated serum, plasma or urine C3, elevated serum, plasma or urine C4, elevated serum AH50 activity, decreased visual acuity, decreased low-light visual acuity, decreased best-corrected visual acuity, central vision loss, area of geographic atrophy, number of areas of geographic atrophy, or morphological changes in the choriocapillaris.
[0342] IX. Cancer Combination Therapy In certain embodiments, the method comprises co-administering compound 696844 with at least one other agent. In certain embodiments, the at least one other agent ameliorates a disease or disorder associated with dysregulation of the complement pathway. In certain embodiments, the at least one other agent ameliorates a disease or disorder associated with dysregulation of the alternative complement pathway. In certain embodiments, the at least one other agent ameliorates a disease or disorder associated with a CFB protein. In certain embodiments, the at least one other agent ameliorates a symptom or hallmark of a disease or disorder associated with an overactive alternative complement pathway. In certain embodiments, compound 696844 is administered simultaneously with at least one other agent to produce a combined effect. In certain embodiments, compound 696844 is administered simultaneously with at least one other agent to produce a synergistic effect.
[0343] In certain embodiments, compound 696844 and at least one other agent are administered simultaneously. In certain embodiments, compound 696844 and at least one other agent are administered at different times. In certain embodiments, compound 696844 and at least one other agent are prepared together in a single formulation. In certain embodiments, compound 696844 and at least one other agent are administered in separate formulations.
[0344] In certain embodiments, pharmaceutical agents that may be co-administered with compound 696844 include agents such as angiotensin-converting enzyme inhibitors (ACEi), angiotensin receptor blockers (ARB), or sodium / glucose cotransporter-2 inhibitors (SGLT2i), or agents for kidney diseases or disorders; anticomplement agents or complement inhibitors; agents targeting AMD, or other agents targeting eye diseases or disorders. [Example]
[0345] The following examples illustrate, but do not limit, the specific embodiments of the present disclosure.Furthermore, when specific embodiments are provided, the inventors intend that these specific embodiments are generally applicable.For example, the disclosure of an oligonucleotide with a specific motif provides rational support for additional oligonucleotides with the same or similar motif.Also, for example, when a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are considered suitable unless otherwise indicated.
[0346] Example 1: Phase 1 Human Clinical Trial with Compound 696844 Compound 696844 was formulated for administration as a sterile parenteral solution of 100 mg / mL compound in phosphate-buffered saline, adjusted to approximately pH 7.4 with acid or base during compounding. The solution was clear, colorless to pale yellow. The drug was packaged as a 0.8 mL deliverable volume in ISO 2R Type I clear glass vials stoppered with butyl rubber closures and sealed with aluminum overseals. Approximately 1.0 mL was filled into each vial to ensure the labeled 0.8 mL volume was available for administration.
[0347] Compound 696844 was evaluated in two Phase 1, double-blind, placebo-controlled, dose-escalation studies of compound 696844 administered as a single or multiple doses by subcutaneous injection to healthy adult subjects.
[0348] A total of 54 healthy human subjects ranging in age from 27 to 65 years were randomized to receive placebo (phosphate-buffered saline (PBS)) or compound 696844 in PBS. In a single ascending dose study, 18 subjects received 10, 20, or 40 mg of compound 696844 by subcutaneous injection, and 6 received placebo and were followed for a 90-day post-treatment period.
[0349] In the multiple ascending dose study, 12 subjects received 10 mg of compound 696844, 12 subjects received 20 mg of compound 696844, and 6 subjects received a placebo via subcutaneous injection. Each subject received eight doses over a 36-day period, four loading doses in the first two weeks (days 1, 4, 8, and 12), and then once weekly for the next four weeks (days 15, 22, 29, and 36). [Table 1]
[0350] Ocular and systemic safety, pharmacokinetic (PK) activity, and pharmacodynamic activity (CFB and ACP activity (AH50)) were evaluated in both single-dose and multiple-ascending dose studies.
[0351] All subjects completed the Phase 1 study (Week 19). There were no safety signals or clinically relevant changes in ocular endpoints (BCVA, IOP, and overall examination), blood chemistry, hematology, or vital signs after administration of compound 696844. Single and multiple doses of compound 696844 in healthy volunteers resulted in statistically significant dose-dependent decreases in plasma CFB levels compared with placebo, with the nadir after multiple doses occurring on Day 43 (56% decrease at 10 mg and 72% decrease at 20 mg) (Figure 1B, Figure 2). Serum factor B function (BF) activity and factor B breakdown products were also reduced.
[0352] Complement assays used include CFB levels (radial immunodiffusion); factor B function, AH50 activity, and CH50 activity (hemolytic assay); Bb levels (QUIDEL MICROVUE Bb PLUS EIA; ELISA immunoassay); AH50 activity WAP (Weislab ELISA); sC5b-9 levels (MICROVUE sC5b-9 PLUS enzyme immunoassay); C5a levels (QUIDEL C5a ELISA); C2 (radial immunodiffusion); C3 (SPAplus (binding site)); C3a (QUIDEL C3a PLUS EIA; ELISA immunoassay); C4 (SPAplus (binding site)); and factor D levels (R&D SYSTEMS QUANTIKINE kit; ELISA immunoassay).
[0353] A single dose of compound 696844 resulted in a dose-dependent decrease in plasma CFB levels, shown as percent change from baseline over time by treatment group (Figure 1A). Results for placebo-treated subjects varied over time but remained within 2 standard deviations of normal. The nadir of CFB reduction was generally reached between days 15 and 30 after dosing. Averaging across days 15, 22, and 30, the mean percent change from baseline with compound 696844 was -15% with 10 mg, -31% with 20 mg, and -39% with 40 mg, compared with -11% with placebo. The difference from placebo was statistically significant at 40 mg (p=0.030) and approached statistical significance at 20 mg (p=0.054).
[0354] After a single dose of compound 696844, serum CFB function levels (reported as factor B function) and factor B cleavage products (Bb) were similarly reduced with compound 696844 treatment. However, the reduction in factor B function was not large enough to cause consistent changes in serum alternative pathway activity (AH50). Furthermore, there were no consistent changes in serum classical complement activity, as measured by CH50 and sC5b-9, or compensatory changes in factor D or C3 levels.
[0355] Multiple doses of compound 696844 in healthy subjects resulted in dose-dependent decreases in plasma CFB, shown as actual values in Figure 1B and as percentage changes from baseline over time for each treatment group in Figure 1C. Results for placebo-treated subjects varied over time but remained within 2 SD (standard deviation) of the normal range. The nadir of CFB reduction was reached on day 43 (56% decrease at 10 mg and 72% decrease at 20 mg). Averaging across days 29, 36, 43, and 57, the mean percentage change from baseline with compound 696844 was 51% with 10 mg and 70% with 20 mg, compared with 10% with placebo.
[0356] The greater decrease in CFB levels after multiple doses was accompanied by a greater decrease in serum factor B functional and Bb levels (FIGS. 6 and 7).
[0357] Multiple administration of compound 696844 resulted in a decrease in plasma CFB and serum Bb levels (Figures 2A and 2B). A moderate (approximately 25%) decrease in AH50 hemolytic activity was observed with multiple 10 mg SC doses, and a greater decrease (approximately 55%) was observed with the 20 mg dose. AH50 hemolytic activity correlated with plasma CFB levels (Figure 2C). Even with substantial decreases in CFB, the maximum decrease in CH50 with compound 696844 treatment was only 11% at 10 mg (day 85) and 12% at 20 mg (day 43). No clinically relevant changes were observed in other complement components, including factors D, C2, C3, and C4. The mean (+ / -SE) % reduction in AH50 and classical component pathway activity (CH50) levels for the 20 mg dose on day 43 (7 days after the last dose) was -62 (+ / -5) and -12 (+ / -5)% (Figure 2B).
[0358] There were no significant safety or tolerability findings after 2 months of exposure to compound 696844, with no serious adverse events and a similar incidence of mild to moderate adverse events compared to the placebo-treated group. No increased incidence of infections was observed. No injection site reactions or clinically relevant changes in hematology, serum chemistry, liver function, or renal function were recorded.
[0359] Example 2: Phase 2 Human Clinical Trial with Compound 696844 for the Treatment of Kidney Disease An exploratory, single-arm, open-label Phase 2 study was conducted to evaluate compound 696844 in patients with primary IgA nephropathy. Subjects had biopsy-confirmed IgA nephropathy (IgAN) diagnosed within 12 months and demonstrated ≤50% interstitial fibrosis, ≤50% crescents, and the presence of C3 deposits; proteinuria of 1.5 g / day to 5.0 g / day from a 24-hour collection; hematuria; and eGFR >40 mL / min / 1.73 m. 2 had not been treated with immunosuppressive / immunomodulatory drugs within the past 12 months.
[0360] An interim analysis of an ongoing open-label study was conducted after subcutaneous administration of compound 696844 (70 mg / month, two doses every two weeks for the first month). Subjects received the compound at weeks 1, 3, and 5, and then every four weeks for 20 weeks (seven doses). The final dose was at week 25. The primary endpoint was the reduction in 24-hour proteinuria at week 29 (four weeks after the final dose) compared to baseline (BL (before compound 696844 administration)). Proteinuria was measured as urinary protein (grams / day). 2 (g / day) 2 ) and urinary protein / creatinine ratio (UPCr) 2 Secondary outcome measures included safety, complement levels, and estimated glomerular flow rate (eGFR).
[0361] Complement assays include those listed in Example 1.
[0362] The study enrolled 10 subjects, aged 25-59 years, 40% were female, 6 were Asian, and 4 were Caucasian. [Table 2] [Table 3]
[0363] Compound 696844 reduced plasma CFB levels in subjects with IgAN, reduced AP hyperactivation, and reduced proteinuria in subjects diagnosed with IgAN. Plasma CFB levels in IgAN patients were measured after multiple subcutaneous injections of 70 mg of compound 696844 at weeks 1, 3, 5, 9, 13, 17, 21, and 25. Plasma CFB levels in IgAN patients, as measured by turbidimetric assay (Figure 6), were reduced by 71% at week 9, the first week of sampling, and remained low throughout treatment. At week 37, 12 weeks after the last dose, plasma CFB levels were below LLN. Steady-state (average of weeks 21, 25, and 27) plasma CFB levels were reduced by 69%.
[0364] From baseline to the end of treatment, there was a selective decrease in plasma CFB protein levels, serum AP activity, and urinary Ba (mean changes of -69%, -39%, and -88%, respectively) (Figure 8). At baseline, median proteinuria (24-hour urine collection) was 1.89 g / day (IQR 1.09, 3.51 g / d). At week 29, the change in proteinuria was -1.00 g / d (IQR -1.82, -0.79 g / d), corresponding to a 52% decrease (Figure 4). There was no change in eGFR at week 29 compared with baseline (mean ± SD; BL 69 ± 30; Wk29 70 ± 24 mL / min / 1.73 m2) (Figure 5). The decrease in other complement components in patients with IgA nephropathy was similar to that observed in healthy subjects. Plasma levels of the factor B cleavage product Bb decreased by 78%. Furthermore, urinary levels of Ba were reduced by 88% (Figure 7). Serum alternative pathway activity, measured using a modified AH50 Wieslab alternative pathway ELISA assay (AH50 WAP), was reduced by -40%. CH50 WAP activity was reduced by only 8%. Furthermore, plasma CFBb was reduced by approximately 69%, and serum AH50 activity was reduced, although no change in CH50 was observed.
[0365] Eight of 10 subjects receiving compound 696844 demonstrated a reduction in proteinuria, as measured by 24-hour urine protein / creatinine ratios, at an interim analysis. Ten IgAN patients in an ongoing, open-label clinical trial of compound 696844 were initially maintained on a maximum dose of an ACE / ARB, followed by a baseline 24-hour urine collection. Baseline UPCr levels from the 24-hour collections ranged from 1.00 to 3.58 g / g. The median UPCr at baseline was 1.49 g / g (Q1, Q3 of 1.12 and 1.90 g / g). When assessed at week 29 after monthly administration of 70 mg SC, the median reduction in proteinuria (UPCr from 24-hour urine collections) was -45%. The range of change in proteinuria was -87% to +26%. At week 29, median eGFR (estimated creatinine-adjusted CKD-EPI2021) was maintained (+4%) compared with baseline (67.7 mL / l, 73 m2).
[0366] Compound 696844 demonstrated a favorable safety profile with no serious treatment-emergent adverse events, and the only clinically meaningful safety signals (moderate treatment-emergent adverse events (TEAEs)) were an elevation of ALT (3-5x ULN) in one subject and transient erythema at the injection site in one subject. All subjects completed the study (Week 29).
[0367] Example 3: Phase 2 Human Clinical Trial with Compound 696844 for the Treatment of AMD-Associated Geographic Atrophy A randomized, placebo-controlled, double-blind, phase 2 study was conducted in patients with geographic atrophy secondary to AMD. Patients with AMD-related geographic atrophy, BCVA > 35 letters, and GA area 1.9 mm without macular neovascularization were included. 2 Subjects aged 50 years or older with a GA size of ≤17 mm2 were enrolled. Two screening visits, 3 months apart, were conducted to assess initial growth rate for randomization stratification. The median age of participants was 76 years, and approximately 58% were women. Approximately 67% of GA lesions were subfoveal, 65% were multifocal, and 95% were bilateral. The baseline GA area was 7.6 mm2. 2 The annual change in GA area is approximately 2.0 mm 2 The growth rate was fastest in non-ocular central multifocal lesions and slowest in non-ocular central unifocal lesions. BCVA was more than 2 lines better in multifocal lesions than in unifocal lesions. As expected, the results were worse in central ocular lesions.
