Filamentous fungal strains containing enhanced protein productivity phenotypes and methods thereof
Genetically modified filamentous fungal strains deficient in SPT5 protein production, combined with heterologous expression, enhance protein productivity, addressing limitations in volumetric efficiency and carbon yield, and reducing costs in industrial applications.
Patent Information
- Application Number
- JP2025526518
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-11
- Filing Date
- 2023-10-13
- Publication Date
- 2025-11-14
AI Technical Summary
Existing filamentous fungal strains used for protein production in submerged culture have limitations in protein productivity, particularly in terms of volumetric efficiency, specific productivity, and carbon source yield, which affect the cost-effectiveness of industrial applications.
Genetically modified filamentous fungal strains deficient in the production of the native SPT5 protein, combined with heterologous expression cassettes, enhance protein productivity by increasing volumetric productivity, specific productivity, and carbon conversion efficiency, allowing production at elevated temperatures.
The modified strains exhibit enhanced protein productivity, including increased total protein production, improved carbon source yield, and reduced bioreactor operating costs, making them suitable for large-scale industrial applications.
Smart Images

Figure 2025537244000005 
Figure 2025537244000006 
Figure 2025537244000001
Abstract
Description
[Technical Field]
[0001] The present disclosure relates generally to fields such as biology, molecular biology, filamentous fungi, yeast, fermentation, genetics, and the production of industrially relevant proteins. More particularly, the strains and methods of the disclosure relate to genetic modifications in filamentous fungi that result in variant (modified) strains with altered phenotypes, which are particularly suitable for growth in submerged culture (e.g., for large-scale production of proteins for industrial / commercial applications).
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 383,320, filed November 11, 2022, which is incorporated herein by reference in its entirety.
[0003] Sequence Listing Reference The contents of the electronic submission of the sequence listing text file entitled "NB41704-WO-PCT_SequenceListing.xml" was created on October 4, 2023, is 32KB in size, and is incorporated herein by reference in its entirety. [Background technology]
[0004] Filamentous fungi (e.g., Aspergillus spp., Penicillium spp., Talaromyces spp., Fusarium spp., Myceliophthora spp., Neurospora spp., Candida spp., and Trichoderma spp., etc.) are capable of expressing native and heterologous proteins at high levels, making them suitable for the mass production of proteins (e.g., enzymes, antibodies, peptides, etc.) and / or metabolites for industrial and / or commercial applications, such as pharmaceutical, animal health, food, beverage, laundry and textile applications, etc. Filamentous fungi are typically grown in submerged mycelial culture in bioreactors adapted to introduce and distribute oxygen and nutrients into the culture medium (i.e., culture broth). For example, the filamentous fungus Trichoderma reesei (T. reesei; an anamorph of the fungus Hypocrea jecorina) is known to be an efficient producer of cellulase enzymes.
[0005] Thus, filamentous fungi have been exploited for their ability to produce proteins (e.g., enzymes) that are valuable in the production of essential commodities such as cellulosic ethanol, textile processing, grain processing, detergents, fiber / pulp / paper, food additives, and feed additives. For example, because recombinant gene expression in such fungal host strains is a common method for the production of proteins (i.e., for industrial and commercial purposes), improving the protein productivity of fungal host strains is an important economic factor in the cost of protein production. Therefore, as can be appreciated by those skilled in the art, such novel compositions and methods for enhancing protein production in filamentous fungal strains are of great commercial interest. Summary of the Invention [Means for solving the problem]
[0006] As shown and described herein, the present disclosure generally relates to genetically modified filamentous fungal strains (cells) and their use in the production of proteins of interest. In certain embodiments, the present disclosure provides, inter alia, methods and compositions for the design and construction of genetically modified filamentous fungal cells (strains), recombinant (modified) filamentous fungal cells (strains) comprising phenotypes with enhanced protein productivity (including, but not limited to, improved volumetric efficiency, higher specific productivity, improved carbon source yield, and increased bioreactor operating temperatures (e.g., reduced / lowered bioreactor cooling needs and lower operating costs), and methods and compositions for culturing / fermenting filamentous fungal strains over a wide temperature range for the production of proteins of interest.
[0007] Certain embodiments of the present disclosure relate to variant / mutated / recombinant (modified) strains of filamentous fungi derived from or obtained from a parent or control strain containing a gene encoding a native SPT5 protein. More particularly, certain aspects relate to variant filamentous fungal cells derived from or obtained from a parent filamentous fungal cell containing a gene encoding a native SPT5 protein, wherein the variant cells comprise a genetic modification that renders the cells deficient in production of the native SPT5 protein. In certain other aspects, such variant cells comprise a phenotype of enhanced protein productivity compared to the control or parent cells when cultured under the same conditions. In related aspects, the SPT5 gene comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 1. In certain other embodiments, the SPT5 gene encodes a naturally occurring SPT5 protein that comprises at least 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO:2.
[0008] In one or more other embodiments or aspects of the present disclosure, the native SPT5 protein comprises at least one domain selected from the group consisting of an SPT5 N-terminal domain (NTD) comprising at least 80% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 80% identity to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) comprising at least 80% identity to SEQ ID NO: 7. In certain other embodiments, the enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity. In related embodiments, the variant cells of the present disclosure comprise an enhanced protein productivity phenotype compared to the parental cell when cultured under the same conditions at a temperature of about 25°C to 29°C.
[0009] In one or more other embodiments or aspects, the cells of the present disclosure comprise an introduced expression cassette encoding a heterologous protein of interest (POI). In one or more other embodiments or aspects, the cells of the present disclosure express / produce one or more lignocellulolytic enzymes. In certain embodiments, the one or more lignocellulolytic enzymes expressed / produced are expressed from endogenous genes encoding one or more lignocellulolytic enzymes. In other embodiments, the one or more lignocellulolytic enzymes are expressed from an introduced (heterologous) expression cassette.
[0010] Certain other one or more embodiments or aspects of the present disclosure provide, inter alia, methods for producing increased amounts of lignocellulolytic enzymes in modified filamentous fungal cells. In certain embodiments, such methods include obtaining a parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein. In one or more related embodiments or aspects, the one or more parent filamentous fungal cells having an SPT5 gene encoding a native SPT5 protein are genetically modified, such that the genetic modification renders a modified cell obtained therefrom deficient in the production of the native SPT5 protein. In certain other one or more related embodiments or aspects, such methods include fermenting / culturing the modified cell under conditions suitable for the production of lignocellulolytic enzymes, wherein the modified cell produces increased amounts of lignocellulolytic enzymes compared to the parent cell when fermented / cultured under the same conditions at a temperature of about 25°C to 29°C.
[0011] Certain other one or more embodiments or aspects of the present disclosure provide, inter alia, methods for producing increased amounts of a heterologous protein of interest in a modified filamentous fungal cell. In certain embodiments, such methods comprise obtaining a parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein and producing one or more heterologous proteins of interest. In certain other embodiments, such methods comprise obtaining a parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein and introducing into the parent cell one or more expression cassettes encoding one or more (heterologous) proteins of interest. In one or more other embodiments or aspects, the parent filamentous fungal cell having an SPT5 gene encoding a native SPT5 protein is genetically modified, such that a modified cell obtained therefrom is deficient in production of the native SPT5 protein. In certain other one or more related embodiments or aspects, such methods comprise fermenting / culturing the modified cells under conditions suitable for the production of one or more heterologous proteins of interest, wherein the modified cells produce increased amounts of the one or more heterologous proteins of interest compared to the parent cells when fermented / cultured under the same conditions at a temperature of about 25°C to 29°C.
[0012] In certain embodiments of the disclosed methods and / or compositions, modified filamentous fungal cells deficient in expression / production of a native SPT5 protein comprise an enhanced protein productivity phenotype, particularly when fermented at elevated fermentation temperatures, where the enhanced protein productivity phenotype comprises increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity. For example, in certain embodiments, modified filamentous fungal cells deficient in expression / production of a native SPT5 protein comprise an increased total protein productivity phenotype when fermented at elevated temperatures. In certain related embodiments, modified filamentous fungal cells deficient in expression / production of a native SPT5 protein comprise at least a 1% increase in total protein productivity compared to parental or control cells when fermented under the same conditions at elevated fermentation temperatures. In certain embodiments, the high fermentation temperature is at least about 28.05°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, 29°C, 29.1°C, 29.2°C, 29.3°C, 29.4°C, 29.5°C, 29.6°C, 29.7°C, 29.8°C, 29.9°C, or 30°C.
[0013] A brief description of biological sequences SEQ ID NO:1 is the Trichoderma reesei polynucleotide (DNA) sequence encoding the native SPT5 protein of SEQ ID NO:2.
[0014] SEQ ID NO:2 is the amino acid sequence of the native (full-length) SPT5 protein encoded by SEQ ID NO:1.
[0015] SEQ ID NO:3 is the open reading frame (ORF) sequence encoding the native (full-length) SPT5 protein of SEQ ID NO:2.
[0016] SEQ ID NO: 4 is the amino acid sequence of a C-terminally truncated SPT5 variant protein.
[0017] SEQ ID NO: 5 is the amino acid sequence of the SPT5 N-terminal domain (NTD).
[0018] SEQ ID NO: 6 is the amino acid sequence of the NusG superfamily (NGN) domain.
[0019] SEQ ID NO: 7 is the amino acid sequence of the SPT5 C-terminal domain (CTD).
[0020] SEQ ID NO: 8 is the sequence of an artificial RNA target site (TS) designated "CLsgRNA58."
[0021] SEQ ID NO: 9 is an artificial DNA sequence designated "AL950."
[0022] SEQ ID NO: 10 is an artificial DNA sequence designated "AL952."
[0023] SEQ ID NO: 11 is an artificial DNA sequence designated "CL2350."
[0024] SEQ ID NO: 12 is an artificial DNA sequence designated "CL2351."
[0025] SEQ ID NO:13 is the T. reesei DNA sequence encoding the native GEF1 protein comprising SEQ ID NO:14.
[0026] SEQ ID NO:14 is the amino acid sequence of the native (full-length) GEF1 protein encoded by SEQ ID NO:13.
[0027] SEQ ID NO: 15 is the sequence "GEF1 REST This is an artificial RNA target site (TS) sequence named ".
[0028] Sequence number 16 is an artificial DNA sequence designated "CLN2514."
[0029] Sequence number 17 is an artificial DNA sequence designated "CLN2517." [Brief explanation of the drawings]
[0030] [Figure 1] Figure 1 shows the amino acid sequences of the native SPT5 protein (SEQ ID NO: 2; Figure 1A) and the C-terminal truncated mutant SPT5 protein (SEQ ID NO: 4; Figure 1B). As shown in Figure 1, the native (full-length) SPT5 protein contains 1,057 amino acid residues (Figure 1A), whereas the C-terminal truncated mutant protein contains 929 amino acid residues (Figure 1B). The last 128 C-terminal amino acid residues of the native SPT5 protein (Figure 1A, underlined residues) are deleted in the mutant SPT5 protein (Figure 1B).
[0031] [Figure 2] Figure 2 shows the amino acid sequence of the native Trichoderma sp. SPT5 protein (Figure 2A; SEQ ID NO: 2), showing the SPT5 N-terminal domain (NTD; SEQ ID NO: 5) in gray-shaded residues, the SPT5 NusG (NGN) domain (SEQ ID NO: 6) in underlined residues, and the SPT5 C-terminal domain (CTD; SEQ ID NO: 7) in bold. As shown in Figure 1A, the C-terminal truncation of the variant SPT5 protein (SEQ ID NO: 4) occurs near the C-terminus of the SPT5 domain, as indicated by the double-underlined serine (S) residue. Similarly, the amino acid sequences of the N-terminal domain (NTD; SEQ ID NO: 5), NusG (NGN) domain (SEQ ID NO: 6), and C-terminal domain (CTD; SEQ ID NO: 7) of the native Trichoderma sp. SPT5 protein are shown in Figure 2B for clarity. DETAILED DESCRIPTION OF THE INVENTION
[0032] As shown and described herein, the present disclosure generally relates to genetically modified filamentous fungal strains (cells) and their use in the production of proteins of interest. More particularly, the strains and methods of the present disclosure relate to genetic modifications in filamentous fungi that result in variant strains with altered phenotypes, which are particularly suitable for growth in submerged culture (e.g., for large-scale production of proteins for industrial / commercial applications). As described and exemplified below, certain embodiments of the present disclosure provide, inter alia, methods and compositions for the design and construction of genetically modified filamentous fungal cells (strains), modified filamentous fungal cells comprising phenotypes with enhanced protein productivity (including, but not limited to, improved volumetric efficiency, higher specific productivity, improved carbon source yield, and reduced bioreactor (fermenter) operating costs), and methods and compositions for culturing / fermenting filamentous fungal strains over a wide temperature range for the production of proteins of interest.
[0033] I. Definition Before describing the strains and methods in detail, the following terms are defined for clarity. Terms not defined should be accorded their usual meaning as used in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the compositions and methods belong.
[0034] All publications and patents cited herein are hereby incorporated by reference.
[0035] Where a range of values is presented, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, and any other stated or intervening value within that stated range, is encompassed within the compositions and methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the compositions and methods of the invention, subject to any specifically excluded limit in the stated range. When the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the compositions and methods.
[0036] Herein, a range is expressed by numerical values preceded by the term "about." Herein, the term "about" is used to provide literal support for the exact number it precedes and a number that is close to or approximately the number preceded by the term. In determining whether a number is close to or approximately a specifically recited number, the unrecited near or approximately number may be a number that, in the context in which it is presented, provides a substantially equivalent number to the specifically recited number. For example, in connection with a numerical value, the term "about" does not necessarily mean the exact number of that number unless the term is clearly defined otherwise in the context. - 10%~ + As another example, the phrase "a pH value of about 6" refers to a pH value of 5.4 to 6.6, unless the pH value is specifically defined otherwise.
[0037] The headings provided herein are not limitations of the various aspects or embodiments of the present compositions and methods, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.
[0038] In accordance with this detailed description, the following abbreviations and definitions apply. Note that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" includes a plurality of such enzymes, reference to "the dosage" includes one or more dosages and equivalents thereof known to those skilled in the art, and so forth.
[0039] It is further noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as a prelude to the use of exclusive terminology such as "solely," "only," "excluding," and "not including" or the use of a "negative" limitation in connection with the recitation of claim elements.
[0040] Furthermore, it should be noted that the term "comprising" as used herein means "including, but not limited to" the component before the term "comprising." The component before the term "comprising" is required or essential, but a composition containing that component may further include other non-essential or optional components.
[0041] It should also be noted that, as used herein, the term "consisting of" means "including and limited to" the component before the term "consisting of." Thus, the component before the term "consisting of" is required or essential, and no other component is present in the composition.
[0042] It will be apparent to those skilled in the art upon reading this disclosure that each of the individual embodiments described and illustrated herein has distinct components and features that may be readily separated from or combined with any of the features of some other embodiments without departing from the scope or spirit of the compositions and methods described herein. Any described method can be carried out in the order of events recited or in any other order that is logically possible.
[0043] As used herein, the terms "wild-type" and "native" are used interchangeably to refer to a gene, protein, fungal cell, or strain as found in nature.
[0044] As used herein, the terms "recombinant" or "non-naturally occurring" refer to an organism, microorganism, cell, nucleic acid molecule, or vector that has at least one engineered genetic alteration or that has been modified by the introduction of a heterologous nucleic acid molecule, or to a cell (e.g., a microbial cell) that has been altered so that expression of a heterologous or endogenous nucleic acid molecule or gene can be controlled. Recombinant also refers to a cell that is derived from or is the progeny of a non-naturally occurring cell that has one or more such modifications. Genetic alterations include, for example, modifications that introduce an expressible nucleic acid molecule that encodes a protein, or the addition, deletion, substitution, or other functional alteration of other nucleic acid molecules in the genetic material of a cell. For example, recombinant cells may express genes or other nucleic acid molecules that are not found in the same or homologous form in native (wild-type) cells, or may provide an altered expression pattern of an endogenous gene, such as overexpression, underexpression, minimal expression, or no expression at all.
[0045] "Recombination," "recombining," or producing a "recombinant" nucleic acid generally refers to the assembly of two or more nucleic acid fragments, which assembly results in a chimeric gene.
[0046] As used herein, the term "gene" is synonymous with the term "allele," which refers to a nucleic acid that encodes and directs the expression of a protein or RNA. Because vegetative propagation forms of filamentous fungi are generally haploid, a single copy of a particular gene (i.e., a single allele) is sufficient to confer a particular phenotype.
[0047] As used herein, the term "gene" refers to a segment of DNA involved in producing a polypeptide (protein) chain, which may or may not include regions preceding and following the coding region (e.g., 5' untranslated (5' UTR) or "leader" sequence, 3' UTR or "trailer" sequence, promoter sequence, and terminator sequence), and intervening sequences (introns) between individual coding segments (exons). For example, a gene (DNA) sequence of interest (GOI) can encode regulatory proteins, structural proteins, and commercially important industrial proteins or peptides, such as enzymes (e.g., proteases, mannanases, xylanases, amylases, glucoamylases, cellulases, oxidases, phytases, lipases), etc. A gene of interest can be a naturally occurring gene, a mutated (modified) gene, or a synthetic gene.
[0048] As used herein, the term "promoter" refers to a nucleic acid sequence that functions to direct transcription of a downstream gene or its open reading frame (ORF). A promoter will generally be appropriate for the host cell (e.g., a filamentous fungal cell) in which the target gene is to be expressed. A promoter, along with other transcriptional and translational regulatory nucleic acid sequences (also called "control sequences"), are necessary to express a given gene. Generally, transcriptional and translational regulatory sequences include, but are not limited to, promoter and terminator sequences, including a core promoter and enhancer or activator or repressor sequences, transcriptional and translational start and stop sequences. In certain embodiments, the promoter is an inducible promoter or a constitutive promoter. In certain embodiments, the inducible promoter is an inducible cellulase gene promoter.
