Oil compositions with engineered lipid properties and methods for producing same

Abstract

Provided herein are engineered microorganisms containing one or more genes involved in fatty acid metabolism. For example, provided are engineered microorganisms containing a first nucleic acid sequence encoding an elongase and a second nucleic acid sequence encoding a desaturase, the first and second nucleic acid sequences being operably linked to a promoter. Methods for producing and using the engineered microorganisms are also provided. Also provided are microbial oils containing fatty acids, the fatty acids including C20:3(n-6) (di-homo-γ-linoleic acid) and C20:5(n-3) eicosapentaenoic acid (EPA). Additionally, provided herein are methods for enhancing the conversion of saturated fatty acids to unsaturated fatty acids by transforming a microorganism with a nucleic acid encoding a polypeptide involved in a fatty acid synthesis pathway to result in increased conversion of saturated fatty acids to unsaturated fatty acids.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63,429,852, filed December 2, 2022, which is incorporated by reference herein in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in .xml format and is incorporated herein by reference in its entirety. A copy of said .xml, created on November 29, 2023, is entitled "MAR-025US-WO-095523-1416607-1412622.xml" and is 36 kilobytes in size. It is hereby stated that the information recorded in computer-readable form is identical to the Sequence Listing as written and does not include any matter beyond that disclosed in the international application as filed. [Background technology]

[0003] Certain microorganisms produce oils as a result of two similar fatty acid synthesis pathways: the classical fatty acid synthesis (FAS) pathway and the polyunsaturated fatty acid (PUFA) synthase pathway. Medium-chain fatty acids such as myristic acid (C14:0) and palmitic acid (C16:0) are generally produced from the FAS pathway, while long-chain polyunsaturated fatty acids (LC-PUFAs) such as docosahexaenoic acid (DHA, C22:6n-3) and docosapentaenoic acid (DPA, C22:5n-6) are generally produced from the PUFA synthase pathway. However, the resulting fatty acid profiles vary greatly among microorganisms depending on the relative activity of these similar pathways. Summary of the Invention

[0004] Provided herein are engineered microorganisms containing one or more heterologous nucleic acids encoding polypeptides involved in fatty acid metabolism. For example, provided are engineered microorganisms containing a first nucleic acid sequence encoding an elongase and a second nucleic acid sequence encoding a desaturase, the first and second nucleic acid sequences operably linked to a promoter. Methods for producing and using the engineered microorganisms are also provided. Also provided are microbial oils containing fatty acids, the fatty acids including C20:3(n-6) (di-homo-γ-linoleic acid) and C20:5(n-3) eicosapentaenoic acid (EPA). Further provided herein are methods for enhancing the conversion of saturated fatty acids to unsaturated fatty acids by transforming a microorganism with one or more nucleic acids encoding polypeptides involved in the fatty acid synthesis pathway to result in increased conversion of saturated fatty acids to unsaturated fatty acids. [Brief explanation of the drawings]

[0005] [Figure 1] FIG. 1 is a schematic diagram showing the pathway for fatty acid modification of C16:0 from the FAS pathway. [Figure 2-1] A series of schematic diagrams showing the constructs transformed into WT T18 or derivative strains for the production of different fatty acids. The promoters, terminators (1 kb upstream and downstream of the native genes, respectively), and internal coding regions of Δ9 desaturase, α-tubulin, and PUFA synthase subunit B are used as homology arms for homologous recombination. [Figure 2-2] This is a continuation of Figure 2-1. [Figure 3A] Schematic diagram of WT T18 and its homologous recombination constructs (95 and 116), showing Southern blotting to confirm homologous recombination with the Δ9 desaturase for WT T18 and transformants of the 95 and 116 lines. [Figure 3B]

[0039] Figure 11 is an image of a Southern blot showing that all transformants show homologous recombination at the Δ9 site with one heterozygous transformant: 116-2. The probe is in the upstream region of the Δ9 desaturase promoter. The blot shows that all transformants are homologous recombinants at the Δ9 desaturase site. [Figure 4] These are images of Southern blots of WT T18 and 12 transformants of line 95 (shown in Figures 2-1, 2-2, and 3A). Genomic DNA (gDNA) of each transformant was digested with PstI. To detect the neomycin resistance gene in the transformants, the blot was probed with a neomycin sequence. All transformants show the presence of the neomycin resistance (neo-R) gene. The neo-R gene is absent in WT T18. [Figure 5] Figure 1 shows a graph depicting fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and 95 selected lineage transformants. See also Figure 1 for fatty acid legend. Strains were grown in flasks containing 25 mL of WDL medium for approximately 7 days until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg / g total fatty acids present in dry biomass. [Figure 6] 5 shows the same FAME analysis as in FIG. 5 for 95 transformants, but plotted as a percentage of the total fatty acid profile. See also FIG. 1 for fatty acid legend. [Figure 7]

[0023] Figure 1 shows a graph showing FAME analysis of freeze-dried biomass of strain 95-1 grown in regular WDL medium or WDL containing low nitrogen. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 8] 1 is a graph showing FAME analysis of samples taken during fermentation of transformant 95-1. See also FIG. 1 for fatty acid legend. [Figure 9] Southern blot of luciferase transformants targeted to the native Δ9 desaturase site. [Figure 10]1 is a table showing selected FAME data of luciferase transformants showing the complete absence of C16:1n-7, C18:1n-9, and C18:1n-7 in transformant Δ12 luciferase 4. [Figure 11] 1 is a graph of FAME data showing fatty acid content of 57 transformants compared to WT T18 in mg / g dry biomass. See also FIG. 1 for fatty acid legend. [Figure 12] 1 is a table showing selected FAME data for 57 transformant lines showing increased C16:1n-7 and C18:1n-7 compared to WT T18. [Figure 13] 1 is a graph of FAME data showing fatty acid content of 84 transformants compared to WT T18 in mg / g dry biomass. See also FIG. 1 for fatty acid legend. [Figure 14] 1 is a table showing selected FAME data for 84 transformant lines showing increased C16:1n-7 and C18:1n-7 compared to WT T18. [Figure 15] Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and 116 lineage transformants. See also Figure 1 for fatty acid legend. Transformants were grown in flasks containing 25 mL of medium for approximately 7 days until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg total fatty acids present per g dry biomass. [Figure 16A] Figure 16A provides a schematic diagram of the construction of WT T18 and its homologous recombinant containing pHR47 at the α-tubulin locus. Figure 16B shows a Southern blot comparing WT, 95-1, and 110 lineage recombinants. The probe is directed against the downstream region of the α-tubulin terminator. 110-1, 3, 4, 9, and 10 are putative α-tubulin double knockouts based on the larger fragment size shown in the Southern blot. [Figure 16B]Figure 16A provides a schematic diagram of the construction of WT T18 and its homologous recombinant containing pHR47 at the α-tubulin locus. Figure 16B shows a Southern blot comparing WT, 95-1, and 110 lineage recombinants. The probe is directed against the downstream region of the α-tubulin terminator. 110-1, 3, 4, 9, and 10 are putative α-tubulin double knockouts based on the larger fragment size shown in the Southern blot. [Figure 17] Figure 1 shows fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18, the 95-1 parent, and transformants of line 110. See also Figure 1 for fatty acid legend. Transformants were grown in flasks containing 25 mL of medium for approximately 7 days until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg total fatty acids present per g dry biomass. [Figure 18] Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and 67-1 from cultures fed different free fatty acid species. Values ​​are mg / g total fatty acids present in dry biomass. Conversion of ALA to EPA and GLA to ARA is seen in 67-1. See also Figure 1 for fatty acid legend. [Figure 19A] Figure 19A provides a schematic diagram of WT T18 and its homologous recombination construct containing pHR47 at the subB locus in lineage 113. Figure 19B is a Southern blot comparing the homologous recombination of constructs in pHR52 at the subB locus in WT T18 and lineage 113 transformants. The probe is directed against the upstream region of the subB promoter. 113-4 is a double knockout at subB. [Figure 19B]Figure 19A provides a schematic diagram of WT T18 and its homologous recombination construct containing pHR47 at the subB locus in lineage 113. Figure 19B is a Southern blot comparing the homologous recombination of constructs in pHR52 at the subB locus in WT T18 and lineage 113 transformants. The probe is directed against the upstream region of the subB promoter. 113-4 is a double knockout at subB. [Figure 20]

[0023] Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and transformants of line 113. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 21A] Figure 21A provides a schematic diagram of the construction of a homologous recombinant of WT T18 and pHR58 at the sub-B locus in the 121 lineage. Figure 21B is a Southern blot showing WT-T18 and a transformant with homologous recombination. The probe is directed against the downstream region of the sub-B promoter. 121-1 is a double knockout at the sub-B locus. [Figure 21B] Figure 21A provides a schematic diagram of the construction of a homologous recombinant of WT T18 and pHR58 at the sub-B locus in the 121 lineage. Figure 21B is a Southern blot showing WT-T18 and a transformant with homologous recombination. The probe is directed against the downstream region of the sub-B promoter. 121-1 is a double knockout at the sub-B locus. [Figure 22] Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of 121-1 from cultures fed different free fatty acid (FFA) species (0.5 mM FFA in each culture). Values ​​are expressed as mg / g total fatty acids present in dry biomass. Conversion of linoleic acid (LA) to alpha-linoleic acid (ALA) is observed in each culture. See also Figure 1 for fatty acid legend. [Figure 23] FIG. 23 is a graph of the FAME results for 121-1 shown in FIG. 22, expressed as percent total fatty acids (TFA%). See also FIG. 1 for fatty acid legend. [Figure 24] FIG. 12 is a graph showing increased substrate conversion by a Δ12 desaturase (at either the α-tubulin site or the Δ9 desaturase site shown above the graph) when expressed in the same open reading frame as a C16 elongase and a Δ9 desaturase, rather than at individual sites. [Figure 25A] FIG. 1 is a schematic diagram showing homologous recombination in which WT T18 and subB are replaced with pHR64 or pHR62. [Figure 25B] Southern blot comparing WT T18 with transformants in which subB was replaced with pHR64 or pHR62. The probe is specific for the downstream region of the subB TR. 127-3 and 129-1 appear to have recombination events at subB and may be double knockouts at subB, but they lack the expected fragment size for a double knockout. 129-2 appears to be a double knockout at subB with the expected fragment size. [Figure 26]

[0023] Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of the 116-5 parent and 127 lineage transformants. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 27]

[0023] Figure 1 shows a graph showing fatty acid methyl ester (FAME) analysis of freeze-dried biomass of the 116-5 parent and 129 lineage transformants. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 28]

[0023] Figure 1 is a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of axenic strains 121-1-S and 121-1-F passaged through 121-1. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 29]Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of 127-3 and 129-2 passaged axenic transformants 127-3-T, 127-3-W, 127-3-R, and 127-3-P (127-3-T, W, R + P), and 129-2-T, 129-2-W, 129-2-R, and 129-2-P (129-2-T, W, R + P). Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 30] 29 is a graph of the same FAME results as shown in Figure 28, expressed as % TFA, for 127-3 and 129-2 passaged germ-free transformants. See also Figure 1 for fatty acid legend. [Figure 31] Figure 1 shows fatty acid methyl ester (FAME) analysis of freeze-dried biomass of WT T18 and 164 lineage transformants. See also Figure 1 for fatty acid legend. Transformants were grown in flasks containing 25 mL of medium for approximately 5 days until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg total fatty acids present per g dry biomass. [Figure 32] Figure 1 shows a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of transformants from line 167. See also Figure 1 for fatty acid legend. Transformants were grown in flasks containing 25 mL of medium for approximately 5 days until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg total fatty acids present per g dry biomass. [Figure 33] Figure 1 shows fatty acid methyl ester (FAME) analysis of freeze-dried biomass of transformants from line 165. See also Figure 1 for fatty acid legend. Transformants were grown in flasks containing 25 mL of medium for approximately 9 days until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg total fatty acids present per g dry biomass. [Figure 34] Graph of the results shown in Figure 33, expressed as % TFA. See also Figure 1 for fatty acid legend. [Figure 35]Figure 1 shows a graph depicting fatty acid methyl ester (FAME) analysis of freeze-dried biomass of transformants from the 173 line. See also Figure 1 for fatty acid legend. Transformants 173-1 and 173-2 (173-1+2) were grown in flasks containing 25 mL of 10% N WDL until glucose consumption stalled at approximately 13 g / L glucose after 7 days. After 4 days, transformant 173-3 was grown in a flask containing 25 mL of 10% N WDL until glucose was depleted. Pellets were collected and freeze-dried. Values ​​are expressed as mg / g total fatty acids present in dry biomass. [Figure 36] Figure 1 shows fatty acid methyl ester (FAME) analysis of freeze-dried biomass of 173-1 and 173-2 passaged axenic transformants 173-1-T, 173-1-W, 173-1-R, and 173-1-P (173-1-T, W, R+P), and 173-2-W, 173-2-R, and 173-2-P (173-2-W, R+P). Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also Figure 1 for fatty acid legend. [Figure 37] 34 is a graph of the 173-1 and 173-2 passaged germ-free transformants shown in Figure 33, expressed as % TFA. See also Figure 1 for fatty acid legend. [Figure 38] 1 is a graph of RT-qPCR results for differential expression of five elongases in WT T18 versus 173-1-R and 173-2-R. [Figure 39] FIG. 1 is a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of 173-1-R ALE 2-3 C1-8. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also FIG. 1 for fatty acid legend. [Figure 40] Figure 39 is a graph of the FAME results for 173-1-R ALE2-3 C1-8 shown in Figure 39, expressed as TFA %. See also Figure 1 for fatty acid legend. [Figure 41]FIG. 1 is a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of 173-1-R and 173-1-R MUT1. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also FIG. 1 for fatty acid legend. [Figure 42] FIG. 42 is a graph of the FAME results, expressed as % TFA, of 173-1-R and 173-1-R MUT1 shown in FIG. 41. See also FIG. 1 for fatty acid legend. [Figure 43] FIG. 1 is a graph of fatty acid methyl ester (FAME) analysis of freeze-dried biomass of 173-1-R and 173-1-R MUT5. Values ​​are expressed as mg / g total fatty acids present in dry biomass. See also FIG. 1 for fatty acid legend. [Figure 44] FIG. 44 is a graph of the FAME results, expressed as % TFA, for 173-1-R and 173-1-R MUT5 shown in FIG. 43. See also FIG. 1 for fatty acid legend. [Figure 45] Figure 1 is a graph comparing the transformation of line 116, which has a C16 elongase (Ob1) 3' to Δ9PR, with lines 136 and 137, which have a Δ6 desaturase (Bty) and an Ω3 desaturase (Obl) 3' to Δ9PR, respectively. Compared to the transformant of line 116, the transformants of lines 136 and 137 have approximately 10-fold reduced oleic acid production. The reduced activity of C16 elongase (Obl) at C16:0 in lines 136 and 137 results in the accumulation of more than 2.5-fold more C16:0 in line 116. See also Figure 1 for fatty acid legend. [Figure 46] 1 is a graph showing FAME analysis in mg / g of strains 180-1 and 180-2. [Figure 47] 1 is a graph showing FAME analysis in mg / g for strains 183-3, 183-5, 183-6, 183-7, and 183-8. [Figure 48] 1 is a graph showing FAME analysis in mg / g of strains 183-8-T, 183-8-W, 183-8-R, and 183-8-P. [Figure 49]1 is a graph showing FAME analysis in mg / g for strains 190-1, 190-2, 190-3, 190-4, 190-5, and 190-6. DETAILED DESCRIPTION OF THE INVENTION

