Systems and methods for genome editing

Abstract

Methods and compositions for genetically modifying cells are provided.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 477,093, filed December 23, 2022, which is incorporated herein by reference in its entirety.

[0002] Electronic Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in .XML format, which is hereby incorporated by reference in its entirety. The .XML copy, created on December 2, 2023, is named "01155-0056-00PCT.xml" and is 1,643,869 bytes in size. The Sequence Listing contained in this .XML file is a part of the specification and is incorporated by reference in its entirety. Summary of the Invention

[0003] The present disclosure relates to methods, compositions, and systems for genome editing.

[0004] The ability to precisely and reproducibly introduce deletions into a cell's genome is of interest for gene editing and clinical therapeutic applications. For example, adoptive cell therapy approaches using genetically modified immune cells have become attractive treatments for reconstituting cell lineages and immune system defenses to treat various conditions and diseases, including cancer. However, clinical application of cell product therapies has been challenging, in part due to the complex genetic engineering requirements. The ability to precisely excise genetic elements such as start codons, splice sites, and transcription factor binding sites while minimizing the risk of off-target cleavage and locus inversions is of great interest in the field of genetic engineering.

[0005] Although CRISPR / Cas9 genome editing has proven highly efficient, generating precise deletions has been challenging. Double-strand breaks (DSBs) are repaired by the error-prone non-homologous end joining (NHEJ) pathway, which generates small insertions or deletions around the break site. This process can therefore generate deletions around the location of the DSB, but the size of these deletions can vary significantly from cell to cell and even from allele to allele. Therefore, a more efficient approach to generating precise and reproducible deletions within a cell's genome is needed.

[0006] The methods provided herein involve the use of an orthogonal Cas9-Cas9 fusion system for precise genome editing applications, offering significant advantages over conventional methods.

[0007] Accordingly, the present invention provides a method for providing a modification to the genome of a target cell, the method comprising: (a) contacting the cell with a fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase, wherein the first cleavase is a Streptococcus pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises an R1333K mutation within its protospacer-adjacent motif recognition domain, and the second cleavase is a Neisseria meningitidis (Nme) Cas9 cleavase, a Campylobacter jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavage vector; (b) contacting the cell with a first guide RNA that directs the first cleavage vector to a first genomic locus; and (c) contacting the cell with a second guide RNA that directs a second cleavage vector to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0008] In some embodiments, a method for generating a cell or cell population comprising a modification of the genome of a target cell(s) is provided. In some embodiments, the method includes: (a) contacting the cell with a fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase, the first cleavase being a SpyCas9 cleavase, the SpyCas9 cleavase comprising an R1333K mutation in its protospacer adjacent motif recognition domain, and the second cleavase being an NmeCas9 cleavase, a CjeCas9 cleavase, or an SmuCas9 cleavase; (b) contacting the cell with a first guide RNA that directs the first cleavase to a first genomic locus; and (c) contacting the cell with a second guide RNA that directs the second cleavase to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0009] In some embodiments, a polynucleotide is provided that includes an open reading frame (ORF) encoding a fusion protein, the fusion protein including a first cleavase and a second cleavase, wherein the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase including an R1333K mutation within its protospacer adjacent motif recognition domain, and the second cleavase is a NmeCas9 cleavase, a Cje Cas9 cleavase, or a Smu Cas9 cleavase.

[0010] In some embodiments, a composition is provided.

[0011] In some embodiments, the composition comprises: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase, wherein the first cleavase is an S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase comprising an R1333K mutation in its protospacer adjacent motif recognition domain, and the second cleavase is an NmeCas9 cleavase, a Cje Cas9 cleavase, or an Smu Cas9 cleavase; (b) a first guide RNA that directs the first cleavase to a first genomic locus; and (c) a second guide RNA that directs the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus.

[0012] The following is a non-exhaustive list of embodiments provided herein.

[0013] Embodiment 1. A method for providing a modification to the genome of a target cell, said method comprising: (a) contacting the cell with a fusion protein or a nucleic acid encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a Streptococcus pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises an R1333K mutation within its protospacer adjacent motif recognition domain; b. the second cribrase is a Neisseria meningitidis (Nme) Cas9 cribrase, a Campylobacter jejuni (Cje) Cas9 cribrase, or a Simonsiella muelleri (Smu) Cas9 cribrase; (b) contacting the cell with a first guide RNA that directs the first cleavage to a first genomic locus; (c) contacting the cell with a second guide RNA that guides the second cleavage vector to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0014] Embodiment 2. A method of generating a cell or cell population comprising a modification of the genome of a target cell(s), said method comprising: (a) contacting the cell(s) with a fusion protein or a nucleic acid encoding a fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. the second cribridase is a N. meningitidis (Nme) Cas9 cribridase, a C. jejuni (Cje) Cas9 cribridase, or a S. muelleri (Smu) Cas9 cribridase; (b) contacting the cell(s) with a first guide RNA that directs the first cleavage to a first genomic locus; (c) contacting the cell(s) with a second guide RNA that guides the second cleavage vector to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0015] Embodiment 3. The method of any one of embodiments 1 or 2, wherein the first cleavase is located N-terminal to the second cleavase.

[0016] Embodiment 4. The method of any one of embodiments 1 or 2, wherein the first cleavase is located C-terminal to the second cleavase.

[0017] Embodiment 5. The method of any one of the preceding embodiments, wherein (i) the SpyCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 105, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 105, or (ii) the nucleotides encoding the SpyCas9 cleavase comprise an open reading frame (ORF) comprising the sequence of SEQ ID NO: 104, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 104.

[0018] Embodiment 6 The method of any one of the preceding embodiments, wherein the second cleavage agent is NmeCas9.

[0019] Embodiment 7. The method of any one of the preceding embodiments, wherein the NmeCas9 cleavage base is Nme1Cas9, Nme2Cas9, or Nme3Cas9.

[0020] Embodiment 8. (i) the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137; or (ii) the nucleotides encoding the NmeCas9 cleavase are 138, or 139, or a nucleotide sequence which is at least 85%, at least 90%, or at least 95% identical to the nucleotide sequence of any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138, or 139.

[0021] Embodiment 9. The method of any one of the preceding embodiments, wherein (a) the NmeCas9 cleavase is an Nme2Cas9 comprising the amino acid sequence of any one of SEQ ID NOs: 22, 109, or 136, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 109, or 136, or (b) the nucleotide encoding the NmeCas9 cleavase comprises the nucleotide sequence of any one of SEQ ID NOs: 21, 108, or 138, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 21, 108, or 138.

[0022] Embodiment 10. The method of any one of the preceding embodiments, wherein (a) the CjeCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 144, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 144, or (b) the nucleotides encoding the CjeCas9 cleavase comprise the sequence of SEQ ID NO: 143, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 143.

[0023] Embodiment 11. The method of any one of the preceding embodiments, wherein (a) the SmuCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 142, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 142, or (b) the nucleotides encoding the SmuCas9 cleavase comprise an open reading frame (ORF) comprising the sequence of SEQ ID NO: 140 or 141, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 140 or 141.

[0024] Embodiment 12 The method of any one of the preceding embodiments, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase.

[0025] Embodiment 13. The method of any one of the preceding embodiments, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, or at least 80 amino acids.

[0026] Embodiment 14. The method of any one of the preceding embodiments, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises 11, 21, 31, 41, 51, 61, 71, or 81 amino acid residues.

[0027] Embodiment 15. The method of any one of the preceding embodiments, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 150-158, or the amino acid sequence is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 150-158.

[0028] Embodiment 16 The method of any one of the preceding embodiments, wherein the fusion protein comprises a nuclear localization signal (NLS).

[0029] Embodiment 17. The method of any one of the preceding embodiments, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is present at the C-terminus of the fusion protein.

[0030] Embodiment 18. The method of any one of the preceding embodiments, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is present at the N-terminus of the fusion protein.

[0031] Embodiment 19. The method of any one of the preceding embodiments, wherein the fusion protein comprises a nuclear localization signal (NLS), the NLS being present at both the N-terminus and the C-terminus of the fusion protein.

[0032] Embodiment 20. The method of any one of the preceding embodiments, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 366-369 and 371-384.

[0033] Embodiment 21. The method of any one of the preceding embodiments, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is encoded by a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% identity to any one of SEQ ID NOs: 370 and 385-397.

[0034] Embodiment 22. The method of any one of the preceding embodiments, wherein the fusion protein comprises one, two, or three nuclear localization signals (NLSs) independently selected from SEQ ID NOs: 366-369 and 371-384.

[0035] Embodiment 23. The fusion protein comprises, from N-terminus to C-terminus: a. the first cribasis; b. a peptide linker, optionally comprising 81 amino acid residues; c. the second chrysanthemum; d. An NLS comprising an SV40 NLS.

[0036] Embodiment 24. The fusion protein comprises, from N-terminus to C-terminus: a. a first NLS, wherein the first NLS comprises an SV40 NLS; b. the second crispy base; c. a peptide linker, optionally comprising 41 amino acid residues; d. the first chrysanthemum vase; e. A method according to any one of embodiments 1 to 22, comprising a second NLS, wherein the second NLS comprises an SV40 NLS.

[0037] Embodiment 25. The fusion protein comprises, from N-terminus to C-terminus: a. the second crispy base; b. a peptide linker, optionally comprising 41 amino acid residues; c. the first crispy base; d. A method according to any one of embodiments 1 to 22, comprising an NLS, optionally comprising an SV40 NLS.

[0038] Embodiment 26. (a) The fusion protein comprises the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105; or (b) the nucleic acid encoding the fusion protein is at least 90%, or at least 95%, identical to the nucleotide sequence of SEQ ID NO: 1-2, 4, 6, 8, 9, 11, 12, 14-15, 38-39, 41-42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104, or to SEQ ID NO: 1 or 2. 100, or 104. The method of any one of the preceding embodiments, comprising a nucleotide sequence or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:4, 6, 8, 9, 11, 12, 14-15, 38-39, 41-42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104.

[0039] Embodiment 27. (a) The fusion protein comprises the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, or 13, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13; or (b) the method of any one of the preceding embodiments, wherein the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 1, 2, 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 1 or 2, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

[0040] Embodiment 28. (a) The fusion protein comprises an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5 or 99, or to the amino acid sequence of SEQ ID NO: 5 or 99; or (b) the method of any one of the preceding embodiments, wherein the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 4, 6, 7, or 8, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 7, or 8.

[0041] Embodiment 29. A method for providing a modification to the genome of a target cell, said method comprising: (a) contacting the cell with a first polypeptide or a nucleic acid encoding the first polypeptide, wherein the first polypeptide comprises a first cleavase and a first intein, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, and the SpyCas9 cleavase comprising a R1333K mutation within a protospacer-adjacent motif recognition domain; (b) contacting the cell with a second polypeptide or a nucleic acid encoding the first polypeptide, wherein the second polypeptide comprises a second cleavase and a second intein capable of binding to the first intein, and the second cleavase is a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a S. muelleri (Smu) Cas9 cleavase; the contacting, wherein the first polypeptide is conjugated to the second polypeptide via an intein catalyst; (c) contacting the cell with a first guide RNA that directs the first cleavage to a first genomic locus; (d) contacting the cell with a second guide RNA that guides the second cleavage vector to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0042] Embodiment 30. The first polypeptide comprises, from N-terminus to C-terminus: a. the first intein; b. the first cleavase, wherein the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, and the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; c. a first NLS comprising an SV40 NLS.

[0043] Embodiment 31. The second polypeptide comprises, from N-terminus to C-terminus: a. a second NLS comprising the SV40 NLS; b. a third NLS, including a nucleoplasmic NLS; c. the second chrysanthemum; d. a peptide linker, optionally comprising 41 or 81 amino acid residues; e. said second intein capable of binding to said first intein.

[0044] Embodiment 32. The method of any one of embodiments 29 to 31, wherein (i) the first polypeptide comprises the amino acid sequence of SEQ ID NO: 28 or 31, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 28 or 31, or the nucleic acid(s) encoding the polypeptide(s) comprise the sequence of SEQ ID NO: 27 or 30, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 27 or 30.

[0045] Embodiment 33. The method of any one of embodiments 29 to 33, wherein the second polypeptide comprises the amino acid sequence of SEQ ID NO: 25 or 34, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 25 or 34, or the nucleic acid encoding the polypeptide(s) comprises the sequence of SEQ ID NO: 24 or 33, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 24 or 33.

[0046] Embodiment 34 The method of any one of the preceding embodiments, wherein the first guide RNA and the second guide RNA target two non-overlapping genomic loci.

[0047] Embodiment 35. The method of the immediately preceding embodiment, wherein the two non-overlapping genomic loci are separated by no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides.

[0048] Embodiment 36 The method of the immediately preceding embodiment, wherein the two non-overlapping genomic loci are separated by no more than 110 nucleotides.

[0049] Embodiment 37. The method of any one of the preceding embodiments, wherein the first guide RNA is a single guide RNA (sgRNA).

[0050] Embodiment 38 The method of any one of the preceding embodiments, wherein the first guide RNA is a SpyCas9 guide RNA.

[0051] Embodiment 39. The SpyCas9 guide RNA is a single guide RNA, which: a conserved portion of an sgRNA comprising an upper stem region and a hairpin region, wherein each nucleotide of the upper stem region is modified with 2'-O-Me and each nucleotide of the hairpin region is modified with 2'-O-Me; a 3'-end modification comprising 2'-O-Me modified nucleotides in the last three nucleotides of the 3'-end and phosphorothioate (PS) linkages between the last four nucleotides of the 3'-end; The method of the immediately preceding embodiment, comprising a 5' end modification comprising 2'-O-Me modified nucleotides in the first three nucleotides of the 5' end, and a phosphorothioate (PS) linkage between the first four nucleotides of the 5' end.

[0052]

[0040] Embodiment 40. The method of embodiment 38 or 39, wherein the SpyCas9 guide RNA is a short single guide RNA (short sgRNA) that comprises a conserved portion of the sgRNA, including a hairpin region, wherein the hairpin region lacks at least 5-10 nucleotides, and the short sgRNA comprises (i) a 5' end modification or (ii) a 3' end modification.

[0053] Embodiment 41. The method of any one of the preceding embodiments, wherein the first guide RNA is a SpyCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 159-167, 170-177, and 180-194, or a nucleotide sequence that is at least 85%, 90%, or 95% identical to SEQ ID NOs: 159-167, 170-177, and 180-194.

[0054] Embodiment 42. The method of any one of the preceding embodiments, wherein the second guide RNA is a single guide RNA (sgRNA).

[0055] Embodiment 43. The method of the directly preceding embodiment, wherein the second guide RNA is a truncated or chemically modified single guide RNA (sgRNA).

[0056] Embodiment 44 The method of any one of the preceding embodiments, wherein the second guide RNA is an NmeCas9 guide RNA.

[0057] Embodiment 45. The method of any one of the preceding embodiments, wherein the second guide RNA is an NmeCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 280-297, or a nucleotide sequence that is at least 85%, 90%, or 95% identical to SEQ ID NOs: 280-297.

[0058] Embodiment 46. The method of the directly preceding embodiment, wherein the second guide RNA comprises one or more internal polyethylene glycol (PEG) linkers, and optionally, the second guide RNA is at least 85%, 90%, 95%, 99%, 100% identical to a sequence selected from SEQ ID NOs: 272-278.

[0059] Embodiment 47 The method of any one of the preceding embodiments, wherein one or both of the guide RNAs contain one or more mismatches to the target sequence.

[0060] Embodiment 48 The method of any one of the preceding embodiments, wherein the nucleic acid encoding the fusion protein is delivered to the cell by at least one vector.

[0061] Embodiment 49 The method of any one of the preceding embodiments, wherein the fusion protein or the nucleic acid encoding the fusion protein is delivered to the cell by electroporation.

[0062] Embodiment 50 The method of any one of the preceding embodiments, wherein the first guide RNA is delivered to the cell by electroporation.

[0063] Embodiment 51 The method of any one of the preceding embodiments, wherein the second guide RNA is delivered to the cell by electroporation.

[0064] Embodiment 52. The method of any one of embodiments 1 to 48, wherein one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with the one or more lipid nanoparticles (LNPs).

[0065] Embodiment 53. The method of any one of embodiments 1 to 48, or 52, wherein the nucleic acids encoding the fusion proteins are each associated with a separate lipid nanoparticle (LNP).

[0066] Embodiment 54. The method of any one of embodiments 1 to 48, or 52 to 53, wherein the first guide RNA and the second guide RNA are associated with the same lipid nanoparticle (LNP).

[0067] Embodiment 55. The method of any one of embodiments 1 to 48, or 52 to 54, wherein the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are all associated with the same lipid nanoparticle (LNP).

[0068] Embodiment 56. The method of any one of embodiments 1 to 48, or 52 to 55, wherein the LNP comprises (i) an ionizable lipid, (ii) a helper lipid, (iii) a stealth lipid, (iv) a neutral lipid, or a combination of one or more of (i) to (iv).

[0069] Embodiment 57. The method of the directly preceding embodiment, wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate.

[0070] Embodiment 58. The method of embodiment 56 or 57, wherein the helper lipid is cholesterol.

[0071] Embodiment 59. The method of any one of embodiments 56 to 58, wherein the stealth lipid is PEG-DMG.

[0072] Embodiment 60. The method of any one of embodiments 56 to 59, wherein the PEG-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).

[0073] Embodiment 61. The method of any one of embodiments 56 to 60, wherein the neutral lipid is DSPC.

[0074] Embodiment 62. The method of any one of embodiments 56-61, wherein the LNP composition comprises about 50 mol% ionizable lipids, about 9 mol% neutral lipids, about 3 mol% stealth lipids, and the remaining lipid components are helper lipids, such as cholesterol.

[0075] Embodiment 63. The method of any one of embodiments 56 to 62, wherein the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate DSPC, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate, cholesterol, and PEG2k-DMG.

[0076] Embodiment 64 The method of any one of the preceding embodiments, wherein the modification is performed in vivo.

[0077] Embodiment 65. The method of any one of embodiments 1 to 63, wherein the modification is carried out in vitro.

[0078] Embodiment 66. The method of any one of the preceding embodiments, wherein the modification comprises a deletion of no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30 nucleotides.

[0079] Embodiment 67. The method of the immediately preceding embodiment, wherein the modification comprises a deletion of no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 contiguous nucleotides.

[0080] Embodiment 68. The method of any one of the preceding embodiments, wherein the modification comprises a deletion of 25, 35, 45, 55, 65, 75, 85, 95, 100, 105 or more nucleotides.

[0081] Embodiment 69. The method of the immediately preceding embodiment, wherein the modification comprises a deletion of 25, 35, 45, 55, 65, 75, 85, 95, 100, 105 or more consecutive nucleotides.

[0082] Embodiment 70 The method of any one of the preceding embodiments, wherein the modification comprises a deletion of each of the nucleotides between the first and second cleavage sites.

[0083] Embodiment 71. The method of any one of embodiments 66 to 70, wherein the deletion comprises one or both of the protospacer adjacent motif (PAM) sites recognized by the first cleavage or the second cleavage.

[0084] Embodiment 72 The method of any one of the preceding embodiments, wherein said modification increases expression of said one or more RNAs or proteins.

[0085] Embodiment 73 The method of any one of the preceding embodiments, wherein said modification increases expression of said one or more mRNAs by at least two-fold.

[0086] Embodiment 74 The method of any one of the preceding embodiments, wherein said modification increases expression of said one or more proteins by at least two-fold.

[0087] Embodiment 75. The method of any one of the preceding embodiments, wherein the modification results in the deletion of a start codon.

[0088] Embodiment 76 The method of any one of the preceding embodiments, wherein said modification reduces or eliminates expression of said one or more mRNAs or proteins.

[0089] Embodiment 77. The method of any one of the preceding embodiments, wherein said modification reduces or eliminates expression of said one or more mRNAs by at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0090] Embodiment 78. The method of any one of the preceding embodiments, wherein said modification reduces or eliminates expression of said one or more proteins by at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0091] Embodiment 79. The method of any one of the preceding embodiments, wherein the cell is in a subject.

[0092] Embodiment 80 The method of any one of the preceding embodiments, wherein the cells are kidney cells.

[0093] Embodiment 81 The method of any one of the preceding embodiments, wherein the cells are hepatocytes.

[0094] Embodiment 82. The method of any one of the preceding embodiments, wherein the cells are selected from mesenchymal stem cells, hematopoietic stem cells (HSCs), mononuclear cells, endothelial progenitor cells (EPCs), neural stem cells (NSCs), limbal stem cells (LSCs), tissue-specific primary cells or cells derived therefrom (TSCs), induced pluripotent stem cells (iPSCs), ocular stem cells, pluripotent stem cells (PSCs), embryonic stem cells (ESCs), and cells for organ or tissue transplantation.

[0095] Embodiment 83 The method of any one of the preceding embodiments, wherein the cell is an immune cell.

[0096] Embodiment 84 The method of any one of the preceding embodiments, wherein the cells are lymphocytes.

[0097] Embodiment 85 The method of any one of the preceding embodiments, wherein the cell is a T cell.

[0098] Embodiment 86 A genetically engineered cell or population of genetically engineered cells modified by the method of any one of the preceding embodiments.

[0099] Embodiment 87. The genetically engineered cell or genetically engineered cell population of the directly preceding embodiment, wherein the genetic modification comprises a deletion of no more than 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides.

[0100] Embodiment 88. The genetically engineered cell or genetically engineered cell population of any one of embodiments 86 or 87, wherein the deletion comprises one or both of the protospacer adjacent motif (PAM) sites.

[0101] Embodiment 89. A polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. The polynucleotide, wherein the second cleavage vector is a N. meningitidis (Nme) Cas9 cleavage vector, a C. jejuni (Cje) Cas9 cleavage vector, or a S. muelleri (Smu) Cas9 cleavage vector.

[0102] Embodiment 90. A composition comprising: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. the polynucleotide, wherein the second cribrase is a N. meningitidis (Nme) Cas9 cribrase, a C. jejuni (Cje) Cas9 cribrase, or a Simonsiella muelleri (Smu) Cas9 cribrase; (b) a first guide RNA that guides the first cleavage vector to a first genomic locus; (c) a second guide RNA that guides the second cleavage vector to a second genomic locus, the second genomic locus being different from the first genomic locus.

[0103] Embodiment 91. A composition comprising: (a) a first polynucleotide comprising an ORF encoding the first polypeptide, wherein the first polypeptide comprises a first cleavase and a first intein, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, and the SpyCas9 cleavase comprising a R1333K mutation within a protospacer adjacent motif recognition domain; (b) a second polynucleotide comprising an ORF encoding the second polypeptide, wherein the second polypeptide comprises a second cleavase and a second intein capable of binding to the first intein, wherein the second cleavase is a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase; The composition, wherein the first polypeptide is conjugated to the second polypeptide via an intein catalyst.

[0104] Embodiment 92. One or more lipid nanoparticles, (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. the polynucleotide, wherein the second cribrase is a N. meningitidis (Nme) Cas9 cribrase, a C. jejuni (Cje) Cas9 cribrase, or a Simonsiella muelleri (Smu) Cas9 cribrase; (b) a first guide RNA that guides the first cleavage vector to a first genomic locus; (c) a second guide RNA that guides the second cleavage vector to a second genomic locus, the second genomic locus being different from the first genomic locus.

[0105] Embodiment 93. The polynucleotide, composition, or lipid nanoparticle described in any one of embodiments 89 to 92, wherein (i) the SpyCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 105, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 105, or (ii) the nucleotide encoding the SpyCas9 cleavase comprises an open reading frame (ORF) comprising the sequence of SEQ ID NO: 104, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 104.

[0106] Embodiment 94. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89 to 93, wherein the second cleavage agent is an NmeCas9 cleavage agent.

[0107] Embodiment 95. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 94, wherein the NmeCas9 cleavage base is Nme1Cas9, Nme2Cas9, or Nme3Cas9.

[0108] Embodiment 96. (i) the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137; or (ii) the nucleotide sequence encoding the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 21, 22, 107, 109, 120, 127, 136, or 137. 96. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89-95, comprising the nucleotide sequence of any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138 or 139, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138 or 139.

[0109] Embodiment 97. A polynucleotide, composition, or lipid nanoparticle described in any one of embodiments 89 to 96, wherein (a) the NmeCas9 cleavase is an Nme2Cas9 having the amino acid sequence of any one of SEQ ID NOs: 22, 109, or 136, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 109, or 136, or (b) the nucleotide encoding the NmeCas9 cleavase has the nucleotide sequence of any one of SEQ ID NOs: 21, 108, or 138, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 21, 108, or 138.

[0110] Embodiment 98. A polynucleotide, composition, or lipid nanoparticle described in any one of embodiments 89 to 97, wherein (a) the CjeCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 144 or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 144, or (b) the nucleotide encoding the CjeCas9 cleavase comprises the sequence of SEQ ID NO: 143 or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 143.

[0111] Embodiment 99. A polynucleotide, composition, or lipid nanoparticle described in any one of embodiments 89 to 98, wherein (a) the SmuCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 142, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 142, and (b) the nucleotide encoding the SmuCas9 cleavase comprises an open reading frame (ORF) comprising the sequence of SEQ ID NO: 140 or 141, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 140 or 141.

[0112] Embodiment 100. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 99, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase.

[0113] Embodiment 101. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 100, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, or at least 80 amino acids.

[0114] Embodiment 102. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 101, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises 11, 21, 31, 41, 51, 61, 71, or 81 amino acid residues.

[0115] Embodiment 103. The polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 101, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 150 to 158, or the amino acid sequence is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 150 to 158.

[0116] Embodiment 104. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89 to 103, wherein the fusion protein comprises a nuclear localization signal (NLS).

[0117] Embodiment 105. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89 to 104, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is present at the C-terminus of the fusion protein.

[0118] Embodiment 106. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89 to 105, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is present at the N-terminus of the fusion protein.

[0119] Embodiment 107. The polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 106, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is present at both the N-terminus and the C-terminus of the fusion protein.

[0120] Embodiment 108. The polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 107, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 366 to 369 and 371 to 384.

[0121] Embodiment 109. The polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 108, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS is encoded by a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or 100% identity to any one of SEQ ID NOs: 370 and 385 to 397.

[0122] Embodiment 110. The polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 109, wherein the fusion protein comprises one, two, or three nuclear localization signals (NLS) independently selected from SEQ ID NOs: 366 to 369 and 371 to 384.

[0123] Embodiment 111. The fusion protein comprises, from N-terminus to C-terminus: a. the first cribasis; b. a peptide linker, optionally comprising 81 amino acid residues; c. the second chrysanthemum; d. An NLS comprising an SV40 NLS.

[0124] Embodiment 112. The fusion protein comprises, from N-terminus to C-terminus: a. a first NLS, wherein the first NLS comprises an SV40 NLS; b. the second crispy base; c. a peptide linker, optionally comprising 41 amino acid residues; d. the first chrysanthemum vase; e. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 111, comprising a second NLS, wherein the second NLS comprises an SV40 NLS.

[0125] Embodiment 113. The fusion protein comprises, from N-terminus to C-terminus: a. the second crispy base; b. a peptide linker, optionally comprising 41 amino acid residues; c. the first crispy base; d. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 89 to 112, comprising an NLS, optionally comprising an SV40 NLS.

[0126] Embodiment 114. (a) The fusion protein comprises the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105; or (b) the nucleic acid encoding the fusion protein is a nucleotide sequence of SEQ ID NO: 1-2, 4, 6-8, 9, 11, 12, 14-15, 38-39, 41-42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104, or a nucleotide sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 1 or 2; or 114. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89-113, comprising a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, 12, 14-15, 38-39, 41-42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104.

[0127] Embodiment 115. (a) the fusion protein comprises the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, or 13, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13; or (b) The polynucleotide, composition, or lipid nanoparticle of any one of embodiments 89 to 114, wherein the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 1, 2, 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 1 or 2, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

[0128] Embodiment 116. (a) the fusion protein comprises the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13; or (b) The polynucleotide, composition, or lipid nanoparticle described in any one of embodiments 89 to 115, wherein the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

[0129] Embodiment 117. The first polypeptide comprises, from N-terminus to C-terminus: a. the first intein; b. the first cleavase, wherein the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, and the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; c. A first NLS comprising an SV40 NLS.

[0130] Embodiment 118. The second polypeptide comprises, from N-terminus to C-terminus: a. a second NLS comprising the SV40 NLS; b. a third NLS, including a nucleoplasmic NLS; c. the second chrysanthemum; d. a peptide linker, optionally comprising 41 or 81 amino acid residues; e. The polynucleotide, composition, or lipid nanoparticle of embodiment 116 or 117, comprising: a second intein capable of binding to the first intein.

[0131] Embodiment 119. A polynucleotide, composition or lipid nanoparticle described in any one of embodiments 116 to 118, wherein (a) the first polypeptide comprises the amino acid sequence of SEQ ID NO: 28 or 31, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 28 or 31, or the nucleic acid encoding the polypeptide(s) comprises the sequence of SEQ ID NO: 27 or 30, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 27 or 30.

[0132] Embodiment 120. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 116 to 119, wherein (a) the second polypeptide comprises the amino acid sequence of SEQ ID NO: 25 or 34, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 25 or 34, or the nucleic acid encoding the polypeptide(s) comprises the sequence of SEQ ID NO: 24 or 33, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 24 or 33.

[0133] Embodiment 121. The polynucleotide, composition, or lipid nanoparticle of any one of embodiments 89 to 120, wherein the polynucleotide comprises a 5'UTR having at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 398 to 405.

[0134] Embodiment 122. The polynucleotide, composition, or lipid nanoparticle of any one of embodiments 89 to 121, wherein the polynucleotide comprises a 3'UTR having at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 406 to 413.