[0049] As used herein, the term "promoter activity" refers to the ability of a nucleic acid to direct transcription of a downstream (3') polynucleotide in a host cell. To test promoter activity, a (promoter) nucleic acid can be operably linked to a downstream polynucleotide to generate a recombinant nucleic acid. The recombinant nucleic acid can be introduced into a cell to assess transcription of the polynucleotide. In certain cases, the polynucleotide can encode a protein, and transcription of the polynucleotide can be assessed by assessing the production of the protein in the cell.
[0050] As used herein, the term "operably linked" refers to a functional linkage between two or more nucleic acid sequences. Thus, a nucleic acid sequence is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or terminator sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation; a nucleic acid sequence encoding a secretory leader (i.e., signal peptide) is operably linked to a nucleic acid sequence encoding a polypeptide (e.g., ORF) if it is expressed as a preprotein that participates in the secretion of the polypeptide. Generally, "operably linked" means that the DNA (nucleic acid) sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers need not be contiguous. Linking (i.e., operably linking) two or more nucleic acid sequences can be accomplished using any method well known to those of skill in the art.
[0051] As used herein, a "functional gene" is a gene for which cellular components can be used to produce an active gene product, typically a protein. In contrast, a "non-functional gene" is one for which cellular components cannot be used to produce an active gene product (i.e., a functional protein), or for which the ability of cellular components to be used to produce an active gene product (i.e., a functional protein) is reduced.
[0052] As used herein, a "functional protein" is a protein that has a function or activity, such as an enzymatic function / activity, a binding function / activity (e.g., DNA binding), and a surfactant property, and that has not been mutated, truncated, or otherwise modified to eliminate or reduce that function / activity.
[0053] As used herein, the term "gene" is synonymous with the term "allele," which refers to a nucleic acid that encodes and directs the expression of a protein or RNA. Because vegetative propagation forms of filamentous fungi are generally haploid, a single copy of a particular gene (i.e., a single allele) is sufficient to confer a particular phenotype.
[0054] As used herein, the terms "wild-type" and "native" are used interchangeably to refer to a gene, protein, fungal cell, or strain as found in nature.
[0055] As used herein, the phrases "modified filamentous fungal cell," "mutated filamentous fungal cell," "variant filamentous fungal cell," "recombinant filamentous fungal cell," and "modified filamentous fungal strain," etc., may be used interchangeably and refer to a filamentous fungal cell derived from (obtained from) a control or parent filamentous fungal cell belonging to the subphylum Opisthobranchia. For example, a "modified" filamentous fungal cell may be derived from (obtained from) a control or parent filamentous fungal cell, and the modified cell contains at least one genetic modification not found in the control or parent cell.
[0056] As used herein, the term "ascomycota fungal cell" refers to any organism in the phylum Ascomycota in the kingdom Fungi. Examples of ascomycota fungal cells include, but are not limited to, filamentous fungi in the subphylum Ascomycota, such as Trichoderma species, Aspergillus species, Myceliophthora species, and Penicillium species.
[0057] As used herein, the term "filamentous fungi" refers to all filamentous fungal forms of the Fungi and Oomycota classes, including, but not limited to, species of the genera Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, and Trichoderma. In some embodiments, the filamentous fungus may be Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.
[0058] In some embodiments, the filamentous fungus is a Fusarium species, such as Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium These include Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, and Fusarium venenatum. In other embodiments, the filamentous fungus is Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, Thielavia terrestris, or the like.In certain other embodiments, the filamentous fungus is Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride, and the like.
[0059] Exemplary parent Trichoderma reesei strains used herein include, but are not limited to, T. reesei strain QM6a (ATCC Accession No. 13631), T. reesei strain RL-P37 (NRRL Accession No. 15709), and T. reesei strain RUT-C30 (ATCC Accession No. 56765); exemplary parent Aspergillus niger strains include, but are not limited to, A. niger strain ATCC Accession No. 1015; exemplary parent Aspergillus oryzae oryzae strains include, but are not limited to, A. oryzae strain RIB40 (ATCC Accession No. 42149); and exemplary parent Myceliophthora thermophila strains include, but are not limited to, M. thermophila strain ATCC Accession No. 42464.
[0060] For example, Trichoderma strains Rut-RUT-C30 and RL-P37 are mutagenized (cellulase-overproducing) derivatives of the Trichoderma natural isolate QM6a (Sheir-Neiss and Montenecourt, 1984), with strain NG14 being the immediate common ancestor. In certain embodiments, suitable Trichoderma strains can be derived from / obtained from T. reesei strains containing a deletion of the T. reesei pyr2 gene (Δpyr2), as generally described by Sheir-Neiss and Montenecourt (1984) and WO 2011 / 153449, which are specifically incorporated herein by reference in their entireties.
[0061] In certain other embodiments, exemplary Trichoderma strains are shown and described in Table 1. [Table 1]
[0062] As used herein, the T. reesei parent strain designated "T4" is a cellulase-overproducing strain derived from T. reesei strain RL-P37, generally as described in International Publication No. WO 2021 / 092356, which is specifically incorporated by reference in its entirety.
[0063] As used herein, the T. reesei parent (control) strain, designated "T4-GEF1," was determined as a specific productivity (Q pThe strains were serially grown under selection conditions to identify and isolate mutant strains thereof capable of high temperature protein production without adversely affecting the T4 gene expression. For example, WO 2021 / 092356 generally describes the serial growth of Trichoderma "T4" strains under selection conditions to identify and isolate mutant T4 strains thereof capable of high temperature (HT) protein production relative to the parent (control) T4 strain. As described in this publication, a mutant strain was identified that was capable of HT protein production relative to the parent T4 strain, where the mutant gene encoded a truncated protein designated "GEF1," and the strain was designated T4-GEF1.
[0064] As used herein, a mutant Trichoderma strain designated "T4-26rc" (derived from the control strain T4-GEF1) was identified and isolated under selective temperatures, where the T4-26rc mutant is the Q of the control T4-GEF1 strain grown at 28°C. p Compared with the specific productivity (Q p ) are similar.
[0065] As used herein, the variant Trichoderma strain designated "SPT5 t-BBW51" is derived from the T4-GEF1 control strain and contains a single nucleotide polymorphism (SNP; G→A) in the SPT5 coding sequence (CDS) that results in a (W930*) C-terminal truncation of the SPT5 protein.
[0066] As used herein, the T. reesei parent strain designated "t-BAL50" contains an introduced single copy of a cellulase expression cassette integrated into the genome, the cellulase cassette encoding cellobiohydrolase 1 (Cbh1), cellobiohydrolase 2 (Cbh2), endoglucanase 1 (Eg1), and endoglucanase 2 (Eg2) proteins.
[0067] As used herein, the mutant Trichoderma strain designated "t-BDA85" is derived from the t-BAL50 strain and contains a SNP (G to A) in the SPT5 gene coding sequence (CDS) that results in a C-terminal truncation (W930*) of amino acids 930 to 1,057 of the native SPT5 protein, as shown in FIG. 1B (SEQ ID NO: 4).
[0068] As used herein, the mutant Trichoderma strain designated "t-BDA88" is derived from the t-BAL50 strain and contains a pyr2 selectable marker gene inserted at nucleotide position 3,183 of the SPT5 gene CDS, thereby disrupting the SPT5 CDS, resulting in a truncated SPT5 protein.
[0069] As used herein, the mutant Trichoderma strain designated "t-BEX65" restores the disrupted GEF1 gene to the wild-type GEF1 gene (WTGEF1 REST ) was obtained from the t-BDA85 strain.
[0070] As used herein, the terms "polypeptide" and "protein" (and / or their respective plurals) are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. Conventional one-letter or three-letter codes for amino acid residues are used herein. Polymers may be linear or branched, may comprise modified amino acids, and may be interrupted by non-amino acids. The terms also encompass amino acid polymers that are modified, either naturally or by intervention, such as, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as, for example, conjugation with a labeling component. Also included within this definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids), as well as other modifications known in the art.
[0071] The term "derived polypeptide / protein" as used herein refers to a protein that is derived from or can be obtained from a protein by the addition of one or more amino acids to either or both of the N-terminus and C-terminus, the substitution of one or more amino acids at one or many different sites in the amino acid sequence, the deletion of one or more amino acids at one or both termini of the protein or at one or more sites in the amino acid sequence, and / or the insertion of one or more amino acids at one or more sites in the amino acid sequence. Preparation of a protein derivative can be achieved by modifying a DNA sequence encoding the native protein and transforming the DNA sequence into a suitable host and expressing the modified DNA sequence to form the derived protein.
[0072] Related (and derived) proteins include "variant proteins." Variant proteins differ from a reference / parent protein (e.g., a wild-type protein) by substitution, deletion, and / or insertion of a small number of amino acid residues. The number of different amino acid residues between a variant protein and a parent protein can be one or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. A variant protein can share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more amino acid sequence identity with the reference protein. Variant proteins may also differ from the reference protein in selected motifs, domains, epitopes, conserved regions, and the like.
[0073] As used herein, the term "analogous sequence" refers to a sequence within a protein that provides a similar function, tertiary structure, and / or conserved residues to a protein of interest (i.e., typically the original protein of interest). For example, in epitope regions containing an α-helical or β-sheet structure, the substituted amino acids in the analogous sequence preferably maintain the same specific structure. The term also refers to nucleotide and amino acid sequences. In some embodiments, analogous sequences are developed such that the amino acid substitutions result in variant enzymes that exhibit similar or improved function. In some embodiments, the tertiary structure and / or conserved amino acid residues within the protein of interest are located in or near the segment or fragment of interest. Thus, if the segment or fragment of interest contains, for example, an α-helical or β-sheet structure, the substituted amino acids preferably maintain that specific structure.
[0074] As used herein, the term "homologous protein" refers to a protein that has a similar activity and / or structure to a reference protein. It is not intended that homologs are necessarily evolutionarily related. Thus, the term is intended to encompass identical, similar, or corresponding proteins (i.e., with respect to structure and function) obtained from different organisms. In some embodiments, it is desirable to identify homologs that have similar quaternary, tertiary, and / or primary structure to the reference protein.
[0075] The degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al., 1984). For purposes of the present disclosure, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970) as implemented in the Needle program in the EMBOSS package (Rice et al., 2000), preferably version 3.0.0 or later. Optional parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
[0076] The output of Needle labeled "longest identity" (obtained using the nobrief option) is used as the percent identity, calculated as follows: (Identical residues × 100) / (length of alignment − total number of gaps in alignment)
[0077] As used herein, the phrases "substantially similar" and "substantially identical," in the context of at least two nucleic acids or polypeptides, typically mean that the polynucleotide or polypeptide comprises a sequence having at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% or more identity compared to a reference (i.e., wild-type) sequence. Sequence identity can be determined using known programs such as BLAST, ALIGN, and CLUSTAL, using standard parameters. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. Databases can also be searched using FASTA. One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, for example, when the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize with each other under stringent conditions (for example, within a range of moderate to high stringency).
[0078] In certain embodiments, the filamentous fungal cells for the manipulations, constructions, and uses described herein are generally derived from fungi of the subphylum Entomotrichum, particularly those having a vegetative mycelial state and containing the SPT5 gene or a gene homolog thereof.
[0079] As used herein, a "gene or polynucleotide encoding a native SPT5 protein" comprises sequence homology to SEQ ID NO: 1. In certain embodiments, a gene or polynucleotide encoding a native SPT5 protein comprises at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3. In certain other embodiments, a gene or polynucleotide encoding a native SPT5 protein comprises at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 and encodes one or more protein domains selected from the group consisting of the SPT5 N-terminal domain (SPT5 NTD), the NusG superfamily N-terminal domain (NGN), and the SPT5 C-terminal domain (SPT5 CTD). In certain other embodiments, a gene or polynucleotide encoding a native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.
[0080] As used herein, an "open reading frame (ORF) nucleic acid sequence encoding a native SPT5 protein" comprises sequence homology to the ORF sequence of SEQ ID NO: 3. In certain other embodiments, the ORF nucleic acid sequence (encoding the native SPT5 protein) encodes an SPT5 that comprises at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, the ORF encoding the native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.
[0081] As used herein, the phrases "lignocellulolytic enzymes," "cellulase enzymes," and "cellulases" are used interchangeably and include glycoside hydrolase (GH) enzymes, such as cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases, which hydrolyze the glycosidic bonds of cellulose (hemicellulose) to produce sugars (e.g., glucose, xylose, arabinose, etc.).
[0082] As used herein, an "endoglucanase" protein may be abbreviated as "EG," a "cellobiohydrolase" protein may be abbreviated as "CBH," a "β-glucosidase" protein may be abbreviated as "BG," and a "xylanase" protein may be abbreviated as "XYL." Thus, as used herein, a gene (or ORF) encoding an EG protein may be abbreviated as "eg," a gene (or ORF) encoding a CBH protein may be abbreviated as "cbh," a gene (or ORF) encoding a BG protein may be abbreviated as "bg," and a gene (or ORF) encoding an XYL protein may be abbreviated as "xyl." In certain embodiments, cellobiohydrolases include enzymes classified under the Enzyme Commission number (EC 3.2.1.91), endoglucanases include enzymes classified under EC 3.2.1.4, endo-β-1,4-xylanases include enzymes classified under EC 3.2.1.8, β-xylosidases include enzymes classified under EC 3.2.1.37, and β-glucosidases include enzymes classified under EC 3.2.1.21.
[0083] As used herein, the term "cellulase gene promoter" includes, but is not limited to, cellobiohydrolase (cbh) gene promoter sequences, endoglucanase (eg) gene promoter sequences, β-glucosidase (bg) gene promoter sequences, and xylanase (xyl) gene promoter sequences.
[0084] As used herein, "nucleic acid" refers to nucleotide or polynucleotide sequences, and fragments or portions thereof, as well as DNA, cDNA, and RNA of genomic or synthetic origin, which may be double-stranded or single-stranded, whether representing the sense or antisense strand.
[0085] As used herein, the term "expression" refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from a nucleic acid molecule of the present disclosure. Expression can also refer to the translation of mRNA into a polypeptide. Thus, the term "expression" includes all steps involved in producing a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0086] As used herein, the compound term "express / produce" used in phrases such as "the variant strain of filamentous fungal cells expresses / produces an "increased" amount of a protein of interest (POI) (i.e., compared to the parent / control cells)" is intended to include all steps involved in the expression and production of a protein in the filamentous fungal strains of the present disclosure.
[0087] In certain embodiments, a gene, polynucleotide, or nucleic acid sequence encoding a native SPT5 protein that contains "sequence homology" refers to a DNA or RNA (nucleic acid) sequence that has minimal sequence variation from the corresponding nucleic acid sequence (to which it is compared) and retains substantially the same biological function as the corresponding nucleic acid sequence (to which it is compared). For example, in certain embodiments, a nucleic acid sequence that contains substantial sequence homology to a gene, polynucleotide, or nucleic acid encoding a native SPT5 protein is assessed by identifying the encoded gene product (the native SPT5 protein) as described herein.
[0088] In certain other embodiments, gene, polynucleotide, or nucleic acid sequences containing sequence homology to a gene, polynucleotide, or nucleic acid encoding a naturally occurring SPT5 protein are determined / identified using nucleic acid hybridization methods. For example, in certain embodiments, DNA / RNA sequences containing substantial sequence homology to a gene encoding a naturally occurring SPT5 protein (e.g., SEQ ID NO: 2) are identified by the ability of such DNA / RNA sequences to hybridize under stringent conditions with specific nucleic acid sequences of the present disclosure.
[0089] As used herein, "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences that are significantly identical or homologous to each other remain hybridized to each other. Such stringent conditions are well known to those of skill in the art (see, e.g., Ausubel et al., 1995; Sambrook et al., 1989). For example, in certain embodiments, non-limiting examples of stringent hybridization conditions include hybridization in 4x sodium chloride / sodium citrate (SSC) at about 65-70°C (or hybridization in 4x SSC plus 50% formamide at about 42-50°C), followed by one or more washes in 1x SSC at about 65-70°C. Similarly, non-limiting examples of highly stringent hybridization conditions include hybridization in 1x SSC at about 65-70°C (or hybridization in 4x SSC plus 50% formamide at about 42-50°C), followed by one or more washes in 0.3x SSC at about 65-70°C.
[0090] Certain embodiments of the present disclosure relate to modified strains of filamentous fungal cells comprising a genetic modification of the gene encoding a native SPT5 protein. Thus, certain aspects relate to variant / mutant / recombinant (genetically modified) strains of filamentous fungi that are derived from or obtained from a parent (or control) strain that comprises the gene encoding a native SPT5 protein. More particularly, certain aspects relate to variant filamentous fungal cells that are derived from or obtained from a parent or control filamentous fungal cell that comprises the gene encoding a native SPT5 protein, wherein the variant cells comprise a genetic modification that renders the cells deficient in expression / production of the native SPT5 protein. In certain other aspects, such variant cells comprise a phenotype of enhanced protein productivity compared to the parent or control cells when cultured under the same conditions. In a related embodiment, the SPT5D gene comprises at least about 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO:1. In certain other embodiments, the SPT5 gene encodes a naturally occurring SPT5 protein comprising at least about 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO:2.