[0368] Subjects received subcutaneous injections of compound 696844 every 4 weeks, with the primary analysis occurring 12 months after treatment initiation. In Stage 1, subjects received 40 mg, 70 mg, or 100 mg of compound 696844 or a placebo-matching solution ("placebo") from Weeks 1 through 45. In Stage 2, the 40 mg and 70 mg treatment cohorts were expanded to new randomized groups of participants based on the interim analysis of State 1 at Week 45. Subjects were evaluated for the primary outcome measure, which included absolute change from baseline in area of geographic atrophy (GA) at Week 49 as assessed by retinal imaging. Retinal imaging was assessed by fundus autofluorescence (FAF). Subjects were evaluated for secondary outcome measures including percent change from baseline in complement, including change in plasma factor B (CFB) levels (baseline and to week 49); percent change from baseline in serum AH50 activity levels (baseline and to week 49); and absolute change from baseline in low-light visual acuity (LLVA) (baseline to week 49).
[0369] Complement assays may include those listed in Example 1 and may also include evaluation of the following: FB level (BECKMAN IMMAGE 800; nephelometry / turbidity); AH50 WAP (Weislab ELISA; deposition function ELISA); CH50 WCP (Weislab ELISA; deposition function ELISA); C3 level (BECKMAN IMMAGE 800; nephelometry / turbidity); Bb level (QUIDEL MICROVUE Bb PLUS EIA; ELISA immunoassay); MBL level (BIOPORTO (QUIDEL); ELISA immunoassay); sC5b-9 level (QUIDEL MICROVUE sC5b-9 PLUS EIA; ELISA immunoassay); Factor D level (MILLIPORE Complement Panel #1; Multiplex Luminex Immunoassay); C2 level (MILLIPORE Complement Panel #1; Multiplex Luminex Immunoassay); and C4 level (BECKMAN IMMAGE 800; nephelometry / turbidity).
[0370] Example 4: Phase 3 human clinical trial using compound 696844 for IgA nephropathy A randomized, double-blind, placebo-controlled Phase 3 clinical trial will be conducted to evaluate the efficacy and safety of compound 696844 administered subcutaneously in adult subjects with IgA nephropathy.
[0371] Example 5: Phase 3 Human Clinical Trial with Compound 696844 for AMD-Associated Geographic Atrophy A randomized, double-blind, placebo-controlled Phase 3 clinical trial will be conducted to evaluate the efficacy and safety of compound 696844 administered subcutaneously in adult subjects with geographic atrophy associated with AMD.
Claims
1. 1. A method of ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: 【Chemistry 1】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
2. 10. The method of claim 1, wherein the compound is a sodium or potassium salt.
3. 1. A method of ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: 【Chemistry 2】 (SEQ ID NO: 4) to said human subject.
4. 1. A method of ameliorating a disease or disorder associated with dysregulation of the alternative complement pathway in a human subject in need thereof, comprising administering to said human subject a therapeutically effective amount of a compound having the following chemical designation: GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= 【Transformation 3】 (wherein
5. 1. A method of reducing expression of complement factor B (CFB) RNA in a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of a compound having the following chemical structure: 【Chemistry 4】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
6. 10. The method of claim 1, wherein the compound is a sodium or potassium salt.
7. 1. A method of reducing expression of complement factor B (CFB) RNA in a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of a compound having the following chemical structure: 【Transformation 5】 (SEQ ID NO: 4) to said human subject.
8. 1. A method for reducing complement factor B (CFB) RNA in a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical designation (5' to 3'): GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= 【Transformation 6】 (wherein
9. The method of any one of claims 6 to 8, wherein CFB mRNA is reduced.
10. The method of any one of claims 6 to 8, wherein CFB protein is reduced.
11. The method of any one of claims 6 to 10, wherein administration of the compound reduces CFB protein in one or both eyes.
12. 12. The method of any one of claims 6 to 11, wherein administering the compound reduces CFB protein in one or both kidneys.
13. 13. The method of claim 12, wherein administering the compound reduces CFB protein in the glomerulus.
14. 1. A method of reducing levels of complement components in the eye or kidney of a human subject having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of a compound having the following chemical structure: 【Transformation 7】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
15. 15. The method of claim 14, wherein the compound is a sodium or potassium salt.
16. 1. A method of reducing levels of complement components in the eye or kidney of a human subject having or at risk of having a disease associated with dysregulation of the alternative complement pathway, comprising administering a therapeutically effective amount of a compound having the following chemical structure: 【Transformation 8】 (SEQ ID NO: 4) to said human subject.
17. 1. A method of reducing the level of a complement component in the eye or kidney of a human subject having, or at risk of having, a disease or disorder associated with dysregulation of the alternative complement pathway, comprising administering to the human subject a therapeutically effective amount of a compound having the following chemical designation (5' to 3'): GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C = 5-methylcytosine nucleobase G = guanine nucleobase T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= 【Chemistry 9】 (wherein
18. 18. The method of any one of claims 14 to 17, wherein the complement component is any of C3, C3a, C3b, C4b, C3dg, C5, C5a, C5b, C6, C7, C8 and C9.
19. 1. A method of reducing Complement Factor B (CFB) protein in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: 【Chemistry 10】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, to said human subject.
20. 20. The method of claim 19, wherein the compound is a sodium or potassium salt.
21. 1. A method of reducing Complement Factor B (CFB) protein in a human subject in need thereof, comprising administering to a subject a therapeutically effective amount of the following chemical structure: 【Chemistry 11】 (SEQ ID NO: 4) to said human subject.
22. 1. A method for reducing Complement Factor B (CFB) protein in a human subject in need thereof, comprising administering to said human subject a therapeutically effective amount of a compound having the following chemical designation (5' to 3'): GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= 【Chemistry 12】 (wherein
23. 23. The method of any one of claims 19 to 22, wherein the human subject has a disease or disorder associated with dysregulation of the alternative complement pathway.
24. The method of any one of claims 1 to 23, wherein the activity of the complement pathway is increased.
25. The method of any one of claims 1 to 24, wherein the activity of alternative complement activity is increased.
26. 26. The method of claim 24 or 25, wherein the increased activity is associated with a disease or disorder in the human subject.
27. The method of any one of claims 1 to 26, wherein the disease or disorder is ameliorated by reducing CFB protein.
28. The method of any one of claims 1 to 18 or 23 to 27, wherein the disease or disorder is an eye disease or disorder.
29. 29. The method of any one of claims 1 to 18 or 23 to 28, wherein the disease or disorder is macular degeneration, neuromyelitis optica, corneal disease, corneal inflammation, autoimmune uveitis, or diabetic retinopathy.
30. 30. The method of claim 29, wherein the macular degeneration is age-related macular degeneration (AMD).
31. 31. The method of claim 30, wherein the AMD is wet AMD or intermediate AMD.
32. 31. The method of claim 30, wherein the AMD is dry AMD.
33. 33. The method of any one of claims 1-18 or 23-32, wherein the disease or disorder is geographic atrophy associated with AMD.
34. 28. The method of any one of claims 1 to 18 or 23 to 27, wherein the disease or disorder is a kidney disease or disorder.
35. 35. The method of claim 34, wherein the kidney disease or disorder is IgA nephropathy.
36. 35. The method of claim 34, wherein the disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposition disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS).
37. 37. The method of claim 36, wherein the aHUS is characterized by a thrombotic microangiopathy.
38. The method of any one of claims 34 to 36, wherein the disease disorder is a kidney disease or a disorder associated with C3 deposits.
39. 39. The method of claim 38, wherein the kidney disease or disorder is associated with C3 deposits in the glomerulus.
40. 40. The method of any one of claims 34 to 39, wherein the disease or disorder is a kidney disease or disorder associated with lower than normal circulating C3 levels.
41. 41. The method of claim 40, wherein the circulating C3 level is a serum or plasma C3 level.
42. 42. The method of any one of claims 1 to 41, wherein administering the compound reduces the accumulation of C3 levels in the eye.
43. 43. The method of claim 42, wherein the accumulation is within the vascular system.
44. 42. The method of any one of claims 1 to 41, wherein administering the compound reduces C3 accumulation in the kidney.
45. 45. The method of any one of claims 1-41 or 44, wherein administering the compound reduces the level of C3 in the kidney or reduces the accumulation of C3 deposits in the kidney.
46. 46. The method of any one of claims 41, 44 or 45, wherein administering the compound reduces the level of C3 in the glomerulus or reduces the accumulation of C3.
47. 28. The method of any one of claims 1-18 or 23-27, wherein the disease or disorder is ANCA-associated vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, myasthenia gravis, multiple sclerosis, pre-eclampsia, or a metabolic disorder (such as NASH).
48. 48. The method of any one of claims 1 to 47, wherein the subject is identified as having or at risk of having a disease or disorder associated with dysregulation of the alternative complement pathway.
49. 49. The method of claim 48, wherein said identifying comprises detecting complement levels or membrane attack complex levels in the subject's blood.
50. 50. The method of claim 49, wherein said identifying comprises detecting complement levels or membrane attack complex levels in the serum or plasma of said subject.
51. 50. The method of claim 49, wherein said identifying comprises performing genetic testing for a genetic mutation in a complement factor associated with said disease or disorder.
52. 52. The method of any one of claims 1-18 or 23-51, wherein at least one symptom or characteristic of the disease or disorder associated with dysregulation of the alternative complement pathway is ameliorated.
53. 53. The method of claim 52, wherein the symptom or feature is proteinuria; progressive decline in renal function; C3 deposits in the kidney; hematuria; hypertension; renal inflammation; IgA deposits in the glomerular mesangium; a highly active alternative complement pathway; elevated plasma CFB protein; elevated serum, plasma, or urinary Bb; elevated serum, plasma, or urinary Ba; elevated serum, plasma, or urinary sC5b-9; elevated or decreased serum, plasma, or urinary C3; elevated serum, plasma, or urinary C4; or elevated serum AH50 activity.
54. 53. The method of claim 52, wherein the symptom or feature is a progressive decrease in visual acuity; a progressive decrease in low-light visual acuity; a progressive decrease in best-corrected visual acuity; a progressive decrease in central visual acuity; morphological changes in the choriocapillaris; ocular geographic atrophy; ocular C3 deposits; a hyperactive alternative complement pathway; elevated plasma CFB protein; elevated serum, plasma, or urinary Bb; elevated serum, plasma, or urinary Ba; elevated serum, plasma, or urinary sC5b-9; elevated or decreased serum, plasma, or urinary C3; elevated serum, plasma, or urinary C4; or elevated serum AH50 activity.
55. The method of any one of claims 1-54, wherein administration of the compound delays or prevents visual acuity decline, delays or prevents decline in low light visual acuity; delays or prevents decline in best-corrected visual acuity; delays or prevents decline in central visual acuity; delays or prevents morphological changes in the choriocapillaris; delays or prevents ocular geographic atrophy; reduces ocular C3 deposits; reduces alternative complement pathway activity; reduces plasma CFB protein; reduces serum, plasma, or urinary Bb; reduces serum, plasma, or urinary Ba; reduces serum, plasma, or urinary sC5b-9; modulates, increases, or decreases serum, plasma, or urinary C3; reduces serum, plasma, or urinary C4; or reduces serum AH50 activity.
56. 54. The method of any one of claims 1-53, wherein administration of the compound reduces proteinuria; delays or prevents decline in renal function; reduces renal C3 deposits; reduces hematuria; reduces hypertension; reduces renal inflammation; reduces glomerular mesangial IgA deposits; reduces alternative complement pathway activity; reduces plasma CFB protein; reduces serum, plasma, or urinary Bb; reduces serum, plasma, or urinary Ba; reduces serum, plasma, or urinary sC5b-9; modulates, increases, or decreases serum, plasma, or urinary C3; reduces serum, plasma, or urinary C4; or reduces serum AH50 activity.
57. 57. The method of any one of claims 1 to 56, wherein the urinary protein / creatine ratio is reduced following administration of the compound.
58. 58. The method of any one of claims 1 to 57, wherein the level of urinary protein is reduced following administration of the compound.
59. 34. The method of any one of claims 28-33, wherein administering the compound delays or prevents the progression or onset of geographic atrophy in the subject.
60. 34. The method of any one of claims 28 to 33, wherein administering the compound slows the expansion of the area of geographic atrophy in the subject.
61. 61. The method of claim 60, wherein administration of the compound slows the spread of geographic atrophy to the foveal region.
62. 34. The method of any one of claims 28 to 33, wherein administering the compound halts the expansion of geographic atrophy.
63. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is 10 mg.
64. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is 20 mg.
65. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is 40 mg.
66. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is 70 mg.
67. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is 100 mg.
68. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is about 10 mg.
69. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is about 20 mg.
70. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is about 40 mg.
71. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is about 70 mg.
72. 63. The method of any one of claims 1 to 62, wherein the therapeutically effective amount is about 100 mg.
73. The therapeutically effective amount may be 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, 350 mg, 355 mg, 360 mg, 365 mg, 370 mg, 375 mg, 380 mg, 385 mg, 390 mg, 400 mg, 405 mg, 410 mg, 415 mg, 420 mg, 425 mg, 430 mg, 430 mg, 440 mg, 4 63. The method of any one of claims 1 to 62, wherein the dose is any one of 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, 300 mg, 305 mg, 310 mg, 315 mg, 320 mg, 325 mg, 330 mg, 335 mg, 340 mg, 345 mg, and 350 mg.
74. the therapeutically effective amount is about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, 63. The method of any one of claims 1 to 62, wherein the dose is any of about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, about 300 mg, about 305 mg, about 310 mg, about 315 mg, about 320 mg, about 325 mg, about 330 mg, about 335 mg, about 340 mg, about 345 mg, and about 350 mg.