[0135] Embodiment 123. A polynucleotide, composition or lipid nanoparticle according to any one of embodiments 89 to 122, wherein the polynucleotide comprises a 5'UTR and a 3'UTR from the same source.

[0136] Embodiment 124. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89 to 123, wherein the polynucleotide comprises a 5' cap, and optionally the 5' cap is Cap0, Cap1, or Cap2.

[0137] Embodiment 125. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 89 to 124, wherein the polynucleotide is mRNA.

[0138] Embodiment 126. A polynucleotide, composition or lipid nanoparticle according to any one of embodiments 89 to 125, wherein at least 85% of the uridines are substituted with modified uridines.

[0139] Embodiment 127. The polynucleotide, composition or lipid nanoparticle of embodiment 126, wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine or 5-iodouridine.

[0140] Embodiment 128. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 126 to 127, wherein the modified uridine is N1-methyl-pseudouridine.

[0141] Embodiment 129. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 126 to 128, wherein the modified uridine is a pseudouridine.

[0142] Embodiment 130. The polynucleotide, composition or lipid nanoparticle of embodiment 126, wherein the modified uridine is 5-iodouridine.

[0143] Embodiment 131. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 126 to 130, wherein at least 85% of the uridines are substituted with modified uridines.

[0144] Embodiment 132. The polynucleotide, composition or lipid nanoparticle of any one of embodiments 126 to 131, wherein 100% of the uridines are substituted with the modified uridines.

[0145] Embodiment 133. The composition or lipid nanoparticle of any one of embodiments 90 to 132, wherein one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with the one or more lipid nanoparticles (LNPs).

[0146] Embodiment 134. A composition or lipid nanoparticle described in any one of embodiments 90 to 133, wherein the nucleic acids encoding the fusion proteins are each associated with a separate lipid nanoparticle (LNP).

[0147] Embodiment 135. The composition or lipid nanoparticle of any one of embodiments 90 to 133, wherein the first guide RNA and the second guide RNA are associated with the same lipid nanoparticle (LNP).

[0148] Embodiment 136. The composition or lipid nanoparticle of any one of embodiments 90 to 133, wherein the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are all associated with the same lipid nanoparticle (LNP).

[0149] Embodiment 137. The composition or lipid nanoparticle of any one of embodiments 133 to 136, wherein the LNP comprises (i) an ionizable lipid, (ii) a helper lipid, (iii) a stealth lipid, (iv) a neutral lipid, or a combination of one or more of (i) to (iv).

[0150] Embodiment 138. The composition or lipid nanoparticle of embodiment 137, wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate.

[0151] Embodiment 139. A composition or lipid nanoparticle according to any one of embodiments 133 to 138, wherein the helper lipid is cholesterol.

[0152] Embodiment 140. A composition or lipid nanoparticle described in any one of embodiments 133 to 139, wherein the stealth lipid is PEG-DMG.

[0153] Embodiment 141. A composition or lipid nanoparticle described in any one of embodiments 133 to 140, wherein the PEG-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).

[0154] Embodiment 142. A composition or lipid nanoparticle according to any one of embodiments 133 to 141, wherein the neutral lipid is DSPC.

[0155] Embodiment 143. The composition or lipid nanoparticle of any one of embodiments 133 to 142, wherein the LNP composition comprises about 50 mol% ionizable lipids, about 9 mol% neutral lipids, about 3 mol% stealth lipids, and the remaining lipid components are helper lipids, such as cholesterol.

[0156] Embodiment 144. The composition or lipid nanoparticle of any one of embodiments 133 to 143, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate DSPC, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate, cholesterol, and PEG2k-DMG.

[0157] Embodiment 145. A polypeptide encoded by a polynucleotide according to any one of embodiments 89 to 132.

[0158] Embodiment 146. A vector comprising a polynucleotide according to any one of embodiments 89 to 132.

[0159] Embodiment 147. An expression construct comprising a promoter operably linked to a sequence encoding the polynucleotide of any one of embodiments 89 to 132.

[0160] Embodiment 148. A plasmid comprising the expression construct of embodiment 147.

[0161] Embodiment 149. A host cell comprising the vector of embodiment 146, the expression construct of embodiment 147, or the plasmid of embodiment 148.

[0162] Embodiment 150. A pharmaceutical composition comprising the polynucleotide, composition, lipid nanoparticle, or polypeptide according to any one of embodiments 89 to 145 and a pharmaceutically acceptable carrier.

[0163] Embodiment 151. A kit comprising a polynucleotide, composition, or polypeptide according to any one of embodiments 89 to 145.

[0164] Embodiment 152. Use of a polynucleotide, composition, lipid nanoparticle, or polypeptide according to any one of embodiments 89 to 145 for providing a modification to the genome of a target cell.

[0165] Embodiment 153. Use of a polynucleotide, composition, lipid nanoparticle, or polypeptide according to any one of embodiments 89 to 145 for the manufacture of a medicament for providing a modification to the genome of a target cell.

[0166] Embodiment 154. The method of any one of embodiments 1 to 85, wherein one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with the one or more target LNPs.

[0167] Embodiment 155. The method of embodiment 154, wherein the targeted LNP targets one or more of the brain, eye, muscle, liver, lung, spleen, and bone marrow.

[0168] Embodiment 156. The method of any one of embodiments 154 to 155, wherein the targeted LNP comprises a targeted lipid component.

[0169] Embodiment 157. The method of any one of embodiments 154 to 156, wherein the targeting LNP comprises a targeting domain.

[0170] Embodiment 158. The method of embodiment 157, wherein the targeting domain comprises a nucleic acid, peptide, antibody, small molecule, glycan, sugar, or hormone.

[0171] Embodiment 159. The method of any one of embodiments 154 to 158, wherein the targeted LNP is administered by an intravenous, intradermal, subcutaneous, inhaled, intranasal, or intramuscular delivery route.

[0172] Embodiment 160. The composition of any one of embodiments 91, or 93-144, wherein one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with the one or more target LNPs.

[0173] Embodiment 161. The composition of embodiment 160, wherein the targeted LNP comprises a targeted lipid component.

[0174] Embodiment 162. The composition of any one of embodiments 160-161, wherein the targeted LNP comprises a targeting domain.

[0175] Embodiment 163. The composition of embodiment 162, wherein the targeting domain comprises a nucleic acid, peptide, antibody, small molecule, glycan, sugar, or hormone. [Brief explanation of the drawings]

[0176] [Figure 1] The average percentage of editing in HEK-Blue cells is shown. [Figure 2] Percent editing in HEK-Blue cells is shown. [Figure 3] Percent editing in primary mouse hepatocytes is shown. [Figure 4] Percent editing in primary mouse hepatocytes is shown. [Figure 5] The percentage of editing in Hepa1-6 cells is shown. [Figure 6] The percentage of editing in Hepa1-6 cells is shown. [Figure 7] 1 shows orthogonal Cas9-Cas9 fusion and SpyCas9 expression in Hepa1-6 cells 72 hours after transfection. [Figure 8] Orthogonal Cas9-Cas9 fusion to GAPDH and SpyCas9 expression are shown. [Figure 9] 1 shows the percent editing at the TTR locus in primary mouse hepatocytes. [Figure 10]The percentage of editing in liver tissue is shown. [Figure 11A] Serum TTR levels are shown. [Figure 11B] Serum TTR levels are shown. [Figure 12] The percentage of editing in liver tissue is shown. [Figure 13A] Serum TTR levels are shown. [Figure 13B] Serum TTR levels are shown. [Figure 14] The percentage of editing in transfected cells is shown. The dotted line represents excision of mRNA A. [Figure 15] The percentage of editing in transfected cells is shown. [Figure 16] Expression of orthogonal Cas9-Cas9 fusion proteins detected by Western blot is shown. [Figure 17] The mean percentage of editing in primary mouse hepatocytes is shown. [Figure 18] The average percentage of editing at the PSCK9 locus by Spy guide and SpyCas9 is shown. [Figure 19] The average percentage of editing at the PSCK9 locus by Nme guide and NmeCas9 is shown. [Figure 20] Average percent editing at the PSCK9 locus with Spy guide and orthogonal Cas9-Cas9 fusions is shown. [Figure 21] Average percentage of editing at the PSCK9 locus by Nme guide and orthogonal Cas9-Cas9 fusions is shown. [Figure 22] Average percent editing at the PSCK9 locus with Spy-guide and Nme-guide G017566 and orthogonal Cas9-Cas9 fusions is shown. [Figure 23] Average percent editing at the PSCK9 locus with Spy guide and Nme G017564 and orthogonal Cas9-Cas9 fusions is shown. [Figure 24] The mean percent editing at the TTR locus in primary mouse hepatocytes is shown. [Figure 25] The mean percent editing at the TTR locus in primary mouse hepatocytes is shown. [Figure 26] Average percent editing at the TTR locus in cells transfected with orthogonal Cas9-Cas9 fusion mRNA and Nme guide is shown. [Figure 27] The average percent of editing at the TTR locus in cells transfected with NmeCas9 mRNA and Nme guides is shown. [Figure 28] Shown are the average percent editing at the TTR locus in cells transfected with Spy guide G000502, Nme guide G021845, and orthogonal Cas9-Cas9 fusions. [Figure 29] Shown are the average percent editing at the TTR locus in cells transfected with Spy guide G000502, Nme guide G021846, and the orthogonal Cas9-Cas9 fusion. [Figure 30] Average percent editing at the TTR locus in cells transfected with Spy guide G000502 and SpyCas9 is shown. [Figure 31] The average percentage of editing at the TTR locus in cells transfected with Nme guide G021845 and NmeCas9 is shown. [Figure 32] Average percent editing at the TTR locus in cells transfected with Nme guide G021846 and NmeCas9 is shown. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] DETAILED DESCRIPTION OF THE INVENTION

[0177] The present disclosure provides systems and methods for contacting cells with orthogonal Cas9-Cas9 fusions for, e.g., precise and reproducible genome editing. These methods provide for excising sequences from a cell's genome without significant side effects, such as inversions.

[0178] In some embodiments, provided herein are methods for genetically modifying a cell, comprising contacting a cell with an orthogonal Cas9-Cas9 fusion comprising a first cleavage site and a second cleavage site, or a nucleic acid encoding the same, thereby excising a DNA sequence between a first cleavage site cleaved by the first Cas9 cleavage site and a second cleavage site cleaved by the second Cas9 cleavage site.

[0179] The present disclosure also relates to a manufacturing method for preparing cells ex vivo for subsequent therapeutic administration to a subject. In some embodiments, the platform relates to genome editing via simultaneous or sequential administration of lipid nanoparticles (LNPs) containing orthogonal Cas9-Cas9 fusions comprising a first cleavase and a second cleavase, as disclosed herein, or nucleic acids encoding the same. The systems and methods disclosed herein are relevant to any cell type, but are particularly advantageous for preparing cells, such as primary immune cells, that require excision of defined genomic sequences for full therapeutic applicability. As provided herein, the platform methods apply to "cells" or "cell populations" (or "populations of cells"). When a method for delivery or gene editing of "cells" is referred to herein, it is understood that the method can also be used for delivery or gene editing of "cell populations."

[0180] In some embodiments, provided herein are cells treated in vitro with any of the methods or compositions disclosed herein. In some embodiments, provided herein are cells treated in vivo with any of the methods or compositions disclosed herein. In some embodiments, provided herein are cell populations comprising any of the cells disclosed herein.

[0181] In some embodiments, provided herein is the use of any cell, cell population, or composition disclosed herein for treating cancer. In some embodiments, provided herein is the use of any cell, cell population, or composition disclosed herein for preparing a medicament for treating cancer. In some embodiments, provided herein is a genetically engineered cell modified by the methods disclosed herein, wherein the genetically engineered cell comprises at least one genomic modification, for example, a deletion of consecutive nucleotides.

[0182] In some embodiments, the orthogonal Cas9-Cas9 fusions disclosed herein comprise a first Cas9 cleavage vector and a second Cas9 cleavage vector. The first cleavage vector is a S. pyogenes (Spy) Cas9 cleavage vector, which contains an R1333K mutation within its protospacer-adjacent motif recognition domain. The second cleavage vector can be a N. meningitidis (Nme) Cas9 cleavage vector, a C. jejuni (Cje) Cas9 cleavage vector, or a Simonsiella muelleri (Smu) Cas9 cleavage vector.

[0183] Thus, in some embodiments, a method for providing a modification to the genome of a target cell is provided. In some embodiments, the method includes: (a) contacting the cell with a fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase; (b) contacting the cell with a first guide RNA that directs the first cleavase to a first genomic locus; and (c) contacting the cell with a second guide RNA that directs the second cleavase to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0184] In some embodiments, a method for generating a cell or cell population is provided. In some embodiments, the method includes modifying the genome of a target cell(s), the method including: (a) contacting a cell(s) with a fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase; (b) contacting a cell(s) with a first guide RNA that guides the first cleavase to a first genomic locus; and (c) contacting a cell(s) with a second guide RNA that guides the second cleavase to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0185] In some embodiments, a composition is provided, the composition comprising: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; (b) a first guide RNA that directs the first cleavase to a first genomic locus; and (c) a second guide RNA that directs the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus.

[0186] In some embodiments, a composition is provided, the composition comprising: (a) a first polynucleotide comprising an ORF encoding a first polypeptide, the first polypeptide comprising a first cleavase and a first intein, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises an R1333K mutation within its protospacer-adjacent motif recognition domain; and (b) a second polynucleotide comprising an ORF encoding a second polypeptide, the second polypeptide comprising a second cleavase and a second intein capable of binding to the first intein, the second cleavase being a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase, wherein the first polypeptide is conjugated to the second polypeptide via intein catalysis.

[0187] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that material incorporated by reference conflicts with a defined term or other explicit content of the present specification, the present specification shall control. While the present teachings have been described in connection with various embodiments, the present teachings are not intended to be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0188] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:

[0189] The terms "polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds containing nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs linked together along a backbone, including polymers of conventional RNA, DNA, mixed RNA-DNA, and their analogs. The nucleic acid "backbone" can be composed of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acids" or PNA, PCT Publication No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, such as 2'-methoxy, 2'-halide, or 2'-O-(2-methoxyethyl) (2'-O-moe) substitutions. The nitrogenous bases may be conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines, e.g., 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, etc.), derivatives of inosine, purines, or pyrimidines (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 5,378,825 and PCT Publication WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids, vol. 5-36, Adams et al., ed., 11 th ed., 1992). Nucleic acids can contain one or more "abasic" residues, where the backbone does not contain a nitrogenous base at one or more positions in the polymer (U.S. Patent No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases, and linkages, or can contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), analogs containing one or more LNA nucleotide monomers that have a bicyclic furanose unit locked to an RNA-mimetic sugar structure and enhance hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Nucleic acids include "unlocked nucleic acids," which allow for tuning of thermodynamic stability and also provide nuclease stability. RNA and DNA can be distinguished by having different sugar moieties, the presence of uracil or its analogues in RNA and the presence of thymine or its analogues in DNA.

[0190] As used herein, "polypeptide" refers to a multimeric compound comprising amino acid residues capable of adopting a three-dimensional conformation. Polypeptides include, but are not limited to, enzymes, proenzyme proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, etc. Polypeptides can, but need not, include post-translational modifications, unnatural amino acids, prosthetic groups, etc.

[0191] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA together with an RNA-guided DNA-binding agent, such as a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA-binding agent (e.g., Cas9). In some embodiments, the guide RNA guides an RNA-guided DNA-binding agent, such as Cas9, to a target sequence, where the guide RNA hybridizes to the target sequence, the agent binds to the target sequence, and, if the agent is a cleavase or nickase, binding can be followed by cleavage or nicking.

[0192] As used herein, "Cas nuclease," also referred to as "Cas protein" as used herein, encompasses Cas cleavase, Cas nickase, and dCas DNA binders. Cas cleavase / Cas nickase and dCas DNA binders include the Csm complex or Cmr complex of a Type III CRISPR system, their Cas10 subunit, Csm1 subunit, or Cmr2 subunit, the Cascade complex of a Type I CRISPR system, its Cas3 subunit, and Class 2 Cas nucleases. As used herein, "Class 2 Cas nucleases" are single-chain polypeptides with RNA-guided DNA-binding activity. Class 2 Cas nucleases include Class 2 Cas cleavase, Class 2 Cas nickases (e.g., H840A, D10A, or N863A mutants) (which further possess RNA-guided DNA cleavase or nickase activity), and Class 2 dCas DNA binders in which cleavase / nickase activity has been inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A mutants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A mutants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A mutants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A mutants) proteins, as well as modified forms thereof. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. The Cpf1 sequence of Zetsche is incorporated by reference in its entirety. See, e.g., Tables S1 and S3 of Zetsche. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0193] As used herein, the term "orthogonal" refers to two genome editors (e.g., base editors, nucleases, nickases, or cleavases), each capable of recognizing its own target(s) via its cognate guide RNA(s), but not compatible with the cognate guide RNA(s) of the other genome editor; e.g., each unable to recognize the target(s) of the other genome editor via the cognate guide RNA(s) of the other genome editor. For example, an N. meningitidis Cas9 (NmeCas9) cleavase may be able to recognize a genomic locus via a guide RNA cognate to the NmeCas9 cleavase, and an S. pyogenes Cas9 (SpyCas9) cleavase may be able to recognize another genomic locus via a guide RNA cognate to the SpyCas9 cleavase. In this example, the NmeCas9 cleavases and SpyCas9 cleavases are orthogonal to each other. Genome editors or genome editing components may be designed to be orthogonal. In this example, the NmeCas9 and SpyCas9 creator bases are derived from different organisms, but two genome editors do not need to be derived from different organisms to be orthogonal to each other.

[0194] As used herein, the term "fusion protein" refers to a hybrid polypeptide comprising polypeptides from at least two different proteins or sources. One polypeptide can be located at the amino-terminal (N-terminal) portion or the carboxy-terminal (C-terminal) portion of the fusion protein, thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. Any of the proteins provided herein can be produced by any method known in the art. For example, the proteins provided herein can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods for recombinant protein expression and purification are well known and include those described in Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0195] The term "intein" as used herein refers to a protein domain that can mediate a process known as protein splicing. For example, a first intein (N-terminal intein) located at the C-terminus of a first polypeptide and a second intein (C-terminal intein) located at the N-terminus of a second polypeptide can undergo a chemical reaction that leads to the formation of a peptide bond between the first and second polypeptides and the excision of the first and second intein domains. Intein-mediated protein splicing is known in the art and represents an established technique for generating a single protein from two separate polypeptides (see, for example, Shah and Muir. Inteins: Nature's Gift to Protein Chemists. Chem. Sci., 5(1), 446-461 (2014)).

[0196] As used herein, the term "linker" refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, a linker is located between or sandwiched between two groups, molecules, or other moieties and covalently linked to each other. In some embodiments, the linker is a peptide linker comprising one or more amino acids (e.g., peptides or proteins), such as the 16-amino acid residue "XTEN" linker, or a variant thereof (see, for example, Schellenberger et al., "A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner." Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 301), SGSETPGTSESA (SEQ ID NO: 302), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 303). In some embodiments, the linker comprises one or more sequences selected from SEQ ID NOs: 150-158 and 304-365.

[0197] As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that directs the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be fused to the molecule by a covalent bond, hydrogen bond, or ionic interaction. In some embodiments, the NLS may be fused to the molecule via a linker.

[0198] As used herein, the "open reading frame" or "ORF" of a gene refers to a sequence of codons that specifies the amino acid sequence of the protein encoded by that gene. An ORF generally begins with a start codon (e.g., ATG in DNA, AUG in RNA) and ends with a stop codon (e.g., TAA, TAG, TGA in DNA, UAA, UAG, UGA in RNA).

[0199] As used herein, "mRNA" refers to a polynucleotide, other than DNA, that contains an open reading frame that is translatable into a polypeptide (i.e., that can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). mRNA can contain one or more modifications, for example, as set forth below. Generally, mRNA does not contain a sufficient amount of thymidine residues (e.g., 0 residues, or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues, or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). mRNA can contain modified uridines at some or all of its uridine positions.

[0200] "Modified uridine" is used herein to refer to a nucleoside other than thymidine that has the same hydrogen bond acceptor as uridine and has one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy, such as methoxy) replace a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl, such as methyl) replace a proton. In some embodiments, the modified uridine is either a substituted uridine, a pseudouridine, or a substituted pseudouridine.

[0201] As used herein, a "uridine position" refers to a position in a polynucleotide occupied by a uridine or modified uridine. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridines" contains a modified uridine at every position that would be a uridine in normal RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, the U in the polynucleotide sequences in this disclosure or in the sequence listing or sequence listings attached to this disclosure can be a uridine or a modified uridine.

[0202] As used herein, the "minimal uridine codon(s)" of a given amino acid are the codon(s) with the fewest uridines (usually 0 or 1, except for the codon for phenylalanine, which has two uridines as its minimal uridine codon). In assessing uridine content, modified uridine residues are considered equivalent to uridine.

[0203] As used herein, the "uridine dinucleotide (UU) content" of an ORF can be expressed in absolute terms as the number of UU dinucleotides in the ORF, or on a percentage basis as the percentage of positions occupied by uridine dinucleotides (e.g., AUUAU has a 40% uridine dinucleotide content because 2 of the 5 positions are occupied by uridine dinucleotides). In assessing uridine dinucleotide content, modified uridine residues are considered equivalent to uridine.

[0204] As used herein, the "minimal adenine codon(s)" of a given amino acid are the codon(s) with the fewest adenines (usually 0 or 1, except for the codons for lysine and asparagine, which have two adenines as their minimal adenine codon). In assessing adenine content, modified adenine residues are considered equivalent to adenine.

[0205] As used herein, the "adenine dinucleotide content" of an ORF can be expressed in absolute terms as the number of AA dinucleotides in the ORF, or on a percentage basis as the percentage of positions occupied by adenine dinucleotides (e.g., UAAUA has an adenine dinucleotide content of 40% because 2 of 5 positions are occupied by adenine dinucleotides). Modified adenine residues are considered equivalent to adenine for the purposes of assessing adenine dinucleotide content.

[0206] As used herein, "guide RNA," "gRNA," and "guide" are used interchangeably to refer to either crRNA (also called CRISPR RNA) or a combination of crRNA and trRNA (also called tracrRNA). The crRNA and trRNA can associate as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refer to each type. The trRNA can be a naturally occurring sequence or can be an altered or mutated trRNA sequence compared to the naturally occurring sequence.

[0207] As used herein, the term "genomic locus," when used in the context of a genomic locus targeted by a guide RNA, includes one or more portions of a genome that, when targeted, affect the expression of a gene associated with that locus. For example, a genomic locus can include a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splicing site, or a non-coding sequence between genes (e.g., an intergenic space).

[0208] As used herein, "guide sequence" or "guide region" or "target sequence" or "spacer" or "spacer sequence" refers to a sequence within a gRNA that is complementary to a target sequence and functions to guide the gRNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided nickase. Guide sequences can be 20 nucleotides in length, for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9 (also referred to as SpCas9)) and related Cas9 homologs / orthologs. Shorter or longer sequences, e.g., 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as guides. Guide sequences can be 20-25 nucleotides in length, e.g., in the case of NmeCas9, e.g., 20, 21, 22, 23, 24, or 25 nucleotides in length. For example, Nme Cas9 can use a guide sequence that is 24 nucleotides in length (e.g., Nme2 Cas9).

[0209] In some embodiments, the target sequence is complementary to the guide sequence, e.g., on a genomic locus or chromosome. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence can be about 75%, about 80%, about 85%, about 90%, about 95%, or 100%. In some embodiments, the guide sequence and target region can be 100% complementary or identical. In other embodiments, the guide sequence and target region can contain at least one mismatch. For example, the guide sequence and target sequence can contain one, two, three, or four mismatches, and the combined length of the target sequence is at least 17, at least 18, at least 19, at least 20, or more base pairs. In some embodiments, the guide sequence and target region can contain one to four mismatches, and the guide sequence contains at least 17, at least 18, at least 19, at least 20, or more nucleotides. In some embodiments, the guide sequence and target region can contain one, two, three, or four mismatches, and the guide sequence comprises 20 nucleotides. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence is at least 80%, at least 85%, at least 90%, or at least 95%, for example, when the guide sequence comprises a sequence of 24 contiguous nucleotides. In some embodiments, the guide sequence and target region can be 100% complementary or identical. In other embodiments, the guide sequence and target region can contain at least one mismatch, i.e., one nucleotide that is not identical or complementary, depending on the reference sequence. For example, the guide sequence and target sequence can contain one to two, preferably one or fewer, mismatches, and the total length of the target sequence is 19, 20, 21, 22, 23, or 24 nucleotides or more. In some embodiments, the guide sequence and target region can contain at least 24 nucleotides or more, and the guide sequence contains one to two mismatches. In some embodiments, the guide sequence and the target region can contain 1-2 mismatches, and the guide sequence comprises 24 nucleotides.

[0210] As used herein, "target sequence" or "genomic target sequence" refers to a nucleic acid sequence in a target genomic locus, either in the plus or minus strand, that is complementary to a gRNA's guide sequence, i.e., sufficiently complementary to the gRNA's guide sequence to allow the guide to specifically bind to the target sequence. The interaction between the target sequence and the guide sequence directs an RNA-guided DNA-binding agent to bind and potentially nick or cleave (depending on the activity of the agent) within the target sequence. The specific length of the target sequence and the number of mismatches that can occur between the target sequence and the guide sequence depend, for example, on the identity of the Cas9 nuclease guided by the gRNA. Because the nucleic acid substrate of a Cas protein is a double-stranded nucleic acid, the target sequence of the Cas protein includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is said to be "complementary to a target sequence," it is understood that the guide sequence can direct an RNA-guided DNA-binding agent (e.g., dCas9 or a disordered Cas9) to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence without the PAM), except for the substitution of T for U in the guide sequence.

[0211] As used herein, a first sequence is considered to "contain at least X% identical sequence" to a second sequence if, when aligned to the second sequence, X% or more of the positions across the second sequence match the first sequence. For example, the sequence AAGA contains a sequence that is 100% identical to the sequence AAG, because the alignment results in 100% identity in that all three positions in the second sequence match. Differences between RNA and DNA (generally, the exchange of uridine with thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity between polynucleotides, as long as the related nucleotide (e.g., thymidine, uridine, or modified uridine) has the same complement (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine as their complement). Thus, for example, a 5'-AXG sequence (where X is a modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered 100% identical to AUG, and both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand which algorithm and parameter settings to select for a given pair of sequences to be aligned; generally, for sequences of similar length and predicted identity of 50% or more for amino acids and 75% or more for nucleotides, the Needleman-Wunsch algorithm, with default settings in the Needleman-Wunsch algorithm interface provided by EBI on its www.ebi.ac.uk web server, is generally suitable.

[0212] As used herein, the term "contacting" refers to providing at least one component in physical contact with a cell, including physical contact with the cell surface, cytoplasm, and / or nucleus. "Contacting" a cell with a polypeptide includes, for example, contacting the cell with a nucleic acid encoding the polypeptide, causing the cell to express the polypeptide.

[0213] As used herein, "indel" refers to an insertion or deletion mutation consisting of an inserted, deleted, or inserted and deleted number of nucleotides, such as at the site of a double-strand break (DSB) in a target nucleic acid. As used herein, when an insertion occurs by indel formation, the insertion is a random insertion at the site of the DSB and is generally not directed by or based on a template sequence.

[0214] As used herein, an "excision" is defined as a single long deletion that begins within the indel window of one guide RNA and ends within the indel window of the other guide RNA.

[0215] As used herein, "inversion" refers to a mutation in which a DNA sequence flanked by two double-strand breaks (DSBs) is reinserted into a chromosome in the opposite orientation. Inversions can occur after two adjacent DSBs are created simultaneously or nearly simultaneously.

[0216] As used herein, "reducing or eliminating" (or "reduced or eliminated") the expression of a protein on a cell refers to a partial or complete loss of expression of the protein compared to unmodified cells. In some embodiments, surface expression of a protein on a cell is measured by flow cytometry, and surface expression is "reduced or eliminated" compared to unmodified cells, as evidenced by a decrease in fluorescent signal when stained with the same antibody against the protein. Cells that have "reduced or eliminated" surface expression of a protein by flow cytometry compared to unmodified cells can be said to be "negative" for the expression of that protein, as evidenced by a fluorescent signal similar to cells stained with an isotype control antibody. "Reduced or eliminated" protein expression can be measured by other known techniques in the art using appropriate controls known to those of skill in the art. As used herein, "eliminated" expression means that expression is reduced to below a level where the protein can be detected by the method in question.

[0217] As used herein, "increasing" (or "increasing") the expression of a protein on a cell refers to an increase in the expression of the protein compared to unmodified cells. In some embodiments, surface expression of a protein on a cell is measured by flow cytometry, and an increase in fluorescent signal when stained with the same antibody against the protein demonstrates "increased" surface expression compared to unmodified cells. An "increase" in protein expression can be measured by other techniques known in the art, using appropriate controls known to those of skill in the art.

[0218] As used herein, "knockdown" refers to a reduction in the expression of a particular gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured by detecting the protein secreted from a tissue or cell population (e.g., in serum or cell medium) or by detecting the total cellular amount of protein from a tissue or cell population of interest. Methods for measuring mRNA knockdown are known and include sequencing mRNA isolated from a tissue or cell population of interest. In some embodiments, "knockdown" can refer to the loss of expression of a particular gene product, e.g., a reduction in the amount of transcribed mRNA or a reduction in the amount of protein expressed or secreted by a cell population (including an in vivo population such as found in a tissue).