[0091] In one or more other embodiments or aspects of the present disclosure, the native SPT5 protein comprises at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:5. an N-terminal domain (NTD), a NusG superfamily (NGN) domain comprising at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:6, and an SPT5 C-terminal domain (CTD) comprising at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:7. In certain other embodiments, the enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity. In related embodiments, the variant cells of the present disclosure comprise an enhanced protein productivity phenotype compared to parental or control cells when cultured under the same conditions at a temperature of about 25° C. to 29° C.
[0092] In certain other embodiments, the variant cells of the disclosure comprise a phenotype of enhanced protein productivity compared to parental or control cells when cultured under the same conditions at temperatures between about 25° C., 26° C., 27° C., 28° C., or 29° C. In other embodiments, the variant cells of the disclosure comprise a phenotype of enhanced protein productivity compared to parental or control cells when cultured under the same conditions at temperatures between about 25.0° C., 25.1° C., 25.2° C., 25.3° C., 25.4° C., 25.5° C., 25.6° C., 25.7° C., 25.8° C., 25.9° C., 26.0° C., 26.1° C., 26.2° C., 26.3° C., 26.4° C., 26.5° C., 26.6° C., 26.7° C., 26.8° C., 26.9° C., 27.0° C., 27.1° C., 27.2° C. , 27.3°C, 27.4°C, 27.5°C, 27.6°C, 27.7°C, 27.8°C, 27.9°C, 28.0°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, or 29.0°C, when cultured under the same conditions at a temperature between 27.3°C, 27.4°C, 27.5°C, 27.6°C, 27.7°C, 27.8°C, 27.9°C, 28.0°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, or 29.0°C, includes an enhanced protein productivity phenotype compared to parental or control cells.
[0093] In one or more other embodiments or aspects, the cells of the present disclosure comprise an introduced expression cassette encoding a heterologous protein of interest (POI). In one or more other embodiments or aspects, the cells of the present disclosure express / produce one or more lignocellulolytic enzymes. In certain embodiments, the one or more lignocellulolytic enzymes produced are expressed from endogenous genes encoding one or more lignocellulolytic enzymes. In other embodiments, the one or more lignocellulolytic enzymes produced are expressed from an introduced (heterologous) expression cassette encoding one or more lignocellulolytic enzymes.
[0094] As used herein, the terms "modification" and "genetic modification" are used interchangeably and include, but are not limited to: (a) the introduction, substitution, or removal of one or more nucleotides within a gene, or the introduction, substitution, or removal of one or more nucleotides within a regulatory element required for the transcription or translation of a gene; (b) gene disruption; (c) gene conversion; (d) gene deletion; (e) gene downregulation (e.g., antisense RNA, siRNA, miRNA, etc.); (f) directed mutagenesis (including, but not limited to, CRISPR / Cas9-mediated mutagenesis); and / or (g) random mutagenesis of any one or more genes disclosed herein.
[0095] As used herein, the variant strain of filamentous fungi comprising genetic modifications includes, but is not limited to, the genetic modification of the gene encoding the native SPT5 protein disclosed herein.Thus, as described in more detail below, various molecular biology methods are well known and available to those skilled in the art for generating / constructing such variant strains of filamentous fungal cells.
[0096] As used herein, "the introduction, substitution, or removal of one or more nucleotides in a gene encoding a protein" includes the coding sequences (i.e., exons) and the non-coding intervening (intron) sequences of the gene.
[0097] As used herein, the terms "gene disruption," "gene disruption," "gene inactivation," and "gene inactivation" are used interchangeably and broadly refer to any genetic modification that substantially disrupts / inactivates a target gene. Exemplary gene disruption methods include, but are not limited to, complete or partial elimination of any portion of a gene, including a polypeptide coding sequence (CDS), promoter, enhancer, or other regulatory element, or mutagenesis of the gene, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and any combinations and variations thereof that disrupt / inactivate the target gene and substantially reduce or prevent expression / production of a functional gene product. In certain embodiments of the present disclosure, such gene disruption prevents a host cell from expressing / producing the encoded lov gene product.
[0098] In certain other embodiments, the gene, polynucleotide, or nucleic acid sequence encoding the native SPT5 protein is genetically modified using established gene editing techniques such as CRISPR / Cas9 gene editing, zinc finger nuclease (ZFN) gene editing, transcription activator-like effector nuclease editing (TALEN), and homing (mega)nuclease editing.
[0099] In other embodiments, variant strains of filamentous fungi are constructed (ie, genetically modified) by the process of gene conversion.
[0100] In other embodiments, the protein of interest (e.g., endogenous POI or heterologous POI) expressed / produced by the fungal cells of the present disclosure is detected, measured, assayed, etc. by protein quantification methods, gene transcription methods, and mRNA translation methods, including, but not limited to, protein migration / mobility (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation velocity analysis, transcriptomics, proteomics, fluorescent tag, epitope tag, and fluorescent protein (e.g., GFP, RFP) chimeras / hybrids, etc.
[0101] As used herein, functionally and / or structurally similar proteins are considered to be "related proteins." Such related proteins may be from organisms of different genera and / or species, or from different classes of organisms (e.g., bacteria and fungi). Related proteins also encompass homologs and / or orthologs, as determined by primary sequence analysis, by secondary or tertiary structure analysis, or by immunological cross-reactivity.
[0102] As used herein, the term "promoter" refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' (downstream) of the promoter sequence. A promoter may be derived entirely from a native gene, may be composed of various elements from different promoters found in nature, or may include synthetic nucleic acid segments. Those skilled in the art will understand that different promoters may direct the expression of a gene in different cell types, at different developmental stages, or in response to different environmental or physiological conditions. Promoters that most frequently cause gene expression in most cell types are generally referred to as "constitutive promoters." Furthermore, it is recognized that because the exact boundaries of regulatory sequences in most cases have not been completely defined, DNA fragments of different lengths may have identical promoter activity.
[0103] As defined herein, the term "introducing," when used in phrases such as "introducing at least one polynucleotide open reading frame (ORF), or gene thereof, or vector thereof, into a fungal cell, includes methods known in the art for introducing polynucleotides into cells, including, but not limited to, protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, and transfection.
[0104] As used herein, "transformed" or "transformation" means that a cell has been transformed by the use of recombinant DNA techniques. Transformation typically occurs by inserting one or more nucleotide sequences (e.g., polynucleotides, ORFs, or genes) into the cell. The inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e., a sequence that does not naturally occur in the cell being transformed).
[0105] As used herein, "transformation" refers to the introduction of exogenous DNA into a host cell such that the DNA is maintained as a chromosomal integrant or a self-replicating extrachromosomal vector. As used herein, "transforming DNA," "transforming sequence," and "DNA construct" refer to DNA used to introduce a sequence into a host cell. The DNA may be generated in vitro by PCR or any other suitable technique. In some embodiments, the transforming DNA includes the incoming sequence, while in other embodiments, it further includes the incoming sequence flanked by homology boxes. In yet other embodiments, the transforming DNA includes other non-homologous sequences (i.e., stuffer sequences or flanking sequences) added to the ends. The ends can be closed to form a closed circle of the transforming DNA, for example, for insertion into a vector.
[0106] As used herein, "incoming sequence" refers to a DNA sequence to be introduced into a fungal cell chromosome. In some embodiments, the incoming sequence is part of a DNA construct. In other embodiments, the incoming sequence encodes one or more proteins of interest. In some embodiments, the incoming sequence comprises a sequence that may or may not already be present in the genome of the cell to be transformed (i.e., it may be a homologous or heterologous sequence). In some embodiments, the incoming sequence encodes one or more proteins of interest, genes, and / or mutant or modified genes. In alternative embodiments, the incoming sequence encodes a functional wild-type gene or operon, a functional mutant gene or operon, or a non-functional gene or operon. In some embodiments, the incoming sequence is a non-functional sequence inserted into a gene to disrupt the function of the gene. In another embodiment, the incoming sequence comprises a selectable marker. In a further embodiment, the incoming sequence comprises two homology boxes.
[0107] As used herein, a "homology box" refers to a nucleic acid sequence that is homologous to a sequence within a fungal cell chromosome. More specifically, a homology box is an upstream or downstream region that shares about 80-100% sequence identity, about 90-100% sequence identity, or about 95-100% sequence identity with the immediately adjacent coding region of a gene or portion of a gene to be deleted, disrupted, inactivated, downregulated, etc., according to the present invention. These sequences direct the location of integration of a DNA construct within a fungal cell chromosome and direct which portion of the fungal cell chromosome will be replaced by the incoming sequence. While not intended to limit the present disclosure, a homology box can include from about 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology box includes from about 1 bp to 10.0 kb; 1 bp to 5.0 kb; 1 bp to 2.5 kb; 1 bp to 1.0 kb; and 0.25 kb to 2.5 kb. The homology box may also include approximately 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb, and 0.1 kb. In some embodiments, the 5' and 3' ends of the selectable marker are flanked by homology boxes, wherein the homology boxes comprise nucleic acid sequences that immediately flank the coding region of the gene.
[0108] As used herein, the term "nucleotide sequence encoding a selectable marker" refers to a nucleotide sequence expressible in a host cell, where expression of the selectable marker confers on cells containing the expressed gene the ability to grow in the presence of a corresponding selection agent or in the absence of an essential nutrient.
[0109] As used herein, the terms "selectable marker" and "selection marker" refer to a nucleic acid (e.g., a gene) that can be expressed in a host cell, facilitating the selection of hosts containing a vector. Examples of such selectable markers include, but are not limited to, antimicrobial agents. Thus, the term "selectable marker" refers to a gene that indicates that a host cell has taken up incoming DNA of interest or that some other reaction has occurred. Typically, a selectable marker is a gene that confers antimicrobial resistance or a metabolic advantage to a host cell, allowing cells containing foreign DNA to be distinguished from cells that have not received any foreign sequences during transformation.
[0110] A host cell "genome," a fungal cell "genome," or a filamentous fungal cell "genome," as defined herein, includes chromosomal genes and extrachromosomal genes.
[0111] As used herein, the terms "plasmid," "vector," and "cassette" refer to extrachromosomal elements that often carry genes that are not typically part of the cell's central metabolism and are usually in the form of circular double-stranded DNA molecules. Such elements can be linear or circular, single- or double-stranded, self-replicating sequences of DNA or RNA, genome-integrating sequences, phage, or nucleotide sequences from any source in which multiple nucleotide sequences have been joined or recombined into a unique structure that can introduce into a cell a promoter fragment and DNA sequence for a selected gene product, along with appropriate 3' untranslated sequences.
[0112] As used herein, the term "vector" refers to any nucleic acid that can replicate (propagate) within a cell and carry a new gene or DNA segment (e.g., an "incoming sequence") into the cell. Thus, the term refers to a nucleic acid construct designed for transport between various host cells. Vectors include viruses, bacteriophages, proviruses, plasmids, phagemids, transposons, and artificial chromosomes, such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), which are either "episomal" (i.e., autonomously replicating) or can be integrated into a host cell chromosome.
[0113] As used herein, "transformation cassette" refers to a particular vector that contains a gene (or its ORF) and has elements in addition to the gene that facilitate transformation of a particular host cell.
[0114] As used herein, "expression vector" refers to a vector capable of incorporating and expressing heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and known to those skilled in the art. The selection of an appropriate expression vector is within the knowledge of one skilled in the art.
[0115] As used herein, the terms "expression cassette" and "expression vector" refer to a nucleic acid construct, either recombinantly or synthetically produced, with a set of specific nucleic acid elements that allow for transcription of a specific nucleic acid in a target cell (i.e., they are vectors or vector elements as described above). Recombinant expression cassettes can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments, a DNA construct also includes a set of specific nucleic acid elements that allow for transcription of a specific nucleic acid in a target cell. In certain embodiments, a DNA construct of the present disclosure includes a selectable marker and an inactivated chromosomal segment or gene segment or DNA segment, as defined herein.
[0116] As used herein, a "targeting vector" is a vector that contains a polynucleotide sequence homologous to a region in a host cell chromosome into which the targeting vector is transformed and is capable of driving homologous recombination at that region. For example, a targeting vector is used to introduce a genetic modification into a host cell chromosome via homologous recombination. In some embodiments, the targeting vector contains other non-homologous sequences (i.e., stuffer sequences or flanking sequences), e.g., added to the ends. The ends can be closed so that the targeting vector forms a closed circle, e.g., for insertion into a vector.
[0117] The phrases "enhanced protein productivity phenotype" and "increased protein productivity phenotype" as defined herein may be used interchangeably.
[0118] As used herein, variant cells (or strains) comprising an "enhanced protein productivity phenotype" include, but are not limited to, variant cells comprising enhanced / increased volumetric productivity, variant cells comprising enhanced / increased carbon conversion efficiency, variant cells comprising enhanced / increased protein yield, and variant cells comprising enhanced / increased specific protein productivity. For example, in certain embodiments, variant cells or strains comprising an enhanced protein productivity phenotype express / produce at least 0.1% or more g of total protein per g of feed sugar (compared to the parent strain), where feed sugar can be expressed in terms of the mass of sugar added to the fermentor during the production phase (i.e., after the start of the feed).
[0119] As used herein, when describing an "enhanced / increased protein productivity phenotype" in unmodified (parental or control) cells versus modified (variant) cells, it will be understood that the "parental" and "variant" cells are grown / cultured / fermented under the same conditions (e.g., the same conditions of medium, temperature, pH, etc.).
[0120] Similarly, when describing the "expression / production" of a protein of interest (POI) in unmodified (parent or control) cells versus the "expression / production" of the POI in modified (variant) cells, it will be understood that the "parent" and "variant" cells are grown / cultured / fermented under essentially the same conditions (e.g., the same conditions of medium, temperature, pH, etc.).
[0121] As used herein, "aerobic fermentation" refers to growth in the presence of oxygen.
[0122] As used herein, the terms "broth," "cell broth," "fermentation broth," and / or "culture broth" are used interchangeably and collectively refer to (i) fermentation (culture) medium and (ii) cells in liquid (submerged) culture.
[0123] As used herein, the term "cell mass" refers to the cellular components (including intact and lysed cells) present in a liquid (submerged) culture. Cell mass can be expressed as dry cell weight (DCW) or wet cell weight (WCW).
[0124] As used herein, the phrase "high fermentation (cultivation) temperature" refers to a fermentation temperature above 28°C. In certain embodiments, the high fermentation temperature is at least about 28.05°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, 29°C, 29°C, 29.1°C, 29.2°C, 29.3°C, 29.4°C, 29.5°C, 29.6°C, 29.7°C, 29.8°C, 29.9°C, or 30°C. In certain other embodiments, the high fermentation temperature is at least about 28.5°C to about 29°C. In certain other embodiments, the high fermentation temperature is at least about 29°C to 30°C.
[0125] II. Fungal strains containing phenotypes that enhance protein productivity at high culture temperatures As generally described and demonstrated in the Examples section below, in certain embodiments, Applicants continuously grow a Trichoderma reesei whole cellulase strain, designated T4-GEF1, under selective conditions to obtain specific productivity (Q p Mutant strains capable of high-temperature protein production without adversely affecting the Q4-GEF1 gene expression level were identified and isolated (Example 1). For example, a mutant T. reesei strain designated T4-26rc was identified and isolated under such selective conditions (Example 2), and the mutant T4-26rc strain exhibited a Q4-lowering effect when grown at 29°C compared to the control T4-GEF1 strain grown at 28°C. p are similar (Table 2).
[0126] As detailed in Example 2, Applicant sequenced the HT T. reesei T4-26rc mutant strain described / isolated in Example 1 to identify any mutant alleles that may contribute to the enhanced protein productivity observed at growth / culture conditions at 31° C. More specifically, the mutant allele identified herein is present at scaffold position 2:1043183-1043184 in wild-type T. reesei QM6a (v2.0 genome sequence assembly, available at the Joint Genomes Institute (JGI) website; genome.jgi.doe.gov), and the mutant allele contains a SNP (G→A) that encodes a truncated SPT5 protein (see, e.g., Figures 1 and 2). In particular, the mutant T4-26rc T. reesei strain exhibited a Q expression level of 1.0 when grown / cultured at 29°C compared to the parental (control) T. reesei T4-GEF1 grown / cultured at 28°C. p are similar.
[0127] As described in Example 3, inactivation of the wild-type SPT5 gene (JGI; T. reesei v2.0 Scaffold2:1043183-1043184), encoding the native (functional) SPT5 protein (SEQ ID NO:2; PID:4136), was carried out in a T. reesei strain designated SPT5t-BBW51 by introducing a SNP (G to A) into the SPT5 gene CDS, resulting in a C-terminal truncation (W930*) of amino acid positions 930 to 1057 of the native SPT5 protein. As shown in Example 3 (Table 2), the fermentor performance of the SPT5t-BBW51 transformant was compared to that of the parental (control) T4-GEF1 strain and the mutant T4-26rc strain described in Examples 1-2. In particular, as shown in Table 2, the total protein yields of the T4, T4-GEF1, T4-26rc, and SPT5t-BBW51 strains are presented as a percentage (%) compared to the control T4 strain cultured at 25° C. For example, the percent (%) total protein yields of T4, T4-GEF1, and SPT5t-BB51 at 28° C. compared to the control % of T4 at 25° C. are 68%, 107%, and 112%, respectively. In another example, the percent (%) total protein yields of T4-GEF1, T4-26rc, and SPT5t-BB51 at 29° C. compared to the control % of T4 at 25° C. are 73%, 100%, and 112%, respectively.
