Treatment of neurological disorders using NHR

Abstract

The present disclosure provides a method of ameliorating or treating a neurological condition or disease in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising: (i) recombinant DNA (rDNA), wherein the rDNA comprises a human nuclear hormone receptor (hNHR) gene or a fragment thereof; and (ii) a delivery vehicle suitable for delivering the rDNA to a neurological cell or tissue to ameliorate or treat the neurological condition or disease.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 423,481, filed November 7, 2022, which is incorporated herein by reference in its entirety.

[0003] Reference to Electronic Sequence Listing

[0004] The contents of the following electronic sequence listing are incorporated herein by reference in their entirety: Name of XML file: OCU-000520PC_SEQ_ID_LIST.xml; File size: 13,141 bytes; Created: November 5, 2023

[0005] The present disclosure relates to a method of ameliorating or treating a neurological condition or disease in a subject in need thereof by administering to the subject a therapeutically effective amount of a composition comprising: (i) recombinant DNA (rDNA), wherein the rDNA comprises a human nuclear hormone receptor (hNHR) gene or a fragment thereof; and (ii) a delivery vehicle suitable for delivering the rDNA to a neurological cell or tissue to ameliorate or treat the neurological condition or disease. [Background technology]

[0006] Genetic variation is observed in many Mendelian monogenic diseases. Although environmental influences contribute only slightly, the variability in phenotypic outcomes is generally due to allelic heterogeneity or genetic modifier genes (allelic variants distinct from the mutant gene), which can influence disease onset, progression, and outcome by increasing or decreasing disease severity.

[0007] One of the modified gene therapy methods currently being developed by the applicant is aimed at treating retinal degeneration caused by mutations in genes such as NR2E3, RHO, CEP290, and PDE6B, for example, by affecting the expression of NR2E3. See U.S. Patent Application Publication No. 2019 / 0129999, published January 2, 2019, and U.S. Patent Application Publication No. 2022 / 0129999, published June 7, 2022, which are incorporated herein by reference in their entireties. Thus, while several modified gene therapy methods are known, there are numerous other clinical diseases or conditions for which modified gene therapy methods are not currently available. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] US$9,855,314 [Patent Document 2] US11,351,225 Summary of the Invention [Problem to be solved by the invention]

[0009] Thus, there is a continuing need for modified gene therapies for other clinical diseases or conditions. [Means for solving the problem]

[0010] Nuclear hormone receptors (NHRs) have been found to play an important role in regulating cellular homeostasis through transcriptional regulation of several downstream genes. Some aspects of the present disclosure provide for the use of modified gene therapy to treat various genetic diseases that are caused by multiple genetic mutations in various genes but result in the same pathological outcome (phenotype). The modified gene alters the phenotype regardless of the underlying genetic mutation that causes the disease.

[0011] Without being bound by any theory, in some aspects of the present disclosure, it is believed that the compositions disclosed herein modulate gene expression or activity, thereby altering the phenotype of the underlying genetic mutation that causes the clinical condition or disorder. In some embodiments, the compositions of the present disclosure reduce the expression or activity of a gene that causes a neurological condition or disorder. In yet other embodiments, the compositions of the present disclosure increase the expression or activity of a wild-type (or "normal") gene, thereby improving or treating the neurological condition or disorder.

[0012] Certain aspects of the present disclosure provide a method of ameliorating or treating a neurological condition or disease in a subject in need thereof, the method comprising: (i) recombinant DNA (rDNA) containing a human nuclear hormone receptor (hNHR) gene or a fragment thereof; and (ii) a delivery vehicle suitable for delivering said rDNA to a neurological cell to ameliorate or treat said neurological condition or disease; The method comprises administering to a subject a therapeutically effective amount of a composition comprising:

[0013] In some embodiments, the delivery vehicle comprises a viral delivery vector. In certain instances, the viral delivery vector comprises a viral delivery vector (e.g., a capsid protein) associated with an adeno-associated virus (AAV), an adenovirus, or a lentivirus. In yet other embodiments, the delivery vehicle comprises an adeno-associated virus (AAV). In some embodiments, the rDNA comprises an adeno-associated virus inverted terminal repeat (AAV ITR). In one specific embodiment, the AAV ITR comprises an AAV2 ITR. In yet other embodiments, the rDNA further comprises (i) a promoter, (ii) an enhancer, (iii) a polyadenylation region, or (iv) a combination thereof. In some instances, the polyadenylation region comprises a simian virus 40 (SV40) polyadenylation (polyA) region, a bovine growth hormone (bGH) polyA region, or a combination thereof. In further embodiments, the composition further comprises a cytomegalovirus (CMB) promoter or enhancer, elongation factor 1a (EF1a), chicken beta actin (CBA) promoter, a CAG promoter, or a combination thereof.

[0014] In yet other embodiments, the delivery vector comprises a non-viral delivery vehicle comprising a nanoparticle, nanosome, liposome, biodegradable polymer complex, or a combination thereof.

[0015] In some embodiments, delivery vehicles are adapted to target the brain using adsorption ligands such as lectins, cardiolipin, heparin, and cell-penetrating peptides, or transporter ligands such as mannose, glutathione, and various amino acids, or receptor ligands such as transferrin, OX26 mAb, lactoferrin, apolipoprotein E, polysorbate 80, angiopep-2, candoxin, peptides, RVG29-rabies virus glycoprotein (29aa peptide), RGD (arginine-glycine-aspartic acid) peptide, and NGR (asparagine-glycine-arginine) peptide. Generally, nanoparticles can be targeted to the brain by modifying their surface with molecules / ligands that are specifically recognized by receptors or transporters overexpressed in the brain (such as transferrin, lactoferrin, LDL, nAChR, αβ integrin receptors, or glucose, glutathione, and amino acid transporters).

[0016] In yet another embodiment, the rDNA comprises a cell- or tissue-specific promoter. Exemplary cell- or tissue-specific promoters that can be used in the present invention include human Syn1, MeCP2, NSE, and BM88 promoters (widespread neuronal expression); CaMKII (glutaminergic neuron expression specific); DLX5 / 6 enhancer (GABAergic neuron specific); tyrosine hydroxylase (catecholamine neuron specific); dopamine beta-hydroxylase (DBH), PRSx8 (synthetic DBH) (adrenergic and noradrenergic neuron specific); PCP2 (Purkinje cell protein 2) (Purkinje neuron specific); FEV1, ETS transcription factor (Ple67) (serotonergic neuron specific); MCH (metabolites) These include, but are not limited to, SLC6A4 (serotonin transporter Ple198), NR2E1 (ple264) [Müller glia specific]; GfABC1D (truncated GFAP), Aldh1A1 [astrocytic specific]; MBP (myelin basic protein), MAG (myelin-associated glycoprotein) [oligodendrocyte specific]; ICAM-2 (intercellular adhesion molecule 2), CLDN5 (claudin 5), Tie-2 (TEK, receptor tyrosine kinase), vWF (von Willebrand factor), FLT1 (endothelial growth factor receptor) [endothelial cell specific]; and combinations thereof.

[0017] In yet other embodiments, the hNHR gene is selected from the group consisting of NR2E3, NR1C3, NR1D1, RORA, NUPR1, NR2C1, and LXRα. In one particular embodiment, the hNHR gene comprises RORA.

[0018] In further embodiments, the neurological condition or disease includes intellectual developmental disability, epilepsy, cerebellar ataxia, autism spectrum disorder (ASD), or a combination thereof. In one particular example, the neurological condition or disease includes autism spectrum disorder. In yet another example, the neurological condition or disease includes intellectual developmental disability. In yet another example, the neurological condition or disease includes epilepsy. In yet another example, the neurological condition or disease includes cerebellar ataxia. In yet another example, the neurological condition or disease includes Parkinson's disease. In yet another example, the neurological condition or disease includes Alzheimer's disease.

[0019] In another embodiment, the composition further comprises a cell- or tissue-specific promoter for targeted expression in neural cells or tissues. Exemplary cell- or tissue-specific promoters that can be used in the present disclosure include, but are not limited to: Human Syn1, MeCP2, NSE, BM88 promoters: broad neuronal expression; CaMKII: glutamatergic neuron expression specific; DLX5 / 6 enhancer: GABAergic neuron specific; Tyrosine hydroxylase: catecholamine neuron specific; Dopamine β-hydroxylase (DBH), PRSx8 (synthetic DBH): specific for adrenergic and noradrenergic neurons; PCP2 (Purkinje cell protein 2): Purkinje neuron specific; FEV, ETS transcription factor (Ple67): serotonin neuron specific; MCH (melanin-concentrating hormone): specific to the dorsal hypothalamus; SLC6A4 (serotonin transporter Ple198), NR2E1 (ple264): Müller glia specific; GfABC1D (truncated GFAP), Aldh1A1: astrocyte-specific; MBP (myelin basic protein), MAG (myelin-associated glycoprotein): oligodendrocyte-specific; ICAM-2 (intercellular adhesion molecule 2), CLDN5 (claudin 5), Tie-2 (TEK, receptor tyrosine kinase), vWF (von Willebrand factor), FLT1 (endothelial growth factor receptor): endothelial cell specific; or A combination of these.

[0020] Another aspect of the present disclosure provides a method for ameliorating or treating a neurological condition or disease in a subject in need of such treatment, the method comprising administering to the subject a therapeutically effective amount of a composition comprising (i) a human nuclear hormone receptor (hNHR) gene or a fragment thereof, or its mRNA, or its dbDNA, and (ii) an hNHR delivery vehicle, wherein the hNHR gene or a fragment thereof, or its mRNA, or its dbDNA is selected from the group consisting of NR2E3, NR1C3, NR1D1, RORA, NUPR1, NR2C1, and LXRa, or their mRNAs, or their dbDNAs.

[0021] In some embodiments, the delivery vehicle comprises a viral delivery vector or viral capsid protein, and the viral delivery vector comprises a viral delivery vector associated with an adeno-associated virus, a lentivirus, an adenovirus, or an HSV1 viral vector. In other embodiments, the delivery vehicle comprises a nanoparticle or a lipid nanoparticle. Exemplary lipid nanoparticles (LNPs) that can be used in the present disclosure include any LNP known to those skilled in the art of gene therapy. Some exemplary LNPs are disclosed in U.S. Patent Application Publication No. 2022 / 0184201, the entire contents of which are incorporated herein by reference.

[0022] However, in other embodiments, the nanoparticles comprise liposomes, lipid nanoparticles, polymeric nanoparticles, dendrimers, cyclodextrins, silica nanoparticles, polymer composites, magnetic nanoparticles, gold nanoparticles, quantum dots, or carbon nanotubes.

[0023] In yet other embodiments, the composition comprises an hNHR gene or a fragment thereof, or a plasmid thereof, or an mRNA thereof, or a dbDNA (Doggybone) thereof.

[0024] In a further embodiment, the composition further comprises a pharmaceutically acceptable carrier.

[0025] In one particular embodiment, the composition is administered to the subject multiple times.

[0026] Additionally, in some embodiments, methods of administration of the disclosed compositions include local routes to the CNS, such as intraspinally, intracerebroventricularly, intrastriatally, intrathalamicly, or combinations thereof. Other methods of administration include systemic routes, such as intravenous (IV) injection and intramuscular (IM) injection.

[0027] In yet another embodiment, the method of the present invention comprises administering a medicament comprising administering a medicament comprising administering a medicament to a subject in need thereof, the subject being a subject of administration of ... 8 ~about 10 14 The method includes administering to a subject a number of viral particles.

[0028] In yet another embodiment, the composition comprises an rAAV vector. Optionally, the composition further comprises an rDNA comprising (i) a promoter, (ii) an enhancer, (iii) a polyadenylation portion, or (iv) a combination thereof. In a specific example, the polyadenylation portion comprises a simian virus 40 (SV40) polyadenylation (polyA) region, a bovine growth hormone (bGH) polyA region, or a combination thereof. In another example, the vector further comprises a cytomegalovirus (CMB) promoter or enhancer, elongation factor 1a (EF1a), chicken beta actin (CBA) promoter, a CAG promoter, a cell- or tissue-specific promoter for targeted expression in neural cells or tissues, or a combination thereof.

[0029] In a further embodiment, the vector is delivered directly to neural cells or brain tissue of the subject. [Brief explanation of the drawings]

[0030] [Figure 1] Figure 1 shows the various developments and homeostasis of several physiological systems controlled by RORA. [Figure 2] FIG. 2 depicts a specific embodiment of an NHR transgene expression cassette of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0031] The present invention relates to the use of modified genes known as nuclear hormone receptor (NHR) genes, or fragments thereof, or mRNA thereof, or dbDNA thereof, to treat various clinical conditions or diseases. In particular, NHR transgenes are used herein to ameliorate or treat clinical conditions associated with neurological diseases or disorders. Nuclear receptors are a class of proteins responsible for a variety of functions, including, but not limited to, sensing steroids, thyroid hormones, cholesterol, and vitamins. These receptors have been shown to work in conjunction with other proteins to regulate the expression of various genes, thereby controlling the development, homeostasis, and metabolism of organisms. Therefore, these modified genes can be used to correct defects and genetic disorders that manifest as various clinical symptoms and / or diseases. Nuclear receptors are thought to directly bind to DNA, thereby controlling the expression of neighboring genes. Therefore, these receptors are classified as transcription factors. One important characteristic that distinguishes nuclear receptors from other classes of receptors is their direct regulation of genomic DNA. There are various types of NHRs known to those skilled in the art, including, but not limited to, NR2E3, NR1C3, NR1D1, RORA (i.e., RORα), NUPR1, NR2C1, and LXRa.