75. The therapeutically effective amount may be 10 mg, 10.1 mg, 10.2 mg, 10.3 mg, 10.4 mg, 10.5 mg, 10.6 mg, 10.7 mg, 10.8 mg, 10.9 mg, 11 mg, 11.1 mg, 11.2 mg, 11.3 mg, 11.4 mg, 11.5 mg, 11.6 mg, 11.7 mg, 11.8 mg, 11.9 mg, 12 mg, 12.1 mg, 12.2 mg, 12.3 mg, 12.4 mg, 12.5 mg, 12.6 mg, 12.7 mg, 12.8 mg, 12.9 mg, 13 mg, 13.1 mg, 13.2 mg, 13.3 mg, 13.4 mg, 13.5 mg, 13.6 mg, 13.7 mg, 13.8 mg, 13.9 mg, 14.0 mg, 14.1 mg, 14.2 mg, 14.3 mg, 14.4 mg, 14.5 mg, 14.6 mg, 14.7 mg, 14.8 mg, 14.9 mg, 15.0 mg, 15.1 mg, 15.2 mg, 15.3 mg, 15.4 mg, 15.5 mg, 15.6 mg, 15.7 mg, 15.8 mg, 15.9 mg, 16.0 mg, 16.1 mg, 16.2 mg, 16.3 mg, 16.4 mg, 16.5 mg, 16.6 mg, 16.7 mg, 16.8 mg, 16.9 mg, 17.0 mg, 17.1 mg, 17.2 mg, mg, 13.6mg, 13.7mg, 13.8mg, 13.9mg, 14mg, 14.1mg, 14.2mg, 14.3mg, 14.4m g, 14.5mg, 14.6mg, 14.7mg, 14.8mg, 14.9mg, 15mg, 15.1mg, 15.2mg, 15.3mg, 15.4mg, 15.5mg, 15.6mg, 15.7mg, 15.8mg, 15.9mg, 16mg, 16.1mg, 16.2mg, 1 6.3mg, 16.4mg, 16.5mg, 16.6mg, 16.7mg, 16.8mg, 16.9mg, 17mg, 17.1mg, 17. 2mg, 17.3mg, 17.4mg, 17.5mg, 17.6mg, 17.7mg, 17.8mg, 17.9mg, 18mg, 18.1 mg, 18.2mg, 18.3mg, 18.4mg, 18.5mg, 18.6mg, 18.7mg, 18.8mg, 18.9mg, 19mg , 19.1mg, 19.2mg, 19.3mg, 19.4mg, 19.5mg, 19.6mg, 19.7mg, 19.8mg, 19.9m g, 20mg, 20.1mg, 20.2mg, 20.3mg, 20.4mg, 20.5mg, 20.6mg, 20.7mg, 20.8mg, 20.9mg, 21mg, 21.1mg, 21.2mg, 21.3mg, 21.4mg, 21.5mg, 21.6mg, 21.7mg, 2 1.8mg, 21.9mg, 22mg, 22.1mg, 22.2mg, 22.3mg, 22.4mg, 22.5mg, 22.6mg, 22. 7mg, 22.8mg, 22.9mg, 23mg, 23.1mg, 23.2mg, 23.3mg, 23.4mg, 23.5mg, 23.6m g, 23.7mg, 23.8mg, 23.9mg, 24mg, 24.1mg, 24.2mg, 24.3mg, 24.4mg, 24.5mg,24.6mg、24.7mg、24.8mg、24.9mg、25mg、25.1mg、25.2mg、25.3mg、25.4mg、25.5mg、25.6mg、25.7mg、25.8mg、25.9mg、26mg、26.1mg、26.2mg、26.3mg、26.4mg、26.5mg、26.6mg、26.7mg、26.8mg、26.9mg、27mg、27.1mg、27.2mg、27.3mg、27.4mg、27.5mg、27.6mg、27.7mg、27.8mg、27.9mg、28mg、28.1mg、28.2mg、28.3mg、28.4mg、28.5mg、28.6mg、28.7mg、28.8mg、28.9mg、29mg、29.1mg、29.2mg、29.3mg、29.4mg、29.5mg、29.6mg、29.7mg、29.8mg、29.9mg、30mg、30.1mg、30.2mg、30.3mg、30.4mg、30.5mg、30.6mg、30.7mg、30.8mg、30.9mg、31mg、31.1mg、31.2mg、31.3mg、31.4mg、31.5mg、31.6mg、31.7mg、31.8mg、31.9mg、32mg、32.1mg、32.2mg、32.3mg、32.4mg、32.5mg、32.6mg、32.7mg、32.8mg、32.9mg、33mg、33.1mg、33.2mg、33.3mg、33.4mg、33.5mg、33.6mg、33.7mg、33.8mg、33.9mg、34mg、34.1mg、34.2mg、34.3mg、34.4mg、34.5mg、34.6mg、34.7mg、34.8mg、34.9mg、35mg、35.1mg、35.2mg、35.3mg、35.4mg、35.5mg、35.6mg、35.7mg、35.8mg、35.9mg、36mg、36.1mg、36.2mg、36.3mg、36.4mg、36.5mg、36.6mg、36.7mg、36.8mg、36.9mg、37mg、37.1mg、37.2mg、37.3mg、37.4mg、37.5mg、37.6mg、37.7mg、37.8mg、37.9mg、38mg、38.1mg、38.2mg、38.3mg、38.4mg、38.5mg、38.6mg、38.7mg、38.8mg、38.9mg、39mg、39.1mg、39.2mg、39.3mg、39.4mg、39.5mg、39.6mg、39.7mg、39.8mg、39.9mg、40mg、40.1mg、40.2mg、40.3mg、40.4mg、40.5mg、40.6mg、40.7mg、40.8mg、40.9mg、41mg、41.1mg、41.2mg、41.3mg、41.4mg、41.5mg、41.6mg、41.7mg、41.8mg、41.9mg、42mg、42.1mg、42.2mg、42.3mg、42.4mg、42.5mg、42.6mg、42.7mg、42.8mg、42.9mg、43mg、43.1mg、43.2mg、43.3mg、43.4mg、43.5mg、43.6mg、43.7mg、43.8mg、43.9mg、44mg、44.1mg、44.2mg、44.3mg、44.4mg、44.5mg、44.6mg、44.7mg、44.8mg、44.9mg、45mg、45.1mg、45.2mg、45.3mg、45.4mg、45.5mg、45.6mg、45.7mg、45.8mg、45.9mg、46mg、46.1mg、46.2mg、46.3mg、46.4mg、46.5mg、46.6mg、46.7mg、46.8mg、46.9mg、47mg、47.1mg、47.2mg、47.3mg、47.4mg、47.5mg、47.6mg、47.7mg、47.8mg、47.9mg、48mg、48.1mg、48.2mg、48.3mg、48.4mg、48.5mg、48.6mg、48.7mg、48.8mg、48.9mg、49mg、49.1mg、49.2mg、49.3mg、49.4mg、49.5mg、49.6mg、49.7mg、49.8mg、49.9mg、50mg、50.1mg、50.2mg、50.3mg、50.4mg、50.5mg、50.6mg、50.7mg、50.8mg、50.9mg、51mg、51.1mg、51.2mg、51.3mg、51.4mg、51.5mg、51.6mg、51.7mg、51.8mg、51.9mg、52mg、52.1mg、52.2mg、52.3mg、52.4mg、52.5mg、52.6mg、52.7mg、52.8mg、52.9mg、53mg、53.1mg、53.2mg、53.3mg、53.4mg、53.5mg、53.6mg、53.7mg、53.8mg、53.9mg、54mg、54.1mg、54.2mg、54.3mg、54.4mg、54.5mg、54.6mg、54.7mg、54.8mg、54.9mg、55mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68mg、68.1mg、68.2mg、68.3mg、68.4mg、68.5mg、68.6mg、The method according to any one of claims 1 to 62, wherein the dose is any of 68.7 mg, 68.8 mg, 68.9 mg, 69 mg, 69.1 mg, 69.2 mg, 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, and 69.9 mg.
76. the therapeutically effective amount is about 10 mg, about 10.1 mg, about 10.2 mg, about 10.3 mg, about 10.4 mg, about 10.5 mg, about 10.6 mg, about 10.7 mg, about 10.8 mg, about 10.9 mg, about 11 mg, about 11.1 mg, about 11.2 mg, about 11.3 mg, about 11.4 mg, about 11.5 mg, about 11.6 mg, about 11.7 mg, about 11.8 mg, about 11.9 mg, about 12 mg, about 12.1 mg, about 12.2 mg, about 12.3 mg, about 12.4 mg, about 12.5 mg, about 12.6 mg, about 12.7 mg, about 12.8 mg, about 12.9 mg, about 13 mg, about 13.1 mg, about 13.2 mg, about 13.3 mg, about 13.4 mg, about 13.5 mg, about 13.6 mg, about 13.7 mg, about 13.8 mg, about 13.9 mg, about 14 mg, about 14.1 mg, about 14.2 mg, about 14.3 mg, about 14.4 mg, about 14.5 mg, about 14.6 mg, about 14.7 mg, about 14.8 mg, about 14.9 mg, about 15 mg, about 15.1 mg, about 15.2 mg, about 15.3 mg, about 15.4 mg, about 15.5 mg, about 15.6 mg, about 15.7 mg, about 15.8 mg, about 15.9 mg, about 16 mg, about 16.1 mg, about 16.2 mg, about 16.3 mg, about 16.4 mg, about 16.5 mg, about 16.6 mg, about 16.7 mg, about 16.8 mg, about 16.9 mg, about 17 mg, about 17.1 mg, about 17.2 mg, about 17.3 mg, about 17.4 mg, about 17.5 mg, about 17.6 mg, about 17.7 mg, about 17.8 mg, about 17.9 mg, about 18 mg, about 18.1 mg, about 18.2 mg, about 18.3 mg, about 18.4 mg, about 18.5 mg, about 18.6 mg, about 18.7 mg, about 18.8 mg, about 18.9 mg, about 19 mg, about 19.1 mg, about 19.2 mg, about 19.3 mg, about 19.4 mg, about 19.5mg, about 19.6mg, about 19.7mg, about 19.8mg, about 19.9mg, about 20mg, about 20.1mg, about 20.2mg, About 20.3mg, about 20.4mg, about 20.5mg, about 20.6mg, about 20.7mg, about 20.8mg, about 20.9mg, about 21mg, about 21.1mg, about 21.2mg, about 21.3mg, about 21.4mg, about 21.5mg, about 21.6mg, about 21.7mg, about 21.8mg , about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, about 22.6 mg,Approximately 22.7 mg, approximately 22.8 mg, approximately 22.9 mg, approximately 23 mg, approximately 23.1 mg, approximately 23.2 mg, approximately 23.3 mg, approximately 23.4 mg, approximately 23.5 mg, approximately 23.6 mg, approximately 23.7 mg, approximately 23.8 mg, approximately 23.9 mg, approximately 24 mg, approximately 24.1 mg, approximately 24.2 mg, Approximately 24.3 mg, approximately 24.4 mg, approximately 24.5 mg, approximately 24.6 mg, approximately 24.7 mg, approximately 24.8 mg, approximately 24.9 mg, approximately 25 mg, approximately 25.1 mg, approximately 25.2 mg, approximately 25.3 mg, approximately 25.4 mg, approximately 25.5 mg, approximately 25.6 mg, approximately 25.7 mg, approximately 25.8 mg Approximately 25.9 mg, approximately 26 mg, approximately 26.1 mg, approximately 26.2 mg, approximately 26.3 mg, approximately 26.4 mg, approximately 26.5 mg, approximately 26.6 mg, approximately 26.7 mg, approximately 26.8 mg, approximately 26.9 mg, approximately 27 mg, approximately 27.1 mg, approximately 27.2 mg, approximately 27.3 mg, approximately 27.4 mg, Approximately 27.5 mg, approximately 27.6 mg, approximately 27.7 mg, approximately 27.8 mg, approximately 27.9 mg, approximately 28 mg, approximately 28.1 mg, approximately 28.2 mg, approximately 28.3 mg, approximately 28.4 mg, approximately 28.5 mg, approximately 28.6 mg, approximately 28.7 mg, approximately 28.8 mg, approximately 28.9 mg, approximately 29 mg, approximately... 29.1 mg, approximately 29.2 mg, approximately 29.3 mg, approximately 29.4 mg, approximately 29.5 mg, approximately 29.6 mg, approximately 29.7 mg, approximately 29.8 mg, approximately 29.9 mg, approximately 30 mg, approximately 30.1 mg, approximately 30.2 mg, approximately 30.3 mg, approximately 30.4 mg, approximately 30.5 mg, approximately 30.6 mg Approximately 30.7 mg, approximately 30.8 mg, approximately 30.9 mg, approximately 31 mg, approximately 31.1 mg, approximately 31.2 mg, approximately 31.3 mg, approximately 31.4 mg, approximately 31.5 mg, approximately 31.6 mg, approximately 31.7 mg, approximately 31.8 mg, approximately 31.9 mg, approximately 32 mg, approximately 32.1 mg, approximately 32.2 mg, Approximately 32.3 mg, approximately 32.4 mg, approximately 32.5 mg, approximately 32.6 mg, approximately 32.7 mg, approximately 32.8 mg, approximately 32.9 mg, approximately 33 mg, approximately 33.1 mg, approximately 33.2 mg, approximately 33.3 mg, approximately 33.4 mg, approximately 33.5 mg, approximately 33.6 mg, approximately 33.7 mg, approximately 33.8 mg Approximately 33.9 mg, approximately 34 mg, approximately 34.1 mg, approximately 34.2 mg, approximately 34.3 mg, approximately 34.4 mg, approximately 34.5 mg, approximately 34.6 mg, approximately 34.7 mg, approximately 34.8 mg, approximately 34.9 mg, approximately 35 mg, approximately 35.1 mg, approximately 35.2 mg, approximately 35.3 mg, approximately 35.4 mg,about 35.5 mg, about 35.6 mg, about 35.7 mg, about 35.8 mg, about 35.9 mg, about 36 mg, about 36.1 mg, about 36.2 mg, about 36.3 mg, about 36.4 mg, about 36.5 mg, about 36.6 mg, about 36.7 mg, about 36.8 mg, about 36.9 mg, about 37 mg, Approximately 37.1mg, approximately 37.2mg, approximately 37.3mg, approximately 37.4mg, approximately 37.5mg, approximately 37.6mg, approximately 37.7mg, approximately 37.8m g, about 37.9 mg, about 38 mg, about 38.1 mg, about 38.2 mg, about 