[0006] Certain microorganisms, including Thraustochytrids, produce oils containing a variety of lipids, including fatty acids in various forms and amounts. As used herein, the term lipid includes phospholipids, free fatty acids, esters of fatty acids, triacylglycerols, sterols and sterol esters, carotenoids, xanthophylls (e.g., oxycarotenoids), hydrocarbons, and other lipids. Fatty acids are hydrocarbon chains terminating in a carboxyl group and are termed unsaturated if they contain at least one carbon-carbon double bond or polyunsaturated if they contain multiple carbon-carbon double bonds. For example, microorganisms can produce (i) short-chain fatty acids (SCFAs) (e.g., butyric acid), which are fatty acids with an aliphatic tail of fewer than six carbons; (ii) medium-chain fatty acids (MCFAs), which are fatty acids with an aliphatic tail of six to twelve carbons; and (iii) long-chain fatty acids (LCFAs), which are fatty acids with an aliphatic tail of more than 13 carbons. Different microorganisms produce different types and amounts of these fatty acids. Provided herein are microorganisms and methods for shifting the production of these fatty acids from medium-chain fatty acids produced by the FAS pathway to long-chain fatty acids produced by the PUFA synthase pathway. Fatty acid synthesis (FAS) is defined as the generation of fatty acids from acetyl-CoA and NADPH through the action of enzymes called fatty acid synthases. The PUFA synthase pathway allows the de novo synthesis of polyunsaturated fatty acids from malonyl-CoA by large multi-domain, multi-subunit enzymes. The major end product of the FAS pathway is palmitic acid, and the major end products of PUFA synthases are PUFAs such as DHA and DPA.

[0007] Microorganisms can be used for the commercial production of lipids for applications including nutritional supplements, animal feed, or biofuels. Consuming saturated fatty acids to increase mono- or polyunsaturated fatty acids (MUFA and PUFA) increases the fluidity of the oil, facilitating downstream handling. For biofuel applications, shorter carbon chains or MUFAs may be desirable. High Ω-3 or Ω-6 content may be desirable for nutritional applications. In addition to targeting a specific oil profile, consistently producing the same profile in the same way is essential in industrial environments. Provided herein are genetically modified strains capable of producing consistent oil profiles during fermentation.

[0008] Eukaryotic microorganisms useful for producing the provided microbial oils and biomass include, but are not limited to, microorganisms selected from the genera Oblongichytrium (Obl), Aurantiochytrium, Thraustochytrium, Schizochytrium, and Ulkenia, or any mixture thereof. Optionally, the eukaryotic microorganism is the same as the microorganism deposited on October 6, 2004, with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassass, VA 20110-2209, and assigned ATCC accession number PTA-6245. This deposit is exemplary and is made solely as a convenience to those skilled in the art, and does not constitute an admission that the deposit is required for patentability. As used throughout, the terms T18 and WT T18 are used interchangeably and refer to the same microorganism, ATCC accession number PTA-6245.

[0009] Provided herein are engineered microorganisms containing one or more heterologous nucleic acids encoding polypeptides involved in fatty acid metabolism. By heterologous nucleic acid is meant a nucleic acid sequence not normally found within a given cell in nature. A heterologous nucleic acid can be foreign to its host cell, naturally occurring but present in the cell in an unnatural amount (e.g., greater or less than that naturally found in the cell), or naturally occurring within the host cell but located outside its natural locus. For example, engineered microorganisms are provided containing a first heterologous nucleic acid sequence encoding an elongase and a second heterologous nucleic acid sequence encoding a desaturase, wherein the first and second nucleic acid sequences are operably linked to a promoter. The promoter can be a Δ9 desaturase, Δ5 desaturase, sub B, or α-tubulin promoter. The promoter can be used in its native genomic location or outside its original native genomic location. Thus, a promoter, e.g., a Δ9 desaturase promoter, can be located in its native location in the genome of the microorganism. Optionally, the promoter, e.g., a Δ9 desaturase promoter, and the nucleic acid encoding the fatty acid metabolism polypeptide are located on a heterologous construct. (See, e.g., Figures 2-1 and 2-2.) The desaturase can be a Δ9 desaturase, which can be a Thraustochytrium species or an Ulkenia species Δ9 desaturase. The elongase can be, for example, a delta-5 elongase or a C16:0 elongase, which can be an Oblongitrium species elongase. Optionally, the first and second nucleic acids disrupt the endogenous Δ9 desaturase sequence of the microorganism.

[0010] Optionally, the provided microorganisms comprise several nucleic acids encoding polypeptides involved in fatty acid metabolism. Thus, the provided microorganisms may further comprise an Ω3 desaturase, which may be an Ω3 desaturase from an Oblongichtrium species. The engineered microorganisms may comprise a heterologous nucleic acid encoding a Δ12 desaturase, which may be a desaturase from a Thraustochytrium species. The engineered microorganisms may comprise a Δ6 desaturase, which may be a Δ6 desaturase from a Botryochytrium species. The engineered microorganisms may also comprise a Δ5 desaturase, which may be a Δ5 desaturase from a Thraustochytrium species.

[0011] The engineered microorganism can be engineered to contain several nucleic acids using constructs containing additional sequences such as promoters, selectable markers or resistance genes, terminators, linking sequences, etc. In some examples, the constructs contain resistance genes for zeomycin, bleomycin, neomycin, hygromycin, or G418. Optionally, the engineered microorganism contains a zeocin resistance gene. Optionally, the engineered microorganism contains one or more 2A sequences. The engineered microorganism can contain a reporter gene. Optionally, the reporter gene is luciferase. As discussed, the engineered microorganism can contain a nucleic acid having one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators. Optionally, the nucleic acid contains one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators.

[0012] An engineered microorganism can be modified to contain different nucleic acids, for example, nucleic acid sequences or constructs comprising one or more promoters, nucleic acids encoding polypeptides involved in fatty acid synthesis, terminators, linking sequences, etc. By way of example, an engineered microorganism can contain any combination or sequence of nucleic acids described herein. Exemplary constructs are shown in Figures 2-1 and 2-2. Thus, an engineered microorganism can contain a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a neomycin resistance gene, and a Δ9 desaturase terminator. An engineered microorganism can contain a Δ9 desaturase promoter, a bleomycin resistance gene, a 2A sequence, a luciferase gene, and a Δ9 desaturase terminator. An engineered microorganism can contain an α-tubulin promoter, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, and an α-tubulin terminator. The engineered microorganism may comprise an elongase promoter, a sub B promoter, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, and an elongase terminator. The engineered microorganism may comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism may comprise an alpha-tubulin promoter, a bleomycin resistance gene, a 2A sequence, a Δ12 desaturase, and an alpha-tubulin terminator. The engineered microorganism may comprise a sub B promoter, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a PfaC domain, and a sub B internal sequence. The engineered microorganism may comprise a sub B promoter, a hygromycin resistance gene, a 2A sequence, a nucleic acid encoding an Ω-3 desaturase, and a sub B terminator. The engineered microorganism can comprise a sub B promoter, a nucleic acid encoding an omega-3 desaturase, a 2A sequence, a neomycin resistance gene, and a sub B terminator.The engineered microorganism may comprise an α-tubulin promoter, a hygromycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ5 desaturase, and an α-tubulin terminator. The engineered microorganism may comprise an α-tubulin promoter, a nucleic acid encoding a Δ5 desaturase, a 2A sequence, a neomycin resistance gene, and an α-tubulin terminator. The engineered microorganism may comprise a sub-B promoter, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a neomycin resistance gene, and a sub-B terminator. The engineered microorganism may comprise a sub-B promoter, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a nucleic acid encoding an Ω-3 desaturase, a 2A sequence, a neomycin resistance gene, and a sub-B terminator. The engineered microorganism may comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism may comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding an Ω-3 desaturase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ6 desaturase, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism may comprise a Δ9 desaturase promoter, a nucleic acid encoding a Δ6 desaturase, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator. The engineered microorganism may comprise a Δ9 desaturase promoter, a nucleic acid sequence encoding an Ω-3 desaturase, a nucleic acid sequence encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid encoding a Δ12 desaturase, and a Δ9 desaturase terminator.The engineered microorganism may comprise a Δ9 desaturase promoter, a nucleic acid encoding a C16 elongase, a 2A sequence, a nucleic acid encoding a Δ9 desaturase, a 2A sequence, a bleomycin resistance gene, a 2A sequence, a nucleic acid sequence encoding a Δ6 desaturase, a 2A sequence, a nucleic acid sequence encoding a Δ5 elongase, a nucleic acid sequence encoding an Ω-3 desaturase, a 2A sequence, a Δ5 desaturase, a 2A sequence, a nucleic acid sequence encoding an Ω-3 desaturase, a 2A sequence, a nucleic acid sequence encoding a Δ12 desaturase, and a Δ9 desaturase terminator.

[0013] The term transformation, as used herein, refers to a process by which a heterologous nucleic acid molecule (e.g., a vector or recombinant nucleic acid molecule) is introduced into a recipient cell or microorganism. The heterologous nucleic acid molecule may or may not be integrated into (i.e., covalently linked to) chromosomal DNA making up the genome of the host cell or microorganism. For example, the heterologous polynucleotide may be maintained on an episomal element, such as a plasmid. Alternatively, or additionally, the heterologous polynucleotide may become integrated into a chromosome so that it is inherited by daughter cells through chromosomal replication. Methods of transformation include, but are not limited to, calcium phosphate precipitation, Ca 2+ These include treatment, fusion of recipient cells with bacterial protoplasts containing the recombinant nucleic acid, treatment of recipient cells with liposomes containing the recombinant nucleic acid, fusion using DEAE-dextran, polyethylene glycol (PEG), electroporation, magnetoporation, biolistic delivery, retroviral infection, lipofection, and microinjection of DNA directly into cells.

[0014] The term transformed, when used with reference to a cell, refers to a cell that has undergone transformation as described herein such that the cell harbors heterologous genetic material (e.g., a recombinant nucleic acid). The term transformed may also, or alternatively, be used to refer to microorganisms, microbial strains, tissues, organisms, etc. that contain heterologous genetic material.

[0015] The term introduction, as used herein with respect to the introduction of nucleic acid into a cell or organism, is intended to have its broadest meaning and to encompass, for example, introduction by transformation methods (e.g., calcium chloride-mediated transformation, electroporation, biolistics), as well as introduction by other methods including transduction, conjugation, and conjugation. Optionally, a construct is utilized to introduce the nucleic acid into the cell or organism. As used herein, the term transformant refers to a cell, microorganism, microbial strain, tissue, organism, etc., that comprises a nucleic acid that has been introduced or transformed into the cell, microorganism, microbial strain, tissue, organism, etc.

[0016] As used herein, nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof, or their complements. The term includes deoxyribonucleotides or ribonucleotides in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, both synthetic, natural, and non-natural, that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to the reference nucleotide. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide nucleic acids (PNAs). Unless otherwise indicated, conservatively modified variants of nucleic acid sequences (e.g., degenerate codon substitutions) and complementary sequences can be substituted for the specific nucleic acid sequences described herein. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.

