Engineered Guide RNAs and Polynucleotides

Abstract

Disclosed herein are engineered guide RNAs and compositions comprising the same for treating a disease or condition in a subject. Also disclosed herein are methods for treating a disease or condition in a subject by administering the engineered guide RNA or pharmaceutical composition described herein. In some embodiments, the disease or condition comprises a synucleinopathy. In some embodiments, the synucleinopathy comprises Parkinson's disease. In some embodiments, the subject is a human or non-human animal.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. § 119 of Provisional Application No. 63 / 528,027, filed July 20, 2023, and Provisional Application No. 63 / 434,986, filed December 23, 2022, the disclosures of which are incorporated herein by reference. [Background technology]

[0002] Compositions that mediate RNA editing can be effective treatments for genetic diseases. However, there is a need for highly effective compositions that can maximize on-target RNA editing while simultaneously minimizing off-target RNA editing. Furthermore, there is a need for compositions that can promote RNA editing. Summary of the Invention

[0003] Disclosed herein is a composition comprising an engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA has complementarity to a target sequence of a target SNCA RNA and comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784; and upon hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA, a guide-target RNA scaffold is formed that has one or more structural features not present in the engineered guide RNA prior to hybridization and selected from the group consisting of a bulge, an internal loop, and a hairpin; and wherein formation of the guide-target RNA scaffold results in knockdown of alpha-synuclein protein encoded by the target SNCA RNA. In some embodiments, the engineered guide RNA comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 293-299 or 333-340. In some embodiments, the engineered guide RNA comprises the polynucleotide sequence of any one of SEQ ID NOs: 293-299 or 333-340. In some embodiments, the target sequence of the target SNCA RNA comprises a translation start site. In some embodiments, the translation start site is the SNCA codon 1 translation start site in exon 2. In some embodiments, the translation start site is the SNCA codon 1 translation start site in exon 2, which corresponds to position 226 of the SNCA transcript variant with Accession No. NM_000345.4. In some embodiments, the one or more structural features comprise at least a first 6 / 6 symmetric internal loop and at least a second 6 / 6 symmetric loop. In some embodiments, the first 6 / 6 symmetric internal loop is at a position selected from the group consisting of 33, 32, 30, 28, and 26 relative to the target adenosine at position 0.In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:337. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:338 or SEQ ID NO:339.In some embodiments, the one or more structural features include a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 ...21 relative to position 0, a U / G wobble base at position -21 relative to position 0, a U / G wobble base at position -21 relative to position 0, a U / G wobble base at position -21 relative to position 0, a U / G wob In some embodiments, the engineered guide RNA further comprises at least one structural feature selected from the group consisting of a 2 / 2 symmetrical bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 340. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a 2 / 2 symmetrical internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 298 or SEQ ID NO: 299. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 299. In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:333. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:334. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:335.In some embodiments, the one or more structural features include a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, In some embodiments, the engineered guide RNA comprises at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, a G / U wobble base at position -3 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 336. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 295. In some embodiments, the first 6 / 6 symmetric internal loop is at position 30 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -18 relative to position 0, a 3 / 3 symmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 297. In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, a G / U wobble base pair at position 2 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 293. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −10 relative to position 0, a 0 / 1 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 294. In some embodiments, the first 6 / 6 symmetric internal loop is at position 26 relative to the target adenosine at position 0. In some embodiments, the one or more structural features are at least one structure selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA further comprises a structural feature. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 296. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the guide-target RNA scaffold comprises a wobble base pair. In some embodiments, the one or more structural features comprise a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, upon hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA, the engineered guide RNA promotes RNA editing of one or more adenosines in the target sequence of the target SNCA RNA by the RNA editor. In some embodiments, the RNA editor comprises ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, the composition comprises an engineered polynucleotide encoding the engineered guide RNA. In some embodiments, the engineered polynucleotide is contained in or present on a vector. In some embodiments, the vector is a viral vector, and the engineered polynucleotide is encapsidated in the viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector or a derivative thereof. In some embodiments, the viral vector is an adeno-associated viral (AAV) vector, wherein the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant of any of them.In some embodiments, the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof. In some embodiments, the target sequence of the target SNCA RNA has a polynucleotide sequence at least 80% identical to SEQ ID NO: 300. In some embodiments, the engineered guide RNA comprises the sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784.

[0004] Also disclosed herein are compositions comprising an engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA has a length of 85 to 100 nucleotides and hybridizes to at least 80 bases of a target RNA sequence, and the target RNA sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300. In some embodiments, upon hybridization of the engineered guide RNA to at least 80 bases of the target RNA sequence, the engineered guide RNA promotes RNA editing of one or more adenosines in at least 80 bases of the target RNA sequence by an RNA editor. In some embodiments, upon hybridization to at least 80 bases of the target RNA sequence, the engineered guide RNA forms a guide-target RNA scaffold comprising one or more structural features. In some embodiments, the one or more structural features include a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the one or more structural features comprise a wobble base pair. In some embodiments, the one or more structural features comprise a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, the RNA editing agent comprises ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, the composition comprises an engineered polynucleotide encoding an engineered guide RNA. In some embodiments, the engineered polynucleotide encoding the engineered guide RNA is contained in or present on a vector.In some embodiments, the vector is a viral vector, and the engineered polynucleotide encoding the engineered guide is encapsidated in the viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector or a derivative thereof. In some embodiments, the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant thereof. In some embodiments, the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

[0005] Also disclosed herein are pharmaceutical compositions comprising (a) a composition described herein and (b) a pharmaceutically acceptable excipient, carrier, or diluent.

[0006] Also disclosed herein are methods of treating a disease or condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition described herein or a pharmaceutical composition described herein. In some embodiments, the disease or condition comprises a synucleinopathy. In some embodiments, the synucleinopathy comprises Parkinson's disease. In some embodiments, the subject is a human or non-human animal. In some embodiments, the pharmaceutical composition or composition is in unit dosage form. In some embodiments, administration is sufficient to treat one or more symptoms of the disease or condition. In some embodiments, the disease or condition is a synucleinopathy. In some embodiments, the one or more symptoms treated comprise muscle rigidity, bradykinesia, resting tremor, or any combination thereof. In some embodiments, administration is sufficient to reduce aggregation of alpha-synuclein protein compared to (a) the level of aggregation before administration, (b) the level of aggregation accumulated in the subject in the absence of administration, or (c) both.

[0007] Also disclosed herein is a method for treating Parkinson's disease in a subject in need thereof, comprising administering to the subject a composition described herein or a pharmaceutical composition described herein in an amount sufficient to treat Parkinson's disease in the subject. In some embodiments, the administration is sufficient to treat one or more symptoms of Parkinson's disease in the subject compared to before administration. In some embodiments, the one or more symptoms treated include rigidity, bradykinesia, resting tremor, or any combination thereof. In some embodiments, the subject after administration exhibits an increased Unified Parkinson's Disease Rating Scale (UPDRS) score compared to the UPDRS score before administration.

[0008] Also disclosed herein are methods for reducing the expression of alpha-synuclein protein in a subject in need thereof, comprising administering to the subject a composition described herein, wherein the administration is sufficient to reduce the expression of alpha-synuclein protein in the subject compared to the amount of alpha-synuclein protein before administration, as determined by an in vitro assay, thereby reducing the expression of alpha-synuclein protein in the subject. In some embodiments, the engineered guide RNA has sufficient complementarity to the target sequence of the target SNCA RNA such that the engineered guide RNA hybridizes to the target sequence of the target SNCA RNA, and the target sequence includes a translation start site in the target SNCA RNA. In some embodiments, the translation start site is the SNCA codon 1 translation start site in exon 2. In some embodiments, the target SNCA RNA includes a pre-mRNA transcript of SNCA. In some embodiments, hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA results in editing of one or more adenosines in the target sequence by an RNA editing agent present in the subject. In some embodiments, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of SNCA pre-mRNA transcripts have one or more adenosine edits in the target sequence. In some embodiments, editing one or more adenosines in the target sequence of the target SNCA RNA promotes a reduction in alpha-synuclein protein expression in the subject. In some embodiments, the reduction in alpha-synuclein protein expression is at least 10% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least 20% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least 25% compared to the amount of alpha-synuclein protein present before administration.In some embodiments, the reduction in alpha-synuclein protein expression is at least a 30% reduction compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least a 35% reduction compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least a 30% reduction compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least a 40% reduction compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least a 45% reduction compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is at least a 50% reduction compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is about 10% to up to 20% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is about 20% to up to about 30% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is about 30% to up to about 40% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is about 40% to up to about 50% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is about 50% to up to about 60% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the reduction in alpha-synuclein protein expression is about 60% to up to about 70% compared to the amount of alpha-synuclein protein present before administration. In some embodiments, the target sequence of the target SNCA RNA comprises a sequence that is at least 80% identical to SEQ ID NO:300.In some embodiments, hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA results in exon skipping in the SNCA pre-mRNA transcript. In some embodiments, exon skipping generates an SNCA mRNA alternative splice variant that does not include exon 2 of the wild-type SNCA mRNA transcript. In some embodiments, exon skipping results in a reduction of alpha-synuclein protein. In some embodiments, reducing alpha-synuclein protein expression in a subject comprises a decrease in alpha-synuclein protein level in a biological sample from the subject, as determined by an in vitro assay, compared to: (i) the alpha-synuclein protein level in a biological sample obtained from the subject before administration, or (ii) a reference alpha-synuclein protein level obtained from a subject with Parkinson's disease. In some embodiments, the method further comprises reducing the level of an alpha-synuclein RNA transcript comprising exon 2 in the subject, as determined by an in vitro assay, compared to: (i) the level of an alpha-synuclein RNA transcript comprising exon 2 in a biological sample obtained from the subject before administration, or (ii) a reference level of an alpha-synuclein RNA transcript comprising exon 2 obtained from a subject with Parkinson's disease. In some embodiments, the method treats a disease or condition in the subject. In some embodiments, the disease or condition is at least one selected from the group consisting of neurodegenerative diseases, Parkinson's disease, tremor, muscle rigidity, muscle rigidity, bradykinesia, dementia with Lewy bodies (DLB), multiple system atrophy (MSA), pure dysautonomia (PAF), and REM sleep behavior disorder (RBD).

[0009] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0010] The novel features of the present disclosure are set forth with particularity in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description that sets forth illustrative embodiments, in which exemplary principles of the present disclosure are utilized, and the accompanying drawings, in which: [Brief explanation of the drawings]

[0011] [Figure 1]

[0023] Figure 1 shows a legend for various exemplary structural features present in the guide-target RNA scaffold formed upon hybridization of a potential guide RNA of the present disclosure to a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base-paired with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side).

[0012] [Figure 2] A schematic diagram of the alpha-synuclein (SNCA, α-Syn) target showing the translation initiation site (TIS) in exon 2 of the RNA transcript is shown.

[0013] [Figure 3]Graph showing quantification of α-Syn protein expression compared to beta-actin control by Western blot. WT-SH-SY5Y cells are indicated by a gray bar with a circle. The TIS c.1 A>G hardwired mutation is indicated by 0. The TIS c.5 A>G hardwired mutation does not affect α-syn protein expression, as shown in the black square. The 3'UTR A>G hardwired mutation does not affect α-syn protein expression, as shown in the white bar with a triangle. Y-axis: total α-Syn / β-actin; X-axis: undifferentiated or differentiated SH-SY5Y cells.

[0014] [Figure 4] A-B show the selection of guide RNA structures for targeting SNCA. A shows a graph of percent RNA editing by gRNAs from high-throughput screening in the presence of ADAR1 or ADAR1 + ADAR2 compared to control RNA. Y-axis: percent RNA editing; X-axis: guides (numbered 1-50); C: control. B shows selected guide RNAs for further optimization with diverse secondary structures.

[0015] [Figure 5A] Figure 1 shows the results of on-target and bystander editing for each of the selected SNCA targeting guides. A schematic diagram of RNA editing is shown for the unedited transcript, on-target editing, on- and off-target editing, upstream off-target editing, and downstream targeted editing. [Figure 5B] Figure 1 shows the results of on-target and bystander editing for each of the selected SNCA targeting guides. The percentage of editing in the presence of ADAR1 is shown. [Figure 5C] Figure 1 shows the results of on-target and bystander editing for each of the selected SNCA targeting guides. The percentage of editing in the presence of both ADAR1 and ADAR2 is shown.

[0016] [Figure 6]1 shows a graph of on-target editing rates for engineered guide RNAs based on parent guide RNAs having the polynucleotide sequence of SEQ ID NO: 298, SEQ ID NO: 375, or SEQ ID NO: 784. Editing rates increase with guide length. Y-axis: on-target editing rate; X-axis: macro footprints shown as the length of the guide. mismatch positions, including 80.40, 80.45, 90.50, 95.55, and 100.60.

[0017] [Figure 7A] 1 shows the results of barbell scanning. 2 shows a schematic diagram of barbell scanning for a targeting site of a guide RNA containing a mismatched nucleobase. [Figure 7B] 1 shows the results of barbell scanning, and a heat map showing the positions of the left and right barbells of exemplary guide RNAs based on parent guide RNAs having the polynucleotide sequence of SEQ ID NO: 298, SEQ ID NO: 375, or SEQ ID NO: 784, which have the highest RNA editing ability.

[0018] [Figure 8A]

[0023] Figure 1 illustrates the macrofootprint optimization of exemplary guide RNAs using transient transfection assays.

[0024] Figure 1 shows the effect of guide RNA length on the ADAR-mediated editing efficiency of selected guide RNAs. [Figure 8B] 1 illustrates the macrofootprint optimization of an exemplary guide RNA using transient transfection assays. 2 illustrates the editing profile of an exemplary guide as a function of nucleotide position.

[0019] [Figure 9]A-B illustrate SNCA RNA editing in mouse primary neurons treated with select gRNAs. A shows a graph of relative SNCA protein levels after delivery of gRNA1 or gRNA2 to mouse primary neurons compared to control RNA. Y-axis: relative SNCA protein levels; X-axis: condition, regulatory element variants reg1, reg2, reg3, and reg4. B shows RNA editing in response to gRNA1 or gRNA2 compared to control RNA. Y-axis: percent SNCA TIS editing; X-axis: condition, regulatory element variants reg1, reg2, reg3, and reg4. Error bars represent standard deviation.

[0020] [Figure 10] Figures A-B show that selected SNCA-targeting gRNAs result in targeted α-synuclein protein knockdown and RNA editing in vivo. Figure A shows micrograms (μg) of human SNCA (hSNCA) per milligram (mg) of total protein in the brains of mice administered with gRNA. Y-axis: μg of hSNCA / mg of total protein. X-axis: condition, regulatory element variants reg1, reg2, reg3, and reg4. Statistics: one-way ANOVA with Dunnett's post-hoc test, **p<0.005, *p<0.05 compared to control gRNA. Figure B shows RNA editing in response to gRNA1 or gRNA2 compared to control RNA administered in vivo. Y-axis: percent SNCA TIS editing. X-axis: condition, regulatory element variants reg1, reg2, reg3, and reg4. Mice were administered AAV-gRNA via bilateral ICV at a dose of 1.55e11 vg / mouse. Y-axis: μg hSNCA / mg total protein; X-axis: condition. N=8 mice. Statistics: One-way ANOVA with Dunnett's post-hoc test **p<0.005, *p<0.05 compared to control gRNA.

[0021] [Figure 11]Figures A-B show alternative splice variants detected in mouse models and primary neurons in vitro. Figure A shows a schematic diagram of splice variants detected in SNCA. Figure B shows a gel of RT-PCR products from primary neurons and brain samples treated with SNCA-targeting gRNA. Bands are indicated, and an arrow indicates exon 2.

[0022] [Figure 12A] Figure 1 shows the relationship between gRNA structure and exon skipping in SNCA transcripts in mouse models and primary neurons in vitro. Densitometry graphs show the approximate % of novel splice variants (NSVs) for SNCA-targeting guide RNAs compared to control gRNAs in primary neurons. Y-axis: % of novel splice variants (NSVs), X-axis: Condition, Reg: Regulatory element. [Figure 12B] Figure 1 shows the relationship between gRNA structure and exon skipping in SNCA transcripts in mouse models and primary neurons in vitro. Densitometry shows a graph of the approximate % of novel splice variants (NSVs) for SNCA-targeting guide RNAs compared to control gRNAs in mouse brains after intracerebral injection. Y-axis: % of novel splice variants (NSVs). X-axis: condition, regulatory element variants reg1 and reg3. [Figure 12C] Figure 1 shows the relationship between gRNA structure and exon skipping in SNCA transcripts in mouse models and primary neurons in vitro. Graphs of the percentage of transcripts with exon 1-3 splice junctions for control, LCOR gRNA, gRNA1, and gRNA2 are shown. Y-axis: % of transcripts with 1-3 splice junctions; X-axis: condition. SNCA transcripts were measured by droplet digital PCR (ddPCR).