[0128] Example 4 generally describes the inactivation / disruption of the wild-type SPT5 gene by introducing a single nucleotide polymorphism (SNP) into a T. reesei parent (control) strain (t-BAL50) containing a heterologous cellulase expression cassette, resulting in a modified T. reesei strain designated t-BDA88, as shown in Table 3. A second transformant designated t-BDA85, which also contained a SNP (G>A) at nucleotide position 3,183 in the coding sequence of the SPT5 gene, was evaluated via fermentor performance, as shown in Table 3. More specifically, the fermentor performance of the t-BDA85 and t-BDA88 transformants was compared to the parent t-BAL50 (control) strain, as shown in Table 3. Here, the total protein yield of the t-BDA85 and t-BDA88 strains is shown as a percentage (%) compared to the t-BAL50 parental (control) strain grown at 25°C.
[0129] Example 5 of the present disclosure further evaluates the effect of SPT5 in the absence of a GEF1 gene disruption (ΔGEF1). In this example, the wild-type GEF1 gene (GEF1) encoding the native GEF1 protein is disrupted. Rest Restoration of WT GEF1 (GEF1) was performed in T. reesei strain t-BDA85 using a Cas9-based method, where a transformant designated t-BEX65 contained the restored WT GEF1 (GEF1 Rest The fermentor performance of the t-BEX65 strain was evaluated at protein production temperatures of 25°C, 28°C, and 29°C, as shown in Table 4, where the total protein yield of t-BEX65 is shown as a percentage (%) compared to t-BEX65 at 25°C.
[0130] Thus, as shown and described below, in certain embodiments, the gene encoding the native SPT5 protein comprises sequence homology to SEQ ID NO: 1. In certain embodiments, the gene encoding the native SPT5 protein comprises at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3. In certain embodiments, a gene encoding a native SPT5 protein comprises at least about 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to 100% sequence identity to SEQ ID NO:1 or SEQ ID NO:3.
[0131] In certain embodiments, the gene encoding the native SPT5 protein comprises at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 and encodes one or more protein domains selected from the group consisting of the SPT5 N-terminal domain (SPT5 NTD), the NusG superfamily N-terminal domain (NGN), and the SPT5 C-terminal domain (SPT5 CTD). In certain other embodiments, the gene or polynucleotide encoding the native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.
[0132] In certain other embodiments or aspects of the present disclosure, the gene CDS (open reading frame; ORF) nucleic acid sequence encoding the native SPT5 protein comprises sequence homology to the ORF sequence of SEQ ID NO: 3. In certain other embodiments, the ORF nucleic acid sequence (encoding the native SPT5 protein) encodes an SPT5 that comprises at least about 50% to 100% sequence identity to the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, the ORF nucleic acid sequence (encoding the native SPT5 protein) encodes an SPT5 that comprises at least about 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to 100% sequence identity to the native SPT5 protein of SEQ ID NO:2. In certain other embodiments, the ORF encoding the native SPT5 protein hybridizes to the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under moderate to stringent hybridization conditions.
[0133] In certain embodiments, the "positions" of amino acid residues in a given amino acid sequence are numbered herein using the numbering (positions) of amino acid residues in the native Trichoderma sp. SPT5 protein of SEQ ID NO: 2. For example, Figure 1A shows the amino acid sequence of the native SPT5 protein (SEQ ID NO: 2), and a given amino acid sequence described herein can be aligned with the SPT5 protein amino acid sequence (SEQ ID NO: 2) using the alignment algorithms described herein (and / or alignment algorithms known to those of skill in the art), and amino acid residues in the given amino acid sequence that align (preferably, optimally align) with amino acid residues in the native sequence can be conveniently numbered by reference to the corresponding amino acid residues in the SPT5 sequence.
[0134] Similarly, to establish sequence homology or sequence identity to the primary (1°) sequence of the SPT5 protein (SEQ ID NO: 2), one skilled in the art can readily compare the primary sequence of SEQ ID NO: 2 with one or more candidate SPT5 protein homolog / ortholog sequences using sequence alignment algorithms, software, and methods known to those skilled in the art. Thus, after aligning conserved residues, allowing for necessary insertions and deletions to maintain alignment (i.e., avoiding the elimination of conserved residues through any deletions and insertions), residues equivalent to specific amino acids in the primary sequence of the candidate filamentous fungal SPT5 protein are defined. Alignment of conserved residues should preferably preserve 100% of such residues. However, alignment of 98%, 95%, 90%, 85%, 80%, 75%, 70%, 50%, or at least 45% of the conserved residues is also sufficient to define equivalent residues.
[0135] Thus, in certain embodiments, a gene encoding a native SPT5 protein contains at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 and encodes one or more protein domains selected from the group consisting of an SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N-terminal domain (NGN), and an SPT5 C-terminal domain (SPT5 CTD). For example, as shown in Figure 2A, a native Trichoderma SPT5 protein (SEQ ID NO: 2) contains 1,057 amino acid (residue) positions, and the SPT5 protein contains an SPT5 N-terminal domain (SPT5 NTD) at amino acid positions 147 to 217 of SEQ ID NO: 2, a NusG superfamily N-terminal domain (NGN) at amino acid positions 224 to 313 of SEQ ID NO: 2, and an SPT5 C-terminal domain (SPT5 CTD) at amino acid positions 856 to 934 of SEQ ID NO: 2.
[0136] Thus, in certain other aspects, a naturally occurring SPT5 protein of the present disclosure comprises an SPT5 NTD comprising at least about 80% identity to SEQ ID NO:5 (see, e.g., Figure 2B, SEQ ID NO:5). In other embodiments, an SPT5 protein comprises an NGN domain comprising at least about 80% identity to SEQ ID NO:6 (see, e.g., Figure 2B, SEQ ID NO:6). In another embodiment, an SPT5 protein comprises an SPT5 CTD comprising at least about 80% identity to SEQ ID NO:7 (see, e.g., Figure 2B, SEQ ID NO:7).
[0137] In one or more other embodiments or aspects, the present disclosure provides recombinant fungal cells comprising a genetic modification that renders the fungal cell deficient in expression of a native SPT5 protein. In certain embodiments or aspects, those skilled in the art can refer to one or more figures (drawings) set forth herein and / or one or more nucleic acid (DNA) sequences described herein and / or one or more protein (amino acid) sequences of the present disclosure. In certain other embodiments or aspects, those skilled in the art can refer to Figures 1 and / or 2 of the present disclosure, particularly to such relevant native and variant SPT5 protein (amino acid) sequences described herein. In certain other embodiments or aspects, a wild-type (WT) T. reesei SPT5 gene encoding a native SPT5 protein comprises substantial sequence identity to the native SPT5 protein of SEQ ID NO:2. In other embodiments or aspects, a WT SPT5 gene comprises substantial sequence identity to the WT SPT5 gene of SEQ ID NO:1. In certain other embodiments or aspects, the WT SPT5 gene comprises a genetic modification in a portion of the SPT5 gene CDS encoding one or more naturally occurring SPT5 protein domains selected from the SPT5 NTD, the SPT5 NGN superfamily domain, and the SPT5 CTD, or a portion of the SPT5 gene CDS interposed between one or more naturally occurring SPT5 protein domains (i.e., the SPT5 NTD, the SPT5 NGN, and the SPT5 CTD), or a portion of the upstream (5') SPT5 gene regulatory sequence and / or a portion of the downstream (3') SPT5 gene regulatory sequence, etc. As shown and described in the Examples below, such genetically modified filamentous fungal cells deficient in expression / production of the naturally occurring SPT5 protein are particularly useful for enhancing production of a protein of interest at high fermentation temperatures.
[0138] Based on the foregoing, the following sections further describe, inter alia, molecular biology techniques and processes for constructing / making filamentous fungal cells deficient in the expression / production of native (functional) SPT5 protein; molecular biology techniques and processes for constructing recombinant (modified) filamentous fungal cells that express / produce one or more lignocellulolytic enzymes; molecular biology techniques and processes for constructing recombinant (modified) filamentous fungal cells that express / produce one or more heterologous proteins of interest; heterologous and / or endogenous proteins of interest suitable for expression / production in the filamentous fungal cells of the present disclosure; compositions, methods, and techniques for growing / fermenting / culturing filamentous fungal cells for the production / expression / secretion of one or more heterologous and / or endogenous proteins of interest; methods and techniques for detecting, assaying, quantifying, etc. one or more proteins, heterologous and / or endogenous proteins of interest;
[0139] III.Molecular biology As generally set forth above, certain embodiments of the present disclosure relate to modified filamentous fungal cells comprising a phenotype that enhances protein productivity. In certain embodiments, the modified (variant) filamentous fungal cells comprise a phenotype that enhances protein productivity at elevated fermentation (cultivation) temperatures. In certain other embodiments or aspects of the present disclosure, the modified filamentous fungal cells comprise a genetic modification that renders the fungal cell deficient in the production of native SPT5 protein. Thus, certain embodiments relate to molecular biology, genetic modifications, polynucleotides, genes, ORFs, gene coding sequence (CDS) sequences, vectors, expression cassettes, and the like. In certain other embodiments, the present disclosure relates to recombinant nucleic acids (polynucleotides, expression cassettes, etc.) comprising genes or gene CDSs or ORFs encoding one or more proteins of interest. In certain embodiments, polynucleotides of the present disclosure comprise one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, alsl, amdS, hygR, pyr2, pyr4, pyrG, sucA, bleomycin resistance markers, blasticidin resistance markers, pyrithiamine resistance markers, chlorimuron ethyl resistance markers, neomycin resistance markers, adenine pathway genes, tryptophan pathway genes, and thymidine kinase markers. In a particular embodiment, the selectable marker is pyr2, the compositions and methods of use of which are generally set forth in WO 2011 / 153449.
[0140] In other embodiments or aspects of the present disclosure, the filamentous fungal cell comprises a genetic modification that renders the fungal cell deficient in the production of a native SPT5 protein. In certain embodiments or aspects, and as discussed further below, such genetic modifications include, but are not limited to, the introduction, substitution, or removal of one or more nucleotides in the SPT5 gene or its SPT5 gene CDS, or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the SPT5 gene (or its SPT5 gene CDS), SPT5 gene disruption of a gene encoding an SPT5 protein, SPT5 gene conversion, SPT5 gene deletion, SPT5 gene downregulation, directed SPT5 mutagenesis, and / or random SPT5 mutagenesis.
[0141] Standard techniques for transforming filamentous fungi and culturing fungi, well known to those skilled in the art, are used to transform the fungal host cells of the present disclosure. Thus, introduction of a DNA construct or vector into a fungal host cell includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection-mediated and DEAE-dextrin-mediated transfection), incubation with calcium phosphate DNA precipitates, high-velocity gun, biolistic or biolistic transformation with DNA-coated microprojectiles, and protoplast fusion. General transformation techniques are known in the art. Expression of heterologous proteins in Trichoderma is described, for example, in U.S. Pat. Nos. 6,022,725 and 6,268,328. For transformation of Aspergillus strains, see also Cao et al. (2000).
[0142] Generally, transformation of Trichoderma species is typically performed within 10 5 ~10 7 cells / mL, especially 2 × 10 6Permeabilized protoplasts or cells are used at a density of 100 μL / mL. A volume of 100 μL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) is mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives such as dimethyl sulfoxide, heparin, spermidine, and potassium chloride may also be added to the uptake solution to facilitate transformation. Similar procedures are available for other fungal host cells (e.g., U.S. Pat. Nos. 6,022,725 and 6,268,328, both incorporated by reference).
[0143] Thus, the methods and compositions of the present disclosure generally rely on routine techniques in the field of recombinant genetics. For example, in certain embodiments, a heterologous gene or ORF encoding a protein of interest is introduced into a filamentous fungal (host) cell. In certain embodiments, the heterologous gene or ORF is typically cloned into an intermediate vector before being transformed into the filamentous fungal (host) cell for replication and / or expression. These intermediate vectors may be prokaryotic vectors, such as plasmids or shuttle vectors. In certain embodiments, expression of the heterologous gene or ORF is under the control of its native promoter. In other embodiments, expression of the heterologous gene or ORF is placed under the control of a heterologous promoter, which may be a heterologous constitutive promoter or a heterologous inducible promoter.
[0144] Those skilled in the art know that a native (natural) promoter can be modified by replacing, substituting, adding, or removing one or more nucleotides without altering its function, and the practice of the present invention encompasses, but does not mandate, such changes to promoters.
[0145] Expression vectors typically contain a transcription unit or "expression cassette" that contains all additional elements required for expression of a heterologous sequence. For example, a typical expression cassette contains a 5' promoter operably linked to a heterologous nucleic acid sequence encoding a protein of interest, and may further include sequence signals necessary for efficient polyadenylation of the transcript, a ribosome binding site, and a translation termination sequence. Additional elements of the cassette may include an enhancer and, if genomic DNA is used as the structural gene, an intron with functional splice donor and acceptor sites.
[0146] In addition to a promoter sequence, the expression cassette may also contain a transcription termination region downstream of the structural gene to provide efficient termination. The termination region may be obtained from the same gene as the promoter sequence or from a different gene. While any fungal terminator is likely to be functional in the present invention, preferred terminators include those derived from the Trichoderma cbhI gene, the Aspergillus nidulans trpC gene, and the Aspergillus awamori or Aspergillus niger glucoamylase gene.
[0147] The particular expression vector used to transport genetic information into cells is not particularly critical. Any conventional vector used for expression in eukaryotic or prokaryotic cells can be used. Standard bacterial expression vectors include bacteriophage λ and M13, as well as plasmids such as pBR322-based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags, such as c-myc, can also be added to recombinant proteins to provide convenient isolation methods.
[0148] Elements that can also be included in an expression vector include a replicon, a gene encoding antibiotic resistance to allow for selection of bacteria harboring the recombinant plasmid, or a unique restriction site in a non-essential region of the plasmid to allow for the insertion of heterologous sequences. The particular antibiotic resistance gene chosen is not critical, as any of the many resistance genes known in the art may be suitable. Prokaryotic sequences are preferably selected so as not to interfere with DNA replication or integration in the fungal host.
[0149] The transformation methods of the present invention can result in stable integration of all or part of the transformation vector into the filamentous fungal genome. However, transformation resulting in the maintenance of a self-replicating extrachromosomal transformation vector is also contemplated. Many standard transfection methods can be used to generate Trichoderma reesei cell lines expressing large amounts of heterologous proteins, and any known procedure for introducing foreign nucleotide sequences into fungal host cells can be used. These include calcium phosphate transfection, polybrene transfection, protoplast fusion, electroporation, biolistics, liposome transfection, microinjection, plasma vectors, viral vectors, and any other known method for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into host cells. Agrobacterium-mediated transfection, as described in U.S. Patent No. 6,255,115, is also useful.
[0150] After the expression vector is introduced into the cells, the transformed cells are cultured under conditions favorable for gene expression. Large batches of transformed cells can be cultured as described herein. Finally, the protein product is recovered from the culture using standard techniques. Thus, the disclosure herein provides for enhanced expression and production of a desired protein of interest, particularly at the high fermentation (cultivation) temperatures described herein.
[0151] In certain other embodiments, the present disclosure relates to genetically modified filamentous fungal strains (cells) comprising a phenotype of enhanced protein productivity. In certain embodiments, the modified fungal strains of the present disclosure comprise a phenotype of enhanced protein productivity at high fermentation temperatures. For example, in certain embodiments, a variant strain of filamentous fungus comprises a genetic modification of the gene encoding the SPT5 protein, including, but not limited to, (a) introduction, substitution, or removal of one or more nucleotides in the SPT5 gene (or its ORF), or introduction, substitution, or removal of one or more nucleotides in a regulatory element required for transcription or translation of the SPT5 gene (or its ORF), (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) gene downregulation, (f) directed mutagenesis, and / or (g) random mutagenesis of the gene encoding the SPT5 protein (e.g., SEQ ID NO: 2).
[0152] Thus, in certain embodiments, a variant strain of filamentous fungus containing a genetic modification is constructed by gene deletion that eliminates expression / production of the SPT5 protein (i.e., rendering the cell deficient in expression of the native SPT5 protein).
[0153] In another embodiment, a variant strain of filamentous fungi containing a genetic modification is constructed by partial gene deletion or gene disruption to eliminate expression / production of the native SPT5 protein. For example, as shown in the Examples below, inactivation of the wild-type SPT5 gene in a parent filamentous fungal strain resulted in a mutant strain with a phenotype of enhanced protein productivity compared to the parent cell when grown at 29°C.
[0154] Thus, in certain embodiments, the modified filamentous fungal strain comprises a partial deletion of the SPT5 gene, where the partial deletion includes partial deletion of any portion of the coding sequence of the SPT5 gene, and such variant strains comprise a phenotype of enhanced protein productivity. Thus, in certain other embodiments, such variant strains do not express / produce the SPT5 protein, or such variant strains express / produce reduced amounts of the SPT5 protein compared to the parent strain.
[0155] Thus, as generally set forth herein and described above, one skilled in the art can, with reference to one or more nucleic acid and / or protein sequences disclosed herein, readily implement one or more genetic modifications that render a filamentous fungal cell deficient in expression of a native SPT5 protein. For example, gene deletion techniques allow for partial or complete removal of a gene, thereby completely eliminating or reducing expression / production of the encoded protein (e.g., SPT5). In such methods, deletion of the gene can be achieved by homologous recombination using an integrating plasmid / vector constructed to contain adjacent 5' and 3' regions flanking the gene. The flanking 5' and 3' regions can be introduced into a filamentous fungal cell, for example, by an integrating plasmid / vector associated with a selectable marker that allows the plasmid to be integrated into the cell.