[0017] A nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA encoding a presequence or secretory leader is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of that sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, operably linked means that the DNA sequences being linked are contiguous, and in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. For example, a nucleic acid sequence operably linked to a second nucleic acid sequence is covalently linked to such second sequence, either directly or indirectly, although any effective tertiary association is acceptable. A single nucleic acid sequence can be operably linked to multiple other sequences. For example, a single promoter can direct the transcription of multiple RNA species. Linkage can be accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.

[0018] As used herein, the terms promoter, promoter element, and regulatory sequence refer to a polynucleotide that controls the expression of a selected polynucleotide sequence operably linked to the promoter, resulting in the expression of the selected polynucleotide sequence in a cell. The term Thraustochytrium promoter, as used herein, refers to a promoter that naturally occurs in Thraustochytrium cells. In some embodiments, the promoter element is or includes the 5' untranslated region (UTR) of a coding sequence. The 5' UTR is an essential part of protein expression in eukaryotes because it forms part of the mRNA transcript. Following transcription, the 5' UTR can regulate protein expression at both the transcriptional and translational levels.

[0019] As used herein, the term terminator refers to a polynucleotide that inhibits expression of a selected polynucleotide sequence operably linked to the terminator in a cell, targets the maturation of that sequence (e.g., by adding a polyA tail), or confers mRNA stability to that sequence. The term terminator sequence can be downstream of a stop codon in a nucleic acid. The term Thraustochytrium terminator, as used herein, refers to a terminator that naturally occurs in Thraustochytrium cells. Also provided herein are nucleic acid constructs comprising nucleic acid sequences encoding xylose isomerase, xylulose kinase, and xylose transporter, as well as promoters, terminators, selectable markers, 2A peptides, or any combination thereof.

[0020] The phrase "selectable marker," as used herein, refers to either a nucleotide sequence, e.g., a gene, that encodes a product (polypeptide) that allows for selection, or the nucleotide sequence product (e.g., polypeptide) itself. The term "selectable marker," as used herein, is generally understood in the art to refer to a marker whose presence in a cell or organism confers a significant growth or survival advantage or disadvantage to the cell or organism under certain defined culture conditions (selective conditions). For example, the conditions can be the presence or absence of a particular compound, or a specific environmental condition, such as elevated temperature, elevated radiation, or the presence of a compound that is toxic in the absence of the marker. The presence or absence of a compound(s) or environmental condition(s) is / are referred to as selective condition(s). A growth advantage refers to an increased survival rate (e.g., a cell or organism with a growth advantage has, on average, an increased lifespan compared to an otherwise identical cell lacking the trait or condition that confers the growth advantage), an increased growth rate (also referred to herein as growth rate) relative to an otherwise identical cell or organism, or both. Generally, a population of cells that has a growth advantage will have fewer dead or non-viable cells and / or a higher cell proliferation rate than a population of otherwise identical cells that lack the growth advantage. While selectable markers typically confer a growth advantage to cells, certain selectable markers confer a growth disadvantage to cells, e.g., making cells more susceptible to the adverse effects of certain compounds or environmental conditions than otherwise identical cells that do not express the marker. Antibiotic resistance markers are a non-limiting example of a class of selectable markers that can be used to select cells that express the marker. In the presence of an appropriate concentration of antibiotic (selective conditions), such markers confer a growth advantage to cells that express the marker. Thus, cells that express an antibiotic resistance marker can survive and / or grow in the presence of the antibiotic, while cells that do not express the antibiotic resistance marker cannot survive and / or grow in the presence of the antibiotic.

[0021] Examples of selectable markers include, but are not limited to, common bacterial antibiotics such as ampicillin, kanamycin, and chloramphenicol, as well as selective compounds known to function in microalgae. Examples include rrnS and AadA (aminoglycoside 3'-adenylyltransferase), which can be isolated from the E. coli plasmid R538-1 and confer resistance to spectinomycin and streptomycin in E. coli and some microalgae, respectively (Hollingshead and Vapnek, Plasmid 13:17-30, 1985; Meslet-Cladiere and Vallon, Eukaryot Cell. 10(12):1670-8 2011). Another example is rrnL, a 23S RNA protein that confers resistance to erythromycin (Newman, Boynton et al., Genetics, 126:875-888 1990; Roffey, Golbeck et al., Proc. Natl Acad. Sci. USA, 88:9122-9126 1991). Another example is Ble, a GC-rich gene isolated from Streptoalloteichus hindustanus that confers resistance to zeocin (Stevens, Purton et al., Mol. Gen. Genet., 251:23-30 1996

[30] ). Aph7 is yet another example, an aminoglycoside phosphotransferase gene from Streptomyces hygroscopicus that confers resistance to hygromycin B (Berthold, Schmit et al., Protist 153(4):401-412 2002).Additional examples include AphVIII, an aminoglycoside 3'-phosphotransferase type VIII from Streptomyces rimosus, which confers resistance to paromycin in E. coli and some microalgae (Sizova, Lapina et al., Gene 181(1-2):13-18 1996; Sizova, Fuhrmann et al., Gene 277(1-2):221-229 2001), Nat and Sat-1, which encode nourseothricin acetyltransferase from Streptomyces noursei and streptothricin acetyltransferase from E. coli, and which confers resistance to nourseothricin (Zaslavskaia, Lippmeier et al., Journal of Phycology 36(2):379-386, 2000), Neo, an aminoglycoside 3'-phosphotransferase that confers resistance to aminoglycosides, kanamycin, neomycin, and the analog G418 (Hasnain, Manavathu et al., Molecular and Cellular Biology 5(12):3647-3650, 1985), and Cry1, a ribosomal protein S14 that confers resistance to emetine (Nelson, Savereide et al., Molecular and Cellular Biology 14(6):4011-4019, 1994).

[0022] Other selectable markers include nutritional markers, also called autotrophic or auxotrophic markers. These include photoautotrophic markers, which impose selection based on the restoration of photosynthetic activity in photosynthetic organisms. Photoautotrophic markers include, but are not limited to, AtpB, TscA, PetB, NifH, psaA, and psaB (Boynton, Gillham et al., Science 240(4858):1534-1538 1988; Goldschmidt-Clermont, Nucleic Acids Research 19(15):4083-4089, 1991; Kindle, Richards et al., PNAS, 88(5):1721-1725, 1991; Redding, MacMillan et al., EMBO J 17(1):50-60, 1998; Cheng, Day et al., Biochemical and Biophysical Research Communications 329(3):966-975, 2005). Alternative or additional nutritional markers include ARG7, which encodes argininosuccinate lyase, a key step in arginine biosynthesis (Debucy, Purton et al., EMBO J8(10):2803-2809, 1989), NIT1, which encodes nitrate reductase essential for nitrogen metabolism (Fernandez, Schnell et al., PNAS, 86(17):6449-6453, 1989), THI10, essential for thiamine biosynthesis (Ferris, Genetics 141(2):543-549, 1995), and NIC1, which catalyzes an essential step in nicotinamide biosynthesis (Ferris, Genetics 141(2):543-549, 1995). Such markers are generally enzymes that function in biosynthetic pathways to produce compounds required for cell growth or survival. Generally, under non-selective conditions, the required compound is present in the environment or produced by an alternative pathway within the cell. Under selective conditions, production of the compound requires function of the biosynthetic pathway involving the marker.

[0023] The term selection agent, as used herein, refers to an agent that exerts selective pressure on a cell or population of cells, either in favor of or against a cell or population of cells that have a selectable marker. For example, the selection agent is an antibiotic and the selectable marker is an antibiotic resistance gene. Optionally, zeocin is used as the selection agent.

[0024] The terms identical or percent identity, with respect to two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have the same or a specified percentage of the same amino acid residues or nucleotides (e.g., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region), as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters as described below, or by manual alignment and visual inspection (see, e.g., the NCBI website). Such sequences are then said to be substantially identical. This definition also refers to or can be applied to the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. As explained below, preferred algorithms can account for gaps, etc. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

[0025] For sequence comparison, typically, one sequence serves as the reference sequence to which test sequence is compared.When using sequence comparison algorithm, test sequence and reference sequence are input into computer, subsequence coordinates are designated as needed, and sequence algorithm program parameters are designated.Preferably, default program parameters can be used, and alternative parameters can be designated as appropriate.Then, sequence comparison algorithm calculates the percent sequence identity of test sequence to reference sequence based on program parameters.

[0026] A comparison window, as used herein, includes reference to any one segment of a number of contiguous positions selected from the group consisting of 20 to 600, usually about 50 to about 200, and more usually about 100 to about 150, within which a sequence is compared to a reference sequence of the same number of contiguous positions after optimally aligning the two sequences. Methods for aligning sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).

[0027] Preferred examples of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used with the parameters described herein to determine percent sequence identity for nucleic acids and proteins. As known in the art, software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of a selected length (W) in a query sequence that either match or meet a certain positive threshold score T when aligned with words of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al.). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. Word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. For nucleotide sequences, the cumulative score is calculated using the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of word hits in each direction is stopped when the cumulative alignment score falls by an amount X from its achieved maximum, when the cumulative score falls below zero due to the accumulation of one or more negative-scoring residue alignments, or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The expectation value (E) represents the number of distinct alignments with scores equal to or greater than those expected to occur by chance in a database search.The BLASTN program (for nucleotide sequences) uses by default a word length (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses by default a word length of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (Henikoff & Henikoff, Proc Natl. Acad. Sci. USA 89:10915 (1989)), an alignment (B) of 50, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

[0028] Also provided herein are methods for enhancing the conversion of saturated fatty acids to unsaturated fatty acids. The methods include transforming an oil-producing microorganism with a construct comprising a first nucleic acid encoding an elongase and a second nucleic acid encoding a desaturase, wherein the construct is inserted into the genome of the oil-producing microorganism at a site where expression of the encoded elongase and desaturase is controlled by a promoter native to the oil-producing microorganism, and culturing the transformed microorganism under fatty acid production conditions that convert saturated fatty acids to more unsaturated fatty acids than a control, non-transformed microorganism. Optionally, the native promoter is a Δ9 desaturase promoter. Optionally, the desaturase is a Δ9 desaturase. The Δ9 desaturase can be a Thraustochytrium species or Ulkenia species Δ9 desaturase. The elongase in these methods can be a delta-5 elongase or a C16:0 elongase, which can be a C16:0 elongase from Oblongichytrium species. Optionally, the construct further comprises a third nucleic acid encoding a Δ12 desaturase, which may be a Thraustochytrium sp. Δ12 desaturase. Optionally, the construct further comprises a fourth nucleic acid encoding a Δ6 desaturase, which may be a Botryochytrium sp. Δ6 desaturase.

[0029] The construct in these methods may further comprise additional nucleic acids, for example, a nucleic acid encoding an Ω-3 desaturase, a nucleic acid encoding a Δ5 desaturase, or both. Optionally, the Ω-3 desaturase is an Oblongichytrium sp. Ω3 desaturase. Optionally, the Δ5 desaturase is a Thraustochytrium sp. Δ5 desaturase.

[0030] In the provided methods, the first and second nucleic acids can replace the endogenous Δ9 desaturase coding sequence of the microorganism.

[0031] As explained throughout, the construct may include several nucleic acids encoding polypeptides involved in fatty acid synthesis, with the construct including additional sequences such as a promoter, a selectable marker or resistance gene, a terminator, a linking sequence, etc. For example, the construct may include a zeocin resistance gene, one or more 2A sequences, a reporter gene such as luciferase, one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators, one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators, and combinations thereof.

[0032] This method can result in saturated fatty acids being converted to C16:0 and C18:0 unsaturated fatty acids. The unsaturated fatty acids can be C18:1 (oleic acid), C18:2(n-6) (linoleic acid), C18:3(n-3) (α-linoleic acid), C18:3(n-6) (γ-linoleic acid), or any combination thereof. The method can also result in transformed microorganisms producing increased amounts of C20:3(n-6) (di-homo-γ-linoleic acid), C20:4(n-3) (eicosatetraenoic acid), C20:5(n-3) (EPA), and C22:5(n-3) (DPA-3) compared to control, untransformed microorganisms.

[0033] Also provided are microbial oils produced by the engineered microorganisms described herein. The microbial oils may be produced by microorganisms selected from the group consisting of Schizochytrium, Oblongichytrium, Aurantiochytrium, and Thraustochytrium. Accordingly, provided herein are microbial oils and methods for making and using microbial oils. The oils include fatty acids in the form of monoglycerides, diglycerides, and triglycerides, as well as free fatty acids and phospholipids. Optionally, the microbial oils include at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) triglycerides. Optionally, the microbial oils include at least 95% triglycerides.

[0034] The oil also contains at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) total fatty acids (TFA) by weight. Optionally, the oil contains 85% to 99% total fatty acids by weight. Optionally, the microbial oil comprises 85% to 95% total fatty acids by weight. Optionally, the microbial oil comprises at least 90% total fatty acids.

[0035] Percentages referring to oil or total fatty acid are listed as weight % throughout.For example, if microbial oil comprises at least 90% total fatty acid, then the oil contains at least 90% total fatty acid by weight of the total fatty acid of the oil.Also, if the total fatty acid contains specific fatty acid, the percentage of specific fatty acid is expressed as weight % of total fatty acid throughout.For example, if the total fatty acid in the oil contains DHA, the amount of DHA is expressed as weight % of total fatty acid.For example, the total fatty acid comprises at least 50% DHA by weight.