[0023] [Figure 13]Quantification of viral genomes and gRNAs in mice treated with SNCA-targeting gRNAs is shown. Graphs of viral genomes per diploid genome (VG / DG) isolated from mouse brains treated with selected gRNAs are shown. Y-axis: VG / DG, X-axis: condition, N=8 / group. Regulatory element variants reg1 and reg3. Statistics: One-way ANOVA with Dunnett's post-hoc test, **p<0.005, *p<0.05 compared to control gRNA.

[0024] [Figure 14A] Figure 1 shows α-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with select SNCA-targeting gRNAs. Images of various NSC-derived dopaminergic neuron cultures treated with SNCA gRNAs are shown. The top image shows a population of primarily neuronal cells. The bottom image shows a mixed cell population. [Figure 14B] Figure 1 shows α-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with select SNCA-targeting gRNAs. A graph of α-Syn protein levels compared to untransduced control cells is shown. Y-axis: relative α-Syn protein levels normalized to untransduced control cells. + indicates the presence of two hnRNP A1s in the vector, and - indicates the absence of hnRNP A1 in the vector. X-axis: condition. Two replicates were tested per condition. [Figure 14C] Figure 1 shows α-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with select SNCA-targeting gRNAs. A graph of the percentage of TIS editing in human NSC-derived dopaminergic neurons treated with SNCA gRNAs is shown. + indicates the presence of two hnRNP A1s in the vector, and - indicates the absence of hnRNP A1 in the vector. X-axis: condition. Two replicates were tested per condition.

[0025] [Figure 15A]Figure 1 shows α-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with select SNCA-targeting gRNAs. A graph of the percentage of TIS editing in human neurons treated with gRNA1, gRNA2, gRNA, and control is shown. Y-axis: SNCA TIS editing percent; + indicates the presence of two hnRNP A1s in the vector; - indicates the absence of hnRNP A1s in the vector. X-axis: Condition. [Figure 15B] Figure 1 shows α-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with select SNCA-targeting gRNAs. A graph of relative SNCA protein levels after delivery of gRNA1, gRNA2, or gRNA, and control gRNA to human neurons compared to control RNA is shown. Y-axis: relative SNCA protein levels; X-axis: conditions; + indicates the presence of two hnRNP A1s in the vector; - indicates the absence of hnRNP A1 in the vector.

[0026] [Figure 16A] Figure 1 shows that SNCA TIS-guided treatment of NSC- and iPSC-derived neurons contributes to exon skipping of exon 2. Figure 2 shows a gel of PCR-amplified SNCA transcripts in NSC-derived neurons. [Figure 16B] This shows that treatment of NSC- and iPSC-derived neurons with SNCA TIS-guided gene therapy contributes to exon skipping of exon 2. A graph of the percentage of SNCA transcripts in NSC-derived neurons showing SNCA exon 2 skipping in response to gRNA treatment (ddPCR) is shown. Y-axis: % exon 2 skipping; X-axis: condition. + indicates the presence of two hnRNP A1 constructs in the vector; - indicates the absence of hnRNP A1 constructs in the vector. Two replicates were tested per condition. [Figure 16C]Figure 1 shows that SNCA TIS-guided treatment of NSC- and iPSC-derived neurons contributes to exon skipping of exon 2. Figure 2 shows a gel of PCR-amplified SNCA transcripts in iPSC-derived neurons.

[0027] [Figure 17] Figure 1 shows a schematic diagram of a droplet digital PCR (ddPCR) assay for novel splice variants of SNCA. The assay was validated for use in hSNCA mouse and human cell lines. The assay measures the amount of transcripts with novel splice junctions between hSNCA exons 1 and 3 relative to the reference exon 2.

[0028] [Figure 18] Figure 1 shows a schematic diagram of gRNA modifications tested to minimize off-target effects at position -4 of the targeting portion of the gRNA sequence. gRNAs were modified to: 1. move the barbell closer to the target mismatch site; 2. increase the size of the barbell; introduce a U deletion at position -4; and any combination of modifications 1 through 4.

[0029] [Figure 19] 1 shows a graph of RNA editing by SNCA-TIS-targeting gRNA in vitro. Y-axis: % RNA editing, X-axis: guide structure. Parent - P0: SEQ ID NO: 295, Offspring - P15: SEQ ID NO: 333, P16: SEQ ID NO: 390, P18: SEQ ID NO: 334, P20: SEQ ID NO: 335, P22: SEQ ID NO: 391, P24: SEQ ID NO: 336, P26: SEQ ID NO: 392, P28: SEQ ID NO: 393, P28: SEQ ID NO: 394, Structural diversity: SEQ ID NO: 395. DETAILED DESCRIPTION OF THE INVENTION

[0030] RNA editing RNA editing refers to the process in which RNA is modified with specific nucleosides by enzymes after synthesis. RNA editing can involve either the insertion, deletion, or substitution of nucleotide(s). Examples of RNA editing include chemical modifications, such as pseudouridylation (isomerization of uridine residues) and deamination (removal of amine groups from cytidine to produce uridine, or C→U editing; or removal of amine groups from adenosine to produce inosine, or A→I editing). RNA editing can be used to correct mutations (e.g., correct missense mutations) to restore protein expression, as well as to introduce mutations or edit the coding region of RNA to achieve protein knockdown.

[0031] Described herein are engineered guide RNAs that promote RNA editing by RNA editing substances (e.g., RNA adenosine deaminase (ADAR)) or biologically active fragments thereof. For example, the engineered guide RNAs of the present disclosure can promote editing of the transcription start site (e.g., codon 1 transcription start site) of a target SNCA mRNA (e.g., an engineered guide RNA of any one of SEQ ID NOS: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784). In some examples, the ADAR can be an enzyme that catalyzes the chemical conversion of adenosine in RNA to inosine. Because the properties of inosine are similar to those of guanosine (e.g., inosine forms two hydrogen bonds with cytosine), inosine can be recognized as guanosine by the cellular translation machinery. Adenosine-to-inosine (A→i) RNA editing thus effectively alters the primary sequence of the RNA target. Generally, ADAR enzymes share a common domain structure, including a variable number of amino-terminal dsRNA-binding domains (dsRBDs) and a single carboxy-terminal deaminase catalytic domain. Human ADARs have two or three dsRBDs. Evidence suggests that ADARs can form homodimers and heterodimers with other ADARs when bound to double-stranded RNA, although it is currently uncertain whether dimerization is required for editing to occur. The engineered guide RNAs disclosed herein can promote RNA editing by any of the three identified human ADAR genes (ADAR1-3) or any combination thereof. ADARs have a typical modular domain organization, containing at least two copies of a dsRNA-binding domain (dsRBD; ADAR1 has three dsRBDs; ADAR2 and ADAR3 each have two dsRBDs) in their N-terminal region, followed by a C-terminal deaminase domain.

[0032] The engineered guide RNAs of the present disclosure (e.g., engineered guide RNAs comprising any one of the polynucleotide sequences of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) promote RNA editing by endogenous ADAR enzymes (e.g., RNA editing of the SNCA exon 2 codon 1 transcription start site). In some embodiments, the engineered guide RNAs of the present disclosure can be encoded by a polynucleotide comprising any one of the polynucleotide sequences of SEQ ID NOs: 286-292, 325-332, 358-379, 441-776, or 785-792. In some embodiments, an exogenous ADAR can be delivered together with the engineered guide RNAs disclosed herein to promote RNA editing. In some embodiments, the ADAR is human ADAR1. In some embodiments, the ADAR is human ADAR2. In some embodiments, the ADAR is human ADAR3. In some embodiments, the ADAR is human ADAR1, human ADAR2, human ADAR2, or any combination thereof.

[0033] TIS. In some embodiments, an engineered guide RNA of the present disclosure targets a target sequence of a target SNCA RNA that includes the translation start site (TIS), and an adenosine in the TIS is edited. In some embodiments, an engineered guide RNA of the present disclosure (e.g., an engineered guide RNA comprising the polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) may target the codon 1 TIS of exon 2, which corresponds to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4). In some embodiments, an engineered guide RNA targeting the SNCA codon 1 TIS of exon 2 comprises the polynucleotide sequence of any one of SEQ ID NOs: 293-299, 334, or 340. In some embodiments, the engineered guides disclosed herein are at least partially complementary to a target SNCA RNA. In some embodiments, the target SNCA RNA comprises the sequence GCCAUUCGACGACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUUCAUGAAAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUGCUGAG (SEQ ID NO: 300). In some cases, the target SNCA RNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300. The engineered guide RNA of the present disclosure can be used to promote the modification of target RNA (for example, SNCA). In some embodiments, the engineered guide disclosed herein can promote ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 300.In some embodiments, the engineered guide RNA hybridizes to at least 80 bases of a target RNA sequence having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300, promoting protein knockdown. In some embodiments, the engineered guide RNA promotes ADAR-mediated RNA editing of TIS(AUG) to GUG. In some cases, this results in protein knockdown. Protein knockdown can also be referred to as reducing the expression of wild-type protein. In some cases, the engineered guide disclosed herein can promote ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 300, resulting in exon skipping. In some cases, exon skipping, which occurs through editing of the SNCA codon 1 TIS, produces an SNCA mRNA alternative splice variant. Without wishing to be bound by theory, alternative splicing may result in the production of SNCA mRNA alternative splice variants that lack exon 2, which contains the codon 1 TIS. The production of these alternative splice variants that lack exon 2 (and thus the exon 2 codon 1 TIS) results in the knockdown of wild-type α-synuclein protein. Thus, protein knockdown can be achieved either by directly editing the TIS itself (thereby reducing SNCA mRNA transcription) or by indirectly removing the exon 2 TIS by exon skipping.

[0034] Engineered guide RNAs Disclosed herein are engineered guide RNAs (e.g., engineered guide RNAs comprising the polynucleotide sequence of any one of SEQ ID NOS: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) for site-specific selective editing of a target RNA (e.g., the SNCA codon 1 TIS in exon 2, corresponding to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)) by an RNA editing agent or a biologically active fragment thereof, and engineered polynucleotides encoding the same. In some embodiments, the engineered guide RNA targeting the SNCA codon 1 TIS in exon 2 comprises the polynucleotide sequence of any one of SEQ ID NOS: 293-299, 334, or 340. In some embodiments, an engineered guide RNA of the present disclosure may be encoded by a polynucleotide comprising the polynucleotide sequence of any one of SEQ ID NOs: 286-292, 325-332, 358-379, 441-776, or 785-792. In some embodiments, an engineered guide RNA of the present disclosure targets one or more adenosines in the RNA sequence of SEQ ID NO: 300 or a sequence that is at least 80% identical to SEQ ID NO: 300.

[0035] In some embodiments, engineered guide RNAs of the present disclosure that target SNCA comprise microfootprint sequences and / or macrofootprint sequences, each comprising a potential structure that is revealed when the engineered guide RNA hybridizes to the target RNA, and when revealed, the potential structure provides at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. In some embodiments, engineered guide RNAs of the present disclosure form a guide-target RNA scaffold upon hybridization of the engineered guide RNA with a target RNA sequence, comprising (i) a region comprising at least one structural feature and (ii) a macrofootprint, such as a first internal loop (also referred to as a "left bell" or "LB") and a second internal loop (also referred to as a "right bell" or "RB") flanking opposite ends of the guide-target RNA scaffold region, wherein the engineered guide RNA promotes increased amounts of targeted editing of an adenosine in the target RNA via an adenosine deaminase enzyme RNA editor, compared to an otherwise equivalent engineered guide RNA lacking the first and second internal loops. As described herein, the first and second internal loops may be described with reference to their positions relative to an A / C mismatch in the target RNA scaffold, where the A of the A / C mismatch is the targeted adenosine in the SNCA target RNA.

[0036] Provided herein are microfootprint sequences with potential structures that, when revealed, promote adenosine editing of target RNA via adenosine deaminase enzyme. The macrofootprints can serve to guide RNA editing substances (e.g., ADARs) and direct their activity toward the microfootprints. In some embodiments, a nucleotide contained within the microfootprint sequence is positioned opposite the adenosine to be edited by adenosine deaminase when the guide RNA hybridizes to the target RNA, so as not to form a base pair with the edited adenosine. This nucleotide, referred to herein as a "mismatch position" or "mismatch," may be a cytosine. The microfootprint sequences described herein have at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof, upon hybridization of the engineered guide RNA and the target RNA. Engineered guide RNAs with excellent microfootprint sequences can be selected based on their ability to promote editing of a specific target RNA (e.g., SNCA mRNA).

[0037] In some embodiments, a guide RNA of the present disclosure (e.g., a guide RNA comprising any one of the polynucleotide sequences of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) may further comprise a macrofootprint. In some embodiments, the macrofootprint comprises a barbell macrofootprint. The microfootprint may serve to guide an RNA-editing enzyme and direct its activity to the target adenosine to be edited. As used herein, "barbell" refers to a pair of potential internal loop structures revealed upon hybridization of a guide RNA to a target RNA. In some embodiments, each internal loop is located at the 5' or 3' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some aspects, each internal loop is adjacent to opposite sides of the microfootprint sequence. Inserting barbell macrofootprint sequences adjacent to opposite sides of the microfootprint sequence results in the formation of barbell internal loops on opposite sides of the microfootprint upon hybridization of the guide RNA to the SNCA target RNA, thereby providing at least one structural feature that promotes editing of the SNCA target RNA.

[0038] Provided herein are engineered guide RNAs (such as potential guide RNAs comprising microfootprint sequences and / or macrofootprint sequences) and polynucleotides encoding the same; and compositions comprising the engineered guide RNAs or polynucleotides. As used herein, the term "engineered," with respect to a guide RNA or a polynucleotide encoding the same, refers to a non-natural guide RNA or a polynucleotide encoding the same. For example, the present disclosure provides engineered polynucleotides encoding engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some aspects, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0039] The engineered guide RNA as described herein comprises a targeting domain that is complementary to the target RNA described herein. Thus, the guide RNA can be engineered to site-specifically / selectively target a specific target RNA, hybridize therewith, and thereby promote the editing of specific nucleotides of the target RNA by an RNA editor or a biologically active fragment thereof. The targeting domain can comprise a nucleotide that is positioned opposite the base edited by the RNA editor or a biologically active fragment thereof when the guide RNA hybridizes with the target RNA, and does not base-pair with the edited base or does not completely base-pair with the edited base. This mismatch can help restrict the editing of the RNA editor to the desired base of the target RNA. However, in some cases, some off-target editing may occur, and in some cases, significant off-target editing may occur.

[0040] Hybridization of the target RNA and the targeting domain of the guide RNA results in specific secondary structures in the guide-target RNA scaffold that emerge upon hybridization, referred to herein as "cryptic structures." When these structures emerge, they represent structural features described herein, including mismatches, bulges, internal loops, and hairpins. Without wishing to be bound by theory, the presence of structural features described herein that form upon hybridization of the guide RNA with the target RNA configures the guide RNA to promote specific or selective targeted editing of the target RNA by an RNA editor or a biologically active fragment thereof. Furthermore, structural features combined with the mismatches described above typically promote increased amounts of target adenosine editing, less off-target editing, or both, compared to constructs containing only mismatches or constructs with perfect complementarity to the target RNA. Thus, rational design of cryptographic structures in engineered guide RNAs of the present disclosure to generate specific structural features in the guide-target RNA scaffold can be a powerful tool for promoting target RNA editing with high specificity, selectivity, and potent activity.

[0041] Provided herein are engineered guides and polynucleotides encoding them, as well as compositions comprising engineered guide RNAs or polynucleotides. As used herein, the term "engineered" with respect to a guide RNA or a polynucleotide encoding it refers to a non-natural guide RNA or a polynucleotide encoding it. For example, the present disclosure provides an engineered polynucleotide encoding an engineered guide RNA. In some embodiments, the engineered guide comprises RNA. In some aspects, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.

[0042] In some examples, the engineered guides provided herein include engineered guides that can be configured, upon hybridization to a target RNA molecule, to at least partially form a guide-target RNA scaffold with at least a portion of the target RNA molecule, wherein the guide-target RNA scaffold comprises at least one structural feature, and the guide-target RNA scaffold recruits an RNA editor and facilitates chemical modification of nucleotide bases of the target RNA molecule by the RNA editor.