38.3 mg, about 38.4 mg, about 38.5 mg, about 38.6 mg , about 38.7 mg, about 38.8 mg, about 38.9 mg, about 39 mg, about 39.1 mg, about 39.2 mg, about 39.3 mg, about 39.4 mg, about 39.5 mg, about 39.6 mg, about 39.7 mg, about 39.8 mg, about 39.9 mg, about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg , about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 44.5 mg, about 44.6 mg, about 44.7 mg, about 44.8 mg, about 44.9 mg, about 45 mg, about 45.1 mg, about 45.2 mg, about 45.3 mg, about 45.4 mg, about 45.5 mg, about 45.6 mg, about 45.7 mg, about 45.8 mg, about 45.9 mg, about 46 mg, about 46.1 mg, about 46.2 mg, about 46.3 mg, about 46.4 mg, about 46.5 mg, about 46.6 mg, about 46.7 mg, about 46.8 mg, about 46.9 mg, about 47 mg, about 47.1 mg, about 47.2 mg, about 47.3 mg, about 47.4 mg, about 47.5 mg, about 47.6 mg, about 47.7 mg, about 47.8 mg, about 47.9 mg, about 48 mg, about 48.1 mg, about 48.2 mg,About 48.3 mg, about 48.4 mg, about 48.5 mg, about 48.6 mg, about 48.7 mg, about 48.8 mg, about 48.9 mg, about 49 mg, about 49.1 mg, about 49.2 mg, about 49.3 mg, about 49.4 mg, about 49.5 mg, about 49.6 mg, about 49.7 mg, about 49.8 mg, about 49.9 mg, about 50 mg, about 50.1 mg, about 50.2 mg, about 50.3 mg, about 50.4 mg, about 50.5 mg, about 50.6 mg, about 50.7 mg, about 50.8 mg, about 50.9 mg, about 51 mg, about 51.1 mg, about 51.2 mg, about 51.3 mg, about 51.4 mg , about 51.5 mg, about 51.6 mg, about 51.7 mg, about 51.8 mg, about 51.9 mg, about 52 mg, about 52.1 mg, about 52.2 mg, about 52.3 mg, about 52.4 mg, about 52.5 mg, about 52.6 mg, about 52.7 mg, about 52.8 mg, about 52.9 mg, about 53 mg, about 53.1 mg, about 53.2 mg, about 53.3 mg, about 53.4 mg, about 53.5 mg, about 53.6 mg, about 53.7 mg, about 53.8 mg, about 53.9 mg, about 54 mg, about 54.1 mg, about 54.2 mg, about 54.3 mg, about 54.4 mg, about 54.5 mg, about 54.6 mg , about 54.7 mg, about 54.8 mg, about 54.9 mg, about 55 mg, about 55.1 mg, about 55.2 mg, about 55.3 mg, about 55.4 mg , about 55.5 mg, about 55.6 mg, about 55.7 mg, about 55.8 mg, about 55.9 mg, about 56 mg, about 56.1 mg, about 56.2 mg , about 56.3 mg, about 56.4 mg, about 56.5 mg, about 56.6 mg, about 56.7 mg, about 56.8 mg, about 56.9 mg, about 57 mg , about 57.1mg, about 57.2mg, about 57.3mg, about 57.4mg, about 57.5mg, about 57.6mg, about 57.7mg, about 57.8m g, about 57.9 mg, about 58 mg, about 58.1 mg, about 58.2 mg, about 58.3 mg, about 58.4 mg, about 58.5 mg, about 58.6 m g, about 58.7 mg, about 58.8 mg, about 58.9 mg, about 59 mg, about 59.1 mg, about 59.2 mg, about 59.3 mg, about 59.4 mg , about 59.5mg, about 59.6mg, about 59.7mg, about 59.8mg, about 59.9mg, about 60mg, about 60.1mg, about 60.2mg , about 60.3 mg, about 60.4 mg, about 60.5 mg, about 60.6 mg, about 60.7 mg, about 60.8 mg, about 60.9 mg, about 61 mg,About 61.1 mg, about 61.2 mg, about 61.3 mg, about 61.4 mg, about 61.5 mg, about 61.6 mg, about 61.7 mg, about 61.8 mg, about 61.9 mg, about 62 mg, about 62.1 mg, about 62.2 mg, about 62.3 mg, about 62.4 mg, about 62.5 mg, about 62.6 mg, about 62.7 mg, about 62.8 mg, about 62.9 mg, about 63 mg, about 63.1 mg, about 63.2 mg, about 63.3 mg, about 6 3.4 mg, about 63.5 mg, about 63.6 mg, about 63.7 mg, about 63.8 mg, about 63.9 mg, about 64 mg, about 64.1 mg, about 64.2 mg, about 64.3 mg, about 64.4 mg, about 64.5 mg, about 64.6 mg, about 64.7 mg, about 64.8 mg, about 64.9 mg, about 65 mg, about 65.1 mg, about 65.2 mg, about 65.3 mg, about 65.4 mg, about 65.5 mg, about 65.6 mg, about 65. 7 mg, about 65.8 mg, about 65.9 mg, about 66 mg, about 66.1 mg, about 66.2 mg, about 66.3 mg, about 66.4 mg, about 66.5 mg, about 66.6 mg, about 66.7 mg, about 66.8 mg, about 66.9 mg, about 67 mg, about 67.1 mg, about 67.2 mg, about 67.3 mg, about 67.4 mg, about 67.5 mg, about 67.6 mg, about 67.7 mg, about 67.8 mg, about 67.9 mg, about 68 mg, The method of any one of claims 1 to 62, wherein the dose is any one of about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, and about 69.9 mg.
77. The therapeutically effective amount may be 20 mg, 20.1 mg, 20.2 mg, 20.3 mg, 20.4 mg, 20.5 mg, 20.6 mg, 20.7 mg, 20.8 mg, 20.9 mg, 21 mg, 21.1 mg, 21.2 mg, 21.3 mg, 21.4 mg, 21.5 mg, 21.6 mg, 21.7 mg, 21.8 mg, 21.9 mg, 22 mg, 22.1 mg, 22.2 mg, 22.3 mg, 22.4 mg, 22.5 mg, 22.6 mg, 22.7 mg, 22.8 mg, 22.9 mg, 23 mg, 23.1 mg, 23.2 mg, 23.3 mg, 23.4 mg, 23.5 mg, 23.6 mg, 23.7 mg, 23.8 mg, 23.9 mg, 24.1 mg, 24.2 mg, 24.3 mg, 24.4 mg, 24.5 mg, 24.6 mg, 24.7 mg, 24.8 mg, 24.9 mg, 25 mg, 25.1 mg, 25.2 mg, 25.3 mg, 25.4 mg, 25.5 mg, 25.6 mg, 25.7 mg, 25.8 mg, 25.9 mg, 26 mg, 26.1 mg, 26.2 mg, 26.3 mg, 26.4 mg, 26.5 mg, 26.6 mg, 26.7 mg, 26.8 mg, 26.9 mg, 27 mg, 27.1 mg, 27.2 mg, 27.3 mg, 27.4 mg, mg, 23.6mg, 23.7mg, 23.8mg, 23.9mg, 24mg, 24.1mg, 24.2mg, 24.3mg, 24.4m g, 24.5mg, 24.6mg, 24.7mg, 24.8mg, 24.9mg, 25mg, 25.1mg, 25.2mg, 25.3mg, 25.4mg, 25.5mg, 25.6mg, 25.7mg, 25.8mg, 25.9mg, 26mg, 26.1mg, 26.2mg, 2 6.3mg, 26.4mg, 26.5mg, 26.6mg, 26.7mg, 26.8mg, 26.9mg, 27mg, 27.1mg, 27. 2mg, 27.3mg, 27.4mg, 27.5mg, 27.6mg, 27.7mg, 27.8mg, 27.9mg, 28mg, 28.1 mg, 28.2mg, 28.3mg, 28.4mg, 28.5mg, 28.6mg, 28.7mg, 28.8mg, 28.9mg, 29mg , 29.1mg, 29.2mg, 29.3mg, 29.4mg, 29.5mg, 29.6mg, 29.7mg, 29.8mg, 29.9m g, 30mg, 30.1mg, 30.2mg, 30.3mg, 30.4mg, 30.5mg, 30.6mg, 30.7mg, 30.8mg, 30.9mg, 31mg, 31.1mg, 31.2mg, 31.3mg, 31.4mg, 31.5mg, 31.6mg, 31.7mg, 3 1.8mg, 31.9mg, 32mg, 32.1mg, 32.2mg, 32.3mg, 32.4mg, 32.5mg, 32.6mg, 32. 7mg, 32.8mg, 32.9mg, 33mg, 33.1mg, 33.2mg, 33.3mg, 33.4mg, 33.5mg, 33.6m g, 33.7mg, 33.8mg, 33.9mg, 34mg, 34.1mg, 34.2mg, 34.3mg, 34.4mg, 34.5mg,34.6mg, 34.7mg, 34.8mg, 34.9mg, 35mg, 35.1mg, 35.2mg, 35.3mg, 35.4mg, 35.5mg, 35.6mg, 35.7mg, 35.8mg, 35.9mg, 36mg, 36.1mg, 36.2mg, 36.3mg, 36.4mg, 36.5mg, 36.6mg, 36.7mg, 36.8mg, 36.9mg, 37mg, 37.1mg, 37.2mg, 37.3mg, 37.4mg, 37.5m 63. The method of any one of claims 1 to 62, wherein the amount of the compound is any one of 37.6 mg, 37.7 mg, 37.8 mg, 37.9 mg, 38 mg, 38.1 mg, 38.2 mg, 38.3 mg, 38.4 mg, 38.5 mg, 38.6 mg, 38.7 mg, 38.8 mg, 38.9 mg, 39 mg, 39.1 mg, 39.2 mg, 39.3 mg, 39.4 mg, 39.5 mg, 39.6 mg, 39.7 mg, 39.8 mg, 39.9 mg, and 40 mg.
78. the therapeutically effective amount is about 20 mg, about 20.1 mg, about 20.2 mg, about 20.3 mg, about 20.4 mg, about 20.5 mg, about 20.6 mg, about 20.7 mg, about 20.8 mg, about 20.9 mg, about 21 mg, about 21.1 mg, about 21.2 mg, about 21.3 mg, about 21.4 mg, about 21.5 mg, about 21.6 mg, about 21.7 mg, about 21.8 mg, about 21.9 mg, about 22 mg, about 22.1 mg, about 22.2 mg, about 22.3 mg, about 22.4 mg, about 22.5 mg, about 22.6 mg, about 22.7 mg, about 22.8 mg, about 22.9 mg, about 23 mg, Approximately 23.1mg, approximately 23.2mg, approximately 23.3mg, approximately 23.4mg, approximately 23.5mg, approximately 23.6mg, approximately 23.7mg, approximately 23.8m g, about 23.9 mg, about 24 mg, about 24.1 mg, about 24.2 mg, about 24.3 mg, about 24.4 mg, about 24.5 mg, about 24.6 mg , about 24.7mg, about 24.8mg, about 24.9mg, about 25mg, about 25.1mg, about 25.2mg, about 25.3mg, about 25.4mg , about 25.5 mg, about 25.6 mg, about 25.7 mg, about 25.8 mg, about 25.9 mg, about 26 mg, about 26.1 mg, about 26.2 mg, about 26.3mg, about 26.4mg, about 26.5mg, about 26.6mg, about 26.7mg, about 26.8mg, about 26.9mg, about 27mg, Approximately 27.1mg, approximately 27.2mg, approximately 27.3mg, approximately 27.4mg, approximately 27.5mg, approximately 27.6mg, approximately 27.7mg, approximately 27.8mg , about 27.9mg, about 28mg, about 28.1mg, about 28.2mg, about 28.3mg, about 28.4mg, about 28.5mg, about 28.6mg , about 28.7mg, about 28.8mg, about 28.9mg, about 29mg, about 29.1mg, about 29.2mg, about 29.3mg, about 29.4mg, about 29.5 mg, about 29.6 mg, about 29.7 mg, about 29.8 mg, about 29.9 mg, about 30 mg, about 30.1 mg, about 30.2 mg, About 30.3mg, about 30.4mg, about 30.5mg, about 30.6mg, about 30.7mg, about 30.8mg, about 30.9mg, about 31mg, about 31.1mg, about 31.2mg, about 31.3mg, about 31.4mg, about 31.5mg, about 31.6mg, about 31.7mg, about 31.8mg , about 31.9 mg, about 32 mg, about 32.1 mg, about 32.2 mg, about 32.3 mg, about 32.4 mg, about 32.5 mg, about 32.6 mg,Approximately 32.7mg, approximately 32.8mg, approximately 32.9mg, approximately 33mg, approximately 33.1mg, approximately 33.2mg, approximately 33.3mg, approximately 33.4mg, approximately 33.5mg, approximately 33.6m g, about 33.7 mg, about 33.8 mg, about 33.9 mg, about 34 mg, about 34.1 mg, about 34.2 mg, about 34.3 mg, about 34.4 mg, about 34.5 mg, about 34. 6mg, about 34.7mg, about 34.8mg, about 34.9mg, about 35mg, about 35.1mg, about 35.2mg, about 35.3mg, about 35.4mg, about 35.5mg, about 3 5.6mg, about 35.7mg, about 35.8mg, about 35.9mg, about 36mg, about 36.1mg, about 36.2mg, about 36.3mg, about 36.4mg, about 36.5mg, Approximately 36.6 mg, approximately 36.7 mg, approximately 36.8 mg, approximately 36.9 mg, approximately 37 mg, approximately 37.1 mg, approximately 37.2 mg, approximately 37.3 mg, approximately 37.4 mg, approximately 37.5 mg, approximately 37.6 mg, approximately 37.7 mg, approximately 37.8 mg, approximately 37.9 mg, approximately 38 mg, approximately 38.1 mg, approximately 38.2 mg, approximately 38.3 mg, approximately 38.4 mg, approximately 38.