[0156] In other embodiments, the variant strain of filamentous fungus comprises a genetic modification that disrupts or inactivates a gene encoding a protein (e.g., SPT5). Exemplary methods of gene disruption / inactivation include disrupting any portion of the gene, including the gene coding sequence (CDS), promoter, enhancer, or another regulatory element, and such disruptions include substitutions, insertions, deletions, inversions, and combinations and variations thereof. Non-limiting examples of gene disruption techniques include inserting (integrating) an integrable plasmid containing a nucleic acid fragment homologous to a gene (e.g., SPT5) into one or more genes of the present disclosure, creating an overlap between the region of homology and the overlapping region of the integration (insertion) vector DNA. In certain other non-limiting examples, gene disruption techniques include inserting an integrative plasmid containing a nucleic acid fragment homologous to a gene (e.g., SPT5) into a gene (e.g., a gene encoding the SPT5 protein) to create an overlap between the region of homology and the overlapping region of the integration (insertion) vector DNA, where the inserted vector DNA separates, for example, the promoter of the SPT5 gene from the SPT5 protein-coding region or disrupts (disrupts) the coding or non-coding sequence of the SPT5 gene, resulting in a phenotype of enhanced protein production. Thus, the disruption construct can be a selectable marker gene (e.g., pyr2) accompanied by 5' and 3' regions homologous to the SPT5 gene. The selectable marker allows for identification of transformants containing the disrupted gene. Thus, in certain embodiments, gene disruption includes modifications of regulatory elements of the gene, such as the promoter, ribosome binding site (RBS), untranslated region (UTR), and codon changes.
[0157] In other embodiments, variant strains of filamentous fungi are constructed (i.e., genetically modified) by introducing, substituting, or removing one or more nucleotides within a gene or regulatory element required for transcription or translation. For example, nucleotides can be inserted or removed to introduce a premature stop codon, remove a start codon, or cause a frameshift in the open reading frame (ORF). Such modifications can be achieved by site-directed mutagenesis or PCR-generated mutagenesis according to methods known in the art.
[0158] In another embodiment, a variant strain of filamentous fungi is constructed by a gene conversion process. For example, in gene conversion, a nucleic acid sequence corresponding to a target gene is mutated in vitro to generate a defective nucleic acid sequence, which is then transformed into a parent cell to generate a variant cell containing the defective gene. The defective nucleic acid sequence replaces the endogenous gene through homologous recombination. It may be desirable for the defective gene or gene fragment to also encode a marker that can be used to select for transformants containing the defective gene. For example, the defective gene can be introduced into a non-replicating or temperature-sensitive plasmid associated with a selectable marker. Selection for plasmid integration is affected by selection for the marker under conditions that do not allow plasmid replication. Selection for a second recombination event resulting in gene replacement is affected by examining colonies for loss of the selectable marker and acquisition of the mutated gene.
[0159] In another embodiment, a variant strain of filamentous fungi is constructed using established antisense (gene silencing) technology, using a nucleotide sequence complementary to the nucleic acid sequence of the SPT5 gene. More specifically, expression of the SPT5 gene by a filamentous fungal strain can be reduced (downregulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the SPT5 gene, which is transcribed in the cell and can hybridize to the mRNA produced in the cell. Under conditions that allow the complementary antisense nucleotide sequence to hybridize to the mRNA, the amount of translated protein is thus reduced or eliminated (i.e., the modified cell lacks expression of the native SPT5 protein). Such antisense methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), and antisense oligonucleotides, all of which are well known to those skilled in the art.
[0160] In other embodiments, variant strains of filamentous fungi are constructed by random or directed mutagenesis using methods well known in the art, including, but not limited to, chemical mutagenesis and translocation. Genetic modification can be performed by subjecting parent cells to mutagenesis and screening for mutant cells in which expression of the SPT5 gene is reduced or eliminated. Mutagenesis can be directed or random, for example, using appropriate physical or chemical mutagens, using appropriate oligonucleotides, or by subjecting DNA sequences to PCR-generated mutagenesis. Furthermore, mutagenesis can be performed by using any combination of these mutagenesis methods. Examples of physical or chemical mutagens suitable for the purposes of the present invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methylhydroxylamine, nitrous acid, ethyl methanesulfonate (EMS), sodium bisulfite, formic acid, and nucleotide analogs. When such agents are used, mutagenesis is typically carried out by incubating the parent cells to be mutagenized in the presence of the mutagenizing agent of choice under appropriate conditions and selecting for mutant cells that exhibit reduced or no expression of the gene.
[0161] In certain other embodiments, the variant strain of filamentous fungi is constructed by site-specific gene editing technology. For example, in certain embodiments, the variant strain of filamentous fungi is constructed (i.e., genetically modified) by using transcription activator-like endonuclease (TALEN), zinc finger endonuclease (ZFN), homing (mega) endonuclease, etc. More specifically, the part of the gene to be modified (e.g., coding region, non-coding region, leader sequence, propeptide sequence, signal sequence, transcription terminator, transcription activator, or other regulatory element required for expressing the coding region) is subjected to genetic modification by ZFN gene editing, TALEN gene editing, homing (mega) endonuclease, etc., and these modification methods are well known and available to those skilled in the art.
[0162] In certain other embodiments, the variant strain of filamentous fungus is constructed by CRISPR / Cas9 editing (see, for example, the Examples herein). More specifically, compositions and methods for fungal genome modification using the CRISPR / Cas9 system have been described and are well known in the art (see, for example, WO 2016 / 100571, WO 2016 / 100568, WO 2016 / 100272, and WO 2016 / 100562, etc.). Thus, the gene encoding the SPT5 protein can be disrupted, deleted, mutated, or otherwise genetically modified by a nucleic acid-guided endonuclease that finds target DNA by binding either a guide RNA (e.g., Cas9) or a guide DNA (e.g., NgAgo) that recruits the endonuclease to a target sequence on the DNA, where the endonuclease can generate a single- or double-strand break in the DNA. This targeted DNA cleavage provides a substrate for DNA repair, which, combined with the provided editing template, can disrupt or delete the gene. For example, a gene encoding a nucleic acid-guided endonuclease (e.g., Cas9 from S. pyogenes, or a codon-optimized gene encoding a Cas9 nuclease) is operably linked to a promoter active in filamentous fungal cells and a terminator active in filamentous fungal cells, thereby creating a filamentous fungal Cas9 expression cassette. Similarly, one or more target sites unique to a gene of interest can be easily identified by one skilled in the art.
[0163] For example, to construct a DNA construct encoding a gRNA directed to a target site within a gene of interest, a variable targeting domain (VT) would contain the 5' (PAM) protospacer adjacent motif (TGG) nucleotides of the target site, fused to DNA encoding the Cas9 endonuclease recognition domain (CER) for S. pyogenes Cas9. Combination of the DNA encoding the VT domain with the DNA encoding the CER domain generates DNA encoding the gRNA. Thus, a filamentous fungal expression cassette for a gRNA is created by operably linking the DNA encoding the gRNA to a promoter active in filamentous fungal cells and a terminator active in filamentous fungal cells.
[0164] In certain embodiments, the DNA break induced by endonuclease is repaired / replaced by the incoming sequence.For example, a nucleotide editing template is provided so that the DNA repair mechanism of cells can use the editing template to precisely repair the DNA break generated by the above-mentioned Cas9 expression cassette and gRNA expression cassette.For example, about 500bp of the 5' target gene can be fused to about 500bp of the 3' target gene to generate an editing template, and this template is used by the mechanism of the filamentous fungal host to repair the DNA break generated by RGEN (RNA-guided endonuclease).
[0165] The Cas9 expression cassette, gRNA expression cassette, and editing template can be co-delivered into filamentous fungal cells using a variety of methods (e.g., protoplast fusion, electroporation, natural competence, or induced competence). Transformed cells are screened by PCR by amplifying the target locus with forward and reverse primers. These primers can amplify the wild-type locus or the modified locus edited by RGEN. These fragments are then sequenced using sequencing primers to identify edited colonies.
[0166] Another way in which the gene encoding the SPT5 protein of the present disclosure can be genetically modified is by altering the expression level of the gene of interest. For example, nuclease-deficient variants of such nucleotide-guided endonucleases (e.g., Cas9 D10A, N863A or Cas9 D10A, H840A) can be used to regulate the expression level of a gene by enhancing or antagonizing transcription of the target gene. These Cas9 variants are inactive for all nuclease domains present in the protein sequence but retain RNA-guided DNA-binding activity (i.e., these Cas9 variants cannot cleave either strand of DNA upon binding to their cognate target site). Thus, the nuclease-deficient proteins (i.e., Cas9 variants) can be expressed as fungal expression cassettes, and when combined with a fungal gRNA expression cassette, the Cas9 variant protein is directed to a specific target sequence within the cell. The binding of Cas9 (variant) protein to a specific gene target site can reduce the amount of gene product produced by blocking the binding or movement of the transcription machinery on the cellular DNA. Therefore, any of the genes disclosed herein can be targeted to reduce gene expression using this method. Gene silencing can be monitored in cells containing nuclease-deficient Cas9 expression cassettes and gRNA expression cassettes by using methods such as RNA sequencing.
[0167] Thus, in one or more specific embodiments, the recombinant (modified) filamentous fungal cells of the present disclosure comprise a genetic modification that renders the cells deficient in expression of native SPT5 protein, such that the modified cells are at least about 5% to 100% deficient in expression of native SPT5 protein. Thus, in certain embodiments, the modified filamentous fungal cells of the present disclosure are at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to 100% deficient in expression of native SPT5 protein.
[0168] IV. Target Protein As briefly described in the preceding section, the strains and methods are used for the production of commercially important proteins in submerged culture of filamentous fungi. The protein of interest (POI) of the present disclosure can be any endogenous or heterologous protein, or a variant of such a POI. The protein may contain one or more disulfide bridges or be a protein whose functional form is monomeric or multimeric, i.e., the protein has a quaternary structure and is composed of multiple identical (homologous) or non-identical (heterologous) subunits, where the POI or variant POI is preferably a protein with a desired property.
[0169] In certain embodiments, the variant strains of filamentous fungi exhibit an increased protein titer compared to the (unmodified) parent strain, where protein titer is defined as the amount of protein per volume (g / L). For example, titer can be measured by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.). Thus, in certain embodiments, the variant strains of filamentous fungi comprise an increase in protein titer of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cell.
[0170] In certain embodiments, the variant strains of filamentous fungi exhibit increased volumetric productivity compared to the (unmodified) parent strain, where volumetric productivity is defined as the amount of protein (g) produced during fermentation per nominal volume (L) of bioreactor per total fermentation time (h). For example, volumetric productivity can be measured by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.). Thus, in certain embodiments, the variant strains of filamentous fungi comprise an increase in volumetric productivity of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cells.
[0171] In certain other embodiments, the variant strain of filamentous fungus exhibits an increased total protein yield compared to the (unmodified) parent strain, where total protein yield is defined as the amount of protein (g) produced per gram of carbohydrate fed. Thus, total protein yield (g / g) as used herein is calculated using the following formula: "Yf=Tp / Tc" can be calculated using where "Yf" is the total protein yield (g / g), "Tp" is the total protein produced during fermentation (g), and "Tc" is the total carbohydrate (g) fed during the fermentation (bioreactor) run. In certain embodiments, the increase in total protein yield of the modified strain (i.e., compared to the parent strain) is at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more increase compared to the unmodified (parent) cell.
[0172] Total protein yield can also be described as carbon conversion efficiency / carbon yield, e.g., as the percentage (%) of supplied carbon that is incorporated into total protein. Thus, in certain embodiments, a variant strain of filamentous fungus comprises an increased carbon conversion efficiency (e.g., an increased percentage (%) of supplied carbon that is incorporated into total protein) compared to the (unmodified) parent strain. In certain embodiments, the increased carbon conversion efficiency of the modified strain (i.e., compared to the parent strain) is at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10%, or more, compared to the unmodified (parent) cell.
[0173] In certain embodiments, the variant strain of filamentous fungus exhibits an increased specific productivity (Qp) of the POI compared to the (unmodified) parent strain. For example, detecting the specific productivity (Qp) is a suitable method for assessing the production rate of a protein. The specific productivity (Qp) is calculated using the following formula: "Qp = gP / gDCW·hr" can be found using where "gP" is grams of protein produced in the tank, "gDCW" is grams of dry cell weight (DCW) in the tank, and "hr" is the fermentation time (hours) from the time of inoculation, which includes production time and growth time. Thus, in certain embodiments, the variant strain of filamentous fungus comprises an increase in specific productivity (Qp) of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parental) cells.
[0174] In certain embodiments, the POI or variant POI thereof is selected from the group consisting of acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endo-β-glucanase, glucoamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glycosyl hydrolase, hemicellulase, hexose oxidase, hydrolase, and the like. The enzyme is selected from the group consisting of chlorase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin degrading enzyme, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnogalacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase, hexose oxidase, and combinations thereof.
[0175] In certain embodiments, the POI or variant POI thereof is selected from an Enzyme Commission (EC) number selected from the group consisting of EC1, EC2, EC3, EC4, EC5, or EC6.
[0176] For example, in certain embodiments, the POI may be selected from the group consisting of EC 1.10.3.2 (e.g., laccase), EC 1.10.3.3 (e.g., L-ascorbic acid oxidase), EC 1.1.1.1 (e.g., alcohol dehydrogenase), EC 1.11.1.10 (e.g., chloride peroxidase), EC 1.11.1.17 (e.g., peroxidase), EC 1.1.1.27 (e.g., L-lactate dehydrogenase), EC 1.1.1.47 (e.g., glucose 1-dehydrogenase), EC 1.1.3.X (e.g., glucose oxidase), EC 1.1.3.10 (e.g., pyranose oxidase), EC 1.13.11.X (e.g., dioxygenase), EC 1.13.11.12 (e.g., linoleic acid 13S-lipozygenase), EC 1.1.3.13 (e.g., alcohol oxidase), E and EC 1 enzymes (oxidoreductases) selected from C1.14.14.1 (e.g., monooxygenases), EC 1.14.18.1 (e.g., monophenol monooxygenases), EC 1.15.1.1 (e.g., superoxide dismutases), EC 1.1.5.9 (formerly EC 1.1.99.10, e.g., glucose dehydrogenase), EC 1.1.99.18 (e.g., cellobiose dehydrogenase), EC 1.1.99.29 (e.g., pyranose dehydrogenase), EC 1.2.1.X (e.g., fatty acid reductases), EC 1.2.1.10 (e.g., acetaldehyde dehydrogenase), EC 1.5.3.X (e.g., fructosylamine reductase), EC 1.8.1.X (e.g., disulfide reductase), and EC 1.8.3.2 (e.g., thiol oxidase).
[0177] In certain embodiments, the POI is selected from the group consisting of EC 2.3.2.13 (e.g., transglutaminase), EC 2.4.1.X (e.g., hexosyltransferase), EC 2.4.1.40 (e.g., alternasucrase), EC 2.4.1.18 (e.g., 1,4 alpha-glucan branching enzyme), EC 2.4.1.19 (e.g., cyclomaltodextrin glucanotransferase), EC 2.4.1.2 (e.g., dextrin dextranase), EC 2.4.1.20 (e.g., cellobiose phosphorylase), EC 2.4.1.25 (e.g., 4-alpha-glucanotransferase), EC 2.4.1.333 (e.g., 1,2-beta-oligoglucan lintranase). transferase enzymes, including, but not limited to, EC2 (transferase) enzymes selected from EC 2.4.1.4 (e.g., amylosucrase), EC 2.4.1.5 (e.g., dextransucrase), EC 2.4.1.69 (e.g., galactoside 2-alpha-L-fucosyltransferase), EC 2.4.1.9 (e.g., inulosucrase), EC 2.7.1.17 (e.g., xylulokinase), EC 2.7.7.89 (formerly EC 3.1.4.15, e.g., [glutamine synthetase]-adenylyl-L-tyrosine phosphorylase), EC 2.7.9.4 (e.g., alpha-glucan kinase), and EC 2.7.9.5 (e.g., phosphoglucan kinase).