[0043] In some examples, the target RNA of the engineered guide RNA of the present disclosure can be pre-mRNA or mRNA.In some embodiments, the engineered guide RNA of the present disclosure hybridizes to the sequence of the target RNA.In some embodiments, a part of the engineered guide RNA (e.g., targeting domain) hybridizes to the sequence of the target RNA.The part of the engineered guide RNA that hybridizes to the target RNA is sufficiently complementary to the sequence of the target RNA for hybridization to occur.

[0044] A. Targeting Domains The engineered guide RNA disclosed herein can be engineered in any suitable way for RNA editing.In some examples, the engineered guide RNA generally comprises at least a targeting sequence that allows it to hybridize with the region of the target RNA molecule (for example, the SNCA codon 1 TIS of exon 2, which corresponds to the canonical TIS at nucleotide 226 of SNCA transcript variant 1 (NCBI reference sequence: NM_000345.4).The targeting sequence can also be referred to as "targeting domain" or "targeting region".

[0045] In some cases, the targeting domain of the engineered guide allows the engineered guide to target an RNA sequence by base pairing, e.g., Watson-Crick base pairing. In some examples, the targeting sequence can be present at either the N-terminus or C-terminus of the engineered guide. In some cases, the targeting sequence can be present at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155 7, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 nucleotides in length, or up to about 200 nucleotides in length.In some cases, the targeting sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123 The length of the engineered guide RNA can be 3, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides or less. In some examples, the engineered guide RNA comprises a targeting sequence that can be about 60 to about 500, about 60 to about 200, about 75 to about 100, about 80 to about 200, about 90 to about 120, or about 95 to about 115 nucleotides in length. In some examples, the engineered guide RNA comprises a targeting sequence that can be about 100 nucleotides in length.

[0046] In some cases, the targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target RNA. In some cases, the targeting sequence comprises less than 100% complementarity to the target RNA sequence. For example, the targeting sequence and the region of the target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0047] The targeting sequence can have sufficient complementarity to the target RNA to allow hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to a non-contiguous section of sequence. In some embodiments, antisense complementarity refers to a continuous section of sequence.

[0048] In some examples, an engineered guide RNA targeting SNCA may contain multiple targeting sequences. In some examples, one or more target sequence domains of the engineered guide RNA may bind to one or more regions of the target SNCA RNA. For example, a first targeting sequence may be configured to be at least partially complementary to a first region of the target RNA (e.g., the first exon of the pre-mRNA), while a second targeting sequence may be configured to be at least partially complementary to a second region of the target RNA (e.g., the second exon of the pre-mRNA). In some examples, multiple targeting sequences may be operably linked to provide continuous hybridization of multiple regions of the target RNA. In some examples, multiple targeting sequences may provide non-contiguous hybridization of multiple regions of the target RNA. "Discontinuous" overlap or hybridization refers to hybridization of a first region of a target SNCA RNA with a second targeting sequence simultaneously with hybridization of a second region of a target SNCA RNA with a first targeting sequence, where the first and second regions of the target SNCA RNA are non-contiguous (e.g., there is an intervening sequence between the first and second regions of the target RNA). For example, a targeting sequence may be configured to bind to a portion of a first exon and may include an internal asymmetric loop (e.g., an oligotether) configured to bind to a portion of a second exon, while the intervening sequence between a portion of exon 1 and a portion of exon 2 is not hybridized by either the targeting sequence or the oligotether. The use of engineered guide RNAs as described herein configured for discontinuous hybridization may provide numerous advantages. For example, such guides could potentially target pre-mRNAs during transcription (or shortly thereafter) and then facilitate chemical modification using deaminases (e.g., ADARs) co-transcriptionally, thus increasing the overall efficiency of chemical modification. Furthermore, the use of oligo-tethers could result in non-contiguous hybridization, while skipping intervening sequences could result in shorter, more specific guide RNAs with less off-target editing.

[0049] In some instances, an engineered guide RNA configured for non-contiguous hybridization to a target SNCA RNA (e.g., an engineered guide RNA comprising a targeting sequence with an oligo-tether) can be configured to bind to distinct regions of the target SNCA RNA separated by intervening sequences. In some examples, the intervening sequence is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 , 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 41 0, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950 , 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900,5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, The length of the targeting sequence may be 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, or 10000 nucleotides. In some examples, the targeting sequence and oligotether may target separate, non-contiguous regions of the same intron or exon. In some examples, the targeting sequence and oligotether may target separate, non-contiguous regions of adjacent exons or introns. In some examples, the targeting sequence and oligotether may target separate, non-contiguous regions of distal exons or introns.

[0050] In some embodiments, a guide RNA or a polynucleotide encoding a guide RNA disclosed herein may comprise a targeting sequence disclosed in Table 2, such as any one of SEQ ID NOs: 293-299, 333-357 (represented as the DNA sequences of SEQ ID NOs: 286-292, 325-332, 358-374). In some embodiments, a composition may comprise an engineered guide RNA comprising any one of SEQ ID NOs: 293-299, 333-357. In some embodiments, a composition may comprise an engineered guide RNA comprising any one of SEQ ID NOs: 293-299, 334, or 340. In some embodiments, a composition may comprise an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 293-299, 333-357. In some embodiments, a composition may comprise an engineered guide RNA with at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 293-299, 334, or 340. In some embodiments, a composition may comprise a polynucleotide encoding an engineered guide RNA comprising any one of SEQ ID NOs: 293-299, 333-357. In some embodiments, a composition may comprise a polynucleotide encoding an engineered guide RNA comprising any one of SEQ ID NOs: 293-299, 334, or 340. In some embodiments, a composition may comprise a polynucleotide encoding an engineered guide RNA having at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 293-299, 333-357.In some embodiments, a composition may comprise a polynucleotide encoding an engineered guide RNA having at least about: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 293-299, 334, or 340.

[0051] In some embodiments, the hybridization of the targeting domain of the engineered guide RNA to the target SNCA RNA results in protein knockdown. For example, the hybridization of the targeting domain of the engineered guide RNA to the sequence of the target SNCA RNA containing the exon 2 codon 1 TIS can result in the silencing of the codon 1 TIS. This silencing can occur, for example, when the hybridization of the targeting domain to the target SNCA RNA results in ADAR-mediated editing of the adenosine of the codon 1 TIS, thereby converting the AUG start codon to a GUG codon and silencing the codon 1 TIS. Silencing can also occur, for example, when the hybridization of the targeting domain to the target SNCA RNA results in exon skipping of exon 2, thereby silencing the exon 2 TIS by removing it from the mature SNCA mRNA. In some cases, the silencing of the exon 2 codon 1 TIS can occur through both ADAR-mediated editing of the exon 2 TIS and exon skipping of exon 2.

[0052] B. Engineered guide RNAs with recruitment domains In some examples, the engineered guide RNA of the present invention comprises a recruitment domain that recruits an RNA editor (e.g., an ADAR), where in some cases, the recruitment domain is formed and exists in the absence of binding to the target RNA. A "recruitment domain" may also be referred to herein as a "recruitment sequence" or "recruitment region." In some examples, the subject engineered guide can promote editing of nucleotide bases in a target sequence of a target RNA (e.g., SEQ ID NO: 300), which ultimately regulates the expression of a polypeptide encoded by the target RNA. The regulation can be an increase in polypeptide expression or a decrease in polypeptide expression. In some examples, the engineered guide can be configured to promote editing of nucleotides or polynucleotide bases in an RNA region by an RNA editor (e.g., an ADAR). To promote editing, the engineered guide RNA of the present disclosure can recruit an RNA editor (e.g., an ADAR). A variety of RNA editor recruitment domains can be utilized. In some embodiments, the recruitment domain includes: ionotropic glutamate receptor AMPA-type subunit 2 (GluR2), an Alu sequence, or, if recruiting an APOBEC, an APOBEC recruitment domain.

[0053] In some examples, two or more recruitment domains can be included in the engineered guide of the present disclosure. In examples where a recruitment domain is present, the recruitment domain can be used to position the RNA editing substance to effectively react with the subject target RNA after the targeting sequence hybridizes to the target sequence of the target RNA. In some examples, the recruitment domain can allow the RNA editing substance to bind transiently to the engineered guide. In some examples, the recruitment domain can allow the RNA editing substance to bind persistently to the engineered guide. The recruitment domain can be of any length. In some cases, the recruitment domain can be from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 nucleotides up to about 80 nucleotides in length. In some cases, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length or less. In some cases, the recruitment domain can be about 45 nucleotides in length. In some cases, at least a portion of the recruitment domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of the recruitment domain comprises about 45 nucleotides to about 60 nucleotides.

[0054] In some aspects, the recruitment domain comprises a GluR2 sequence or a functional fragment thereof. In some cases, the GluR2 sequence can be recognized by an RNA editing substance, such as an ADAR, or a biologically active fragment thereof. In some aspects, the GluR2 sequence can be a non-naturally occurring sequence. In some cases, the GluR2 sequence can be modified, for example, to enhance recruitment. In some embodiments, the GluR2 sequence can include portions of naturally occurring GluR2 sequences and synthetic sequences.

[0055] In some examples, the recruitment domain comprises a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and / or length to the GluR2 sequence, or GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 1). In some examples, the recruitment domain may comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 1. In some examples, the recruitment domain may comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and / or length to SEQ ID NO: 1.

[0056] Additional RNA editing substance recruitment domains are also contemplated. In embodiments, the recruitment domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEc) domain. In some instances, the APOBEC domain can comprise a non-naturally occurring sequence or a naturally occurring sequence. In some embodiments, the sequence encoding the APOBEC domain can comprise modified portions. In some cases, the sequence encoding the APOBEC domain can comprise a portion of the sequence encoding a naturally occurring APOBEC domain. In another embodiment, the recruitment domain can be derived from an Alu domain.

[0057] Any number of recruitment domains can be found in the engineered guides of the present disclosure. In some instances, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains can be included in an engineered guide. The recruitment domain can be located anywhere in the engineered guide RNA. In some cases, the recruitment domain can be located at the N-terminus, middle, or C-terminus of the engineered guide RNA. The recruitment domain can be located upstream or downstream of the targeting sequence. In some cases, the recruitment domain is adjacent to the targeting sequence of the subject guide. The recruitment sequence can contain all ribonucleotides or deoxyribonucleotides, although in some cases, recruitment domains containing both ribonucleotides and deoxyribonucleotides may not be excluded.

[0058] C. Engineered guide RNAs with potential structures In some examples, the engineered guide disclosed herein that is useful for promoting target RNA editing by an RNA editing substance can be an engineered potential guide RNA. "Engineered potential guide RNA" refers to an engineered guide RNA that includes a potential structure. "Potential structure" refers to a structural feature that is substantially formed when the guide RNA hybridizes to the target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are substantially formed only when the guide RNA hybridizes to the target RNA, so that one or more potential structural features appear as structural features when the guide RNA hybridizes to the target RNA. When the guide RNA hybridizes to the target RNA, the structural feature is formed, thus exposing the potential structure provided by the guide RNA.

[0059] Upon hybridization of the engineered guide RNA of the present disclosure to a target RNA (e.g., SNCA codon 1 TIS), a double-stranded RNA (dsRNA) substrate is formed. The resulting dsRNA substrate is also referred to herein as a "guide-target RNA scaffold."

[0060] Figure 1 shows a legend for various exemplary structural features present in the guide-target RNA scaffold formed upon hybridization of a potential guide RNA of the present disclosure to a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24-bp region (24 nucleotides on the target RNA side base-paired with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Unless otherwise noted, the number of nucleotides involved in a given structural feature is shown as the number of nucleotides on the guide RNA side versus the number of nucleotides on the target RNA side. This legend also provides clues for positional annotations in each figure. For example, the edited target nucleotide is designated as position 0. Each nucleotide downstream (3') of the edited target nucleotide is counted by +1. Each nucleotide upstream (5') of the edited target nucleotide is counted by -1. Thus, an exemplary 2 / 2 symmetric bulge in this legend is located at positions +12 to +13 of the guide-target RNA scaffold. Similarly, a 2 / 3 asymmetric bulge in this legend is located at positions -36 to -37 of the guide-target RNA scaffold. As used herein, positional annotations are provided relative to the edited target nucleotide and on the target RNA side of the guide-target RNA scaffold. As used herein, when a single position is annotated, the structural feature extends from that position away from position 0 (the edited target nucleotide). For example, if a potential guide RNA is annotated herein as forming a 2 / 3 asymmetric bulge at position -36, the 2 / 3 asymmetric bulge will form at positions -36 to -37 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA scaffold.As another example, if a potential guide RNA is annotated herein as forming a 2 / 2 symmetric bulge at position +12, the 2 / 2 symmetric bulge is formed at positions +12 to +13 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA scaffold.

[0061] In some instances, the engineered guides disclosed herein lack a recruitment domain, and recruitment of RNA editors can be achieved by structural features of the guide-target RNA scaffold formed by hybridization of the engineered guide RNA and the target RNA. In some instances, the engineered guide does not contain structural features that recruit RNA editors (e.g., ADARs) when present in aqueous solution and not bound to a target RNA molecule. Upon hybridization to the target RNA, the engineered guide RNA forms one or more structural features with the target RNA molecule that recruit RNA editors (e.g., ADARs).

[0062] In the absence of a recruitment sequence, the engineered guide RNA may still be able to associate with a target RNA editor (e.g., an ADAR) to facilitate editing of the target RNA and / or regulate expression of a polypeptide encoded by the target RNA. This can be achieved by structural features formed in the guide-target RNA scaffold upon hybridization of the engineered guide RNA and the target RNA. The structural features can include any one of a mismatch, a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, a hairpin, a wobble base pair, or any combination thereof.

[0063] A double-stranded RNA (dsRNA) substrate is formed upon hybridization of the engineered guide RNA of the present disclosure to the target RNA. The resulting dsRNA substrate is also referred to herein as a "guide-target RNA scaffold." Structural features that may be present in the guide-target RNA scaffold of the present disclosure are described herein. Examples of features include mismatches, bulges (symmetric or asymmetric bulges), internal loops (symmetric or asymmetric internal loops), or hairpins (mobilizing or non-mobilizing hairpins). The engineered guide RNA of the present disclosure may have 1 to 50 features. Engineered guide RNAs of the present disclosure can have 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 5-20, 1-3, 4-5, 2-10, 20-40, 10-40, 20-50, 30-50, 4-7, or 8-10 features. In some embodiments, structural features (e.g., mismatches, bulges, internal loops) can be formed from potential structures within the engineered potential guide RNA upon hybridization of the engineered potential guide RNA to the target RNA, thus forming the guide-target RNA scaffold. In some embodiments, structural features are not formed from potential structures but instead are preformed structures (e.g., GluR2-recruiting hairpins or U7 snRNA-derived hairpins).

[0064] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a mismatch refers to a single nucleotide in the guide RNA that is not base-paired with an opposing single nucleotide in the target RNA within the guide-target RNA scaffold. A mismatch may include any two single nucleotides that do not base-pair. If the number of involved nucleotides on the guide RNA and target RNA sides exceeds one, the resulting structure is no longer considered a mismatch, but rather a bulge or internal loop, depending on the size of the structural feature. In some embodiments, the mismatch is an A / C mismatch. An A / C mismatch may include a C of an engineered guide RNA of the present disclosure opposite an A of the target RNA. An A / C mismatch may include an A of an engineered guide RNA of the present disclosure opposite a C of the target RNA. A G / G mismatch may include a G of an engineered guide RNA of the present disclosure opposite a G of the target RNA.

[0065] In some embodiments, a mismatch located 5' of the editing site can facilitate base flipping of the edited target A. Mismatches can also serve to confer sequence specificity.

[0066] Thus, mismatches may be structural features formed from potential structures provided by engineered potential guide RNAs.

[0067] In another embodiment, the structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair in the present disclosure may refer to a G paired with a U. Thus, a wobble base pair may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.

[0068] In some cases, the structural feature can be a hairpin. As disclosed herein, a hairpin comprises an RNA duplex in which portions of a single-stranded RNA fold back on themselves to form an RNA duplex. The portions of the single-stranded RNA fold back due to nucleotide sequences that base-pair with each other, separated by an intervening sequence that does not base-pair with itself, thereby forming a base-paired portion and an intervening loop portion that does not base-pair with itself. The hairpin can have an overall duplex length of 10 to 500 nucleotides. The loop portion of the hairpin can be 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein have one hairpin. In some embodiments, the engineered guide RNAs disclosed herein have two hairpins. As disclosed herein, hairpins can be recruitment hairpins or non-recruitment hairpins.Hairpins can be present anywhere within the engineered guide RNA of the present disclosure.In some embodiments, one or more hairpins can be present at or near the 3' end of the engineered guide RNA of the present disclosure, at or near the 5' end of the engineered guide RNA of the present disclosure, at or near the targeting domain of the engineered guide RNA of the present disclosure, or any combination thereof.