[0032] The wild-type nucleic acid sequences of human RORA (ie, RORα) mRNA, NR1D1 mRNA, and mutant 1LXRa mRNA are shown in SEQ ID NOs: 1 to 3, respectively. Human RORA mRNA sequence (CCDS10177): 1 11 21 31 41 ATGGAGTCAG CTCCGGCAGC CCCCGACCCC GCCGCCAGCG AGCCAGGCAG CAGCGGCGCG GACGCGGCCG CCGGCTCCAG GGAGACCCCG CTGAACCAGG AATCCGCCCG CAAGAGCGAG CCGCCTGCCC CGGTGCGCAG ACAGAGCTAT TCCAAGGCAGTCAGTCAGTCAGTCAGCAG ATACATCTCA AATTGAAATT ATTCCATGCA AGATCTGTGG AGACAAATCA TCAGGAATCC ATTATGGTGT CATTACATGT GAAGGCTGCA AGGGCTTTTT CAGGAGAAGT CAGCAAAGCA ATGCCACCTA CTCCTGTCCT CGTCAGAAGA ACTGTTTGAT GGATCCACCAA GCTGACCAA CTGTCGATTA CAGAAATGCC TTGCCGTAGG GATGTCTCGA GATGCTGTAA AATTTGGCCG AATGTCAAAA AAGCAGAGAG ACAGCTTGTA TGCAGAAGTA CAGAAACACC GGATGCAGCA GCAGCAGCGC GACCACCAGC AGCAGCCTGG AGAGGGCTGACCTCGACCGCCCCGACCG AACGGGCTGA CGGAACTTCA CGACGACCTC AGTAACTACA TTGACGGGCA CACCCCTGAG GGGAGTAAGG CAGACTCCGC CGTCAGCAGC TTCTACCTGG ACATACAGCC TTCCCCAGAC CAGTCAGGTC TTGATATCAA TGGAATCAAA CCAGGAACCAACCATCAGACTGACTCAGTCCAGTCCA TTCCCTACTG TTCGTTCACC AACGGCGAGA CTTCCCCAAC TGTGTCCATG GCAGAATTAG AACACCTTGC ACAGAATATA TCTAAATCGC ATCTGGAAAC CTGCCAATAC TTGAGAGAAG AGCTCCAGCA GATAACGTGG CAGACCTTTTTACAGGAAGA AATTGAGAAC TATCAAAACA AGCAGCGGGA GGTGATGTGG CAATTGTGTG CCATCAAAAT TACAGAAGCT ATACAGTATG TGGTGGAGTT TGCCAAACGC ATTGATGGAT TTATGGAACT GTGTCAAAAT GATCAAATTG TGCTTCTAAA AGCAGGTTCT CTAGAGGTGG TGTTTATCAG AATGTGCCGT GCCTTTGACT CTCAGAACAA CACCGTGTAC TTTGATGGGA AGTATGCCAG CCCCGACGTC TTCAAATCCT TAGGTTGTGA AGACTTTATT AGCTTTGTGT TTGAATTTGG AAAGAGTTTA TGTTCTATGC ACCTGACTGA AGATGAAATT GCATTATTTT CTGCATTTGT ACTGATGTCA GCAGATCGCT CATGGCTGCA AGAAAAGGTA AAAATTGAAA AACTGCAACA GAAAATTCAG CTAGCTCTTC AACACGTCCT ACAGAAGAAT CACCGAGAAG ATGGAATACT AACAAAGTTA ATATGCAAGG TGTCTACCTT AAGAGCCTTA TGTGGACGAC ATACAGAAAA GCTAATGGCA TTTAAAGCAA TATACCCAGA CATTGTGCGA CTTCATTTTC CTCCATTATA CAAGGAGTTG TTCACTTCAG AATTTGAGCC AGCAATGCAA ATTGATGGGTAA (SEQ ID NO:1) Human Nr1d1 mRNA (Genbank accession number HQ692861.1 (GI:325495532) (CCDS11361.1)): 1 11 21 31 41 ATGACGACCC TGGACTCCAA CAACAACACA GGTGGCGTCA TCACCTACAT TGGCTCCAGT GGCTCCTCCC CAAGCCGCAC CAGCCCTGAA TCCCTCTATA GTGACAACTC CAATGGCAGC TTCCAGTCCC TGACCCAAGG CTGTCCCACC TACTTCCCACCCCCCCCCCCTCCCTCCCTCCCTC CTTTGGGAGC ATTCCACCCA GCCTGAGTGA TGACGGCTCC CCTTCTTCCT CATCTTCCTC GTCGTCATCC TCCTCCTCCT TCTATAATGG GAGCCCCCCT GGGAGTCTAC AAGTGGCCAT GGAGGACAGC AGCCGAGTGT CCCCCAGCAA GAGCACCACCAAGCATGAGTGAGGTTG CTGTGTAAAG TGTGTGGGGA CGTTGCCTCG GGCTTCCACT ACGGTGTGCA CGCCTGCGAG GGCTGCAAGG GCTTTTTCCG TCGGAGCATC CAGCAGAACA TCCAGTACAA AAGGTGTCTG AAGAATGAGA ATTGCTCCAT CGTCCGCATC AATCGCAACCCAACCAACCAGTC AGTGCTC TCTCTGTGGG CATGTCTCGA GACGCTGTGC GTTTTGGGCG CATCCCCAAA CGAGAGAAGC AGCGGATGCT TGCTGAGATG CAGAGTGCCA TGAACCTGGC CAACAACCAG TTGAGCAGCC AGTGCCCGCT GGAGACTTCA CCCACCCAGC ACCCCACCCCAT AGCCCCTCGGCCCTT TCCGGTCCCC TCACCCCTGG TGGGCTTCTC CCAGTTTCCA CAACAGCTGA CGCCTCCCAG ATCCCCAAGC CCTGAGCCCA CAGTGGAGGA TGTGATATCC CAGGTGGCCC GGGCCCATCG AGAGATCTTC ACCTACGCCCATGACAAGCT GGGCAGCTCA CCTGGCAACT TCAATGCCAA CCATGCATCA GGTAGCCCTC CAGCCACCAC CCCACATCGC TGGGAAAATC AGGGCTGCCC ACCTGCCCCC AATGACAACA ACACCTTGGC TGCCCAGCGT CATAACGAGG CCCAAATGG TCTGCGCCAG GCTCCCTCCT CCTACCCTCC CACCTGGCCT CCTGGCCCTG CACACCACAG CTGCCACCAG TCCAACAGCA ACGGGCACCG TCTATGCCCC ACCCACGTGT ATGCAGCCCC AGAAGGCAAG GCACCTGCCA ACAGTCCCCG GCAGGGCAAC TCAAAGAATG TTCTGCTGGC ATGTCCTATG AACATGTACC CGCATGGACG CAGTGGGCGA ACGGTGCAGG AGATCTGGGA GGATTTCTCC ATGAGCTTCA CGCCCGCTGT GCGGGAGGTG GTAGAGTTTG CCAAACACAT CCCGGGCTTC CGTGACCTTT CTCAGCATGA CCAAGTCACC CTGCTTAAGG CTGGCACCTT TGAGGTGCTG ATGGTGCGCT TTGCTTCGTT GTTCAACGTG AAGGACCAGA CAGTGATGTT CCTAAGCCGC ACCACCTACA GCCTGCAGGA GCTTGGTGCC ATGGGCATGG GAGACCTGCT CAGTGCCATG TTCGACTTCA GCGAGAAGCT CAACTCCCTG GCGCTTACCG AGGAGCT GGGCCTCTTC ACCGCGGTGG TGCTTGTCTC TGCAGACCGC TCGGGCATGG AGAATTCCCGC TTCGGTGGAG CAGCTCCAGG AGACGCTGCT GCGGGCTCTT CGGGCTCTGG TGCTGAAGAA CCGGCCCTTG GAGACTTCCC GCTTCACCAA GCTGCTGCTC AAGCTGCCGG ACCTGCGGAC CCTGAACAAC ATGCATTCCGAGAAGCTGCTGTCCTTCCGGGTGGACGCCCAGTGA (SEQ ID NO: 2) Homo sapiens nuclear receptor subfamily 1 group H member 3 (NR1H3), transcript variant 1 (CCDS7929.1) mRNA (i.e., human LXRa mRNA): 1 11 ATGTCCTTGT GGCTGGGGGC CCCTGTGCCT GACATTCCTC CTGACTCTGC GGTGGAGCTG TGGAAGCCAG GCGCACAGGA TGCAAGCAGC CAGGCCCAGG GAGGCAGCAG CTGCATCCTC AGAGAGGAAG CCAGGATGCC CCACTCTGCT GGGGCTGGGGGGGGGGGCT GCAGAGCCCA CAGCCCTGCT CACCAGGGCA GAGCCCCCTT CAGAACCCAC AGAGATCCGT CCACAAAAGC GGAAAAAGGG GCCAGCCCCC AAAATGCTGG GGAACGAGCT ATGCAGCGTG TGTGGGGACA AGGCCTCGGG CTTCCACTAC AATGGACTGAGGCTGGGGGGGGG TTCTTCCGCC GCAGCGTCAT CAAGGGAGCG CACTACATCT GCCACAGTGG CGGCCACTGC CCCATGGACA CCTACATGCG TCGCAAGTGC CAGGAGTGTC GGCTTCGCAA ATGCCGTCAG GCTGGCATGC GGGAGGAGTG TGTCCTGTCA GAAGAACAGAGA GCGACTAGGAG GCGACTAGGAG AGGAACAGGC TCATGCCACA TCCTTGCCCC CCAGGGCTTC CTCACCCCCC CAAATCCTGC CCCAGCTCAG CCCGGAACAA CTGGGCATGA TCGAGAAGCT CGTCGCTGCC CAGCAACAGT GTAACCGGCG CTCCTTTTCT GACCGGCTTC GAGTCACCCCGTCGCCGATCGCCGATC GGAGGCCCGT CAGCAGCGCT TTGCCCACTT CACTGAGCTG GCCATCGTCT CTGTGCAGGA GATAGTTGAC TTTGCTAAAC AGCTACCCGG CTTCCTGCAG CTCAGCCGGG AGGACCAGAT TGCCCTGCTG AAGACCTCTG CGATCGAGGT GATGCTTTCTCTCGGGAGGTACAA CCCTGGGAGT GAGAGTATCA CCTTCCTCAA GGATTTCAGT TATAACCGGG AAGACTTTGC CAAAGCAGGG CTGCAAGTGG AATTCATCAA CCCCATCTTC GAGTTCTCCA GGGCCATGAA TGAGCTGCAA CTCAATGATG CCGAGTTTGC CTTGCTCATT GCTATCAGCA TCTTCTCTGC AGACCGGCCC AACGTGCAGG ACCAGCTCCA GGTAGAGAGG CTGCAGCACA CATATGTGGA AGCCCTGCAT GCCTACGTCT CCATCCACCA TCCCCATGAC CGACTGATGT TCCCACGGAT GCTAATGAAA CTGGTGAGCC TCCGGACCCT GAGCAGCGTC CACTCAGAGC AAGTGTTTGC ACTGCGTCTG CAGGACAAAA AGCTCCCACC GCTGCTCTCT GAGATCTGGG ATGTGCACGA ATGA (SEQ ID NO: 3)

[0033] It should be understood that the scope of the present disclosure also includes allelic variants of SEQ ID NOS: 1-3 known to those of skill in the art. The term "allelic variant" refers to any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variants arise naturally through mutation and can result in polymorphism within a population. Genetic variants can be silent (no change in the encoded polypeptide) or can encode polypeptides with altered amino acid sequences. In some embodiments, an allelic variant is a silent mutation variant.

[0034] Additionally, the present disclosure also encompasses nucleic acids encoding biologically active fragments or variants of Nr1d1, Rora, or LXRa. Biologically active fragments or variants are "functional equivalents," a term well understood in the art and further defined herein. Using any method disclosed herein or known in the art for establishing nuclear hormone receptor activity, the requisite biological activity of the fragment or variant is about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, and any range derivable therein, e.g., about 70% to about 80%, more preferably about 81% to about 90%, or even more preferably about 91% to about 99%, of the wild-type, native polypeptide. As used herein, the term "wild-type" refers to a fragment that does not result in an undesired phenotype or that is believed to result in a "normal" phenotype typical of the species in which it occurs in nature.

[0035] When referring to a numerical value, the terms "about" and "approximately" are used interchangeably herein and refer to being within an acceptable error range for the particular value as determined by one of ordinary skill in the art. Determining such a value will depend, at least in part, on how the value is measured or determined, including, for example, the limitations of the measurement system, i.e., the degree of precision needed for a particular purpose. For example, the term "about" can mean within one standard deviation or more than one standard deviation, as is customary in the art. Alternatively, when referring to a numerical value, the term "about" can mean ±20%, usually ±10%, often ±5%, and more often ±1% of the numerical value. However, in general, when a specific value is described in an application or claim, unless otherwise specified, the term "about" will mean within an acceptable error range for the particular value, usually within one standard deviation.

[0036] For these sequences and all other sequences provided herein, a fragment is defined as a portion of a whole that is less than the whole. Furthermore, fragment sizes range from one nucleotide or amino acid within a polynucleotide or polypeptide sequence to one less nucleotide or amino acid than the entire polynucleotide or polypeptide sequence. Finally, a fragment is defined as any portion of a complete polynucleotide or polypeptide sequence that is intermediate between the extremes defined above. For example, a fragment of any of the nuclear hormone receptor genes disclosed herein is about 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 150 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 350 nucleotides, 400 nucleotides, 450 nucleotides, 500 nucleotides, 550 nucleotides, 600 nucleotides, 650 nucleotides, 700 nucleotides, 750 nucleotides, 800 nucleotides, 850 nucleotides, 900 nucleotides, 950 nucleotides, 1000 nucleotides, 1100 nucleotides, 1200 nucleotides, 1300 nucleotides, 1400 nucleotides, or 1500 nucleotides in length.