63. The method according to any one of claims 1 to 62, wherein the dose is any one of about 5 mg, about 38.6 mg, about 38.7 mg, about 38.8 mg, about 38.9 mg, about 39 mg, about 39.1 mg, about 39.2 mg, about 39.3 mg, about 39.4 mg, about 39.5 mg, about 39.6 mg, about 39.7 mg, about 39.8 mg, about 39.9 mg, and about 40 mg.
79. The therapeutically effective amount may be 40 mg, 40.1 mg, 40.2 mg, 40.3 mg, 40.4 mg, 40.5 mg, 40.6 mg, 40.7 mg, 40.8 mg, 40.9 mg, 41 mg, 41.1 mg, 41.2 mg, 41.3 mg, 41.4 mg, 41.5 mg, 41.6 mg, 41.7 mg, 41.8 mg, 41.9 mg, 42 mg, 42.1 mg, 42.2 mg, 42.3 mg, 42.4 mg, 42.5 mg, 42.6 mg, 42.7 mg, 42.8 mg, 42.9 mg, 43 mg, 43.1 mg, 43.2 mg, 43.3 mg, 43.4 mg, 43.5 mg, 43.6 mg, 43.7 mg, 43.8 mg, 43.9 mg, 44.1 mg, 44.2 mg, 44.3 mg, 44.4 mg, 44.5 mg, 44.6 mg, 44.7 mg, 44.8 mg, 44.9 mg, 45 ... mg, 43.6mg, 43.7mg, 43.8mg, 43.9mg, 44mg, 44.1mg, 44.2mg, 44.3mg, 44.4m g, 44.5mg, 44.6mg, 44.7mg, 44.8mg, 44.9mg, 45mg, 45.1mg, 45.2mg, 45.3mg, 45.4mg, 45.5mg, 45.6mg, 45.7mg, 45.8mg, 45.9mg, 46mg, 46.1mg, 46.2mg, 4 6.3mg, 46.4mg, 46.5mg, 46.6mg, 46.7mg, 46.8mg, 46.9mg, 47mg, 47.1mg, 47. 2mg, 47.3mg, 47.4mg, 47.5mg, 47.6mg, 47.7mg, 47.8mg, 47.9mg, 48mg, 48.1 mg, 48.2mg, 48.3mg, 48.4mg, 48.5mg, 48.6mg, 48.7mg, 48.8mg, 48.9mg, 49mg , 49.1mg, 49.2mg, 49.3mg, 49.4mg, 49.5mg, 49.6mg, 49.7mg, 49.8mg, 49.9m g, 50mg, 50.1mg, 50.2mg, 50.3mg, 50.4mg, 50.5mg, 50.6mg, 50.7mg, 50.8mg, 50.9mg, 51mg, 51.1mg, 51.2mg, 51.3mg, 51.4mg, 51.5mg, 51.6mg, 51.7mg, 5 1.8mg, 51.9mg, 52mg, 52.1mg, 52.2mg, 52.3mg, 52.4mg, 52.5mg, 52.6mg, 52. 7mg, 52.8mg, 52.9mg, 53mg, 53.1mg, 53.2mg, 53.3mg, 53.4mg, 53.5mg, 53.6m g, 53.7mg, 53.8mg, 53.9mg, 54mg, 54.1mg, 54.2mg, 54.3mg, 54.4mg, 54.5mg,54.6mg、54.7mg、54.8mg、54.9mg、55mg、55.1mg、55.2mg、55.3mg、55.4mg、55.5mg、55.6mg、55.7mg、55.8mg、55.9mg、56mg、56.1mg、56.2mg、56.3mg、56.4mg、56.5mg、56.6mg、56.7mg、56.8mg、56.9mg、57mg、57.1mg、57.2mg、57.3mg、57.4mg、57.5mg、57.6mg、57.7mg、57.8mg、57.9mg、58mg、58.1mg、58.2mg、58.3mg、58.4mg、58.5mg、58.6mg、58.7mg、58.8mg、58.9mg、59mg、59.1mg、59.2mg、59.3mg、59.4mg、59.5mg、59.6mg、59.7mg、59.8mg、59.9mg、60mg、60.1mg、60.2mg、60.3mg、60.4mg、60.5mg、60.6mg、60.7mg、60.8mg、60.9mg、61mg、61.1mg、61.2mg、61.3mg、61.4mg、61.5mg、61.6mg、61.7mg、61.8mg、61.9mg、62mg、62.1mg、62.2mg、62.3mg、62.4mg、62.5mg、62.6mg、62.7mg、62.8mg、62.9mg、63mg、63.1mg、63.2mg、63.3mg、63.4mg、63.5mg、63.6mg、63.7mg、63.8mg、63.9mg、64mg、64.1mg、64.2mg、64.3mg、64.4mg、64.5mg、64.6mg、64.7mg、64.8mg、64.9mg、65mg、65.1mg、65.2mg、65.3mg、65.4mg、65.5mg、65.6mg、65.7mg、65.8mg、65.9mg、66mg、66.1mg、66.2mg、66.3mg、66.4mg、66.5mg、66.6mg、66.7mg、66.8mg、66.9mg、67mg、67.1mg、67.2mg、67.3mg、67.4mg、67.5mg、67.6mg、67.7mg、67.8mg、67.9mg、68mg、68.1mg、68.2mg、68.3mg、68.4mg、68.5mg、68.6mg、68.7mg、68.8mg、68.9mg、69mg、69.1mg、69.2mg、The method according to any one of claims 1 to 62, wherein the dosage is any one of 69.3 mg, 69.4 mg, 69.5 mg, 69.6 mg, 69.7 mg, 69.8 mg, 69.9 mg, and 70 mg.
80. the therapeutically effective amount is about 40 mg, about 40.1 mg, about 40.2 mg, about 40.3 mg, about 40.4 mg, about 40.5 mg, about 40.6 mg, about 40.7 mg, about 40.8 mg, about 40.9 mg, about 41 mg, about 41.1 mg, about 41.2 mg, about 41.3 mg, about 41.4 mg, about 41.5 mg, about 41.6 mg, about 41.7 mg, about 41.8 mg, about 41.9 mg, about 42 mg, about 42.1 mg, about 42.2 mg, about 42.3 mg, about 42.4 mg, about 42.5 mg, about 42.6 mg, about 42.7 mg, about 42.8 mg, about 42.9 mg, about 43 mg, about 43.1 mg, about 43.2 mg, about 43.3 mg, about 43.4 mg, about 43.5 mg, about 43.6 mg, about 43.7 mg, about 43.8 mg, about 43.9 mg, about 44 mg, about 44.1 mg, about 44.2 mg, about 44.3 mg, about 44.4 mg, about 44.5 mg, about 44.6 mg, about 44.7 mg, about 44.8 mg, about 44.9 mg, about 45 mg, about 45.1 mg, about 45.2 mg, about 45.3 mg, about 45.4 mg, about 45.5 mg, about 45.6 mg, about 45.7 mg, about 45.8 mg, about 45.9 mg, about 46 mg, about 46.1 mg, about 46.2 mg, about 46.3 mg, about 46.4 mg, about 46.5 mg, about 46.6 mg, about 46.7 mg, about 46.8 mg, about 46.9 mg, about 47 mg, about 47.1 mg, about 47.2 mg, about 47.3 mg, about 47.4 mg, about 47.5 mg, about 47.6 mg, about 47.7 mg, about 47.8 mg, about 47.9 mg, about 48 mg, about 48.1 mg, about 48.2 mg, about 48.3 mg, about 48.4 mg, about 48.5 mg, about 48.6 mg, about 48.7 mg, about 48.8 mg, about 48.9 mg, about 49 mg, about 49.1 mg, about 49.2 mg, about 49.3 mg, about 49.4 mg, about 49.5 mg, about 49.6 mg, about 49.7 mg, about 49.8 mg, about 49.9 mg, about 50 mg, about 50.1 mg, about 50.2 mg, about 50.3 mg, about 50.4 mg, about 50.5 mg, about 50.6 mg, about 50.7 mg, about 50.8 mg, about 50.9 mg, about 51 mg, about 51.1 mg, about 51.2 mg, about 51.3 mg, about 51.4 mg, about 51.5 mg, about 51.6 mg, about 51.7 mg, about 51.8 mg, about 51.9 mg, about 52 mg, about 52.1 mg, about 52.2 mg, about 52.3 mg, about 52.4 mg, about 52.5 mg, about 52.6 mg,about 52.7 mg, about 52.8 mg, about 52.9 mg, about 53 mg, about 53.1 mg, about 53.2 mg, about 53.3 mg, about 53.4 mg, about 53.5 mg, about 53.6 mg, about 53.7 mg, about 53.8 mg, about 53.9 mg, about 54 mg, about 54.1 mg, about 54.2 mg, about 54.3 mg, about 54.4 mg, about 54.5 mg, about 54.6 mg, about 54.7 mg, about 54.8 mg, about 54.9 mg, about 55 mg, Approximately 55.1 mg, approximately 55.2 mg, approximately 55.3 mg, approximately 55.4 mg, approximately 55.5 mg, approximately 55.6 mg, approximately 55.7 mg, approximately 55.8 mg , about 55.9 mg, about 56 mg, about 56.1 mg, about 56.2 mg, about 56.3 mg, about 56.4 mg, about 56.5 mg, about 56.6 mg, about 56.7 mg, about 56.8 mg, about 56.9 mg, about 57 mg, about 57.1 mg, about 57.2 mg, about 57.3 mg, about 57.4 mg, about 57.5 mg, about 57.6 mg, about 57.7 mg, about 57.8 mg, about 57.9 mg, about 58 mg, about 58.1 mg, about 58.2 mg, about 58.3 mg, about 58.4 mg, about 58.5 mg, about 58.6 mg, about 58.7 mg, about 58.8 mg, about 58.9 mg, about 59 mg, 59.1 mg, about 59.2 mg, about 59.3 mg, about 59.4 mg, about 59.5 mg, about 59.6 mg, about 59.7 mg, about 59.8 mg, about 59.9 mg, about 60 mg, about 60.1 mg, about 60.2 mg, about 60.3 mg, about 60.4 mg, about 60.5 mg, about 60.6 mg, about 60.7 mg, about 60.8 mg, about 60.9 mg, about 61 mg, about 61.1 mg, about 61.2 mg, about 61.3 mg, about 61.4 mg, about 61.5 mg, about 61.6 mg, about 61.7 mg, about 61.8 mg, about 61.9 mg, about 62 mg, about 62.1 mg, about 62.2 mg, about 62.3 mg, about 62.4 mg, about 62.5 mg, about 62.6 mg, about 62.7 mg, about 62.8 mg, about 62.9 mg, about 63 mg, about 63.1 mg, about 63.2 mg, about 63.3 mg, about 63.4 mg, about 63.5 mg, about 63.6 mg, about 63.7 mg, about 63.8 mg, about 63.9 mg, about 64 mg, about 64.1 mg, about 64.2 mg, about 64.3 mg, about 64.4 mg, about 64.5 mg, about 64.6 mg, about 64.7 mg, about 64.8 mg, about 64.9 mg, about 65 mg, about 65.1 mg, about 65.2 mg, about 65.3 mg, about 65.4 mg,About 65.5 mg, about 65.6 mg, about 65.7 mg, about 65.8 mg, about 65.9 mg, about 66 mg, about 66.1 mg, about 66.2 mg, about 66.3 mg, about 66.4 mg, about 66.5 mg, about 66.6 mg, about 66.7 mg, about 66.8 mg, about 66.9 mg, about 67 mg, about 67.1 mg, about 67.2 mg, about 67.3 mg, about 67.4 mg, about 67.5 mg, about 67.6 mg, about 67.7 mg, about 67.8 mg, about 67.9 mg , about 68 mg, about 68.1 mg, about 68.2 mg, about 68.3 mg, about 68.4 mg, about 68.5 mg, about 68.6 mg, about 68.7 mg, about 68.8 mg, about 68.9 mg, about 69 mg, about 69.1 mg, about 69.2 mg, about 69.3 mg, about 69.4 mg, about 69.5 mg, about 69.6 mg, about 69.7 mg, about 69.8 mg, about 69.9 mg, and about 70 mg.