[0069] In some embodiments, the structural feature comprises a non-recruiting hairpin. As disclosed herein, the non-recruiting hairpin does not have the primary function of recruiting an RNA editor. Sometimes, the non-recruiting hairpin does not recruit an RNA editor. In some instances, the non-recruiting hairpin has a binding dissociation constant for the RNA editor that is insufficient for binding under physiological conditions. For example, the non-recruiting hairpin has a binding dissociation constant for the RNA editor at 25°C greater than about 1 mM, 10 mM, 100 mM, or 1 M, as measured in an in vitro assay. The non-recruiting hairpin may exhibit the function of improving the localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruiting hairpin improves intranuclear anchoring. In some embodiments, the non-recruiting hairpin comprises a hairpin derived from U7 snRNA. Thus, non-recruiting hairpins, such as those derived from U7 snRNA, are preformed structural features that may be present in constructs containing engineered guide RNA constructs, rather than structural features formed by potential structures introduced into engineered potential guide RNAs.

[0070] Hairpins of the present disclosure can be of any length, hi some embodiments, hairpins can be from about 10 to 500 nucleotides or more. In some cases, the hairpin may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 3, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188 46, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 4, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, or more nucleotides. In other cases, hairpins are 10-20, 10-30, 10-40,10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 10~110, 10~120, 10~130, 10~140, 10~150, 10~160, 10~170, 10~180, 10~190, 10~200, 10~210, 10~220, 10~230, 10~240, 10~250, 10~260, 10~270, 10~280, 10~ It may contain 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0071] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, a bulge refers to a structure that is formed substantially only upon formation of the guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposing strand. A bulge can alter the secondary or tertiary structure of the guide-target RNA scaffold. A bulge can independently have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or a bulge can independently have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, as used herein, the term "bulge" does not refer to a structure in which a single nucleotide involved in an engineered guide RNA and a single nucleotide involved in a target RNA do not base-pair; a single nucleotide involved in an engineered guide RNA and a single nucleotide involved in a target RNA that do not base-pair is referred to herein as a "mismatch." Furthermore, if the number of involved nucleotides on either the guide RNA or the target RNA exceeds four, the resulting structure is no longer considered a bulge, but rather an internal loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has two bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has three bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has four bulges. Thus, a bulge can be a structural feature formed from a potential structure resulting from an engineered potential guide RNA.

[0072] In some embodiments, the presence of a bulge in the guide-target RNA scaffold can position or help position ADARs to selectively edit target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in the guide-target RNA scaffold can recruit or help recruit additional amounts of ADARs. The bulge in the guide-target RNA scaffold disclosed herein can recruit other proteins, such as other RNA editing substances. In some embodiments, a bulge located 5' of the editing site can promote base flipping of the target A to be edited. The bulge can also help impart sequence specificity to the A of the target RNA to be edited compared to other A(s) present in the target RNA. For example, the bulge can help direct ADAR editing by constraining it to a direction that results in selective editing of target A.

[0073] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. A symmetric bulge is formed when the same number of nucleotides are present on both sides of the bulge. For example, a symmetric bulge of a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and two nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and three nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and four nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, the symmetric bulge may be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0074] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. An asymmetric bulge is formed when a different number of nucleotides are present on either side of the bulge. For example, an asymmetric bulge of a guide-target RNA scaffold of the present disclosure can have a different number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide ...2 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold.The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric bulge can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0075] In some embodiments, the asymmetric bulge can be a 1 / 0 asymmetric bulge. In some embodiments, the 1 / 0 asymmetric bulge can be a U deletion. A "U deletion" refers to a 1 / 0 asymmetric bulge in which a U nucleotide of an engineered guide RNA that would be present at a position opposite a non-targeting A of a target RNA of a guide-targeting RNA scaffold has been removed from the engineered guide RNA. In some instances, a 1 / 0 asymmetric bulge containing a U deletion can reduce editing of a non-targeting A compared to a comparable guide RNA lacking the U deletion.

[0076] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, an internal loop refers to a structure that is substantially formed only upon the formation of the guide-target RNA scaffold, in which nucleotides in either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposite strand, and one side of the internal loop on either the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold has five or more nucleotides. If the number of nucleotides involved on both the guide RNA side and the target RNA side is reduced to less than five, the resulting structure is no longer considered an internal loop, but rather a bulge or mismatch, depending on the size of the structural feature. The internal loop can be a symmetric internal loop or an asymmetric internal loop. An internal loop present near the editing site can be useful for base flipping of target A in the target RNA being edited.

[0077] One side of the internal loop, the target RNA side or engineered guide RNA side of the guide-target RNA scaffold, can be formed by 5 to 150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides therebetween. One side of the internal loop may be formed by 5 nucleotides. One side of the internal loop may be formed by 10 nucleotides. One side of the internal loop may be formed by 15 nucleotides. One side of the internal loop may be formed by 20 nucleotides. One side of the internal loop may be formed by 25 nucleotides. One side of the internal loop may be formed by 30 nucleotides. One side of the internal loop may be formed by 35 nucleotides. One side of the internal loop may be formed by 40 nucleotides. One side of the internal loop may be formed by 45 nucleotides. One side of the internal loop may be formed by 50 nucleotides. One side of the internal loop may be formed by 55 nucleotides. One side of the internal loop may be formed by 60 nucleotides. One side of the internal loop may be formed by 65 nucleotides. One side of the internal loop may be formed by 70 nucleotides. One side of the internal loop may be formed by 75 nucleotides. One side of the internal loop may be formed by 80 nucleotides. One side of the internal loop may be formed by 85 nucleotides. One side of the internal loop may be formed by 90 nucleotides. One side of the internal loop may be formed by 95 nucleotides. One side of the internal loop may be formed by 100 nucleotides. One side of the internal loop may be formed by 110 nucleotides. One side of the internal loop may be formed by 120 nucleotides. One side of the internal loop may be formed by 130 nucleotides. One side of the internal loop may be formed by 140 nucleotides. One side of the internal loop may be formed by 150 nucleotides.One side of the internal loop may be formed by 200 nucleotides. One side of the internal loop may be formed by 250 nucleotides. One side of the internal loop may be formed by 300 nucleotides. One side of the internal loop may be formed by 350 nucleotides. One side of the internal loop may be formed by 400 nucleotides. One side of the internal loop may be formed by 450 nucleotides. One side of the internal loop may be formed by 500 nucleotides. One side of the internal loop may be formed by 600 nucleotides. One side of the internal loop may be formed by 700 nucleotides. One side of the internal loop may be formed by 800 nucleotides. One side of the internal loop may be formed by 900 nucleotides. One side of the internal loop may be formed by 1000 nucleotides. Thus, an internal loop may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.

[0078] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The internal loop can be a symmetric internal loop or an asymmetric internal loop. A symmetric internal loop is formed when the same number of nucleotides are present on both sides of the internal loop. For example, a symmetric internal loop of a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 15 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 20 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 20 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 30 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 40 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 50 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 60 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 70 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 80 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 90 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 100 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 110 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 120 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 130 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 140 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 200 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 250 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 300 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 350 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 400 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 450 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 500 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 600 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 700 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 800 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 900 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetric internal loop can be a structural feature formed from a potential structure resulting from a potential engineered guide RNA.

[0079] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The internal loop can be a symmetric internal loop or an asymmetric internal loop. An asymmetric internal loop is formed when a different number of nucleotides is present on either side of the internal loop. For example, the asymmetric internal loop of a guide-target RNA scaffold of the present disclosure can have a different number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0080] The asymmetric internal loop of the present disclosure can be formed by 5 to 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered side of the guide-target RNA scaffold target is different compared to the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 to 1,000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered side of the guide-target RNA scaffold target is different compared to the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 9 nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the A-side. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric internal loop can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0081] As disclosed herein, a "base-paired (bp) region" refers to a region of a guide-target RNA scaffold in which a base of the guide RNA pairs with an opposing base of the target RNA. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near the other end of the guide-target RNA scaffold. A base-paired region can extend between two structural features. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near a structural feature. A base-paired region can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, the base-paired region is from 1 bp to 100 bp, from 1 bp to 90 bp, from 1 bp to 80 bp, from 1 bp to 70 bp, from 1 bp to 60 bp, from 1 bp to 50 bp, from 1 bp to 45 bp, from 1 bp to 40 bp, from 1 bp to 35 bp, from 1 bp to 30 bp, from 1 bp to 25 bp, from 1 bp to 20 bp, from 1 bp to 15 bp, from 1 bp to 10 bp, from 1 bp to 5 bp, from 5 bp to 10 bp, from 5 bp to 20 bp, from 10 bp to 20 bp, from 10 bp to 50 bp, from 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp, At least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.

[0082] The present disclosure provides engineered guide RNAs (e.g., engineered guide RNAs comprising the polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) that target a sequence of a target SNCA RNA (e.g., the codon 1 TIS of exon 2 corresponding to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)). In some embodiments, the target RNA comprises the sequence of SEQ ID NO: 300. In some cases, the target RNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:300.

[0083] In some embodiments, engineered guide RNAs of the present disclosure targeting SNCA codon 1 TIS in exon 2 comprise one or more structural features, wherein the one or more structural features comprise at least a first 6 / 6 symmetric internal loop and at least a second 6 / 6 symmetric loop. In some embodiments, the first 6 / 6 symmetric internal loop is at a position selected from the group consisting of 33, 32, 30, 28, and 26 relative to the target adenosine at position 0.

[0084] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 337.

[0085] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:338 or SEQ ID NO:339.

[0086] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features are a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, or a G / U wobble base at position -25 relative to position 0. and a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:3.

[0087] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:298 or SEQ ID NO:299.

[0088] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:299.

[0089] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:333.

[0090] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:334.

[0091] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:335.

[0092] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features are a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, a G / U wobble base at position -3 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:336.

[0093] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:295.

[0094] In some embodiments, the first 6 / 6 symmetric internal loop is at position 30 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -18 relative to position 0, a 3 / 3 symmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:297.

[0095] In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, a G / U wobble base pair at position 2 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:293.

[0096] In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -10 relative to position 0, a 0 / 1 asymmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:294.

[0097] In some embodiments, the first 6 / 6 symmetric internal loop is at position 26 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA may comprise at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO:296.

[0098] D. Guide with macro footprint The guide RNA of the present disclosure may further comprise a macrofootprint. In some embodiments, the macrofootprint comprises a barbell macrofootprint. The microfootprint may serve to guide the RNA-editing enzyme and direct its activity to the target adenosine to be edited. As described herein, "barbell" refers to a pair of potential internal loop structures that are revealed upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is located at the 5' or 3' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA and the target RNA. In some aspects, each internal loop is adjacent to opposite sides of a microfootprint sequence. Insertion of barbell macrofootprint sequences adjacent to opposite sides of a microfootprint sequence results in the formation of barbell internal loops on opposite sides of the microfootprint upon hybridization of the guide RNA to the target RNA. In some cases, the barbell internal loop may comprise at least one structural feature that facilitates editing of a specific target RNA.

[0099] In some embodiments, the presence of a barbell adjacent to a microfootprint can improve one or more aspects of editing. For example, the presence of a barbell macrofootprint in addition to a microfootprint can result in greater amounts of on-target adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. Additionally and / or alternatively, the presence of a barbell macrofootprint in addition to a microfootprint can result in less localized off-target adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. Furthermore, while the effects of various microfootprint structural features can vary on a target-by-target basis based on selection in high-throughput screens, the enhancement of one or more aspects of editing provided by a barbell macrofootprint structure can be independent of the particular target RNA. For example, a macrofootprint (e.g., a barbell macrofootprint) and a microfootprint can increase the amount of targeted adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. In other embodiments, the presence of a barbell macrofootprint in addition to the microfootprints described herein may result in a lower amount of localized off-target adenosine editing upon hybridization of a guide RNA and a target RNA to form a guide-target RNA scaffold lacking the barbell, compared to an otherwise equivalent guide RNA.

[0100] As described herein, a "microfootprint" sequence refers to a sequence with a cryptic structure that, when revealed, promotes adenosine editing of target RNA via adenosine deaminase enzyme. Macrofootprints can serve to guide or focus RNA editing substances (e.g., ADARs) and direct their activity toward the microfootprint. In some embodiments, the microfootprint sequence contains a nucleotide that, when the guide RNA hybridizes to the target RNA, faces the adenosine edited by the ADAR enzyme and is positioned so as not to base pair with the edited adenosine. This nucleotide, referred to herein as a "mismatch position" or "mismatch," may be a cytosine. The microfootprint sequences described herein have at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof, upon hybridization of the engineered guide RNA and the target RNA. Engineered guide RNAs with excellent microfootprint sequences can be selected based on their ability to promote editing of a specific target RNA. Engineered guide RNAs selected for their ability to promote editing of specific targets can adopt a variety of microfootprint potential structures that can vary on a target-by-target basis.

[0101] In some embodiments, the presence of a barbell adjacent to a microfootprint can improve one or more aspects of editing. For example, the presence of a barbell macrofootprint in addition to a microfootprint can result in greater amounts of on-target adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. Additionally and / or alternatively, the presence of a barbell macrofootprint in addition to a microfootprint can result in less localized off-target adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. Furthermore, while the effects of various microfootprint structural features can vary on a target-by-target basis based on selection in high-throughput screens, the enhancement of one or more aspects of editing provided by a barbell macrofootprint structure can be independent of the particular target RNA. For example, a macrofootprint (e.g., a barbell macrofootprint) and a microfootprint can increase the amount of targeted adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. In other embodiments, the presence of a barbell macrofootprint in addition to the microfootprints described herein may result in a lower amount of localized off-target adenosine editing upon hybridization of a guide RNA and a target RNA to form a guide-target RNA scaffold lacking the barbell, compared to an otherwise equivalent guide RNA.

[0102] The dumbbell design in the engineered guide RNA comprises two symmetric internal loops, and the target A to be edited is positioned between the two symmetric loops for selective editing of the target A. The two symmetric internal loops are formed by 6 nucleotides on the guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold, respectively. Thus, the dumbbell can be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0103] As disclosed herein, a "macrofootprint" sequence can be positioned such that it is adjacent to a microfootprint sequence. Furthermore, while a macrofootprint sequence can be adjacent to a microfootprint sequence, it can also incorporate additional cryptic structures adjacent to either end of the macrofootprint. In some aspects, such additional cryptic structures are included as part of the macrofootprint. In some aspects, such additional cryptic structures are separate from, distinct from, or both the macrofootprint and the macrofootprint. In some embodiments, a macrofootprint sequence can comprise a barbell macrofootprint sequence that includes cryptic structures that, when revealed, generate a first internal loop and a second internal loop.

[0104] In some embodiments, the barbell first internal loop or the barbell second internal loop is positioned at least about 5 bases (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) away from the A / C mismatch relative to the base of the first internal loop or the second internal loop that is closest to the A / C mismatch. In some embodiments, the barbell first internal loop or the barbell second internal loop is positioned up to about 50 bases (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 bases) away from the A / C mismatch relative to the base of the first internal loop or the second internal loop closest to the A / C mismatch.

[0105] In some embodiments, the first internal loop or the second internal loop, independently, is at least about 5 bases or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or less (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 160, 270, 280, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 410, 420, 430, 440, 450, 460, 470, 480, 490, 510, 520, 530, 540, 550, 560, 570, 580, 590, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880 8, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-5 0) and engineered guide RNAs of at least about 5 bases or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or less (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13 , 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5 to 150, 6 to 145, 7 to 140, 8 to 135, 9 to 130, 10 to 125, 11 to 120, 12 to 115, 13 to 110, 14 to 105, 15 to 100, 16 to 95, 17 to 90, 18 to 85, 19 to 80, 20 to 75, 21 to 70, 22 to 65, 23 to 60, 24 to 55, 25 to 50).

[0106] In some embodiments, provided herein are engineered guide RNAs comprising a barbell macrofootprint. In some embodiments, provided herein are engineered guide RNAs comprising a microfootprint. In some embodiments, provided herein are engineered guide RNAs comprising a macrofootprint and a microfootprint. In some cases, the engineered guide RNAs disclosed herein may comprise a microfootprint in the absence of a macrofootprint. In some cases, the engineered guide RNAs disclosed herein may comprise a macrofootprint in the absence of a microfootprint.

[0107] In some embodiments, the macro footprint sequence can include a barbell macro footprint sequence that includes a latent structure that, when manifested, generates a first inner loop and a second inner loop.