[0037] The term "derivative thereof" refers to a nucleotide sequence having at least about 70%, typically at least about 75%, often at least about 80%, more often at least about 85%, even more often at least about 90%, more often at least about 95%, and most often at least about 99% sequence identity or identity to those disclosed in SEQ ID NOs: 1-3.

[0038] The terms "identical" and percent "identity" are used interchangeably herein and, in the context of two or more nucleic acids, refer to two or more sequences or subsequences that are the same or that have the same specified percentage of nucleotides when compared and aligned for maximum correspondence, as determined using a sequence comparison algorithm, such as those exemplified below, or by visual inspection.

[0039] Alternatively, the phrase "substantially identical" in the context of two nucleic acid sequences refers to two or more sequences or subsequences that, when compared and aligned for maximum correspondence, have at least about 75%, typically at least about 80%, often at least about 85%, more often at least about 90%, and most often at least about 95% or more nucleotide identity, as determined, for example, using a sequence comparison algorithm such as those described below or by visual inspection. Generally, substantial identity exists over a sequence region at least about 40-60 nucleotides in length, in other cases over a region at least about 60-80 nucleotides in length, and in still other cases over a region at least 90-100 nucleotides in length; in still other cases, the sequences are substantially identical over the entire length of the sequences being compared, e.g., the nucleotide coding regions. Examples of possible modifications include the insertion of one or more nucleotides into a sequence, the addition of one or more nucleotides to either end of the sequence, or the deletion of one or more nucleotides at either end or within the sequence. The degree of identity between two polynucleotides can be readily determined using computer algorithms and methods well known to those of skill in the art.

[0040] In sequence comparison, one sequence usually serves as a reference sequence, and the test sequence is compared to it.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, and subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated.Then, the sequence comparison algorithm calculates the percent sequence identity of the test sequence to the reference sequence based on the designated program parameters.

[0041] Optimal alignment of sequences for comparison can be determined, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), the similarity search method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection [generally, Current Protocols in Molecular Biology, (Ausubel, F. M. et al., eds.), John Wiley & Sons, Inc., New York (1987-1999, supplement 46 (April 1999) inclusive. Sequence comparisons using these programs are typically run using the default parameters specific to each program.

[0042] Another example of an algorithm suitable for determining percentages of sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available from the National Center for Biotechnology Information. This algorithm identifies high-scoring sequence pairs (HSPs) by first identifying short words of length W in the query sequence that, when aligned with words of the same length in a database sequence, match or meet a positive threshold score T. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits serve as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as long as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues, always >0) and N (penalty score for mismatching residues, always <0). Extension of word hits in each direction is stopped when the cumulative alignment score decreases from the maximum by an amount X, when the accumulation of one or more negative-scoring residue alignments causes the cumulative score to fall below 0, or when the end of either sequence is reached. The default parameters of the BLAST program are suitable for identifying whether a nucleic acid is within the scope of this disclosure. The BLASTN program (for nucleotide sequences) uses the following defaults: word length (W) of 11, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The TBLATN program (which uses protein sequences instead of nucleotide sequences) uses, by default, a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

[0043] The BLAST algorithm not only calculates the percentage of sequence identity, but also performs statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the minimum total probability (P(N)), which indicates the probability that two nucleotide matches occur by chance. For example, if the minimum total probability in the comparison between the test nucleic acid and the reference nucleic acid is less than about 0.1, typically less than about 0.01, and often less than about 0.001, the nucleic acid is considered to be similar to the reference sequence.

[0044] Another indicator that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. "Substantially bind" refers to complementary hybridization between the probe nucleic acid and the target nucleic acid, and includes minor mismatches that can be accommodated by reducing the stringency of the hybridization medium to achieve the desired detection of the target polynucleotide sequence. The phrase "specifically hybridize" or "specific hybridization" refers to the fact that a molecule only binds, forms a duplex, or hybridizes to a specific nucleotide sequence under stringent conditions when that specific nucleotide sequence exists in the DNA or RNA of a complex mixture (e.g., whole cells).

[0045] The term "stringent conditions" refers to conditions under which a probe or primer hybridizes to a target subsequence but not to other sequences. Stringent conditions are sequence-dependent and vary depending on the environment. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) of a particular sequence at a defined ionic strength and pH. In other cases, stringent conditions are selected that are about 20°C or 25°C lower than the melting temperature of the sequence, and the probe has exact or near-exact complementarity to the target. As used herein, the melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half-dissociated into single strands. Methods for calculating the Tm of nucleic acids are well known in the art (see, e.g., Berger and Kimmel (1987) Methods in Enzymology, vol. 152: Guide to Molecular Cloning Techniques, San Diego: Academic Press, Inc. and Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., vols. 1-3, Cold Spring Harbor Laboratory), which are incorporated herein by reference. As indicated in standard references, when a nucleic acid is in an aqueous solution of 1 M NaCl, a simple estimate of the Tm value can be calculated using the following formula: Tm = 81.5 + 0.41 (% G + C) (see, e.g., Anderson and Young, "Quantitative Filter Hybridization," in Nucleic Acid Hybridization (1985)). Other references include more sophisticated calculations that take into account structural and sequence characteristics in calculating Tm.The melting temperature of a hybrid (and stringent hybridization conditions) is affected by various factors, including the length and nature (DNA, RNA, base composition) of the probe or primer, the nature of the target (DNA, RNA, base composition, whether in solution or immobilized, etc.), and the concentrations of salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol). The effects of these factors are well known and are discussed in standard references in the art (e.g., Sambrook, supra; Ausubel, supra). Typically, stringent conditions involve a salt concentration of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion (or other salts) at pH 7.0 to 8.3, a temperature of at least about 30°C for short probes or primers (e.g., 10 to 50 nucleotides), and a temperature of at least about 60°C for long probes or primers (e.g., greater than 50 nucleotides). Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide.

[0046] In some embodiments, the composition containing the recombinant nucleic acid or rDNA is administered by electroporation. Alternatively, the composition is administered via biodegradable Nile Red poly(lactide-co-glycolide) (PLGA) nanoparticle-based gene delivery, small molecule-based gene delivery, naked DNA delivery, virus-based gene delivery (e.g., adeno-associated virus delivery), or genome editing systems (e.g., CRISPR).

[0047] Nucleic acid sequences encoding NHRs can be obtained using recombinant methods known in the art, for example, by deriving the gene from a vector known to contain the NHR gene or by directly isolating the gene from cells and tissues containing the NHR gene using standard techniques. Alternatively, the gene of interest can be produced synthetically. Nucleic acids can be cloned into a variety of vectors, including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, PCR-generated linear DNA sequences, and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and vectors optimized for in vitro transcription.

[0048] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, such as oil-in-water emulsions, micelles, mixed micelles, carbohydrates, peptides, cationic polymers, and liposomes. An exemplary colloidal system used as a delivery vehicle in vitro and in vivo is a liposome (e.g., artificial membrane vesicle).

[0049] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for introducing nucleic acids into host cells (in vitro, ex vivo, or in vivo). In another embodiment, the nucleic acid may be associated with a lipid. The lipid-associated nucleic acid may be encapsulated within the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, attached to the liposome via a linking molecule bound to both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained as a suspension in lipids, contained in or complexed with micelles, or otherwise associated with lipids. Lipid, lipid / RNA, or lipid / expression vector-related compositions are not limited to a particular structure in solution. For example, they may exist as bilayer structures, micelles, or "collapsed" structures. They may also simply be dispersed in solution, forming aggregates that are not uniform in size or shape. Lipids are fatty substances that may be naturally occurring or synthetic. For example, lipids include the lipid droplets that occur naturally in the cytoplasm, as well as a class of compounds that contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, aminoalcohols, and aldehydes.

[0050] Suitable lipids for use are commercially available. For example, dimyristyl phosphatidylcholine ("DMPC") is available from Sigma, St. Louis, MO; dicetyl phosphate ("DCP") is available from K&K Laboratories (Plainview, NY); cholesterol ("Choi") is available from Calbiochem-Behring; and dimyristyl phosphatidylglycerol ("DMPG") and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. "Liposome" is a generic term that encompasses a variety of unilamellar and multilamellar lipid vesicles formed by the formation of enclosed lipid bilayers or aggregates. Liposomes may be characterized as vesicular structures with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers. However, compositions with structures in solution that differ from the typical vesicle structure are also included. For example, lipids may form micelles or exist as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes have also been investigated.

[0051] Optionally, the method of the present invention further includes administering a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" is art-recognized and refers to compositions, polymers, and other materials and / or dosage forms that, within the scope of sound medical judgment, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic reaction, or other problems or complications, commensurate with a reasonable benefit / risk ratio. For example, a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, that is involved in carrying or transporting a supplement or composition, or its components, from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other components of the supplement and not harmful to the patient. Optionally, a pharmaceutically acceptable carrier is non-pyrogenic. Examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars (such as lactose, glucose, and sucrose); (2) starches (such as corn starch and potato starch); (3) cellulose and its derivatives (such as sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate); (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients (such as cocoa butter and suppository wax); (9) oils (such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil); (10) glycols (such as propylene glycol); (11) polyols (such as glycerin, sorbitol, mannitol, and polyethylene glycol); (12) esters (such as ethyl oleate and ethyl laurate); (13) agar; (14) buffers (such as magnesium hydroxide and aluminum hydroxide); (15) alginic acid; and (16) pyrogen-free water. (17) Isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) phosphate buffer, and (21) other nontoxic compatible substances used in pharmaceutical formulations.

[0052] Typically, polynucleotides and / or other biological agents are purified and / or isolated prior to administration. As used herein, an "isolated" or "purified" nucleic acid molecule or polynucleotide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. A purified compound is at least 60% by weight (dry weight) of the compound of interest. Typically, preparations are at least 75%, often at least 90%, and most often at least 99% by weight of the compound of interest. For example, a purified compound is at least 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99%, or 100% (w / w) of the compound of interest by weight. Purity is measured by appropriate standard methods, such as column chromatography, thin-layer chromatography, or high-performance liquid chromatography (HPLC) analysis. A purified or isolated polynucleotide (ribonucleic acid (RNA) or deoxyribonucleic acid (DNA)) is free of naturally occurring flanking genes or sequences. Purification also defines the degree of sterility that makes it safe for human administration, i.e., free from infectious or toxic substances.

[0053] Similarly, "substantially pure" means that the nucleotides have been separated from components that naturally accompany them. Typically, nucleotides are substantially pure when they are at least about 60%, 70%, 80%, 90%, 95%, or 99%, by weight, nucleotides or nucleic acids and are free from the naturally occurring organic molecules with which they are naturally associated.

[0054] Conservatively modified variants of SEQ ID NOS: 1-3 are also within the scope of this disclosure. "Conservatively modified variations" of a particular polynucleotide sequence refer to polynucleotides that encode identical or essentially identical amino acid sequences. Due to the degeneracy of the genetic code, a particular polypeptide can be encoded by a large number of functionally identical nucleic acids. For example, the codons CGU, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent substitutions" or "silent mutations," and are one type of "conservatively modified mutation." All polynucleotide sequences encoding polypeptides described herein also describe all possible silent variations, unless otherwise specified. Thus, silent substitutions are an implicit feature of all nucleic acid sequences encoding amino acids. Those of skill in the art will recognize that each codon within a nucleic acid (except AUG, which is usually the only codon for methionine) can be modified using standard techniques to produce a functionally identical molecule.

[0055] An "isolated nucleic acid" refers to a nucleic acid that is free of the genes that flank it in the naturally occurring genome of the organism from which it is derived. This term covers, for example, (a) DNA that is part of a naturally occurring genomic DNA molecule, but is not flanked by both nucleic acid sequences that flank that molecule in the genome of the naturally occurring organism; (b) nucleic acid that has been incorporated into a prokaryotic or eukaryotic vector or genomic DNA in such a way that the resulting molecule is not identical to the naturally occurring vector or genomic DNA; (c) discrete molecules such as cDNA, genomic fragments, fragments produced by polymerase chain reaction (PCR), or restriction fragments; and (d) recombinant nucleotide sequences that are part of a hybrid gene, i.e., a gene encoding a fusion protein. Isolated nucleic acid molecules according to the present invention also include synthetically produced molecules, as well as any nucleic acid that has been chemically modified and / or has a backbone modified. For example, an isolated nucleic acid is a purified cDNA or RNA polynucleotide.

[0056] Although the phrase "nucleic acid molecule" primarily refers to the physical nucleic acid and the phrase "nucleic acid sequence" refers to the linear list of nucleotides in a nucleic acid molecule, the two terms can be used interchangeably.

[0057] The terms "effective amount" and "therapeutically effective amount" of a formulation or formulation component refer to a sufficient amount of the formulation or component, alone or in combination, to produce the desired effect. For example, an "effective amount" refers to the amount of a compound, alone or in combination, necessary to alleviate or prevent eye disease in a mammal. Ultimately, the attending physician or veterinarian will determine the appropriate amount and method of administration.

[0058] As used herein, the terms "therapy" and "treatment" refer to the administration of an agent or formulation to a clinically symptomatic individual suffering from an adverse condition, disorder, or disease to reduce the severity and / or frequency of symptoms, eliminate the symptoms and / or their underlying causes, and / or promote the improvement or repair of damage.