[0219] As used herein, "knockout" refers to the loss of expression of a particular protein in a cell. Knockout can be measured by detecting the amount of protein secreted from a tissue or cell population (e.g., in serum or cell medium) or by detecting the total cellular amount of the protein in a tissue or cell population. In some embodiments, the methods of the present disclosure "knockout" a target protein in one or more cells (e.g., within a cell population, including an in vivo population such as found in a tissue). In some embodiments, knockout does not refer to the formation of a mutant form of the target protein, such as an indel, but rather to the complete loss of expression of the target protein in the cell, i.e., expression is reduced below the detection level of the assay used.

[0220] As used herein, a "cell population comprising edited cells" (or a "cell population comprising genetically engineered cells"), etc., refers to a cell population that includes edited cells (or genetically engineered cells), but not all cells in the population need be edited. A cell population that includes edited cells may also include non-edited cells. The percentage of edited cells within a cell population that includes edited cells can be determined by counting the number of cells in the population that are edited within the population as determined by standard cell counting methods. For example, in some embodiments, a cell population that includes edited cells that include a single genome edit has at least 20%, at least 30%, at least 40%, preferably at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the cells in the population have a single edit. In some embodiments, the cell population comprising edited cells comprising at least two genome edits has at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the cells having at least two genome edits.

[0221] As used herein, "TTR" refers to the TTR gene (NCBI Gene ID: 7276, Ensembl: ENSG00000118271), which encodes the protein transthyretin (TTR).

[0222] As used herein, "treatment" refers to the administration or application of a therapeutic agent for a disease or disorder in a subject, and includes suppressing the disease, preventing the progression of the disease, alleviating one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including the recurrence of symptoms.

[0223] As used herein, "delivery" and "administration" are used interchangeably and include ex vivo and in vivo applications.

[0224] As used herein, co-administration means that two or more agents are administered close enough in time that the agents act together. Co-administration includes administering the agents together in a single formulation, as well as administering the agents in separate formulations close enough in time that the agents act together.

[0225] As used herein, the phrase "pharmaceutically acceptable" means useful in preparing pharmaceutical compositions that are generally non-toxic, not biologically undesirable, and not otherwise unacceptable for pharmaceutical use. Pharmaceutically acceptable generally refers to a substance that is non-pyrogenic. Pharmaceutically acceptable can refer to a substance that is sterile, particularly a pharmaceutical substance for injection or infusion.

[0226] As used herein, "subject" refers to any member of the animal kingdom. In some embodiments, "subject" refers to a human. In some embodiments, "subject" refers to a non-human animal. In some embodiments, "subject" refers to a primate. In some embodiments, a subject may be a transgenic animal, a genetically engineered animal, or a clone. In certain embodiments of the invention, a subject is an adult, an adolescent, or an infant. In some embodiments, the terms "individual" or "patient" are used and are intended to be interchangeable with "subject."

[0227] The term "about" or "approximately" refers to an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, or a degree of variation that does not substantially affect the properties of the described subject matter, or within an acceptable range accepted in the art, e.g., within 10%, 5%, 2%, or 1%, or within two standard deviations of a set of values. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and appended claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0228] Before describing the present teachings in detail, it is to be understood that the disclosure is not limited to particular configurations or process steps, as such may vary. It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, the term "conjugate" includes plural conjugates, the term "cell" includes plural cells, and so forth.

[0229] Numerical ranges are inclusive of the numbers defining the range. Measured and measurable values ​​are understood to be approximations taking into account significant digits and inherent error in measurement. Also, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" are not intended to be limiting. It should be understood that the foregoing general description and detailed description are exemplary and explanatory only and are not intended to limit the present teachings.

[0230] Unless otherwise noted herein, embodiments described herein as "comprising" various components are also contemplated as "consisting of" or "consisting essentially of" the listed components, and embodiments described herein as "consisting of" various components are also contemplated as "comprising" or "consisting essentially of" the listed components. Also, embodiments described herein as "consisting essentially of" various components are also contemplated as "consisting of" or "including" the listed components (this interchangeability does not apply to the use of these terms in the claims).

[0231] The term "or" is used in its inclusive equivalent to "and / or" unless the context clearly indicates otherwise.

[0232] As used herein, ranges include both upper and lower limits.

[0233] In the event of a conflict between the sequence in the application and a designated accession number or position within an accession number, the sequence in the application will take precedence.

[0234] Reference will now be made in detail to certain specific embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that it is not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the invention, as defined by the appended claims and included embodiments.

[0235] II. Cas9-Cas9 fusion proteins The Cas9-Cas9 fusion system can use both Cas9 domains to achieve coordinated cleavage at two adjacent locations in the genome. For example, combining an attenuated SpyCas9 cleavage base with an NmeCas9 cleavage base creates two double-stranded breaks, specifically excising the intervening sequence.

[0236] In some embodiments, a fusion protein (or "Cas9-Cas9 fusion") disclosed herein comprises (a) a first Cas9 cleavase and a guide RNA (gRNA) that targets at least one genomic locus and is cognate to the first Cas9 cleavase, and (b) a second Cas9 cleavase and a gRNA that targets at least one genomic locus and is cognate to the second Cas9 cleavase, thereby excising a DNA sequence between a first cleavage site cleaved by the first cleavase and a second cleavage site cleaved by the second cleavase. In some embodiments, the fusion protein is delivered to a cell as at least one polypeptide or at least one mRNA.

[0237] In some embodiments, a polynucleotide is provided comprising an open reading frame (ORF) encoding a fusion protein. In some embodiments, the fusion protein comprises a first cleavase and a second cleavase, wherein the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase comprising an R1333K mutation in its protospacer-adjacent motif recognition domain, and the second cleavase is a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase.

[0238] In some embodiments, a composition is provided, the composition comprising: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase comprising an R1333K mutation in its protospacer adjacent motif recognition domain, and the second cleavase being a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase; (b) a first guide RNA that directs the first cleavase to a first genomic locus; and (c) a second guide RNA that directs the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus.

[0239] In some embodiments, a composition is provided, the composition comprising: (a) a first polynucleotide comprising an ORF encoding a first polypeptide, the first polypeptide comprising a first cleavase and a first intein, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises an R1333K mutation within its protospacer-adjacent motif recognition domain; and (b) a second polynucleotide comprising an ORF encoding a second polypeptide, the second polypeptide comprising a second cleavase and a second intein capable of binding to the first intein, the second cleavase being a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase, wherein the first polypeptide is conjugated to the second polypeptide via intein catalysis.

[0240] In some embodiments, the first cleavase is located at the N-terminus of the second cleavase. In some embodiments, the first cleavase is located at the C-terminus of the second cleavase.

[0241] A. First Cryptogenes: Attenuated SpyCas9 In some embodiments, the present disclosure provides an attenuated SpCas9 comprising a mutation in the protospacer adjacent motif (PAM) recognition domain. In some embodiments, the SpCas9 may have attenuated DNA-binding activity. Exemplary mutations in the PAM-interacting domain include R1333S, R1333K, and R1335K. See also WO2016106338; Nishimasu et al., Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell. 2014 Feb 27;156(5):935-49; and Anders et al., Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 2014 Sep 25;513(7519):569-73, the contents of all of which are incorporated herein by reference.

[0242] In some embodiments, the first cleavase comprises an R1333K mutation in the PAM recognition domain.

[0243] In some embodiments, the SpyCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 105, or an amino acid sequence at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 105. In some embodiments, the nucleotide sequence encoding the SpyCas9 cleavase comprises an open reading frame (ORF) comprising the sequence of SEQ ID NO: 104, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 104.

[0244] B. Second Cas9 Cryptobase In some embodiments, the fusion proteins disclosed herein include a second Cas9 cleavage site. The second Cas9 can be a Class II-C Cas9 ortholog. Non-limiting examples of Class II-C Cas9s include N. meningitidis (NmeCas9), C. jejuni Cas9 (CjeCas9), or S. muelleri (Smu) Cas9.

[0245] In some embodiments, the Cas9 is Nme1Cas9, Nme2Cas9, or Nme3Cas9. In some embodiments, the second cleavage is NmeCas9. In some embodiments, the second cleavage is Nme1Cas9, Nme2Cas9, or Nme3Cas9. In some embodiments, the second cleavage is Nme2Cas9.

[0246] In some embodiments, the second cleavage vector is CjeCas9. In some embodiments, the second cleavage vector is SmuCas9.

[0247] In some embodiments, the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137.

[0248] In some embodiments, the nucleotides encoding the NmeCas9 cleavase comprise the nucleotide sequence of any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138, or 139, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to the nucleotide sequence of any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138, or 139.

[0249] In some embodiments, the NmeCas9 cleavase is an Nme2Cas9 comprising the amino acid sequence of any one of SEQ ID NOs: 22, 109, or 136, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 109, or 136; or (b) the nucleotides encoding the NmeCas9 cleavase comprise the nucleotide sequence of any one of SEQ ID NOs: 21, 108, or 138, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 21, 108, or 138.

[0250] In some embodiments, the CjeCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 144, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 144. In some embodiments, the nucleotide sequence encoding the CjeCas9 cleavase comprises the sequence of SEQ ID NO: 143, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 143.

[0251] In some embodiments, the SmuCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 142, or an amino acid sequence at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 142. In some embodiments, the nucleotide sequence encoding the SmuCas9 cleavase comprises an open reading frame (ORF) comprising the sequence of SEQ ID NO: 140 or 141, or a nucleotide sequence at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 140 or 141.

[0252] C. Linker In some embodiments, the fusion protein described herein further comprises a linker between the first cleavase and the second cleavase. In some embodiments, the linker is an organic molecule, a polymer, or a chemical moiety. In some embodiments, the linker is a peptide linker. In some embodiments, the nucleic acid encoding the polypeptide comprising the first cleavase or the second cleavase further comprises a sequence encoding the peptide linker.

[0253] In some embodiments, the peptide linker is any stretch of amino acids having at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, or more amino acids.

[0254] In some embodiments, the peptide linker is any stretch of amino acids having at least 11, at least 21, at least 31, at least 41, at least 51, at least 61, at least 71, at least 81, or at least 91 amino acids.

[0255] In some embodiments, the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, In some embodiments, the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, wherein the peptide linker comprises at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, or at least 80 amino acids.

[0256] In some embodiments, the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, wherein the peptide linker comprises 11, 21, 31, 41, 51, 61, 71, or 81 amino acid residues.

[0257] In some embodiments, the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, wherein the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 150-158, or the amino acid sequence is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 150-158.

[0258] Other types of peptide linkers can also be used herein. The peptide linker can be a 16-residue "XTEN" linker or variants thereof (see, e.g., Chellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 301), SGSETPGTSESA (SEQ ID NO: 302), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 303). In some embodiments, the XTEN linker consists of the sequence SGSETPGTSESATPES (SEQ ID NO: 301), SGSETPGTSESA (SEQ ID NO: 302), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 303).

[0259] In some embodiments, the peptide linker is (GGGGS) n (For example, SEQ ID NOs: 305, 309-311, 314-318, 320-331, or 333-359), (G) n , (EAAAK) n (For example, SEQ ID NOs: 306, 310-312, 315-318, 320-331, or 334-360), (GGS) n, SGSETPGTSESATPES (SEQ ID NO: 301) motif (see, e.g., Guilinger JP, Thompson DB, Liu D R. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 2014;32(6):577-82, the entire contents of which are incorporated herein by reference), or (XP) n motif, or any combination thereof, wherein n is independently an integer from 1 to 30. See, for example, paragraph

[0012] of WO2015089406, the entire contents of which are incorporated herein by reference.

[0260] In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NOs: 150-158 and 301-365. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 150. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 151. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 152. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 153. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 154. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 155. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 156. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 157. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 158. In some embodiments, the peptide linker comprises one or more sequences selected from SEQ ID NO: 301, SEQ ID NO: 302, SEQ ID NO: 303, SEQ ID NO: 361, SEQ ID NO: 362, SEQ ID NO: 363, SEQ ID NO: 364, and SEQ ID NO: 365. In some embodiments, the peptide linker comprises the sequence of SEQ ID NO: 361.

[0261] D. Nuclear localization signal (NLS) In some embodiments, the heterologous functional domain can facilitate the transport of the fusion protein disclosed herein into the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the fusion protein comprises a nuclear localization signal (NLS).

[0262] In some embodiments, the fusion protein can be fused with 1 to 10 NLS(s). In some embodiments, the fusion protein disclosed herein can be fused with 1 to 5 NLSs. In some embodiments, the fusion protein can be fused with 1 NLS.

[0263] When one NLS is used, the NLS can be fused to the N-terminus or C-terminus of the fusion protein.In some embodiments, the fusion protein disclosed herein can be fused to at least one NLS at the C-terminus.NLS can also be inserted into the fusion protein.In other embodiments, the fusion protein can be fused to multiple NLSs.

[0264] In some embodiments, the fusion protein can be fused to two, three, four, or five NLSs. In some embodiments, the fusion protein can be fused to two NLSs. Depending on the situation, the two NLSs can be the same (e.g., two SV40 NLSs) or different. In some embodiments, the fusion protein is fused to two SV40 NLS sequences at the C-terminus. In some embodiments, the fusion protein can be fused to two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the fusion protein can be fused to three NLSs.

[0265] In some embodiments, the fusion protein can be fused without an NLS.

[0266] In some embodiments, the NLS can be a monopartite sequence, such as, for example, an SV40 NLS, such as PKKKRKVE (SEQ ID NO: 366), KKKRKVE (SEQ ID NO: 367), PKKKRKV (SEQ ID NO: 371), or PKKKRRV (SEQ ID NO: 383). In some embodiments, the NLS can be a bipartite sequence, such as the nucleoplasmic NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 384). In certain embodiments, a single PKKKRKV (SEQ ID NO: 371) NLS can be fused to the C-terminus of the first cleavage or the second cleavage. One or more linkers are optionally included at the fusion site (e.g., between the fusion protein disclosed herein and the NLS).

[0267] In some embodiments, one or more NLSs according to any of the preceding embodiments are present in the fusion protein in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below.

[0268] In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present at the C-terminus of the fusion protein. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present at the N-terminus of the fusion protein. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present at both the N-terminus and the C-terminus of the fusion protein. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the first Cas9 protein or the second Cas9 protein and the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present within the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the C-terminus of a first nucleotide sequence disclosed herein and the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the C-terminus of a second nucleotide sequence disclosed herein and the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS) located between the N-terminus of a first nucleotide sequence disclosed herein and the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS) located between the N-terminus of a second nucleotide sequence disclosed herein and the linker sequence.

[0269] In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 366-369 and 371-384. In some embodiments, the fusion protein comprises one, two, or three nuclear localization signals (NLS) independently selected from SEQ ID NOs: 366-369 and 371-384.

[0270] In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is encoded by a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% identity to any one of SEQ ID NOs: 370 and 385-397.

[0271] E. Exemplary Cas9-Cas9 Fusion Proteins In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first cleavase, a peptide linker, optionally comprising 81 amino acid residues, a second cleavase, and an NLS comprising an SV40 NLS.

[0272] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first NLS, the first NLS comprising an SV40 NLS, a second cleavase, a peptide linker, optionally comprising 41 amino acids, the first cleavase, and a second NLS, the second NLS comprising an SV40 NLS.

[0273] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a second cleavase, a peptide linker optionally comprising 41 amino acids, a first cleavase, and an NLS, optionally comprising an SV40 NLS. In some embodiments, the first cleavase comprises SpyCas9. In some embodiments, the second cleavase comprises CjeCas9, SmuCas9, Nme1Cas9, Nme2Cas9, or Nme3Cas9.

[0274] In some embodiments, the fusion protein disclosed herein comprises (a) a first cleavase and a guide RNA (gRNA) that targets at least one genomic locus and is cognate with the first cleavase; and (b) a second cleavase and a gRNA that targets at least one genomic locus and is cognate with the second cleavase, wherein the first cleavase is orthogonal to the second cleavase. In some embodiments, the first cleavase comprises SpyCas9. In some embodiments, the second cleavase comprises CjeCas9, SmuCas9, Nme1Cas9, Nme2Cas9, or Nme3Cas9.

[0275] In some embodiments, the fusion protein disclosed herein comprises (a) a first cleavase and a guide RNA (gRNA) that targets at least one genomic locus and is cognate with the first cleavase; and (b) a second cleavase and a gRNA that targets at least one genomic locus and is cognate with the second cleavase, wherein the first cleavase is orthogonal to the second cleavase. In some embodiments, the first cleavase comprises R1333K SpyCas9. In some embodiments, the second cleavase comprises CjeCas9, SmuCas9, Nme1Cas9, Nme2Cas9, or Cas9.

[0276] In some embodiments, a fusion protein disclosed herein comprises (a) a first cleavase and a guide RNA (gRNA) that targets at least one genomic locus and is cognate to the first cleavase; and (b) a second cleavase and a gRNA that targets at least one genomic locus and is cognate to the second cleavase, wherein the first cleavase is orthogonal to the second cleavase. In some embodiments, a fusion protein disclosed herein comprises R1333K SpyCas9 and CjeCas9. In some embodiments, a fusion protein disclosed herein comprises R1333K SpyCas9 and SmuCas9. In some embodiments, a fusion protein disclosed herein comprises R1333K SpyCas9 and Nme1Cas9. In some embodiments, a fusion protein disclosed herein comprises R1333K SpyCas9 and Nme2Cas9. In some embodiments, the fusion protein disclosed herein comprises R1333K Spy Cas9 and Nme3Cas9.

[0277] In some embodiments, the first cleavase and the second cleavase are linked via a linker. In some embodiments, the first cleavase and the second cleavase are linked via a peptide linker. In some embodiments, the fusion proteins disclosed herein further comprise one or more additional heterologous functional domains. In some embodiments, the first cleavase further comprises one or more nuclear localization sequences (NLS) (described herein) at the C-terminus of the polypeptide or the N-terminus of the polypeptide. In some embodiments, the one or more NLSs comprise one or more sequences selected from SEQ ID NOs: 366-384.

[0278] In some embodiments, a fusion protein disclosed herein comprises (a) a first cleavase and a guide RNA (gRNA) that targets at least one genomic locus and is cognate to the first cleavase; and (b) a second cleavase and a gRNA that targets at least one genomic locus and is cognate to the second cleavase, wherein the first cleavase is orthogonal to the second cleavase. In some embodiments, the first cleavase comprises R1333K SpyCas9 and the second cleavase comprises Nme2 Cas9. In some embodiments, the R1333K SpyCas9 and Nme2 Cas9 are fused via a linker. In some embodiments, the first cleavase comprises R1333K SpyCas9 and the second cleavase comprises Cje Cas9. In some embodiments, the R1333K SpyCas9 and Cje Cas9 are fused via a linker. In some embodiments, the first cleavase comprises R1333K SpyCas9 and the second cleavase comprises Smu Cas9. In some embodiments, the R1333K SpyCas9 and Smu Cas9 are fused via a linker. In some embodiments, the fusion proteins disclosed herein comprise an NLS at the C-terminus of the polypeptide. In some embodiments, the fusion proteins disclosed herein comprise a first NLS at the C-terminus of the polypeptide and a second NLS at the N-terminus of the polypeptide. In some embodiments, the fusion proteins disclosed herein comprise a first NLS and a second NLS at the C-terminus of the polypeptide and a third NLS at the N-terminus of the polypeptide. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the first Cas9 protein or the second Cas9 protein and the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present within the linker sequence. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present within the linker sequence.In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the C-terminus of a first cleavage and the linker sequence disclosed herein. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the C-terminus of a second cleavage and the linker sequence disclosed herein. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the N-terminus of a first cleavage and the linker sequence disclosed herein. In some embodiments, the fusion protein comprises a nuclear localization signal (NLS), wherein the NLS is present between the N-terminus of a second cleavage and the linker sequence disclosed herein.

[0279] In some embodiments, the fusion proteins disclosed herein comprise the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105.

[0280] In some embodiments, a nucleic acid encoding a fusion protein disclosed herein has the nucleotide sequence of SEQ ID NO: 1, 2, 4, 6-8, 9, 11, 12, 14-15, 38-39, 41-42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104, or a sequence that is at least 90% identical to SEQ ID NO: 1 or 2. or a nucleotide sequence that is at least 95% identical, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, 12, 14-15, 38-39, 41-42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104.

[0281] In some embodiments, the fusion proteins disclosed herein comprise the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, or 13, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13.

[0282] In some embodiments, a nucleic acid encoding a fusion protein disclosed herein comprises the nucleotide sequence of SEQ ID NO: 1, 2, 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 1 or 2, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

[0283] In some embodiments, the fusion proteins disclosed herein comprise the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13.

[0284] Alternatively, in some embodiments, a nucleic acid encoding a fusion protein disclosed herein comprises the nucleotide sequence of SEQ ID NO: 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

[0285] III. Exemplary Compositions and Methods for Genome Editing Compositions are provided that include a Cas9-Cas9 fusion protein or a nucleic acid (e.g., mRNA) encoding the fusion protein and a guide RNA. In some embodiments, the composition includes: (a) a polynucleotide comprising an open reading frame (ORF) encoding the fusion protein, the fusion protein comprising a first cleavase and a second cleavase; (b) a first guide RNA that guides the first cleavase to a first genomic locus; and (c) a second guide RNA that guides the second cleavase to a second genomic locus that is different from the first genomic locus. In some embodiments, the first cleavase is a S. pyogenes (Spy) Cas9 cleavase comprising an R1333K mutation in the PAM recognition domain. In some embodiments, the second cleavage vector is a N. meningitidis (Nme) Cas9 cleavage vector (e.g., Nme1Cas9, Nme2Cas9, or Nme3Cas9), a C. jejuni (Cje) Cas9 cleavage vector, or a Simonsiella muelleri (Smu) Cas9. The compositions disclosed herein can be used to provide modifications to the genome of a target cell.

[0286] Methods for providing modifications to the genome of a target cell are provided. In some embodiments, the methods include contacting a cell with an orthogonal Cas9-Cas9 fusion protein, or a nucleic acid encoding the fusion protein, comprising a first cleavage site and a second cleavage site, thereby excising a DNA sequence between a first cleavage site cleaved by the first Cas9 cleavage site and a second cleavage site cleaved by the second Cas9 cleavage site. In some embodiments, the methods include (a) contacting a cell with a fusion protein, or a nucleic acid encoding the fusion protein, wherein the fusion protein comprises a first cleavage site and a second cleavage site, (b) contacting the cell with a first guide RNA that directs the first cleavage site to a first genomic locus, and (c) contacting the cell with a second guide RNA that directs the second cleavage site to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0287] Also contemplated are methods of generating edited (or genetically engineered) cells or populations of genetically engineered cells. In some embodiments, the methods involve modifying the genome of a target cell(s), the methods comprising: (a) contacting the cell(s) with a fusion protein or a nucleic acid encoding the fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase; (b) contacting the cell(s) with a first guide RNA that directs the first cleavase to a first genomic locus; and (c) contacting the cell(s) with a second guide RNA that directs the second cleavase to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0288] In some embodiments, the first guide RNA and the second guide RNA target two non-overlapping genomic loci. In some embodiments, the two non-overlapping genomic loci are separated by no more than 500, 450, 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides. In some embodiments, the two non-overlapping genomic loci are separated by no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides. In some embodiments, two non-overlapping genomic loci are separated by 25 to 150, 30 to 150, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, or 140 to 150 nucleotides. In some embodiments, two non-overlapping genomic loci are separated by 25 to 110, 30 to 110, 40 to 110, 50 to 110, 60 to 110, 70 to 110, 80 to 110, 90 to 110, or 100 to 110 nucleotides. In some embodiments, two non-overlapping genomic loci are separated by 25-90, 30-90, 40-90, 50-90, 60-90, 70-90, or 80-90 nucleotides. In some embodiments, two non-overlapping genomic loci are separated by 110 nucleotides or less. In some embodiments, the first guide RNA is a single guide RNA (sgRNA). In some embodiments, the first guide RNA is a SpyCas9 guide RNA. In some embodiments, the second guide RNA is an NmeCas9 guide RNA. In some embodiments, one or both of the guide RNAs contain one or more mismatches to the target sequence.

[0289] In some embodiments, the nucleic acid encoding the fusion protein is delivered to the cell by at least one vector.In some embodiments, the fusion protein or the nucleic acid encoding the fusion protein is delivered to the cell by electroporation.In some embodiments, the first guide RNA is delivered to the cell by electroporation.In some embodiments, the second guide RNA is delivered to the cell by electroporation.

[0290] In some embodiments, one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with one or more lipid nanoparticles (LNPs). In some embodiments, the nucleic acids encoding the fusion protein, the first guide RNA, and the second guide RNA are each associated with separate lipid nanoparticles (LNPs). In some embodiments, the first guide RNA and the second guide RNA are associated with the same lipid nanoparticle (LNP). In some embodiments, the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are all associated with the same lipid nanoparticle (LNP). Delivery of polynucleotides and compositions via LNPs is further described below.

[0291] In some embodiments, the modification is performed in vivo. In some embodiments, the modification is performed in vitro.

[0292] In some embodiments, the modifications comprise deletions of 500, 450, 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30 or fewer nucleotides. In some embodiments, the modifications comprise deletions of 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30 or fewer nucleotides. In some embodiments, the modification comprises a deletion of 25 to 150, 30 to 150, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, or 140 to 150 nucleotides. In some embodiments, the modification comprises a deletion of 25 to 110, 30 to 110, 40 to 110, 50 to 110, 60 to 110, 70 to 110, 80 to 110, 90 to 110, or 100 to 110 nucleotides. In some embodiments, the modification comprises a deletion of 25 to 90, 30 to 90, 40 to 90, 50 to 90, 60 to 90, 70 to 90, or 80 to 90 nucleotides.

[0293] In some embodiments, the modification comprises a deletion of no more than 500, 450, 400, 350, 300, 250, 200, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 contiguous nucleotides. In some embodiments, the modification comprises a deletion of no more than 500 to 450, 500 to 400, 500 to 350, 500 to 300, 500 to 250, 500 to 200, 500 to 150, 500 to 140, 500 to 130, 500 to 120, 500 to 110, 500 to 100, 500 to 90, 500 to 80, 500 to 70, 500 to 60, 500 to 50, 500 to 40, or 500 to 30 contiguous nucleotides. In some embodiments, the modification comprises a deletion of no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 contiguous nucleotides.

[0294] In some embodiments, the modification comprises a deletion of 25 to 150, 30 to 150, 40 to 150, 50 to 150, 60 to 150, 70 to 150, 80 to 150, 90 to 150, 100 to 150, 110 to 150, 120 to 150, 130 to 150, or 140 to 150 contiguous nucleotides. In some embodiments, the modification comprises a deletion of 25 to 110, 30 to 110, 40 to 110, 50 to 110, 60 to 110, 70 to 110, 80 to 110, 90 to 110, or 100 to 110 contiguous nucleotides. In some embodiments, the modification comprises a deletion of 25 to 90, 30 to 90, 40 to 90, 50 to 90, 60 to 90, 70 to 90, or 80 to 90 consecutive nucleotides.

[0295] In some embodiments, the modification comprises a deletion of 25, 35, 45, 55, 65, 75, 85, 95, 100, 105, 115, 124, 135, 145, 155, 205, 255, 305, 355, 405, or 455 nucleotides or more. In some embodiments, the modification comprises a deletion of about 25, about 35, about 45, about 55, about 65, about 75, about 85, about 95, about 100, or about 105 nucleotides or more. In some embodiments, the modification comprises a deletion of 25, 35, 45, 55, 65, 75, 85, 95, 100, 105, 115, 124, 135, 145, 155, 205, 255, 305, 355, 405, or 455 consecutive nucleotides or more. In some embodiments, the modification comprises a deletion of about 25, about 35, about 45, about 55, about 65, about 75, about 85, about 95, about 100, or about 105 consecutive nucleotides or more.

[0296] In some embodiments, the modification comprises a deletion of each of the nucleotides between the first and second cleavage sites, and in some embodiments, the deletion comprises one or both of the protospacer adjacent motif (PAM) sites recognized by the first or second cleavage site.

[0297] In some embodiments, the modification reduces or eliminates expression of one or more mRNAs or proteins.

[0298] In some embodiments, the modification reduces or eliminates expression of one or more mRNAs by at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the modification reduces or eliminates expression of one or more proteins by at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0299] In some embodiments, the modification increases expression of one or more RNAs or proteins. In some embodiments, the modification increases expression of one or more mRNAs by at least two-fold, at least three-fold, or at least four-fold, or at least five-fold. In some embodiments, the modification increases expression of one or more proteins by at least two-fold, at least three-fold, or at least four-fold, or at least five-fold.

[0300] In some embodiments, the methods and compositions disclosed herein are used to reduce or eliminate expression of one or more target proteins in a cell population, hi some embodiments, the cell population is at least 55%, 60%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% negative for the target protein as compared to an unmodified cell population, as measured by flow cytometry.

[0301] In some embodiments, the methods and compositions disclosed herein are used to increase expression of one or more target proteins in a cell population, hi some embodiments, the cell population is at least 55%, 60%, 65%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% positive for the target protein as compared to an unmodified cell population, as measured by flow cytometry.

[0302] In some embodiments, the modification deletes a start codon. In some embodiments, the modification deletes a splice site. In some embodiments, the modification deletes a splicing enhancer. In some embodiments, the modification deletes a splicing repressor. In some embodiments, the modification deletes a transcription factor binding site.

[0303] A. Intein-mediated fusion proteins In some embodiments, the compositions disclosed herein comprise: (a) a first polynucleotide comprising an ORF encoding a first polypeptide, the first polypeptide comprising a first cleavase and a first intein; and (b) a second polynucleotide comprising an ORF encoding a second polypeptide, the first polypeptide being linked to the second polypeptide via an intein catalyst.