[0036] As described, the total fatty acids of the provided oil contain DHA. Optionally, the total fatty acids contain at least 35%, at least 40%, or at least 45% DHA. Optionally, the total fatty acids contain at least 50% DHA. Optionally, the total fatty acids contain at least 60% DHA. Optionally, the total fatty acids contain 50%-70% DHA. Optionally, the total fatty acids contain 60%-70% DHA.

[0037] Provided herein is an oil containing C20:3(n-6) (di-homo-γ-linoleic acid) and C20:5(n-3) eicosapentaenoic acid (EPA). Thus, provided is a microbial oil containing fatty acids, the fatty acids comprising C20:3(n-6) (di-homo-γ-linoleic acid) and C20:5(n-3) eicosapentaenoic acid (EPA). The fatty acids may contain 0.01% to 16% C20:3(n-6) (di-homo-γ-linoleic acid) (DLGA), or any percentage or range within 0.01% to 16% DLGA. The fatty acids may contain 1-17% EPA, or 5-17% EPA, or any percentage or range within 1-17%.

[0038] The fatty acids in the oil may also include C14:0 (myristic acid) or C16:0 (hexadecanoic acid). Optionally, the fatty acids comprise 5-10% C14:0 (myristic acid), or any percentage or range within 5-10%. Optionally, the fatty acids comprise 13-22% C16:0 (hexadecanoic acid), or any percentage or range within 13-22%.

[0039] The fatty acids in the oil may include C18 unsaturated fatty acids. Optionally, the fatty acids include 10-60% C18 unsaturated fatty acids. The fatty acids may include 10-45% C18:1 oleic acid. Optionally, the C18 unsaturated fatty acids include C18:2(n-6) linoleic acid. For example, the fatty acids may include 0.01%-40% linoleic acid, or any percentage or range within 0.01%-40%.

[0040] Optionally, the fatty acids in the oil further include C18:3(n-3) (α-linoleic acid), C18:3(n-6) (γ-linoleic acid), C20:4(n-3) (eicosatetraenoic acid), C20:5(n-3) (EPA), and C22:5(n-3) (docosapentaenoic acid(n-3) (DPA-3).

[0041] Optionally, the total fatty acids in the oil comprise less than 45%, 40%, 35%, 30%, or 25% saturated fatty acids (SFAs). Saturated fatty acids in oils produced by the methods described herein include, but are not limited to, C12:0 (lauric acid), C14:0 (myristic acid), C15:0 (pentadecanoic acid), C16:0 (palmitic acid), C17:0 (heptadecanoic acid), and C18:0 (stearic acid). Optionally, the total fatty acids comprise 0.001% to 45% saturated fatty acids. Optionally, the total fatty acids in the oil comprise 10% to 45% saturated fatty acids (e.g., 10% to 40%, 10% to 30%, 10% to 20%, 15% to 30%, 15% to 20%, 20% to 30%, or 20% to 25% saturated fatty acids). Thus, the microbial oil may contain less than 35% saturated fatty acids. The microbial oil may contain less than 30% saturated fatty acids. Optionally, the microbial oil contains between 0.001% and 35% saturated fatty acids.

[0042] Also provided is a method for producing polyunsaturated fatty acids, comprising providing an engineered microorganism as described herein and culturing the engineered microorganism under conditions sufficient to produce polyunsaturated fatty acids.

[0043] The culture medium used in the described method provides the microorganism with various nutrients, including carbon and nitrogen sources. The culture medium can contain any of a variety of carbon sources. Examples of carbon sources include fatty acids, lipids, glycerol, triglycerol, carbohydrates, polyols, amino sugars, and any type of biomass or waste stream. Fatty acids include, for example, oleic acid. Carbohydrates include, but are not limited to, glucose, cellulose, hemicellulose, fructose, dextrose, xylose, lactulose, galactose, maltotriose, maltose, lactose, glycogen, gelatin, starch (corn or wheat), acetate, m-inositol (e.g., from corn steep liquor), galacturonic acid (e.g., from pectin), L-fucose (e.g., from galactose), gentiobiose, glucosamine, alpha-D-glucose-1-phosphate (e.g., from glucose), cellobiose, dextrin, alpha-cyclodextrin (e.g., from starch), and sucrose (e.g., from molasses). Polyols include, but are not limited to, maltitol, erythritol, and adonitol. Amino sugars include, but are not limited to, N-acetyl-D-galactosamine, N-acetyl-D-glucosamine, and N-acetyl-beta-D-mannosamine. The carbon source can be present in the heterotrophic medium at a concentration of 200 g / L, 175 g / L, 150 g / L, 100 g / L, 60 g / L, or less, for example, 1-200 g / L, 5-200 g / L, 10-200 g / L, 50-200 g / L, or 100-200 g / L.

[0044] The microorganisms can be cultured in media having a chloride concentration of about 0.5 g / L to about 50.0 g / L (e.g., about 0.5 g / L to about 35 g / L, about 18 g / L to about 35 g / L, or about 2 g / L to about 35 g / L). The microorganisms described herein can be grown under low chloride conditions, e.g., about 0.5 g / L to about 20 g / L, or about 0.5 g / L to about 15 g / L.

[0045] The culture medium optionally contains NaCl. The culture medium can contain non-chloride-containing sodium salts as a sodium source. Examples of non-chloride sodium salts suitable for use in accordance with the present method include, but are not limited to, soda ash (a mixture of sodium carbonate and sodium oxide), sodium carbonate, sodium bicarbonate, sodium sulfate, and mixtures thereof. See, for example, U.S. Patent Nos. 5,340,742 and 6,607,900, the entire contents of each of which are incorporated herein by reference. Optionally, the medium contains 9 g / L chloride when using 20 g / L carbon, 20 g / L soy peptone, and 5 g / L yeast extract. When the medium contains 10 g / L carbon, 5 g / L soy peptone, 5 g / L yeast extract, and 10 g / L agar, the medium can contain 35 g / L chloride. If the medium contains 20-40 g / L carbon, 1 g / L yeast extract, 1-20 g / L monosodium glutamate (MSG), 0.3-2.0 g / L phosphate, 4 g / L magnesium sulfate, 5-10 g / L ammonium sulfate, 1.5 mL / L trace element solution, 1 mL / L vitamin B solution, and 0.1 g / L CaCl2, the medium may contain 2 g / L chloride.

[0046] Media for microbial culture can include any of a variety of nitrogen sources. Exemplary nitrogen sources include ammonium solutions (e.g., NH4 in HO), ammonium or amine salts (e.g., (NH4)2SO4, (NH4)3PO4, NH4NO3, NH4OOCH2CH3(NH4Ac)), peptone, soy peptone, tryptone, yeast extract, malt extract, fish meal, monosodium glutamate, soy extract, casamino acids, and distiller's grains. The concentration of the nitrogen source in a suitable medium is typically within the range of about 1 g / L to about 25 g / L (e.g., about 5-20 g / L, about 10-15 g / L, or about 20 g / L). Optionally, when yeast extract is the complex nitrogen source in the medium, the nitrogen concentration is about 10-15 g / L. Optionally, when soy peptone is in the medium along with monosodium L-glutamate hydrate (MSG) or ammonium sulfate, the nitrogen concentration is about 1-5 g / L.

[0047] The medium optionally contains a phosphate, such as potassium phosphate or sodium phosphate (eg, potassium phosphate monobasic).

[0048] The inorganic salts and trace nutrients in the medium can include ammonium sulfate, sodium bicarbonate, sodium orthovanadate, potassium chromate, sodium molybdate, selenite, nickel sulfate, copper sulfate, zinc sulfate, cobalt chloride, iron chloride, manganese chloride, calcium chloride, and EDTA. Optionally, the medium contains at least 1.5 ml / L of a trace element solution. Optionally, the trace element solution contains 2 mg / mL copper(II) sulfate pentahydrate, 2 mg / mL zinc sulfate heptahydrate, 1 mg / mL cobalt(II) chloride hexahydrate, 1 mg / mL manganese(II) chloride tetrahydrate, 1 mg / mL sodium molybdate dihydrate, and 1 mg / mL nickel(II) sulfate.

[0049] The medium may optionally contain magnesium sulfate and / or monobasic potassium phosphate with a trace element solution.

[0050] Vitamins such as pyridoxine hydrochloride, thiamine hydrochloride, calcium pantothenate, p-aminobenzoic acid, riboflavin, nicotinic acid, biotin, folic acid, and vitamin B12 can be included in the culture medium.

[0051] The pH of the medium can be adjusted to between 3.0 and 10.0, inclusive, using an acid or base, as appropriate, and / or a nitrogen source. Optionally, the medium is sterilized.

[0052] Generally, the medium used to culture microorganisms is a liquid medium. However, the medium used to culture microorganisms may be a solid medium. In addition to the carbon and nitrogen sources discussed herein, a solid medium may contain one or more components (e.g., agar and / or agarose) that provide structural support and / or allow the medium to be in a solid form.

[0053] The microorganism can be cultured under known conditions, such as those described in International Patent Publication Nos. WO2007 / 069078 and WO2008 / 129358. For example, the culture can be performed for 1 to 30 days (e.g., 1 to 21 days, 1 to 15 days, 1 to 12 days, 1 to 9 days, or 3 to 5 days). The culture can be performed at a temperature of 4 to 30°C. Optionally, the culture can be performed by aeration shaking culture, shaking culture, static culture, batch culture, fed-batch culture, continuous culture, rolled-batch culture, wave culture, or the like. Optionally, the culture can be performed at a dissolved oxygen content of the culture medium of 1 to 20%, 1 to 10%, or 1 to 5%.

[0054] The biomass described herein can be incorporated into end products (e.g., foods or dietary supplements, biofuels, etc.). Accordingly, methods of using protein-rich biomass are provided. The methods optionally include incorporating the protein-rich biomass into food products (e.g., pet food, livestock feed, or aquaculture feed).

[0055] Oils or lipids can be isolated from the described microbial cultures and used in various foods and nutritional supplements.Suitable foods or nutritional supplements that can incorporate the oil include beverages such as milk, water, sports drinks, energy drinks, tea, and juice; confectioneries such as candy, jelly, and biscuits; fat-containing foods and drinks such as dairy products; processed foods such as porridge, infant formula, breakfast cereals, etc.Optionally, one or more produced lipids can be incorporated into dietary supplements, such as vitamins or multivitamins.Optionally, the oil produced according to the methods described herein can be included in dietary supplements, and optionally can be directly incorporated into ingredients of food or feed (e.g., dietary supplements).

[0056] Examples of feeds that can incorporate the oils or lipids produced by the methods described herein include pet foods such as feline food, dog food, feeds for ornamental fish, cultured fish, or crustaceans, or feeds for farmed animals (including livestock and aquaculture-raised fish or crustaceans). Food or feed ingredients that can incorporate the oils or lipids produced according to the methods described herein are preferably palatable to the intended recipient organism. The food or feed ingredients can have any physical properties currently known for food ingredients (e.g., solid, liquid, soft).

[0057] Optionally, one or more of the produced compounds (for example, PUFA) can be incorporated into nutritional supplement products or pharmaceutical products.Examples of such nutritional supplement or pharmaceutical forms include various types of tablets, capsules, drinks, etc.Optionally, the nutritional supplement or pharmaceutical preparation is suitable for topical use (for example, lotion form).Dosage forms can include, for example, capsules, oils, tablets, etc.

[0058] The oils or lipids produced according to the methods described herein can be incorporated into products in combination with any of a variety of other agents. For example, such compounds can be combined with one or more binders or fillers, chelating agents, pigments, salts, surfactants, humectants, viscosity modifiers, thickeners, emollients, fragrances, preservatives, etc., or any combination thereof.

[0059] As used herein, a control or standard control refers to a sample, measurement, or value that serves as a reference, usually a known reference, for comparison with a test sample, measurement, or value. For example, a test microorganism, e.g., a microorganism transformed with a nucleic acid sequence encoding a gene for metabolizing xylose, can be compared to a known normal (wild-type) microorganism (e.g., a standard control microorganism). A standard control can also represent an average measurement or value collected from a population of microorganisms (e.g., a standard control microorganism) that do not grow or grow poorly on xylose as the sole carbon source, or that have no or minimal levels of xylose isomerase activity, xylose kinase activity, and / or xylose transport activity. Those skilled in the art will recognize that standard controls can be designed to evaluate any number of parameters (e.g., RNA levels, polypeptide levels, specific cell types, etc.).

[0060] Disclosed are materials, compositions, and components that can be used for, used in conjunction with, used in preparation for, or are products of the disclosed methods and compositions. When these and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are disclosed, it is understood that each is specifically contemplated and described herein, even though specific reference to each of the various individual and collective combinations and permutations of these compounds may not be explicitly disclosed. For example, when a method is disclosed and discussed, and multiple modifications that can be made to multiple molecules comprising this method are discussed, each and every combination and permutation of this method and possible modifications is specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, including, but not limited to, steps in methods using the disclosed compositions. Thus, where there are various additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method step or combination of method steps of the methods of the present disclosure, and that each such combination or subset of combinations is to be considered specifically contemplated and disclosed.

[0061] Publications cited herein and the material for which they are cited are specifically incorporated herein by reference in their entirety.