81. The therapeutically effective amount may be 70 mg, 70.1 mg, 70.2 mg, 70.3 mg, 70.4 mg, 70.5 mg, 70.6 mg, 70.7 mg, 70.8 mg, 70.9 mg, 71 mg, 71.1 mg, 71.2 mg, 71.3 mg, 71.4 mg, 71.5 mg, 71.6 mg, 71.7 mg, 71.8 mg, 71.9 mg, 72 mg, 72.1 mg, 72.2 mg, 72.3 mg, 72.4 mg, 72.5 mg, 72.6 mg, 72.7 mg, 72.8 mg, 72.9 mg, 73 mg, 73.1 mg, 73.2 mg, 73.3 mg, 73.4 mg, 73.5 mg, 73.6 mg, 73.7 mg, 73.8 mg, 73.9 mg, 74 mg, 74.1 mg, 74.2 mg, 74.3 mg, 74.4 mg, 74.5 mg, 74.6 mg, 74.7 mg, 74.8 mg, 74.9 mg, 75 ... mg, 73.6mg, 73.7mg, 73.8mg, 73.9mg, 74mg, 74.1mg, 74.2mg, 74.3mg, 74.4m g, 74.5mg, 74.6mg, 74.7mg, 74.8mg, 74.9mg, 75mg, 75.1mg, 75.2mg, 75.3mg, 75.4mg, 75.5mg, 75.6mg, 75.7mg, 75.8mg, 75.9mg, 76mg, 76.1mg, 76.2mg, 7 6.3mg, 76.4mg, 76.5mg, 76.6mg, 76.7mg, 76.8mg, 76.9mg, 77mg, 77.1mg, 77. 2mg, 77.3mg, 77.4mg, 77.5mg, 77.6mg, 77.7mg, 77.8mg, 77.9mg, 78mg, 78.1 mg, 78.2mg, 78.3mg, 78.4mg, 78.5mg, 78.6mg, 78.7mg, 78.8mg, 78.9mg, 79mg , 79.1mg, 79.2mg, 79.3mg, 79.4mg, 79.5mg, 79.6mg, 79.7mg, 79.8mg, 79.9m g, 80mg, 80.1mg, 80.2mg, 80.3mg, 80.4mg, 80.5mg, 80.6mg, 80.7mg, 80.8mg, 80.9mg, 81mg, 81.1mg, 81.2mg, 81.3mg, 81.4mg, 81.5mg, 81.6mg, 81.7mg, 8 1.8mg, 81.9mg, 82mg, 82.1mg, 82.2mg, 82.3mg, 82.4mg, 82.5mg, 82.6mg, 82. 7mg, 82.8mg, 82.9mg, 83mg, 83.1mg, 83.2mg, 83.3mg, 83.4mg, 83.5mg, 83.6m g, 83.7mg, 83.8mg, 83.9mg, 84mg, 84.1mg, 84.2mg, 84.3mg, 84.4mg, 84.5mg,84.6mg、84.7mg、84.8mg、84.9mg、85mg、85.1mg、85.2mg、85.3mg、85.4mg、85.5mg、85.6mg、85.7mg、85.8mg、85.9mg、86mg、86.1mg、86.2mg、86.3mg、86.4mg、86.5mg、86.6mg、86.7mg、86.8mg、86.9mg、87mg、87.1mg、87.2mg、87.3mg、87.4mg、87.5mg、87.6mg、87.7mg、87.8mg、87.9mg、88mg、88.1mg、88.2mg、88.3mg、88.4mg、88.5mg、88.6mg、88.7mg、88.8mg、88.9mg、89mg、89.1mg、89.2mg、89.3mg、89.4mg、89.5mg、89.6mg、89.7mg、89.8mg、89.9mg、90mg、90.1mg、90.2mg、90.3mg、90.4mg、90.5mg、90.6mg、90.7mg、90.8mg、90.9mg、91mg、91.1mg、91.2mg、91.3mg、91.4mg、91.5mg、91.6mg、91.7mg、91.8mg、91.9mg、92mg、92.1mg、92.2mg、92.3mg、92.4mg、92.5mg、92.6mg、92.7mg、92.8mg、92.9mg、93mg、93.1mg、93.2mg、93.3mg、93.4mg、93.5mg、93.6mg、93.7mg、93.8mg、93.9mg、94mg、94.1mg、94.2mg、94.3mg、94.4mg、94.5mg、94.6mg、94.7mg、94.8mg、94.9mg、95mg、95.1mg、95.2mg、95.3mg、95.4mg、95.5mg、95.6mg、95.7mg、95.8mg、95.9mg、96mg、96.1mg、96.2mg、96.3mg、96.4mg、96.5mg、96.6mg、96.7mg、96.8mg、96.9mg、97mg、97.1mg、97.2mg、97.3mg、97.4mg、97.5mg、97.6mg、97.7mg、97.8mg、97.9mg、98mg、98.1mg、98.2mg、98.3mg、98.4mg、98.5mg、98.6mg、98.7mg、98.8mg、98.9mg、99mg、99.1mg、99.2mg、The method according to any one of claims 1 to 62, wherein the amount is any one of 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, and 99.9 mg.
82. the therapeutically effective amount is about 70 mg, about 70.1 mg, about 70.2 mg, about 70.3 mg, about 70.4 mg, about 70.5 mg, about 70.6 mg, about 70.7 mg, about 70.8 mg, about 70.9 mg, about 71 mg, about 71.1 mg, about 71.2 mg, about 71.3 mg, about 71.4 mg, about 71.5 mg, about 71.6 mg, about 71.7 mg, about 71.8 mg, about 71.9 mg, about 72 mg, about 72.1 mg, about 72.2 mg, about 72.3 mg, about 72.4 mg, about 72.5 mg, about 72.6 mg, about 72.7 mg, about 72.8 mg, about 72.9 mg, about 73 mg, Approximately 73.1mg, approximately 73.2mg, approximately 73.3mg, approximately 73.4mg, approximately 73.5mg, approximately 73.6mg, approximately 73.7mg, approximately 73.8m g, about 73.9 mg, about 74 mg, about 74.1 mg, about 74.2 mg, about 74.3 mg, about 74.4 mg, about 74.5 mg, about 74.6 mg , about 74.7mg, about 74.8mg, about 74.9mg, about 75mg, about 75.1mg, about 75.2mg, about 75.3mg, about 75.4mg , about 75.5 mg, about 75.6 mg, about 75.7 mg, about 75.8 mg, about 75.9 mg, about 76 mg, about 76.1 mg, about 76.2 mg, about 76.3 mg, about 76.4 mg, about 76.5 mg, about 76.6 mg, about 76.7 mg, about 76.8 mg, about 76.9 mg, about 77 mg, Approximately 77.1mg, approximately 77.2mg, approximately 77.3mg, approximately 77.4mg, approximately 77.5mg, approximately 77.6mg, approximately 77.7mg, approximately 77.8mg , about 77.9mg, about 78mg, about 78.1mg, about 78.2mg, about 78.3mg, about 78.4mg, about 78.5mg, about 78.6mg , about 78.7 mg, about 78.8 mg, about 78.9 mg, about 79 mg, about 79.1 mg, about 79.2 mg, about 79.3 mg, about 79.4 mg, about 79.5 mg, about 79.6 mg, about 79.7 mg, about 79.8 mg, about 79.9 mg, about 80 mg, about 80.1 mg, about 80.2 mg, about 80.3 mg, about 80.4 mg, about 80.5 mg, about 80.6 mg, about 80.7 mg, about 80.8 mg, about 80.9 mg, about 81 mg, about 81.1 mg, about 81.2 mg, about 81.3 mg, about 81.4 mg, about 81.5 mg, about 81.6 mg, about 81.7 mg, about 81.8 mg, about 81.9 mg, about 82 mg, about 82.1 mg, about 82.2 mg, about 82.3 mg, about 82.4 mg, about 82.5 mg, about 82.6 mg,About 82.7 mg, about 82.8 mg, about 82.9 mg, about 83 mg, about 83.1 mg, about 83.2 mg, about 83.3 mg, about 83.4 mg, about 83.5 mg, about 83.6 mg, about 83.7 mg, about 83.8 mg, about 83.9 mg, about 84 mg, about 84.1 mg, about 84.2 mg, about 84.3 mg, about 84.4 mg, about 84.5 mg, about 84.6 mg, about 84.7 mg, about 84.8 mg, about 84.9 mg, about 85 mg, about 85.1 mg, about 85.2 mg, about 85.3 mg, about 85.4 mg, about 85.5 mg, about 85.6 mg, about 85.7 mg, about 85.8 mg , about 85.9 mg, about 86 mg, about 86.1 mg, about 86.2 mg, about 86.3 mg, about 86.4 mg, about 86.5 mg, about 86.6 mg, about 86.7 mg, about 86.8 mg, about 86.9 mg, about 87 mg, about 87.1 mg, about 87.2 mg, about 87.3 mg, about 87.4 mg, about 87.5 mg, about 87.6 mg, about 87.7 mg, about 87.8 mg, about 87.9 mg, about 88 mg, about 88.1 mg, about 88.2 mg, about 88.3 mg, about 88.4 mg, about 88.5 mg, about 88.6 mg, about 88.7 mg, about 88.8 mg, about 88.9 mg, about 89 mg, 89.1 mg, about 89.2 mg, about 89.3 mg, about 89.4 mg, about 89.5 mg, about 89.6 mg, about 89.7 mg, about 89.8 mg, about 89.9 mg, about 90 mg, about 90.1 mg, about 90.2 mg, about 90.3 mg, about 90.4 mg, about 90.5 mg, about 90.6 mg, about 90.7 mg, about 90.8 mg, about 90.9 mg, about 91 mg, about 91.1 mg, about 91.2 mg, about 91.3 mg, about 91.4 mg, about 91.5 mg, about 91.6 mg, about 91.7 mg, about 91.8 mg, about 91.9 mg, about 92 mg, about 92.1 mg, about 92.2 mg, about 92.3 mg, about 92.4 mg, about 92.5 mg, about 92.6 mg, about 92.7 mg, about 92.8 mg, about 92.9 mg, about 93 mg, Approximately 93.1mg, approximately 93.2mg, approximately 93.3mg, approximately 93.4mg, approximately 93.5mg, approximately 93.6mg, approximately 93.7mg, approximately 93.8mg , about 93.9 mg, about 94 mg, about 94.1 mg, about 94.2 mg, about 94.3 mg, about 94.4 mg, about 94.5 mg, about 94.6 mg , about 94.7 mg, about 94.8 mg, about 94.9 mg, about 95 mg, about 95.1 mg, about 95.2 mg, about 95.3 mg, about 95.4 mg,About 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96 mg, about 96.1 mg, about 96.2 mg, about 96.3 mg, about 96.4 mg, about 96.5 mg, about 96.6 mg, about 96.7 mg, about 96.8 mg, about 96.9 mg, about 97 mg, about 97.1 mg, about 97.2 mg, about 97.3 mg, about 97.4 mg, about 97.5 mg, about 97.6 mg, about 97.7 mg, about 97.8 mg, about 97.
63. The method of any one of claims 1 to 62, wherein the dose is any one of about 9 mg, about 98 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg, about 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg, and about 99.9 mg.
83. The therapeutically effective amount may be 100 mg, 100.1 mg, 100.2 mg, 100.3 mg, 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101 .. 7mg, 101.8mg, 101.9mg, 102mg, 102.1mg, 102.2mg, 102.3mg, 102.4mg, 102.5mg, 102.6m g, 102.7mg, 102.8mg, 102.9mg, 103mg, 103.1mg, 103.2mg, 103.3mg, 103.4mg, 103.5mg. 103.6mg, 103.7mg, 103.8mg, 103.9mg, 104mg, 104.1mg, 104.2mg, 104.3mg, 104.4mg, 104.5mg, 104.6mg, 10 4.7mg, 104.8mg, 104.9mg, 105mg, 105.1mg, 105.2mg, 105.3mg, 105.4mg, 105.5mg, 105.6mg, 105.7mg, 105.8 mg, 105.9mg, 106mg, 106.1mg, 106.2mg, 106.3mg, 106.4mg, 106.5mg, 106.6mg, 106.7mg, 106.8mg, 106.9mg, 107mg, 107.1mg, 107.2mg, 107.3mg, 107.4mg, 107.5mg, 107.6mg, 107.7mg, 107.8mg, 107.9mg, 108mg, 108.1 mg, 108.2mg, 108.3mg, 108.4mg, 108.5mg, 108.6mg, 108.7mg, 108.8mg, 108.9mg, 109mg, 109.1mg, 109.2mg , 109.3mg, 109.4mg, 109.5mg, 109.6mg, 109.7mg, 109.8mg, 109.9mg, 110mg, 110.1mg, 110.2mg, 110.3mg, 11 0.4mg, 110.5mg, 110.6mg, 110.7mg, 110.8mg, 110.9mg, 111mg, 111.1mg, 111.2mg, 111.3mg, 111.4mg, 111.5 mg, 111.6mg, 111.7mg, 111.8mg, 111.9mg, 112mg, 112.1mg, 112.2mg, 112.3mg, 112.4mg, 112.5mg, 112.6mg,112.7mg, 112.8mg, 112.9mg, 113mg, 113.1mg, 113.2mg, 113.3mg, 113.4mg, 113.5mg, 113.6mg, 113.7mg, 113.8mg, 113.9mg, 114mg, 114.1mg, 114.2mg, 114.3mg, 114.4mg, 114.5mg, 114.6mg, 114.7mg, 114.8mg, 114.9mg, 115mg, 115.1mg, 115.2mg, 115.3mg, 115.4mg, 115.5mg, 115.6mg, 115.7mg, 115.8mg , 115.9mg, 116mg, 116.1mg, 116.2mg, 116.3mg, 116.4mg, 116.5mg, 116.6mg , 116.7mg, 116.8mg, 116.9mg, 117mg, 117.1mg, 117.2mg, 117.3mg, 117.4mg, 117.5mg, 117.6mg, 117.7mg, 117.8mg, 117.9mg, 118mg, 118.1mg, 118.2mg, 118.3mg, 118.4mg, 118.5mg, 118.6mg, 118.7mg, 118.8mg, 118.9mg, 119mg, 1 19.1mg, 119.2mg, 119.3mg, 119.4mg, 119.5mg, 119.6mg, 119.7mg, 119.8mg , 119.9mg, 120mg, 120.1mg, 120.2mg, 120.3mg, 120.4mg, 120.5mg, 120.6mg , 120.7mg, 120.8mg, 120.9mg, 121mg, 121.1mg, 121.2mg, 121.3mg, 121.4mg , 121.5mg, 121.6mg, 121.7mg, 121.8mg, 121.9mg, 122mg, 122.1mg, 122.2mg, The method of any one of claims 1 to 62, wherein the amount of the compound is any one of 122.3 mg, 122.4 mg, 122.5 mg, 122.6 mg, 122.7 mg, 122.8 mg, 122.9 mg, 123 mg, 123.1 mg, 123.2 mg, 123.3 mg, 123.4 mg, 123.5 mg, 123.6 mg, 123.7 mg, 123.8 mg, 123.9 mg, 124 mg, 124.1 mg, 124.2 mg, 124.3 mg, 124.4 mg, 124.5 mg, 124.6 mg, 124.7 mg, 124.8 mg, 124.9 mg, and 125 mg.