[0304] In some embodiments, a method for providing a modification to the genome of a target cell is provided, the method comprising: (a) contacting the cell with a first polypeptide or a nucleic acid encoding the first polypeptide; (b) contacting the cell with a second polypeptide or a nucleic acid encoding the first polypeptide, wherein the second polypeptide comprises a second cleavase and a second intein capable of binding to the first intein, and the first polypeptide is bound to the second polypeptide via intein catalysis; (c) contacting the cell with a first guide RNA that directs the first cleavase to a first genomic locus; and (d) contacting the cell with a second guide RNA that directs the second cleavase to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

[0305] In some embodiments, the first polypeptide comprises, from N-terminus to C-terminus, a first intein, a first cleavage that is a S. pyogenes (Spy) Cas9 cleavage that comprises an R1333K mutation in the protospacer adjacent motif recognition domain, and a first NLS that comprises an SV40 NLS.

[0306] In some embodiments, the second polypeptide comprises, from N-terminus to C-terminus, a second NLS comprising an SV40 NLS, a third NLS comprising a nucleoplasmic NLS, a second cleavase, a peptide linker, optionally comprising 41 or 81 amino acid residues, and a second intein capable of binding to the first intein.

[0307] In some embodiments, the first polypeptide comprises the amino acid sequence of SEQ ID NO:28 or 31, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:28 or 31.

[0308] In some embodiments, the nucleic acid encoding the first polypeptide(s) comprises the sequence of SEQ ID NO: 27 or 30, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 27 or 30.

[0309] In some embodiments, the second polypeptide comprises the amino acid sequence of SEQ ID NO:25 or 34, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:25 or 34. In some embodiments, the nucleic acid encoding the polypeptide(s) comprises the sequence of SEQ ID NO:24 or 33, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:24 or 33.

[0310] IV. Additional Features The following sections describe additional features of the Cas9 cleavase, fusion proteins, nucleic acids encoding the same, guide RNAs, and compositions disclosed herein. In any of the embodiments described herein, the nucleic acid(s) can be one or more expression constructs comprising a promoter operably linked to multiple polypeptides comprising an ORF encoding a Cas9 cleavase or a fusion protein disclosed herein.

[0311] A. Codon Optimization In some embodiments, a nucleic acid encoding a polypeptide(s) comprising a first cleavase, a second cleavase, or a fusion protein disclosed herein comprises one or more ORFs comprising one or more codon-optimized nucleic acid sequences. In some embodiments, the codon-optimized nucleic acid sequences comprise minimal adenine codons and / or minimal uridine codons.

[0312] A given ORF can have a reduced adenine or adenine dinucleotide content, for example, by using minimal adenine codons in a sufficient portion of the ORF. For example, one or more amino acid sequences of a first cleavase, a second cleavase, or a fusion protein described herein can be reverse-translated into one or more ORF sequences by converting amino acids to codons, with some or all of the ORFs using the exemplary minimal adenine codons shown below. In some embodiments, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% of the codons in the ORF are those listed in Table 1A. [Table 2]

[0313] In some embodiments, the ORF(s) may consist of a set of codons in which at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% of the codons are those listed in Table 2.

[0314] To the extent feasible, any of the above features regarding low adenine content can be combined with any of the above features regarding low uridine content. The same applies to uridine and adenine dinucleotides. Similarly, the content of uridine nucleotides and adenine dinucleotides in the ORF(s) is as described above. Similarly, the content of uridine dinucleotides and adenine nucleotides in the ORF(s) is as described above.

[0315] In some cases, the uridine content or uridine dinucleotide content of a given ORF can be reduced, for example, by using minimal uridine codons in a sufficient portion of the ORF. In other cases, the uridine and adenine nucleotide or dinucleotide content of a given ORF can be reduced, for example, by using minimal uridine and adenine codons in a sufficient portion of the ORF. For example, one or more amino acid sequences of a first cleavase, a second cleavase, or a fusion protein disclosed herein can be reverse-translated into an ORF sequence by converting amino acids to codons, whereby part or all of one or more ORFs use minimal uridine codons or minimal uridine and adenine codons. Exemplary minimal uridine codons or exemplary minimal uridine and adenine codons can be found in WO.

[0316] In some embodiments, the ORF can include codons that increase translation in a mammal, such as a human. In further embodiments, the ORF is an mRNA and includes codons that increase translation in a mammal, e.g., a human organ, such as the liver. In further embodiments, the ORF can have codons that increase translation in a cell type, such as a mammalian (e.g., human) hepatocyte. The increase in translation in a mammal, cell type, mammalian organ, human, human organ, etc. can be determined relative to the range of translation of the wild-type sequence of the ORF, or relative to an ORF with a codon distribution that matches the codon distribution of the organism from which the ORF is derived, or the organism that contains the most similar ORF at the amino acid level. In some embodiments, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest-expressing tRNAs for each amino acid) in a mammal, e.g., a human. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the codons in the ORF correspond to tRNAs highly expressed in a mammalian organ, such as a human organ (e.g., the most highly expressed tRNA for each amino acid). Alternatively, codons corresponding to RNAs highly expressed in organisms generally (e.g., humans) can be used.

[0317] Any of the aforementioned codon selection approaches can be combined with a minimal number of uridine or adenine codons, e.g., starting with the codons in Table 1. If multiple options are available, generally use codons corresponding to highly expressed tRNAs in either the organism (e.g., human) or organ or cell type of interest (e.g., human liver or human hepatocytes).

[0318] In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the codons in an ORF are from a codon set shown in Table 1B (e.g., a low U1, low A, or low A / U codon set). The codons in the low U1, low G, low A, and low A / U sets use codons that minimize the specified nucleotides, as well as codons that correspond to highly expressed tRNAs if multiple options are available. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the codons in an ORF are from a low U1 codon set shown in Table 1B. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the codons in an ORF are from the low A codon set shown in Table 1 B. In some embodiments, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the codons in an ORF are from the low A / U codon set shown in Table 1 B. [Table 3]

[0319] B. Heterologous Functional Domains In some embodiments, a heterologous functional domain may alter the intracellular half-life of a fusion protein disclosed herein. In some embodiments, the half-life of a fusion protein disclosed herein may be extended. In some embodiments, the half-life of a fusion protein disclosed herein may be shortened. In some embodiments, a heterologous functional domain may increase the stability of a fusion protein disclosed herein. In some embodiments, a heterologous functional domain may decrease the stability of a fusion protein disclosed herein. In some embodiments, a heterologous functional domain may function as a signal peptide for protein degradation. In some embodiments, protein degradation may be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, a heterologous functional domain may comprise a PEST sequence. In some embodiments, a polypeptide may be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene 15 (ISG15)), ubiquitin-related modifier 1 (URM1), developmentally downregulated protein expressed by neural progenitor cells 8 (NEDD8, also known as Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy 8 (ATG8) and 12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier 1 (UFM1), and ubiquitin-like protein 5 (UBL5).

[0320] In some embodiments, the heterologous functional domain can be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain can be a fluorescent protein. Known fluorescent proteins, such as GFP, YFP, EBFP, ECFP, DsRed, or other suitable fluorescent proteins, can be used as the marker domain. In some embodiments, the marker domain can be a purification tag or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. In some embodiments, the marker domain can be a reporter gene. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, or fluorescent protein.

[0321] In additional embodiments, the heterologous functional domain can direct the fusion proteins disclosed herein to a particular organelle, cell type, tissue, or organ, hi some embodiments, the heterologous functional domain can direct the fusion proteins disclosed herein to mitochondria.

[0322] C.UTR, Kozak sequence In some embodiments, a nucleic acid (e.g., mRNA) disclosed herein comprises the 5' UTR, 3' UTR, or 5' and 3' UTRs from hydroxysteroid 17beta dehydrogenase 4 (HSD17B4 or HSD) or a globin, such as human alpha globin (HBA), human beta globin (HBB), Xenopus beta globin (XBG), bovine growth hormone, cytomegalovirus (CMV), mouse Hba-al, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta actin, alpha tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0323] In some embodiments, the nucleic acids described herein do not include a 5' UTR, e.g., there are no additional nucleotides between the 5' cap and the start codon. In some embodiments, the nucleic acids include a Kozak sequence (described below) between the 5' cap and the start codon, but do not include any additional 5' UTR. In some embodiments, the nucleic acids do not include a 3' UTR, e.g., there are no additional nucleotides between the stop codon and the polyA tail.

[0324] In some embodiments, the polynucleotide comprises a 5' UTR having at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 398-405. In some embodiments, the polynucleotide comprises a 3' UTR having at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 406-413. In some embodiments, the polynucleotide comprises a 5' UTR and a 3' UTR from the same source.

[0325] In some embodiments, the nucleic acids herein comprise a Kozak sequence. The Kozak sequence can affect translation initiation and the overall yield of polypeptides translated from the mRNA. The Kozak sequence includes a methionine codon that functions as the start codon. A minimal Kozak sequence is NNNRUGN (SEQ ID NO:417), where at least one of the following is true: the first N is A or G, the second N is G, and, in the context of the nucleotide sequence, R denotes a purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN (SEQ ID NO:418), NNNRUGG (SEQ ID NO:419), RNNRUGG (SEQ ID NO:420), RNNAUGN (SEQ ID NO:421), NNNAUGG (SEQ ID NO:422), RNNAUGG (SEQ ID NO:423), or GCCACCAAUG (SEQ ID NO:424).

[0326] D. Poly A tail In some embodiments, the nucleic acids disclosed herein further comprise a polyadenylation (polyA) tail. The polyA tail can comprise at least eight consecutive adenine nucleotides, but can also comprise one or more non-adenine nucleotides. As used herein, "non-adenine nucleotides" refers to natural or non-natural nucleotides that do not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, the polyA tail on a nucleic acid described herein can comprise consecutive adenine nucleotides located 3' of the nucleotides encoding the polypeptide of interest. In some cases, the polyA tail on a nucleic acid comprises non-consecutive adenine nucleotides located 3' of the nucleotides encoding the polypeptide, with the non-adenine nucleotides interrupting the adenine nucleotides at regular or irregular intervals.

[0327] In some embodiments, the polyA tail is encoded on a plasmid used for in vitro transcription of mRNA and becomes part of the transcript. The polyA sequence encoded on the plasmid, i.e., the number of consecutive adenine nucleotides in the polyA sequence, may not be precise; for example, 100 polyA sequences in the plasmid may not produce exactly 100 polyA sequences in the transcribed mRNA. In some embodiments, the polyA tail is not encoded on the plasmid but is added by PCR tailing or enzyme tailing, such as E. coli poly(A) polymerase.

[0328] In some embodiments, one or more non-adenine nucleotides are positioned to interrupt consecutive adenine nucleotides, allowing poly(A) binding proteins to bind to the stretch of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotide(s) are positioned after at least 8, at least 9, at least 10, at least 11, or at least 12 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after 8 to 50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after 8 to 100 consecutive adenine nucleotides.

[0329] In some embodiments, the poly-A tail comprises or contains one non-adenine nucleotide or one contiguous stretch of 2-10 non-adenine nucleotides.

[0330] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some cases, when one or more non-adenine nucleotides are present, the non-adenine nucleotides can be selected from a) guanine and thymine nucleotides, b) guanine and cytosine nucleotides, c) thymine and cytosine nucleotides, or d) guanine, thymine, and cytosine nucleotides.

[0331] E. Modified Nucleotides In some embodiments, the nucleic acids disclosed herein contain modified uridines at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, for example, with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, for example, with a C1-C3 alkyl. The modified uridine can be, for example, pseudouridine, N1-methylpseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof.

[0332] In some embodiments, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the uridine positions in the nucleic acids disclosed herein are modified uridines. In some embodiments, 10%-25%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 90%-100% of the uridine positions in an mRNA disclosed herein are modified uridines, e.g., 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or a combination thereof. In some embodiments, 80%-95% or 80%-100% of the uridine positions in an mRNA disclosed herein are modified uridines, e.g., 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or a combination thereof.

[0333] In some embodiments, at least 10% of the uridines are substituted with modified uridines. In some embodiments, 15% to 45% of the uridines are substituted with modified uridines. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the uridines are substituted with modified uridines.

[0334] In some embodiments, at least 85% of the uridines are substituted with modified uridines.

[0335] In some embodiments, the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, or 5-iodouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, at least 85% of the uridines are substituted with modified uridines. In some embodiments, 100% of the uridines are substituted with modified uridines.

[0336] F.5' Cap In some embodiments, the nucleic acids disclosed herein include a 5' cap, e.g., Cap0, Cap1, or Cap2. The 5' cap is typically a 7-methylguanine ribonucleotide (which may be further modified, e.g., as described below with respect to ARCA), attached via a 5' triphosphate to the 5' position of the first nucleotide of the 5'-to-3' strand of the nucleic acid, i.e., the first cap-proximal nucleotide. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both include a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the nucleic acid include a 2'-methoxy and a 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the nucleic acid both include a 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic nucleic acids, including mammalian nucleic acids, e.g., human nucleic acids, contain Cap1 or Cap2. Cap0 and other cap structures distinct from Cap1 and Cap2 can be immunogenic in mammals, e.g., humans, because they are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, and can lead to elevated levels of cytokines, including type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, may also compete with eIF4E to bind to nucleic acids with caps other than Cap1 or Cap2, potentially inhibiting nucleic acid translation.

[0337] A cap can also be included co-transcriptionally. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide and can be incorporated into transcripts in vitro at initiation. ARCA results in a Cap0 cap or Cap0-like cap in which the 2' position of the first cap-proximal nucleotide is hydroxyl. See, for example, Stepinski et al. (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486-1495. The structure of ARCA is shown below. [ka]

[0338] To obtain the Cap1 construct by co-transcription, CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG, TriLink Biotechnologies catalog number N-7133) can be used. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies under catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. CleanCap™ constructs are sometimes referred to herein using the last three digits of the above model numbers (e.g., "CleanCap™ 113" for TriLink Biotechnologies model number N-7113). [ka]

[0339] Alternatively, a cap can be added to RNA post-transcriptionally. For example, vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S), which possesses RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit and a guanine methyltransferase activity provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, it can add 7-methylguanine to RNA to yield Cap0. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For a detailed discussion of caps and capping approaches, see, for example, WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-130.

[0340] V. Guide RNA In some embodiments, the fusion protein disclosed herein comprises (a) a first cleavase and a guide RNA (gRNA) that targets a first genomic locus and is cognate to the first cleavase; and (b) a second cleavase and a gRNA that targets a second genomic locus and is cognate to the second cleavase, wherein the first genomic locus is different from the second genomic locus.

[0341] In some embodiments, the first gRNA that is cognate with the first cleavage is not cognate with the second cleavage. In some embodiments, the second gRNA that is cognate with the second cleavage is not cognate with the first cleavage.

[0342] A. Target Sequences and Genes In some embodiments, the methods and compositions of the disclosure utilize a guide RNA-guided orthogonal Cas9-Cas9 fusion system to excise a sequence between a first cleavage site cleaved by a first Cas9 cleavage site and a second cleavage site cleaved by a second Cas9 cleavage site.

[0343] For example, a target sequence can be recognized and cleaved by a Cas nuclease. In some embodiments, the target sequence of a Cas nuclease is near the nuclease's corresponding PAM sequence. In some embodiments, a Class 2 Cas nuclease is guided to a gene's target sequence by a gRNA, the gRNA hybridizes to the target sequence, and a Class 2 Cas protein cleaves the target sequence. In some embodiments, a guide RNA hybridizes, and the Class 2 Cas nuclease cleaves the target sequence adjacent to or including the cognate PAM. In some embodiments, the target sequence can be complementary to the target sequence of the guide RNA. In some embodiments, the degree of complementarity between the target sequence of the guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA can be about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or 100%. In some embodiments, the percent identity between the target sequence of the guide RNA and the portion of the corresponding target sequence that hybridizes to the guide RNA can be about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or 100%. In some embodiments, the homologous region of the target is adjacent to the cognate PAM sequence. In some embodiments, the target sequence can comprise a sequence that is 100% complementary to the target sequence of the guide RNA. In other embodiments, the target sequence can comprise at least one mismatch, deletion, or insertion compared to the target sequence of the guide RNA.

[0344] The length of the target sequence may vary depending on the nuclease system used. For example, the target sequence of a guide RNA in a CRISPR / Cas system may comprise a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, with the target sequence being of the corresponding length and optionally flanked by a PAM sequence. In some embodiments, the target sequence may comprise 15-24 nucleotides in length. In some embodiments, the target sequence may comprise 17-21 nucleotides in length. In some embodiments, the target sequence may comprise 20 nucleotides in length. In some embodiments, the target sequence may comprise 24 nucleotides in length. In some embodiments, the target sequence may comprise a portion of the target sequence recognized by one or more Cas nucleases.

[0345] The target nucleic acid molecule can be any DNA or RNA molecule that is endogenous or exogenous to a cell.In some embodiments, the target nucleic acid molecule can be episomal DNA, plasmid, genomic DNA, viral genome, or chromosomal DNA.In some embodiments, the target sequence of a gene can be a genomic sequence in a cell or cell, including a human cell.

[0346] In further embodiments, the target sequence may be a viral sequence. In further embodiments, the target sequence may be a pathogen sequence. In yet other embodiments, the target sequence may be a synthetic sequence. In further embodiments, the target sequence may be a chromosomal sequence. In certain embodiments, the target sequence may include a translocation junction, such as, for example, a translocation associated with cancer. In some embodiments, the target sequence may be on a eukaryotic chromosome, such as a human chromosome.

[0347] In some embodiments, the target sequence may be located at a genomic locus, e.g., the target sequence may be located in a coding sequence of a gene, an intron sequence of a gene, a regulatory sequence, a transcriptional control sequence of a gene, a translational control sequence of a gene, a splice site, or a non-coding sequence between genes (e.g., intergenic space). In some embodiments, the gene may be a protein-coding gene. In some embodiments, the gene may be a non-coding RNA gene. In some embodiments, the target sequence may comprise all or a portion of a disease-associated gene. In some embodiments, the target sequence may be located at a non-gene functional site within the genome, e.g., a site that controls aspects of chromatin organization, such as a scaffold site or locus control region.

[0348] In some embodiments involving Cas nucleases, such as Class 2 Cas nucleases, the target sequence may be adjacent to a protospacer adjacent motif ("PAM"). In some embodiments, the PAM can be located adjacent to or within 1, 2, 3, or 4 nucleotides of the 3' end of the target sequence. The length and sequence of the PAM may vary depending on the Cas protein used. For example, the PAM can be selected from consensus or specific PAM sequences for specific Spy Cas9 proteins or Spy Cas9 orthologs, including those disclosed in Figure 1 of Ran et al., Nature, 520:186-191 (2015) and Figure S5 of Zetsche 2015, the relevant disclosures of each of which are incorporated herein by reference. In some embodiments, the PAM is 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NGG, NGGNG, NG, NAAAAN, NNAAAAW, NNNNACA, GNNNCNNA, TTN, and NNNNGATT (where N is defined as any nucleotide and W is defined as either A or T). In some embodiments, the PAM sequence can be NGG. In some embodiments, the PAM sequence can be NGGNG. In some embodiments, the PAM sequence can be TTN. In some embodiments, the PAM sequence can be NNAAAAW.

[0349] In some embodiments, the PAM can be selected from consensus or specific PAM sequences for a particular NmeCas9 protein or NmeCas9 ortholog (Edraki et al., 2019). In some embodiments, the NmeCas9 PAM can comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NCC, N4GAYW, N4GYTT, N4GTCT, NNNNCC(a), and NNNNCAAA (where N is defined as any nucleotide, W is defined as either A or T, R is defined as either A or G, and (a) preferably, but not necessarily, an A after the second C). In some embodiments, the PAM sequence can be NCC.

[0350] In one embodiment, the PAM can be selected from consensus or specific PAM sequences of other Class II-C Cas9 orthologs. In some embodiments, the SmuCas9 PAM can include 1 to 4 required nucleotides selected from the group consisting of N4CN3, N4CT, N4CCN, N4CCA, and N4GNT3. In one embodiment, the required 1 to 4 nucleotides are selected from the group consisting of C, CT, CCN, CCA, CN3, and GNT2. In one embodiment, Type II-C Cas9 is linked to a truncated sgRNA.

[0351] In some embodiments, the first gRNA cognate to the first cleavase or the second gRNA cognate to the second cleavase comprises at least one single guide RNA (sgRNA). In some embodiments, the first gRNA cognate to the first cleavase or the second gRNA cognate to the second cleavase is a short single guide RNA (short sgRNA) that includes a conserved portion of the sgRNA, including a hairpin region, where the hairpin region lacks at least 5-10 nucleotides, and the short sgRNA includes a 5' end modification, a 3' end modification, or both.

[0352] B. Guide RNA In some embodiments, the first guide RNA is a SpyCas9 guide RNA. In the case of a Spy single guide RNA (sgRNA), the guide sequence described above can further include additional nucleotides to form the sgRNA, such as the following exemplary nucleotide sequence in the 5' to 3' direction following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 161).

[0353] In the case of an sgRNA, the guide sequence described above can further include additional nucleotides to form the sgRNA, for example, any one of the following exemplary nucleotide sequences following the 3' end of the guide sequence in the 5' to 3' direction: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 160), or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGGUGCU (SEQ ID NO: 165).

[0354] For sgRNAs, guide sequences can incorporate the following modified motif: mN*mN*mN*NNNNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 192), where "N" can be any natural or unnatural nucleotide, preferably an RNA nucleotide; the sugar moiety of the nucleotide can be ribose, deoxyribose, or a similar compound having a substituent; m is a 2'-O-methyl modified nucleotide; * is a phosphorothioate linkage to the adjacent nucleotide residue; and where the N's together represent the nucleotide sequence of the guide sequence. In the context of modified sequences, unless otherwise specified, A, C, G, N, and U are unmodified RNA nucleotides, i.e., a 2'-OH sugar moiety bearing a phosphodiesterase linkage to the adjacent nucleotide residue, or a 5'-terminal PO4.

[0355] In the case of an sgRNA, the guide sequence may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in Table 39 (SEQ ID NO: 161: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUCGGUGC - "exemplary SpyCas9 sgRNA-1"), which is included at the 3' end of the guide sequence, and the domains are provided as shown in Table 39 below. LS is the lower stem. B is the bulge. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 together are referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069, which is incorporated herein by reference.

[0356] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can serve as a template sequence for specific chemical modifications, sequence substitutions, and cleavage.

[0357] In certain embodiments, the gRNA is, for example, an sgRNA or a dgRNA, and optionally includes chemical modifications. In some embodiments, the modified sgRNA includes a guide sequence and a SpyCas9 sgRNA sequence (e.g., SpyCas9 sgRNA-1). The gRNA (e.g., sgRNA) can include modifications at the 5' end of the guide sequence or the 3' end of the SpyCas9 sgRNA sequence (e.g., in the exemplary SpyCas9 sgRNA-1, at one or more of the terminal nucleotides, e.g., one, two, three, or four of the 3'- or 5'-terminal nucleotides). In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-O-Me) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, or inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide. In certain embodiments, the modified nucleotide comprises a PS linkage. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide and a PS linkage.

[0358] In certain embodiments, using SEQ ID NO: 161 ("exemplary SpyCas9 sgRNA-1") as an example, the exemplary SpyCas9 sgRNA-1 comprises: (A) a shortened hairpin 1 region, or a substituted, optionally shortened hairpin 1 region ((1) in hairpin 1, at least one of the nucleotide pairs H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9 is substituted with a Watson-Crick paired nucleotide, and the hairpin 1 region optionally comprises: (a) a shortened hairpin 1 region; (b) one, two, or three of the nucleotide pairs H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9; or (c) one to eight nucleotides of the hairpin 1 region; or (2) the truncated hairpin 1 region lacks four to eight nucleotides, preferably four to six nucleotides; or (b) one or more of positions H1-1, H1-2, or H1-3 have been deleted or substituted relative to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 161); or (c) one or more of positions H1-6 through H1-10 have been substituted relative to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 161); or (d) a shortened hairpin 1 region lacking 5 to 10 nucleotides, preferably 5 to 6 nucleotides, and one or more of positions N18, H1-12, or n have been substituted relative to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 161); or (e) a shortened upper stem region (the shortened upper stem region lacks 1 to 6 nucleotides, and 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region are substituted relative to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 161). (C) an exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 161) containing no more than four substitutions; or (D) an exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 161) containing substitutions in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14 (wherein the substitution nucleotide is not a pyrimidine followed by an adenine or an adenine preceded by a pyrimidine), orsgRNA-1 (SEQ ID NO: 161) (the upper stem modifications include modifications to any one or more of US1-US12 in the upper stem region, and (1) the modified nucleotides are optionally selected from 2'-O-methyl (2'-O-Me) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof, or (2) the modified nucleotides optionally include 2'-OMe modified nucleotides).

[0359] In some embodiments, the unmodified sgRNA comprises the following sequence: (N) 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (SEQ ID NO: 176), or (N) 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGCU (SEQ ID NO: 177).

[0360] In some embodiments, the sgRNA comprises a modified motif disclosed herein, including any of the modified motifs shown in Tables 2B, 2C, 3B, and 4, where guide RNA, or "N" can be any natural or unnatural nucleotide, but is preferably an RNA nucleotide, the sugar moiety of the nucleotide can be ribose, deoxyribose, or a similar compound having a substituent group, m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage to the adjacent nucleotide residue, and N's collectively represent the nucleotide sequence of the guide sequence.

[0361] In the context of modified sequences, unless otherwise specified, A, C, G, N, and U are unmodified RNA nucleotides, i.e., a 2'-OH sugar moiety with a phosphodiester linkage to the adjacent nucleotide residue, or a 5'-terminal PO4.

[0362] In some embodiments, the first guide RNA that guides the first cleavage site to the first genomic locus is a SpyCas9 guide RNA. In some embodiments, the SpyCas9 guide RNA is a single guide RNA that includes a conserved portion of an sgRNA, including an upper stem region and a hairpin region, where each nucleotide in the upper stem region is 2'-O-Me modified and each nucleotide in the hairpin region is 2'-O-Me modified, a 3'-end modification comprising 2'-O-Me modified nucleotides in the last three nucleotides of the 3'-end and a phosphorothioate (PS) linkage between the last four nucleotides of the 3'-end, a 5'-end modification comprising 2'-O-Me modified nucleotides in the first three nucleotides of the 5'-end, and a phosphorothioate (PS) linkage between the first four nucleotides of the 5'-end.

[0363] In some embodiments, the SpyCas9 guide RNA is a short single guide RNA (short sgRNA) that includes the conserved portion of the sgRNA, including the hairpin region, where the hairpin region lacks at least 5-10 nucleotides, and the short sgRNA includes either (i) a 5' end modification or (ii) a 3' end modification.

[0364] In some embodiments, the first guide RNA is a SpyCas9 guide RNA, which is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 159-167, 170-177, and 180-194, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NOs: 159-167, 170-177, and 180-194.

[0365] In some embodiments, the sgRNA comprises the exemplary SpyCas9 sgRNA-1, or a modified version thereof described herein, or a version described in Table 2B, where the entire N comprises a guide sequence that directs the nuclease to the target sequence. Each N is independently modified or unmodified. In certain embodiments, in the absence of indications of modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone. [Table 4] [Table 5] where N are collectively the guide sequences provided herein. In the context of the unmodified sequences in the tables, A, C, G, U, and N are each independently any natural or unnatural adenine, cytosine, guanine, uracil, and any nucleotide (e.g., A, C, G, or U). [Table 6-1] [Table 6-2] where "m" indicates a 2'-O-Me modification, "f" indicates a 2'-fluoro modification, "*" indicates a phosphorothioate linkage between nucleotides, and the absence of a modification in the context of a modified sequence indicates the presence of an RNA (2'-OH) and a phosphodiesterase linkage to the 3' nucleotide.

[0366] In certain embodiments, the guide sequence is a chemically modified sequence. In certain embodiments, the chemically modified guide sequence is (mN*)3(N)13-17. In certain embodiments, the guide sequence is (mN*)3(N)17, i.e., mN*mN*mN*NNNNNNNNNNNNNNNNNNN. In certain embodiments, each N in (N)13-17 or (N)17 is unmodified. In certain embodiments, each N in (N)13-17 or (N)17 is independently modified, for example, independently modified with a 2'-O-methyl modification. In some embodiments, sgRNAs disclosed herein can be modified as shown herein or to the sequence mN*mN*mN*NNNNNNNNNNNNNNNN GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 193). In some embodiments, sgRNAs disclosed herein can be modified as shown herein or to the sequence mN*mN*mN*NNNNNNNNNNNNNNNN GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 194).

[0367] In some embodiments, the guide RNA is a Campylobacter jejuni Cas9 ("CjeCas9") guide RNA. In some embodiments, the guide RNA is a modified CjeCas9 guide RNA.

[0368] In some embodiments, the guide RNA is a Simonsiella muelleri Cas9 ("SmuCas9") guide RNA. In some embodiments, the guide RNA is a modified SmuCas9 guide RNA.

[0369] In some embodiments, the second guide RNA disclosed herein is an NmeCas9 guide RNA. In some embodiments, the second guide RNA is an NmeCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 280-297, or a nucleotide sequence at least 85%, at least 90%, or at least 95% identical to SEQ ID NOs: 280-297. In some embodiments, the second guide comprises one or more internal polyethylene glycol (PEG) linkers. In some embodiments, the second guide RNA comprising an internal linker comprises a sequence selected from SEQ ID NOs: 161-169.