[0062] The following examples are intended to further illustrate certain aspects of the methods and compositions described herein, and are not intended to limit the scope of the claims. [Example]

[0063] Example 1. Engineered microorganisms containing elongases and desaturases. The C16:0 elongase from Oblongichytrium (Obl) and the Δ9 desaturase from Ulkenia (Ulk) were codon-optimized for ONC-T18 (ATCC Accession No. PTA-6245, also referred to throughout as T18), placed under the control of the native Δ9 desaturase promoter, and cloned upstream of the neomycin resistance (neo-R) gene, resulting in plasmid pHR37 (seen in Figure 2-1). A 2A and GSG linker were included between each gene to ensure efficient cleavage of the expressed proteins. T18 was biolistically transformed to obtain G418-resistant transformants (referred to herein as lineage 95).

[0064] Homozygous homologous recombination at the Δ9 desaturase locus was confirmed by Southern blot using probes against the Δ9 desaturase promoter and the upstream region of neomycin, as shown in Figures 3B and 4. The fatty acid profiles of the 95 series of transformants and T18 WT were determined by growing the strains in 25 mL WDL cultures for 7 days until glucose was depleted (<1 g / L glucose remained). The harvested biomass was lyophilized and subjected to FAME analysis, yielding the oil profiles shown in Figures 5 and 6. T18 WT produced 7.23 milligrams of C18:0 oleic acid per gram of dry biomass (mg / g) and 1.82 milligrams of C18:1 oleic acid per gram of dry biomass (mg / g) (Figure 5). The 95-line transformants produced up to 115.15 mg of C18:0 / g dry biomass (transformant 95-29) and 95.80 mg of C18:1 oleic acid / g dry biomass (transformant 95-3). These C18:0 / dry biomass and C18:1 / dry biomass ratios represent a 1493% and 5164% increase, respectively, over those found in wild-type (WT) T18. One 95-line transformant, 95-1, was grown in 25 milliliters (mL) of WDL and 25 mL of 10% N WDL to compare oil profiles under normal growth and nitrogen stress, respectively. Cultures were grown at 25°C for 8 days to deplete glucose (<1 g / L glucose remaining). The harvested biomass was lyophilized and subjected to FAME analysis, yielding the oil profile shown in Figure 7. C18:1 oleic acid in low nitrogen increased from 66.05 mg / g dry biomass to 244.60 mg / g dry biomass, representing a 270.3% increase in oleic acid content under low nitrogen conditions, and total fatty acids (TFA) in low nitrogen increased from 434.46 mg / g dry biomass to 695.49 mg / g dry biomass, representing a 60.1% increase.

[0065] Transformant 95-1 was also grown in a 5 liter (L) fermenter under standard conditions. Briefly, a 500 mL seed culture of transformant 95-1 in Windus Light (containing 5 g / L yeast extract) was grown at 25°C for 72 hours. 300 mL of the culture was used to inoculate 2.7 L of Windust medium (300 g glucose, 6 g yeast extract, 9.24 g MgSO4.7H2O, 4.95 g NaCl, 11.7 mg FeCl3.6H2O, 24.57 mg citric acid, 7.2 mg CuSO4.5H2O, 7.2 mg ZnSO4.7H2O, 3.6 mg Na2MoO) in a fermenter. The solution contained 4.2H2O, 3.6 mg CoCl2.6H2O, 3.6 mg MnCl2.4H2O, 3.6 mg NiSO4.6H2O, 46.26 g (NH4)2SO4, 5.1 g KH2PO4, 5.55 g K2HPO4, 0.3 g CaCl2.2H2O, 0.09 mg vitamin B12, 0.09 mg biotin, 18 mg thiamine HCl, and 5 drops of Biopmex 153K. A 750 w / v glucose solution was periodically added to maintain the glucose concentration in the vessel between 40 and 90 g / L. The glucose concentration was measured using a YSI analyzer (YSI Incorporated, Yellow Springs, Ohio). The consumption rate was maintained below 2.5 g glucose / L / h by adjusting the agitation. The fermentation was considered complete when 1650 g of total glucose had been consumed. The fermentation was carried out at 20°C, and the pH was maintained at 5.75 by adding 5 M NaOH. The vessel was operated at 20°C and agitated at 450-650 rpm. The fermentation continued for 264 hours. Samples were taken throughout the fermentation to compare the oil profiles at different time points, as shown in Figure 8.

[0066] Example 2. Engineered microorganisms containing desaturase promoters. The reporter gene Gaussia luciferase (Gluc) was inserted into the plasmid pJB12 at the 3' end under the control of the native Δ9 desaturase promoter and the zeocin resistance gene (ble) as shown in FIG. R) into an expression construct and separated by the 2A sequence. T18 was biolistically transformed with pJB12 to obtain zeomycin-resistant transformants, referred to herein as the luciferase lineage. Southern blot analysis using a probe for Δ9 desaturase confirmed homozygous homologous recombination at the Δ9 locus in one transformant, as shown in Figure 9. Luciferase transformants were grown in 50 mL of WDL for 5 days. Biomass harvested from these cultures was lyophilized and subjected to FAME analysis. The FAME data in Figure 10 show that homozygous knockout of the native Δ9 desaturase in T18 results in the absence of C16:1n-7, C18:1n-9, and C18:1n-7, consistent with the gene's proposed function.

[0067] Example 3. Engineered microorganisms containing desaturases. The native T18 Δ9 desaturase was cloned into an expression construct under the control of the native T18 α-tubulin promoter, resulting in plasmid pJB76, as shown in Figure 2-1. T18 was biolistically transformed to obtain Zeocin-resistant transformants, referred to herein as line 57. PCR was used to confirm integration of the Zeocin-containing construct in the transformed strains. Transformants from line 57 were grown in 56 mL of WDL for 5–7 days until glucose was depleted to <4 g / L. The harvested biomass was lyophilized and subjected to FAME analysis. The resulting FAME data are shown in Figure 11. As shown in Figure 12, the FAME data demonstrate an increase in C16:1n-7 and C18:1n-7 relative to WT in all transformants. The most significant increase is in transformant 57-6. Transformant 57-6 had 11.57 mg C16:1n-7 / g biomass and 11.40 mg C18:1n-7 / g biomass compared to 2.15 mg / g and 0.89 mg / g, respectively, for the WT, representing an increase of 438% and 1180%, respectively.

[0068] Example 4. Engineered microorganisms containing desaturases under the control of their native promoters. The native T18 Δ9 desaturase was cloned into an expression construct under the control of the T18-specific PUFA synthase subunit B promoter (subB) containing homology arms, knocking out the native fatty acid elongase, resulting in plasmid pJB87, as shown in Figure 2-1. Polymerase chain reaction (PCR) analysis was used to confirm integration of the Zeocin-containing construct in the transformant strains. Eighty-four transformants were grown in 50 mL of WDL for 5–6 days. The harvested biomass was lyophilized and subjected to FAME analysis, as shown in Figure 13. As shown in Figure 14, the FAME data indicate an increase in both C16:1n-7 and C18:1n-7 relative to T18 WT in most transformants. The most significant increase in Omega-7 was in transformant 84-7, which had 10.9 mg C16:1n-7 / g biomass and 4.58 mg C18:1n-7 / g biomass compared to 2.58 mg / g and 1.94 mg / g, respectively, in the WT, representing an increase of 322% and 136%, respectively, compared to the WT.

[0069] Example 5. Engineered microorganisms containing a Δ12 desaturase. The Δ12 desaturase from Thraustochytrium (Thr) was codon-optimized for T18. This gene was codon-optimized to encode a C16:0 elongase (Obl), a Δ9 desaturase (Ulk), and a zeocin resistance gene (ble) on the 3' side under the control of the native T18 Δ9 desaturase promoter, as shown in Figure 2-1. R) and separated by the 2A sequence, yielding plasmid pHR51. T18 was biolistically transformed with pHR51 to obtain a zeomycin-resistant transformant designated line 116. Southern blot analysis using a probe against the upstream region of the Δ9 desaturase promoter confirmed either homozygous or heterozygous homologous recombination at the Δ9 desaturase locus in the transformants, as shown in Figure 3B. Eleven of the 12 transformants were double knockouts, and the 116-2 transformant is heterozygous for homologous recombination at the Δ9 locus. The fatty acid profiles of line 116 transformants and T18B WT grown in 10% N WDL and recovered upon glucose depletion were determined by FAME analysis, as shown in Figure 15. While T18 WT contains no C18:2 linoleic acid, line 116 transformants produced up to 67.1 mg / g dry biomass, representing 9.7 weight percent of the total fatty acids. The weight percentage is determined by mg / g of a particular fatty acid relative to mg / g of total fatty acids.

[0070] Example 6. Engineered microorganism containing a Δ12 desaturase under the control of a tubulin promoter. The Δ12 desaturase (Thr) was cloned under the control of the T18-specific alpha-tubulin promoter, resulting in plasmid pHR47, as shown in Figure 2-1. T18 transformant 95-1 (the oleic acid-producing form shown in Figure 5) was biolistically transformed with pHR47 to obtain zeocin-resistant transformants, referred to herein as transformants from the 110 series. Southern blotting revealed potential alpha-tubulin knockouts: 110-1, 3, 4, 9, and 10, as shown in Figure 16B. Transformants from the 110 series were grown in 25 mL of 10% N WDL for 6 days until glucose was depleted to 10 g / L remaining. The harvested biomass was lyophilized and subjected to FAME analysis to obtain the oil profile shown in Figure 17. T18 WT contained no 18:2 linoleic acid, the parent 95-1 contained 0.51 mg linoleic acid / g dry biomass, and the 110-3 transformant produced 31.91 mg linoleic acid / g dry biomass, representing 4.8 weight percent of total fatty acids, a 6257% increase over the 95-1 parent.

[0071] Example 7. Engineered microorganisms containing PUFA synthase subunits. Two protein domains from Shewanella PfaC (a subunit of PUFA synthase) were codon-optimized for T18 and cloned into the plasmid pHR26 under the control of the subB promoter. T18 was biolistically transformed with the plasmid pHR26 as described in Figure 2-1. Because using homology arms from the native T18 PUFA synthase subunit B could potentially result in homologous recombination with subB and knockout of subB, transformants were recovered on medium supplemented with 0.5 millimolar (mM) DHA. One Zeocin-resistant transformant was obtained, referred to herein as the 67-1 transformant. When streaked on plates without PUFA supplementation, the 67-1 transformant failed to grow, indicating that transformant 67-1 is auxotrophic. WT T18 and transformant 67-1 were grown in 50 mL WDL cultures and supplemented with 0.5 mM of different free fatty acid PUFAs in each culture: DHA, EPA, ARA, ALA, and GLA. The cultures were grown for 14 days, at which point the T18 cultures had completely consumed glucose (<1 g / L remaining), while the 67-1 cultures had 20.6 g / L glucose (DHA culture), 28.1 g / L glucose (EPA culture), 37.9 g / L glucose (ARA culture), 54.9 g / L glucose (ALA culture), and 54.6 g / L glucose (GLA culture). The harvested biomass was lyophilized and subjected to FAME analysis, yielding the oil profile shown in Figure 18. The average 18:1n-7 content in WT T18 from these cultures grown in the presence of different free fatty acid PUFAs was 0.346 mg / g dry biomass. The average 18:1n-7 content in the 67-1 transformants of these cultures grown in the presence of different free fatty acid PUFAs was 33.54 mg / g dry biomass, representing a 9694% increase over WT T18. The partial conversion of the PUFA-fed cultures indicates the presence of limiting fatty acid elongases and desaturases in WT T18.Notably, cultures fed with ALA accumulated EPA (3.88 mg / g, or 8.8 weight percent of total fatty acids), and 67-1 cultures fed with GLA accumulated ARA (3.63 mg / g, or 8.5 weight percent of total fatty acids).

[0072] Example 8. Engineered microorganisms containing Omega-3 desaturase. The Omega-3 desaturase from Oblongichytrium (Obl) was codon-optimized for T18 and cloned into an expression construct under the control of the T18-specific PUFA synthase subunit B promoter (subB) in plasmid pHR52, as shown in Figure 2-1. T18 transformant 110-3 (linoleic acid-producing, as shown in Figure 17) was biolistically transformed with pHR52 to obtain hygromycin-resistant transformants, referred to herein as series 113 transformants. Knocking out subunit B of the PUFA synthase results in dysfunction of the PUFA synthase, resulting in an auxotroph that requires PUFA supplementation (as described for transformant 67-1). Therefore, transformants are recovered on medium supplemented with 0.5 mM DHA. One of the auxotrophic transformants, referred to herein as transformant 113-4, was recovered. Southern blot confirmed that 113-4 is a homozygous knockout in subunit B of PUFA synthase, as shown in Figure 19B. Transformants from line 113 were grown in flasks in 25 mL of 10% N WDL (cultures of 113-4 also contained 0.5 mM DHA) for 7 days until glucose was depleted to <1 g / L. Transformants 113-4 and 113-14 still had significant glucose at day 7 and were grown for an additional 2 days, at which point the 113-4 culture had 14.2 g / L glucose and the 113-14 culture had 11.8 g / L glucose. All cultures were harvested for biomass, which was lyophilized and subjected to FAME analysis, resulting in the oil profiles shown in Figure 20.