[0178] In other embodiments, the POI is selected from the group consisting of EC 3.1.XX (e.g., esterases), EC 3.1.1.1 (e.g., pectinases), EC 3.1.1.14 (e.g., chlorophyllases), EC 3.1.1.20 (e.g., tannases), EC 3.1.1.23 (e.g., glycerol ester acyl hydrolases), EC 3.1.1.26 (e.g., galactolipases), EC 3.1.1.32 (e.g., phospholipase A1), EC 3.1.1.4 (e.g., phospholipase A2), EC 3.1.1.6 (e.g., acetyl esterases), EC 3.1.1.72 (e.g., acetylxylases), EC 3.1.1.82 (e.g., acetyl esterases), EC 3.1.1.92 (e.g., acetyl xylases), EC 3.1.1.102 (e.g., acetyl xylases), EC 3.1.1.112 (e.g., acetyl xylases), EC 3.1.1.132 (e.g., phospholipase A1), EC 3.1.1.14 (e.g., phospholipase A2), EC 3.1.1.152 (e.g., acetyl esterases), EC 3.1.1.162 (e.g., acetyl xylases), EC 3.1.1.172 (e.g., acetyl xylases), EC 3.1.1.182 (e.g., acetyl xylases), EC 3.1.1.192 (e esterase), EC 3.1.1.73 (e.g., feruloyl esterase), EC 3.1.1.74 (e.g., cutinase), EC 3.1.1.86 (e.g., rhamnogalacturonan acetylesterase), EC 3.1.1.87 (e.g., fumosin B1 esterase), EC 3.1.26.5 (e.g., ribonuclease P), EC 3.1.3.X (e.g., phosphate monoester hydrolase), EC 3.1.30.1 (e.g., Aspergillus nuclease S1), EC 3.1.30.2 (e.g., Serratia marcescens marcescens nuclease), EC 3.1.3.1 (e.g., alkaline phosphatase), EC 3.1.3.2 (e.g., acid phosphatase), EC 3.1.3.8 (e.g., 3-phytase), EC 3.1.4.1 (e.g., phosphodiesterase I), EC 3.1.4.11 (e.g., phosphoinositide phospholipase C), EC 3.1.4.3 (e.g., phospholipase C), EC 3.1.4.4 (e.g., phospholipase D), EC 3.1.6.1 (e.g., arylsufatase), EC 3.1.8. 2 (e.g., diisopropyl-fluorophosphatase), EC 3.2.1.10 (e.g., oligo-1,6-glucosidase), EC 3.2.1.101 (e.g., mannan endo-1,6-alpha-mannosidase), EC 3.2.1.11 (e.g., alpha-1,6-glucan-6-glucanohydrolase), EC 3.2.1.131 (e.g., xylan alpha-1,2-glucuronosidase), EC 3.2.1.132 (e.g., chitosan N-acetylglucosaminohydrolase), EC 3.2.1.139 (e.g., alpha-glucuronidase), EC 3.2.1.14 (e.g., chitinase), EC 3.2.1.151 (e.g., xyloglucan-specific endo-beta-1,4-glucanase), EC 3.2.1.155 (e.g., xyloglucan-specific exo-beta-1,4-glucanase), EC 3.2.1.164 (e.g., galactan endo-1,6-beta-galactosidase), EC 3.2.1.17 (e.g., lysozyme), EC 3.2.1.171 (e.g., rhamnogalacturonan hydrolase), EC 3.2.1.174 (e.g., rhamnogalacturonan rhamnohydrolase), EC 3.2.1.2 (e.g., beta-amylase), EC 3.2.1.20 (e.g., alpha-glucosidase), EC 3.2.1.22 (e.g., alpha-galactosidase), EC. EC 3.2.1.25 (e.g. beta-mannosidases), EC 3.2.1.26 (e.g. beta-fructofuranosidases), EC 3.2.1.37 (e.g. xylan 1,4-beta-xylosidases), EC 3.2.1.39 (e.g. glucan endo-1,3-beta-D-glucosidases), EC 3.2.1.40 (e.g. alpha-L-rhamnosidases), EC 3.2.1.51 (e.g. alpha-L-fucosidases), EC 3.2.1.52 (e.g. beta-N-acetylhexosaminidases), EC 3.2.1.55 (e.g. alpha-N-ara binofuranosidases), EC 3.2.1.58 (e.g. glucan 1,3-beta-glucosidases), EC 3.2.1.59 (e.g. glucan endo-1,3-alpha-glucosidases), EC 3.2.1.67 (e.g. galacturan 1,4-alpha-galacturonidases), EC 3.2.1.68 (e.g. isoamylases), EC 3.2.1.7 (e.g. 1-beta-D-fructan fructanohydrolases), EC 3.2.1.74 (e.g. glucan 1,4-beta-glucosidases), EC 3.2.1.75 (e.g. glucan endo-1,6-beta -glucosidase), EC 3.2.1.77 (e.g., mannan 1,2-(1,3)-alpha-mannosidase), EC 3.2.1.80 (e.g., fructan beta-fructosidase), EC 3.2.1.82 (e.g., exo-poly-alpha-galacturonosidase), EC 3.2.1.83 (e.g., kappa-carrageenase), EC 3.2.1.89 (e.g., arabinogalactan endo-1,4-beta-galactosidase), EC 3.2.1.91 (e.g., cellulose 1,4-beta-cellobiosidase), EC 3.2.1.96 (e.g., mannosidase), L-glycoprotein endo-beta-N-acetylglucosaminidase), EC 3.2.1.99 (e.g., arabinan endo-1,5-alpha-L-arabinanase), EC 3.4.XX (e.g., peptidases), EC 3.4.11.X (e.g., aminopeptidases), EC 3.4.11.1 (e.g., leucyl aminopeptidase), EC 3.4.11.18 (e.g., methionyl aminopeptidase), EC 3.4.13.9 (e.g., Xaa-Pro dipeptidase), EC 3.4.14.5 (e.g., dipeptidyl-peptidase IV), EC 3.4.16.X (e.g., serine-type carboxypeptidases), EC 3.4.16.5 (e.g., carboxypeptidase C), EC 3.4.19.3 (e.g., pyroglutamyl-peptidase I), EC 3.4.21.X (e.g., serine endopeptidases), EC 3.4.21.1 (e.g., chymotrypsin), EC 3.4.21.19 (e.g., glutamyl endopeptidases), EC 3.4.21.26 (e.g., prolyl oligopeptidases), EC 3.4.21.4 (e.g., trypsin), EC 3.4.21.5 (e.g., thrombin), EC 3.4.21.63 (e.g., oryzen), EC 3.4.21.65 (e.g., thermomycoline), EC 3.4.21.80 (e.g., streptoglycin A), EC 3.4.22.X (e.g., cysteine endopeptidase), EC 3.4.22.14 (e.g., actinidain), EC 3.4.22.2 (e.g., papain), EC 3.4.22.3 (e.g., ficain), EC 3.4.22.32 (e.g., stem bromelain), EC 3.4.22.33 (e.g., fruit bromelain), EC 3.4.22.6 (e.g., chymopapain), EC 3. EC 3.4.23.1 (e.g., pepsin A), EC 3.4.23.2 (e.g., pepsin B), EC 3.4.23.22 (e.g., endothiapepsin), EC 3.4.23.23 (e.g., Mucor pepsin), EC 3.4.23.3 (e.g., gastricsin), EC 3.4.24.X (e.g., metalloendopeptidases), EC 3.4.24.39 (e.g., deuterolysin), EC 3.4.24.40 (e.g., serralysin), EC 3.5.1.1 (e.g., asparaginase), EC 3.5.1.11 (e.g., penicillin amidase), EC 3.5.1.1 4 (e.g., N-acyl-aliphatic-L-amino acid amidohydrolase), EC 3.5.1.2 (e.g., L-glutamine amidohydrolase), EC 3.5.1.28 (e.g., N-acetylmuramoyl-L-alanine amidase), EC 3.5.1.4 (e.g., amidase), EC 3.5.1.44 (e.g., protein-L-glutamine amidohydrolase), EC 3.5.1.5 (e.g., urease), EC 3.5.1.52 (e.g., peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase), EC 3.5.1.EC 3 (hydrolase) enzymes selected from EC 3.5.81 (e.g., N-acyl-D-amino acid deacylases), EC 3.5.4.6 (e.g., AMP deaminases), and EC 3.5.5.1 (e.g., nitrilases).
[0179] In other embodiments, the POI is a lyase enzyme, including but not limited to, an EC4 (lyase) enzyme selected from EC 4.1.2.10 (e.g., mandelonitrile lyase), EC 4.1.3.3 (e.g., N-acetylneuraminic acid lyase), EC 4.2.1.1 (e.g., carbonic anhydrase), EC 4.2.2.- (e.g., rhamnogalacturonan lyase), EC 4.2.2.10 (e.g., pectin lyase), EC 4.2.2.22 (e.g., pectate trisaccharide lyase), EC 4.2.2.23 (e.g., rhamnogalacturonan endolyase), and EC 4.2.2.3 (e.g., mannuronic acid-specific alginate lyase).
[0180] In certain other embodiments, the POI is an isomerase enzyme, including, but not limited to, an EC5 (isomerase) enzyme selected from EC 5.1.3.3 (e.g., aldose 1-epimerase), EC 5.1.3.30 (e.g., D-psicose 3-epimerase), EC 5.4.99.11 (e.g., isomaltulose synthase), and EC 5.4.99.15 (e.g., (1→4)-α-D-glucan 1-α-D-glucosylmutase).
[0181] In yet other embodiments, the POI is a ligase enzyme, including but not limited to, an EC6 (ligase) enzyme selected from EC 6.2.1.12 (e.g., 4-coumarate:coenzyme A ligase) and EC 6.3.2.28 (e.g., L-amino acid alpha-ligase).
[0182] V. Fermentation In certain embodiments, the present disclosure provides a method for producing a protein of interest, comprising growing / cultivating / fermenting filamentous fungal cells, wherein the fungal cells secrete the protein of interest. Generally, fermentation methods known in the art are used to ferment the fungal cells. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions. Classical batch fermentation is a closed system in which the composition of the medium is set at the beginning of the fermentation and remains unchanged during the fermentation. At the start of the fermentation, the medium is inoculated with the desired organism. In this method, fermentation occurs without adding any components to the system. Typically, batch fermentation is considered "batch" with respect to the addition of a carbon source, and factors such as pH and oxygen concentration are often controlled. The composition of metabolites and biomass in a batch system changes constantly until the fermentation is stopped. Within a batch culture, cells progress through a static lag phase, a high-growth logarithmic phase, and eventually a stationary phase, where growth rate slows or stops. If untreated, cells in the stationary phase eventually die. Generally, cells in the logarithmic phase are responsible for the majority of product production.
[0183] A suitable variation of the standard batch system is the "fed-batch fermentation" system. In this variation of the typical batch system, substrate is added gradually as the fermentation progresses. Fed-batch systems are useful when catabolite repression is likely to inhibit cellular metabolism and when a limited amount of substrate is desired in the medium. In fed-batch systems, the actual substrate concentration is difficult to measure and is therefore estimated based on changes in measurable factors such as pH, dissolved oxygen, and the partial pressure of waste gases such as CO2. Batch and fed-batch fermentation are common and well known in the art.
[0184] Continuous fermentation is an open system in which a defined fermentation medium is continuously added to a bioreactor and an equal amount of conditioned medium is simultaneously removed for processing. Continuous fermentation generally maintains the culture at a constant high density, with cells primarily in logarithmic growth phase. Continuous fermentation allows for the adjustment of one or more factors that affect cell growth and / or product concentration. For example, in one embodiment, a limiting nutrient, such as a carbon or nitrogen source, can be maintained at a fixed ratio while all other parameters are adjusted. In other systems, several factors that affect growth can be continuously varied while the cell concentration, as measured by medium turbidity, remains constant. Continuous systems attempt to maintain steady-state growth conditions. Therefore, cell loss due to medium removal must be balanced against the cell growth rate during fermentation. Methods for adjusting nutrients and growth factors for continuous fermentation processes and techniques for maximizing product formation rates are well known in the art of industrial microbiology.
[0185] Certain embodiments of the present disclosure relate to fermentation procedures for culturing fungi. Fermentation procedures for the production of cellulase enzymes are known in the art. For example, cellulase enzymes can be produced by solid-state or submerged cultivation, including batch, fed-batch, and continuous-flow processes. Cultivation is generally accomplished in a growth medium containing an aqueous inorganic salts medium, organic growth factors, carbon and energy source substances, molecular oxygen, and, of course, starting inoculum of the filamentous fungal host to be used.
[0186] To ensure proper microbial growth, maximize assimilation of carbon and energy sources by the cells in the microbial conversion process, and achieve maximum cell yield at maximum cell density in the fermentation medium, it is essential to supply appropriate amounts of inorganic nutrients in the proper proportions in addition to the carbon and energy sources, oxygen, assimilable nitrogen, and microbial inoculant.
[0187] The composition of the aqueous mineral medium can vary over a wide range, depending in part on the microorganism and substrate used, as is known in the art. In addition to nitrogen, the mineral medium will contain appropriate amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium in suitable soluble, absorbable, ionic, complex forms, and preferably also certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, again in suitable soluble, assimilable forms, all of which are known in the art.
[0188] Fermentation reactions are aerobic processes in which the necessary molecular oxygen is supplied by a molecular oxygen-containing gas, such as air, oxygen-enriched air, or even substantially pure molecular oxygen, provided to maintain the contents of the fermentor at an appropriate oxygen partial pressure effective to support vigorous growth of the microbial species.
[0189] Microorganisms also require an assimilable nitrogen source. The assimilable nitrogen source can be any nitrogen-containing compound or a compound capable of releasing nitrogen in a form suitable for metabolic utilization by the microorganism. While various organic nitrogen source compounds, such as protein hydrolysates, can be used, typically inexpensive nitrogen-containing compounds such as ammonia, ammonium hydroxide, urea, and various ammonium salts, e.g., ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or various other ammonium compounds, are utilized. Ammonia gas itself is convenient for large-scale operations and can be used by bubbling an appropriate amount through the aqueous fermentation product (fermentation medium). At the same time, such ammonia can also be used to aid in pH control.
[0190] The pH range of the aqueous microbial fermentation (fermentation mixture) should be within an exemplary range of about 2.0 to 8.0. For filamentous fungi, the pH is typically within the range of about 2.5 to 8.0; for Trichoderma reesei, the pH is typically within the range of about 3.0 to 7.0. The preferred pH range for a microorganism depends to some extent on the medium and the particular microorganism used, and will vary somewhat with changes in the medium, as can be readily determined by one of ordinary skill in the art.
[0191] It is preferable to carry out the fermentation in such a way that the carbon-containing substrate can be controlled as the limiting factor, thereby achieving good conversion of the carbon-containing substrate to the cells and avoiding contamination of the cells with significant amounts of unconverted substrate. The latter is not a problem with water-soluble substrates, as any remaining traces can be easily washed away. However, this can be a problem with water-insoluble substrates, necessitating additional product processing steps, such as appropriate washing steps.
[0192] As noted above, the time to reach this level is not critical and may vary depending on the particular microorganism and fermentation process being performed, however, methods for determining the carbon source concentration in a fermentation medium and determining whether the desired carbon source level has been achieved are well known in the art.
[0193] Fermentation can be carried out as a batch or continuous operation, with fed-batch operation being highly preferred for ease of control, production of uniform amounts of product, and the most economical use of all equipment.
[0194] If necessary, some or all of the carbon and energy source materials and / or some of the assimilable nitrogen source, such as ammonia, can be added to the aqueous mineral medium before it is fed to the fermenter.
[0195] Each of the streams introduced into the reactor is preferably controlled at a predetermined rate or according to need, which can be determined by monitoring the concentrations of carbon and energy substrates, pH, dissolved oxygen, oxygen or carbon dioxide in the off-gas from the fermentor, cell density as measured by dry cell weight, or light transmittance, etc. The feed rates of the various materials can be varied to obtain the fastest possible cell growth rate and the highest possible yield of microbial cells relative to the substrate feed, consistent with efficient utilization of the carbon and energy sources.
[0196] In a batch or, preferably, fed-batch operation, all equipment, reactors, or fermentation means, tanks, or vessels, piping systems, and associated circulation or cooling equipment, etc., are first sterilized, typically using steam, e.g., at about 121°C for at least about 15 minutes. The sterilized reactor is then inoculated with a culture of the selected microorganism in the presence of all necessary nutrients, including oxygen, and a carbon-containing substrate. The type of fermentor used is not critical.
[0197] Collection and purification of the protein from the fermentation broth can also be carried out by procedures known to those skilled in the art. The fermentation broth generally contains cellular debris, including cells, various suspended solids and other biomass contaminants, and the desired cellulase enzyme product, which are preferably removed from the fermentation broth by means known in the art.
[0198] Suitable processes for such removal include conventional solid-liquid separation techniques such as, for example, centrifugation, filtration, dialysis, microfiltration, rotary vacuum filtration, or other known processes to produce a cell-free filtrate. Prior to crystallization, it may be preferable to further concentrate the fermentation broth or cell-free filtrate using techniques such as ultrafiltration, evaporation, or precipitation.
[0199] Precipitation of the protein components of the supernatant or filtrate can be achieved with a salt, such as ammonium sulfate, followed by purification by various chromatographic procedures, such as ion exchange chromatography, affinity chromatography, or similar art-recognized procedures.
[0200] VI. Illustrative Embodiments Non-limiting embodiments of the present disclosure include, but are not limited to:
[0201] 1. A recombinant (modified) filamentous fungal cell derived from a parent filamentous fungal cell containing the gene encoding the native SPT5 protein, the recombinant cell containing a genetic modification that renders the cell deficient in expression / production of the native SPT5 protein.
[0202] 2. The recombinant cell of embodiment 1, wherein the parent cell expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.
[0203] 3. The recombinant cell of embodiment 1, comprising a phenotype of enhanced protein productivity compared to the parent cell when cultured under the same conditions at a temperature of about 25°C to 29°C.
[0204] 4. The recombinant cell of embodiment 1, wherein the gene encoding the native SPT5 protein comprises at least 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO:1.
[0205] 5. The recombinant nucleic acid of embodiment 1, wherein the native SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO:2.
[0206] 6. The recombinant cell of embodiment 1, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of an SPT5 N-terminal domain (NTD) comprising at least 80% identity to SEQ ID NO:5, a NusG superfamily (NGN) domain comprising at least 80% identity to SEQ ID NO:6, and an SPT5 C-terminal domain (CTD) comprising at least 80% identity to SEQ ID NO:7.
[0207] 7. The recombinant cell of embodiment 3, wherein the phenotype of enhanced protein productivity is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.
[0208] 8. The recombinant cell of embodiment 3, comprising a phenotype of enhanced protein productivity compared to the parent cell when fermented under the same conditions at 26°C.
[0209] 9. The recombinant cell of embodiment 3, comprising a phenotype of enhanced protein productivity compared to the parent cell when fermented under the same conditions at 27°C.
[0210] 10. The recombinant cell of embodiment 3, comprising a phenotype of enhanced protein productivity compared to the parent cell when fermented under the same conditions at 28°C.
[0211] 11. The recombinant cell of embodiment 3, comprising a phenotype of enhanced protein productivity compared to the parent cell when fermented under the same conditions at 29°C.
[0212] 12. The recombinant cell of embodiment 1, wherein the recombinant cell and the parent cell contain one or more introduced expression cassettes encoding one or more heterologous proteins of interest.