[0370] In some embodiments, using SEQ ID NO:279 ("exemplary NmeCas9 sgRNA-1") as an example, the exemplary NmeCas9 sgRNA-1 comprises (A) a guide RNA (gRNA) comprising a guide region and a conserved region, the conserved region being either (a) a truncated repeat / anti-repeat region (the truncated repeat / anti-repeat region lacking 2-24 nucleotides, (i) one or more of nucleotides 37-48 and 53-64 relative to SEQ ID NO:279, deleted, and optionally one or more of nucleotides 37-64 substituted; (ii) nucleotide 36 is connected to nucleotide 65 by at least two nucleotides), or (b) a truncated hairpin 1 region (the truncated hairpin 1 region lacking 2-10 nucleotides, optionally 2-8 nucleotides, (i) one or more of nucleotides 82-86 and 91-95 relative to SEQ ID NO:279, deleted, and optionally one or more of nucleotides 82-86 and 91-95 substituted). (ii) nucleotide 81 is connected to nucleotide 96 by at least four nucleotides), or (c) a truncated hairpin 2 region (the truncated hairpin 2 region lacks 2 to 18 nucleotides, optionally 2 to 16 nucleotides, and includes one or more of: (i) one or more of nucleotides 113-121 and 126-134 deleted relative to SEQ ID NO:279, optionally with a substitution of one or more of nucleotides 113-134; and (ii) nucleotide 112 is connected to nucleotide 135 by at least four nucleotides, optionally with a deletion of one or both of nucleotides 144-145 relative to SEQ ID NO:279, and optionally with at least 10 nucleotides being modified nucleotides).

[0371] Nucleotide sequences of exemplary unmodified conserved portions are provided in Table 3A.

[0372] For sgRNAs, the guide sequence can incorporate any of the following exemplary modified conserved moiety motifs, as shown in Table 3B:

[0373] In certain embodiments, the length of the guide sequence is 20-25 nucleotides ((N)20-25), and each nucleotide may be independently modified. In certain embodiments, nucleotides 1-3 at the 5' end of the guide are each independently modified. In certain embodiments, nucleotides 1-3 at the 5' end of the guide are each independently modified with a 2'-OMe modification. In certain embodiments, nucleotides 1-3 at the 5' end of the guide are each independently modified with a phosphorothioate linkage to the adjacent nucleotide residue. In certain embodiments, nucleotides 1-3 at the 5' end of the guide are each independently modified with a 2'-OMe modification and a phosphorothioate linkage to the adjacent nucleotide residue.

[0374] For sgRNAs, modified guide sequences can incorporate any of the following exemplary modified conserved moiety motifs, as shown in Table 3B:

[0375] In some embodiments, the guide RNA comprises an sgRNA comprising a guide region and a conserved portion of an sgRNA, such as the conserved portion of the sgRNA shown as exemplary NmeCas9 sgRNA-1, or the conserved portions of the gRNAs shown in Tables 3A-3B and throughout the specification.

[0376] In some embodiments, the sgRNA comprises the exemplary NmeCas9 sgRNA-1 or a modified version thereof described herein, or a version described in Table 3B. Each N is independently modified or unmodified. In certain embodiments, in the absence of indication of modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone. [Table 7] [Table 8-1] [Table 8-2] where "m" indicates a 2'-O-Me modification, "*" indicates an internucleotide phosphorothioate bond, and the absence of modification in the context of the modified sequence indicates RNA(2'-OH) and a phosphorothioate bond.

[0377] In certain embodiments, the guide sequence is a chemically modified sequence. In certain embodiments, the chemically modified guide sequence is (mN*)3(N)17-22. In certain embodiments, the guide sequence is (mN*)3(N)21, i.e., mN*mN*mN*NNNNNNNNNNNNNNNNNNNNNNN. In certain embodiments, each N in (N)17-22 or (N)21 is unmodified. In certain embodiments, each N in (N)18-21 or (N)21 is independently modified, for example, independently modified with a 2'-O-methyl modification.

[0378] The truncated NmeCas9 gRNA may contain an internal linker as disclosed herein. As used herein, "internal linker" describes a non-nucleotide segment that connects two nucleotides within a guide RNA. When a gRNA contains a guide region, the internal linker is located outside the spacer region (e.g., in the scaffold or conserved region of the gRNA). In the case of a Type V guide, it is understood that the last hairpin is the only hairpin in the structure, i.e., the repeat-antirepeat region. In some embodiments, the internal linker comprises a PEG-linker as disclosed herein. Exemplary locations of linkers are as follows: (N) 20-25GUUGUAGCUCCCUUC(L1)GACCGUUGCUACAAUAAGGCCGUC(L1)GAUGUGCCGCAACGCUCUGCC(L1)GGCAUCGUU (SEQ ID NO: 272). As used herein, (L1) refers to an internal linker having a bridge length of about 15-21 atoms. In some embodiments, the internal linker comprises a polyethylene glycol (PEG) linker. Guide RNAs comprising the internal linkers disclosed herein comprise one of the structure / modification patterns disclosed in WO2022 / 261292, the entire contents of which are incorporated herein by reference. Additional exemplary NmeGuide RNAs comprising linkers are provided in Table 4.

[0379] In some embodiments, truncated NmeCas9 guide RNAs containing internal linkers can be chemically modified as shown in Table 4. In certain embodiments, the guide sequence is a chemically modified sequence as shown in Table 4. [Table 9-1] [Table 9-2]

[0380] In certain embodiments, an sgRNA, such as the exemplary SpyCas9 sgRNA-1, or an sgRNA comprising the exemplary SpyCas9 sgRNA-1, comprises a 3' tail, e.g., a 3' tail of 1, 2, 3, 4, or more nucleotides. In certain embodiments, the tail comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe)-modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe)-modified nucleotides, 2'-fluoro (2'-F)-modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic-modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe-modified nucleotides. In certain embodiments, the modified nucleotides comprise an internucleotide PS linkage. In certain embodiments, the modified nucleotides comprise 2'-OMe-modified nucleotides and an internucleotide PS linkage.

[0381] In certain embodiments, the hairpin region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.

[0382] In certain embodiments, the upper stem region comprises one or more modified nucleotides. In certain embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.

[0383] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a modified nucleotide. In certain embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In certain embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide.

[0384] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a sequence replacement nucleotide, where the pyrimidine is replaced with a purine. In certain embodiments, if the pyrimidine forms a Watson-Crick base pair within a single guide, the Watson-Crick nucleotide of the sequence replacement pyrimidine nucleotide is replaced to maintain the Watson-Crick base pair.

[0385] In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA, denoting the presence of one or more non-natural or natural components or arrangements used in place of, or in addition to, the standard A, G, C, and U residues. In some embodiments, when a modified gRNA is synthesized with a non-standard nucleoside or nucleotide, it is referred to herein as "modified." Modified nucleosides and nucleotides can include one or more of the following: (i) an alteration, e.g., substitution, of one or both of the non-linked phosphate oxygens or one or more of the linked phosphate oxygens in the phosphodiester backbone linkage (exemplary backbone modifications); (ii) an alteration of a component of the ribose sugar, e.g., substitution of the 2' hydroxyl group of the ribose sugar (exemplary sugar modifications); (iii) a modification or substitution of a naturally occurring nucleobase, including with a non-standard nucleobase (exemplary base modifications); and (iv) a modification of the 3' or 5' end of the oligonucleotide to provide exonuclease stability, e.g., 2'O-me, 2' halide, or 2' deoxy substituted ribose, or an inverted abasic terminal nucleotide, or substitution of a phosphodiester with a phosphothioate.

[0386] Combining the above chemical modifications can provide modified gRNAs or mRNAs containing nucleosides and nucleotides (collectively "residues") that can have two, three, four, or more modifications. For example, modified residues can have modified sugars and modified nucleobases. In certain embodiments, all or substantially all of the phosphate groups of a gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs contain at least one modified residue at or near the 5' end of the RNA. In some embodiments, modified gRNAs contain at least one modified residue at or near the 3' end of the RNA.

[0387] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, preferably at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%) of the positions in the modified gRNA are modified nucleosides or nucleotides. In some embodiments, at least 5% of the positions in the modified guide RNA are modified nucleotides or nucleosides. In some embodiments, at least 10% of the positions in the modified guide RNA are modified nucleotides or nucleosides. In some embodiments, at least 15% of the positions in the modified gRNA are modified nucleotides or nucleosides. In some embodiments, preferably, at least 20% of the positions in the modified gRNA are modified nucleotides or nucleosides. In some embodiments, no more than 65% of the positions in the modified gRNA are modified nucleotides. In some embodiments, no more than 55% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 50% or less of the positions in the modified gRNA are modified nucleotides. In some embodiments, 10-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-50% of the positions in the modified gRNA are modified nucleotides and the nuclease is SpyCas9 nuclease. In some embodiments, 30-70% of the positions in the modified gRNA are modified nucleotides and the nuclease is NmeCas9 nuclease.

[0388] Unmodified nucleic acids may be susceptible to degradation, for example, by intracellular nucleases or nucleases found in serum. For example, nucleases can hydrolyze phosphodiester bonds in nucleic acids. Thus, in one aspect, the RNAs (e.g., mRNA, gRNA) described herein can contain one or more modified nucleosides or nucleotides to, for example, introduce stability against intracellular or serum nucleases. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a cell population, both in vivo and ex vivo. The term "innate immune response" includes a cellular response to exogenous nucleic acids, such as single-stranded nucleic acids, involving the expression and release of cytokines, particularly interferons, and the induction of cell death.

[0389] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, modified residues, such as modified residues present in modified nucleic acids, can include the replacement of unmodified phosphate moieties with modified phosphate groups as described herein. In some embodiments, backbone modification of the phosphate backbone can include alterations that result in either an uncharged linker or a charged linker with asymmetric charge distribution.

[0390] Examples of modified phosphate groups include phosphorothioates, boranophosphates, methylphosphonates, phosphoramidates, phosphodithioates, alkyl or aryl phosphonates, and phosphotriesters. The phosphorus atom of an unmodified phosphate group is achiral. However, the phosphorus atom can be chiralized by replacing any of the non-bridging oxygens with an atom or group of atoms. The stereogenic phosphorus atom can be in either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). The backbone can also be modified by replacing the bridging oxygen (i.e., the oxygen connecting the phosphate group to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), or carbon (bridging methylene phosphonates). Replacement can occur at either or both of the bonding oxygens.

[0391] In certain backbone modifications (e.g., amide bonds), the phosphate group can be replaced with a phosphorus-free connector. In some embodiments, the charged phosphate group can be replaced with a neutral moiety. Examples of moieties that can replace the phosphate group can include, but are not limited to, methylphosphonate, carboxymethyl, carbamate, amide, and thioether. Further examples of moieties that can replace the phosphate group can include, but are not limited to, ethylene oxide linkers, sulfonates, sulfonamides, thioformacetals, formacetals, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.

[0392] Scaffolds that can mimic nucleic acids can also be constructed by replacing the phosphate linker and ribose sugar with nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0393] Modified nucleosides and nucleotides can contain one or more modifications to the sugar group, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) can be modified, e.g., replaced with a number of different "oxy" or "deoxy" substituents. In some embodiments, modifying the 2' hydroxyl group improves the stability of the nucleic acid by deprotonating the hydroxyl so that it cannot form a 2'-alkoxide ion.

[0394] Examples of modifications of the 2' hydroxyl group include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO) n In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, replacing the 2' hydroxyl group with fluoride. In some embodiments, modifications of the 2' hydroxyl group can include "locked" nucleic acids (LNAs) in which the 2' hydroxyl can be linked to the 4' carbon of the same ribose sugar, for example, by a C1-6 alkylene or C1-6 heteroalkylene bridge; exemplary bridges are methylene, propylene, ether, or amino bridges, O-amino (where amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH2). n-amino (amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, modifications of the 2' hydroxyl group can include "unlocked" nucleic acids (UNA), in which the ribose ring lacks a C2' to C3' bond. In some embodiments, modifications of the 2' hydroxyl group can include a methoxyethyl group (MOE), (OCH2CHOCH3, e.g., PEG derivatives). 2' modifications can include hydrogen (i.e., deoxyribose sugars), halo (e.g., bromine, chlorine, fluorine, or iodo), amino (amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CH2CH2NH) n These may include CH2CH2-amino (wherein amino can be, for example, as described herein), -NHC(O)R (wherein R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkylthioalkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which can be, for example, optionally substituted with amino as described herein.

[0395] Sugar modifications can include sugar groups that can contain one or more carbons with the opposite stereochemical configuration to the corresponding carbons in ribose. Thus, modified nucleic acids can include nucleotides containing, for example, arabinose as the sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one L-sugar (e.g., an L-nucleoside). As used herein, a single abasic sugar is not considered to cause a duplex discontinuity.

[0396] In certain embodiments, 2' modifications include, for example, 2'-OMe, 2'-F, 2'-H, and optionally, 2'-O-Me.

[0397] The modified nucleosides and modified nucleotides described herein can be incorporated into modified nucleic acids and can include modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring and synthetic derivatives of bases.

[0398] In embodiments, when dual guide RNAs are used, modifications can be included in each of the crRNA and tracr RNA. Such modifications can be made to one or both ends of the crRNA or tracr RNA. In embodiments involving an sgRNA, one or more residues at one or both ends of the sgRNA can be chemically modified, or internal nucleosides can be modified, or the entire sgRNA can be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. Certain embodiments include 5'-end and 3'-end modifications.

[0399] In some embodiments, the guide RNAs disclosed herein comprise one of the modification patterns disclosed in WO2018 / 107028, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNAs disclosed herein comprise one of the structure / modification patterns disclosed in US20170114334, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNAs disclosed herein comprise one of the structure / modification patterns disclosed in WO2017 / 136794, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNAs disclosed herein comprise one of the structure / modification patterns disclosed in WO2019 / 237069, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNAs disclosed herein comprise one of the structure / modification patterns disclosed in WO2021 / 119275, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNAs disclosed herein comprise one of the structure / modification patterns disclosed in PCT / US2022 / 079121, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNAs disclosed herein comprise one of the structure / modification patterns disclosed in WO2022 / 261292, the entire contents of which are incorporated herein by reference.

[0400] VI. Delivery The following sections describe additional features of lipid-based delivery compositions, including lipid nanoparticles (LNPs) and lipoplexes, for the nucleic acids described herein or nucleic acids encoding the polypeptides disclosed herein. In some embodiments, the nucleic acid or nucleic acid encoding it is delivered to a cell via at least one lipid nanoparticle (LNP).

[0401] In some embodiments, LNP refers to lipid nanoparticles with a diameter of less than 100 nM, or a population of LNPs with an average diameter of less than 100 nM. In certain embodiments, LNPs have a diameter of about 1-250 nm, about 10-200 nm, about 20-150 nm, about 50-150 nm, about 50-100 nm, about 50-120 nm, about 60-100 nm, about 75-150 nm, about 75-120 nm, or about 75-100 nm, or the average diameter of a population of LNPs is about 10-200 nm, about 20-150 nm, about 50-150 nm, about 50-100 nm, about 50-120 nm, about 60-100 nm, about 75-150 nm, about 75-120 nm, or about 75-100 nm. In preferred embodiments, LNP compositions have a diameter of 75-150 nm.

[0402] LNPs are formed by precisely mixing a lipid component (e.g., in ethanol) with an aqueous nucleic acid component, and the size of the LNPs is uniform. Lipoplexes are particles formed by mixing lipid and nucleic acid components in large quantities and range in size from approximately 100 nm to 1 micron. In certain embodiments, the lipid-nucleic acid assembly is an LNP. As used herein, a "lipid-nucleic acid assembly" comprises multiple (i.e., one or more) lipid molecules physically bound to each other by intermolecular forces. Lipid-nucleic acid assemblies may contain bioavailable lipids with pKa values ​​<7.5 or <7. Lipid-nucleic acid assemblies are formed by mixing a nucleic acid-containing aqueous solution with an organic solvent-based lipid solution (e.g., 100% ethanol). Suitable solutions or solvents can include water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethyl ether, cyclohexane, tetrahydrofuran, methanol, and isopropanol. A pharmaceutically acceptable buffer may optionally be included in a pharmaceutical formulation containing a lipid-nucleic acid assembly, for example, for ex vivo ACT therapy. In some embodiments, the aqueous solution comprises RNA, such as mRNA or gRNA, hi some embodiments, the aqueous solution comprises mRNA encoding an RNA-guided DNA-binding agent, such as Cas9.

[0403] In some embodiments, lipid nucleic acid assembly formulations include "amine lipids" (sometimes referred to herein or elsewhere as "ionizable lipids" or "biodegradable lipids"), along with optional "helper lipids," "neutral lipids," and stealth lipids such as PEG lipids. In some embodiments, the amine lipids or ionizable lipids become cationic depending on pH.

[0404] A. Amine lipids In some embodiments, the LNPs comprise an ionizable lipid, such as lipid A, or lipid D, or equivalents thereof, including acetal analogs of lipid A or lipid D.

[0405] In some embodiments, the ionizable lipid is lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate. Lipid A can be represented as follows: [ka]

[0406] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84-86). In some embodiments, the amine lipid is lipid A or an amine lipid described in WO2020 / 219876, which is incorporated herein by reference.

[0407] In some embodiments, the ionizable lipid is an analog of lipid A. In some embodiments, the lipid A analog is an acetal analog of lipid A. Particularly for LNPs, the acetal analog is C4-C 12In some embodiments, the acetal analog is a C5-C 12 In additional embodiments, the acetal analog is a C5-C 10 In a further embodiment, the acetal analog is a C4, C5, C6, C7, C9, C 10 , C 11 , and C 12 acetal analogs.

[0408] In some embodiments, the ionizable lipid is a compound having the structure of formula IA: [ka] During the ceremony, X 1A is O, NH, or a direct bond, X 2A is C 2~3 is alkylene, R 3A is C 1~3 is alkyl, R 2A is C 1~3 alkyl, or R 2A is the nitrogen atom to which it is attached and X 2A together with 2 or 3 carbon atoms to form a 5- or 6-membered ring, or R 2A is R 3A and together with the nitrogen atom to which it is attached form a five-membered ring, Y 1A is C 6~10 is alkylene, Y 2A teeth, [ka] is selected from R 4A is C 4~11 is alkyl, Z 1A is C 2~5 is alkylene, Z2A teeth, [ka] or not present, R 5A is C 6~8 Alkyl or C 6~8 is an alkoxy, R 6A is C 6~8 Alkyl or C 6~8 Kokishi, or a salt thereof.

[0409] In some embodiments, the amine lipid is a compound of formula (IIA): [ka] During the ceremony, X 1A is O, NH, or a direct bond, X 2A is C 2~3 is alkylene, Z 1A is a C3 alkylene, and R 5A and R 6A are each C6 alkyl, or Z 1A is a direct bond, and R 5A and R 6A are each C8 alkoxy, R 8A teeth, [ka] or a salt thereof.

[0410] In certain embodiments, X 1A is O. In other embodiments, X 1A is NH. In yet another embodiment, X 1A is a direct bond.

[0411] In certain embodiments, X 2A is C alkylene. In certain embodiments, X2A is a C2 alkylene.

[0412] In certain embodiments, Z 1A is a direct bond, and R 5A and R 6A and each is C alkoxy. In another embodiment, Z 1A is a C3 alkylene, and R 5A and R 6A are each C6 alkyl.

[0413] In certain embodiments, R 8A teeth, [ka] In other embodiments, R 8A teeth, [ka] is.

[0414] In certain embodiments, the amine lipid is a salt.

[0415] Representative compounds of formula (IA) are: [ka] [ka] [ka] [ka] [ka] or a salt thereof, for example, a pharmaceutically acceptable salt thereof.

[0416] In some embodiments, the amine lipid is lipid D, which is nonyl 8-((7,7-bis(octyloxy)heptyl)(2-hydroxyethyl)amino)octanoate. [ka] or a salt thereof.

[0417] Lipid D can be synthesized according to WO2020072605 and Mol. Ther. 2018, 26(6), 1509-1519 ("Sabnis"), the entire contents of which are incorporated herein by reference. In some embodiments, the amine lipid is lipid D, or an amine lipid described in WO2020072605, which is incorporated herein by reference.

[0418] In some embodiments, the amine lipid is a compound having the structure of formula IB: [ka] During the ceremony, X 1B is C 6~7 is alkylene, X 2B teeth, [ka] or not present, X 2B but [ka] In the case of R 2B is not an alkoxy, Z 1B is C 2~3 is alkylene, Z 2B is selected from -OH, -NHC(=O)OCH3, and -NHS(=O)2CH3; R 1B is C 7~9 is an unbranched alkyl; Each R 2Bare independently C8 alkyl or C8 alkoxy, or a salt thereof.

[0419] In some embodiments, the amine lipid is a compound of formula (IIB): [ka] During the ceremony, X 1B is C 6~7 is alkylene, Z 1B is C 2~3 is alkylene, R 1B is C 7~9 is an unbranched alkyl; Each R 2B is a C8 alkyl, or a salt thereof.

[0420] In certain embodiments, X 1B is C alkylene. In other embodiments, X 1B is a C7 alkylene.

[0421] In certain embodiments, Z 1B is a direct bond, and R 5B and R 6B and each is C alkoxy. In another embodiment, Z 1B is a C alkylene, and R and R 6B are each C6 alkyl.

[0422] In certain embodiments, X 2B teeth, [ka] and R 2B is not alkoxy. 2B does not exist.

[0423] In certain embodiments, Z 1B is C alkylene, and in other embodiments, Z1B is a C3 alkylene.

[0424] In certain embodiments, Z 2B is —OH. In another embodiment, Z 2B is —NHC(═O)OCH 3 . In another embodiment, Z 2B is -NHS(=O)2CH3.

[0425] In certain embodiments, R 1B is a C7 unbranched alkylene. In other embodiments, R 1B is a C8 branched or unbranched alkylene. In other embodiments, R 1B is a C9 branched or unbranched alkylene.

[0426] In certain embodiments, the amine lipid is a salt.

[0427] Representative compounds of formula (IB) are: [ka] [ka] or a salt thereof, for example, a pharmaceutically acceptable salt thereof.

[0428] Amine lipids and other "biodegradable lipids" suitable for use in the lipid-nucleic acid assemblies described herein are biodegradable in vivo or in vitro. Amine lipids have low toxicity (e.g., are tolerated in animal models at doses of 10 mg / kg or greater without adverse effects). In some embodiments, lipid-nucleic acid assemblies comprising amine lipids include those in which at least 75% of the amine lipid is cleared from plasma or genetically engineered cells within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In some embodiments, lipid-nucleic acid assemblies comprising amine lipids include those in which at least 50% of the nucleic acid, e.g., mRNA or gRNA, is cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In some embodiments, lipid nucleic acid assemblies comprising amine lipids include those in which at least 50% of the lipid nucleic acid assemblies are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days, e.g., by measuring lipid (e.g., amine lipid), nucleic acid (e.g., RNA / mRNA), or other components. In some embodiments, lipid-encapsulated versus free lipid, RNA, or nucleic acid components of the lipid nucleic acid assemblies are measured.

[0429] Biodegradable lipids include those described in, for example, WO2020 / 219876 (e.g., pages 13-33, 66-87), WO2020 / 118041, WO2020 / 072605 (e.g., pages 5-12, 21-29, 61-68), WO2019 / 067992, WO2017 / 173054, WO2017 / 173054, and WO2014 / 136086, and LNPs include LNP compositions described in these documents, and those lipids and compositions are incorporated herein by reference.

[0430] Lipid clearance can be measured as described in the literature. See Maier, MA, et al. Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics. Mol. Ther. 2013, 21(8), 1570-78 ("Maier"). For example, in Maier, an LNP-siRNA system containing siRNA targeting luciferase was administered to 6-8 week-old male C57Bl / 6 mice via intravenous bolus injection at 0.3 mg / kg via the lateral tail vein. Blood, liver, and spleen samples were collected at 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours post-administration. Mice were perfused with saline before tissue collection, and blood samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. Furthermore, Maier describes procedures for assessing the toxicity of LNP-siRNA formulations after administration. For example, 0, 1, 3, 5, or 10 mg / kg (5 animals / group) of siRNA targeting luciferase was administered to male Sprague-Dawley rats by a single intravenous bolus injection at a dose of 5 mL / kg. After 24 hours, approximately 1 mL of blood was collected from the jugular vein of conscious animals, and serum was separated. Seventy-two hours after administration, all animals were euthanized for necropsy. Clinical signs, body weight, serum chemistry, organ weight, and histopathology were evaluated. While Maier describes methods for evaluating siRNA-LNP formulations, these methods can also be applied to assess the clearance, pharmacokinetics, and toxicity of the LNPs of the present disclosure.

[0431] Ionizable lipids and biodegradable lipids known in the art for LNP delivery of nucleic acids are suitable.Lipids can be ionized depending on the pH of the medium they are contained in.For example, in a slightly acidic medium, lipids such as amine lipids can be protonated and positively charged.On the other hand, in a slightly basic medium such as blood, whose pH is about 7.35, lipids such as amine lipids can be unprotonated and uncharged.

[0432] The ability of a lipid to carry a charge is related to its inherent pKa. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.1 to about 7.4. In some embodiments, the biodegradable lipids of the present disclosure may each independently have a pKa in the range of about 5.1 to about 7.4, e.g., about 5.5 to about 6.6, about 5.6 to about 6.4, about 5.8 to about 6.2, or about 5.8 to about 6.5. For example, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.8 to about 6.5. Lipids with a pKa in the range of about 5.1 to about 7.4 are effective for delivering cargo in vivo, for example, to the liver. Furthermore, lipids with a pKa in the range of about 5.3 to about 6.4 have been shown to be effective for delivery in vivo, for example, to tumors. See, e.g., WO2014 / 136086.

[0433] B. Additional lipids Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, a variety of neutral lipids, uncharged lipids, or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PMP ...

[0039] Examples of suitable phosphatidylcholine include, but are not limited to, palmitoyl oleoyl phosphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine, distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC).

[0434] "Helper lipids" include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid can be cholesterol. In one embodiment, the helper lipid can be cholesterol hemisuccinate.

[0435] A "stealth lipid" is a lipid that alters the time a nanoparticle can persist in vivo (e.g., in the bloodstream). Stealth lipids can aid in the formulation process, for example, by reducing particle aggregation or controlling particle size. Stealth lipids used herein can modulate the pharmacokinetic properties of lipid-nucleic acid assemblies or aid in the stability of nanoparticles in vitro. Stealth lipids suitable for use in the lipid compositions of the present disclosure include, but are not limited to, stealth lipids having a hydrophilic head group attached to the lipid moiety. Stealth lipids suitable for use in the lipid compositions of the present disclosure, as well as information regarding the biochemistry of such lipids, are described in Romberg et al., Pharmaceutical Research, Vol. 25, No. 1, 2008, pp. 55-71 and Hoekstra et al., Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG-lipids are disclosed, for example, in WO 2006 / 007712.

[0436] In one embodiment, the hydrophilic head group of the stealth lipid comprises a polymer moiety selected from PEG-based polymers. The stealth lipid may comprise a lipid moiety. In some embodiments, the stealth lipid is a PEG-lipid.

[0437] In one embodiment, the stealth lipid comprises a polymer moiety selected from polymers based on PEG (sometimes called poly(ethylene oxide)), poly(ethylene oxide), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyamino acids, and poly[N-(2-hydroxypropyl)methacrylamide].

[0438] In one embodiment, the PEG lipid comprises a polymer moiety based on PEG (sometimes referred to as poly(ethylene oxide)).

[0439] The PEG-lipid further comprises a lipid moiety. In some embodiments, the lipid moiety may be derived from a diacylglycerol or diacylglycamide, including those comprising a dialkylglycerol or dialkylglycamide group having an alkyl chain length independently containing from about C4 to about C40 saturated or unsaturated carbon atoms, the chain may include one or more functional groups, such as amides or esters. In some embodiments, the alkyl chain length includes from about C10 to C20. The dialkylglycerol or dialkylglycamide group may further include one or more substituted alkyl groups. The chain length may be symmetric or asymmetric.

[0440] Unless otherwise specified, the term "PEG," as used herein, refers to polyethylene glycol or other polyalkylene ether polymer. In one embodiment, PEG is an optionally substituted linear or branched polymer of ethylene glycol or ethylene oxide. In one embodiment, PEG is unsubstituted. In one embodiment, PEG is substituted, for example, with one or more alkyl, alkoxy, acyl, hydroxy, or aryl groups. In one embodiment, the term includes PEG copolymers, such as PEG-polyurethane or PEG-polypropylene (see, e.g., J. Milton Harris, Poly(ethylene glycol) chemistry: biotechnical and biomedical applications (1992)). In another embodiment, the term does not include PEG copolymers. In one embodiment, the PEG has a molecular weight of about 130 to about 50,000, in one subembodiment, about 150 to about 30,000, in one subembodiment, about 150 to about 20,000, in one subembodiment, about 150 to about 15,000, in one subembodiment, about 150 to about 10,000, in one subembodiment, about 150 to about 6,000, in one subembodiment, about 150 to about 5,000, in one subembodiment, about 150 to about 4,000, in one subembodiment, about 150 to about 3,000, in one subembodiment, about 300 to about 3,000, in one subembodiment, about 1,000 to about 3,000, and in one subembodiment, about 1,500 to about 2,500.

[0441] In some embodiments, the PEG (e.g., attached to a lipid moiety or lipid (e.g., a stealth lipid)) is "PEG-2K," also known as "PEG 2000," which has an average molecular weight of about 2,000 daltons. PEG-2K is represented herein by formula (IV) below, where n is 45, meaning that the number-average degree of polymerization comprises about 45 subunits. [ka]

[0442] However, other PEG embodiments known in the art can also be used, including, for example, those having a number-average degree of polymerization of about 23 subunits (n=23) or 68 subunits (n=68). In some embodiments, n can range from about 30 to about 60. In some embodiments, n can range from about 35 to about 55. In some embodiments, n can range from about 40 to about 50. In some embodiments, n can range from about 42 to about 48. In some embodiments, n can be 45. In some embodiments, R can be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R can be unsubstituted alkyl. In some embodiments, R can be methyl.