84. The therapeutically effective amount may be about 100 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg, about 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 ...1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.9 mg, about 101.1 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.9 mg, about 101.1 mg, about 101.1 mg, about 10 .7 mg, about 101.8 mg, about 101.9 mg, about 102 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg, about 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 103 mg, about 103.1 mg, about 103.2 mg, about 103.3 mg, about 103.4 mg, about 103.5 mg. about 103.6 mg, about 103.7 mg, about 103.8 mg, about 103.9 mg, about 104 mg, about 104.1 mg, about 104.2 mg, about 104.3 mg, about 104.4 mg, about 104.5 mg, about 104.6 mg, about 104.7 mg, about 104.8 mg, about 104.9 mg, about 105 mg, about 105.1 mg, about 105.2 mg, about 105.3 mg, about 105.4 mg, about 105.5 mg, about 105.6 mg, about 105.7 mg, about 105.8 mg, about 105.9 mg, about 106 mg, about 106.1 mg, about 106.2 mg, about 106.3 mg, about 106.4 mg, about 106.5 mg, about 106.6 mg, about 106.7 mg, about 106.8 mg, about 106.9 mg, about 107 mg, about 107.1 mg, about 107.2 mg, about 107.3 mg, about 107.4 mg, about 107.5 mg, about 107.6 mg, about 107.7 mg, about 107.8 mg, about 107.9 mg, about 108 mg, about 108.1 mg, about 108.2 mg, about 108.3 mg, about 108.4 mg, about 108.5 mg, about 108.6 mg, about 108.7 mg, about 108.8 mg, about 108.9 mg, about 109 mg, about 109.1 mg, about 109.2 mg, about 109.3 mg, about 109.4 mg, about 109.5 mg, about 109.6 mg, about 109.7 mg, about 109.8 mg, about 109.9 mg, about 110 mg, about 110.1 mg, about 110.2 mg, about 110.3 mg, about 110.4 mg, about 110.5 mg, about 110.6 mg, about 110.7 mg, about 110.8 mg, about 110.9 mg, about 111 mg, about 111.1 mg,Approximately 111.2 mg, approximately 111.3 mg, approximately 111.4 mg, approximately 111.5 mg, approximately 111.6 mg, approximately 111.7 mg, approximately 111.8 mg, approximately 111.9 mg, approximately 112 mg, approximately 112.1 mg, approximately 112.2 mg, approximately 112.3 mg, approximately 112.4 mg, approximately 112.5 mg, Approximately 112.6 mg, approximately 112.7 mg, approximately 112.8 mg, approximately 112.9 mg, approximately 113 mg, approximately 113.1 mg, approximately 113.2 mg, approximately 113.3 mg, approximately 113.4 mg, approximately 113.5 mg, approximately 113.6 mg, approximately 113.7 mg, approximately 113.8 mg, approximately 113.9 mg, Approximately 114 mg, approximately 114.1 mg, approximately 114.2 mg, approximately 114.3 mg, approximately 114.4 mg, approximately 114.5 mg, approximately 114.6 mg, approximately 114.7 mg, approximately 114.8 mg, approximately 114.9 mg, approximately 115 mg, approximately 115.1 mg, approximately 115.2 mg, approximately 115.3 mg, approximately 1 15.4 mg, approximately 115.5 mg, approximately 115.6 mg, approximately 115.7 mg, approximately 115.8 mg, approximately 115.9 mg, approximately 116 mg, approximately 116.1 mg, approximately 116.2 mg, approximately 116.3 mg, approximately 116.4 mg, approximately 116.5 mg, approximately 116.6 mg, approximately 116.7 mg, approximately 11 6.8 mg, approximately 116.9 mg, approximately 117 mg, approximately 117.1 mg, approximately 117.2 mg, approximately 117.3 mg, approximately 117.4 mg, approximately 117.5 mg, approximately 117.6 mg, approximately 117.7 mg, approximately 117.8 mg, approximately 117.9 mg, approximately 118 mg, approximately 118.1 mg, approximately 118. 2 mg, approximately 118.3 mg, approximately 118.4 mg, approximately 118.5 mg, approximately 118.6 mg, approximately 118.7 mg, approximately 118.8 mg, approximately 118.9 mg, approximately 119 mg, approximately 119.1 mg, approximately 119.2 mg, approximately 119.3 mg, approximately 119.4 mg, approximately 119.5 mg, approximately 119.6 mg mg, approximately 119.7 mg, approximately 119.8 mg, approximately 119.9 mg, approximately 120 mg, approximately 120.1 mg, approximately 120.2 mg, approximately 120.3 mg, approximately 120.4 mg, approximately 120.5 mg, approximately 120.6 mg, approximately 120.7 mg, approximately 120.8 mg, approximately 120.9 mg, approximately 121 mg Approximately 121.1 mg, approximately 121.2 mg, approximately 121.3 mg, approximately 121.4 mg, approximately 121.5 mg, approximately 121.6 mg, approximately 121.7 mg, approximately 121.8 mg, approximately 121.9 mg, approximately 122 mg, approximately 122.1 mg, approximately 122.2 mg, approximately 122.3 mg, approximately 122.4 mg,The method of any one of claims 1 to 62, wherein the dose is any one of about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg, about 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg, and about 125 mg.
85. The therapeutically effective amount may be 10 mg to 200 mg, 10 mg to 190 mg, 10 mg to 180 mg, 10 mg to 170 mg, 10 mg to 160 mg, 10 mg to 150 mg, 10 mg to 140 mg, 10 mg to 120 mg, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 200 mg, 20 mg to 190 mg, 20 mg to 180 mg, 20 mg to 170 mg, 20 mg to 160 mg, 20 mg ~150mg, 20mg~140mg, 20mg~120mg, 20mg~110mg, 20mg~100mg, 20mg~80mg, 2 0mg to 70mg, 20mg to 60mg, 20mg to 50mg, 20mg to 10mg, 20mg to 30mg, 30mg to 200mg, 30 mg~190mg, 30mg~180mg, 30mg~170mg, 30mg~160mg, 30mg~150mg, 30mg~140m g, 30mg to 120mg, 30mg to 110mg, 30mg to 100mg, 30mg to 80mg, 30mg to 70mg, 30mg to 60m g, 30mg to 50mg, 30mg to 20mg, 40mg to 200mg, 40mg to 190mg, 40mg to 180mg, 40mg to 17 0mg, 40mg to 160mg, 40mg to 150mg, 40mg to 140mg, 40mg to 120mg, 40mg to 110mg, 40m g~100mg, 40mg~80mg, 40mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~200mg, 50m g~190mg, 50mg~180mg, 50mg~170mg, 50mg~160mg, 50mg~150mg, 50mg~140mg , 50mg to 120mg, 50mg to 110mg, 50mg to 100mg, 50mg to 80mg, 50mg to 70mg, 50mg to 60m g, 60mg to 200mg, 60mg to 190mg, 60mg to 180mg, 60mg to 170mg, 60mg to 160mg, 60mg to 150mg, 60mg to 140mg, 60mg to 120mg, 60mg to 110mg, 60mg to 100mg, 60mg to 80mg, 60 mg~70mg, 70mg~200mg, 70mg~190mg, 70mg~180mg, 70mg~170mg, 70mg~160mg,70mg~150mg、70mg~140mg、70mg~120mg、70mg~110mg、70mg~100mg、70mg~80mg、80mg~200mg、80mg~190mg、80mg~180mg、80mg~170mg、80mg~160mg、80mg~150mg、80mg~140mg、80mg~120mg、80mg~110mg、80mg~100mg、80mg~90mg、90mg~200mg、90mg~190mg、90mg~180mg、90mg~170mg、90mg~160mg、90mg~150mg、90mg~140mg、90mg~120mg、90mg~110mg、90mg~100mg、100mg~200mg、100mg~190mg、100mg~180mg、100mg~170mg、100mg~160mg、100mg~150mg、100mg~140mg、100mg~120mg、100mg~110mg、110mg~200mg、110mg~190mg、110mg~180mg、110mg~170mg、110mg~160mg、110mg~150mg、110mg~140mg、110mg~130mg、110mg~120mg、120mg~200mg、120mg~190mg、120mg~180mg、120mg~170mg、120mg~160mg、120mg~150mg、120mg~140mg、120mg~130mg、130mg~200mg、130mg~190mg、130mg~180mg、130mg~170mg、130mg~160mg、130mg~150mg、130mg~140mg、140mg~200mg、140mg~190mg、140mg~180mg、140mg~170mg、140mg~160mg、140mg~150mg、150mg~200mg、150mg~190mg、150mg~180mg、150mg~170mg、150mg~160mg、160mg~200mg、160mg~190mg、160mg~180mg、160mg~170mg、180mg~200mg、180mg~190mg、190mg~200mg、105mg~135mg、105mg~130mg、105mg~125mg、105mg~120mg、110mg~135mg、110mg~130mg、110mg~125mg、110mg to 120mg, 115mg to 135mg, 115mg to 130mg, 115mg to 125mg, 115mg to 120mg, 115mg to 125mg, 115mg to 120mg, 120m g~135mg, 120mg~125mg, 125mg~140mg, 125mg~130mg, 130mg~135mg, 135mg~140mg, 120mg~129mg, 120mg~12 8mg, 120mg to 127mg, 120mg to 86mg, 120mg to 124mg, 120mg to 123mg, 120mg to 122mg, 120mg to 121mg, 121mg to 130mg, 1 22mg to 129mg, 122mg to 128mg, 122mg to 127mg, 122mg to 126mg, 122mg to 125mg, 122mg to 124mg, 122mg to 123mg, 123mg to 130mg, 123mg to 129mg, 123mg to 128mg, 123mg to 127mg, 123mg to 126mg, 123mg to 125mg, 123mg to 124mg, 124mg to 130m g, 124mg to 129mg, 124mg to 128mg, 124mg to 127mg, 124mg to 126mg, 124mg to 125mg, 125mg to 129mg, 125mg to 128mg, 125 63. The method of any one of claims 1 to 62, wherein the saturation dose is within any of the following ranges: 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.
86. The therapeutically effective amount may be from 1 mg to less than 350 mg, less than 345 mg, less than 340 mg, less than 335 mg, less than 330 mg, less than 325 mg, less than 320 mg, less than 315 mg, less than 310 mg, less than 305 mg, less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 18 63. The method of any one of claims 1 to 62, wherein the amount of hydroxybenzoates is any of less than 0 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
87. The therapeutically effective amount may be from 1 mg to less than about 350 mg, less than about 345 mg, less than about 340 mg, less than about 335 mg, less than about 330 mg, less than about 325 mg, less than about 320 mg, less than about 315 mg, less than about 310 mg, less than about 305 mg, less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 27 less than about 0 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, 63. The method of any one of claims 1 to 62, wherein the hydroxybenzoate is less than about 0 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
88. 63. The method of any one of claims 1-62, wherein the therapeutically effective amount is any of at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
89. The therapeutically effective amount may be at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 120 mg, 63. The method of any one of claims 1 to 62, wherein the saturation dose is at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or any of at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185 mg, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
90. 90. The method of any one of claims 1-89, comprising administering the compound once every two weeks.
91. 90. The method of any one of claims 1-89, comprising administering the compound once every four weeks.
92. 90. The method of any one of claims 1-89, comprising administering the compound once every eight weeks.
93. 90. The method of any one of claims 1-89, comprising administering the compound once every 12 weeks.
94. 90. The method of any one of claims 1-89, comprising administering the compound once every 16 weeks.
95. 90. The method of any one of claims 1-89, comprising administering the compound once every 20 weeks.
96. 90. The method of any one of claims 1-89, comprising administering the compound once every 24 weeks.
97. 90. The method of any one of claims 1-89, comprising administering the compound once every six months.
98. 90. The method of any one of claims 1-89, comprising administering the compound about once every two weeks.
99. 90. The method of any one of claims 1-89, comprising administering the compound about once every four weeks.
100. 90. The method of any one of claims 1-89, comprising administering the compound once about every 8 weeks.
101. 90. The method of any one of claims 1-89, comprising administering the compound once every about 12 weeks.
102. 90. The method of any one of claims 1-89, comprising administering the compound once every about 16 weeks.
103. 90. The method of any one of claims 1-89, comprising administering the compound once every about 20 weeks.
104. 90. The method of any one of claims 1-89, comprising administering the compound once every about 24 weeks.
105. 90. The method of any one of claims 1-89, comprising administering the compound about once every six months.
106. 90. The method of any one of claims 1-89, comprising administering the compound about once every 6 months, about once every 7 months, about once every 8 months, about once every 9 months, about once every 10 months, about once every 11 months, or about once every 12 months.
107. 90. The method of any one of claims 1-89, comprising administering the compound monthly.
108. 90. The method of any one of claims 1-89, comprising administering the compound once every two months.
109. 90. The method of any one of claims 1-89, comprising administering the compound once every three months.
110. 90. The method of any one of claims 1-89, comprising administering the compound quarterly.
111. 90. The method of any one of claims 1-89, comprising administering the compound semi-annually.
112. 90. The method of any one of claims 1-89, comprising administering the compound once a year.
113. 90. The method of any one of claims 1-89, comprising administering the compound once every two years.
114. The compound is administered once per week, once per 2 weeks, once per 3 weeks, once per 4 weeks, once per 5 weeks, once per 6 weeks, once per 7 weeks, once per 8 weeks, once per 9 weeks, once per 10 weeks, once per 11 weeks, once per 12 weeks, once per 13 weeks, once per 14 weeks, once per 15 weeks, once per 16 weeks, once per 17 weeks, once per 18 weeks, once per 19 weeks, once per 20 weeks 90. The method of any of claims 1-89, comprising administering the compound once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, once every month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months, or once every year.
115. The compound is administered about once every week, about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, about once every 10 weeks, about once every 11 weeks, about once every 12 weeks, about once every 13 weeks, about once every 14 weeks, about once every 15 weeks, about once every 16 weeks, about once every 17 weeks, about once every 18 weeks, about once every 19 weeks, or 90. The method of any of claims 1-89, comprising administering the compound of formula (I) once every about 21 weeks, once every about 22 weeks, once every about 23 weeks, once every about 24 weeks, once every about one month, once every about two months, once every about three months, once every about four months, once every about five months, once every about six months, once every about seven months, once every about eight months, once every about nine months, once every about ten months, once every about 11 months, or once every year.