[0108] In some examples, the first internal loop is located "near the 5' end of the guide-target RNA scaffold," and the second internal loop is located near the 3' end of the guide-target RNA scaffold. The length of the dsRNA includes the 5' end and the 3' end, and up to half the length of the guide-target RNA scaffold from the 5' end can be considered "near the 5' end," and up to half the length of the guide-target RNA scaffold from the 3' end can be considered "near the 3' end." Non-limiting examples of the 5' end include about 50% or less, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5% of the total length of the dsRNA from the 5' end. Non-limiting examples of the 3' end include about 50% or less, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5% of the total length of the dsRNA on the 3' end.

[0109] In some embodiments, engineered guide RNAs of the present disclosure comprising a barbell macrofootprint sequence (appearing as a first internal loop and a second internal loop) can improve RNA editing efficiency and generally increase the amount or percentage of RNA editing, as well as on-target nucleotide edits, such as on-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure comprising a first internal loop and a second internal loop can also promote a reduction in the amount of off-target nucleotide edits, such as off-target adenosines or unintended adenosine edits, or reduce off-target nucleotide edits. In some instances, the reduction or reduction can be a reduction or reduction in the number of off-target edits or the percentage of off-target edits.

[0110] Each of the first and second internal loops of the barbell macrofootprint can be independently symmetric or asymmetric, where symmetry is determined by the number of bases or nucleotides of the engineered guide RNA and the number of bases or nucleotides of the target RNA that together form each of the first and second internal loops.

[0111] E. Additional Engineered Guide RNA Components The present disclosure provides engineered guide RNAs with additional structural features and components.For example, the engineered guide RNAs described herein can be circular.In another example, the engineered guide RNAs described herein can include a U7 sequence, a smOPT sequence, or a combination of both sequences.

[0112] In some instances, the engineered guide RNA may be circularized. In some cases, the engineered guide RNAs provided herein may be circularized or may be in a circular structure. In some aspects, the at least partially circular guide RNA lacks a 5' hydroxyl or a 3' hydroxyl. In some embodiments, the circular engineered guide RNA may include a guide RNA comprising the polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784.

[0113] In some instances, the engineered guide RNA can comprise a backbone comprising multiple sugar and phosphate moieties covalently linked to one another, hi some instances, the backbone of the engineered guide RNA can comprise a phosphodiester bond linkage between the first hydroxyl group of the phosphate group on the 5' carbon of the deoxyribose of DNA or the ribose of RNA and the second hydroxyl group on the 3' carbon of the deoxyribose of DNA or the ribose of RNA.

[0114] In some embodiments, the backbone of the engineered guide RNA can lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to solvent. In some embodiments, the backbone of the engineered guide can lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to nucleases. In some embodiments, the backbone of the engineered guide can lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to hydrolases. Sometimes, the backbone of the engineered guide can be represented as a polynucleotide sequence in a circular two-dimensional format, where one nucleotide follows another. Sometimes, the backbone of the engineered guide can be represented as a polynucleotide sequence in a looped circular two-dimensional format, where one nucleotide follows another. In some cases, the 5' hydroxyl, the 3' hydroxyl, or both can be linked by a phosphorus-oxygen bond. In some cases, the 5' hydroxyl, the 3' hydroxyl, or both can be modified to a phosphoester by a phosphorus-containing moiety.

[0115] As described herein, an engineered guide can include a circular structure. An engineered polynucleotide can be circularized from an engineered polynucleotide precursor. Such an engineered polynucleotide precursor can be an engineered linear polynucleotide precursor. In some cases, the engineered linear polynucleotide precursor can be a precursor for an engineered circular guide RNA. For example, the engineered linear polynucleotide precursor can be a linear mRNA transcribed from a plasmid that can be configured to circularize in a cell using the techniques described herein. The engineered linear polynucleotide precursor can be constructed with domains, such as a ribozyme domain and a ligation domain, that enable circularization when inserted into a cell. The ribozyme domain can include a domain capable of cleaving the linear precursor RNA at a specific site (e.g., adjacent to the ligation domain). The engineered linear precursor polynucleotide can include, from 5' to 3', a 5' ribozyme domain, a 5' ligation domain, a region to be circularized, a 3' ligation domain, and a 3' ribozyme domain. In some cases, the circularization region can include a guide RNA as described herein. In some cases, the precursor polynucleotide can be specifically processed at both sites by 5' and 3' ribozymes to free exposed ends on the 5' and 3' ligation domains, respectively. The free exposed ends can be ligation elements so that the ends can ligate to form a mature circularized structure. For example, the free ends can include a 5'-OH and a 2',3'-cyclic phosphate ligated via RNA ligation in cells. A linear polynucleotide containing a ligation domain and a ribozyme domain can be transfected into a cell, where it can be circularized via endogenous cellular enzymes. In some cases, the polynucleotide can encode an engineered guide RNA containing a ribozyme domain and a ligation domain described herein, which can be circularized in cells.For example, PCT / US2021 / 034301 provides a description of circular guide RNAs and their structures, sequences of circular guide RNAs, and methods for engineering circularized polynucleotide domains, each of which descriptions in PCT / US2021 / 034301 is incorporated herein by reference.

[0116] An engineered polynucleotide (e.g., a circularized guide RNA) as described herein can include a spacer domain. As described herein, a spacer domain can refer to a domain that provides space between other domains. A spacer domain can be used between the region to be circularized and the adjacent ligation sequence to increase the overall size of the mature circularized guide RNA. When the region to be circularized includes a targeting domain as described herein configured to bind to a target sequence, the addition of a spacer can provide improvements (e.g., increased specificity, enhanced editing efficiency, etc.) for the engineered polynucleotide relative to the target polynucleotide compared to a comparable engineered polynucleotide lacking the spacer domain. Sometimes, the spacer domain is configured so that it does not hybridize with the target RNA. In some embodiments, an engineered polynucleotide precursor or engineered circular guide may include, in 5' to 3' order: a first ribozyme domain; a first ligation domain; a first spacer domain; a targeting domain that may be at least partially complementary to the target RNA, a second spacer domain, a second ligation domain, and a second ribozyme domain. In some cases, the first spacer domain, the second spacer domain, or both are configured such that when the targeting domain binds to the target RNA, the first spacer domain, the second spacer domain, or both do not bind to the target RNA.

[0117] Circular or looped RNAs can be formed by using self-cleaving entities such as ribozymes, tRNAs, aptamers, catalytically active fragments of any of these, or any combination thereof. For example, ribozymes, tRNAs, aptamers, catalytically active fragments of any of these, or any combination thereof can be added to the 3' end, 5' end, or both of the precursor engineered RNA. In another example, ribozymes, tRNAs, aptamers, catalytically active fragments of any of these, or any combination thereof can be added to the 3' end, 5' end, or both of the precursor engineered RNA. The self-cleaving ribozyme can include, for example, RNase P RNA, hammerhead ribozyme (e.g., Schistosoma mansoni ribozyme), glmS ribozyme, HDV-like ribozyme, R2 element, peptidyl transferase 23S rRNA, GIR1 branched ribozyme, leadzyme, group II intron, hairpin ribozyme, VS ribozyme, CPEB3 ribozyme, CoTC ribozyme, or group I intron. In some cases, the self-cleaving ribozyme can be a trans-acting ribozyme that joins one RNA end to a separate RNA end. In some embodiments, an aptamer can be added to each end of the engineered guide RNA. A ligase can be contacted with the aptamer at each end of the engineered guide RNA to form a covalent bond between the aptamers, thereby forming a circular engineered guide RNA. In some cases, a self-cleaving element or aptamer can be configured to promote the self-circularization of an engineered polynucleotide or a pro-polynucleotide (e.g., from a precursor engineered polypeptide) after transcription in a cell. In some cases, circularization of a guide RNA can be demonstrated by PCR. For example, a primer can be developed that binds to the end of the guide RNA and is directed outward so that a product is formed only when the guide is circularized.

[0118] In some cases, circularization can occur by back-slicing and ligation of exons. For example, an RNA can be engineered from 5' to 3' to contain a forward complementary intron, an exon (which may contain a guide sequence), followed by a reverse complementary intron. When transcribed, the complementary introns can hybridize to form dsRNA. The internal exon containing the guide sequence can be removed by splicing and ligated by an endogenous ligase to form a circular guide. In one example, the engineered guide RNA can initiate intracellular circularization by the autocatalytic reaction of an encoded ribozyme. After cleavage by one or more ribozymes, the linear polynucleotide undergoes intracellular RNA ligation at the 5' and 3' ends of the ligation sequence by an endogenous ligase to circularize the guide RNA.

[0119] Suitable self-cleaving molecules may include ribozymes. For example, ribozyme domains can generate autocatalytic RNA. Ribozymes may include RNase P, rRNA (such as peptidyl transferase 23S rRNA), leadzymes, group I intron ribozymes, group II intron ribozymes, GIR1 branched ribozymes, glmS ribozymes, hairpin ribozymes, hammerhead ribozymes, HDV ribozymes, twister ribozymes, twister sister ribozymes, VS ribozymes, pistol ribozymes, hatchet ribozymes, viroids, or any combination thereof. Ribozymes may include P3 twister U2A ribozymes. Ribozymes may include 5'GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT3' (SEQ ID NO: 313). The ribozyme can comprise 5'GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU3 (SEQ ID NO: 314). The ribozyme can comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT3' (SEQ ID NO: 313). The ribozyme can comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU3' (SEQ ID NO: 314). The ribozyme can comprise a P1 twister ribozyme. The ribozyme can comprise 5'AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC 3' (SEQ ID NO: 317). The ribozyme can comprise 5'AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC 3' (SEQ ID NO: 318).It may contain at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC 3' (SEQ ID NO: 317).It may contain at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC 3' (SEQ ID NO: 318).

[0120] The ligation domain can facilitate covalent or non-covalent linkage of a first nucleotide to a second nucleotide. In some embodiments, the ligation domain can recruit a ligation entity to facilitate a ligation reaction. In some cases, the ligation domain can recruit a recombination entity to facilitate homologous recombination. In some cases, the first ligation domain can facilitate covalent or non-covalent binding to a second ligation domain. In some embodiments, the first ligation domain can facilitate complementary pairing of a second ligation domain. In some cases, the ligation domain can include 5'AACCATGCCGACTGATGGCAG3' (SEQ ID NO: 320). In some embodiments, the ligation domain can include 5'GATGTCAGGTGCGGCTGACTACCGTC3' (SEQ ID NO: 321). In some cases, the ligation domain can include 5'AACCAUGCCGACUGAUGGCAG3' (SEQ ID NO: 322). In some cases, the ligation domain may comprise 5'GAUGUCAGGUGCGGCUGACUACCGUC3' (SEQ ID NO: 323). In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACCATGCCGACTGATGGCAG3' (SEQ ID NO: 3129). In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GATGTCAGGTGCGGCTGACTACCGTC3' (SEQ ID NO: 321). In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACCAUGCCGACUGAUGGCAG3' (SEQ ID NO: 322).In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GAUGUCAGGUGCGGCUGACUACCGUC3' (SEQ ID NO: 323).

[0121] The disclosed compositions and methods provide engineered polynucleotides encoding guide RNAs operably linked to portions of small nuclear ribonucleic acid (snRNA) sequences. The engineered polynucleotides can comprise at least a portion of the small nuclear ribonucleic acid (snRNA) sequence. U7 and U1 small nuclear RNAs, whose natural role is in spliceosomal processing of pre-mRNAs, have been engineered for decades to alter splicing at desired disease targets. Replacing the first 18 nt of U7 snRNA (which naturally hybridizes to the spacer element of histone pre-mRNAs) with a short targeting sequence (or antisense) of a disease gene redirects the splicing machinery to alter splicing around the target site. Furthermore, converting the wild-type U7 Sm-domain binding site to an optimized consensus Sm-binding sequence (smOPT) can increase the expression level, activity, and subcellular localization of artificial antisense-engineered U7 snRNAs. Many subsequent groups have adapted this modified U7 smOPT snRNA chassis bearing antisense sequences of other genes to recruit spliceosomal elements and modify RNA splicing for additional disease targets.

[0122] snRNAs are a type of small RNA molecule found in the nucleus of eukaryotic cells. They are involved in various important processes, such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintenance of telomeres. They are always associated with specific proteins, and the resulting RNA-protein complexes are called small nuclear ribonucleoproteins (snRNPs), or sometimes snurps. There are numerous snRNAs, designated U1, U2, U3, U4, U5, U6, U7, U8, U9, and U10.

[0123] U7-type snRNAs are typically involved in the maturation of histone mRNAs. These snRNAs have been identified in numerous eukaryotic species (56 so far), and the U7 snRNAs of each of these species should be considered equally advantageous for the present disclosure.

[0124] The wild-type U7 snRNA contains a stem-loop structure, a U7-specific Sm sequence, and an antisense sequence to the 3' end of the histone pre-mRNA.

[0125] In addition to the SmOPT domain, U7 contains an antisense sequence to the 3' end of histone pre-mRNA. When this sequence is replaced with a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Thus, stable expression of a modified U7 snRNA containing the smOPT domain and a target antisense sequence resulted in specific changes in mRNA splicing. An AAV-2 / 1-based vector expressing an appropriately modified murine U7 gene in conjunction with its native promoter and 3' elements enabled highly efficient gene transfer into skeletal muscle and complete dystrophin restoration by covering and skipping mouse DMD exon 23. The engineered polynucleotides described herein (whether administered directly or, for example, via an AAV vector) can promote editing of target RNAs by deaminases.

[0126] The engineered polynucleotide may comprise, at least in part, a snRNA sequence. The snRNA sequence may be a U1, U2, U3, U4, U5, U6, U7, U8, U9, or U10 snRNA sequence.

[0127] In some instances, engineered polynucleotides comprising at least a portion of an snRNA sequence (e.g., an snRNA promoter, an snRNA hairpin, etc.) may have superior properties for treating or preventing a disease or condition compared to equivalent polynucleotides lacking such characteristics. For example, as described herein, engineered guide RNAs comprising at least a portion of an snRNA sequence can promote exon skipping of an exon with greater efficiency than equivalent polynucleotides lacking such characteristics. Furthermore, engineered polynucleotides described herein comprising at least a portion of an snRNA sequence can promote base editing of nucleotides in a target RNA (e.g., pre-mRNA or mature RNA) with greater efficiency than equivalent polynucleotides lacking such characteristics. Promoter and snRNA components are described in PCT / US2021 / 028618 and PCT / US2022 / 078801, each of which is incorporated herein by reference.

[0128] Disclosed herein is an engineered RNA comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, a smOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 hairpin sequence or a mouse U7 hairpin sequence. In some examples, the human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 301 or RNA: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 302)). In some examples, the mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 303 or RNA: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 304)). In some embodiments, the SmOPT sequence has the sequence AATTTTTGGAG (SEQ ID NO: 305) or RNA:AAUUUUUGGAG (SEQ ID NO: 306). In some embodiments, a guide RNA comprising the polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784 targeting SNCA codon 1 TIS in exon 2 can include a guide RNA comprising a U7 hairpin sequence (e.g., a human or mouse U7 hairpin sequence), an SmOPT sequence, or a combination thereof. In some cases, the combination of a U7 hairpin sequence and an smOPT sequence can include a smOPT U7 hairpin sequence in which the smOPT sequence is linked to the U7 sequence. In some examples, the U7 hairpin sequence, the SmOPT sequence, or a combination thereof is downstream (e.g., 3') of an engineered guide RNA disclosed herein.

[0129] Also disclosed herein are promoters for driving the expression of the guide RNAs disclosed herein. In some examples, the promoter for driving expression can be located 5' to the guide RNA sequence disclosed herein. In some examples, the promoter can include a U1 promoter, a U7 promoter, a U6 promoter, or any combination thereof. In some examples, the promoter can include a CMV promoter. In some examples, the U7 promoter or the U6 promoter can be a mouse U7 promoter or a mouse U6 promoter. In some examples, the U1 promoter, the U7 promoter, or the U6 promoter can be a human U1 promoter, a human U7 promoter, or a human U6 promoter. In some examples, the human U6 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 307).In some examples, the mouse U6 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to GTACTGAGTCGCCCAGTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTTG (SEQ ID NO: 308). In some examples, the human U7 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to TTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA (SEQ ID NO: 309).In some examples, the mouse U7 promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to TTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGC (SEQ ID NO: 310). In some examples, the human U1 promoter is TAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCTCTTGGCGACTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCTGCTT It may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to CGCCACGAAGGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGCCCGAAGATCTC (SEQ ID NO: 311).In some examples, the CMV promoter may comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to (SEQ ID NO: 312).

[0130] E. Chemically modified guide RNA The engineered guide RNAs described herein for use in treating diseases or conditions in subjects can contain at least one chemical modification. In some embodiments, the engineered guide RNAs can contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 50, 100 or more chemical modifications. In some embodiments, the engineered guide RNAs described herein can be free of chemical modifications. In some cases, the engineered guide RNAs disclosed herein with barbell macro footprints can be produced, chemically modified, and delivered directly to subjects in need thereof as RNA (without a vector such as AAV).