[0073] Example 9. Engineered microorganisms containing Omega-3 desaturase under the control of the native promoter. The Ω-3 desaturase (Obl) gene under the control of the T18-specific subB promoter was cloned into pHR58 with a neomycin resistance marker at the 5' end and biolistically transformed into strain 116-5, as shown in Figure 2-1. One G418-resistant transformant, designated herein as 121-1, was recovered in medium supplemented with 0.5 mM DHA. Southern blot analysis confirmed that 121-1 was a homozygous knockout in subunit B of PUFA synthase, as shown in Figure 21B. Transformant 121-1 was grown in 25 mL of WDL culture containing 0.5 mM DHA, 10% N, and either 0.5 mM GLA or 0.5 mM ALA. The DHA-supplemented culture was glucose-starved for 7 days. Cultures supplemented with GLA and ALA were grown for 8 days until 16.4 g / L glucose remained for the 121-1 transformant in GLA and 21.6 g / L glucose remained for the 121-1 transformant in ALA. All cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis to obtain the oil profiles shown in Figures 22 and 23.

[0074] An unexpected aspect of the present invention is the discovery that expressing a gene in tandem with other genes at the native Δ9 desaturase site leads to more efficient substrate conversion than expressing the genes at separate sites. Transformation series 110 expresses a Δ12 desaturase (Thr) in a parent that has both a C16:0 elongase (Obl) and a D9 desaturase (Ulk) expressed at the native T18 Δ9 desaturase site. Transformant 110-3 produces 31.91 mg of 18:2-6 / g biomass. When PUFA synthase subB is knocked out in strain 110-3, the resulting strain produces up to 81.78 mg of 18:2-6 / g biomass. Transformation line 116 co-expresses the C16 elongase at the native T18 Δ9 desaturase site and the Δ12 desaturase (Thr) on the same open reading frame as the Δ9 desaturase. Transformant 116-5 produces 67.11 mg of 18:2-6 / g biomass. When PUFA synthase subB is knocked out in strain 116-5, the resulting strain produces up to 269.92 mg of 18:2-6 / g biomass. This represents a 330% increase in 18:2-6, the product of the Δ12 desaturase. These results are shown in Figure 24.

[0075] Example 10. Engineered microorganisms containing a Δ6 desaturase. The Δ6 desaturase from Botryochytrium (Bty) was codon-optimized for T18 and cloned into an expression construct under the control of the subunit B promoter in pHR64, as shown in Figure 2-1. The linoleic acid-producing transformant 116-5 (LA, C18:2n-6) was biolistically transformed using pHR64. Because knockout of subunit B of PUFA synthase generally results in auxotrophs, transformants were recovered on medium supplemented with 0.5 mM DHA. Four G418-resistant transformants were recovered. Southern blot analysis confirmed that 127-3 was a homozygous knockout in subunit B of PUFA synthase, as shown in Figure 24. Transformants from the 127 series were grown in 25 mL of 10% N WDL (0.5 mM DHA was added to the 127-3 culture) for 6–7 days until glucose depletion (<1 g / L glucose remained). All cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis to obtain the oil profile shown in FIG.

[0076] Example 11. Engineered microorganisms containing a Δ6 desaturase and an Ω-3 desaturase. The Δ6 desaturase (Bty) and Ω-3 desaturase from Pavlova pinguis (Pav) were codon-optimized for T18 and cloned into an expression vector under the control of the subB promoter in pHR62, as shown in Figure 2-1. Linoleic acid (LA)-producing strain 116-5 was biolistically transformed with pHR62. Transformants were recovered in medium supplemented with 0.5 mM DHA. Three G418-resistant transformants were recovered. As shown in Figure 25B, Southern blot analysis confirmed that 129-1 and 129-2 were homozygous knockouts in subunit B of PUFA synthase. Transformants from the 129 series were grown in 25 mL of 10% N WDL (0.5 mM DHA was added to cultures of 129-1 and 129-2) for 6–7 days until glucose depletion (<1 g / L glucose remaining). All cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis to obtain the oil profile shown in FIG.

[0077] Example 12. Engineered microorganisms containing knockouts of subB. The PUFA-auxotrophic strains generated by knockout of subB in transformant 116-5 were restored to PUFA prototrophy by passage of cells from various mutant strains through decreasing concentrations of DHA, starting with 0.5 mM DHA, followed by 0.25 mM DHA, 0.05 mM DHA, and finally WDL medium without PUFA supplementation.

[0078] After subculture, axenic strains capable of growth without PUFA supplementation were isolated. Transformant 121-1, expressing Omega-3 desaturase (Obl) from the subB locus, was inoculated into 10 mL of WDL + 0.5 mM DHA and grown for 7 days. A 100 μL sample of the 0.5 mM DHA culture was used to inoculate a 10 mL WDL + 0.25 mM DHA culture and grown for 7 days. A 100 μL sample of the 0.25 mM DHA culture was used to inoculate a 10 mL WDL + 0.05 mM DHA culture and grown for 7 days. A 100 μL sample of the 0.05 mM DHA culture was spread onto a Windust plate and grown for 6 days. Several colonies that grew after 6 days were restreaked onto a second Windust plate and grown for an additional 12 days. The mixed population was restreaked onto a third Windust plate and grown for an additional 3 days. Two 10 mL WDL cultures were inoculated with single colonies from the third WD plate and grown for an additional 4 or 7 days, designated herein as 121-1-S and 121-1-F, respectively. 100 μL samples of the 4-day and 7-day 121-1-S and 121-1-F cultures were used to inoculate 10 mL WDL cultures, which were then grown for 3 days. These 3-day WDL cultures inoculated with 121-1-S and 121-1-F, respectively, were used to make frozen stocks, and 100 μL samples of each stock were used to inoculate 25 mL WDL and 10% N WDL FAME cultures of both 121-1-S and 121-1-F. These WDL FAME cultures were grown for 8 days to a glucose of 2.57 g / L for 121-1-S and for 11 days to a glucose of 12.9 g / L for 121-1-F.

[0079] The cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis, resulting in the oil profile shown in Figure 28. Transformants 127-3 and 129-2, expressing either the Δ6 desaturase (Bty) (127-3) from the subB locus or both Bty and the Ω3 desaturase (Pav) (129-2), were also initially auxotrophic and restored to prototrophy. Ten milliliter (10 mL) samples of WDL + 0.5 mM DHA were inoculated with 127-3 or 129-2 from the plates and grown for three days. A 50 μL sample of the 0.5 mM DHA culture was used to inoculate a 10 mL WDL + 0.25 mM DHA culture. After three days, the 0.25 mM DHA culture was transferred from 25°C to 20°C. The 0.25 mM DHA culture was grown for a total of 6 days, after which a 100 μL sample of the DHA culture was used to inoculate a 10 mL WDL+0.05 mM DHA culture, and those cultures were grown for 7 days.

[0080] A 100 μL sample of the 0.05 mM DHA culture (first culture) of transformant 129-2 was used to inoculate a second culture (10 mL WDL + 0.05 mM DHA) and grown for 7 days. A 100 μL sample of the 0.05 mM DHA culture of the second transformant 129-2 was used to inoculate a third 10 mL WDL culture. The third 10 mL WDL (unsupplemented) 129-2 culture was grown for 6 days, at which point a 100 μL sample was used to inoculate a fourth 10 mL WDL culture. The fourth 129-2 WDL culture was grown for 8 days.

[0081] A 100 μL sample of a 7-day-grown 0.05 mM DHA culture of transformant 127-3 was used to inoculate a 10 mL WDL (unsupplemented) culture and grown for 13 days. A 100 μL sample of the 127-3 WDL culture was used to inoculate a second 10 mL WDL culture and grown for 8 days.

[0082] Cultures of 129-2WDL(2P) and 127-3WDL(2P) were grown for 8 days at 25°C, after which 100 μL samples of each culture were used to inoculate 10 mL of WDL(3P) in 129-2 and 127-3. Cultures of 129-2WDL(3P) and 127-3WDL(3P) were grown for 3 days, after which frozen stocks were made from each. Mixed populations of prototrophic 129-2 and 127-3 were recovered from glycerol stocks onto Windust plates and streaked onto separate Windust plates for single colonies. Colonies of 127-3 grew for 6 days, and four of these colonies were picked and designated 127-3-T, W, and R+P. The 129-2 colonies were grown for 10 days, after which four of these colonies were picked and designated 129-2-T, W, and R+P. A 100 μL sample of 10 mL of 3-day-old WDL axenic stock was used to make frozen stocks and inoculate 25 mL of 10% N WDL cultures. The 127-3-T, W, and R+P cultures were grown for 8 days until all glucose was depleted. The 129-2-T, W, and R+P cultures were grown for 18 days. Residual glucose concentrations were 8.44, 9.61, 22.2, or 10.5 g / L of glucose in the 129-2-T, 129-2-W, 129-2-R, and 129-2-P cultures, respectively.

[0083] The cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis to obtain the oil profile shown in Figures 29 and 30. The 127-3 axenic transformant produced a maximum of 49.32 mg C20:3(n-6)(DGLA) / g dry biomass, representing a 7.3% increase in the FAME profile from 0.68 mg / g DGLA for 116-5, or a 0.1% increase in the FAME profile.

[0084] Example 13. Engineered microorganisms containing multiple desaturases. As shown in Figure 2-1, the Δ6 desaturase (Bty) was expressed under the control of the native T18 Δ9 desaturase promoter, and on the 3' side, the C16:0 elongase (Obl), the Δ9 desaturase (Ulk), and the zeocin resistance gene (bleR ), and cloned 5' into the Δ12 desaturase (Thr), separated by the 2A sequence, resulting in plasmid pHR84. T18 was biolistically transformed with pHR84 to obtain zeomycin-resistant transformants, referred to herein as line 164. The fatty acid profiles of line 164 transformants and T18B WT grown in 10% N WDL and harvested upon glucose depletion were determined by FAME analysis, as shown in Figure 31. T18 WT contained 1.13 mg of C18:3-6 (γ-linoleic acid) / g dry biomass, while line 164 transformants produced up to 23.2 mg / g, representing 3.4% by weight of total fatty acids.

[0085] Example 14. Engineered microorganisms containing multiple desaturases under the control of their native promoters. The Omega-3 desaturase (Pav) was cloned under the control of the native T18 Δ9 desaturase promoter, with the C16:0 elongase (Obl) at the 3' end, the Δ9 desaturase (Ulk) at the 5' end, and the Zeocin resistance gene (ble) at the 6' end, as shown in Figure 2-2. R ), Δ6 desaturase (Bty), and Δ12 desaturase (Thr) were cloned into T18 and separated by the 2A sequence, resulting in plasmid pHR86. T18 was biolistically transformed with pHR86 to obtain a zeomycin-resistant transformant, designated line 167. As shown in Figure 32, the fatty acid profile of line 167 strains grown in 10% N WDL and recovered upon glucose depletion was determined by FAME analysis. Line 167 transformants produced up to 36.6 mg GLA / g dry biomass, representing 5.3% by weight of total fatty acids.

[0086] Example 15. Engineered microorganisms containing desaturases under the control of a tubulin promoter. As shown in Figure 2-1, the Δ5 desaturase (Thr) was codon-optimized for T18 and cloned 3' to the hygromycin resistance gene (Hygro) into an expression vector containing the T18-specific alpha-tubulin promoter (Figure 2-1). The resulting plasmid was designated pHR83. DGLA-producing 127-3-W was biolistically transformed with pHR83. Six hygromycin-resistant transformants were recovered. As shown in Figures 33 and 34, the fatty acid profiles of the 165 lineage transformants grown with the parent 127-3-W in 10% N WDL and recovered at or near glucose depletion (7.04, 2.21, and 8.06 g / L of glucose remained for 165-3, 165-5, and 165-6) were determined by FAME analysis. Transformants of line 165 produced up to 83.07 mg DGLA / g dry biomass, representing 15.4 weight percent of the total fatty acids.

[0087] Example 16. Engineered microorganisms containing delta 5 desaturase. The Δ5 desaturase (Thr) was cloned into an expression vector under the control of the pHR95 sub-B promoter and 5' to the G418 resistance gene (neo), as shown in Figure 2-2. GLA-producing strain 167-1 was biolistically transformed with pHR95. Transformants were recovered in medium supplemented with 0.75 mM DHA. Three G418-resistant transformants were recovered. Transformants 173-1 and 173-2 were also DHA auxotrophs. 173-1 and 173-2 were grown in 25 mL of 10% N WDL + 0.5 mM DHA for 7 days until glucose consumption stalled (approximately 13 g / L glucose remaining). Transformant 173-3 was grown in 10% N WDL for 4 days until glucose was depleted (<1 g / L glucose remaining). All cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis to obtain the oil profile, as shown in Figure 35.