[0059] The terms "prevent" and "prevention" refer to the administration of an agent or composition to a clinically asymptomatic individual susceptible to or prone to a particular adverse condition, disorder, or disease, and thus relate to the prevention of the onset of symptoms and / or their underlying causes.

[0060] In some embodiments, the fragments of the present disclosure comprise or consist essentially of specific domains required for or contributing to the functional activity of Nr1d1, Nr2e3, Rora, Nupr1, Nr2c1, or LXRa. For example, nuclear hormone receptors possess evolutionarily conserved domains shared by all members of the family, including the highly variable A / B domain, the N-terminal DNA-binding domain, the flexible hinge region, the C-terminal ligand-binding domain, and the dimerization domain.

[0061] Variants encompassed by the present invention include those having the following degrees of sequence identity to Nr1d1, Nr2e3, Rora, Nupr1, Nr2c1 or LXRa: about 50%, about 55%, about 60%, about 65%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85% , about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% and any range derivable therein, for example, about 70% to about 80%, typically about 81% to about 90%, and often about 91% to about 99% identity.

[0062] It is understood that, as a result of the degeneracy of the genetic code, all variations of the coding sequences of the nucleic acids of the invention which express polypeptides of the same sequence are within the scope of the present invention.

[0063] Any of several known recombinant methods can be used to produce DNA molecules encoding fragments or variants. Mutant production typically involves introducing mutations into the coding sequence to generate the desired amino acid sequence variants of the present invention. Site-directed mutagenesis is a well-known technique, and protocols and reagents are commercially available (e.g., Zoller, MJ et al., 1982, Nucl Acids Res 10:6487-6500; Adelman, JP et al., 1983, DNA 2:183-93). These mutations include simple deletions or insertions, systematic deletions, insertions or substitutions of clusters of bases, or single base substitutions.

[0064] In some embodiments, the present disclosure includes isolated AAV. As used herein, the term "isolated" with respect to AAV refers to AAV that has been isolated from its natural environment (e.g., a host cell, tissue, or subject) or artificially produced. Isolated AAV may be produced using recombinant methods. Such AAV is referred to herein as "recombinant AAV." Recombinant AAV (rAAV) may have tissue-specific targeting capabilities, such that the rAAV transgene is specifically delivered to one or more predetermined tissues. The AAV capsid is an important factor in determining these tissue-specific targeting capabilities. Therefore, rAAV with a capsid appropriate for the target tissue can be selected. In some embodiments, the rAAV comprises a capsid protein having an amino acid sequence corresponding to any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and variants thereof. Recombinant AAVs typically contain (i.e., harbor or encase) a recombinant nucleic acid of the present disclosure. Methods for obtaining recombinant AAVs with desired capsid proteins are well known in the art (see, e.g., U.S. Patent Publication No. 2003 / 0138772, which is incorporated herein by reference in its entirety). AAV capsid proteins that can be used in the rAAV of the present invention include those disclosed, for example, in G. Gao, et al., J. Virol, 78(12):6381-6388 (June 2004); G. Gao, et al., Proc Natl Acad Sci USA, 100(10):6081-6086 (May 13, 2003); U.S. Patent Publication Nos. 2003 / 0138772, 2007 / 0036760, and 2009 / 0197338, and WO2010 / 138263, all of which are incorporated herein by reference with respect to AAV capsid proteins and related nucleotide and amino acid sequences.Briefly, the method involves culturing a host cell containing a recombinant AAV vector consisting of a nucleic acid sequence encoding an AAV capsid protein or a fragment thereof, a functional rep gene, AAV inverted terminal repeats (ITRs) and a transgene, and sufficient helper functions to package the recombinant AAV vector into the AAV capsid protein.

[0065] Suitable AAVs that can be used in the methods described herein are disclosed in U.S. Patent Publication Nos. 2013 / 0195801 and 2012 / 0137379, all of which are incorporated by reference in their entireties.

[0066] The components cultured within the host cell to package the rAAV vector into an AAV capsid can be provided to the host cell in trans. Alternatively, one or more of the necessary components (e.g., recombinant AAV vector, rep sequence, cap sequence, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the necessary component(s) using methods known to those skilled in the art. Most suitably, such a stable host cell will contain the necessary components under the control of an inducible promoter. However, the necessary component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein. In yet another alternative, the selected stable host cell can contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters.

[0067] The recombinant AAV vector, rep sequence, cap sequence, and helper functions necessary to produce the rAAV of the present invention can be delivered to packaging host cells using any suitable NHR genetic elements (vectors). The selected genetic elements can be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of the present disclosure are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known, and the selection of an appropriate method is not a limitation of the present invention. See, for example, K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Patent No. 5,478,745.

[0068] In some embodiments, recombinant AAV can be produced using a triple transfection method. See, e.g., U.S. Patent No. 6,001,650. Typically, recombinant AAV is produced by introducing into host cells a recombinant AAV vector (containing an NHR transgene) packaged in an AAV particle, an AAV helper function vector, and an accessory function vector. The AAV helper function vector encodes "AAV helper function" sequences (e.g., rep and cap) that function in trans for productive AAV replication and encapsidation. In some embodiments, the AAV helper function vector supports efficient AAV vector production without producing detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in the present disclosure include the pHLP19 vector (described in U.S. Patent No. 6,001,650) and the pRep6cap6 vector (described in U.S. Patent No. 6,156,303), which are incorporated herein by reference in their entireties. Accessory function vectors encode nucleotide sequences for non-AAV-derived viral and / or cellular functions (e.g., "accessory functions") that are dependent on AAV replication. Accessory functions include those required for AAV replication, including moieties involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, cap expression product synthesis, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus.

[0069] In some embodiments, the present invention provides transfected host cells. The term "transfection" is used to refer to the uptake of foreign DNA by a cell; a cell is "transfected" when the foreign DNA is introduced into the cell membrane. Many transfection techniques are commonly known in the art. Such techniques can be used to introduce one or more exogenous nucleic acids, such as nucleotide integration vectors or other nucleic acid molecules, into a suitable host cell. A "host cell" refers to a cell that harbors or is capable of harboring a substance of interest. Often, host cells are mammalian cells, bacterial cells, or other suitable cells known to those skilled in the art. Host cells can be used as recipients of AAV helper constructs, AAV minigene plasmids, accessory function vectors, or other transfer DNAs involved in the production of recombinant AAV. The term also includes the progeny of the original transfected cell. Thus, as used herein, "host cell" can refer to a cell transfected with an exogenous DNA sequence. It is understood that due to natural, accidental, or deliberate mutation, the progeny from a single parental cell may not necessarily be completely identical in morphology, genomic, or total DNA complement to the original parent.

[0070] In some embodiments, the present disclosure provides isolated cells. As used herein, the term "isolated" with respect to cells refers to cells isolated from their natural environment (e.g., a tissue or subject). As used herein, the term "cell line" refers to a cell population capable of continuous or long-term growth and division in vitro. In many cases, cell lines are clonal populations derived from a single progenitor cell. Furthermore, it is known in the art that spontaneous or induced changes in karyotype may occur during storage or transfer of such clonal populations. Thus, cells derived from a reference cell line may not be exactly identical to the ancestral cell or culture, and the reference cell line includes such variants. As used herein, the term "recombinant cell" refers to a cell into which an exogenous DNA segment, such as a DNA segment leading to the transcription of a biologically active polypeptide or the production of a biologically active nucleic acid, such as RNA, has been introduced.

[0071] The term "vector" includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, or virion, that, when associated with appropriate regulatory elements, is capable of replication and transfer of genetic sequences between cells. Thus, the term encompasses cloning and expression vectors as well as viral vectors. In some embodiments, a useful vector may be one in which a nucleic acid segment to be transcribed is placed under the transcriptional control of a promoter. A "promoter" refers to a DNA sequence recognized by the synthetic machinery of a cell or introduced synthetic machinery necessary to initiate specific transcription of a gene. The phrases "operably positioned," "under control," or "under transcriptional control" refer to the promoter being in the correct position and orientation relative to a nucleic acid to control the initiation of RNA polymerase and expression of the gene. The term "expression vector or construct" refers to any type of genetic construct containing a nucleic acid capable of transcribing part or all of a nucleic acid coding sequence. In some embodiments, expression includes transcription of a nucleic acid, for example, to produce a biologically active polypeptide product or an inhibitory RNA (e.g., shRNA, miRNA) from the transcribed gene.

[0072] The foregoing methods for packaging recombinant vectors into desired AAV capsids to produce the rAAV of the present disclosure are not limiting, and other suitable methods will be apparent to the skilled artisan upon reading this disclosure.

[0073] The recombinant nucleic acid of the present invention may be a recombinant AAV vector. The recombinant AAV vector may be packaged into a capsid protein and administered to a subject and / or delivered to selected target cells. A "recombinant AAV (rAAV) vector" typically comprises at least a transgene and its regulatory sequences. In some embodiments, the transgene also includes 5'- and 3'-AAV inverted repeats (ITRs). The transgene may also include one or more regions encoding one or more NHRs, as disclosed elsewhere herein.

[0074] The AAV sequences of the vector typically contain cis-acting 5' and 3' inverted repeat sequences (see, e.g., BJ Carter, in "Handbook of Parvoviruses," ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The length of the ITR sequences ranges from about 100 bp to about 200 bp, but usually ranges from about 110 bp to about 175 bp, often from about 120 bp to about 150 bp, and most frequently from about 130 bp to about 140 bp. In some embodiments, substantially the entire ITR-encoding sequence is used in the molecule, although some minor modifications of these sequences are tolerated. The ability to alter these ITR sequences is within the skill of those in the art. One example of such a molecule for use in the present invention is a "cis-acting" plasmid containing a selected transgene sequence and associated regulatory elements flanked by 5'- and 3'-AAV ITR sequences. AAV ITR sequences can be obtained from any known AAV, including currently identified mammalian AAV types.

[0075] Thus, the recombinant nucleic acid may comprise an inverted terminal repeat (ITR) of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and variants thereof. The recombinant nucleic acid may also comprise a promoter operably linked to one or more NHRs. The promoter may be a tissue-specific promoter, a constitutive promoter, or an inducible promoter.

[0076] In addition to the major elements identified above for recombinant AAV vectors, vectors may also include conventional regulatory elements operably linked to elements of the transgene in a manner that permits transcription, translation, and / or expression in cells transfected with the vector or infected with a virus produced by the present invention. As used herein, "operably linked" sequences include both expression control sequences contiguous with the gene of interest and expression control sequences that act in trans or remotely to regulate the gene of interest. Expression control sequences include appropriate transcription initiation, transcription termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (e.g., Kozak consensus sequences); sequences that increase protein stability; and, if necessary, sequences that increase secretion of the encoded product. Numerous expression control sequences, including native, constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be utilized.

[0077] As used herein, a nucleic acid sequence (e.g., a coding sequence) and a regulatory sequence are said to be operably linked when they are covalently linked such that expression or transcription of the nucleic acid sequence is under the influence or control of the regulatory sequence. When translation of the nucleic acid sequence into a functional protein is desired, induction of a promoter within the 5' regulatory sequence results in transcription of the coding sequence, and the nature of the linkage between the two DNA sequences is operably linked if it (1) does not result in the introduction of a frameshift mutation, (2) does not interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) does not interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region is operably linked to a nucleic acid sequence if it is capable of causing transcription of that DNA sequence such that the resulting transcript can be translated into a desired protein or polypeptide. Similarly, two or more coding regions are operably linked if they are linked such that transcription from a common promoter results in the expression of two or more proteins translated in frame. In some embodiments, operably linked coding sequences produce a fusion protein. In some embodiments, the operably linked coding sequences produce a functional RNA (eg, miRNA).

[0078] In the case of nucleic acids encoding proteins, a polyadenylation sequence is usually inserted after the transgene sequence and before the 3'-AAV ITR sequence. rAAV constructs useful in the present invention may also include an intron, preferably located between the promoter / enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is called the SV-40 T intron sequence. The intron may also be derived from the β-actin gene. Internal ribosome entry sites (IRES) can also be used as vector elements.

[0079] The exact nature of regulatory sequences required for gene expression in host cells may vary depending on the species, tissue, or cell type, but generally include 5' non-transcribed and 5' non-translated sequences, such as the TATA box, capping sequence, CAAT sequence, and enhancer elements, which are involved in initiation of transcription and translation, respectively, as necessary. In particular, such 5' non-transcribed regulatory sequences include promoter regions containing promoter sequences for controlling transcription of operably linked genes. Regulatory sequences may also include enhancer sequences or upstream activating sequences as necessary. Vectors of the present invention may optionally include 5' leader or signal sequences. The selection and design of appropriate vectors is within the ability and discretion of one of ordinary skill in the art.

[0080] Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally containing the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), the SV40 promoter, and the dihydrofolate reductase promoter. Inducible promoters allow for the control of gene expression and can be controlled by exogenously supplied compounds, environmental factors such as temperature, or specific physiological states, such as the acute phase, a specific differentiation state of cells, or the presence of only replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including, but not limited to, Invitrogen, Clontech, Ariad, and others. Many other systems have been described, and one of skill in the art can readily select one. Examples of inducible promoters controlled by an exogenous promoter include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system, the ecdysone insect promoter, the tetracycline-repressible system, the tetracycline-inducible system, the RU486-inducible system, and the rapamycin-inducible system. Still other types of inducible promoters that may be useful in this context include promoters controlled by specific physiological states (e.g., temperature, acute phase, a particular differentiation state of cells, or replicating cells only).

[0081] In another embodiment, the native promoter of the transgene or a fragment thereof is used. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites, Kozak consensus sequences, etc., can also be used to mimic native expression. In some embodiments, the control sequence confers tissue-specific gene expression. In some cases, the tissue-specific control sequence binds to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific control sequences (e.g., promoters, enhancers, etc.) are well known in the art. In some embodiments, the promoter is a chicken β-actin promoter.