[0213] 13. The recombinant cell of embodiment 12, wherein the one or more expression cassettes encode heterologous proteins selected from the group consisting of enzymes, peptides, antibodies, receptors, growth factors, and hormones.
[0214] 14. The recombinant cell of embodiment 13, wherein the enzyme is selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases.
[0215] 15. The recombinant cell of embodiment 2, wherein the recombinant cell expresses one or more lignocellulolytic enzymes.
[0216] 16. The recombinant cell of embodiment 12, comprising one or more introduced expression cassettes encoding one or more lignocellulolytic enzymes.
[0217] 17. The recombinant cell of embodiment 15 or embodiment 16, wherein the one or more lignocellulolytic enzymes are selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases.
[0218] 18. The recombinant cell of embodiment 1, further comprising a genetic modification that renders the cell deficient in the production of a native GEF1 protein.
[0219] 19. The recombinant cell of embodiment 1, wherein the genetic modification that renders the cell deficient in expression / production of native SPT5 protein comprises a complete or partial deletion of the wild-type SPT5 gene coding sequence (CDS) and / or a complete or partial deletion of the upstream (5') wild-type SPT5 gene promoter.
[0220] 20. The recombinant cell of embodiment 19, wherein the partial deletion of the wild-type (WT) SPT5 gene CDS comprises a deletion of at least 9 to about 100 contiguous nucleotides of the WT SPT5 gene CDS and / or a deletion of at least 9 contiguous nucleotides of the upstream WT SPT5 gene promoter.
[0221] 21. The recombinant cell of embodiment 20, wherein the partial deletion of the WT SPT5 gene CDS comprises a deletion of at least 9 consecutive nucleotides encoding an SPT5 N-terminal domain (NTD) comprising identity to a native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides encoding an SPT5 NusG domain (NGN) comprising identity to a native SPT5 NGN of SEQ ID NO: 6, a deletion of at least 9 consecutive nucleotides encoding an SPT5 C-terminal domain (CTD) comprising identity to a native SPT5 NTD of SEQ ID NO: 7, a deletion of at least 9 consecutive nucleotides preceding or following the nucleotides encoding the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides preceding or following the nucleotides encoding the native SPT5 NGN of SEQ ID NO: 6, and / or a deletion of at least 9 consecutive nucleotides preceding or following the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.
[0222] 22. The recombinant cell of embodiment 1, wherein the genetic modification that renders the cell deficient in expression / production of native SPT5 protein comprises disruption of the wild-type (WT) SPT5 gene coding sequence (CDS) and / or the upstream (5') WT SPT5 gene promoter.
[0223] 23. The recombinant cell of embodiment 22, wherein the disruption of the WT SPT5 gene CDS comprises a disruption of the SPT5 N-terminal domain (NTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 5, a disruption of the SPT5 NusG domain (NGN) comprising identity to the native SPT5 NGN of SEQ ID NO: 6, a disruption of the SPT5 C-terminal domain (CTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 7, a disruption of a nucleotide position preceding or following the nucleotide encoding the native SPT5 NTD, a disruption of a nucleotide position preceding or following the nucleotide encoding the native NGN of SEQ ID NO: 6, and / or a disruption of a nucleotide position preceding or following the nucleotide encoding the native SPT5 CTD of SEQ ID NO: 7.
[0224] 24. The recombinant cell of embodiment 1, wherein the genetic modification that renders the cell deficient in expression / production of native SPT5 protein comprises an antisense (gene-silencing) nucleotide sequence complementary to a nucleic acid sequence encoding the native wild-type SPT5 gene coding sequence (CDS).
[0225] 25. A mutant Trichoderma reesei cell containing a variant SPT5 gene having a single nucleotide polymorphism (SNP) mutation from guanine (G) to adenine (A) within the SPT5 gene coding sequence (CDS) at nucleotide position 2,790 of SEQ ID NO:3.
[0226] 26. The mutant cell of embodiment 25, wherein the variant SPT5 gene encodes a truncated SPT5 protein comprising at least about 90-100% identity to SEQ ID NO:4.
[0227] 27. The mutant cell of embodiment 25, which expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.
[0228] 28. A mutant cell of embodiment 25, comprising a phenotype of enhanced protein productivity compared to a control T. reesei cell comprising a wild-type SPT5 gene CDS, expressing one or more of the same endogenous proteins of interest, and / or expressing one or more of the same heterologous proteins of interest, wherein the mutant and control cells are fermented under the same conditions at a temperature of about 25°C to 29°C.
[0229] 29. An isolated variant SPT5 gene comprising at least 90% to 100% identity to SEQ ID NO:3 and comprising a G to A SNP mutation at nucleotide position 2,790 of SEQ ID NO:3.
[0230] 30. An isolated polynucleotide encoding a variant SPT5 protein comprising at least 90% to 100% sequence identity to a C-terminally truncated SPT5 protein of SEQ ID NO:4.
[0231] 31. A method for producing increased amounts of lignocellulolytic enzymes in modified filamentous fungal cells, comprising: (a) obtaining a parent filamentous fungal cell having a gene encoding a native SPT5 protein, and genetically modifying the parent cell to obtain a modified filamentous fungal cell that is deficient in the expression / production of the native SPT5 protein; and (b) fermenting the modified cell under conditions suitable for the production of lignocellulolytic enzymes, wherein the modified cell produces increased amounts of lignocellulolytic enzymes compared to the parent cell when fermented under the same conditions at a temperature of about 25°C to 29°C.
[0232] 32. A method for producing increased amounts of a heterologous protein of interest (POI) in a modified filamentous fungal cell, comprising: (a) obtaining a parent filamentous fungal cell having a gene encoding a native SPT5 protein; genetically modifying the parent cell to obtain a modified filamentous fungal cell that is deficient in expression / production of the native SPT5 protein; and introducing an expression cassette encoding the POI into the parent cell before, during, or after rendering the cell deficient in production of the native SPT5 protein; and (b) fermenting the modified cell under conditions suitable for production of the heterologous POI, wherein the modified cell produces increased amounts of the POI compared to the parent cell when fermented under the same conditions at a temperature of about 25°C to 29°C.
[0233] 33. The method of embodiment 31 or 32, wherein the gene encoding the native SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO:1.
[0234] 34. The method of embodiment 31 or 32, wherein the naturally occurring SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO:2.
[0235] 35. The method of embodiment 31 or 32, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of an SPT5 N-terminal domain (NTD) comprising at least 80% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 80% identity to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) comprising at least 80% identity to SEQ ID NO: 7.
[0236] 36. The method of embodiment 31 or 32, wherein the cells are fermented at 26°C.
[0237] 37. The method of embodiment 31 or 32, wherein the cells are fermented at 27°C.
[0238] 38. The method of embodiment 31 or 32, wherein the cells are fermented at 28°C.
[0239] 39. The method of embodiment 31 or 32, wherein the cells are fermented at 29°C.
[0240] 40. The method of embodiment 31, wherein the one or more lignocellulolytic enzymes are selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases.
[0241] 41. The method of embodiment 32, wherein the expression cassette encodes a heterologous protein selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.
[0242] 42. The method of embodiment 41, wherein the enzyme is selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases.
[0243] 43. The method of embodiment 31 or 32, further comprising a genetic modification that renders the cell deficient in the production of native GEF1 protein.
[0244] 44. The method of embodiment 31 or 32, wherein the genetic modification that renders the cell deficient in expression / production of native SPT5 protein comprises a complete or partial deletion of the wild-type SPT5 gene coding sequence (CDS) and / or a complete or partial deletion of the upstream (5') wild-type SPT5 gene promoter.
[0245] 45. The method of embodiment 44, wherein the partial deletion of the wild-type (WT) SPT5 gene CDS comprises a deletion of at least 9 to about 100 consecutive nucleotides of the WT SPT5 gene CDS and / or a deletion of at least 9 consecutive nucleotides of the upstream WT SPT5 gene promoter.
[0246] 46. The method of embodiment 45, wherein the partial deletion of the WT SPT5 gene CDS comprises a deletion of at least 9 consecutive nucleotides encoding an SPT5 N-terminal domain (NTD) comprising identity to a native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides encoding an SPT5 NusG domain (NGN) comprising identity to a native SPT5 NGN of SEQ ID NO: 6, a deletion of at least 9 consecutive nucleotides encoding an SPT5 C-terminal domain (CTD) comprising identity to a native SPT5 NTD of SEQ ID NO: 7, a deletion of at least 9 consecutive nucleotides preceding or following the nucleotides encoding the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 consecutive nucleotides preceding or following the nucleotides encoding the native SPT5 NGN of SEQ ID NO: 6, and / or a deletion of at least 9 consecutive nucleotides preceding or following the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.
[0247] 47. Method 31 or 32, wherein the genetic modification that renders the cell deficient in expression / production of native SPT5 protein comprises disruption of the wild-type (WT) SPT5 gene coding sequence (CDS) and / or the upstream (5') WT SPT5 gene promoter.
[0248] 48. The method of embodiment 47, wherein the disruption of the WT SPT5 gene CDS comprises a disruption of the SPT5 N-terminal domain (NTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 5, a disruption of the SPT5 NusG domain (NGN) comprising identity to the native SPT5 NGN of SEQ ID NO: 6, a disruption of the SPT5 C-terminal domain (CTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 7, a disruption of a nucleotide position preceding or following the nucleotide encoding the native SPT5 NTD, a disruption of a nucleotide position preceding or following the nucleotide encoding the native NGN of SEQ ID NO: 6, and / or a disruption of a nucleotide position preceding or following the nucleotide encoding the native SPT5 CTD of SEQ ID NO: 7.
[0249] 49. The method of embodiment 31 or 32, wherein the genetic modification that renders the cell deficient in expression / production of native SPT5 protein comprises an antisense (gene-silencing) nucleotide sequence complementary to the nucleic acid sequence encoding the native wild-type SPT5 gene coding sequence (CDS).
[0250] 50. The method of embodiment 31 or 32, wherein the modified cells comprise a phenotype of enhanced protein productivity selected from increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity, compared to the parent cell when fermented under the same conditions.
[0251] 51. The fungal cell of embodiment 1, wherein the cell is selected from the group consisting of an Acremonium spp. cell, an Aspergillus spp. cell, an Emericella spp. cell, a Fusarium spp. cell, a Humicola spp. cell, a Mucor spp. cell, a Myceliophthora spp. cell, a Neurospora spp. cell, a Penicillium spp. cell, a Scytalidium spp. cell, a Thielavia spp. cell, a Tolypocladium spp. cell, and a Trichoderma spp. cell.
[0252] 52. The method of embodiment 31 or 32, wherein the fungal cell is selected from the group consisting of an Acremonium spp. cell, an Aspergillus spp. cell, an Emericella spp. cell, a Fusarium spp. cell, a Humicola spp. cell, a Mucor spp. cell, a Myceliophthora spp. cell, a Neurospora spp. cell, a Penicillium spp. cell, a Scytalidium spp. cell, a Thielavia spp. cell, a Tolypocladium spp. cell, and a Trichoderma spp. cell. [Example]
[0253] Certain aspects of the present disclosure may be further understood in light of the following examples, which should not be construed as limiting. Variations in materials and methods will be apparent to those skilled in the art. Standard recombinant DNA and molecular cloning techniques used herein are well known in the art (Ausubel et al., 1987; Sambrook et al., 1989).
[0254] Example 1 Identifying mutant Trichoderma strains containing phenotypes with enhanced protein productivity at elevated culture temperatures As generally indicated above, WO 2021 / 092356 describes, inter alia, the continuous growth of cellulase-overproducing Trichoderma T4 strains under selective conditions to identify and isolate mutant T4 strains capable of high temperature (HT) protein production relative to the parent (control) T4 strain. In particular, WO 2021 / 092356 publication describes a specific productivity (Q) increase relative to the control T4 strain. p We identified a mutant T4 strain (designated "T4-GEF1") capable of producing HT protein without adversely affecting T4 expression, where the mutant T4 strain contained a mutant "GEF1 gene" encoding a truncated "GEF1 protein" compared to the T4 parent (control) strain.
[0255] As previously described in Section I, Table 1, certain exemplary Trichoderma strains are described herein that contain a deletion of the GEF1 gene (e.g., ΔGEF1 from the control strain T4-GEF1), which exhibits a specific productivity of Q under selection conditions to isolate mutants capable of producing HT protein. p More specifically, in this example, a mutant T. reesei strain designated "T4-26rc" was identified and isolated, which exhibited a Q value of 1.5 when grown at 29°C compared to the parent (control) T. reesei T4-GEF1 strain grown at 28°C. p was similar.
[0256] For example, the T4-GEF1 control strain was sporulated on BIRD agar to give 1 x 10 7Spores per milliliter were collected from agar plates, suspended in water, and treated with 0.15 mg / mL 1-methyl-3-nitro-1-nitrosoguanidine (Sigma 112,994-1) for 2 hours at room temperature until only 1% of the spores were viable. The spores were inoculated into an evolution medium containing 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethylcellulose (CMC; Sigma-Aldrich C5678, St. Louis, MO), or acid-swollen cellulose (see, e.g., Wood, 1971) as the sole carbon source. Also included per liter were ammonium sulfate (4 g), sodium dihydrogen phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g), and 2.5 ml of 400× trace element solution.
[0257] More specifically, in the first method, approximately one million chemically mutated spores were inoculated into a 250 ml hollow-bottom flask containing the above-described evolution medium with Avicel® as the sole carbon source. The flask was incubated at 180 rpm and 31°C for 5 days. At this time, 10% v / v was transferred to a second identical flask incubated in the same manner. Serial transfers continued for 11 (10) passages (P) as follows: P1 = 7 days, P2 = 7 days, P3 = 5 days, P4 = 5 days, P5 = 5 days, P6 = 4 days, P7 = 4 days, P8 = 4 days, P9 = 3 days, and P10 = 2 days. P10 broth from the P10 shake flask was centrifuged at 4000 rpm for 10 minutes. The supernatant was discarded, and the cells were suspended in water and plated on BIRD medium.
[0258] Individual colony-forming units were assessed for total protein BCA (product #23228, Thermo Scientific, Rockford, IL) after 4 days of incubation at 31°C, 200 rpm, and 80% humidity in slow-release lactose microtiter plates (srMTPs; see, e.g., WO 2014 / 047520). Thus, mutant strains producing equivalent amounts of total protein at 31°C compared to the amount of total protein produced by the parent strain at 28°C were further assessed for high-temperature protein production in fermentors.
[0259] In the second method, mutant spores of the T. reesei T4-GEF1 parental (control) strain were encapsulated in water-and-oil emulsion droplets using the method described by Bachmann et al. (2013). The droplets contained evolution medium with 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethylcellulose (Sigma-Aldrich C5678, St. Louis, MO), or acid-swollen cellulose (Wood, 1988) as the sole carbon source. Also included per liter were ammonium sulfate (4 g), sodium dihydrogen phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g), and 2.5 ml of 400x trace element solution. The droplets were incubated in tubes at 31°C for 3 days, at which time the emulsion was broken using the method described by Bachmann et al. (2013). Cells were harvested, sporulated on agar plates, reencapsulated, and incubated at 31°C for 3 days. This process was repeated 10 times. After the final transfer, cells were suspended in water and plated on BIRD medium. Individual colony-forming units were assessed for total BCA protein (product #23228, Thermo Scientific, Rockford, IL) after 4 days of incubation at 31°C, 200 rpm, and 80% humidity in srMTP lactose plates (WO 2014 / 047520). Mutants producing equivalent amounts of total protein at 31°C compared to the amount produced by the parent strain at 28°C were further evaluated for high-temperature protein production in fermentors.
[0260] In a third method, high-temperature mutants were isolated using evolution combined with large-particle flow cytometry. Mutant T4-GEF1 was evolved through 10 rounds of transport as previously described. The evolved culture was used to inoculate 250 mL flasks containing 50 mL citrate minimal medium. The inoculum flasks were incubated at 28–34°C and 180–200 rpm for 48 h and then used to inoculate DASGIP fermenters run under high-productivity fermentation conditions, including pH 4.8, 31°C, and a specific glucose-sophorose feed rate (g / g h) of 0.04. At 169 h, a 10 mL broth sample was harvested, and cells were encapsulated in 300 μm alginate particles by electroextrusion and grown overnight at 31°C and 150–200 rpm in Tr seed medium containing 0.01%–0.5% sophorose or lactose. Particles were stained with 4 μl / mL resorufin cellobioside (CAS 1000404-48-7) for 10–30 min at 31°C before sorting using a large particle cell sorter, COPAS (Union Biometrica, Holliston, Massachusetts, USA). The brightest 0.2–0.5% particles (561 nm excitation and 610 / 20 nm emission) were sorted into 96-well MTPs containing Bird-E agar. Plates were incubated at 31°C for 5–10 days to isolate sporulation mutants. These mutants were evaluated for improved productivity at 25–31°C in srMTPs and fermenters.
[0261] As described below in Example 2, a mutant T. reesei T4-GEF1 strain designated "T4-26rc" was identified as a high temperature (HT) mutant capable of optimal protein production when grown / cultured at 29°C compared to the optimal protein production of the parent (control) T4-GEF1 strain grown / cultured at 28°C.
[0262] Example 2 Characterization of mutant Trichoderma strain T4-26rc containing a mutant SPT5 gene Applicants sequenced the high temperature (HT) T. reesei T4-26rc mutant strain described / isolated in Example 1 to identify any mutant alleles that may contribute to the enhanced protein productivity observed under 31° C. culture conditions. More specifically, the mutant allele identified herein is located at scaffold position 2:1043183-1043184 in wild-type T. reesei QM6a (v2.0 genome sequence assembly, available at the Joint Genomes Institute (JGI) website; genome.jgi.doe.gov), and the mutant allele encodes a truncated SPT5 protein as shown in FIG. 1 by containing a SNP (G to A) within the gene coding sequence.