[0443] In any embodiment described herein, the PEG lipid may be PEG-dilauroylglycerol, PEG-dimyristoylglycerol (PEG-DMG catalog number GM-020, from NOF, Tokyo, Japan), e.g., 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000 (PEG2k-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (catalog number DSPE-020CN, NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristoylglycerol, PEG-dimyristoylglycerol (PEG-DMG catalog number GM-020, from NOF, Tokyo, Japan), e.g., 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000 (PEG2k-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (catalog number DSPE-020CN, from NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristoylglycerol, PEG-dimyristoylglycerol (PEG-DSPE) (catalog number DSPE-020CN, from NOF, Tokyo, Japan), ..., PEG-dimyristoylglycerol (PEG-DSPE) (catalog number DSPE-020CN, from NOF, Tokyo, Japan Listylglycamide, PEG-dipalmitoylglycamide, PEG-distearoylglycamide, PEG-cholesterol (1-[8'-(cholest-5-en-3[β]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxybenzyl-[ω]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMPE) (Cat. no. 880150P, from Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (Cat. no. 880120C, Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG, GS-020, NOF Tokyo, Japan), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one embodiment, the PEG lipid can be 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000. In one embodiment, the PEG lipid can be PEG2k-DMG.In some embodiments, the PEG lipid can be PEG2k-DSG. In one embodiment, the PEG lipid can be PEG2k-DSPE. In one embodiment, the PEG lipid can be PEG2k-DMA. In one embodiment, the PEG lipid can be PEG2k-C-DMA. In one embodiment, the PEG lipid can be compound S027 disclosed in WO2016 / 010840 (paragraphs

[0240] to

[0244] ). In one embodiment, the PEG lipid can be PEG2k-DSA. In one embodiment, the PEG lipid can be PEG2k-C11. In some embodiments, the PEG lipid can be PEG2k-C14. In some embodiments, the PEG lipid can be PEG2k-C16. In some embodiments, the PEG lipid can be PEG2k-C18.

[0444] In some embodiments, the PEG lipid comprises a glycerol group. In some embodiments, the PEG lipid comprises a dimyristoylglycerol (DMG) group. In some embodiments, the PEG lipid comprises PEG-2k. In some embodiments, the PEG lipid is PEG-DMG. In some embodiments, the PEG lipid is PEG-2k-DMG. In some embodiments, the PEG lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000. In some embodiments, the PEG-2k-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000.

[0445] C. Lipid Nanoparticles (LNPs) The LNP can contain (i) a biodegradable lipid, (ii) an optional neutral lipid, (iii) a helper lipid, and (iv) a stealth lipid such as a PEG lipid. The lipid-nucleic acid assembly can contain a biodegradable lipid and one or more of a neutral lipid, a helper lipid, and a stealth lipid such as a PEG lipid.

[0446] The lipid-nucleic acid assembly may contain (i) an amine lipid for encapsulation and endosomal escape, (ii) a neutral lipid for stabilization, (iii) a helper lipid, also for stabilization, and (iv) a stealth lipid, such as a PEG lipid. The lipid-nucleic acid assembly may contain an amine lipid and one or more of a neutral lipid, a helper lipid for stabilization, and a stealth lipid, such as a PEG lipid.

[0447] LNPs may include a nucleic acid (e.g., RNA) component comprising one or more of an RNA-guided DNA binder, a Cas nuclease mRNA, a Class 2 Cas nuclease mRNA, a Cas9 mRNA, and a gRNA. In some embodiments, LNPs may include a Class 2 Cas nuclease and a gRNA as the RNA component. In some embodiments, LNPs may include an RNA component, an amine lipid, a helper lipid, a neutral lipid, and a stealth lipid. In certain LNPs, the helper lipid is cholesterol. In other compositions, the neutral lipid is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, LNPs include lipid A or an equivalent of lipid A, a helper lipid, a neutral lipid, a stealth lipid, and an RNA such as a gRNA. In some embodiments, LNPs include lipid A or an equivalent of lipid A, a helper lipid, a stealth lipid, and an RNA such as a gRNA. In some compositions, the amine lipid is lipid A. In some compositions, the amine lipid is lipid A or an acetal analog thereof, the helper lipid is cholesterol, the neutral lipid is DSPC, and the stealth lipid is PEG2k-DMG.

[0448] In some embodiments, lipid compositions are described according to the respective molar ratios of component lipids in the formulation. Embodiments of the present disclosure provide lipid compositions described according to the respective molar ratios of component lipids in the formulation. In one embodiment, the molar % of amine lipids can be about 30 mol% to about 60 mol%. In one embodiment, the molar % of amine lipids can be about 40 mol% to about 60 mol%. In one embodiment, the molar % of amine lipids can be about 45 mol% to about 60 mol%. In one embodiment, the molar % of amine lipids can be about 50 mol% to about 60 mol%. In one embodiment, the molar % of amine lipids can be about 55 mol% to about 60 mol%. In one embodiment, the molar % of amine lipids can be about 50 mol% to about 55 mol%. In one embodiment, the molar % of amine lipids can be about 50 mol%. In one embodiment, the molar % of amine lipids can be about 55 mol%. In some embodiments, the amine lipid mole % of a lipid nucleic acid assembly batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mole %. In some embodiments, the amine lipid mole % of a lipid nucleic acid assembly batch is ±4 mole %, ±3 mole %, ±2 mole %, ±1.5 mole %, ±1 mole %, ±0.5 mole %, or ±0.25 mole % of the target mole %. All mole % values ​​are expressed as a percentage of the lipid component of the LNP. In some embodiments, the lot-to-lot variation of the amine lipid mole % of the lipid nucleic acid assembly is less than 15%, less than 10%, or less than 5%.

[0449] In one embodiment, the mole % of neutral lipids can be about 5 mole % to about 15 mole %. In one embodiment, the mole % of neutral lipids can be about 7 mole % to about 12 mole %. In one embodiment, the mole % of neutral lipids can be about 9 mole %. In some embodiments, the neutral lipid mole % of a lipid nucleic acid assembly batch will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target neutral lipid mole %. In some embodiments, the lot-to-lot variation of lipid nucleic acid assembly will be less than 15%, less than 10%, or less than 5%.

[0450] In one embodiment, the mole % of helper lipids can be about 20 mole % to about 60 mole %. In one embodiment, the mole % of helper lipids can be about 25 mole % to about 55 mole %. In one embodiment, the mole % of helper lipids can be about 25 mole % to about 50 mole %. In one embodiment, the mole % of helper lipids can be about 25 mole % to about 40 mole %. In one embodiment, the mole % of helper lipids can be about 30 mole % to about 50 mole %. In one embodiment, the mole % of helper lipids can be adjusted based on the concentrations of amine lipids, neutral lipids, and PEG lipids to achieve 100 mole % lipid components. In some embodiments, the helper mole % of the lipid-nucleic acid assembly batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mole %. In some embodiments, the lot-to-lot variation of lipid nucleic acid assemblies will be less than 15%, less than 10%, or less than 5%.

[0451] In one embodiment, the mole % of PEG lipids can be about 1 mole % to about 10 mole %. In one embodiment, the mole % of PEG lipids can be about 2 mole % to about 10 mole %. In one embodiment, the mole % of PEG lipids can be about 1 mole % to about 3 mole %. In one embodiment, the mole % of PEG lipids can be about 2 mole % to about 4 mole %. In one embodiment, the mole % of PEG lipids can be about 1.5 mole % to about 2 mole %. In one embodiment, the mole % of PEG lipids can be about 2.5 mole % to about 4 mole %. In one embodiment, the mole % of PEG lipids can be about 3 mole %. In one embodiment, the mole % of PEG lipids can be about 2.5 mole %. In one embodiment, the mole % of PEG lipids can be about 2 mole %. In one embodiment, the mole % of PEG lipids can be about 1.5 mole %. In some embodiments, the PEG lipid mole % of a lipid nucleic acid assembly batch will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target PEG lipid mole %. In some embodiments, the LNP, e.g., LNP composition, lot-to-lot variation will be less than 15%, less than 10%, or less than 5%.

[0452] Embodiments of the present disclosure provide LNP compositions, e.g., LNP compositions comprising an ionizable lipid (e.g., lipid A or one of its analogs), a helper lipid, and a PEG lipid, according to the respective molar ratios of the component lipids in the formulation. In certain embodiments, the amount of ionizable lipid is about 25 mol% to about 45 mol%, the amount of neutral lipid is about 10 mol% to about 30 mol%, the amount of helper lipid is about 25 mol% to about 65 mol%, and the amount of PEG lipid is about 1.5 mol% to about 3.5 mol%. In certain embodiments, the amount of ionizable lipid is about 29-44 mol% of the lipid component, the amount of neutral lipid is about 11-28 mol% of the lipid component, the amount of helper lipid is about 28-55 mol% of the lipid component, and the amount of PEG lipid is about 2.3-3.5 mol% of the lipid component. In certain embodiments, the amount of ionizable lipids is about 29-38 mol% of the lipid component, the amount of neutral lipids is about 11-20 mol% of the lipid component, the amount of helper lipids is about 43-55 mol% of the lipid component, and the amount of PEG lipids is about 2.3-2.7 mol% of the lipid component. In certain embodiments, the amount of ionizable lipids is about 25-34 mol% of the lipid component, the amount of neutral lipids is about 10-20 mol% of the lipid component, the amount of helper lipids is about 45-65 mol% of the lipid component, and the amount of PEG lipids is about 2.5-3.5 mol% of the lipid component. In certain embodiments, the amount of ionizable lipids is about 30-43 mol% of the lipid component, the amount of neutral lipids is about 10-17 mol% of the lipid component, the amount of helper lipids is about 43.5-56 mol% of the lipid component, and the amount of PEG lipids is about 1.5-3 mol% of the lipid component. In certain embodiments, the ionizable lipid is about 33 mol% of the lipid component, the amount of neutral lipid is about 15 mol% of the lipid component, the amount of helper lipid is about 49 mol% of the lipid component, and the amount of PEG lipid is about 3 mol% of the lipid component.In certain embodiments, the amount of ionizable lipid is about 32.9 mol% of the lipid composition, the amount of neutral lipid is about 15.2 mol% of the lipid composition, the amount of helper lipid is about 49.2 mol% of the lipid composition, and the amount of PEG lipid is about 2.7 mol% of the lipid composition.

[0453] In certain embodiments, the amount of ionizable lipid (e.g., lipid A or one of its analogs) is about 20-50 mol%, about 25-34 mol%, about 25-38 mol%, about 25-45 mol%, about 29-38 mol%, about 29-43 mol%, about 29-34 mol%, about 30-34 mol%, about 30-38 mol%, about 30-43 mol%, about 30-43 mol%, or about 33 mol%. In certain embodiments, the amount of neutral lipid is about 10-30 mol%, about 11-30 mol%, about 11-20 mol%, about 13-17 mol%, or about 15 mol%. In certain embodiments, the amount of helper lipid is about 35-50 mol%, about 35-65 mol%, about 35-55 mol%, about 38-50 mol%, about 38-55 mol%, about 38-65 mol%, about 40-50 mol%, about 40-65 mol%, about 43-65 mol%, about 43-55 mol%, or about 49 mol%. In certain embodiments, the amount of PEG lipid is about 1.5-3.5 mol%, about 2.0-2.7 mol%, about 2.0-3.5 mol%, about 2.3-3.5 mol%, about 2.3-2.7 mol%, about 2.5-3.5 mol%, about 2.5-2.7 mol%, about 2.9-3.5 mol%, or about 2.7 mol%.

[0454] Other embodiments of the present disclosure provide LNP compositions, such as LNP compositions comprising an ionizable lipid (e.g., lipid D or one of its analogs), a helper lipid, and a PEG lipid, according to the molar ratios of each of the component lipids in the formulation. In certain embodiments, the amount of ionizable lipid is about 25 mol% to about 50 mol%, the amount of neutral lipid is about 7 mol% to about 25 mol%, the amount of helper lipid is about 39 mol% to about 65 mol%, and the amount of PEG lipid is about 0.5 mol% to about 1.8 mol%. In certain embodiments, the amount of ionizable lipid is about 27-40 mol% of the lipid component, the amount of neutral lipid is about 10-20 mol% of the lipid component, the amount of helper lipid is about 50-60 mol% of the lipid component, and the amount of PEG lipid is about 0.9-1.6 mol% of the lipid component. In certain embodiments, the amount of ionizable lipids is about 30-45 mol% of the lipid composition, the amount of neutral lipids is about 10-15 mol% of the lipid composition, the amount of helper lipids is about 39-59 mol% of the lipid composition, and the amount of PEG lipids is about 1-1.5 mol% of the lipid composition. In certain embodiments, the amount of ionizable lipids is about 30-45 mol% of the lipid composition, the amount of neutral lipids is about 10-15 mol% of the lipid composition, the amount of helper lipids is about 39-59 mol% of the lipid composition, and the amount of PEG lipids is about 1-1.5 mol% of the lipid composition. In certain embodiments, the amount of ionizable lipids is about 30 mol% of the lipid composition, the amount of neutral lipids is about 10 mol% of the lipid composition, the amount of helper lipids is about 59 mol% of the lipid composition, and the amount of PEG lipids is about 1-1.5 mol% of the lipid composition. In certain embodiments, the amount of ionizable lipid is about 40 mol% of the lipid component, the amount of neutral lipid is about 15 mol% of the lipid component, the amount of helper lipid is about 43.5 mol% of the lipid component, and the amount of PEG lipid is about 1.5 mol% of the lipid component. In certain embodiments, the amount of ionizable lipid is about 50 mol% of the lipid component, the amount of neutral lipid is about 10 mol% of the lipid component, the amount of helper lipid is about 39 mol% of the lipid component, and the amount of PEG lipid is about 1 mol% of the lipid component.

[0455] In certain embodiments, the amount of ionizable lipid (e.g., lipid D or one of its analogs) is about 20-55 mol%, about 20-45 mol%, about 20-40 mol%, about 27-40 mol%, about 27-45 mol%, about 27-55 mol%, about 30-40 mol%, about 30-45 mol%, about 30-55 mol%, about 30 mol%, about 40 mol%, or about 50 mol%. In certain embodiments, the amount of neutral lipid is about 7-25 mol%, about 10-25 mol%, about 10-20 mol%, about 15-20 mol%, about 8-15 mol%, about 10-15 mol%, about 10 mol%, or about 15 mol%. In certain embodiments, the amount of helper lipid is about 39-65 mol%, about 39-59 mol%, about 40-60 mol%, about 40-65 mol%, about 40-59 mol%, about 43-65 mol%, about 43-60 mol%, about 43-59 mol%, about 50-65 mol%, about 50-59 mol%, about 59 mol%, or about 43.5 mol%. In certain embodiments, the amount of PEG lipid is about 0.5-1.8 mol%, about 0.8-1.6 mol%, about 0.8-1.5 mol%, 0.9-1.8 mol%, about 0.9-1.6 mol%, about 0.9-1.5 mol%, 1-1.8 mol%, about 1-1.6 mol%, about 1-1.5 mol%, about 1 mol%, or about 1.5 mol%.

[0456] In some embodiments, the cargo comprises an mRNA encoding an RNA-guided DNA binder (e.g., a Cas nuclease, a class 2 Cas nuclease, or Cas9), a gRNA, a nucleic acid encoding a gRNA, or a combination of an mRNA and a gRNA. In one embodiment, the LNP can comprise lipid A or an equivalent thereof, or an amine lipid provided in WO2020219876, or lipid D or an amine lipid provided in WO2020 / 072605. In some aspects, the amine lipid is lipid A or lipid D. In some aspects, the amine lipid is an equivalent of lipid A, e.g., an analog of lipid A, or an amine lipid provided in WO2020 / 219876. In certain aspects, the amine lipid is an acetal analog of lipid A, optionally an amine lipid described in WO2020 / 219876. In some aspects, the amine lipid is lipid D or an amine lipid described in WO2020 / 219876. In various embodiments, the LNPs comprise an amine lipid, a neutral lipid, a helper lipid, and a PEG lipid. In some embodiments, the helper lipid is cholesterol. In some embodiments, the neutral lipid is DSPC. In certain embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the LNPs can comprise lipid A, a helper lipid, a neutral lipid, and a PEG lipid. In some embodiments, the LNPs comprise an amine lipid, DSPC, cholesterol, and a PEG lipid. In some embodiments, the LNPs comprise a PEG lipid comprising DMG. In some embodiments, the amine lipid is selected from lipid A, an equivalent of lipid A including an acetal analog of lipid A, or an amine lipid described in WO2020 / 219876, or lipid D or an amine lipid described in WO2020 / 072605. In additional embodiments, the LNPs comprise lipid A, cholesterol, DSPC, and PEG2k-DMG. In additional embodiments, the LNPs comprise lipid D, cholesterol, DSPC, and PEG2k-DMG.

[0457] Embodiments of the present disclosure also provide lipid compositions described according to the molar ratio of the positively charged amine groups (N) of the amine lipids to the negatively charged phosphate groups (P) of the nucleic acid to be encapsulated. This can be mathematically expressed as N / P. In some embodiments, LNPs can include a lipid component comprising an amine lipid, a helper lipid, a neutral lipid, and a helper lipid, and a nucleic acid component, with an N / P ratio of about 3 to 10. In some embodiments, LNPs can have an amine lipid to RNA / DNA phosphate molar ratio (N:P) of about 4.5, 5.0, 5.5, 6.0, or 6.5. In some embodiments, LNPs can include a lipid component comprising an amine lipid, a helper lipid, a neutral lipid, and a helper lipid, and an RNA component, with an N / P ratio of about 3 to 10. In one embodiment, the N / P ratio can be about 5 to 7. In one embodiment, the N / P ratio can be about 4.5 to 8. In one embodiment, the N / P ratio can be about 6. In one embodiment, the N / P ratio can be 6±1. In one embodiment, the N / P ratio can be about 6±0.5. In some embodiments, the N / P ratio will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target N / P ratio. In some embodiments, the lot-to-lot variation of lipid nucleic acid assembly will be less than 15%, less than 10%, or less than 5%.

[0458] In some embodiments, the lipid nucleic acid assembly comprises an RNA component, which may comprise an mRNA, such as an mRNA encoding a Cas nuclease. In one embodiment, the RNA component may comprise a Cas9 mRNA. In some compositions comprising an mRNA encoding a Cas nuclease, the lipid nucleic acid assembly further comprises a gRNA nucleic acid, such as a gRNA. In some embodiments, the RNA component comprises a Cas nuclease mRNA and a gRNA. In some embodiments, the RNA component comprises a Class 2 Cas nuclease mRNA and a gRNA.

[0459] In some embodiments, LNPs can comprise an mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In certain LNPs comprising an mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the helper lipid is cholesterol. In other compositions comprising an mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the neutral lipid is DSPC. In additional embodiments comprising an mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain compositions comprising an mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the amine lipid is selected from lipid A and its equivalents, e.g., acetal analogs of lipid A, or the amine lipids provided in WO2020 / 219876, or lipid D, or the amine lipids provided in WO2020 / 072605.

[0460] In some embodiments, the LNPs can include a gRNA. In some embodiments, the LNPs can include an amine lipid, a gRNA, a helper lipid, a neutral lipid, and a PEG lipid. In certain LNPs containing a gRNA, the helper lipid is cholesterol. In some compositions containing a gRNA, the neutral lipid is DSPC. In additional embodiments containing a gRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, the amine lipid is selected from lipid A and its equivalents (e.g., acetal analogs of lipid A), or the amine lipids and their equivalents described in WO2020 / 219876, or lipid D or the amine lipids and their equivalents described in WO2020 / 072605.

[0461] In one embodiment, the LNPs may comprise an sgRNA. In one embodiment, the LNPs may comprise a Cas9 sgRNA. In one embodiment, the LNPs may comprise a Cpf1 sgRNA. In some compositions comprising an sgRNA, the lipid nucleic acid assembly comprises an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In certain compositions comprising an sgRNA, the helper lipid is cholesterol. In other compositions comprising an sgRNA, the neutral lipid is DSPC. In additional embodiments comprising an sgRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, the amine lipid is selected from lipid A and its equivalents (e.g., acetal analogs of lipid A, or the amine lipids described in WO2020 / 219876), or lipid D, or the amine lipids described in WO2020 / 072605.

[0462] In some embodiments, the LNPs comprise an mRNA encoding a Cas nuclease and a gRNA, which may be an sgRNA. In one embodiment, the LNPs may comprise an amine lipid, an mRNA encoding a Cas nuclease, a gRNA, a helper lipid, a neutral lipid, and a PEG lipid. In certain compositions comprising an mRNA encoding a Cas nuclease and a gRNA, the helper lipid is cholesterol. In some compositions comprising an mRNA encoding a Cas nuclease and a gRNA, the neutral lipid is DSPC. In additional embodiments comprising an mRNA encoding a Cas nuclease and a gRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, the amine lipid is selected from lipid A and its equivalents (e.g., acetal analogs of lipid A, or the amine lipids described in WO2020 / 219876), lipid D, or the amine lipids described in WO2020 / 072605.

[0463] In some embodiments, the LNP comprises a Cas nuclease mRNA, e.g., a Class 2 Cas mRNA, and at least one gRNA. In some embodiments, the LNP comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 25:1 to about 1:25 wt / wt. In some embodiments, the lipid nucleic acid assembly formulation comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 10:1 to about 1:10. In some embodiments, the lipid nucleic acid assembly formulation comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 8:1 to about 1:8. Ratios measured herein are by weight. In some embodiments, the lipid nucleic acid assembly formulation comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas mRNA) ratio of about 5:1 to about 1:5. In some embodiments, the ratio is about 3:1 to 1:3, about 2:1 to 1:2, about 5:1 to 1:2, about 5:1 to 1:1, about 3:1 to 1:2, about 3:1 to 1:1, about 3:1, or about 2:1 to 1:1. In some embodiments, the ratio of gRNA to mRNA is about 3:1 or about 2:1. In some embodiments, the ratio of gRNA to Cas nuclease mRNA (e.g., Class 2 Cas nuclease) is about 1:1. In some embodiments, the ratio of gRNA to Cas nuclease mRNA (e.g., Class 2 Cas nuclease) is about 1:2. The ratio can be about 25:1, 10:1, 5:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:5, 1:10, or 1:25.

[0464] The LNPs disclosed herein may include a template nucleic acid. The template nucleic acid may be co-formulated with an mRNA encoding a Cas nuclease, such as a class 2 Cas nuclease mRNA. In some embodiments, the template nucleic acid may be co-formulated with a guide RNA. In some embodiments, the template nucleic acid may be co-formulated with both an mRNA encoding a Cas nuclease and a guide RNA. In some embodiments, the template nucleic acid may be formulated separately from the mRNA encoding the Cas nuclease or the guide RNA. The template nucleic acid may be delivered simultaneously with the LNP or separately from the LNP. In some embodiments, the template nucleic acid may be single-stranded or double-stranded, depending on the desired repair mechanism. The template may have a region of homology to the target DNA or a sequence adjacent to the target DNA.

[0465] In some embodiments, lipid-nucleic acid assemblies are formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution (e.g., 100% ethanol). Suitable solutions or solvents can include water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethyl ether, cyclohexane, tetrahydrofuran, methanol, and isopropanol. For example, any pharmaceutically acceptable buffer for in vivo administration of lipid-nucleic acid assemblies can be used. In some embodiments, a buffer is used to maintain the pH of a composition comprising lipid-nucleic acid assemblies at pH 6.5 or above. In some embodiments, a buffer is used to maintain the pH of a composition comprising lipid-nucleic acid assemblies at pH 7.0 or above. In some embodiments, the composition has a pH in the range of about 7.2 to about 7.7. In additional embodiments, the composition has a pH in the range of about 7.3 to about 7.7, or about 7.4 to about 7.6. In further embodiments, the composition has a pH of about 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7. The pH of the composition can be measured with a micro-pH probe. In some embodiments, a cryoprotectant is included in the composition. Non-limiting examples of cryoprotectants include sucrose, trehalose, glycerol, DMSO, and ethylene glycol. Exemplary compositions may include a cryoprotectant (up to 10%), such as sucrose. In some embodiments, the LNP may include about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% cryoprotectant. In some embodiments, the LNP may include about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% sucrose. In some embodiments, the LNP may include a buffer. In some embodiments, the buffer may include phosphate buffer (PBS), Tris buffer, citrate buffer, and mixtures thereof. In some exemplary embodiments, the buffer includes NaCl. In some embodiments, NaCl is omitted. Exemplary amounts of NaCl may range from about 20 mM to about 45 mM. Exemplary amounts of NaCl can range from about 40 mM to about 50 mM, hi some embodiments, the amount of NaCl is about 45 mM.In some embodiments, the buffer is a Tris buffer. Exemplary amounts of Tris can range from about 20 mM to about 60 mM. Exemplary amounts of Tris can range from about 40 mM to about 60 mM. In some embodiments, the amount of Tris is about 50 mM. In some embodiments, the buffer comprises NaCl and Tris. In certain exemplary embodiments of the LNP, the Tris buffer contains 5% sucrose and 45 mM NaCl. In other exemplary embodiments, the composition contains sucrose in an amount of about 5% w / v, about 45 mM NaCl, and about 50 mM Tris at pH 7.5. The amounts of salt, buffer, and cryoprotectant may be varied to maintain the osmolality of the entire formulation. For example, the final osmolality may be maintained below 450 mOsm / L. In further embodiments, the osmolality is between 350 and 250 mOsm / L. Certain embodiments have a final osmolality of 300±20 mOsm / L.

[0466] In some embodiments, microfluidic mixing, T-type mixing, or cross-mixing is used. In certain aspects, the flow rate, junction size, junction shape, junction geometry, tubing diameter, solution, or RNA and lipid concentrations can be varied. Lipid-nucleic acid assemblies or LNPs can be concentrated or purified by dialysis, tangential flow filtration, chromatography, or the like. Lipid-nucleic acid assemblies can be stored, for example, as a suspension, emulsion, or lyophilized powder. In some embodiments, LNPs are stored at 2-8°C, although in certain aspects, LNPs are stored at room temperature. In additional embodiments, LNPs are stored frozen, for example, at -20°C or -80°C. In other embodiments, LNPs are stored at temperatures ranging from about 0°C to about -80°C. Frozen LNPs can be thawed before use, such as on ice, at 4°C, room temperature, or 25°C. Frozen LNPs can be maintained at various temperatures, such as on ice, at 4°C, room temperature, 25°C, or 37°C.

[0467] In some embodiments, the concentration of LNP in the LNP composition is about 1-10 μg / mL, about 2-10 μg / mL, about 2.5-10 μg / mL, about 1-5 μg / mL, about 2-5 μg / mL, about 2.5-5 μg / mL, about 0.04 μg / mL, about 0.08 μg / mL, about 0.16 μg / mL, about 0.25 μg / mL, about 0.63 μg / mL, about 1.25 μg / mL, about 2.5 μg / mL, or about 5 μg / mL.

[0468] In some embodiments, the LNP comprises a stealth lipid, and optionally, (i) the LNPs comprise a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, e.g., lipid A or lipid D, about 8-10 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNPs is about 6; (ii) the LNPs comprise about 50-60 mol% amine lipids, e.g., lipid A or lipid D, about 27-39.5 mol% helper lipids, about 8-10 mol% neutral lipids, and about 2.5-4 mol% stealth lipids (e.g., PEG lipids), and the N / P ratio of the LNPs is about 5-7 (e.g., about 6); (iii) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, e.g., lipid A or lipid D, about 5-15 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP is about 3-10; (iv) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, e.g., lipid A or lipid D, about 5-15 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP is about 6; (v) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, e.g., lipid A or lipid D, about 5-15 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP is about 6; (vi) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, e.g., lipid A or lipid D, about 0-10 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP is about 3-10; (vii) the LNPs comprise a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, e.g., lipid A or lipid D, less than about 1 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNPs is about 3-10; (viii) the LNPs comprise a lipid component, the lipid component comprising about 40-60 mol % amine lipid, e.g., lipid A or lipid D, about 1.5-10 mol % stealth lipid (e.g., PEG lipid), the remainder of the lipid component being helper lipid, the N / P ratio of the LNP composition being about 3-10, and the LNPs essentially free of or free of neutral phospholipids; or (ix) The LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, e.g., lipid A or lipid D, about 8-10 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP is about 3-7.

[0469] In some embodiments, the LNPs comprise a lipid component comprising about 50 mol% amine lipid, e.g., lipid A or lipid D, about 9 mol% neutral lipid, e.g., DSPC, about 3 mol% stealth lipid, e.g., PEG lipid, e.g., PEG2k-DMG, and the remainder of the lipid component is a helper lipid, e.g., cholesterol, and the N / P ratio of the LNPs is about 6.

[0470] In some embodiments, the LNPs comprise a lipid component comprising about 50 mol% lipid A, about 9 mol% DSPC, about 3 mol% PEG2k-DMG, with the remainder of the lipid component being cholesterol, and the N / P ratio of the LNPs is about 6.

[0471] In some embodiments, the LNP comprises a lipid component comprising about 35 mol% lipid A, about 15 mol% neutral lipid, about 47.5 mol% helper lipid, and about 2.5 mol% stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP composition is about 3-7.

[0472] In some embodiments, the LNP comprises a lipid component comprising about 35 mol% lipid D, about 15 mol% neutral lipid, about 47.5 mol% helper lipid, and about 2.5 mol% stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP composition is about 3-7.