[0082] The compositions disclosed herein are administered in an amount sufficient to transfect cells of the desired tissue and provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to selected tissues (e.g., neurons and other neural cells or tissues) and administration via subcutaneous, intrapancreatic, intranasal, parenteral, intravenous, intramuscular, intrathecal, intracerebral, oral, intraperitoneal, inhalation, or other routes. Administration routes can be combined as needed. Delivery of certain compositions of the present disclosure to a subject can be, for example, via administration into the subject's bloodstream. Administration into the bloodstream can be via injection into a vein, artery, or other blood vessel. Furthermore, in certain instances, it may be desirable to deliver compositions of the present disclosure to brain tissue, meninges, neurons, glial cells, astrocytes, oligodendrocytes, cerebrospinal fluid (CSF), interstitial spaces, etc. In some embodiments, compositions of the present disclosure can be delivered directly to the spinal cord or brain (e.g., prefrontal cortex, etc.) by injection with a needle, catheter, or related device into the ventricular region, as well as the striatum (e.g., the caudate nucleus or putamen of the striatum) and neuromuscular junction or cerebellar lobule, using neurosurgical techniques known in the art, such as stereotactic injection.

[0083] In certain situations, it may be desirable to deliver the compositions of the present disclosure as appropriately formulated pharmaceutical compositions disclosed herein epidurally, intracerebrally, intravenously, subcutaneously, intrapancreatically, intranasally, parenterally, intravenously, intramuscularly, orally, intraperitoneally, or by inhalation. Those skilled in the art will appreciate that desirable administration of the compositions of the present disclosure also includes ex vivo administration. In some embodiments, ex vivo administration involves (1) isolating a cell or tissue of interest from a subject, (2) contacting the cell or tissue with a composition of the present disclosure in an amount sufficient to provide sufficient levels of gene transfer and expression without undue adverse effects, and (3) transplanting the cell or tissue back into the subject. In some embodiments, the cells or tissue can be cultured ex vivo for several days before and / or after transfection.

[0084] Cells or tissues can be isolated from a subject by any suitable method.For example, cells or tissues can be isolated by surgery, biopsy (for example, biopsy of skin tissue, lung tissue, liver tissue, adipose tissue, etc.), or by collecting biological fluids such as blood.In some embodiments, cells are isolated from bone marrow.In some embodiments, cells are isolated from adipose tissue.In some embodiments, cells are isolated from liposuction.Suitable methods for isolating cells from adipose tissue for ex vivo transfection are known in the art.

[0085] In some embodiments, the isolated cells include stem cells, pluripotent stem cells, neural progenitor cells, lipoaspirate-derived stem cells, liver cells (e.g., hepatocytes), hematopoietic stem cells, mesenchymal stem cells, stromal cells, hematopoietic cells, blood cells, fibroblasts, endothelial cells, epithelial cells, or other suitable cells. In some embodiments, the transfected cells are induced pluripotent stem cells prepared from cells isolated from a subject.

[0086] When a viral vector, such as rAAV, is used, it can be delivered to a subject in the form of a composition according to any suitable method known in the art. The rAAV can be suspended in a physiologically compatible carrier (e.g., a composition) and administered to a subject, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or non-human primate (e.g., marmoset, macaque). The composition of the present invention may contain rAAV alone or in combination with one or more other viruses (e.g., a second rAAV encoding one or more different transgenes). In some embodiments, an rAAV vector expressing an NHR (e.g., RORA) is injected into the subject's CSF caudally using IT injection or cranially using cisterna magna injection. A suitable carrier can be easily selected by one skilled in the art, taking into account the indication of the rAAV. For example, one suitable carrier is saline, which can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, water, etc. Other carriers will be apparent to those skilled in the art.

[0087] Optionally, in addition to the rAAV and carrier(s), the compositions of the present invention may contain other conventional pharmaceutical ingredients, such as preservatives and chemical stabilizers. Suitable preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0088] The dosage of rAAV virions required to achieve a desired effect or "therapeutic effect," e.g., dosage units per vector genome / kilogram of body weight (vg / kg), varies depending on several factors. These factors include, but are not limited to, the route of administration of the rAAV, the gene or RNA expression level required to achieve a therapeutic effect, the particular disease or disorder being treated, and the stability of the gene or RNA product. Those skilled in the art can easily determine the dosage range of rAAV virions for treating a subject with a particular disease or disorder based on the aforementioned factors, as well as other factors well known in the art. An effective amount of rAAV is typically about 10 9 ~10 16 The volume ranges from about 10 μL to about 100 mL of solution containing genome copies. Other volumes of solution may also be used. The volume used will typically vary depending on the size of the subject, the dose of rAAV, the route of administration, etc. For example, for intravenous administration, volumes ranging from 10 μL to 100 μL, 100 μL to 1 mL, 1 mL to 10 mL, or more may be used. In some cases, about 10 10 ~10 12 The dosage of rAAV genome copies is appropriate. In some embodiments, the rAAV is administered at a dose of 10 per subject. 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 In some embodiments, the rAAV is administered at a dose of 10 genome copies. 10 , 10 11 , 10 12 , 10 13 , or 10 14 It is administered at a dose of genome copies / kg.

[0089] The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, as is the development of appropriate dosages and treatment regimens for the use of specific compositions described herein in various treatment regimens.Typically, these formulations contain at least about 0.1% or more of the active ingredient, but the percentage of the active ingredient(s) can of course vary, conveniently ranging from about 1 or 2% to about 70 or 80% or more by weight or volume of the total formulation.Of course, the amount of active ingredient in each therapeutically useful composition can be prepared in such a way that an appropriate dosage is obtained in any given unit dose of the compound.Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations are taken into account by those skilled in the art of preparing such pharmaceutical formulations, and therefore, various dosages and treatment regimens may be desirable.

[0090] Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, mixtures thereof, and oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In most cases, this form is sterile and fluid to the extent that it is easy to inject. It must be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is desirable to add isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, such as aluminum monostearate and gelatin.

[0091] For example, when administering an injectable aqueous solution, the solution may be suitably buffered, if necessary, and the liquid diluent may first be rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, suitable sterile aqueous vehicles are known to those skilled in the art. For example, one dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection or injected at the intended injection site. Some variation in dosage will necessarily occur depending on the condition of the host. In any event, the individual responsible for administration will determine the appropriate dosage for each individual host.

[0092] Sterile injectable solution can be prepared by mixing the active composition of the present disclosure in the required amount with various other ingredients listed in this specification in a suitable solvent as needed, and then sterilizing by filtration.Generally, dispersion is prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and other necessary ingredients listed above.For the preparation of sterile injectable solution, the preferred method of preparing sterile powder is vacuum drying and freeze-drying technology, which can obtain a powder of active ingredient and any additional desired ingredients from the solution that has been previously sterile-filtered.

[0093] The compositions disclosed herein can also be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein) formed with inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as sodium, potassium, ammonium, calcium, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, procaine, and the like. Upon formulation, solutions are administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The formulations can be easily administered in a variety of dosage forms, such as injectable solutions, drug-release capsules, and the like.

[0094] As used herein, "carrier" includes any solvent, dispersion medium, vehicle, coating, diluent, antibacterial and antifungal agent, isotonic and absorption delaying agent, buffer, carrier solution, suspension, colloid, etc. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not cause allergic or similar undesirable reactions when administered to a host.

[0095] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles can be used to introduce the compositions of the present invention into suitable host cells. In particular, transgenes delivered by rAAV vectors can be formulated for delivery by encapsulating them in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles. Such formulations may be preferred for the delivery of pharmaceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes are generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulatory half-life have been developed (U.S. Patent No. 5,741,516). Furthermore, various methods for the preparation of liposomes and liposome-like formulations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434; 5,552,157; ​​5,565,213; 5,738,868; and 5,795,587).

[0096] Liposomes have been used effectively in many cell types that are typically resistant to transfection by other procedures. Additionally, liposomes do not have the DNA length constraints typical of virus-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into various cultured cell lines and animals. Several clinical trials validating the efficacy of liposome-mediated drug delivery have been successfully completed. Liposomes are formed from phospholipids dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also known as multilamellar vesicles (MLVs)). MLVs typically range in diameter from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters of 200–500 Å, containing aqueous solution at their centers. Alternatively, nanocapsule formulations of rAAV can be used. Nanocapsules generally encapsulate substances in a stable and reproducible manner. To avoid side effects due to intracellular polymer overload, such ultrafine particles (approximately 0.1 µm in size) must be designed using polymers that can be degraded in vivo. The use of biodegradable poly(alkyl cyanoacrylate) nanoparticles, which meet these requirements, has been investigated.

[0097] In addition to the delivery methods described above, the following techniques are contemplated as alternative methods for delivering rAAV compositions to a host: Sonophoresis (e.g., ultrasound) is used as a device to increase the rate and efficacy of drugs penetrating the circulatory system and is described in U.S. Patent No. 5,656,016. Other alternative drug delivery methods under consideration include intraosseous injection (U.S. Patent No. 5,779,708), microchip devices (U.S. Patent No. 5,797,898), transdermal matrices (U.S. Patent Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Patent No. 5,697,899).

[0098] Treatment methods

[0099] The present disclosure is based on the discovery of gene therapy methods that directly or indirectly administer modified genes to neurons or nerve cells to treat or prevent various neurological conditions or diseases. Exemplary neurological conditions or diseases that can be treated using the methods of the present disclosure include, but are not limited to, intellectual developmental disabilities, epilepsy, cerebellar ataxia, autism spectrum disorder (ASD), Parkinson's disease, Alzheimer's disease, neurodegenerative diseases of unknown cause, or combinations thereof.

[0100] In one embodiment, the present disclosure also features an expression vector, including a vector containing a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. Expression vectors contain sufficient cis-acting elements for expression; other elements for expression are supplied by the host cell or in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), RNA, and viruses incorporating recombinant polynucleotides (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses). The expression vectors of the present invention also contain one or more regulatory elements, such as a heterologous promoter. One specific recombinant polynucleotide containing an expression control sequence is shown in Figure 2. In this recombinant DNA or polynucleotide, the transgene hRORA is under the transcriptional control of the cytomegalovirus (CMV) enhancer and includes the chicken β-actin promoter (CBA) promoter, a Kozak sequence at the transcription start site, and an SV40 polyadenylation sequence. As shown in the figure, an NHR (e.g., hRORA) expression cassette is inserted between two AAV2 ITRs. In particular, the recombinant polynucleotide containing hRORA illustrated in Figure 2 comprises the nucleotide sequence of SEQ ID NO:4. cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt ggtcgcccgg cctcagtgag cgagcgagc cgcagagagg gagtggccaa ctccatcact aggggttcct gcggcctaag gcaattgaga tctcgacatt gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgcc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgcattac catggtcgag gtgagcccca cgttctgctt cactctcccc atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca gcgatgggg cgggggggggg ggggggggcg gcgccaggcg gggcggggcg gggcgagggg cggggcgggg cgaggcggag aggtgcggcg gcagccaatc agagcggcgc gctccgaaag tttcctttta tggcgaggcg gcggcggcgg cggccctata aaaagcgaag cgcgcggcgg gcgggagtcg ctgcgcgctg ccttcgcccc gtgccccgct ccgccgcgcg ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtgagcgggcggga cggcccttct cctccgggct gtaattagcg cttggtttaa tgacggcttg tttcttttct gtggctgcgt gaaagccttg aggggctccg ggagggccct ttgtgcgggg ggagcggctc ggggggtgcg tgcgtgtgtg tgtgcgtggg gagcgccgcg tgcggctccg cgctgcccgg cggctgtgag cgctgcgggc gcggcgcggg gctttgtgcg ctccgcagtg tgcgcgaggg gagcgcggcc gggggcggtg ccccgcggtg cggggggggc tgcgagggga acaaaggctg cgtgcggggt gtgtgcgtgg gggggtgagc agggggtgtg ggcgcgtcgg tcgggctgca accccccctg cacccccctc cccgagttgc tgagcacggc ccggcttcgg gtgcggggct ccgtacgggg cgtggcgcgg ggctcgccgt gccgggcggg gggtggcggc aggtgggggt gccgggcggg gcggggccgc ctcgggccgg ggagggctcg ggggaggggc gcggcggccc ccggagcgcc ggcggctgtc gaggcgcggc gagccgcagc cattgccttt tatggtaatc gtgcgagagg gcgcagggac ttcctttgtc ccaaatctgt gcggagccga aatctgggag gcgccgccgc accccctcta gcgggcgcgg ggcgaagcgg tgcggcgccg gcaggaagga aatgggcggg gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc ctctccagcc tcggggctgt ccgcgggggg acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg gctctagagc ctctgctaac catgttcatg ccttcttctttttcctacag ctcctgggca acgtgctggt tattgtgctg tctcatcatt ttggcaaaga atctcacgtg gtcgacgcta gcctcgagcc accatggagt cagctccggc agccccgac cccgccgcca gcgagccagg cagcagcgg gcggacgcgg ccgccggctc cagggagacc ccgctgaacc aggaatccgc ccgcaagagc gagccgcctg ccccggtgcg cagacagagc tattccagca ccagcagagg tatctcagta acgaagaaga cacatacacatc tcaaattgaa attattccat gcaagagatctg tggagacaaa tcatcaggaa tccattatgg tgtcattaca tgtgaaggct gcaagggctt tttcaggaga agtcagcaaa gcaatgccac ctactcctgt cctcgtcaga agaactgttt gattgatcga accagtagaa accgctgcca acactgtcga ttacagaaat gccttgccgt agggatgtct cgagatgctg taaaatttgg ccgaatgtca aaaaagcaga gagacagctt gtatgcagaa gtacagaaac accggatgca gcagcagcag cgcgaccacc agcagcagcc tggagaggct gagccgctga cgcccaccta caacatctcg gccaacgggc tgacggaact tcacgacgac ctcagtaact acattgacgg gcacacccct gaggggagta aggcagactc cgccgtcagc agcttctacc tggacataca gccttcccca gaccagtcag gtcttgatat caatggaatc aaaccagaac caatatgtga ctacacacca gcatcaggct tctttcccta ctgttcgttc accaacggcg agacttccc aactgtgtcc atggcagaattagaacacct tgcacagaat atatctaaat cgcatctgga aacctgccaa tacttgagag aagagctcca gcagataacg tggcagacct tttacagga agaaattgag aactatcaaa acaagcagcg ggaggtgatg tggcaattgt gtgccatcaa aattacagaa gctatacagt atgtggtgga gtttgccaaa cgcattgatg gatttatgga actgtgtcaa aatgatcaaa ttgtgcttct aaaagcaggt tctctagagg tggtgtttat cagaatgtgc cgtgcctttg actctcagaa caacaccgtg tactttgatg ggaagtatgc cagccccgac gtcttcaaat ccttaggttg tgaagacttt attagctttg tgtttgaatt tggaaagagt ttatgttcta tgcacctgac tgaagatgaa attgcattat tttctgcatt tttctgaatg tcagcagattc gctcatggct gcaagaaaag gtaaaaaattg aaaaaactgca acagaaaatt cagctagctc ttcaacacgt cctacagaag aatcaccgag aagatggaat actaacaaag ttaatatgca aggtgtctac attaagagcc ttatgtggac gacatacaga aaagctaatg gcatttaaag caatataccc agacattgtg cgacttcatt ttcctccatt atacaaggag ttgttcactt cagaatttga gccagcaatg caaattgatg ggtaaggtac cggatccgaa ttcgatatcg cggccgcctc gagcctaggg tttaaacctg atcataatca gccataccac atttgtagag gttttacttg ctttaaaaaa cctcccacac ctccccctga acctgaaaca taaaatgaat gcaattgttgttgttaactt gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttaacg cgcatgctgg ggatgcggtg ggctctatgg ccgcgggccg caggaacccc tagtgatgga gttggccact ccctctctgc gcgctcgctc gctcactgag gccgggcgac caaaggtcgc ccgacgcccg ggctttgccc gggcggcctc agtgagcgag cgagcgcgca gctgcctgca gg (SEQ ID NO: 4)