[0131] Exemplary chemical modifications include 5' adenylate, 5' guanosine-triphosphate cap, 5' N7-methylguanosine-triphosphate cap, 5' triphosphate cap, 3' phosphate, 3' thiophosphate, 5' phosphate, 5' thiophosphate, Cis-Syn thymidine dimer, trimer, C12 spacer, C3 spacer, C6 spacer, d spacer, PC spacer, r spacer, spacer 18, spacer 9, 3'-3' modification, 5'-5' modification, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desthiobiotin TEG, DNP. TEG, DNP-X, DOTA, dT-biotin, double biotin, PC-biotin, psoralen C2, psoralen C6, TINA, 3'DABCYL, black hole quencher 1, black hole quencher 2, DABCYL SE, dT-DABCYL, IRDye The nucleic acid sequence may include any one of QC-1, QSY-21, QSY-35, QSY-7, QSY-9, a carboxyl linker, a thiol linker, a 2' deoxyribonucleoside analog purine, a 2' deoxyribonucleoside analog pyrimidine, a ribonucleoside analog, a 2'-O-methyl ribonucleoside analog, a sugar-modified analog, a wobble / universal base, a fluorescent dye label, a 2' fluoroRNA, a 2' O-methyl RNA, a methyl phosphonate, a phosphodiester DNA, a phosphodiester RNA, a phosphorothioate DNA, a phosphorothioate RNA, a UNA, a pseudouridine-5'-triphosphate, a 5-methylcytidine-5'-triphosphate, a 2-O-methyl 3-phosphorothioate, or any combination thereof.

[0132] Chemical modification can be performed at any position of the engineered guide RNA. In some cases, the modification can be located at the 5'-end or 3'-end, or both. In some cases, the polynucleotide can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86 6, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, The engineered guide RNA may include a modification at a base selected from 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150. In some cases, two or more modifications may be made to the engineered guide RNA. In some cases, the modifications may be permanent. In other cases, the modifications may be transient. In some cases, multiple modifications may be made to the engineered guide RNA. The engineered guide RNA modifications may alter the physicochemical properties of the nucleotide, such as the conformation, polarity, hydrophobicity, chemical reactivity, base pairing interaction, or any combination thereof.

[0133] In some embodiments, the chemical modification can also be a phosphorothioate substitution. In some cases, natural phosphodiester bonds can be susceptible to rapid degradation by cellular nucleases, and modification of internucleotide linkages using phosphorothioate (PS) bond substitutions can be more stable to hydrolysis by cellular degradation. The modification can increase stability in polynucleic acids. The modification can also enhance biological activity. In some cases, phosphorothioate-enhanced RNA polynucleic acids can inhibit RNase A, RNase T1, calf serum nuclease, or any combination thereof. These properties can enable PS-RNA polynucleic acids to be used in applications where exposure to nucleases may be highly likely in vivo or in vitro. For example, phosphorothioate (PS) bonds can be introduced between the last 3-5 nucleotides at the 5' or 3' end of the polynucleic acid, which can inhibit exonuclease degradation. In some cases, phosphorothioate bonds can be added throughout the polynucleic acid to reduce attack by endonucleases.

[0134] In some embodiments, chemical modifications can occur at the 3'OH group, the 5'OH group, the backbone, the sugar moiety, or the nucleotide base. Chemical modifications can include non-naturally occurring linker molecules in interstrand or intrastrand crosslinks. In one aspect, the chemically modified nucleic acid includes modifications to one or more of the 3'OH or 5'OH group, the backbone, the sugar moiety, or the nucleotide base, or the addition of a non-naturally occurring linker molecule. In some embodiments, the chemically modified backbone includes a backbone other than a phosphodiester backbone. In some embodiments, the modified sugar includes a sugar other than deoxyribose (in modified DNA) or a sugar other than ribose (in modified RNA). In some embodiments, the modified base includes a base other than adenine, guanine, cytosine, thymine, or uracil. In some embodiments, the engineered guide RNA includes at least one chemically modified base. In some cases, the engineered guide RNA can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more modified bases. In some cases, chemical modifications to a base moiety include adenine, guanine, cytosine, thymine, or uracil, as well as natural and synthetic modifications of purine or pyrimidine bases.

[0135] In some embodiments, chemical modifications of engineered guide RNAs can include modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkages, modification of one or more of the linking phosphate oxygens in the phosphodiester backbone linkages, modification of a component of the ribose sugar, replacement of a phosphate moiety with a "dephospho" linker, modification or replacement of a naturally occurring nucleobase, modification of the ribose-phosphate backbone, modification of the 5' end of a polynucleotide, modification of the 3' end of a polynucleotide, modification of the deoxyribose phosphate backbone, replacement of a phosphate group, modification of the ribophosphate backbone, modification to the sugar of a nucleotide, modification to the base of a nucleotide, or modification of any one or any combination of stereochemically pure nucleotides. Chemical modifications to engineered guide RNAs include any of the modifications encompassed herein, although some exemplary modifications are listed in Table 3. [Table 3-1] [Table 3-2]

[0136] Modification of the phosphate backbone In some embodiments, chemical modifications can include modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkages or modification of one or more of the linking phosphate oxygen atoms in the phosphodiester backbone linkages. As used herein, "alkyl" can be meant to refer to a saturated hydrocarbon group, which can be straight-chain or branched. Exemplary alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl or isopropyl), butyl (e.g., n-butyl, isobutyl, or t-butyl), or pentyl (e.g., n-pentyl, isopentyl, or neopentyl). Alkyl groups can contain 1 to about 20, 2 to about 20, 1 to about 12, 1 to about 8, 1 to about 6, 1 to about 4, or 1 to about 3 carbon atoms. As used herein, "aryl" can refer to a monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) aromatic hydrocarbon, e.g., phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, or indenyl. In some embodiments, an aryl group has 6 to about 20 carbon atoms. As used herein, "alkenyl" may refer to an aliphatic group containing at least one double bond. As used herein, "alkynyl" may refer to a straight or branched hydrocarbon chain containing 2 to 12 carbon atoms and characterized by one or more triple bonds. Examples of alkynyl groups may include ethynyl, propargyl, or 3-hexynyl. Or, "aralkyl" may refer to an alkyl moiety in which an alkyl hydrogen atom may be replaced by an aryl group. Aralkyl includes groups in which two or more hydrogen atoms are replaced by aryl groups. Examples of "arylalkyl" or "aralkyl" include benzyl, 2-phenylethyl, 3-phenylpropyl, 9-fluorenyl, benzhydryl, and trityl groups. "Cycloalkyl" can refer to cyclic, bicyclic, tricyclic, or polycyclic non-aromatic hydrocarbon groups having 3 to 12 carbons. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclopentyl, and cyclohexyl. "Heterocyclyl" can refer to a monovalent radical of a heterocyclic ring system. Representative heterocyclyls include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, pyrrolidonyl, piperidinyl, pyrrolinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, and morpholinyl. "Heteroaryl" can refer to a monovalent radical of a heteroaromatic ring system. Examples of heteroaryl moieties can include imidazolyl, oxazolyl, thiazolyl, triazolyl, pyrrolyl, furanyl, indolyl, thiophenylpyrazolyl, pyridinyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolizinyl, purinyl, naphthyridinyl, quinolyl, and pteridinyl.

[0137] In some embodiments, the phosphate group of the chemically modified nucleotide can be modified by replacing one or more of the oxygen atoms with another substituent. In some embodiments, the chemically modified nucleotide can include replacing the unmodified phosphate moiety with a modified phosphate as described herein. In some embodiments, the modification of the phosphate backbone can include a change that results in either an uncharged linker or a charged linker with asymmetric charge distribution. Examples of modified phosphate groups can include phosphorothioate, phosphonothioacetate, phosphoroselenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphonate, and phosphotriester. In some embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced by any of the following groups: sulfur (S), selenium (Se), BR3 (where R can be, for example, hydrogen, alkyl, or aryl), C (e.g., an alkyl group, an aryl group, etc.), H, NR2 (where R can be, for example, hydrogen, alkyl, or aryl), or (where R can be, for example, alkyl or aryl). The phosphorus atom in an unmodified phosphate group can be achiral. However, replacement of one of the non-bridging oxygens with one of the above-mentioned atoms or groups of atoms can make the phosphorus atom chiral. The phosphorus atom in a modified phosphate group can be a stereogenic center. The stereogenic phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). In some cases, the engineered guide RNA can include a stereochemically pure nucleotide containing a phosphorothioate S conformation or a phosphorothioate R conformation. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 95%. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 96%.In some embodiments, the chiral phosphate product can be present in 97% diastereomeric excess. In some embodiments, the chiral phosphate product can be present in 98% diastereomeric excess. In some embodiments, the chiral phosphate product can be present in 99% diastereomeric excess. In some embodiments, both non-bridging oxygens of the phosphorodithioate can be replaced with sulfur. The phosphorus center of the phosphorodithioate can be achiral, preventing the formation of oligoribonucleotide diastereomers. In some embodiments, modifications to one or both non-bridging oxygens can also include replacing the non-bridging oxygen with a group independently selected from S, Se, B, C, H, N, and OR (R can be, for example, alkyl or aryl). In some embodiments, the phosphate linker can also be modified by replacing the bridging oxygen (i.e., the oxygen connecting the phosphate to the nucleoside), nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate). In some cases, the replacement can occur at either or both of the linking oxygens.

[0138] In certain embodiments, nucleic acids include linked nucleic acids. Nucleic acids can be linked together using any internucleic acid linkage. Two major classes of internucleic acid linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleic acid linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (P=S). Representative non-phosphorus-containing internucleic acid linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-OC(O)-S-), thionocarbamate (-OC(O)(NH)-S-), siloxane (-O-Si(H)2-O-), and N,N*-dimethylhydrazine (-CH2-N(CH3)-N(CH3). In certain embodiments, internucleic acid linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers, e.g., alkylphosphonates and phosphorothioates. Non-natural nucleic acids can contain a single modification. Non-natural nucleic acids can contain multiple modifications within one of the sites or between different sites.

[0139] In some cases, backbone phosphate modifications to nucleic acids include, but are not limited to, methylphosphonates, phosphorothioates, phosphoramidates (bridged or unbridged), phosphotriesters, phosphorodithioates, phosphodithioates, and boranophosphates, which can be used in any combination. Other non-phosphate linkages may also be used.

[0140] In some embodiments, backbone modifications (e.g., methylphosphonate, phosphorothioate, phosphoramidate, and phosphorodithioate internucleotide linkages) can confer immunomodulatory activity to the modified nucleic acids and / or enhance their in vivo stability.

[0141] In some cases, the phosphorus derivative (or modified phosphate group) can be attached to a sugar or sugar analog moiety therein and can be a monophosphate, diphosphate, triphosphate, alkylphosphonate, phosphorothioate, phosphorodithioate, phosphoramidate, etc.

[0142] In some cases, backbone modifications include replacing phosphodiester linkages with alternative moieties such as anionic, neutral, or cationic groups. Examples of such modifications include anionic internucleoside linkages; N3'-P5' phosphoramidate modifications; boranophosphate DNA; prooligonucleotides; neutral internucleoside linkages such as methylphosphonates; amide-linked DNA; methylene (methylimino) linkages; formacetal and thioformacetal linkages; backbones containing sulfonyl groups; morpholino oligos; peptide nucleic acids (PNAs), and positively charged deoxyribonucleic guanidine (DNG) oligos. Modified nucleic acids can include chimeric or mixed backbones containing one or more modifications, for example, a combination of phosphate linkages, such as a combination of phosphodiester and phosphorothioate linkages.

[0143] In some cases, alternatives to phosphate include, for example, short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatom or heterocyclic internucleoside linkages.These include morpholino linkages (formed in part from the sugar portion of nucleoside); siloxane backbone; sulfide, sulfoxide and sulfone backbone; formacetyl and thioformacetyl backbone; methyleneformacetyl and thioformacetyl backbone; alkene-containing backbone; sulfamate backbone; methyleneimino and methylenehydrazino backbone; sulfonic acid and sulfonamide backbone; amide backbone; and nucleotide substitutes with other components having mixed N, O, S and CH2 component parts.It can also be understood in nucleotide substitution that both the sugar and phosphate portion of nucleotide can be replaced by, for example, amide-type linkage (aminoethylglycine) (PNA). For example, it may be possible to link other types of molecules (conjugates) to nucleotide or nucleotide analogues to enhance cellular uptake.In some cases, conjugates can be chemically bound to nucleotide or nucleotide analogues.Such conjugates include, but are not limited to, cholesterol moieties, thioethers such as hexyl-S-tritylthiol, thiocholesterol, aliphatic chains such as dodecanediol or undecyl residues, phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium l-di-O-hexadecyl-rac-glycero-SH-phosphonate, polyamines or polyethylene glycol chains, or lipid moieties such as adamantane acetic acid, palmityl moieties, or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties.

[0144] In some embodiments, the chemical modifications described herein can include modifications of the phosphate backbone. In some embodiments, the engineered guide RNAs described herein can include at least one chemically modified phosphate backbone. Exemplary chemical modifications of the phosphate group or backbone can include replacing one or more of the oxygens with another substituent. Furthermore, modified nucleotides present in the engineered guide RNA can include replacing an unmodified phosphate moiety with a modified phosphate described herein. In some embodiments, the phosphate backbone modification can include changes that result in either an uncharged linker or a charged linker with an asymmetric charge distribution. Exemplary modified phosphate groups can include phosphorothioates, phosphonothioacetates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced by any of the following groups: sulfur (S), selenium (Se), BR (where R can be, for example, hydrogen, alkyl, or aryl), C (e.g., an alkyl group, an aryl group, etc.), H, NR (where R can be, for example, hydrogen, alkyl, or aryl), or OR (where R can be, for example, alkyl or aryl). The phosphorus atom in an unmodified phosphate group can be achiral. However, replacement of one of the non-bridging oxygens with one of the above-mentioned atoms or groups of atoms can make the phosphorus atom chiral; that is, the phosphorus atom in the phosphate group modified in this way can be a stereogenic center. The stereogenic phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). In such cases, the chemically modified engineered guide RNA can be stereochemically pure (e.g., S or R conformation). In some cases, the chemically modified engineered guide RNA contains stereochemically pure phosphate modifications.For example, the chemically modified engineered guide RNA may comprise a phosphorothioate S conformation or a phosphorothioate R conformation.

[0145] Phosphorodithioates have both non-bridging oxygens replaced by sulfur. The phosphorus center of phosphorodithioates can be achiral, preventing the formation of oligoribonucleotide diastereomers. In some embodiments, modifications to one or both non-bridging oxygens can also include replacing the non-bridging oxygen with a group independently selected from S, Se, B, C, H, N, and OR (R can be, for example, alkyl or aryl).

[0146] In some cases, the phosphate linker can also be modified by replacement of the bridging oxygen (i.e., the oxygen connecting the phosphate to the nucleoside), nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate). Replacement can occur at either or both bridging oxygens.

[0147] Replacement of the phosphate moiety In some embodiments, at least one phosphate group of the engineered guide RNA may be chemically modified. In some embodiments, the phosphate group may be replaced with a non-phosphorus-containing connector. In some embodiments, the phosphate moiety may be replaced with a dephosphorylated linker. In some embodiments, the charged phosphate group may be replaced with a neutral group. In some cases, the phosphate group may be replaced with methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. In some embodiments, the nucleotide analogs described herein may also be modified at the phosphate group. Modified phosphate groups can include modifications at the bond between two nucleotides, such as phosphorothioates, chiral phosphorothioates, phosphodiates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidates and aminoalkylphosphoramidates), thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. In some cases, the phosphate or modified phosphate bond between two nucleotides can be via a 3'-5' or 2'-5' bond, and the bond can include reverse polarities, such as 3'-5' to 5'-3' or 2'-5' to 5'-2'.

[0148] Phosphate group substitution In some embodiments, the chemical modifications described herein can include modifications by replacement of a phosphate group. In some embodiments, the engineered guide RNAs described herein can include at least one chemical modification including phosphate group substitution or replacement. Exemplary phosphate group replacements can include non-phosphorus-containing connectors. In some embodiments, the phosphate group substitution or replacement can include replacing the charged phosphate group with a neutral moiety. Exemplary moieties that can replace the phosphate group can include methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.