[0473] In some embodiments, the LNP comprises a lipid component comprising about 25-45 mol% amine lipid, e.g., lipid A, about 10-30 mol% neutral lipid, about 25-65 mol% helper lipid, and about 1.5-3.5 mol% stealth lipid (e.g., PEG lipid), wherein the N / P ratio of the LNP composition is about 3-7.

[0474] In some embodiments, the LNP comprises a lipid component, a. the amount of amine lipid is about 29-44 mol% of the lipid component, the amount of neutral lipid is about 11-28 mol% of the lipid component, the amount of helper lipid is about 28-55 mol% of the lipid component, and the amount of PEG lipid is about 2.3-3.5 mol% of the lipid component; b. the amount of amine lipid is about 29-38 mol% of the lipid composition, the amount of neutral lipid is about 11-20 mol% of the lipid composition, the amount of helper lipid is about 43-55 mol% of the lipid composition, and the amount of PEG lipid is about 2.3-2.7 mol% of the lipid composition; c. the amount of amine lipid is about 25-34 mol% of the lipid composition, the amount of neutral lipid is about 10-20 mol% of the lipid composition, the amount of helper lipid is about 45-65 mol% of the lipid composition, and the amount of PEG lipid is about 2.5-3.5 mol% of the lipid composition; or d. The amount of amine lipid is about 30-43 mol% of the lipid composition, the amount of neutral lipid is about 10-17 mol% of the lipid composition, the amount of helper lipid is about 43.5-56 mol% of the lipid composition, and the amount of PEG lipid is about 1.5-3 mol% of the lipid composition.

[0475] In some embodiments, the LNP comprises a lipid component comprising about 25-50 mol% amine lipid, e.g., lipid D, about 7-25 mol% neutral lipid, about 39-65 mol% helper lipid, and about 0.5-1.8 mol% stealth lipid (e.g., PEG lipid), wherein the N / P ratio of the LNP composition is about 3-7.

[0476] In some embodiments, the LNPs comprise a lipid component, and the amount of amine lipid is about 30-45 mol% of the lipid component, or about 30-40 mol% of the lipid component, optionally about 30 mol%, 40 mol%, or 50 mol% of the lipid component. In some embodiments, the LNPs comprise a lipid component, and the amount of neutral lipid is about 10-20 mol% of the lipid component, or about 10-15 mol% of the lipid component, optionally about 10 mol% or 15 mol% of the lipid component. In some embodiments, the LNPs comprise a lipid component, and the amount of helper lipid is about 50-60 mol% of the lipid component, about 39-59 mol%, or about 43.5-59 mol% of the lipid component, optionally about 59 mol%, about 43.5 mol%, or about 39 mol% of the lipid component. In some embodiments, the LNP comprises a lipid component, and the amount of PEG-lipid is about 0.9-1.6 mol% of the lipid component, or about 1-1.5 mol% of the lipid component, optionally about 1 mol% of the lipid component, or about 1.5 mol% of the lipid component.

[0477] In some embodiments, the LNP comprises a lipid component, a. The amount of ionizable lipid is about 27-40 mol% of the lipid composition, the amount of neutral lipid is about 10-20 mol% of the lipid composition, the amount of helper lipid is about 50-60 mol% of the lipid composition, and the amount of PEG lipid is about 0.9-1.6 mol% of the lipid composition; b. the amount of ionizable lipid is about 30-45 mol% of the lipid composition, the amount of neutral lipid is about 10-15 mol% of the lipid composition, the amount of helper lipid is about 39-59 mol% of the lipid composition, and the amount of PEG lipid is about 1-1.5 mol% of the lipid composition; c. the ionizable lipid is about 30 mol% of the lipid composition, the amount of neutral lipid is about 10 mol% of the lipid composition, the amount of helper lipid is about 59 mol% of the lipid composition, and the amount of PEG lipid is about 1-1.5 mol% of the lipid composition; d. the amount of ionizable lipid is about 40 mol % of the lipid composition, the amount of neutral lipid is about 15 mol % of the lipid composition, the amount of helper lipid is about 43.5 mol % of the lipid composition, and the amount of PEG lipid is about 1.5 mol % of the lipid composition; or e. The amount of ionizable lipid is about 50 mol% of the lipid composition, the amount of neutral lipid is about 10 mol% of the lipid composition, the amount of helper lipid is about 39 mol% of the lipid composition, and the amount of PEG lipid is about 1 mol% of the lipid composition.

[0478] In some embodiments, the LNPs have a diameter of about 1-250 nm, 10-200 nm, about 20-150 nm, about 50-150 nm, about 50-100 nm, about 50-120 nm, about 60-100 nm, about 75-150 nm, about 75-120 nm, or about 75-100 nm. In some embodiments, the LNPs have a diameter of less than 100 nm. In some embodiments, the LNP composition comprises a population of LNPs having an average diameter of about 10-200 nm, about 20-150 nm, about 50-150 nm, about 50-100 nm, about 50-120 nm, about 60-100 nm, about 75-150 nm, about 75-120 nm, or about 75-100 nm. In some embodiments, the LNPs have an average diameter of less than 100 nm.

[0479] In some embodiments, the LNPs comprise about 40-60 mol% amine lipids, about 5-15 mol% neutral lipids, and about 1.5-10 mol% PEG lipids, with the remainder of the lipid components being helper lipids, and the N / P ratio of the LNP composition is about 3-10. In some embodiments, the LNPs comprise about 50-60 mol% amine lipids, about 8-10 mol% neutral lipids, and about 2.5-4 mol% PEG lipids, with the remainder of the lipid components being helper lipids, and the N / P ratio of the LNP composition is about 3-8. In some embodiments, the LNPs comprise about 50-60 mol% amine lipids, about 5-15 mol% DSPC, and about 2.5-4 mol% PEG lipids, with the remainder of the lipid components being cholesterol, and the N / P ratio of the LNP composition is 3-8±0.2.

[0480] In embodiments, the average diameter is the Z-average diameter. In certain embodiments, the Z-average particle size is measured by dynamic light scattering (DLS) using methods known in the art. For example, the average particle size and polydispersity can be measured by dynamic light scattering (DLS) using a Malvern Zetasizer DLS instrument. The LNP sample is diluted with PBS buffer solution before being measured by DLS. The Z-average diameter, number-average diameter, and polydispersity index (pdi) can be determined. The Z-average is the intensity-weighted average hydrodynamic size of a collection of particles. The number-average is the particle number-weighted average hydrodynamic size of a collection of particles. The Malvern Zetasizer instrument can also be used to measure the zeta potential of LNPs using methods known in the art.

[0481] D. Targeted LNP In certain embodiments, the LNPs disclosed herein are LNPs capable of delivering various cargoes to a cell or cell population of interest, e.g., a tissue or organ (referred to herein as "targeted LNPs"). Targeted LNPs can utilize a variety of active targeting (controlled by the interaction between a targeting domain attached to the targeting LNP, such as by chemical means, and a target associated with the cell or cell population), passive targeting (controlled primarily by the size and charge of the LNP), and endogenous targeting mechanisms. Thus, in some embodiments, targeted LNPs comprise one or more targeting domains that target the LNP to a specific cell or cell population. Targeting domains of the present disclosure include, but are not limited to, antibodies, antibody fragments, proteins, peptides, and nucleic acids. Alternatively or additionally, in certain embodiments, targeted LNPs comprise one or more targeting lipid components. In some embodiments, targeted LNPs target one or more of the brain, eye, muscle, liver, lung, spleen, and bone marrow.Such LNPs can also be used for example, Akinc, A., et al. Mol Ther. 2010 (July), 18(7), 1357-1364; Cheng, Q., et al. Nat. al.Sci.Adv.9,eadd4623(2023);Kasiewicz,LN,et al.Lipid nanoparticles incorporating a GalNAc ligand enable in vivo liver ANGPTL3 editing in wild-type and somatic LDLR knockout non-human primates.BioRXiv.2021,11.08.467731;Kularatne,RN, et al.Pharmaceuticals.2022,15,897;Li,Q.,et al.ACS Chem Biol. 2020 (April), 15 (4), 830-836; Sago, CD, et al. J Am Chem Soc. 2018 (Dec), 140 (49), 17095-17105; Tombacz, I., et al. Mol Ther. 2021 (Nov), 29 (11), 3293-3304; Veiga, N., et al. Nat Commun. 2018, 9, 4493; Wang, X., et al. Nat. Protoc. 2023 (January), 18 (1): 265-291; WO2022 / 232514, WO2022204219, WO2022140252, the contents of each of which are incorporated herein by reference. Targeted LNPs include, but are not limited to, selective organ-targeted (SORT) LNPs, as described in Cheng, Q., et al., 2020. Nat. Nanotechnol. 2020 (April), 15(4), 313-320.

[0482] In certain embodiments, targeted LNPs comprise one or more targeting domains that target the LNP to a particular cell or cell population. The targeting domains may comprise nucleic acids, peptides, antibodies, small molecules, glycans, sugars, hormones, etc., that target the LNP to a cell or cell population. In certain embodiments, the LNPs are capable of multivalent targeting, i.e., the LNPs comprise multiple targeting mechanisms described herein. In certain embodiments, the targeting domain of the LNP specifically binds to a target associated with a cell or cell population in need of the cargo associated with the LNP compositions disclosed herein. For example, the targeting domain may be selected to recognize a ligand that functions as a cell surface marker on a target cell or cell population associated with a particular disease state. Such a target may be a protein, protein fragment, antigen, or other biomolecule associated with the target cell or cell population. In some embodiments, the targeting domain is an affinity ligand that specifically binds to the target. In certain embodiments, the target (e.g., an antigen) is associated with a cell or cell population in need of treatment with the cargo associated with the LNP. In some embodiments, the targeting domain may be copolymerized with a composition comprising the LNP. In some embodiments, the targeting domain can be covalently attached to a composition comprising an LNP, such as through a chemical reaction between the targeting domain and the LNP.

[0483] 1. Peptide targeting domain In one embodiment, a targeting domain of the present disclosure comprises a peptide. In certain embodiments, the peptide targeting domain specifically binds to a target, for example, on a cell or cell population of interest.

[0484] The peptides of the present disclosure can be produced using chemical methods. For example, peptides can be synthesized by solid-phase techniques (Roberge JY et al. (1995) Science 269:202-204), cleaved from the resin, and purified by preparative high performance liquid chromatography. Automated synthesis can be performed, for example, using an ABI 431 A peptide synthesizer (Perkin Elmer) according to the manufacturer's instructions.

[0485] Alternatively, the peptides may be produced by recombinant means or by cleavage from a longer polypeptide. The composition of the peptides may be confirmed by amino acid analysis or sequencing.

[0486] The peptides of the present disclosure can include unnatural amino acids formed by post-translational modification or by introducing unnatural amino acids during translation.

[0487] 2. Nucleic Acid Targeting Domain In one embodiment, the targeting domain of the present invention comprises an isolated nucleic acid, including, for example, DNA and RNA. In certain embodiments, the nucleic acid targeting domain specifically binds to a target, for example, on a cell or cell population of interest. For example, in one embodiment, the nucleic acid comprises a nucleotide sequence that specifically binds to the target of interest.

[0488] The nucleotide sequence of the nucleic acid targeting domain may contain sequence variations relative to the original nucleotide sequence, e.g., substitutions, insertions, and / or deletions of one or more nucleotides, provided that the resulting nucleic acid functions similarly to the original nucleic acid and specifically binds to the intended target.

[0489] 3. Antibodies In one embodiment, the targeting domain of the present disclosure comprises an antibody or antibody fragment. In certain embodiments, the antibody targeting domain specifically binds to a target on, for example, a cell or cell population of interest. Such antibodies include polyclonal antibodies, monoclonal antibodies, Fab and single-chain Fv (scFv) fragments thereof, VHH domains thereof, nanobodies, bispecific antibodies, heteroconjugates, human antibodies, and humanized antibodies. The antibody can be a complete monoclonal or polyclonal antibody, an immunologically active fragment (e.g., a Fab or (Fab)2 fragment), an antibody heavy chain, an antibody light chain, a humanized antibody, a genetically engineered single-chain Fv molecule (Ladner et al., US Pat. No. 4,946,778), or a chimeric antibody (e.g., an antibody that contains the binding specificity of a mouse antibody but whose remaining portions are human). Antibodies, such as monoclonal antibodies, polyclonal antibodies, fragments, and chimeras, can be prepared using methods known to those skilled in the art.

[0490] Such antibodies can be produced in a variety of ways, including hybridoma culture, recombinant expression in bacterial or mammalian cell culture, and recombinant expression in transgenic animals. The choice of production method depends on several factors, including the desired antibody structure, the importance of carbohydrate moieties on the antibody, ease of culture and purification, and cost. Using standard expression techniques, a variety of antibody structures can be produced, including full-length antibodies, antibody fragments such as Fab and Fv fragments, and chimeric antibodies containing components from different species. Bacterial expression systems can produce small antibody fragments, such as Fab and Fv fragments, which lack effector function and have limited pharmacokinetic activity. Single-chain Fv fragments exhibit low immunogenicity.

[0491] In certain embodiments, the targeted LNP comprises a targeting lipid component. The LNPs disclosed herein may comprise a biodegradable lipid (i.e., an amine lipid or an ionizable lipid), a neutral lipid, a helper lipid (e.g., cholesterol), and a stealth lipid (e.g., a PEG-lipid). In some embodiments, the LNP is a targeted LNP disclosed herein, wherein the targeted LNP comprises a biodegradable lipid, a neutral lipid, a helper lipid, and a stealth lipid, and may further comprise a targeting lipid component that can result in a change in the size or charge of the LNP, thus in turn affecting the uptake of the LNP by various cells, cell populations, tissue types, and organ systems. For example, LNPs larger than 200 nm are thought to be unable to pass through the relatively narrow (approximately 100 nm) sinusoidal apertures, resulting in reduced targeting to hepatocytes (Kularatne, RN, et al. The Future of Tissue-Targeted Lipid Nanoparticle-Mediated Nucleic Acid Delivery. Pharmaceuticals. 2022, 15, 897; see also Wang, X., et al. Preparation of Selective Organ-Targeting (SORT) Lipid Nanoparticles (LNPs) Using Multiple Technical Methods for Tissue-Specific mRNA Delivery. Nat. Protoc. 2023 (January), 18(1): 265-291). The appropriate ratio of targeting lipid components to other components of LNPs can be adjusted within the scope of common knowledge in the art, e.g., Cheng, et al., 2020. Nat. Nanotechnol. 2020 (April), 15(4), 313-320.

[0492] In some embodiments, the target lipid component is a permanent cationic lipid, an anionic lipid, a zwitterionic lipid, or an ionizable cationic lipid. In some embodiments, the permanent cationic lipid is 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), dimethyldioctadecylammonium (DDAB), or 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (EPC). In some embodiments, the anionic lipid is 1,2-dimyristoyl-sn-glycero-3-phosphate (14PA) or sn-(3-oleoyl-2-hydroxy)-glycerol-1-phospho-sn-3'-(1',2'-dioleoyl)-glycerol (18BMP). In some embodiments, the zwitterionic lipid is 2-((2,3-bis(oleoyloxy)propyl)dimethylammonium)ethyl ethyl phosphate (DOCPe) or 1,2-distearoyl-sn-glycero-3-phosphocholine (DPSC). In some embodiments, the ionizable cationic lipid is 1,2-dioleoyl-3-dimethylammonium propane (DODAP) or C12-200.

[0493] In certain embodiments, targeted LNPs target one or more cell populations or tissues (eg, brain, eye, muscle, liver, lung, spleen, bone marrow).

[0494] In some embodiments, the LNPs are targeted to the brain. Exemplary cells or cell populations of interest include, but are not limited to, astrocytes, oligodendrocytes, endothelial cells, microglial cells, ependymal cells, or neurons.

[0495] In some embodiments, the targeted LNPs are targeted to the brain and comprise a targeted lipid component. In some embodiments, the targeted LNPs are targeted to the brain and comprise a targeting domain.

[0496] In some embodiments, the targeted LNPs are targeted to the lung. In some embodiments, the targeted LNPs are targeted to the lung and the cell or cell population of interest is an airway epithelial cell, e.g., a goblet cell, a ciliated cell, a Clara cell, a neuroendocrine cell, a basal cell, an intermediate cell, or a parabasal cell, a serous cell, a brush cell, a tumor cell, a non-ciliated columnar cell, or a metaplastic cell, an alveolar cell, e.g., a type 1 or type 2 alveolar epithelial cell, or a cuboidal non-ciliated cell, a bronchial salivary gland cell, e.g., a serous cell, a mucous cell, or a tubular cell, an interstitial connective tissue cell, e.g., a smooth muscle cell, a chondrocyte, a fibroblast, a myofibroblast, a meningodermal cell of a micromeningodermal nodule, an adipocyte, or a lung cell. nerve cells of the inner nerve, blood vessel-associated cells such as endothelial cells, smooth muscle cells, fibroblasts or myofibroblasts, or pericytes, hematopoietic or lymphatic cells such as lymphocytes, plasma cells, cells of bronchial mucosa-associated lymphoid tissue, megakaryocytes, macrophages, Langerhans cells, mast cells, eosinophils, neutrophils, or basophils, pleural cells such as mesothelial cells, multipotent submesothelial fibroblasts, adipocytes of intrapleural fat, endothelial cells, smooth muscle cells, or fibroblasts or myofibroblasts, stem cells, perivascular epithelioid cells, multipotent epithelial stem cells, meningeal cells, endothelial progenitor cells, or mucous cells.

[0497] In some embodiments, the targeted LNPs are targeted to the lung and comprise a targeting lipid component. In some embodiments, the targeting lipid component is a permanent cationic lipid such as 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), DDAB, or EPC. In some embodiments, the targeted LNPs are targeted to the lung and comprise a targeting domain. In some embodiments, the targeting domain is Fab-C4, plasma membrane vesicle-associated protein (PV-1), or an anti-PECAM-1 antibody.

[0498] In some embodiments, the targeted LNPs are targeted to the spleen. In some embodiments, the targeted LNPs are targeted to the spleen and the cell or cell population of interest comprises a red pulp cell, e.g., a fibroblast, a reticulocyte, a macrophage, an erythrocyte, a granulocyte, a circulating mononuclear cell, a lymphocyte, a hematopoietic cell, a plasma cell, a plasmablast, an endothelial cell, an erythroid cell, a myeloid cell, a megakaryocyte, or a melanocyte, a white pulp cell, e.g., a lymphocyte, a macrophage, a dendritic cell, a plasma cell, a reticular cell, or a stromal cell, or a marginal zone cell, e.g., a macrophage, an endothelial cell, a reticular fibroblast, a dendritic cell, a lymphocyte, or a lymphoid tissue inducer cell.

[0499] In some embodiments, the targeted LNP targets the spleen and comprises a targeting lipid component. In some embodiments, the targeting lipid component is negatively charged 1,2-dioleoyl-sn-glycero-3-phosphate (18PA). In some embodiments, the targeting lipid component is an anionic lipid such as 1,2-dimyristoyl-sn-glycero-3-phosphate (14PA) or sn-(3-oleoyl-2-hydroxy)-glycerol-1-phospho-sn-3'-(1',2'-dioleoyl)-glycerol (18BMP). In some embodiments, the targeting lipid component is a zwitterionic lipid such as DOCPe or DSPC. In some embodiments, the targeted LNP targets the spleen and comprises a targeting domain.

[0500] In some embodiments, the targeted LNPs are targeted to bone marrow. In some embodiments, the targeted LNPs are targeted to bone marrow, and the targeted LNPs comprise reticular cells, periarteriolar cells, Schwann cells, osteoclasts, N-cadherin+ cells, osteoblasts, megakaryocytes, erythroblasts, hematopoietic stem cells, granulocyte-monocyte progenitor cells, erythroid progenitor cells, lymphoid progenitor cells, or multipotent progenitor cells.

[0501] In some embodiments, the targeted LNP targets bone marrow and comprises a targeting lipid component. In some embodiments, the targeted LNP targets bone marrow and comprises a targeting domain. In some embodiments, the targeted LNP targets bone marrow and the targeting domain is specific for a target selected from CD34, CD117, CD133, CD105, ABCG2, bone morphogenetic protein receptor (BMPR), CD44, Sca-1, Thy-1, CD133, alkaline phosphatase, and alpha-fetoprotein. In some embodiments, the targeted LNP targets bone marrow and comprises anti-CD29.

[0502] In some embodiments, the target LNP comprises a polynucleotide including an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase, (i) the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase comprising an R1333K mutation within a protospacer-adjacent motif recognition domain, and (ii) the second cleavase is a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a S. muelleri (Smu) Cas9 cleavase. In some embodiments, the target LNP further comprises a first guide RNA that directs the first cleavase to a first genomic locus and a second guide RNA that directs the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus. In some embodiments, the targeted LNP may comprise an ORF encoding a fusion protein, a first guide RNA, a second guide RNA, an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting domain disclosed herein. In some embodiments, the targeted LNP targets the lung, spleen, or bone marrow.

[0503] In some embodiments, the target LNP comprises: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; (b) a first guide RNA directing the first cleavase to a first genomic locus; and (c) a second guide RNA directing the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus. In some embodiments, the target LNP can comprise (a)-(c), an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting lipid component disclosed herein. In some embodiments, the target LNP can comprise (a)-(c), an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting domain disclosed herein. In some embodiments, the target LNP targets the lung, spleen, or bone marrow.

[0504] In some embodiments, the target LNP comprises: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase, (i) the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase comprising an R1333K mutation in a protospacer-adjacent motif recognition domain; and (ii) the second cleavase is a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a S. muelleri (Smu) Cas9 cleavase; (b) a first guide RNA that directs the first cleavase to a first genomic locus; and (c) a second guide RNA that directs the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus. In some embodiments, the targeted LNPs may comprise (a)-(c), an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting lipid component disclosed herein. In some embodiments, the targeted LNPs may comprise (a)-(c), an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting domain disclosed herein. In some embodiments, the targeted LNPs target the lung, spleen, or bone marrow.

[0505] In some embodiments, the target LNP comprises: (a) a first polypeptide comprising an ORF encoding a first polypeptide, the first polypeptide comprising a first cleavase and a first intein, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises an R1333K mutation within a protospacer-adjacent motif recognition domain; and (b) a second polynucleotide comprising an ORF encoding a second polypeptide, the second polypeptide comprising a second cleavase and a second intein capable of binding to the first intein, the second cleavase being a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase, wherein the first polypeptide binds to the second polypeptide via intein catalysis. In some embodiments, the targeted LNP further comprises a first guide RNA that directs the first cleavase to a first genomic locus and a second guide RNA that directs the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus. In some embodiments, the targeted LNP may comprise an ORF encoding a fusion protein, a first guide RNA, a second guide RNA, an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting domain as disclosed herein. In some embodiments, the targeted LNP targets the lung, spleen, or bone marrow.

[0506] In some embodiments, the target LNP comprises: (a) a first polynucleotide comprising an ORF encoding a first polypeptide, the first polypeptide comprising a first cleavase and a first intein, the first cleavase being a S. pyogenes (Spy) Cas9 cleavase, the SpyCas9 cleavase comprising a R1333K mutation in a protospacer-adjacent motif recognition domain; and (b) a second polynucleotide comprising an ORF encoding a second polypeptide, the second polypeptide comprising a second cleavase and a second intein capable of binding to the first intein, the second cleavase being a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a Simonsiella The target LNP comprises: (a) a S. muelleri (Smu) Cas9 cleavase; (b) a first polypeptide; (c) a second polynucleotide that binds to a second polypeptide via intein catalysis; (d) a first guide RNA that guides the first cleavase to a first genomic locus; and (e) a second guide RNA that guides the second cleavase to a second genomic locus, the second genomic locus being different from the first genomic locus. In some embodiments, the target LNP may comprise (a)-(c), an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting lipid component. In some embodiments, the target LNP may comprise (a)-(d), an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting domain. In some embodiments, the target LNP targets the lung, spleen, or bone marrow.

[0507] In some embodiments, the targeted LNP comprises a nucleic acid (e.g., RNA) component comprising one or more of an RNA-guided DNA binder, a Cas nuclease mRNA, a Class 2 Cas nuclease mRNA, a Cas9 mRNA, and a gRNA. In some embodiments, the targeted LNP may comprise a Class 2 Cas nuclease and a gRNA as the RNA component. In some embodiments, the targeted LNP may comprise an RNA component, an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting lipid component. In some embodiments, the targeted LNP may comprise an RNA component, an amine lipid, a helper lipid, a neutral lipid, a stealth lipid, and a targeting domain.

[0508] In some embodiments, the target LNP comprises an RNA component, which may comprise an mRNA, such as an mRNA encoding a Cas nuclease. In one embodiment, the RNA component may comprise a Cas9 mRNA. In some compositions comprising an mRNA encoding a Cas nuclease, the lipid-nucleic acid assembly further comprises a gRNA nucleic acid, such as a gRNA. In some embodiments, the RNA component comprises a Cas nuclease mRNA and a gRNA. In some embodiments, the RNA component comprises a Class 2 Cas nuclease mRNA and a gRNA.

[0509] In some embodiments, the target LNP can comprise mRNA encoding a Cas nuclease, an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In certain LNPs comprising mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the helper lipid is cholesterol. In other compositions comprising mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the neutral lipid is DSPC. In additional embodiments comprising mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain compositions comprising mRNA encoding a Cas nuclease, such as a Class 2 Cas nuclease, the amine lipid is selected from lipid A and its equivalents, e.g., acetal analogs of lipid A, or the amine lipids provided in WO2020 / 219876, or lipid D, or the amine lipids provided in WO2020 / 072605.

[0510] In some embodiments, the target LNP can include a gRNA. In some embodiments, the target LNP can include an amine lipid, a gRNA, a helper lipid, a neutral lipid, and a PEG lipid. In certain LNPs containing a gRNA, the helper lipid is cholesterol. In some compositions containing a gRNA, the neutral lipid is DSPC. In additional embodiments containing a gRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, the amine lipid is selected from lipid A and its equivalents (e.g., acetal analogs of lipid A), or the amine lipids and their equivalents described in WO2020 / 219876, or lipid D, or the amine lipids and their equivalents described in WO2020 / 072605.

[0511] In one embodiment, the target LNP may comprise an sgRNA. In one embodiment, the target LNP may comprise a Cas9 sgRNA. In one embodiment, the target LNP may comprise a Cpf1 sgRNA. In some compositions comprising an sgRNA, the lipid nucleic acid assembly comprises an amine lipid, a helper lipid, a neutral lipid, and a PEG lipid. In certain compositions comprising an sgRNA, the helper lipid is cholesterol. In other compositions comprising an sgRNA, the neutral lipid is DSPC. In additional embodiments comprising an sgRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, the amine lipid is selected from lipid A and its equivalents (e.g., acetal analogs of lipid A, or the amine lipids described in WO2020 / 219876), or lipid D, or the amine lipids described in WO2020 / 072605.

[0512] In some embodiments, the target LNP comprises an mRNA encoding a Cas nuclease and a gRNA, which may be an sgRNA. In one embodiment, the target LNP may comprise an amine lipid, an mRNA encoding a Cas nuclease, a gRNA, a helper lipid, a neutral lipid, and a PEG lipid. In certain compositions comprising an mRNA encoding a Cas nuclease and a gRNA, the helper lipid is cholesterol. In some compositions comprising an mRNA encoding a Cas nuclease and a gRNA, the neutral lipid is DSPC. In additional embodiments comprising an mRNA encoding a Cas nuclease and a gRNA, the PEG lipid is PEG2k-DMG or PEG2k-C11. In some embodiments, the amine lipid is selected from lipid A and its equivalents (e.g., acetal analogs of lipid A, or the amine lipids described in WO2020 / 219876), lipid D, or the amine lipids described in WO2020 / 072605.

[0513] In some embodiments, the targeted LNP comprises a Cas nuclease mRNA, e.g., a Class 2 Cas mRNA, and at least one gRNA. In some embodiments, the targeted LNP comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 25:1 to about 1:25 wt / wt. In some embodiments, the lipid nucleic acid assembly formulation comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 10:1 to about 1:10. In some embodiments, the lipid nucleic acid assembly formulation comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas nuclease mRNA) ratio of about 8:1 to about 1:8. Ratios measured herein are by weight. In some embodiments, the lipid nucleic acid assembly formulation comprises a gRNA to Cas nuclease mRNA (e.g., a Class 2 Cas mRNA) ratio of about 5:1 to about 1:5. In some embodiments, the ratio ranges from about 3:1 to about 1:3, about 2:1 to about 1:2, about 5:1 to about 1:2, about 5:1 to about 1:1, about 3:1 to about 1:2, about 3:1 to about 1:1, about 3:1, or about 2:1 to about 1:1. In some embodiments, the ratio of gRNA to mRNA is about 3:1 or about 2:1. In some embodiments, the ratio of gRNA to Cas nuclease mRNA (e.g., Class 2 Cas nuclease) is about 1:1. In some embodiments, the ratio of gRNA to Cas nuclease mRNA (e.g., Class 2 Cas nuclease) is about 1:2. The ratio can be about 25:1, 10:1, 5:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:5, 1:10, or 1:25.

[0514] The target LNPs disclosed herein may include a template nucleic acid. The template nucleic acid may be co-formulated with an mRNA encoding a Cas nuclease, such as a class 2 Cas nuclease mRNA. In some embodiments, the template nucleic acid may be co-formulated with a guide RNA. In some embodiments, the template nucleic acid may be co-formulated with both an mRNA encoding a Cas nuclease and a guide RNA. In some embodiments, the template nucleic acid may be formulated separately from the mRNA encoding the Cas nuclease or the guide RNA. The template nucleic acid may be delivered simultaneously with the LNP or separately from the LNP. In some embodiments, the template nucleic acid may be single-stranded or double-stranded, depending on the desired repair mechanism. The template may have a region of homology to the target DNA or a sequence adjacent to the target DNA.