[0101] These methods can use various known nucleic acid vectors, such as recombinant viruses, such as recombinant adeno-associated viruses (rAAV), recombinant adenoviruses, recombinant retroviruses, recombinant poxviruses, and other viruses known in the art, as well as plasmids, cosmids, and phages.Many publications known in the art have discussed the use of various such vectors for gene delivery.See, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, latest edition; Kay, MA. et al., 2001, Nat.Med., 7:33-40; and Walther Wet al., 2000, Drugs 60:249-71.

[0102] The compositions of the present disclosure also include recombinant DNA, such as a recombinant human nuclear hormone receptor (hNHR) gene or fragment thereof, or mRNA thereof, or dbDNA thereof. The regulatory element may be endogenously present upstream or downstream of the gene, or it may be an exogenous regulatory element not found to regulate the gene in nature and introduced by recombinant DNA techniques known in the art. The regulatory element may be operably linked to a gene of the present disclosure or fragment thereof, or to a gene encoding a protein of the present disclosure or fragment thereof. Methods for constructing recombinant vectors are well known. For example, see WO00 / 15822 and all other references cited therein, all of which are incorporated by reference. When the vector is delivered to a subject, for example, to the subject's neural cells or brain tissue, the nucleic acid is optionally integrated into the cellular genome.

[0103] The compositions or rDNA of the present disclosure may also include appropriate sequences operably linked to the coding sequence or ORF to facilitate expression of the nuclear hormone receptor of the present disclosure in the target host cell. "Operatively linked" sequences include both expression control sequences, such as a promoter, contiguous with the coding sequence and expression control sequences acting in trans or distally to control expression of the polypeptide product.

[0104] Expression control sequences include appropriate transcription initiation, transcription termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (e.g., Kozak consensus sequences); sequences that increase nucleic acid or protein stability; and, if necessary, sequences that increase protein processing and / or secretion. A variety of expression control sequences, including native and non-native, constitutive, inducible, and / or tissue-specific ones, are known in the art and can be utilized herein depending on the type of expression desired.

[0105] Eukaryotic expression control sequences typically include a promoter, an enhancer (e.g., derived from immunoglobulin genes, SV40, or CMV), and a polyadenylation sequence, which may contain splice donor and acceptor sites. The polyadenylation sequence is usually inserted 3' to the coding sequence and 5' to the 3' ITR sequence. A suitable polyA sequence is derived from bovine growth hormone.

[0106] The promoter can be selected from a number of constitutive or inducible promoters capable of driving expression of a selected transgene in the setting of a neuronal cell or brain tissue. Typically, the promoter used is "cell-specific," meaning that it is selected to drive expression of a selected transgene in a particular neuronal cell type or brain tissue.

[0107] The rAAVs used in this disclosure can be constructed and produced using materials and methods described herein and known in the art. Methods for producing the constructs of this disclosure are conventional and include genetic engineering, recombinant engineering, and synthetic techniques readily understood by those skilled in the art.

[0108] Briefly, packaging of rAAV constructs into rAAV virions requires the presence in the host cell of sequences necessary for expression of AAV rep and AAV cap, or functional fragments thereof, as well as helper genes essential for AAV production. See, e.g., U.S. Patent Publication 2007 / 0015238, which describes the production of pseudotyped rAAV virion vectors encoding various serotypes of AAV Rep and Cap proteins and AdV transcripts that provide helper functions. For example, AAV rep and cap sequences can be introduced into host cells by known methods, including, but not limited to, transfection, electroporation, liposome delivery, membrane fusion, biolistic delivery of DNA-coated pellets, viral infection, and protoplast fusion.

[0109] In another embodiment, the nucleic acid of the present disclosure can be delivered via nanoparticles. Nanoparticles are, for example, lipid-based colloidal particles with a diameter of less than 100 nm. Nanoparticles for drug and gene delivery can be characterized by various parameters, such as particle size, size distribution, morphology, zeta potential, drug loading, injectability and injectability, in vitro drug release, and stability. Nanoparticle formulations vary depending on the purpose, including lipid composition, nucleic acid to lipid ratio, and formulation method. Nanoparticle assembly methods are known in the art and are described in Kompella et al., "Nanoparticles for Drug and Gene Delivery in Treating Diseases of the Eye"; Methods in Pharmacology and Toxicology, 2014, pages 291-316, the entire contents of which are incorporated herein by reference.

[0110] Genome editing systems can also be used to deliver the nucleic acids of the present disclosure. Examples of such genome editing systems include the CRISPER / Cas system, zinc finger nucleases (ZFNS), and transcription activator-like effector nucleases (TALENS). In such systems, the nucleic acids of the present disclosure are easily integrated into the genome of a host cell and expressed. In some embodiments, mutant forms of disease-causing genes (i.e., RORs) can be "edited" or selectively excised and replaced with any of the nucleic acids described herein. Expression is regulated by endogenous or exogenous regulatory elements, and expression of these nucleic acids improves or alleviates the symptoms of a clinical condition or disease.

[0111] The methods and compositions described herein relate to the restoration or normalization of phenotype. As used herein, "restoration" or "normalization" refers to increasing or decreasing the expression level or activity of a defective gene in a subject to a level similar to that of a subject not suffering from a neurological condition or disease, i.e., not exhibiting the neurological condition or disease disclosed herein. The restoration or normalization of neuronal or brain tissue activity can be measured or determined by various tests well known to those skilled in the art.

[0112] As described in detail below, genetic delivery of NHR genes to neuronal cells or brain tissue efficiently ameliorated the clinical, morphological, and functional defects associated with various genetic defects that lead to neurological conditions or diseases of the observed phenotypes disclosed herein.

[0113] Genetic variation is observed in many Mendelian monogenic disorders. While environmental influences may contribute slightly, the diversity of phenotypic outcomes is generally due to allelic heterogeneity or genetic modifier genes. Genetic modifiers are allelic variants distinct from the mutant gene that can alter the outcome of a neurological disease or condition by increasing or decreasing disease severity or by influencing disease onset and progression. Identifying genetic modifiers has a significant impact on predicting disease progression and developing new therapeutic strategies.

[0114] The data presented herein demonstrate the use of modifier genes in the treatment of various neurological conditions or diseases. In some embodiments, restoration of neuronal or brain tissue integrity and function was achieved through a gene therapy approach that delivers modifier genes rather than replacing the disease-causing gene. The approach described herein identifies genetic modifiers that suppress neurological conditions or diseases caused by several different genes that converge on specific nodes or pathways within a signaling network. Because genes do not function in isolation but in networks, the impact of gene delivery is felt across the entire network rather than a single gene. These studies demonstrate that viable therapeutic options with widespread impact may arise from genetic modifier genes that can modulate disease states by affecting not single genes but entire gene networks controlling specific biological processes.

[0115] Administration of genetic modifiers improves or treats clinical, morphological, and / or functional defects associated with primary gene mutations. In one specific embodiment of the present disclosure, RAR-related orphan receptor alpha (RORα), also known as NR1F1 (nuclear receptor subfamily 1, group F, member 1), is used in the modified gene therapy of the present disclosure. RORα plays an important role in regulating lipid metabolism, oxidative stress response, anti-inflammatory response, etc.

[0116] RORα, a member of the NR1 subfamily of nuclear hormone receptors, binds to DNA as a monomer or homodimer at the ROR response element (RORE), which contains a short AT-rich sequence followed by the core motif 5'-AGGTCA-3', upstream of several genes, enhancing their expression. RORα is one of the key regulators of embryonic development, cell differentiation, immunity, circadian rhythms, and lipid, steroid, xenobiotic, and glucose metabolism. While RORα has intrinsic transcriptional activity, some natural ligands, such as oxysterols, which act as agonists (25-hydroxycholesterol) or inverse agonists (7-oxygenated sterols), enhance or repress RORα transcriptional activity, respectively. RORα regulates the transcription of several genes by recruiting various combinations of cofactors to regulatory regions depending on the tissue, time, and promoter context. Some of the genes regulated by RORα are (i) circadian rhythmic expression of several clock genes, including CLOCK, ARNTL / BMAL1, NPAS2, and CRY1; (ii) cerebellar development, such as the sonic hedgehog (SHH) gene and other genes involved in calcium-mediated signaling; (iii) photoreceptor development, such as OPN1SW, OPN1SM, and ARR3; (iv) skeletal muscle development, such as MYOD1; (v) lipid metabolism, such as apolipoproteins APOA1, APOA5, APOC3, and PPARγ; These include genes CYP7B1 and SULT2A1, which encode phase I and phase II proteins involved in hepatic lipid, steroid, and xenobiotic metabolism; (vi) hepatic glucose metabolism through the regulation of G6PC1 and PCK1 by CRY1; (vii) adipocyte differentiation, such as CEBPB and PPARγ; (viii) lineage differentiation of undifferentiated CD4+ T helper cells into Th17 cells; (ix) hypoxic signaling, such as HIF-1α; and (x) anti-inflammatory effects, such as i-κB, which inhibits proinflammatory NF-κB signaling (see Figure 1).

[0117] In some embodiments, the compositions of the present disclosure are administered locally to nerve cells or neurons, or brain tissue, hi another embodiment, the compositions are administered intranasally.

[0118] The composition may be administered at a concentration of 0.001 μg to 100 μg, for example, 0.01 μg, 0.1 μg, 0.5 μg, 1.0 μg, 1.5 μg, 2.0 μg, 5.0 μg, 10 μg, 20 μg, 30 μg, 40 μg, 50 μg, 60 μg, 70 μg, 80 μg, 90 μg, or 100 μg. The composition may be administered in a volume of 0.01 μl to 10 μl, for example, 0.1 μl, 0.25 μl, 0.5 μl, 1 μl, 1.5 μl, 2 μl, 2.5 μl, 3 μl, 3.5 μl, 4 μl, 4.5 μl, 5 μl, 6 μl, 7 μl, 8 μl, 9 μl, or 10 μl. The composition may be administered once daily, once weekly, once monthly, every three months, every six months, or every 12 months. The composition may be administered for a period of one day, one week, one month, three months, six months, one year, two years, or five years. Alternatively, the composition may be administered only once.

[0119] The composition containing the nucleic acid can also be administered by electroporation. Alternatively, the composition can be administered via biodegradable Nile Red poly(lactide-co-glycolide) (PLGA) nanoparticle-based gene delivery, small molecule-based gene delivery, naked DNA delivery, virus-based gene delivery (e.g., adeno-associated virus delivery), or genome editing systems (e.g., CRISPR). Figure 2 shows a specific embodiment of a RORA transgene expression cassette that can be used to improve or treat a neurological condition or disease in a subject. In certain embodiments, the expression cassette is provided in an rAAV vector. In further embodiments, the rAAV vector is an AAV serotype 5-based (AAV5) vector, an AAV2 vector, an AAV8 vector, or an AAV9 vector. In certain embodiments, the rAAV vector is an AAV5 vector. In yet another embodiment, the rAAV vector is an AAV8 vector.