[0263] Example 3 Inactivation of the SPT5 gene in Trichoderma strains by insertion of the PYR2 gene In this example, inactivation of the wild-type SPT5 gene (JGI; T. reesei v2.0 scaffold2:1043183-1043184), encoding the native SPT5 protein (SEQ ID NO:2; PID:4136), was carried out in a Trichoderma strain using a Cas9-based method. More specifically, purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA), and modified crRNA was synthesized by Synthego with the following sequence at its 5' end (CLsgRNA58; SEQ ID NO:8), specific for the target site (TS) CLsgRNA58 within the T. reesei SPT5 gene. CLsgRNA58:CGUCGGCGCCGAAACACCCC (SEQ ID NO: 8)
[0264] For example, the Cas9 target site (TS) in the SPT5 gene, as determined by the CLsgRNA58 RNA sequence (SEQ ID NO: 8), is located at nucleotide positions 3,209-3,228 within the coding sequence (CDS), which is close to the mutation at nucleotide position 3,183 observed in the T4-26rc mutant identified / described in Examples 1-2. Therefore, according to the manufacturer's instructions, the tracrRNA and crRNA were annealed to form a guide RNA (gRNA), which was then combined with the Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Prior to use, the Cas9:RNP was mixed with Lipofectamine CRISPR-MAX (purchased from ThermoFisher Scientific, Inc., Waltham, MA).
[0265] A linear DNA fragment containing the T. reesei pyr2 gene with its native promoter and terminator sequences and flanked by 492 bp T. reesei repeats (SEQ ID NO: 18) was amplified by PCR using primers AL950 (SEQ ID NO: 9) and AL952 (SEQ ID NO: 10). The resulting PCR product was purified using a Qiagen QIAquick PCR purification kit. AL950:CCTAACTAACGTCTGACATCG (SEQ ID NO: 9) AL952: CGTACCATTTGACTGATACGATG (SEQ ID NO: 10)
[0266] Protoplasts of the T. reesei parent strain T4-GEF1 were transformed with the pyr2 PCR product plus Cas9:RNP. Transformants were selected for uridine auxotrophy. Transformants were screened for the desired insertion of pyr2 into the SPT5 gene by PCR using the forward and reverse primer pair CL2350 (SEQ ID NO: 11) and CL2351 (SEQ ID NO: 12), which amplify the entire SPT5 gene. CL2350:AGTCGCTGGTTGTGCTGGAC (SEQ ID NO: 11) CL2351:TAGCGTAGATCCATAGTCCACC (SEQ ID NO: 12)
[0267] A SNP (G to A) was introduced into the SPT5 gene coding sequence (CDS) of a transformant designated "SPT5 t-BBW51," which was determined by Sanger sequencing using primers CL2350 and CL2351.
[0268] As shown in Table 2, the fermentor performance of the disrupted SPT5 gene transformant, SPT5 t-BBW51, was compared to the T4 parent, T4-GEF1 control, and T4-26rc mutant strains described in Examples 1-2. Specifically, as shown in Table 2, the total protein yields of the T4, T4-GEF1, T4-26rc, and SPT5 t-BBW51 strains are presented as a percentage (%) compared to the parent T4 strain cultured at 25°C. For example, as shown in Table 2 below, the total protein yield of the T4 (parent) strain cultured at 28°C is reduced by approximately 32% compared to the T4 (parent) strain cultured at 25°C. Similarly, the total protein yield of the T4GEF1 (ΔGEF1) strain cultured at 28°C is increased by approximately 7% compared to the T4 (parent) strain cultured at 25°C and increased by approximately 39% compared to the T4 (parent) strain cultured at 28°C. [Table 2]
[0269] Furthermore, as shown in Table 2 above, the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultured at 29°C was nearly equal to that of the T4 (parent) strain cultured at 25°C, and the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultured at 29°C was increased by approximately 32% compared to that of the T4 (parent) strain cultured at 28°C. Similarly, the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultured at 29°C (Table 2) was higher than that of the T4GEF1 (ΔGEF1) strain cultured at 29°C. As shown above (Table 2), the total protein yield of the SPT5 t-BBW51-disrupted strain (ΔSPT5) was increased by approximately 12% compared to that of the T4 (parent) strain cultured at 25°C and by approximately 44% compared to that of the T4 (parent) strain cultured at 28°C.
[0270] Example 4 Inactivation of the SPT5 gene by introducing a SNP into Trichoderma strains containing a heterologous cellulase expression cassette Inactivation of the SPT5 gene (JGI; T. reesei v2.0 scaffold2:1043183-1043184), encoding the SPT5 protein (SEQ ID NO:2), was carried out in a T. reesei strain using a Cas9-based method. More specifically, purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA), and modified crRNA was synthesized by Synthego with the following sequence at its 5' end (CLsgRNA58; SEQ ID NO:8) specific for the target site (TS; CLsgRNA58) within the T. reesei SPT5 gene. CLsgRNA58:CGUCGGCGCCGAAACACCCC (SEQ ID NO: 8)
[0271] The Cas9 target site (TS) in the SPT5 gene, as determined by the RNA sequence (SEQ ID NO: 8), is located at nucleotide positions 3,209-3,228 within the coding sequence, which is close to the mutation at nucleotide position 3,183 observed in the mutant strain (Example 2). Following the manufacturer's instructions, the tracrRNA and crRNA were annealed to form a guide RNA (gRNA), which was then combined with the Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Prior to use, the Cas9:RNP was mixed with Lipofectamine CRISPR-MAX (purchased from ThermoFisher Scientific, Inc., Waltham, MA).
[0272] A linear DNA fragment containing the T. reesei SPT5 gene with the desired SNP (G to A) at nucleotide position 3,183 within the coding sequence was amplified by PCR using primers CL2350 and CL2351. The resulting PCR product was purified using a Qiagen QIAquick PCR purification kit.
[0273] Protoplasts of the T. reesei parent strain t-BAL50 were transformed with the SPT5 and pyr2 PCR products plus Cas9:RNP. Transformants were selected for uridine auxotrophy. Transformants were screened for the desired SNP (G to A) at nucleotide position 3,183 into the CDS of the SPT5 gene by PCR using the forward and reverse primer pair CL2350 and CL2351, which amplify the entire SPT5 region. CL2350:AGTCGCTGGTTGTGCTGGAC (SEQ ID NO: 11) CL2351:TAGCGTAGATCCATAGTCCACC (SEQ ID NO: 12)
[0274] Insertion of the 278 bp pyr2 fragment resulted in truncation of SPT5 in a transformant designated "t-BDA88," which was determined by Sanger sequencing using CL2350 and CL2351 primers, confirming disruption of the SPT5CDS.
[0275] In another transformant, designated t-BDA85, a SNP (G to A) at nucleotide position 3,183 in the CDS of the SPT5 gene was identified by sequencing the PCR product using the forward and reverse primer pair CL2350 and CL2351, which amplify the entire SPT5 gene, confirming SPT5 truncation. Fermenter performance of the t-BDA85 and t-BDA88 transformants was compared to the parent (control) t-BAL50 strain, as shown below in Table 3. Specifically, the total protein yields of the t-BDA85 and t-BDA88 strains, as compared to the t-BAL50 control strain grown at 25°C, are shown in Table 3 as a percentage (%).
[0276] For example, as shown in Table 3 below, the total protein yield of the t-BAL50 control strain cultured at 28° C. was reduced by approximately 12% compared to the BAL50 control strain cultured at 25° C. Similarly, the total protein yield of the t-BDA85 strain containing the SPT5 truncation cultured at 29° C. was increased by approximately 2% compared to the t-BAL50 control strain cultured at 25° C., and increased by approximately 14% compared to the t-BAL50 (parent) strain cultured at 28° C.
[0277] In addition, at 29° C., the total protein yield of t-BDA88 containing an SPT5 disruption is reduced by 4% compared to the BAL50 control cultured at 25° C. Similarly, at 29° C., the total protein yield of t-BDA88 is increased by 8% compared to t-BAL50 cultured at 28° C. In addition, at 29° C., the total protein yield of t-BDA88 containing an SPT5 deletion is reduced by 6% compared to the total protein yield at 29° C. of t-BDA85 containing an SPT5 truncation. [Table 3]
[0278] Example 5 Evaluation of SPT5 mutations in Trichoderma strains with wild-type GEF1 genes In this example, the applicant identified the wild-type GEF1 gene (GEF1 Rest ; encoding the native GEF1 protein) was restored to further evaluate the mutant SPT5 phenotype of the present disclosure in the absence of any GEF1 mutant allele contribution. More specifically, the wild-type GEF1 gene (GEF1 Rest Restoration of T. reesei GEF1 gene (GEF1) was performed in the t-BDA85 strain described in Example 4 above, where purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA) and the modified crRNA was targeted to a target site within the T. reesei GEF1 gene (GEF1). Rest ) specific 5' end (GEF1 Rest ; SEQ ID NO: 15) by Synthego. GEF1 Rest :AAGAAUCAAGGGCACCGCAG (SEQ ID NO: 15)
[0279] The Cas9 target site (TS) in the GEF1 gene, determined by the RNA sequence (SEQ ID NO: 15), is located at nucleotide positions 3668-3687 within the coding sequence. Following the manufacturer's instructions, the tracrRNA and crRNA were annealed to form a guide RNA (gRNA), which was then combined with the Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Prior to use, the Cas9:RNP was mixed with Lipofectamine CRISPR-MAX (purchased from ThermoFisher Scientific, Inc., Waltham, MA).
[0280] A linear DNA fragment containing the T. reesei GEF1 wild-type gene was amplified by PCR using primers CLN2516 and CLN2515 derived from P37 genomic DNA, and the resulting PCR product was purified using a Qiagen QIAquick PCR purification kit.
[0281] Protoplasts of the T. reesei parent strain tBDA-85 were transformed with the GEF1 PCR product plus Cas9:RNP. Transformants were selected for resistance to sorbitol. Transformants were screened for the desired wild-type GEF1 gene by PCR using the forward and reverse primer pair CLN2514 and CLN2517, which amplify the entire GEF1 region, and confirmed by sequencing. CLN2514: CAGATCATAGTGCCGACGAG (SEQ ID NO: 16) CLN2517:AGTTCCGCCTTGCAGCTTG (SEQ ID NO: 17)
[0282] Restoration of the wild-type GEF1 gene in transformant t-BEX65 was determined by Sanger sequencing using CLN2514 and CLN2517 primers, confirming the GEF1 wild-type sequence.
[0283] Fermenter performance of the t-BEX65 strain was evaluated at protein production temperatures of 25°C, 28°C, and 29°C, as shown in Table 4 below, where the total protein yield of the t-BEX65 strain is shown as a percentage (%) compared to the t-BEX65 strain cultured at 25°C. More specifically, as shown in Table 4, the t-BEX65 strain containing the mutated SPT5 SNP (G→A) and restored GEF1 gene exhibits an 8% reduction in total protein yield at 28°C compared to the total protein yield at 25°C. Similarly, as shown in Table 4, t-BEX65 at 29°C exhibits a 4% increase in total protein yield compared to 25°C and a 12% increase in total protein yield compared to 28°C. [Table 4]
[0284] References PCT Publication No. WO2011 / 153449 PCT Publication No. WO2014 / 047520 PCT Publication No. WO2016 / 100272 PCT Publication No. WO2016 / 100562 PCT Publication No. WO2016 / 100568 PCT Publication No. WO2016 / 100571 PCT Publication No. WO2021 / 092356 U.S. Patent No. 6,022,725 U.S. Patent No. 6,255,115 U.S. Patent No. 6,268,328 Ausubel et al., “Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987, 1989 and 2003). Cao et al., “Penicillopepsin‐JT2, a recombinant enzyme from Penicillium janthinellum and the contribution of a hydrogen bond in subsite S3 to kcat”, Protein Science (9): 991 - 1001, 2000. Devereux et al., Nucleic Acids Res. 12: 387 - 395, 1984. Needleman and Wunsch,“A general method applicable to the search for similarities in the amino acid sequence of two proteins”,J.Mol.Biol.48:443-453,1970. Pearson and Lipman,Proc.Natl.Acad.Sci.USA 85:2444,1988. Sambrook et al.,Molecular Cloning,A Laboratory Manual,2 nd Edition,Cold SpringHarbor Laboratory Press,Cold Spring,New York,1989. Sambrook et al.,Molecular Cloning,A Laboratory Manual,4 th Edition,Cold SpringHarbor Laboratory Press,Cold Spring,New York,2012. Sheir-Neiss and Montenecourt,“Characterization of the secreted cellulases of Trichoderma reesei wild type and mutants during controlled fermentations”,Applied Microbiology and Biotechnology,20(1):46-53,1984. Smith and Waterman,Adv.Appl.Math.2:482,1981. Wood,“The cellulase of Fusarium solani.Purification and specificity of the β-(1→4)-glucanase and the β-d-glucosidase components”,Biochem.J.,121:353-362,1971.
Claims
1. A recombinant filamentous fungal cell derived from a parent filamentous fungal cell containing a gene encoding a native SPT5 protein, the recombinant cell comprising a genetic modification that renders the cell deficient in expression of the native SPT5 protein.
2. The recombinant cell of claim 1 , wherein the parent cell expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.
3. 2. The recombinant cell of claim 1, comprising a phenotype of enhanced protein productivity compared to the parent cell when cultured under the same conditions at a temperature of about 25°C to 29°C.
4. 2. The recombinant cell of claim 1, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to SEQ ID NO:
1.
5. The recombinant cell of claim 1 , wherein the native SPT5 protein comprises at least 90% identity to SEQ ID NO:
2.
6. 2. The recombinant cell of claim 1, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of an SPT5 N-terminal domain (NTD) comprising at least 95% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 95% identity to SEQ ID NO: 6, and an SPT5 C-terminal domain (CTD) comprising at least 95% identity to SEQ ID NO:
7.
7. 4. The recombinant cell of claim 3, wherein the phenotype of enhanced protein productivity is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.
8. A mutant Trichoderma reesei cell containing a mutant SPT5 gene having a single nucleotide polymorphism (SNP) mutation from guanine (G) to adenine (A) within the SPT5 gene coding sequence (CDS) at nucleotide position 2,790 of SEQ ID NO:
3.
9. The mutant cell of claim 8 , wherein the gene encoding the native SPT5 protein comprises at least 90% identity to SEQ ID NO:
1.
10. The mutant cell of claim 8 , wherein the native SPT5 protein comprises at least 90% identity to SEQ ID NO:
2.
11. An isolated SPT5 gene variant comprising at least 90% identity to SEQ ID NO:3 and comprising a single nucleotide polymorphism (SNP) mutation from guanine (G) to adenine (A) at nucleotide position 2,790 of SEQ ID NO:
3.
12. 1. A method for producing increased amounts of lignocellulolytic enzymes in modified filamentous fungal cells, comprising: (a) obtaining a parent filamentous fungal cell that contains a gene encoding a native SPT5 protein and genetically modifying the parent cell to obtain a modified filamentous fungal cell that is deficient in expression of the native SPT5 protein; (b) fermenting the modified cells under conditions suitable for the production of lignocellulolytic enzymes; Including, The method wherein the modified cells produce increased amounts of the lignocellulolytic enzymes compared to the parent cells when fermented under the same conditions at a temperature of about 25°C to 29°C.
13. 13. The method of claim 12, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to the polypeptide of SEQ ID NO:
1.
14. 13. The method of claim 12, wherein the lignocellulolytic enzyme is selected from the group consisting of cellobiohydrolase, xylanase, endoglucanase, and β-glucosidase.
15. 13. The method of claim 12, wherein the genetic modification that renders the cell deficient in expression of the native SPT5 protein comprises a complete deletion of the wild-type (WT) SPT5 gene coding sequence (CDS), a partial deletion of the WT SPT5 gene CDS, a complete or partial deletion of the upstream WT SPT5 gene promoter, a disruption of the WT SPT5 gene CDS, a disruption of the upstream WT SPT5 gene promoter, or an antisense nucleic acid sequence complementary to a portion of the WT SPT5 CDS and / or the upstream WT SPT5 gene promoter.
16. 1. A method for producing increased amounts of a heterologous protein of interest (POI) in a modified filamentous fungal cell, comprising: (a) obtaining a parent filamentous fungal cell that has a gene encoding a native SPT5 protein, genetically modifying the parent cell to obtain a modified filamentous fungal cell that is deficient in expression of the native SPT5 protein, and introducing an expression cassette encoding the POI into the parent cell before, during, or after rendering the cell deficient in production of the native SPT5 protein; (b) fermenting the modified cells under conditions suitable for the production of the heterologous POI; Including, The modified cells produce increased amounts of the POI compared to the parent cells when fermented under the same conditions at a temperature of about 25°C to 29°C.
17. 17. The method of claim 16, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to the polypeptide of SEQ ID NO:
1.
18. 17. The method of claim 16, wherein the expression cassette encodes a heterologous POI selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.
19. 17. The method of claim 16, wherein the genetic modification that renders the cell deficient in expression of the native SPT5 protein comprises a complete deletion of the wild-type (WT) SPT5 gene coding sequence (CDS), a partial deletion of the WT SPT5 gene CDS, a complete or partial deletion of the upstream WT SPT5 gene promoter, a disruption of the WT SPT5 gene CDS, a disruption of the upstream WT SPT5 gene promoter, or an antisense nucleic acid sequence complementary to a portion of the WT SPT5 CDS and / or the upstream WT SPT5 gene promoter.