[0149] Modification of the ribophosphate backbone In some embodiments, the chemical modifications described herein can include modifying the ribophosphate backbone of the engineered guide RNA. In some embodiments, the engineered guide RNA described herein can include at least one chemically modified ribophosphate backbone. Exemplary chemically modified ribophosphate backbones can include scaffolds that can mimic nucleic acids, which can also be constructed, where the phosphate linker and ribose sugar can be replaced by a nuclease-resistant nucleoside or nucleotide surrogate. In some embodiments, the nucleobase can be tethered by an alternative backbone. Examples include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0150] Sugar modifications In some embodiments, the chemical modifications described herein can include sugar modifications. In some embodiments, the engineered guide RNAs described herein can include at least one chemically modified sugar. Exemplary chemically modified sugars can include a 2' hydroxyl group (OH) that has been modified or replaced with several different "oxy" or "deoxy" substituents. In some embodiments, modifications to the 2' hydroxyl group can enhance nucleic acid stability because the hydroxyl can no longer be deprotonated to form a 2'-alkoxide ion. 2'-alkoxides can catalyze decomposition by intramolecular nucleophilic attack on the linker atom. Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar); polyethylene glycol (PEG), O(CH2CHO) n CH2CH2OR (wherein R can be, for example, H or an optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20)). In some embodiments, the "oxy"-2' hydroxyl group modification includes (LNA, where the 2' hydroxyl can be connected to the 4' carbon of the same ribose sugar, e.g., by a Ci-6 alkylene or Cj-6 heteroalkylene bridge; exemplary bridges can include methylene, propylene, ether, or amino bridges); O-amino (amino can be, e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, ethylenediamine, or polyamino); and aminoalkoxy, O(CH) n-amino (amino can be, for example, NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the "oxy"-2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CHOCH3, e.g., PEG derivatives). In some cases, the deoxy modification can include hydrogen (i.e., deoxyribose sugars, e.g., in partial overhanging portions of dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (amino can be, for example, NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diaryloarylamino, or amino acid); NH(CH2CH2NH) nThe sugar group may include CH2CH2-amino (amino can be, for example, as described herein); NHC(O)R (R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); cyano; mercapto; alkyl-thio-alkyl; thioalkyl; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which can be optionally substituted, for example, with amino, as described herein. In some cases, the sugar group can also contain one or more carbons that have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include nucleotides that contain, for example, arabinose as the sugar. A nucleotide "monomer" can have an alpha linkage at the Γ position on the sugar, e.g., an alpha-nucleoside. Modified nucleic acids can also include "abasic" sugars that lack a nucleobase at C-. Abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that can be in the L-form, e.g., an L-nucleoside. In some aspects, the engineered guide RNAs described herein include the sugar group ribose, which can be a five-membered ring with oxygen. Exemplary modified nucleosides and nucleotides can include replacing the oxygen in the ribose (e.g., with sulfur (S), selenium (Se), or an alkylene, such as methylene or ethylene); adding a double bond (e.g., replacing the ribose with a cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., forming a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., forming a six- or seven-membered ring with additional carbon or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino, which also have phosphoramidate backbones). In some embodiments, modified nucleotides can include polycyclic forms (e.g., tricyclic; and "unlocked" forms, such as glycol nucleic acids (GNAs) (e.g., R-GNAs or S-GNAs, in which the ribose can be replaced by a glycol unit linked to a phosphodiester bond), threose nucleic acids.In some embodiments, modifications to the sugars of the engineered guide RNA include modifying the engineered guide RNA to include a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), or a bridged nucleic acid (BNA).

[0151] Modification of the ribose sugar components In some embodiments, the engineered guide RNAs described herein may include at least one chemical modification of the ribose sugar moiety. In some embodiments, the chemical modification of the ribose sugar moiety may include 2'-O-methyl, 2'-O-methoxy-ethyl (2'-MOE), 2'-fluoro, 2'-aminoethyl, 2'-deoxy-2'-fuloarabinou-cleic acid, 2'-deoxy, 2'-O-methyl, 3'-phosphorothioate, 3'-phosphonoacetate (PACE), or 3'-phosphonothioacetate (thioPACE). In some embodiments, the chemical modification of the ribose sugar moiety comprises a non-natural nucleic acid. In some cases, the non-natural nucleic acid comprises modifications at the 5' and 2' positions of the sugar ring, such as a 5'-CH2-substituted 2'-O-protected nucleoside. In some cases, non-natural nucleic acids include amide-linked nucleoside dimers that can be prepared for incorporation into oligonucleotides. In some cases, the 3'-linked nucleosides in the dimers (5' to 3') include 2'-OCH3 and 5'-(S)-CH3. Non-natural nucleic acids can include 2'-substituted 5'-CH2 (or O) modified nucleosides. Non-natural nucleic acids can include 5'-methylene phosphonate DNA and RNA monomers and dimers. Non-natural nucleic acids can include 5' phosphonate monomers with 2' substitutions and other modified 5' phosphonate monomers. Non-natural nucleic acids can include 5'-modified methylene phosphonate monomers. Non-natural nucleic acids can include 5' or 6' phosphonate ribonucleoside analogs containing hydroxyl groups at the 5' and / or 6' positions. Non-natural nucleic acids can include 5' phosphonate deoxyribonucleoside monomers and dimers with a 5' phosphate group. Non-natural nucleic acids can include nucleosides with a 6' phosphonate group, and the 5' and / or 6' positions can be unsubstituted or substituted with a thio-tert-butyl group (SC(CH3)3) (and analogs thereof), a methyleneamino group (CH2NH2) (and analogs thereof), or a cyano group (CN) (and analogs thereof).

[0152] In some embodiments, non-natural nucleic acids also include modifications to the sugar moiety. In some cases, nucleic acids can include one or more nucleosides, wherein the sugar group is modified. Such sugar-modified nucleosides can confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property. In certain embodiments, nucleic acids can include chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituents (including 5' and / or 2' substituents), bridging of two ring atoms to form bicyclic nucleic acids, and the substitution of S, N(R), or C(R1)(R2) (R = H, C1-C) of the ribosyl ring oxygen atom. 12 alkyl or protecting groups), and combinations thereof.

[0153] In some cases, the engineered guide RNAs described herein may contain modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, the sugar moiety can be a pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, or a sugar "analogous" cyclopentyl group. The sugar can be in pyranosyl or furanosyl form. The sugar moiety can be a furanoside of ribose, deoxyribose, arabinose, or 2'-O-alkylribose, and the sugar can be attached to the respective heterocyclic base in either the [alpha] or [beta] anomeric configuration. Sugar modifications include, but are not limited to, 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA / DNA chimeras. For example, the sugar modification can include 2'-O-methyl-uridine or 2'-O-methyl-cytidine. Sugar modifications include 2'-O-alkyl substituted deoxyribonucleosides and 2'-O-ethylene glycol-like ribonucleosides.

[0154] In some cases, modifications to the sugar moiety include natural modifications of ribose and deoxyribose, as well as non-natural modifications. Sugar modifications include, but are not limited to, the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl (where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6). 10 , alkyl, or C2-C 10 (Alkenyl, and alkynyl). 2' sugar modifications also include -O[(CH2) n O] m CH3, -O(CH2) n OCH3, -O(CH2) n NH2, -O(CH2) n CH3, -O(CH2) n ONH2 and -O(CH2) n Other chemical modifications at the 2' position include, but are not limited to, C1-C1O-N[(CH2)nCH3)]2, where n and m can be 1-10. 10Modifications include, but are not limited to, lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic or pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. Similar modifications can also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3'-terminal nucleotide or in 2'-5'-linked oligonucleotides, and the 5' position of 5'-terminal nucleotides. Chemically modified sugars also include sugars containing modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs can also have sugar mimetics, such as a cyclobutyl moiety in place of the pentofuranosyl sugar. Examples of nucleic acids with modified sugar moieties include, but are not limited to, nucleic acids containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH, and 2'-O(CH)OCH substituents. Substituents at the 2' position also include allyl, amino, azido, thio, O-allyl, O-(C-C 1O alkyl), OCF3, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), and O-CH2-C(=O)-N(R m )(R n ) can be selected from each R m and R n are independently H or substituted or unsubstituted C-C 10 It is alkyl.

[0155] In certain embodiments, the nucleic acids described herein can comprise one or more bicyclic nucleic acids. In certain such embodiments, the bicyclic nucleic acid comprises a bridge between the 4' ribosyl ring atom and the 2' ribosyl ring atom. In certain embodiments, the nucleic acids provided herein can comprise one or more bicyclic nucleic acids, wherein the bridge comprises a 4'-2' bicyclic nucleic acid. Examples of 4'-2' bicyclic nucleic acids include, but are not limited to, one of the formulas 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2', and 4'-CH(CHOCH3)-O-2', and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof.

[0156] Modifications on the base of a nucleotide In some embodiments, the chemical modifications described herein can include modifications of the base (e.g., nucleobase) of a nucleotide. Exemplary nucleobases can include adenine (A), thymine (T), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or replaced in the engineered guide RNAs described herein. The nucleobases of a nucleotide can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can be naturally occurring or synthetic derivatives of bases.

[0157] In some embodiments, the chemical modifications described herein may include modifying uracil. In some embodiments, the engineered guide RNAs described herein may include at least one chemically modified uracil. Exemplary chemically modified uracils include pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl -uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, l-taurin nomethyl-4-thio-pseudouridine, 5-methyl-uridine, 1-methyl-pseudouridine, 5-methyl-2-thio-uridine, l-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydroundine, dihydropseudouridine, 5,6-Dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropylpseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl-sh uridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, l-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(lE-propenylamino)uridine, pyrazolo[3,4-d]pyrimidine, xanthine, and hypoxanthine.

[0158] In some embodiments, the chemical modifications described herein may include modifying cytosines. In some embodiments, the engineered guide RNAs described herein may include at least one chemically modified cytosine. Exemplary chemically modified cytosines include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza- -zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, and 2'-OH-ara-cytidine.

[0159] In some embodiments, the chemical modification described herein may include modifying adenine. In some embodiments, the engineered guide RNA described herein may include at least one chemically modified adenine. Exemplary chemically modified adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza- 8-Aza-2,6-diaminopurine, 1-methyl-adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N 6-Methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine may be mentioned.

[0160] In some embodiments, the chemical modification described herein may include modifying guanine. In some embodiments, the engineered guide RNA described herein may include at least one chemically modified guanine. Exemplary chemically modified guanines include guanosine, 1-methyl-guanosine, guanosine, methylguanosine, 4-demethyl-guanosine, isowyosine, guanosine, peroxyguanosine, hydroxyguanosine, unmodified hydroxyguanosine, 7-deaza-guanosine, queosine, epoxyqueosine, galactosyl-queosine, mannosyl-queosine, 7-cyano-7-deaza-guanosine, ... -aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2, N2-dimethyl-guanosine, N 2,7-dimethyl-guanosine, N2,N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-metathio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine , 1-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1,2'-O-dimethyl-inosine, 6-O-phenyl-2'-deoxyinosine, 2'-O-ribosylguanosine, 1-thio-guanosine, 6-O-methyguanosine, O6-methyl-2'-deoxyguanosine, 2'-F-ara-guanosine, and 2'-F-guanosine.

[0161] In some cases, chemical modification of the engineered guide RNA may include the introduction or substitution of a nucleic acid analog or a non-natural nucleic acid into the engineered guide RNA. In some embodiments, the nucleic acid analog may be any one of the chemically modified nucleic acids described herein. Exemplary nucleic acid analogs can be found in PCT / US2021 / 034272, PCT / US2015 / 025175, PCT / US2014 / 050423, PCT / US2016 / 067353, PCT / US2018 / 041503, PCT / US18 / 041509, PCT / US2004 / 011786, or PCT / US2004 / 011833, all of which are expressly incorporated by reference in their entirety. In some cases, the chemically modified nucleotides described herein can include variants of guanosine, uridine, adenosine, thymidine, and cytosine, including any naturally occurring or non-naturally occurring guanosine, uridine, adenosine, thymidine, or cytidine that has been chemically modified, for example, by acetylation, methylation, or hydroxylation. Exemplary chemically modified nucleotides include 1-methyl-adenosine, 1-methyl-guanosine, 1-methyl-inosine, 2,2-dimethyl-guanosine, 2,6-diaminopurine, 2'-amino-2'-deoxyadenosine, 2'-amino-2'-deoxycytidine, 2'-amino-2'-deoxyguanosine, 2'-amino-2'-deoxyuridine, 2-amino-6-chloropurine riboside, 2-aminopurine riboside, 2'-araadenosine, 2'-aracytidine, 2'-arauridine, 2'-azido-2'-deoxyadenosine, 2'-azido-2'-deoxy Cytidine, 2'-azido-2'-deoxyguanosine, 2'-azido-2'-deoxyuridine, 2-chloroadenosine, 2'-fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'-fluoro-2'-deoxyuridine, 2'-fluorothymidine, 2-methyl-adenosine, 2-methyl-guanosine, 2-methyl-thio-N6-isopenenyl-adenosine, 2'-O-methyl-2-aminoadenosine, 2'-O-methyl-2'-deoxyadenosine, 2'-O-methyl-2'-deoxycytidine,2'-O-methyl-2'-deoxyguanosine, 2,-O-methyl-2'-deoxyuridine, 2'-O-methyl-5-methyluridine, 2'-O-methylinosine, 2'-O-methylpseudouridine, 2-thiocytidine, 2-thio-cytidine, 3-methyl-cytidine, 4-acetyl-cytidine, 4-thiouridine, 5-(carboxyhydroxymethyl)-uridine, 5,6-dihydrouridine, 5-aminoallylcytidine, 5-aminoallyl-deoxyuridine, 5-bromouridine, 5-carboxymethylaminomethyl-2-thio-uracil, 5-carboxymethylammonomethyl-uracil, 5-chloro-ara-cytosine, 5-fluoro-uridine, 5-iodouridine, 5 -Methoxycarbonylmethyl-uridine, 5-methoxy-uridine, 5-methyl-2-thio-uridine, 6-azacytidine, 6-azauridine, 6-chloro-7-deaza-guanosine, 6-chloropurine riboside, 6-mercapto-guanosine, 6-methyl-mercaptopurine-riboside, 7-deaza-2'-deoxy-guanosine, 7-deazaadenosine, 7-methyl-guanosine, 8-azaadenosine, 8-bromo-adenosine, 8-bromo-guanosine, 8-mercapto-guanosine, 8-oxoguanosine, benzimidazole-riboside, beta-D-mannosyl-queosine, dihydro-uridine, boar, N1-methyladenosine, N6-([6-aminohexyl] (carbamoylmethyl)-adenosine, N6-isopentenyl-adenosine, N6-methyl-adenosine, N7-methyl-xanthosine, N-uracil-5-oxyacetic acid methyl ester, puromycin, queosin, uracil-5-oxyacetic acid, uracil-5-oxyacetic acid methyl ester, wybutoxosin, xanthosine, and xylo-adenosine. In some embodiments, the chemically modified nucleic acids described herein may include 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate,2'-O-methyl-inosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate Xyluridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate phosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, 6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or xanthosine-5'-triphosphate. In some embodiments, the chemically modified nucleic acids described herein are selected from the group consisting of pyridin-4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine,The nucleotides include at least one chemically modified nucleotide selected from 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine. In some embodiments, the artificial nucleic acids described herein are selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine , 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In some embodiments, the chemically modified nucleic acids described herein include 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyl adenosine, N6-(cis-hydroxyisopentenyl)adenosine,The nucleotides include at least one chemically modified nucleotide selected from 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In other embodiments, the chemically modified nucleic acids described herein may comprise at least one chemically modified nucleotide selected from inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-thio-6-thio-guanosine. In certain embodiments, the chemically modified nucleic acids described herein are selected from the group consisting of 6-aza-cytidine, 2-thio-cytidine, alpha-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, alpha-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, The nucleotides may include at least one chemically modified nucleotide selected from alpha-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytildine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-isocytide, 6-chloro-purine, N6-methyl-adenosine, alpha-thio-adenosine, 8-azido-adenosine, and 7-aza-adenosine.

[0162] In some embodiments, modified bases in non-natural nucleic acids include, but are not limited to, uracil-5-yl, hypoxanthine-9-yl (I), 2-aminoadenin-9-yl, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl These include uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo-especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Certain unnatural nucleic acids, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 substituted purines, N-6 substituted purines, O-6 substituted purines, 2-aminopropyladenine, 5-propynyluracil, 5-propynylcytosine, 5-methylcytosine, those that enhance the stability of duplex formation, universal nucleic acids, hydrophobic nucleic acids, promiscuous nucleic acids, size-expanded nucleic acids, fluorinated nucleic acids, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, such as 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyl (-C≡C-CH3)uracil, other alkynyl derivatives of 5-propynylcytosine, pyrimidine nucleic acids, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil),4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo especially 5-bromo, 5-trifluoromethyl, other 5-substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, tricyclic pyrimidines, phenoxy sazine cytidine ([5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamp, phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrimido[ 3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one), in which the purine or pyrimidine base may be replaced by other heterocycles, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, 2-pyridone, azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil, 5,6-dihydrocytosine, 5-iodocytosine Cytosine, hydroxyurea, iodouracil, 5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and 5-iodouracil, 2-amino-adenine, 6-thio-guanine, 2-thio-thymine, 4-thio-thymine, 5-propynyl-uracil, 4-thio-uracil, N4-ethylcytosine, 7-deazaguanine, 7-deaza-8-azaguanine, 5-hydroxycytosine, 2'-deoxyuridine, or 2-amino-2'-deoxyadenosine.