[0120] Other features and advantages of the present invention will be apparent from the following description of the preferred embodiments and the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All published foreign patents and patent applications cited herein are incorporated by reference. GenBank and NCBI submissions identified by accession numbers cited herein are incorporated by reference. All other published references, documents, manuscripts, and scientific literature cited herein are incorporated by reference. In the case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not limiting. [Example]

[0121] The present invention relates to the treatment of various clinical conditions or diseases using modified genes known as nuclear hormone receptor (NHR) genes. Nuclear receptors are a class of proteins responsible for a variety of activities, including, but not limited to, sensing steroids, thyroid hormones, cholesterol, and vitamins. These receptors have been shown to cooperate with other proteins to control the expression of various genes, thereby regulating the development, homeostasis, and metabolism of organisms. Therefore, these modified genes can be used to correct defects and genetic disorders that manifest as various clinical conditions and / or diseases. Nuclear receptors are believed to directly bind to DNA, thereby regulating the expression of neighboring genes. Therefore, these receptors are classified as transcription factors. One important characteristic that distinguishes nuclear receptors from other classes of receptors is their direct regulation of genomic DNA. Those skilled in the art are familiar with a wide variety of NHRs, including, but not limited to, RORA (i.e., RORα), NR1D1, and LXRa.

[0122] Some aspects of the present disclosure provide methods of using compositions that modify or restore the signaling pathways and / or functions of various genes for use in the treatment and / or prevention of various clinical conditions and disorders. For example, the present disclosure provides methods for treating clinical diseases or symptoms associated with neurological disorders. Exemplary neurological disorders that can be treated using the methods of the present disclosure include, but are not limited to, intellectual developmental disabilities, epilepsy, cerebellar ataxia, autism spectrum disorder (ASD), Parkinson's disease, Alzheimer's disease, neurodegeneration of unknown etiology, or a combination thereof.

[0123] Administration of gene modifiers improves the clinical, morphological, and functional defects associated with the primary gene mutation. In one specific embodiment of the present disclosure, retinoic acid-related orphan receptor alpha (RORα), also known as nuclear hormone receptor 1 subfamily F1 (NR1F1), is used in the modified gene therapy of the present disclosure. RORα plays an important role in regulating lipid metabolism, oxidative stress response, anti-inflammatory response, etc.

[0124] RORα, a member of the NR1 subfamily of nuclear hormone receptors, binds to DNA as a monomer or homodimer at the ROR response element (RORE), which contains a short AT-rich sequence followed by the core motif 5'-AGGTCA-3', upstream of several genes, enhancing their expression. RORα is one of the key regulators of embryonic development, cell differentiation, immunity, circadian rhythms, and lipid, steroid, xenobiotic, and glucose metabolism. While RORα has intrinsic transcriptional activity, some natural ligands, such as oxysterols, which act as agonists (25-hydroxycholesterol) or inverse agonists (7-oxygenated sterols), enhance or repress RORα transcriptional activity, respectively. RORα regulates the transcription of several genes by recruiting various combinations of cofactors to regulatory regions depending on the tissue, time, and promoter context. Some of the genes regulated by RORα are (i) circadian rhythmic expression of several clock genes, including CLOCK, ARNTL / BMAL1, NPAS2, and CRY1; (ii) cerebellar development, such as the sonic hedgehog (SHH) gene and other genes involved in calcium-mediated signaling; (iii) photoreceptor development, such as OPN1SW, OPN1SM, and ARR3; (iv) skeletal muscle development, such as MYOD1; (v) lipid metabolism, such as apolipoproteins APOA1, APOA5, APOC3, and PPARγ; These include genes CYP7B1 and SULT2A1, which encode phase I and phase II proteins involved in hepatic lipid, steroid, and xenobiotic metabolism; (vi) hepatic glucose metabolism through the regulation of G6PC1 and PCK1 by CRY1; (vii) adipocyte differentiation, such as CEBPB and PPARγ; (viii) lineage differentiation of undifferentiated CD4+ T helper cells into Th17 cells; (ix) hypoxic signaling, such as HIF-1α; and (x) anti-inflammatory effects, such as i-κB, which inhibits proinflammatory NF-κB signaling (see Figure 1).

[0125] RORα staggerer (RORα sg / RORα sg ) Mouse modelThe first homozygous staggerer mouse was observed in 1995 and recognized by its staggering gait, mild tremor, hypotonia, and underdeveloped cerebellar cortex with reduced granule and Purkinje cells. Twenty-five years later, the mutation was genetically mapped to a 160-kilobase interval on mouse chromosome 9 containing the RORα gene. This mutation removes an exon encoding part of the RORα ligand-binding domain, resulting in the production of a truncated protein. Since then, RORα has been identified. sg / RORα sg Phenotypes involving multiple physiological systems have been observed in mice. Neurological phenotypes include ataxia, hypoactivity, tremor, and abnormal gait, posture, coordination, and motor learning, with associated defects in the morphology of the cerebellum, cerebrum, and olfactory bulb. Staggerer mice also exhibited abnormal metabolic phenotypes, including elevated prothyrotropin and norepinephrine levels, depleted neuronal aspartate, taurine, and gamma-aminobutyric acid (GABA) levels, and reduced circulating cholesterol leading to abnormal lipid homeostasis.

[0126] Intellectual and Developmental Disabilities with or without Epilepsy or Cerebellar Ataxia (IDDECA) The human RORα gene is located on the long arm (q) of chromosome 15, and microdeletions and duplications of RORα at 15q22.2 have been reported in IDDECA patients. A multicenter study identified three copy number variant deletions, one disruptive duplication, and nine denovo point mutations (three truncations, one canonical splice site, and five missense mutations) related to the RORα gene in 16 individuals (13 families) with various neurodevelopmental delays and IDDECA. See Table 1. Table 1. Genotypes and clinical outcomes of RORA mutations in human participants. See Guissart et al., Am J Hum Genet, 2018, 102, pp. 744-759. [Table 1]

[0127] Using a zebrafish model, Guissart et al. compared 16 affected humans with RORα sg We recapitulated the neuroanatomical findings found in mice. While most mutations exhibited loss of function or hemifunction, two missense mutations in the DNA-binding domain exhibited predominant toxic effects. IDDECA exhibits either (A) a cognitive and motor phenotype characterized by moderate to severe intellectual disability (ID) with ataxia, severe cerebellar vermis hypoplasia, and generalized epilepsy, or (B) a cognitive and behavioral phenotype often associated with autism spectrum disorder (ASD), mild intellectual disability, normal cognitive function, and epilepsy. Cerebellar lesions caused by a truncated splice variant of RORα (TSV) in a zebrafish model were rescued using wild-type human RORα mRNA. IDDECA

[0128] Mutations in individuals 6, 7, 8, and 13 (who exhibited ASD) disrupt the RORα ligand-binding domain, consistent with reports that RORα is a candidate for ASD. Analysis has shown that RORα protein is recruited to approximately 2,544 gene promoter regions throughout the human genome, specifically to genes regulating neuronal differentiation, adhesion, survival, synaptogenesis, synaptic transmission, plasticity, axonogenesis, cortical and cerebellar development, cognition, memory, and spatial learning. Independent ChIP-quantitative PCR analysis confirmed that RORα protein binds to the promoter regions of selected ASD-associated genes (A2BP1, CYP19A1, ITPR1, NLGN1, and NTRK2). Expression levels of these ASD genes have been shown to be reduced in RORα-silenced human neurons and in prefrontal cortex tissue from ASD patients. Furthermore, two RORα polymorphisms (rs11639084 and rs4774388) have been shown to be associated with ASD risk. Treatment with the synthetic RORα agonist SR1078 reduced repetitive behaviors in the BTBR mouse model of autism, demonstrating that upregulation of RORα by the compositions disclosed herein is a viable gene therapy for intellectual and developmental disorders with or without epilepsy or cerebellar ataxia (IDDECA) and ASD.

[0129] The uses of RORα gene therapy disclosed herein are suitable for treating individuals exhibiting or at risk of developing ASD.

[0130] Autism spectrum disorderWild-type human RORA rescues cerebellar damage induced by RORA-TSV in zebrafish, but not by the R462Q mutant. Several studies have linked nuclear receptor defects to human autism. RORα polymorphisms (rs11639084 and rs4774388) are associated with ASD risk. Global methylation profiling revealed that epigenetic alterations in the RORα gene significantly reduced RORα protein levels in the brains of ASD patients. Multiple ASD-related genes are direct targets of RORα, and reduced RORα expression reduces the expression of these genes, leading to ASD. Purkinje cell loss has consistently been identified as a neuroanatomical abnormality in the brains of ASD patients. RORα has been shown to be important for Purkinje cell development. Therefore, increasing RORα expression could be a therapeutic approach for ASD. ASD patients exhibit significant disruption of their circadian rhythm, and RORα plays a role in circadian rhythm regulation. Environmental and metabolic factors in ASD have also been reported to affect the expression levels of RORα. Sex differences in the expression of RORα and its target genes in the brain have been investigated as a potential factor for the sex bias in autism. Furthermore, RORα sg Mice exhibit autism-associated behaviors compared to WT mice, including abnormal spatial learning, reduced exploratory ability, limited maze patrol, and increased perseverative behaviors.

[0131] RORα protein is reduced in autistic brains A study of twins, one with autism and one without, revealed increased CpG island methylation upstream of the RORα promoter region in the ASD twins. This resulted in decreased RORα protein expression in lymphoblastoid cell lines (LCLs) from the ASD twins (Figures 4 and 5). Postmortem examination of age-matched case-control individuals also showed decreased RORα protein expression in the prefrontal cortex and cerebellum of individuals with autism. These findings support the role of RORα in the pathogenesis of autism. sgThis is important because mouse studies have shown that the RORα protein is involved in several processes associated with autism, including Purkinje cell differentiation, cerebellar development, brain lipid homeostasis, protection from oxidative stress and inflammation, and circadian rhythms.

[0132] RORα in Purkinje cell and cerebellar development Purkinje cells express RORα very early in development and continue to do so into adulthood. sg In mice, the majority of Purkinje cells die within one month of birth. Surviving Purkinje cells fail to mature and develop spiny branches. RORα is essential for early Purkinje cell development, causing transient dendrite retraction and the formation of mature dendrites. RORα deficiency in adult mice also results in Purkinje cell defects, including premature dendritic atrophy and death, elevated FoxP2 levels, an immature "capuchon" stage of climbing fibers from brainstem olivary neurons, and multiple Purkinje cell innervation by climbing fibers in contrast to more mature single innervation. Thus, RORα is a terminal differentiation gene that defines the functional properties of mature Purkinje cells throughout their lifespan, from development to maintenance. The genetic program of developing Purkinje cells analyzed daily during prenatal development in mice revealed that RORα binds to promoter sites and controls the expression of Shh, Slc1a6, Itpr1, Pcp4, and Pcp2. These RORα target genes provide mitogenic activity and are also required for reciprocal signaling between Purkinje cells, granule cells, and cerebellar cells during cerebellar development. sgMouse studies suggest that RORα may play a role in cell proliferation, neuronal differentiation, and expression of mature neuronal markers (Ki67, DCX, and NeuN, respectively) in the dentate gyrus. The dentate gyrus is the first region where all sensory modalities converge to form a unique representation that connects different sensory stimuli, thereby playing a role in learning and memory. Liver X receptors (LXRs), nuclear receptors closely related to RORα, have been linked to developmental abnormalities in the dentate gyrus and autism spectrum disorders. RORα sg Exogenous RORα expression in mice ( FIG. 5 ) partially restored normal Purkinje cell numbers and neural architecture in the cerebellum, demonstrating that the compositions disclosed herein can be used to treat ASD.

[0133] RORα in brain lipid metabolism Polyunsaturated fatty acids (PUFAs), such as omega-6 and omega-3 fatty acids, are known to play a role in early brain development. The major PUFA species, arachidonic acid (n-6) and docosahexaenoic acid (DHA, n-3), are required for neuronal growth, synaptogenesis, neuronal survival, and neurotransmitter regulation. Although abnormal neurolipid metabolism in ASD patients has not been extensively investigated, abnormal lipid metabolism has been reported as one of the plasma biomarkers, and PUFA intervention in animal models may alleviate autism-like cognitive and social behaviors. RORα regulates lipoprotein homeostasis, and RORα sg Mice exhibit abnormal lipid metabolism (decreased serum cholesterol and triglycerides) due to decreased expression of ApoA1 and ApoC3, respectively. RORα may regulate adipogenesis and mitochondrial fatty acid oxidation by suppressing the expression of peroxisome proliferator-activated receptor gamma (PPARγ), its coactivator PGC1, and lipin1. Recent reports suggest that RORα deficiency delays the accumulation of all fatty acids during a critical period of brain development, whereas deficiency of the omega-3 PUFA species DHA leads to the development of RORα in adults. sgThis persists in mice and is not improved by dietary DHA supplementation. Similarly, a meta-analysis of case-control cohorts found that blood DHA concentrations were selectively lower in children with ASD (age 12 or younger) despite no difference in dietary intake compared with controls. Although DHA supplementation reversed some deficits in mouse models of ASD (BTBR and serotonin transporter knockout), human studies reporting increased blood DHA after dietary supplementation did not observe improvement in social behavior in children with ASD. This provides further evidence that RORα deficiency may affect the efficacy of dietary DHA supplementation by slowing DHA incorporation into brain phospholipids and / or accelerating DHA loss from brain phospholipids. Therefore, in humans, upregulating RORα through gene therapy, combined with supplementation and other medical options for symptom management, is a viable option for patients with ASD (Figure 5).

[0134] RORα protects neurons from oxidative stress Oxidative stress is a common feature in cases of autism and may be further exacerbated by the presence of genetic susceptibility alleles. Limited antioxidant capacity, high energy requirements, and high levels of iron and PUFAs in the brain increase vulnerability to oxidative stress. Postmortem studies of brain tissue from ASD patients have shown elevated levels of oxidative damage and reduced antioxidant capacity compared to age-matched controls.