[0515] In some embodiments, the targeted LNPs disclosed herein can be administered by intravenous, intradermal, subcutaneous, inhalation, intranasal, or intramuscular delivery.

[0516] E. Cell-LNP contact In some embodiments, the LNPs are pretreated with serum factors before contacting the cells. In some embodiments, the LNPs are pretreated with primate serum factors before contacting the cells. In some embodiments, the LNPs are pretreated with human serum factors before contacting the cells.

[0517] In some embodiments, the methods disclosed herein involve pre-incubating the serum factors and LNPs for about 30 seconds to overnight. In some embodiments, the pre-incubation step involves pre-incubating the serum factors and LNPs for about 1 minute to 1 hour. In some embodiments, it involves pre-incubating for about 1 to 30 minutes.

[0518] In some embodiments, the LNP compositions are administered sequentially. In some embodiments, the LNP compositions are administered simultaneously. In some embodiments, the cell population is contacted with three LNP compositions. In some embodiments, the cell population is contacted with four LNP compositions.

[0519] In some embodiments, the cells are frozen between successive contacting or editing steps.

[0520] In some embodiments, the LNPs are pretreated with serum factors before contacting with cells. In some embodiments, the LNPs are pretreated with human serum before contacting with cells. In some embodiments, the LNPs are pretreated with a serum substitute, for example, a commercially available serum substitute, and preferably, the serum substitute is suitable for in vitro use.

[0521] In some embodiments, LNPs are provided to "non-activated" cells. "Non-activated" cells refer to cells that have not been stimulated in vitro. In some embodiments, "non-activated" T cells may be stimulated in vivo (e.g., by antigen) while in the body, but may be referred to herein as non-activated if the cells have not been stimulated in vitro while in culture. "Activated" cells are also useful in the methods disclosed herein and can refer to cells that have been stimulated in vitro. Agents for activating cells in vitro, particularly with respect to activation of T cells or B cells, are provided herein and are known in the art.

[0522] In some embodiments, the T cells are activated before contact with the LNPs, activated during contact with the LNPs, or activated after contact with the LNPs.

[0523] While the present invention will be described in conjunction with the illustrated embodiments, it will be understood that it is not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, including equivalents of the specific features that may be included in the invention as defined by the appended claims.

[0524] VII. Exemplary DNA Molecules, Vectors, Expression Constructs, Host Cells, and Methods of Production In certain embodiments, the present disclosure provides one or more DNA molecules comprising a sequence encoding any of the nucleic acids (e.g., mRNA) encoding the cleavase or fusion proteins described herein. In some embodiments, the DNA molecule may further comprise, but is not limited to, promoters, enhancers, and regulatory sequences.

[0525] In certain embodiments, the present invention provides one or more DNA molecules comprising a sequence encoding one or more guide RNAs described herein. In some embodiments, the DNA molecule may further comprise, but is not limited to, a promoter, an enhancer, and a regulatory sequence. In some embodiments, the DNA molecule further comprises a promoter operably linked to a sequence encoding a guide RNA described herein.

[0526] In some embodiments, the DNA molecule comprises a promoter operably linked to a sequence encoding any of the nucleic acids (e.g., mRNA) encoding the cleavage or fusion protein or guide RNA described herein. In some embodiments, the DNA molecule is an expression construct suitable for expression in mammalian cells, e.g., human cells or mouse cells, e.g., human hepatocytes or rodent (e.g., mouse) hepatocytes. In some embodiments, the DNA molecule is an expression construct suitable for expression in cells of a mammalian organ, e.g., human liver or rodent (e.g., mouse) liver. In some embodiments, the DNA molecule is a plasmid or episome. In some embodiments, the DNA molecule is contained in a host cell, e.g., a bacterium or a cultured eukaryotic cell. Exemplary bacteria include Proteobacteria, such as E. coli. Exemplary cultured eukaryotic cells include primary hepatocytes, including hepatocytes from rodents (e.g., mice) or humans, hepatocyte cell lines, including hepatocytes from rodents (e.g., mice) or humans, human cell lines, rodent (e.g., mice) cell lines, Chinese hamster ovary (CHO) cells, microbial fungi such as fission yeast or budding yeast (e.g., Saccharomyces, S. cerevisiae, etc.), and insect cells.

[0527] In some embodiments, methods for producing a nucleic acid (e.g., mRNA or guide RNA) disclosed herein are provided. In some embodiments, such methods comprise contacting a DNA molecule described herein with an RNA polymerase under conditions that allow transcription. In some embodiments, the contacting is performed in vitro, e.g., in a cell-free system. In some embodiments, the RNA polymerase is an RNA polymerase of bacteriophage origin, e.g., T7 RNA polymerase. In some embodiments, NTPs are provided that comprise at least one modified nucleotide as described above. In some embodiments, the NTPs comprise at least one modified nucleotide as described above, but do not comprise UTP.

[0528] In some embodiments, the nucleic acids disclosed herein (e.g., mRNA or guide RNA), alone or together with one or more guide RNAs, can be contained within or delivered by a vector system of one or more vectors. In some embodiments, one or more vectors, or all of the vectors, can be DNA vectors. In some embodiments, one or more vectors, or all of the vectors, can be RNA vectors. In some embodiments, one or more vectors, or all of the vectors can be circular. In other embodiments, one or more vectors, or all of the vectors can be linear. In some embodiments, one or more vectors, or all of the vectors can be encapsulated in lipid nanoparticles, liposomes, non-lipid nanoparticles, or viral capsids. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.

[0529] Non-limiting exemplary viral vectors include adeno-associated viral (AAV) vectors, lentiviral vectors, adenoviral vectors, helper-dependent adenoviral (HDAd) vectors, herpes simplex viral (HSV-1) vectors, bacteriophage T4, baculoviral vectors, and retroviral vectors. In some embodiments, the viral vector can be an AAV vector. In some embodiments, the viral vector can be a lentiviral vector. In some embodiments, the lentivirus can be non-integrating. In some embodiments, the viral vector can be an adenoviral vector. In some embodiments, the adenovirus can be a high-cloning-capacity or "gutless" adenovirus, in which all viral coding regions except the 5' and 3' inverted terminal repeats (ITRs) and packaging signal ("I") have been deleted from the virus to increase packaging capacity. In yet other embodiments, the viral vector can be an HSV-1 vector. In some embodiments, the HSV-1-based vector is helper-dependent, while in other embodiments, it is helper-independent. For example, amplicon vectors that retain only the packaging sequence require a helper virus containing structural components for packaging, whereas 30 kb deleted HSV-1 vectors, in which nonessential viral functions have been removed, do not require a helper virus. In additional embodiments, the viral vector may be bacteriophage T4. In some embodiments, bacteriophage T4 may be capable of packaging any linear or circular DNA or RNA molecule when the viral head is emptied. In further embodiments, the viral vector may be a baculovirus vector. In still further embodiments, the viral vector may be a retrovirus vector. In embodiments using AAV or lentivirus vectors, which have limited cloning capacity, it may be necessary to use multiple vectors to deliver all elements of the vector system disclosed herein.For example, one AAV vector may contain a sequence encoding a Cas protein, while a second AAV vector may contain one or more guide sequences.

[0530] In some embodiments, the vector may be capable of driving expression of one or more coding sequences in a cell, such as the coding sequences of the mRNAs disclosed herein. In some embodiments, the cell may be a prokaryotic cell, such as a bacterial cell. In some embodiments, the cell may be a eukaryotic cell, such as a yeast, plant, insect, or mammalian cell. In some embodiments, the eukaryotic cell may be a mammalian cell. In some embodiments, the eukaryotic cell may be a rodent cell. In some embodiments, the eukaryotic cell may be a human cell. Suitable promoters for driving expression in different types of cells are known in the art. In some embodiments, the promoter may be wild-type. In other embodiments, the promoter may be modified for more efficient or effective expression. In still other embodiments, the promoter may be truncated but retain its function. For example, the promoter may have a normal size or a reduced size suitable for proper packaging of the vector into a virus.

[0531] In some embodiments, the promoter can be constitutive, inducible, or tissue-specific. In some embodiments, the promoter can be a constitutive promoter. Non-limiting exemplary constitutive promoters include a cytomegalovirus (CMV) immediate early promoter, a simian virus (SV40) promoter, an adenovirus major late promoter (MLP), a Rous sarcoma virus (RSV) promoter, a mouse mammary tumor virus (MMTV) promoter, a phosphoglycerate kinase (PGK) promoter, an elongation factor alpha (EF1a) promoter, a ubiquitin promoter, an actin promoter, a tubulin promoter, an immunoglobulin promoter, a functional fragment thereof, or a combination of any of the foregoing. In some embodiments, the promoter can be a CMV promoter. In some embodiments, the promoter can be a truncated CMV promoter. In other embodiments, the promoter can be an EF1a promoter. In some embodiments, the promoter can be an inducible promoter. Non-limiting exemplary inducible promoters include those inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. In some embodiments, the inducible promoter can be a promoter that has a low basal (uninduced) expression level, such as, for example, the Tet-On® promoter (Clontech).

[0532] In some embodiments, the promoter can be a tissue-specific promoter, for example, a promoter specific for expression in the liver.

[0533] The vector may further comprise a nucleotide sequence encoding at least one guide RNA. In some embodiments, the vector comprises one copy of the guide RNA. In other embodiments, the vector comprises multiple copies of the guide RNA. In embodiments using multiple guide RNAs, the guide RNAs may be non-identical so as to target different target sequences, or identical so as to target the same target sequence. In some embodiments in which the vector comprises multiple guide RNAs, each guide RNA may have other distinct properties, such as activity or stability within a ribonucleoprotein complex with a cleavase or fusion protein disclosed herein. In some embodiments, the nucleotide sequence encoding the guide RNA may be operably linked to at least one transcriptional or translational control sequence, such as a promoter, a 3' UTR, or a 5' UTR. In one embodiment, the promoter may be a tRNA promoter, e.g., a tRNALys3, or a tRNA chimera. See Mefferd et al., RNA. 2015 21:1683-9; Scherer et al., Nucleic Acids Res. 2007 35:2620-2628. In some embodiments, the promoter can be recognized by RNA polymerase III (Pol III). Non-limiting examples of Pol III promoters include the U6 promoter and the H1 promoter. In some embodiments, the nucleotide sequence encoding the guide RNA can be operably linked to a mouse or human U6 promoter. In other embodiments, the nucleotide sequence encoding the guide RNA can be operably linked to a mouse or human H1 promoter. In embodiments using multiple guide RNAs, the promoters used to drive expression can be the same or different. In some embodiments, the nucleotides encoding the crRNA of the guide RNA and the nucleotides encoding the trRNA of the guide RNA can be provided on the same vector. In some embodiments, the nucleotides encoding the crRNA and the trRNA can be driven by the same promoter.In some embodiments, the crRNA and trRNA can be transcribed into a single transcript. For example, the crRNA and trRNA can be processed from a single transcript to form a dual-molecule guide RNA. Alternatively, the crRNA and trRNA can be transcribed into a single guide RNA. In other embodiments, the crRNA and trRNA can be driven by corresponding promoters on the same vector. In yet other embodiments, the crRNA and trRNA can be encoded by different vectors.

[0534] In some embodiments, the composition may include a vector system, the system including one or more vectors. In some embodiments, the vector system may...

Claims

1. 1. A method for providing a modification to the genome of a target cell, said method comprising: (a) contacting the cell with a fusion protein or a nucleic acid encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a Streptococcus pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. The second cleavase is a Neisseria meningitidis (Nme) Cas9 cleavase, a Campylobacter jejuni (Cje) Cas9 cleavase, or a Simonsiella muelleri (Smu) Cas9 cleavase; (b) contacting the cell with a first guide RNA that directs the first cleavage to a first genomic locus; (c) contacting the cell with a second guide RNA that guides the second cleavage vector to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

2. 1. A method for generating a cell or cell population comprising a modification of the genome of a target cell(s), said method comprising: (a) contacting the cell(s) with a fusion protein or a nucleic acid encoding a fusion protein, wherein the fusion protein comprises a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. The contacting, wherein the second cribrase is a N. meningitidis (Nme) Cas9 cribrase, a C. jejuni (Cje) Cas9 cribrase, or a S. muelleri (Smu) Cas9 cribrase; (b) contacting the cell(s) with a first guide RNA that directs the first cleavage to a first genomic locus; (c) contacting the cell(s) with a second guide RNA that guides the second cleavage vector to a second genomic locus, wherein the second genomic locus is different from the first genomic locus.

3. 3. The method of claim 1, wherein the first cleavase is located at the N-terminus of the second cleavase.

4. 3. The method of claim 1, wherein the first cleavase is located at the C-terminus of the second cleavase.

5. 5. The method of any one of claims 1 to 4, wherein the first guide RNA and the second guide RNA target two non-overlapping genomic loci, and optionally the two non-overlapping genomic loci are separated by no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides.

6. 6. The method of claim 5, wherein the two non-overlapping genomic loci are separated by no more than 110 nucleotides.

7. 10. The method of any one of the preceding claims, wherein the first guide RNA is a single guide RNA (sgRNA), optionally a SpyCas9 guide RNA.

8. The SpyCas9 guide RNA is a single guide RNA, and the single guide RNA comprises: a conserved portion of an sgRNA comprising an upper stem region and a hairpin region, wherein each nucleotide of the upper stem region is modified with 2'-O-Me and each nucleotide of the hairpin region is modified with 2'-O-Me; a 3'-end modification comprising 2'-O-Me modified nucleotides in the last three nucleotides of the 3'-end and phosphorothioate (PS) linkages between the last four nucleotides of the 3'-end; a 5'-end modification comprising 2'-O-Me modified nucleotides in the first three nucleotides of the 5'-end and a phosphorothioate (PS) linkage between the first four nucleotides of the 5'-end; The method of claim 7, comprising:

9. 9. The method of claim 7 or 8, wherein the SpyCas9 guide RNA is a short single guide RNA (short sgRNA) that comprises a conserved portion of an sgRNA, including a hairpin region, wherein the hairpin region is lacking at least 5-10 nucleotides, and the short sgRNA comprises (i) a 5' end modification or (ii) a 3' end modification, and optionally comprises a nucleotide sequence selected from SEQ ID NOs: 159-167, 170-177, and 180-194, or a nucleotide sequence that is at least 85%, 90%, or 95% identical to SEQ ID NOs: 159-167, 170-177, and 180-194.

10. 10. The method of any one of claims 1 to 9, wherein the second guide RNA is a single guide RNA (sgRNA), optionally an NmeCas9 guide RNA.

11. 11. The method of Claim 10, wherein the second guide RNA is a truncated or chemically modified single guide RNA (sgRNA).

12. 12. The method of any one of claims 1 to 11, wherein the second guide RNA is a NmeCas9 guide RNA that is a single guide RNA comprising a nucleotide sequence selected from SEQ ID NOs: 280-297, or a nucleotide sequence that is at least 85%, 90%, or 95% identical to SEQ ID NOs: 280-297.

13. 13. The method of Claim 12, wherein the second guide RNA comprises one or more internal polyethylene glycol (PEG) linkers, and optionally the second guide RNA is at least 85%, 90%, 95%, 99%, 100% identical to a sequence selected from SEQ ID NOs: 272-278.

14. 14. The method of any one of claims 1 to 13, wherein one or both of the guide RNAs contains one or more mismatches to the target sequence.

15. The method of any one of claims 1 to 14, wherein the nucleic acid encoding the fusion protein is delivered to the cell by at least one vector.

16. 16. The method of any one of claims 1 to 15, wherein the fusion protein or the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are delivered to the cell by electroporation.

17. The method according to any one of claims 1 to 16, wherein the modification is carried out in vivo.

18. The method according to any one of claims 1 to 17, wherein the modification is carried out in vitro.

19. 19. The method of any one of claims 1 to 18, wherein the modification comprises a deletion of no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides, optionally wherein the modification comprises a deletion of no more than 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 consecutive nucleotides.

20. 20. The method of any one of claims 1 to 19, wherein the modification comprises a deletion of 25, 35, 45, 55, 65, 75, 85, 95, 100, 105 or more nucleotides, optionally wherein the modification comprises a deletion of 25, 35, 45, 55, 65, 75, 85, 95, 100, 105 or more consecutive nucleotides.

21. 21. The method of any one of claims 1 to 20, wherein the modification comprises a deletion of each of the nucleotides between the first and second cleavage sites.

22. 22. The method of any one of claims 19 to 21, wherein the deletion includes one or both of the protospacer adjacent motif (PAM) sites recognized by the first cleavase or the second cleavase.

23. 23. The method of any one of claims 1 to 22, wherein said modification increases expression of one or more RNAs or proteins, optionally wherein said modification increases expression of one or more RNAs or proteins by at least two-fold.

24. The method of any one of claims 1 to 23, wherein the modification results in the deletion of an initiation codon.

25. 25. The method of any one of claims 1 to 24, wherein said modification reduces or eliminates expression of said one or more mRNAs or proteins, and optionally said modification reduces or eliminates expression of said one or more mRNAs or proteins by at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

26. The method of any one of claims 1 to 25, wherein the cell is in a subject.

27. The cells a. kidney cells, b. liver cells, c. Cells selected from mesenchymal stem cells, hematopoietic stem cells (HSCs), mononuclear cells, endothelial progenitor cells (EPCs), neural stem cells (NSCs), limbal stem cells (LSCs), tissue-specific primary cells or cells derived therefrom (TSCs), induced pluripotent stem cells (iPSCs), ocular stem cells, pluripotent stem cells (PSCs), embryonic stem cells (ESCs), and cells for organ or tissue transplantation; d. immune cells, e. T cells, or f) The method of any one of claims 1 to 26, comprising lymphocytes.

28. A genetically engineered cell or population of genetically engineered cells modified by the method of any one of claims 1 to 27.

29. 29. The genetically engineered cell or genetically engineered cell population of Claim 28, wherein the genetic modification comprises a deletion of no more than 110, 100, 90, 80, 70, 60, 50, 40, 30, or 25 nucleotides, and optionally, the deletion comprises one or both of a protospacer adjacent motif (PAM) site.

30. A polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. The polynucleotide, wherein the second cleavase is a N. meningitidis (Nme) Cas9 cleavase, a C. jejuni (Cje) Cas9 cleavase, or a S. muelleri (Smu) Cas9 cleavase.

31. 1. A composition comprising: (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. the polynucleotide, wherein the second cleavage vector is a N. meningitidis (Nme) Cas9 cleavage vector, a C. jejuni (Cje) Cas9 cleavage vector, or a Simonsiella muelleri (Smu) Cas9 cleavage vector; (b) a first guide RNA that guides the first cleavage vector to a first genomic locus; (c) a second guide RNA that guides the second cleavage vector to a second genomic locus, the second genomic locus being different from the first genomic locus.

32. One or more lipid nanoparticles, (a) a polynucleotide comprising an open reading frame (ORF) encoding a fusion protein, the fusion protein comprising a first cleavase and a second cleavase; a. the first cleavase is a S. pyogenes (Spy) Cas9 cleavase, wherein the SpyCas9 cleavase comprises a R1333K mutation within its protospacer adjacent motif recognition domain; b. the polynucleotide, wherein the second cleavage vector is a N. meningitidis (Nme) Cas9 cleavage vector, a C. jejuni (Cje) Cas9 cleavage vector, or a Simonsiella muelleri (Smu) Cas9 cleavage vector; (b) a first guide RNA that guides the first cleavage vector to a first genomic locus; (c) a second guide RNA that guides the second cleavage vector to a second genomic locus, the second genomic locus being different from the first genomic locus, said one or more lipid nanoparticles comprising the second guide RNA.

33. 33. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 32, wherein (i) the SpyCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 105, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 105, or (ii) the nucleotide encoding the SpyCas9 cleavase comprises an open reading frame (ORF) comprising the sequence of SEQ ID NO: 104, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:

104.

34. 34. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 33, wherein the second cleavase is an NmeCas9 cleavase.

35. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 34, wherein the NmeCas9 cleavase is Nme1Cas9, Nme2Cas9, or Nme3Cas9.

36. (i) the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 107, 109, 120, 127, 136, or 137; or (ii) the nucleotide sequence encoding the NmeCas9 cleavase comprises the amino acid sequence of any one of SEQ ID NOs: 21, 106, 109, 120, 127, 136, or 137.

36. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 35, comprising the nucleotide sequence of any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138, or 139, or a nucleotide sequence which is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 21, 106, 108, 121-126, 128-133, 134, 135, 138, or 139.

37. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 36, wherein (a) the NmeCas9 cleavase is an Nme2Cas9 comprising the amino acid sequence of any one of SEQ ID NOs: 22, 109, or 136, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 22, 109, or 136, or (b) the nucleotide encoding the NmeCas9 cleavase comprises the nucleotide sequence of any one of SEQ ID NOs: 21, 108, or 138, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 21, 108, or 138.

38. 38. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 37, wherein (a) the CjeCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 144, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 144, or (b) the nucleotide encoding the CjeCas9 cleavase comprises the sequence of SEQ ID NO: 143, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:

143.

39. 39. The method, polynucleotide, composition, or lipid nanoparticle of any one of claims 1 to 38, wherein (a) the SmuCas9 cleavase comprises the amino acid sequence of SEQ ID NO: 142, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 142, or (b) the nucleotide encoding the SmuCas9 cleavase comprises an open reading frame (ORF) comprising the sequence of SEQ ID NO: 140 or 141, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 140 or 141.

40. The fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and optionally, the peptide linker comprises: a. at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80 amino acid residues, or b. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 39, comprising 11, 21, 31, 41, 51, 61, 71 or 81 amino acid residues.

41. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 40, wherein the fusion protein comprises a peptide linker between the first cleavase and the second cleavase, and the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 150 to 158, or the amino acid sequence is at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 150 to 158.

42. The fusion protein comprises a nuclear localization signal (NLS), and optionally a. the NLS is at the C-terminus of the fusion protein; b. the NLS is at the N-terminus of the fusion protein, or c) The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 41, wherein the NLS is present at both the N-terminus and the C-terminus of the fusion protein.

43. 43. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 42, wherein the fusion protein comprises a nuclear localization signal (NLS), and the NLS comprises a sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 366-369 and 371-384, or is encoded by a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or 100% identity to any one of SEQ ID NOs: 370 and 385-397.

44. 44. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 43, wherein the fusion protein comprises one, two, or three nuclear localization signals (NLS) independently selected from SEQ ID NOs: 366-369 and 371-384.

45. a. the fusion protein comprises, from N-terminus to C-terminus: i. the first cribasis; ii. a peptide linker, optionally comprising 81 amino acid residues; iii. the second chrysanthemum vase; iv. an NLS, including an SV40 NLS; b. The fusion protein comprises, from N-terminus to C-terminus: i. a first NLS, wherein the first NLS comprises an SV40 NLS; ii. the second cribasis; iii. a peptide linker, optionally comprising 41 amino acid residues; iv. the first cribasis; v. a second NLS, wherein the second NLS comprises an SV40 NLS; or c. the fusion protein comprises, from N-terminus to C-terminus: i. the second cribasis; ii. a peptide linker, optionally comprising 41 amino acid residues; iii. the first cribasis; iv. A NLS, optionally comprising an SV40 NLS.

46. (a) the fusion protein comprises an amino acid sequence of SEQ ID NO: 3, 5, 7, 10, 13, 16, 40, 43, 45, 47, 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 5, 7, 10, 13, 16, 40, 43, 45, 47 , 50, 52, 55, 57, 60, 62, 65, 67, 70, 72, 75, 77, 80, 82, 85, 87, 90, 92, 101, or 105, or (b) the nucleic acid encoding the fusion protein comprises an amino acid sequence at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NOs: 1-2, 4, 6-8, 9, 11, 12, 14-15, 38-39, 41-42, 44 , 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104, or a nucleotide sequence which is at least 90%, or at least 95%, identical to SEQ ID NO: 1 or 2, or SEQ ID NO: 4, 6, 8, 9, 11, 12, 14-15, 38-39, 41- 46. ​​The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 45, comprising a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to 42, 44, 46, 48-49, 51, 53, 54, 56, 58, 59, 61, 63, 64, 66, 68, 69, 71, 73, 74, 76, 78, 79, 81, 83, 84, 86, 88, 89, 91, 100, or 104.

47. (a) the fusion protein comprises the amino acid sequence of SEQ ID NO: 3, 5, 7, 10, or 13, or an amino acid sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 3, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, or 13; or 47. The method, polynucleotide, composition or lipid nanoparticle of any one of claims 1 to 46, wherein (b) the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 1, 2, 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 90%, or at least 95%, identical to SEQ ID NO: 1 or 2, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

48. (a) the fusion protein comprises the amino acid sequence of SEQ ID NO: 5, 7, 10, 13, or 99, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of SEQ ID NO: 5, 7, 10, 13, or 99; or (b) the nucleic acid encoding the fusion protein comprises the nucleotide sequence of SEQ ID NO: 4, 6, 8, 9, 11, or 12, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 4, 6, 8, 9, 11, or 12.

49. a. the first polypeptide comprises the amino acid sequence of SEQ ID NO:28 or 31, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:28 or 31, or the nucleic acid encoding the polypeptide(s) comprises the sequence of SEQ ID NO:27 or 30, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO:27 or 30, or b. The method, polynucleotide, composition, or lipid nanoparticle of claim 48, wherein the second polypeptide comprises the amino acid sequence of SEQ ID NO: 25 or 34, or an amino acid sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 25 or 34, or the nucleic acid encoding the polypeptide(s) comprises the sequence of SEQ ID NO: 24 or 33, or a nucleotide sequence that is at least 85%, at least 90%, or at least 95% identical to SEQ ID NO: 24 or 33.

50. The polynucleotide is a. a 5'UTR having at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 398-405; b. a 3'UTR having at least 85%, at least 90%, or at least 95% identity to any one of SEQ ID NOs: 406-413, or c. The polynucleotide, composition, or lipid nanoparticle of any one of claims 30 to 49, comprising a 5' cap, wherein the 5' cap is optionally cap 0, cap 1, or cap 2.

51. The polynucleotide, composition or lipid nanoparticle of any one of claims 30 to 50, wherein the polynucleotide is mRNA.

52. The polynucleotide, composition or lipid nanoparticle of any one of claims 30 to 51, wherein at least 85% of the uridines are substituted with modified uridines.

53. 53. The method, composition, or lipid nanoparticle of any one of claims 1 to 52, wherein one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with the one or more lipid nanoparticles (LNPs).

54. a. the nucleic acids encoding the fusion proteins are associated with each distinct lipid nanoparticle (LNP); b. the first guide RNA and the second guide RNA are associated with the same lipid nanoparticle (LNP); or c) The method, composition, or lipid nanoparticle of any one of Claims 1-53, wherein the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are all associated with the same lipid nanoparticle.

55. The LNPs comprise (i) an ionizable lipid, (ii) a helper lipid, (iii) a stealth lipid, (iv) a neutral lipid, or a combination of one or more of (i)-(iv), and optionally: a. the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate; b. the helper lipid is cholesterol; c. the stealth lipid is PEG-DMG, or d. The method, composition or lipid nanoparticle of any one of claims 53 to 54, wherein the neutral lipid is DSPC.

56. 56. The method, composition or lipid nanoparticle of any one of claims 53 to 55, wherein the PEG-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).

57. 57. The method, composition or lipid nanoparticle of any one of claims 53 to 56, wherein the LNP composition comprises about 50 mol% ionizable lipids, about 9 mol% neutral lipids, about 3 mol% stealth lipids, with the remaining lipid components being helper lipids such as cholesterol.

58. 58. The method, composition, or lipid nanoparticle of any one of claims 53 to 57, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate DSPC, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate, cholesterol, and PEG2k-DMG.

59. A polypeptide encoded by the polynucleotide of any one of claims 30 to 52.

60. 53. A vector comprising an expression construct comprising a sequence encoding the polynucleotide of any one of claims 30 to 52 or a promoter operably linked to a sequence encoding the polynucleotide of any one of claims 30 to 52, optionally wherein the expression construct is present in a plasmid.

61. 61. A host cell comprising the vector or expression construct of claim 60.

62. A pharmaceutical composition comprising the polynucleotide, composition, lipid nanoparticle, or polypeptide of any one of claims 30 to 59 and a pharmaceutically acceptable carrier.

63. A kit comprising the polynucleotide, composition, or polypeptide of any one of claims 30 to 59.

64. 60. Use of a polynucleotide, composition, lipid nanoparticle or polypeptide according to any one of claims 30 to 59 for providing a modification to the genome of a target cell.

65. 60. Use of a polynucleotide, composition, lipid nanoparticle or polypeptide according to any one of claims 30 to 59 for the manufacture of a medicament for providing a modification to the genome of a target cell.

66. 59. The method or composition of any one of claims 1-27, 31, and 33-58, wherein one or more of the nucleic acid encoding the fusion protein, the first guide RNA, and the second guide RNA are associated with one or more target LNPs.

67. 67. The method or composition of claim 66, wherein the targeted LNP targets one or more of the brain, eye, muscle, liver, lung, spleen, and bone marrow.

68. 68. The method or composition of any one of claims 66 to 67, wherein the targeted LNP comprises a targeting lipid component or a targeting domain.

69. 69. The method or composition of claim 68, wherein the targeting domain comprises a nucleic acid, peptide, antibody, small molecule, glycan, sugar, or hormone.

70. 70. The method of any one of claims 66-69, wherein the targeted LNP is administered by an intravenous, intradermal, subcutaneous, inhalation, intranasal, or intramuscular delivery route.

Images