[0088] Example 17. PUFA auxotrophic engineered microorganisms were restored to PUFA prototrophy. A PUFA-auxotrophic strain, generated by knockout of subB in strain 167-1, was restored to PUFA prototrophy. Restoration of auxotrophy was achieved by passage of cells derived from 173-1 and 173-2 through decreasing concentrations of DHA, starting with 0.5 mM DHA, followed by 0.25 mM DHA, 0.125 mM DHA, 0.05 mM DHA, and finally WDL medium supplemented with no PUFAs. Mixed populations of prototrophic 173-1 and 173-2 were allowed to recover on Windust plates and streaked onto individual Windust plates for single colonies. Colonies of 173-1 grew for 6 days, and four were picked and designated 173-1-T, 173-1-W, 173-1-R, and 173-1-P. Colonies of 173-2 were grown over 7 days, and four were picked and designated 173-2-T, 173-2-W, 173-2-R, and 173-2-P. Frozen stocks were made using 100 μL of 3-day-old 10 mL WDL axenic stock and inoculated into 25 mL of 10% N WDL culture. Cultures of 173-1-T, 171-1-W, 171-1-R, and 171-1-P were grown for 7–10 days until glucose consumption stalled. Cultures of 173-2-W, 173-2-R, and 173-2-P were grown for 7 days. One of the strains, 173-2-T, did not grow well in culture. Residual glucose concentrations were 24.8, 26.8, 21.4, 24.5, 23.7, 32.1, and 25.6 g / L of glucose in 173-1-T, 173-1-W, 173-1-R, 173-1-P, 173-2-W, 173-2-R, and 173-2-P, respectively. The cultures were harvested for biomass, which was freeze-dried and subjected to FAME analysis to obtain the oil profiles shown in Figures 36 and 37.

[0089] Interestingly, different PUFA products accumulated in the 173 transformation lines. In one recovered auxotroph, 173-1, EPA accumulated at approximately 5.0% in axenic flasks. In another recovered auxotroph, 173-2, from the same transformation, DPAn-3 accumulated at approximately 4.0% in axenic flasks, as shown in Figure 35. Without wishing to be bound by any theory, it appears that the elongase in WT T18 that acts on EPA to convert it to DPAn-3 is inactivated in 173-1.

[0090] In an attempt to determine the identity of this elongase, RT-qPCR experiments were performed using five forward elongases selected from the annotated sequencing data. These elongases were designated "fatty acid elongase," "polyunsaturated fatty acid Δ5 elongase," "C18-Δ9-specific elongase," "very long-chain fatty acid elongase 1," and "very long-chain fatty acid elongase 2." While the results showed no elongases to be completely inactivated in 173-1-R, there is one candidate: very long-chain fatty acid elongase 2, which appears to experience much greater upregulation in 173-2-R. The best natural elongase candidate for upregulation in the recovered auxotroph, responsible for the conversion of g-linolenic acid to DGLA, is polyunsaturated fatty acid Δ5 elongase (Figure 38).

[0091] Example 18. Engineered microorganisms subject to adaptive evolution. Transformant 173-1-R was subjected to adaptive laboratory evolution. In this method, the transformant was passaged 30 times in 10 mL of WDL + 30 g / L NaCl. Each subculture was grown at 25°C for 24 hours and then at 4°C for 48 hours. The culture was then used to inoculate 10 mL of fresh 10 mL of WDL + 30 g / L NaCl and subjected to the same temperature cycle. After 30 passages, single colonies were obtained from the resulting mixed population. Axenic transformants were grown in 60 mL of UF60 medium at 20°C for 10–14 days (until glucose was depleted). FAME profiles of seven axenic transformants isolated from the 173-1-R ALE mixed population are shown in Figures 39 and 40.

[0092] Example 19. Engineered microorganisms subject to mutagenesis. Transformant 173-1-R was subjected to mutagenesis in 10 mL of WDL containing 0.3 M ethyl methanesulfonate (EMS). Working in the dark, the culture was incubated at 28°C and 200 rpm for 1 hour. The culture was pelleted at 1000 g for 3 minutes, washed with phosphate-buffered saline (PBS), resuspended in 10 mL of WDL, and allowed to recover at 25°C and 200 rpm in the dark for 3 days. 100 μL of the recovered culture was used to inoculate 10 mL of WDL and grown at 25°C and 200 rpm in the dark for 4 days. The culture was pelleted at 1000 g for 3 minutes and resuspended in 8 mL of PBS. Four milliliters of resuspended cells were stained with 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY) (1 μL of BODIPY and 397 μL of 50% glycerol were added) and incubated at room temperature in the dark for 20 minutes. Cells were pelleted at 1000 x g for 3 minutes, washed with 4 mL of PBS, and then pelleted again and resuspended in 4 mL of PBS. One milliliter (1 mL) of resuspended cells was added to 3 mL of PBS, and single cells were sorted by FACS using a Bio-Rad S3e Cell Sorter onto a 96-well plate containing WDL medium. After sorting, the plate was incubated at 25°C with shaking for 72 hours in a BioTek Synergy H1 Hybrid Reader. One well showed significant growth; this strain was designated 173-1-R MUT1. 173-1-R MUT1 was grown in 60 mL WDL in triplicate baffled flasks at 25°C and 200 rpm for 6-7 days (until glucose was depleted). The FAME profiles of these transformants are shown in Figures 41 and 42.

[0093] Example 20. Engineered microorganisms subject to mutagenesis. Transformant 173-1-R was subjected to mutagenesis in 10 mL of WDL containing 0.35 M ethyl methanesulfonate (EMS). Working in the dark, the culture was incubated at 200 rpm at 28°C for 1 hour. The culture was pelleted at 1000 g for 3 minutes, washed with PBS, resuspended in 10 mL of WDL, and allowed to recover at 200 rpm at 25°C in the dark for 7 days. 100 μL of the recovered culture was used to inoculate 10 mL of WDL + 1.5 mM isoniazid + 12.5 μM cerulenin and grown at 200 rpm at 25°C for 3 days. 3 milliliters of the culture was pelleted at 1000 g for 3 minutes and resuspended in 3 mL of PBS. The resuspended cells were stained with BODIPY (1.5 μL of BODIPY and 6.5 μL of DMSO were added) and incubated at room temperature in the dark for 20 minutes. Cells were pelleted at 1000 g for 3 minutes, washed with 3 mL of PBS, then pelleted again and resuspended in 3 mL of PBS. Single cells were sorted by FACS using a Bio-Rad S3e Cell Sorter into 96-well plates containing WDL medium. After sorting, plates were incubated in a BioTek Synergy H1 Hybrid Reader at 25°C with shaking for 14 days. A transformant isolated from growth in one of the wells was designated 173-1-R MUT5. Strains 173-1-R and 173-1-R MUT5 were grown in 60 mL UF60 in triplicate baffled flasks at 20°C and 200 rpm for 13 days (until glucose was depleted). FAME profiles are shown in Figures 43 and 44.

[0094] During the oil profile engineering attempts described above, it became clear that there was a unique transcriptional activity conferred by the juxtaposition of the native Δ9 desaturase promoter and the C16 elongase ORF, connected by a short junction sequence. This transcriptional activity was significantly reduced when the Δ6 desaturase (Bty) or Ω-3 desaturase (Obl) was located 3' to the Δ9 desaturase promoter. This effect can be seen in Figure 45, which compares line 116 (C16elo3'~Δ9PR), line 136 (Δ6desBty3'~Δ9PR), and line 137 (Ω-3 desaturase Obl3'~Δ9PR). Compared to the transformants of line 116, lines 136 and 137 show an approximately 10-fold decrease in oleic acid production. The reduced activity of C16 elongase (Obl) on C16:0 in the 136 and 137 lines leads to the accumulation of more than 2.5-fold more C16:0 in the 116 line.

[0095] An unexpected and unintended effect of manipulating the classical pathway in T18 was increased production of carotenoids, as well as the production of novel carotenoid species not normally found in T18. Oil extracted from fermentation of the recovered auxotroph and EPA producer 173-1-R was analyzed by HPLC and showed a 93% increase in β-carotene content and a 203% increase in canthaxanthin content when compared to oil samples from WT T18.

[0096] Example 21. Engineered microorganism containing T18 wild-type polyunsaturated fatty acid delta 5 elongase (5ELO). Based on the qPCR results, the D5 elongase from WT T18, designated 5ELO, was cloned into an expression vector under the control of the native T18 Δ9 desaturase promoter, with the C16:0 elongase (Obl) and Δ9 desaturase (Ulk), a zeocin resistance gene (bleR), and a Δ6 desaturase (Bty) at the 3' end, and with the Ω-3 desaturase (Pav) (two copies), a Δ5 desaturase (Thr), and a Δ12 desaturase (Thr) at the 5' end, separated by a 2A sequence, to yield pHR101. T18 WT was biolistically transformed with pHR101 to obtain zeocin-resistant transformants, referred to herein as the 180 series of transformants. The fatty acid profiles of transformants 180-1 and 180-2 of the 180 series, grown in 10% N WDL until glucose depletion, were determined by FAME analysis, as shown in Figure 46. While T18 WT has been demonstrated to produce little EPA and no C18:2 linoleic acid, 180-1 produced 23.3 mg / g EPA and 25.4 mg / g linoleic acid, representing 3.4% and 3.7% by weight of total fatty acids. The weight percentages are determined by mg / g of specific fatty acid relative to mg / g of total fatty acids. Strain 180-1 produced EPA at levels comparable to 173-1-R: 23.3 mg / g vs. 24.6 mg / g, respectively.

[0097] Strain 180-1 was biolistically transformed with pHR64 with the intent of knocking out subunit B of PUFA synthase. G418-resistant transformants were obtained and are referred to herein as 183-series transformants. The fatty acid profiles of 183-3 and 183-(5-8) transformants grown in 10% N WDL + 0.6 mM DHA to 18.7, 22.2, 14.2, or 29.3 g / L of glucose remaining, respectively (no glucose reading for 183-8 due to YSI device error), were determined by FAME analysis, as shown in Figure 47. Strain 183-8 was restored to prototrophy using previously described methods to yield axenic strains 183-8-T, 183-8-W, 183-8-R, and 183-8-P. The fatty acid profiles of 183-8-T, -W, -R, and -P grown in 10% N WDL to 3.63, 3.33, 3.86, and 5.81 g / L glucose remaining, respectively, were determined by FAME analysis as shown in Figure 48. 183-8 prototrophs reached 47 mg / g DPAn-3.

[0098] Strain 180-1 was biolistically transformed with pHR106 to knock out very long chain fatty acid elongase 2, designated VLCELO2. Hygromycin-resistant transformants were obtained and are referred to herein as lineage 185. Strain 185-6 was biolistically transformed with pHR95 to knock out subunit B of PUFA synthase. G418-resistant transformants were obtained and are referred to herein as lineage 190 transformants. The fatty acid profiles of the 190-(1-6) transformants grown in 10% N WDL + 0.6 mM DHA (except for 190-6, which was grown in 10% N WDL until 18.5, 28.6, 32.3, 29.0, 17.0, or 0 g / L glucose remained, respectively) were determined by FAME analysis, as shown in Figure 49. Strain 190-6, despite the appearance of a functional PUFA synthase, produced 49.56 mg / g EPA, more than double the rate in 180-1.

[0099] Sequence Listing D9 desaturase (ONC-T18) promoter (SEQ ID NO: 1) AGGATCAAAGTCATACTATGCGTACACGCCGCGTTCGGAAACCCTAGCTGGTTCAACCAGTTCCCTCTTCTGATTCCCTCGCTGGGTTCTGCGGGCCACGCTCAAGCCGTCCGGGACGTCATGGACGTCGCGCTGCCCTGCGTCGTTCTTCTACGCGTACGCACAAGAAGGCGTCACCGCCGCGCCCGCGCCGAAGACCTCCCTCCCGATCGAAGGTCCTGGTTCTCGGGAGGCGCTGTGCGTGGTATGTCGACGCGCTCGGCTCTGCGCTGGAGAGCGCAAGGCGGCTTTTTGACCAGGTTGCCTGCCTCCTACCACGTGCCCGTAGGGAGGGGGAATGTACCGCAGTGCGGTGGTCCGCCAAGCAAGAAACCCCGCAGAGAAGGCGTAAAGTGGAAGAAAAACAGCGTCGTATGCCGCCGTCGTCGCAGGTGCTCGTCGTCGCCTCGTCGATGGGACCCATCATGCGCTGAGAGTCTGCTGCAAAAGAGGTAGGGACTCGGGAAGGACCTGGTTCGCGCTGGCTGGGGAATCAGTAATCGCATTTCGGACATGGATGCGGAGACGCTCCCCGATGACGATGCTCCAGGAATCGCGCGGCACGTTTTACGGCGGCGAGAGAGAAAGTCTCAGCTTCTTTTCGAGGGTATACTCCGTGGCGGGTTATCATCATGTGAGAGATGTATCGACGCGATGGAGAAGCATCGGGTCTTCGTCGAACATCCGGGGTCGCCGGTTCGTCACGAAGCCAGCTCATGCCTCCACATGTCTCACAAGACCACCGAAAAACTGTCGAACTTGATTCTTTAGGTCTCTCGGACGCAAATAAAAAGCATCGGCGCGCTCGCGTTCACCAGCAAGCAGACAAAACCAATATCAGCCTATTGGCCGACCAAAACCAAGCAGCAGTTCCTCAACTCGGCTCTGCTCAACTCAGCAAACTGCCAACGCGTACTAGCAGACAAGGATTCACCCCAGCTTCGGTTGAAACTACAAGATC。

[0100] C16 elongase Oblongichytrium sp. (SEQ ID NO: 2)

[0101] D9 desaturase Ulkenia sp. (SEQ ID NO: 3)

[0102] D9 desaturase Thraustochytrid ONC-T18 (SEQ ID NO: 4)

[0103] D12 desaturase Thraustochytrium sp. (SEQ ID NO: 5)

[0104] Shewanella PfaC (PUFA synthase subunit) (SEQ ID NO: 6)

[0105] Omega-3 desaturase Oblongichytrium sp. (SEQ ID NO: 7)

[0106] D6 desaturase Botryochytrium sp. (SEQ ID NO: 8)

[0107] Omega-3 desaturase from Pavlova pinguis (Pav) (SEQ ID NO: 9)

[0108] Δ5 desaturase Thraustochytrium sp. (SEQ ID NO: 10)

[0109] Δ9 promoter with C16 elongase (Obl) ORF (SEQ ID NO: 11) Lower case letters indicate the ends of the promoter sequence and the junction between the promoter and the C16 elongase.