[0135] Patients with ASD have elevated levels of lipid hydroperoxides (due to fatty acid oxidation), malonyldialdehyde (due to lipid peroxidation), 8-hydroxy-2'-deoxyguanosine (due to oxidative DNA damage), protein carbonyls (due to protein oxidation), 3-nitrotyrosine (due to protein nitration), and carboxyethylpyrrole (a lipid-derived oxidative protein modification). Overexpression of human RORα1 in cultured mouse cortical neurons increases the expression of the antioxidant proteins glutathione peroxidase 1 (Gpx1) and peroxiredoxin 6 (Prx6), reduces reactive oxygen species (ROS) levels (Figure 5), and protects neurons from apoptosis induced by oxidative stressors such as β-amyloid peptide, c2-ceramide, and H2O2. Another study reported that maternal diabetes in mice induces oxidative stress in the brains of their offspring, leading to autism-like behavior (ALB). Both oxidative stress and ALB in mouse offspring were accompanied by downregulation of RORα and its target genes, CYP19A1 (aromatase) and Sod2 (superoxide dismutase). Overexpression of RORα in postnatal offspring ameliorated both ALB and neuronal oxidative stress, whereas sh-RNA knockdown had the opposite effect, exacerbating ALB.

[0136] RORα protects neurons from neuroinflammationA striking feature common to ASD patients is the persistence of neuroinflammation across a wide age range, resulting in elevated levels of cytokines and chemokines, such as IL-6, TGFβ1, TNFα, CCL2, and CCL17, in the cerebellum and other brain regions. Transcriptome organization patterns in the brains of ASD patients show abnormalities in gene coexpression networks associated with immune activation. In ASD, disruption of resting monocyte / macrophage function has been reported to reduce production of the regulatory (anti-inflammatory) cytokines TGFβ1 and IL-10 and increase levels of antibodies against cerebellar proteins, all of which are associated with worsening behavioral phenotypes. Astrocytes are multifunctional macroglial cells that provide structural and metabolic support to neurons, absorb neurotransmitters, regulate ion concentrations and synaptic transmission, maintain the blood-brain barrier, function as chemical sensors, promote myelination and axon regeneration, and drive molecular oscillations of the circadian clock. The role of astrocytes in neuroinflammation has been previously reported. As effectors of innate immunity in the brain, astrocytes are thought to be activated primarily by the NF-κB signaling pathway and produce high levels of IL-6 through an ROR-dependent mechanism. sg Although mouse astrocytes have been reported to have lower resting IL-6 levels than WT mice, stimulation with the proinflammatory cytokines IL-1β and TNFα increases RORα levels. sg IL-6 levels were significantly elevated in astrocytes, indicating that neuroinflammation is promoted even in the absence of RORα (Fig. 5).

[0137] RORα protects neurons in in vitro models of neuroinflammation in Parkinson's and Alzheimer's diseaseTo investigate whether RORα plays a role in neuronal death, Boukhtouche et al. (2006) overexpressed the human RORα1 (hRORa1) isoform in neurons by transiently transfecting cultures with a plasmid encoding hRORα1 (pSG5-hRORa1) or by infecting cultures with a lentivirus-derived vector encoding hRORα1 (LentihRORa1). Next, hRORa1-overexpressing neurons were exposed to three different apoptotic stimuli: β-amyloid (an Alzheimer's disease model), c2-ceramide (a Parkinson's / Alzheimer's disease model), and H2O2 (an oxidative stress model), and their survival was assessed. Overexpression of hRORa1 not only protects cortical neurons from apoptosis, but also significantly improves their survival after exposure to apoptotic stimuli. A recent prospective study demonstrated an association between sleep duration and Parkinson's disease in carriers of the RORA genotype rs2028122 (Shao et al., 2022). Another study (Li et al., 2022) showed that RORA was downregulated in a Parkinson's disease model and that melatonin ameliorated the disease by upregulating RORA expression. Yet another study on nucleoside diphosphate kinase A, a neuroprotective agent for Parkinson's disease, revealed its mechanism of action via RORA (Anantha et al., 2021). Network analysis studies found that a remarkable cross-section of differentially expressed genes in the hippocampus of a mouse model of Alzheimer's disease were associated with RORA (Acquaah-Mensah et al., 2015 / Darshini et al., 2019). Another study identified that RORA regulates microglial cells, which mediate the development of Alzheimer's disease (Jian et al., 2021).

[0138] hRORA transgeneThe transgene hRORA was produced, which is under the transcriptional control of the cytomegalovirus (CMV) enhancer and contains the chicken β-actin promoter (CBA) promoter, a Kozak sequence at the transcription start site, and an SV40 polyadenylation sequence. The generated hRORA transgene contained the following sequences of different genetic elements (DNA sequence length and element name): 1-130 (130 bp) left AAV2 ITR; 155-534 (380 bp) CMV enhancer (CAG); 536-813 (278 bp) chicken β-actin promoter (CAG); 814-1830 (1017 bp) chimeric intron (CAG); 1908-1917 (10 bp) Kozak sequence; 1914-3485 (1572 bp) hRORA; 3646-3767 (122 bp) SV40 poly(A) signal sequence; and 3812-3952 (141 bp) right AAV2 ITR.

[0139] This transgene, hRORA, will be administered to neural cells, tissues, and organs to determine the therapeutic efficacy of various neurological conditions and diseases.

[0140] The foregoing discussion of the present invention has been presented for purposes of illustration and description. It is not intended to limit the present invention to the form disclosed herein. While the description of the present invention includes a description of one or more embodiments and certain variations and modifications, other variations and modifications are within the scope of the present invention, for example, within the skill and knowledge of one of ordinary skill in the art after understanding the present disclosure. The right to include alternative embodiments within the permissible scope, including alternative, interchangeable, and / or equivalent structures, functions, ranges, or steps to those set forth in the claims, regardless of whether such alternative, interchangeable, and / or equivalent structures, functions, ranges, or steps are disclosed herein, is intended, and is not intended to publicly offer patentable subject matter. All references cited herein are incorporated by reference in their entirety.

[0141] Drawing Terminology Lipidmetabolism Glucosemetabolism Liver functions Skeletal muscle development Cerebellum development Purkinjeneurons granule cells granule cells Eye development Adipose tissue development Adipose tissue inflammation Oxidative stress Atherosclerosis & Heart Disease Th17 Response Regulation of Inflammation Tissue macrophages Enhancer Promoter ChimericIntron ChimericIntron Poly A

Claims

1. 1. A method of ameliorating or treating a neurological condition or disease in a subject in need thereof, said method comprising administering to a subject in need of such treatment a therapeutically effective amount of a therapeutic agent, said therapeutic agent comprising: (a) a recombinant DNA (rDNA), recombinant RNA, or combination thereof, of a human nuclear hormone receptor (hNHR) gene or a fragment thereof; and (b) a delivery vehicle suitable for delivering said hNHR gene or a fragment thereof to a neurological cell, tissue, organ, or combination thereof to ameliorate or treat said neurological condition or disease; A method comprising:

2. The method of claim 1 , wherein the delivery vehicle comprises a viral delivery vector.

3. 3. The method of claim 2, wherein the viral delivery vector comprises an adeno-associated virus (AAV), an adenovirus, and a lentivirus.

4. 2. The method of claim 1, wherein the rDNA further comprises (i) a promoter, (ii) an enhancer, (iii) a polyadenylation portion, or (iv) a combination thereof.

5. 5. The method of claim 4, wherein the polyadenylation portion comprises a simian virus 40 (SV40) polyadenylation (polyA) region, a bovine growth hormone (bGH) polyA region, or a combination thereof.

6. 2. The method of claim 1, wherein the rDNA further comprises a cytomegalovirus (CMB) promoter or enhancer, an elongation factor 1a (EF1a), a chicken beta actin (CBA) promoter, a CAG promoter, or a combination thereof.

7. The method of claim 1 , wherein the delivery vehicle is adapted to target brain cells.

8. The delivery vehicle (i) peptide ligands, (ii) transporter ligands for various amino acids, or (iii) receptor ligands, arginine-glycine-aspartic acid (RGD) peptide or asparagine-glycine-arginine (NGR) peptide; The method of claim 7, comprising:

9. The delivery vehicle further comprises a cell or tissue specific promoter, and the cell or tissue specific promoter comprises: human Syn1, MeCP2, NSE, or BM88 promoter, CaMKII, DLX5 / 6 enhancer, tyrosine hydroxylase, dopamine beta-hydroxylase (DBH), or PRSx8; PCP2 (Purkinje cell protein 2), FEV, ETS transcription factor (Ple67), MCH (melanin-concentrating hormone), SLC6A4 (serotonin transporter Ple198), or NR2E1 (ple264), GfABC1D (truncated GFAP) or Aldh1A1 MBP (myelin basic protein), or MAG (myelin-associated glycoprotein), ICAM-2 (intercellular adhesion molecule 2), CLDN5 (claudin 5), Tie-2 (TEK, receptor tyrosine kinase), vWF (von Willebrand factor), or FLT1 (endothelial growth factor receptor), or 2. The method of claim 1, comprising:

10. 10. The method of claim 1, wherein the delivery vehicle comprises a non-viral delivery vehicle comprising a nanoparticle, a nanosome, a liposome, a biodegradable polymer complex, or a combination thereof.

11. 11. The method of claim 10, wherein the nanoparticles comprise liposomes, lipid nanoparticles, polymeric nanoparticles, dendrimers, cyclodextrins, silica nanoparticles, polymer composites, magnetic nanoparticles, gold nanoparticles, quantum dots, carbon nanotubes, or combinations thereof.

12. 2. The method of claim 1, wherein the hNHR gene or a fragment thereof is expressed by a plasmid, RNA, or its dbDNA (doggybone).

13. 2. The method of claim 1, wherein the hNHR gene is selected from the group consisting of NR1D1, RORA, and LXRa.

14. 14. The method of claim 13, wherein the hNHR gene comprises RORA.

15. 10. The method of claim 1, wherein the neurological condition or disease comprises intellectual developmental disability, epilepsy, cerebellar ataxia, autism spectrum disorder (ASD), Parkinson's disease, Alzheimer's disease, neurodegeneration of unknown cause, or a combination thereof.

16. 16. The method of claim 15, wherein the neurological condition or disease comprises an autism spectrum disorder.

17. 16. The method of claim 15, wherein the neurological condition or disease comprises intellectual developmental disability.

18. 16. The method of claim 15, wherein the neurological condition or disease comprises epilepsy.

19. 16. The method of claim 15, wherein the neurological condition or disease comprises cerebellar ataxia.

20. 16. The method of claim 15, wherein the neurological condition or disease comprises Parkinson's disease.

21. 16. The method of claim 15, wherein the neurological condition or disease comprises Alzheimer's disease.

22. 16. The method of claim 15, wherein the neurological condition or disease comprises neurodegeneration of unknown cause.

23. A method for improving or treating a neurological condition or disease in a subject in need of treatment, the method comprising administering to the subject a therapeutically effective amount of a composition comprising a human nuclear hormone receptor (hNHR) gene or a fragment thereof and an hNHR delivery vehicle, wherein the hNHR gene or fragment thereof is selected from the group consisting of NR1D1, RORA, and LXRa.

24. The delivery vehicle comprises: (i) a viral delivery vector related to an adeno-associated virus (AAV), lentivirus, or HSV1 viral vector; or 24. The method of claim 23, comprising (ii) a non-viral delivery vector comprising a nanoparticle, a nanosome, a liposome, a biodegradable polymer complex, or a combination thereof.

25. 24. The method of claim 23, wherein the composition further comprises a pharmaceutically acceptable carrier.

26. 24. The method of claim 23, wherein the composition is administered to the subject multiple times.

27. about 10 ８ ~about 10 １４ 24. The method of claim 23, wherein particles of the hNHR delivery vehicle are administered to the subject.

28. A recombinant adeno-associated virus (AAV) gene therapy particle comprising an AAV capsid protein and a nucleic acid sequence encoding a hRORA protein or a biologically active portion thereof operably linked to a promoter, and first and second AAV inverted terminal repeat (ITR) sequences flanking the sequence encoding the hRORA protein or a portion thereof.

29. 29. The recombinant AAV gene therapy particle of claim 28, wherein the nucleic acid sequence further comprises a cytomegalovirus enhancer, a chicken beta-actin promoter, a chimeric intron, and a simian virus 40 polyadenylation region.

30. 29. The recombinant AAV gene therapy particle of claim 28, wherein the AAV capsid protein comprises a capsid protein derived from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAVRh10, AAV11, and mutants thereof.

31. 29. The recombinant AAV gene therapy particle of claim 28, wherein the nucleic acid sequence comprises a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:

4.

32. A method of ameliorating or treating a neurological condition or disease in a subject in need of treatment, said method comprising administering to a subject in need of such treatment a therapeutically effective amount of a composition comprising: A recombinant DNA (rDNA) for ameliorating or treating a neurological condition or disease, said recombinant DNA comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO:4; and a delivery vehicle suitable for delivering the recombinant DNA to a subject's neurological cells, tissues, organs, or combinations thereof; A method comprising:

33. 33. The method of claim 32, wherein the delivery vehicle comprises a viral delivery vector.

34. 34. The method of claim 33, wherein the viral delivery vector comprises an adeno-associated virus (AAV) capsid protein.

35. 35. The method of claim 34, wherein the AAV capsid protein comprises a capsid protein derived from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAVRh10, AAV11, and mutants thereof.

Images