116. 90. The method of any one of claims 1-89, comprising administering to the human subject a 20 mg dose of the compound once every four weeks.
117. 90. The method of any one of claims 1-89, comprising administering to the human subject a 40 mg dose of the compound once every four weeks.
118. 90. The method of any one of claims 1-89, comprising administering to the human subject a 70 mg dose of the compound once every four weeks.
119. 90. The method of any one of claims 1-89, comprising administering to the human subject a 100 mg dose of the compound once every four weeks.
120. 90. The method of any one of claims 1-89, comprising administering to the human subject a 20 mg dose of the compound once every 8 weeks.
121. 90. The method of any one of claims 1-89, comprising administering to the human subject a 40 mg dose of the compound once every 8 weeks.
122. 90. The method of any one of claims 1-89, comprising administering to the human subject a 70 mg dose of the compound once every 8 weeks.
123. 90. The method of any one of claims 1-89, comprising administering to the human subject a 100 mg dose of the compound once every 8 weeks.
124. 90. The method of any one of claims 1-89, comprising administering to the human subject a 20 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
125. 90. The method of any one of claims 1-89, comprising administering to the human subject a 40 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
126. 90. The method of any one of claims 1-89, comprising administering to the human subject a 70 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
127. 90. The method of any one of claims 1-89, comprising administering to the human subject a 100 mg dose of the compound once every 12 weeks, once every three months, or once quarterly.
128. 90. The method of any one of claims 1-89, comprising administering to the human subject a 20 mg dose of the compound once every six months or twice a year.
129. 90. The method of any one of claims 1-89, comprising administering to the human subject a 40 mg dose of the compound once every six months or twice a year.
130. 90. The method of any one of claims 1-89, comprising administering to the human subject a 70 mg dose of the compound once every six months or twice a year.
131. 90. The method of any one of claims 1-89, comprising administering to the human subject a 100 mg dose of the compound once every six months or twice a year.
132. 132. The method of any one of claims 1-131, wherein two doses of the compound are administered.
133. 132. The method of any one of claims 1-131, wherein four doses of the compound are administered.
134. 90. The method of any one of claims 1-89, comprising administering a 100 mg dose of the compound to the human subject once every two weeks for a total of three doses, followed by administering a 100 mg dose of the compound once every four weeks thereafter.
135. 90. The method of any one of claims 1-89, comprising administering a 70 mg dose of the compound to the human subject once every two weeks for a total of three doses, followed by administering a 70 mg dose of the compound once every four weeks thereafter.
136. 90. The method of any one of claims 1-89, comprising administering a 40 mg dose of the compound to the human subject once every two weeks for a total of three doses, followed by administering a 40 mg dose of the compound once every four weeks thereafter.
137. 90. The method of any one of claims 1-89, comprising administering to the human subject a dose of 40 mg to 70 mg of the compound once every four weeks.
138. 90. The method of any one of claims 1-89, comprising administering to the human subject a dose of about 40 mg to about 70 mg of the compound once every four weeks.
139. 90. The method of any one of claims 1-89, comprising administering to the human subject a dose of 40 mg to 70 mg of the compound once every two weeks for a total of three doses, followed by administration of a dose of 40 mg to 70 mg of the compound once every four weeks thereafter.
140. 90. The method of any one of claims 1-89, comprising administering to the human subject a dose of about 40 mg to about 70 mg of the compound once every two weeks for a total of three doses, followed by administration of a dose of about 40 mg to about 70 mg of the compound once every four weeks thereafter.
141. 141. The method of claim 139 or claim 140, wherein the first six administrations are administered with the same amount of compound.
142. 90. The method of any one of claims 1-89, comprising administering to the human subject a 70 mg dose of the compound once every four weeks for a total of three doses, followed by administering a 40 mg dose of the compound once every four weeks thereafter.
143. 90. The method of any one of claims 1-89, comprising administering a 70 mg dose of the compound to the human subject once every four weeks for a total of three doses, followed by administering a 70 mg dose of the compound once every eight weeks thereafter.
144. 90. The method of any one of claims 1-89, wherein the human subject is suffering from IgA nephropathy, comprising administering to the subject a first dosing regimen comprising a 100 mg dose of the compound once every two weeks for a total of three doses, then once every four weeks.
145. 129. The method of claim 128, further comprising monitoring the safety or effectiveness of the dosing regimen, discontinuing administration of the first dosing regimen, and then administering to the subject a second dosing regimen comprising administering a 70 mg dose of the compound every four weeks.
146. 146. The method of any one of claims 90-145, wherein 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 doses are administered.
147. 90. The method of any one of claims 1-89, comprising administering to the human subject an initial loading dose of 70 mg of the compound.
148. 148. The method of claim 147, comprising administering a second loading dose of 70 mg of the compound to the human subject four weeks after administration of the initial loading dose.
149. 149. The method of claim 147 or claim 148, comprising administering to the human subject a maintenance dose of 40 mg of the compound four weeks after administration of the second loading dose.
150. 149. The method of claim 147 or claim 148, comprising administering to the human subject a maintenance dose of 40 mg of the compound 8 weeks after administration of the second loading dose.
151. 149. The method of claim 147 or claim 148, comprising administering to the human subject a maintenance dose of 40 mg of the compound 12 weeks after administration of the second loading dose.
152. 149. The method of claim 147 or 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound four weeks after administration of the second loading dose and every four weeks thereafter.
153. 149. The method of claim 147 or 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 8 weeks after administration of the second loading dose and every 8 weeks thereafter.
154. 149. The method of claim 147 or 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 12 weeks after administration of the second loading dose and every 12 weeks thereafter.
155. 149. The method of claim 147 or 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 16 weeks after administration of the second loading dose and every 16 weeks thereafter.
156. 149. The method of claim 147 or 148, comprising administering to the human subject a maintenance dose of 10 mg, 20 mg, 40 mg, 70 mg or 100 mg of the compound 24 weeks after administration of the second loading dose and every 24 weeks thereafter.
157. 157. The method of any one of claims 149-156, wherein at least 2, at least 3, at least 4, at least 5, or at least 6 maintenance doses are administered to the human subject.
158. 158. The method of any one of claims 1 to 157, wherein the compound is administered subcutaneously.
159. 146. The method of claim 145, wherein the compound is administered by injection.
160. 160. The method of any one of claims 1 to 159, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
161. 161. The method of claim 160, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline, or sterile phosphate-buffered saline.
162. 162. The method of any one of claims 1-161, wherein the compound is co-administered with an angiotensin converting enzyme inhibitor, an angiotensin receptor blocker, a sodium / glucose cotransporter-2 inhibitor, an anti-complement agent, or a complement inhibitor.
163. 1. A method of ameliorating IgA nephropathy, ameliorating geographic atrophy, reducing CFB protein, or reducing CFB RNA in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: 【Chemistry 13】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, subcutaneously administering to said human subject.
164. 164. The method of claim 163, wherein the compound is a sodium salt or a potassium salt.
165. 1. A method of ameliorating IgA nephropathy, ameliorating geographic atrophy, reducing CFB protein, or reducing CFB RNA in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: 【Chemistry 14】 (SEQ ID NO: 4) to said human subject.
166. 1. A method of ameliorating IgA nephropathy, ameliorating geographic atrophy, reducing CFB protein, or reducing CFB RNA in a human subject in need thereof, comprising subcutaneously administering to the human subject 40 mg, about 40 mg, 70 mg, or about 70 mg of a compound having the following chemical designation (5' to 3'): GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= 【Chemistry 15】 (wherein
167. 1. A method of ameliorating IgA nephropathy in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg or about 70 mg of the following chemical structure: 【Chemistry 16】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, subcutaneously administering to said human subject.
168. 168. The method of claim 167, wherein the compound is a sodium salt or a potassium salt.
169. 1. A method of ameliorating IgA nephropathy in a human subject in need thereof, comprising administering to a subject at or about 70 mg of the following chemical structure: 【Chemistry 17】 (SEQ ID NO: 4) to said human subject.
170. 1. A method of ameliorating IgA nephropathy in a human subject in need thereof, comprising subcutaneously administering to the human subject 70 mg or about 70 mg of a compound having the following chemical designation (5' to 3'): GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= [Chemistry 18] (wherein
171. 1. A method of ameliorating geographic atrophy in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: 【Chemistry 19】 (SEQ ID NO: 4), or a pharmaceutically acceptable salt thereof, subcutaneously administering to said human subject.
172. 172. The method of claim 171, wherein the compound is a sodium salt or a potassium salt.
173. 1. A method of ameliorating geographic atrophy in a human subject in need thereof, comprising administering 40 mg, about 40 mg, 70 mg, or about 70 mg of the following chemical structure: 【Chemistry 20】 (SEQ ID NO: 4) to said human subject.
174. 1. A method of ameliorating geographic atrophy in a human subject in need thereof, comprising subcutaneously administering to said human subject 40 mg, about 40 mg, 70 mg, or about 70 mg of a compound having the following chemical designation (5' to 3'): GalNAc 3 -7 a-o’ A es T es m C es m C es m C es A ds m C ds G ds m C ds m C ds m C ds m C ds T ds G ds T ds m C es m C es A es G es m C e (SEQ ID NO: 4) A = adenine nucleobase; m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase; e=2′-MOE sugar moiety; d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; GalNAc 3 -7 a-o’= 【Chemistry 21】 (wherein
175. 175. The method of any one of claims 163-174, comprising administering the compound once every four weeks.
176. 175. The method of any one of claims 163-174, comprising administering the compound once every eight weeks.
177. 175. The method of any one of claims 163-174, comprising administering the compound once every 12 weeks.
178. 175. The method of any one of claims 163-174, comprising administering the compound once every 16 weeks.
179. 175. The method of any one of claims 163-174, comprising administering the compound once every 24 weeks.
180. 175. The method of any one of claims 163-174, comprising administering the compound once every six months.
181. 175. The method of any one of claims 163-174, comprising administering the compound about once every four weeks.
182. 175. The method of any one of claims 163-174, comprising administering the compound once about every eight weeks.
183. 175. The method of any one of claims 163-174, comprising administering the compound once every about 12 weeks.
184. 175. The method of any one of claims 163-174, comprising administering the compound once every about 16 weeks.
185. 175. The method of any one of claims 163-174, comprising administering the compound once every about 24 weeks.
186. 175. The method of any one of claims 163-174, comprising administering the compound about once every six months.
187. 175. The method of any one of claims 163-174, comprising administering to the human subject a 40 mg dose of the compound once every four weeks.
188. 175. The method of any one of claims 163-174, comprising administering to the human subject a 70 mg dose of the compound once every four weeks.
189. 175. The method of any one of claims 163-174, comprising administering to said human subject a 100 mg dose of said compound once every four weeks.
190. 175. The method of any one of claims 163 to 174, wherein the compound is administered by injection.
191. 191. The method of any one of claims 163 to 190, wherein the compound is formulated as a pharmaceutical composition comprising the compound and a pharmaceutically acceptable diluent.
192. 192. The method of claim 191, wherein the pharmaceutically acceptable diluent is sterile water, sterile saline, or sterile phosphate-buffered saline.
193. 193. The method of any one of claims 163-192, wherein administering the compound reduces the level of ocular C3 deposits, reduces the accumulation of ocular C3 deposits, or slows the progression of geographic atrophy in the subject.
194. 193. The method of any one of claims 163 to 192, wherein administering the compound reduces the level of plasma CFB protein, reduces serum AP activity, reduces the level of serum functional CFB, reduces the level of urinary factor B degradation products (Ba), or reduces the level of proteinuria in the subject.
195. 195. The method of claim 194, wherein the urinary protein / creatine ratio is reduced after administration of the compound.
196. 195. The method of claim 194, wherein the level of urinary protein is reduced after administration of the compound.
197. 193. The method of any one of claims 163-192, wherein administering the compound slows the progression of geographic atrophy in the subject.
198. 194. The method of any one of claims 163-193, wherein administering the compound slows the expansion of the area of geographic atrophy.
199. 194. The method of any one of claims 163-193, wherein administration of the compound slows the spread of geographic atrophy to the foveal region.
200. 194. The method of any one of claims 163-193, wherein administering the compound halts the expansion of geographic atrophy.
201. 201. The method of any one of claims 1 to 200, comprising detecting the amount of CFB protein or CFB RNA in a biological sample from the human subject.
202. 202. The method of claim 201, wherein the biological sample is blood.
203. 103. The method of claim 102, wherein the biological sample is serum or plasma.
204. 202. The method of claim 201, wherein the biological sample is urine.
205. 205. The method of any one of claims 201 to 204, wherein said detecting is performed before administering said compound.
206. The method of any one of claims 201-204-178, wherein the detecting is performed after administering the compound.
207. 205. The method of any one of claims 201 to 204, wherein said detecting is performed before and after administering said compound.
208. 208. The method of any one of claims 201-207, comprising adjusting the initial loading dose, loading dose, maintenance dose, or therapeutically effective amount of the compound administered after detecting the amount of CFB RNA, CFB protein, or a combination thereof.
209. The method of any one of claims 1 to 208, comprising analyzing the subject's plasma CFB protein level, serum AP activity level, serum functional CFB level, urinary factor B degradation product (Ba) level, or urinary protein level.
210. 210. The method of claim 209, wherein the urinary protein / creatine ratio in a urine sample from the subject is analyzed after administering the compound.
211. 210. The method of claim 209, wherein the level of urinary protein in a urine sample from the subject is analyzed after administering the compound.
212. 212. The method of claim 210 or 211, wherein the analysis is performed before administering the compound, or after administering the compound, or a combination thereof.
213. 213. The method of claim 212, comprising determining or adjusting the therapeutically effective amount of the compound after performing the analysis.
214. 214. The method of claim 212 or claim 213, comprising administering the compound, performing the analysis, and adjusting the frequency of administering the compound after performing the analysis.