[0110] Junction between the Δ9 promoter and the C16 elongase (Obl) ORF (SEQ ID NO: 12) ggtacctcgcgaatgcatcttaga

[0111] Δ9 promoter with Δ6 desaturase (Bty) ORF (SEQ ID NO: 13) Lowercase letters indicate the ends of the promoter sequence and the junction between the promoter and the Δ6 desaturase (Bty) ORF.

[0112] Junction between the Δ9 promoter and the Δ6 desaturase (Bty) ORF (SEQ ID NO: 14) ggtacctcgcgaatgcatcttaga

[0113] Δ9 promoter with Ω3 desaturase (Obl) ORF (SEQ ID NO: 15) Lowercase letters indicate the ends of the promoter sequence and the junction between the promoter and the Ω3 desaturase (Obl) ORF.

[0114] Junction between the Δ9 promoter and the Ω3 desaturase (Obl) ORF (SEQ ID NO: 16) ggtacctcgcgaatgcatcttaga

[0115] Delta 5 elongase from Thraustochytrium sp. (SEQ ID NO: 17) ATGGAGGTCGCCGGGCAGCAATGGCGCCGGTTCGTGGACGCCGTAGACAACCGGATCGTGGAATTCATGGAGCACGAAAAGCCCAACAAGCTGAACGAGGGCAAGCTCTTTATCTCGACCGAGGAGATGATGGCGCTCATCGTCGGCTACCTGGCGTTCGTGGTTCTCGGGTCTGCCTTCATGACGGCCTTTGTGAGTAAGCCTTTCGAGCTCAAGTTCCTGAAGCTCGTGCACAACATCTTTCTCACCGGTCTGTCCCTGTACATGGCTAGCGAGTGCGCGCGCCAGGCCTACCTCGGCGGCTACAAGCTCTTTGGCAACCCGATGGAGAAGGGTGCCGAGTCTCACGCCCTGGGCATGGCTAGCATTATCTACGTTTTTTACGTGAGCAAGTTCCTCGAGTTTCTTGACACGGTCTTCATGATCCTCGGCAAGAAGTGGAAGCAGCTCAGCTTTCTTCACGTCTACCACCACGCGAGCATCAGCTTCATCTGGGGCATTATCGCCCGTTTTGCGCCCGGTGGCGACGCGTACTTTTCCACCATCCTCAACAGCAGCGTGCATGTCGTGCTCTACGGCTACTACGCCTCGACCACGCTCGGCTACACCTTCATGCGCCCGCTGCGCCCGTACATTACTACCATCCAGCTCACGCAGTTCATGGCCATGGTCGTCCAGTCCGTCTATGACTACTACAACCCTTGCGACTACCCGCAGCCCCTCGTCAAGCTACTCTTCTGGTACATGCTCACCATGCTCGGCCTTTTCGGCAACTTCTTCGTGCAGCAGTACCTCAAGCCCAAGGCGCCTAAGAAGCAAAAGACCATC

Claims

1. A microbial oil comprising fatty acids, the fatty acids comprising C20:3(n-6) (di-homo-γ-linoleic acid) and C20:5(n-3) eicosapentaenoic acid (EPA).

2. 2. The microbial oil of claim 1, wherein the fatty acids comprise 0.01% to 16% C20:3(n-6) (di-homo-gamma-linoleic acid).

3. The microbial oil of claim 1 or 2, wherein the fatty acids comprise 1 to 17% EPA.

4. 4. The microbial oil of claim 3, wherein the fatty acids comprise 5-17% EPA.

5. The microbial oil of any one of claims 1 to 4, wherein the fatty acids comprise 5-10% C14:0 (myristic acid).

6. The microbial oil of any one of claims 1 to 5, wherein the fatty acids comprise 13 to 22% C16:0 (hexadecanoic acid).

7. The microbial oil of any one of claims 1 to 6, wherein the fatty acids comprise C18 unsaturated fatty acids.

8. 8. The microbial oil of claim 7, wherein the fatty acids comprise 10-60% C18 unsaturated fatty acids.

9. The microbial oil of claim 7 or 8, wherein the fatty acids comprise 10-45% C18:1 oleic acid.

10. The microbial oil of any one of claims 7 to 9, wherein the fatty acids comprise C18:2 (n-6) linoleic acid.

11. 11. The microbial oil of claim 10, wherein the fatty acids comprise 0.01% to 40% linoleic acid.

12. 12. The microbial oil of any one of claims 1-11, wherein the oil further comprises C18:3(n-3) (alpha-linoleic acid), C18:3(n-6) (gamma-linoleic acid), C20:4(n-3) (eicosatetraenoic acid), C20:5(n-3) (EPA), and C22:5(n-3) (docosapentaenoic acid(n-3) (DPA-3).

13. The microbial oil of any one of claims 1 to 12, wherein the microbial oil comprises 85% to 95% by weight of total fatty acids.

14. 14. The microbial oil of claim 13, wherein the microbial oil comprises at least 90% by weight of total fatty acids.

15. The microbial oil of any one of claims 1 to 14, wherein the microbial oil contains less than 35% saturated fatty acids.

16. The microbial oil of any one of claims 1 to 14, wherein the microbial oil contains less than 30% saturated fatty acids.

17. The microbial oil of any one of claims 1 to 14, wherein the microbial oil comprises 0.001% to 35% saturated fatty acids.

18. The microbial oil according to any one of claims 1 to 17, wherein the microbial oil is produced by a microorganism selected from the group consisting of the genera Schizochytrium, Oblongichytrium, Aurantiochytrium, and Thraustochytrium.

19. The microbial oil of any one of claims 1 to 18, produced by an engineered microorganism.

20. 1. An engineered microorganism comprising a first nucleic acid sequence encoding an elongase and a second nucleic acid sequence encoding a desaturase, wherein said first and second nucleic acid sequences are operably linked to a delta9 desaturase promoter.

21. 21. The engineered microorganism of claim 20, wherein the desaturase is a delta 9 desaturase.

22. 22. The engineered microorganism of claim 21 , wherein the delta 9 desaturase is a Thraustochytrium sp. or Ulkenia sp. delta 9 desaturase.

23. 23. The engineered microorganism of any one of claims 20-22, wherein the elongase is a C16:0 elongase or a Delta5 elongase.

24. 24. The engineered microorganism of claim 23, wherein the C16:0 elongase is an Oblongichytrium sp. elongase.

25. 25. The engineered microorganism of any one of claims 20 to 24, further comprising a third nucleic acid encoding a delta-12 desaturase.

26. 26. The engineered microorganism of claim 25, wherein the delta-12 desaturase is a Thraustochytrium sp. desaturase.

27. 27. The engineered microorganism of any one of claims 20 to 26, further comprising a fourth nucleic acid encoding a delta-6 desaturase.

28. 28. The engineered microorganism of claim 27, wherein the delta-6 desaturase is a Botryochytrium sp. delta-6 desaturase.

29. 29. The engineered microorganism of any one of claims 20 to 28, further comprising a fifth nucleic acid encoding an omega-3 desaturase.

30. 30. The engineered microorganism of claim 29, wherein the omega-3 desaturase is an Oblongichytrium sp. omega-3 desaturase.

31. 31. The engineered microorganism of any one of claims 20 to 30, further comprising a sixth nucleic acid encoding a delta 5 desaturase.

32. 32. The engineered microorganism of claim 31 , wherein the delta 5 desaturase is a Thraustochytrium sp. delta 5 desaturase.

33. 33. The engineered microorganism of any one of claims 20-32, wherein the delta9 desaturase promoter is located in its native location within the genome of the microorganism.

34. 33. The engineered microorganism of any one of claims 20-32, wherein the delta9 desaturase promoter and the first and second nucleic acids are located on a heterologous construct.

35. 35. The engineered microorganism of any one of claims 20-34, wherein the first and second nucleic acids disrupt an endogenous delta 9 desaturase sequence of the microorganism.

36. 36. The engineered microorganism of any one of claims 20 to 35, further comprising a zeocin resistance gene.

37. 37. The engineered microorganism of any one of claims 20 to 36, further comprising one or more 2A sequences.

38. 38. The engineered microorganism of any one of claims 20 to 37, further comprising a reporter gene.

39. 39. The engineered microorganism of claim 38, wherein the reporter gene is luciferase.

40. 40. The engineered microorganism of any one of claims 20 to 39, further comprising one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators.

41. 40. The engineered microorganism of any one of claims 20-39, wherein the nucleic acid comprises one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators.

42. 42. A microbial oil produced by the engineered microorganism of any one of claims 20 to 41.

43. 1. A method for producing polyunsaturated fatty acids, comprising: (a) providing an engineered microorganism according to any one of claims 20 to 41; (b) culturing the engineered microorganism under conditions sufficient to produce the polyunsaturated fatty acid.

44. 1. A method for promoting the conversion of saturated fatty acids to unsaturated fatty acids, comprising: (a) transforming an oil-producing microorganism with a construct comprising a first nucleic acid encoding an elongase and a second nucleic acid encoding a desaturase, wherein the construct is inserted into the genome of the oil-producing microorganism at a position where expression of the encoded elongase and desaturase is controlled by a promoter native to the oil-producing microorganism; (iii) culturing the transformed microorganism under conditions to produce fatty acids, wherein the transformed microorganism converts saturated fatty acids to more unsaturated fatty acids than a control non-transformed microorganism.

45. 45. The method of claim 44, wherein the native promoter is a delta9 desaturase promoter.

46. 46. ​​The method of claim 44 or 45, wherein the desaturase is a delta9 desaturase.

47. 47. The method of claim 46, wherein the delta9 desaturase is a Thraustochytrium sp. or Ulkenia sp. delta9 desaturase.

48. 48. The method of any one of claims 44 to 47, wherein the elongase is a C16:0 elongase or a Delta5 elongase.

49. 49. The method of claim 48, wherein the C16:0 elongase is a C16:0 elongase from Oblongichytrium sp.

50. 50. The method of any one of claims 44 to 49, wherein the construct further comprises a third nucleic acid encoding a delta-12 desaturase.

51. 51. The method of claim 50, wherein the delta-12 desaturase is a delta-12 desaturase from a Thraustochytrium species.

52. 52. The method of any one of claims 44 to 51, wherein the construct further comprises a fourth nucleic acid encoding a delta-6 desaturase.

53. 53. The method of claim 52, wherein the delta-6 desaturase is a Botryochytrium sp. delta-6 desaturase.

54. 54. The method of any one of claims 44 to 53, wherein the construct further comprises a fifth nucleic acid encoding an omega-3 desaturase.

55. 55. The method of claim 54, wherein the omega-3 desaturase is an Oblongichytrium sp. omega-3 desaturase.

56. 56. The method of any one of claims 44 to 55, wherein the construct further comprises a sixth nucleic acid encoding a delta 5 desaturase.

57. 57. The method of claim 56, wherein the delta 5 desaturase is a delta 5 desaturase from a Thraustochytrium species.

58. 58. The method of any one of claims 44 to 57, wherein the first and second nucleic acids replace an endogenous delta-9 desaturase coding sequence of the microorganism.

59. 59. The method of any one of claims 44 to 58, wherein the construct further comprises a zeocin resistance gene.

60. 50. The method of any one of claims 44 to 49, wherein the construct further comprises one or more 2A sequences.

61. 61. The method of any one of claims 44 to 60, wherein the construct further comprises a reporter gene.

62. 62. The method of claim 61, wherein the reporter is luciferase.

63. 63. The method of any one of claims 44 to 62, wherein the construct further comprises one or more tubulin promoters, one or more tubulin terminators, or both one or more tubulin promoters and one or more tubulin terminators.

64. 63. The method of any one of claims 44 to 62, wherein the construct comprises one or more PUFA synthase subunit B promoters, one or more PUFA synthase subunit B terminators, or both one or more PUFA synthase subunit B promoters and one or more PUFA synthase subunit B terminators.

65. 65. The method of any one of claims 44 to 64, wherein the saturated fatty acids converted to unsaturated fatty acids are C16:0 and C18:

0.

66. 66. The method of any one of claims 44 to 65, wherein the unsaturated fatty acid is selected from the group consisting of C18:1 (oleic acid), C18:2(n-6) (linoleic acid), C18:3(n-3) (alpha-linoleic acid), and C18:3(n-6) (gamma-linoleic acid).

67. 67. The method of any one of claims 44 to 66, wherein the transformed microorganism produces increased amounts of C20:3(n-6) (di-homo-γ-linoleic acid), C20:4(n-3) (eicosatetraenoic acid), C20:5(n-3) (EPA), and C22:5(n-3) (DPA-3) compared to the control non-transformed microorganism.

Images