[0163] In some cases, the at least one chemical modification may include chemically modifying the 5' or 3' end of the engineered guide RNA, such as a 5' cap or 3' tail. In some embodiments, the engineered guide RNA may include a chemical modification including a 3' nucleotide, which may be stabilized against degradation, for example, by incorporating one or more of the modified nucleotides described herein. In this embodiment, uridine may be replaced with a modified uridine, such as 5-(2-amino)propyluridine and 5-bromouridine, or any of the modified uridines described herein, and adenosine and guanosine may be replaced with a modified adenosine and guanosine, for example, an 8-position modification, such as 8-bromoguanosine, or any of the modified adenosines or guanosines described herein. In some embodiments, a deazanucleotide, such as 7-deaza-adenosine, may be incorporated into the gRNA. In some embodiments, O- and N-alkylated nucleotides, such as N6-methyladenosine, may be incorporated into the gRNA. In some embodiments, sugar-modified ribonucleotides can be incorporated, e.g., the 2'OH group can be replaced with a group selected from H, -OR, -R (R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), halo, -SH, -SR (R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), amino (amino can be, e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or an amino acid), or cyano (-CN). In some embodiments, the phosphate backbone can be modified, e.g., with a phosphothioate group, as described herein.In some embodiments, the nucleotides in the overhang region of the gRNA can each independently be modified or unmodified nucleotides, including 2'-sugar modified nucleotides such as, but not limited to, 2-F 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), or any combination thereof.

[0164] Targets and Treatment Methods The present disclosure provides compositions of engineered guide RNAs or engineered polynucleotides encoding guide RNAs and methods of their use, such as methods of treatment. In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs that target coding sequences of RNAs (e.g., TISs).

[0165] The present disclosure provides engineered guide RNAs that, upon contact with SNCA RNA, promote editing of SNCA RNA to knock down expression of alpha-synuclein protein. Knockdown of alpha-synuclein protein by the engineered guide RNAs of the present disclosure results in a reduction of alpha-synuclein protein by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% compared to the amount before contacting the engineered guide RNA with SNCA RNA. In some embodiments, the target SNCA RNA comprises a sequence at least 80% identical to SEQ ID NO: 300.

[0166] Alpha-synucleinopathies are characterized by alpha-synuclein dysfunction, overexpression, and / or aggregation and are associated with neurodegenerative disorders through genetic and neuropathological evidence. The gene encoding the alpha-synuclein protein is called SNCA. In Parkinson's disease (PD), gene duplications and variants of SNCA (e.g., A53T) that promote alpha-synuclein aggregation result in early-onset and severe forms of the disease. Therefore, engineered guide RNAs of the present disclosure can target SNCA for RNA editing, thereby causing a reduction in alpha-synuclein synthesis and promoting the removal of aggregates. In some embodiments, the present disclosure provides engineered guide RNA compositions that target SNCA and promote ADAR-mediated RNA editing of SNCA by targeting a critical adenosine present in the translation start site (TIS) for deamination, thereby reducing pathogenic levels of alpha-synuclein. In some embodiments, the engineered guide RNAs of the present disclosure target the coding sequence of SNCA. For example, the coding sequence may be the translation initiation site (TIS) (AUG) of SNCA, and the engineered guide RNA may promote ADAR-mediated RNA editing of the AUG to a GUG. Thus, engineered guide RNAs of the present disclosure that target these sites in SNCA can promote editing that results in reduced expression of alpha-synuclein protein. In some embodiments, the TIS targeted by the engineered guide RNA of the present disclosure is located at codon 1 of SNCA. In some embodiments, the engineered guide RNA of the present disclosure targets any critical adenosine in the native TIS of SNCA. For example, in some embodiments, the engineered guide RNA targets the AUG at position 265 of SNCA exon 2 to promote ADAR-mediated editing to a GUG, thereby reducing alpha-synuclein expression. Assays for confirming successful RNA editing may include next-generation sequencing (NGS), Sanger sequencing, qPCR, ddPCR, fluorescent Western blot, and alpha-synuclein-specific sandwich ELISA. In some embodiments, any of the engineered guide RNAs disclosed herein are packaged into an AAV vector and delivered virally.In some embodiments, administering a composition provided herein is sufficient to reduce the expression of alpha-synuclein protein in a subject compared to the amount of alpha-synuclein protein before administration, as determined by an in vitro or in vivo assay. In some embodiments, the in vitro assay comprises an immunosorbent assay or a sequencing assay. In some embodiments, the in vivo assay comprises obtaining a biological sample from a subject and performing an in vitro assay, such as an enzyme-linked immunosorbent assay (ELISA).

[0167] As disclosed herein, ADAR-mediated editing of the target sequence of the target SNCA RNA (SEQ ID NO: 300) by an engineered guide RNA can be used to reduce the expression of alpha-synuclein protein. Reduction of alpha-synuclein can be used to treat diseases or conditions associated with alpha-synuclein. In some embodiments, the disease or condition is a synucleinopathy. Editing of the target SNCA RNA as described herein, accompanied by reduction of alpha-synuclein levels, can be used to reduce or prevent the aggregation of alpha-synuclein protein. Thus, one or more symptoms associated with the aggregation of alpha-synuclein (e.g., synucleinopathy) can be treated by administering the engineered guide RNAs described herein.

[0168] As disclosed herein, administration of an engineered guide RNA described herein that targets SNCA RNA to a subject can be used to treat a disease or condition associated with alpha-synuclein, e.g., to treat one or more symptoms associated with the disease or condition. In some embodiments, the disease or condition is associated with alpha-synuclein aggregation in the subject's brain. In some embodiments, the disease or condition is at least one selected from the group consisting of neurodegenerative diseases, Parkinson's disease, tremor, muscle rigidity, muscle rigidity, bradykinesia, dementia with Lewy bodies (DLB), multiple system atrophy (MSA), pure autonomic neuropathy (PAF), and REM sleep behavior disorder (RBD). In some embodiments, the disease or condition can be Parkinson's disease. In some embodiments, one or more symptoms of Parkinson's disease can be treated by administration of an engineered guide RNA that targets SNCA RNA as described herein. For example, administration of an engineered guide RNA may be sufficient to reduce resting tremor, muscle rigidity, difficulty standing, difficulty walking, difficulty moving, involuntary movements, muscle rigidity, incoordination, rhythmic muscle contractions, slow movements, bradykinesia, slow shuffling gait, or any combination thereof. In some embodiments, treatment of Parkinson's disease includes improving cognitive function. For example, a subject administered an engineered guide RNA targeting SNCA of the present disclosure may show improvement in cognitive ability or motor skill tests compared to pre-administration performance. In some embodiments, a subject may show improvement in a Unified Parkinson's Disease Rating Scale (UPDRS) test, such as the MDS-UPDRS test. In some embodiments, a subject may be evaluated by imaging techniques, such as MRI or CAT scan, to monitor the progression of a disease or condition. For example, MRI imaging may be used to visualize a subject's neurons over the course of treatment to monitor the progress of treatment. In some embodiments, destruction of neurons in the substantia nigra may be monitored throughout the treatment period.

[0169] As disclosed herein, administration of the engineered guide RNAs of the present disclosure can be used to reduce alpha-synuclein protein levels by knockdown to treat diseases or conditions associated with alpha-synuclein. Although reduction is achieved by administration, residual alpha-synuclein may still be present after administration. In some instances, the presence of reduced alpha-synuclein protein levels treats a disease or condition without reducing the level of alpha-synuclein protein levels to zero. Such levels can be determined in an in vitro assay using a sample obtained from a subject. In some instances, levels can be determined in vivo using imaging techniques such as MRI, as described above. Treatment can result in the improvement of certain biomarkers in a subject. For example, treatment can result in a reduction of SNCA in the CSF, a reduction in blood SNCA, a reduction in neurofilament A levels in the CSF, or any combination thereof.

[0170] In some embodiments, engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of 1-100% of target adenosines. Engineered guide RNAs of the present disclosure may promote editing of 40-90% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 5% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 10% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 15% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 20% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 25% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 30% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 35% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 40% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 45% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 50% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 55% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 60% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 65% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 70% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 75% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may facilitate the editing of at least 80% of target adenosines.In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 85% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 90% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 95% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 100% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 5-20% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 20-40% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 40-60% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 60-80% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 80-100% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 60-80% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of 70-90% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% or more of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 80% or more of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of up to 90% or more of target adenosines. Optionally, engineered guide RNAs of the present disclosure may further promote these levels of on-target RNA editing while maintaining editing of less than 10% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 30% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 25% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 20% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 15% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 10% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 9% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 8% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 7% of off-target adenosines.In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 6% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 5% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 4% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 3% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 2% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of less than 1% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote these levels of on-target RNA editing while maintaining editing of 0% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 30% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 29% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 28% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 27% of off-target adenosines.In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 26% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 25% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 24% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 23% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 22% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 21% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 20% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 19% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 18% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 17% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 16% of off-target adenosines.In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 15% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 14% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 13% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 12% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 11% of off-target adenosines. In some embodiments, engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 10% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 9% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 8% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 7% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 6% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 5% of off-target adenosines.In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 4% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 3% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 2% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of less than 1% of off-target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure may promote editing of at least 70% of target adenosines while maintaining editing of 0% of off-target adenosines.

[0171] In some embodiments, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of SNCA, resulting in protein level knockdown. Protein level knockdown is quantified as a reduction in alpha-synuclein protein expression. The engineered guide RNAs of the present disclosure can promote 1% to 100% alpha-synuclein knockdown. The engineered guide RNAs of the present disclosure may promote alpha-synuclein knockdown of 1% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, 90% to 100%, 20% to 40%, 30% to 50%, 40% to 60%, 50% to 70%, 60% to 80%, 20% to 50%, 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%. In some embodiments, the engineered guide RNAs of the present disclosure promote 30% to 60% alpha-synuclein knockdown, which can be measured by an assay comparing a sample or subject treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.

[0172] The engineered guide RNAs of the present disclosure can be used in methods for treating a disorder in a subject in need thereof. The disorder can be any condition associated with a disease, condition, genotype, phenotype, or adverse effect. In some embodiments, treating a disorder can include preventing, slowing progression, reversing, or alleviating symptoms of the disorder. The method for treating a disorder can include delivering an engineered polynucleotide encoding the engineered guide RNA to cells of a subject in need thereof and expressing the engineered guide RNA in the cells. In some embodiments, the engineered guide RNAs of the present disclosure can be used to treat genetic disorders (e.g., synucleinopathies such as Parkinson's disease). In some embodiments, the engineered guide RNAs of the present disclosure can be used to treat conditions associated with one or more mutations.

[0173] Pharmaceutical Composition The compositions described herein (e.g., compositions comprising engineered guide RNAs or engineered polynucleotides) can be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or non-human animal). Pharmaceutically acceptable carriers can include, but are not limited to, phosphate-buffered saline, water, emulsions (e.g., oil / water emulsions or water / oil emulsions), glycerol, liquid polyethylene glycol, aprotic solvents (e.g., dimethyl sulfoxide, N-methylpyrrolidone, or mixtures thereof), and various types of wetting agents, solubilizers, antioxidants, bulking agents, protein carriers such as albumin, any solvents, dispersion media, coating agents, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions can also include stabilizers and preservatives. Additional examples of carriers, stabilizers, and adjuvants compatible with the compositions of the present disclosure can be found, for example, in Remington's Pharmaceutical Sciences, 21st Ed., Mack Publ. Co., Easton, Pa. (2005), which is incorporated herein by reference in its entirety.

[0174] In some instances, pharmaceutical compositions may be formulated in unit-dosage or multiple-dosage forms. In some instances, a unit-dosage form may be a physically discrete unit suitable for administration to a human or non-human subject (e.g., an animal). In some instances, the unit-dosage forms may be individually packaged. In some instances, each unit dose contains a predetermined amount of active ingredient(s), which may be sufficient to produce a desired therapeutic effect in association with a pharmaceutical carrier, diluent, excipient, or any combination thereof. In some instances, a unit-dosage form comprises an ampoule, a syringe, or individually packaged tablets and capsules, or any combination thereof. In some instances, a unit-dosage form may be contained in a disposable syringe. In some instances, a unit-dosage form is administered individually or in multiples thereof. In some instances, a multiple-dosage form comprises multiple identical unit-dosage forms packaged in a single container that may be administered separately as unit-dosage forms. Examples of multiple-dosage forms include, but are not limited to, vials, bottles of tablets or capsules, or pint or gallon bottles. In some instances, multiple-dosage forms contain the same pharmaceutically active agent. In some instances, the multiple dosage forms contain different pharmaceutically active agents.

[0175] In some instances, the pharmaceutical composition comprises a pharmaceutically acceptable excipient, hi some instances, the excipient comprises a buffering agent, a cryopreservative, a preservative, a stabilizer, a binder, a compression agent, a lubricant, a chelating agent, a dispersion enhancer, a disintegrant, a flavoring agent, a sweetening agent, or a coloring agent, or any combination thereof.

[0176] In some examples, the excipient comprises a buffering agent. In some examples, the buffering agent comprises sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, calcium bicarbonate, or any combination thereof. In some examples, the buffering agent comprises sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium gluconate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium monohydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, or calcium hydroxide and other calcium salts, or any combination thereof.

[0177] In some examples, the excipient comprises a cryopreservative. In some examples, the cryopreservative comprises DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the cryopreservative comprises sucrose, trehalose, starch, a salt of any of these, a derivative of any of these, or any combination thereof. In some examples, the excipient comprises a pH agent (to minimize oxidation or degradation of the components of the composition), a stabilizer (to prevent denaturation or degradation of the components of the composition), a buffer (to increase temperature stability), a solubilizer (to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a nonionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient comprises sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSa), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HCl, disodium edetate, lecithin, glycerin, xanthan gum, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof. In some examples, the excipient can be an excipient described in Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986).

[0178] In some examples, the excipient includes a preservative. In some examples, the preservative includes an antioxidant such as α-tocopherol and ascorbate, an antibacterial agent such as paraben, chlorobutanol, and phenol, or any combination thereof. In some examples, the antioxidant includes EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), sodium sulfite, p-aminobenzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol, or N-acetylcysteine, or any combination thereof. In some examples, the preservative comprises validamycin A, TL-3, sodium orthovanadate, sodium fluoride, Na-tosyl-Phe-chloromethylketone, Na-tosyl-Lys-chloromethylketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitors, phosphatase inhibitors, caspase inhibitors, granzyme inhibitors, cell adhesion inhibitors, cell division inhibitors, cell cycle inhibitors, lipid signaling inhibitors, protease inhibitors, reducing agents, alkylating agents, antimicrobial agents, oxidase inhibitors, or other inhibitors, or any combination thereof.

[0179] In some examples, the excipient comprises a binder, ie, starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamide, polyvinyloxoazolidone, polyvinyl alcohol, C12-C18 fatty acid alcohol, polyethylene glycol, polyol, sugar, oligosaccharide, or any combination thereof.

[0180] In some examples, the binder may be a starch, such as potato starch, corn starch, or wheat starch; a sugar, such as sucrose, glucose, dextrose, lactose, or maltodextrin; a natural and / or synthetic gum; gelatin; a cellulose derivative, such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropylmethyl cellulose, carboxymethyl cellulose, methyl cellulose, or ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); a wax; calcium carbonate; calcium phosphate; an alcohol, such as sorbitol, xylitol, mannitol, or water, or any combination thereof.

[0181] In some examples, the excipient comprises a lubricant. In some examples, the lubricant comprises magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oil, hydrogenated vegetable oil (STEROTEX®), hydrogenated cottonseed oil, polyoxyethylene monostearate, talc, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, or light mineral oil, or any combination thereof. In some examples, the lubricant comprises a metal stearate (e.g., magnesium stearate, calcium stearate, aluminum stearate), a fatty acid ester (e.g., sodium stearyl fumarate), a fatty acid (e.g., stearic acid), a fatty alcohol, glyceryl behenate, mineral oil, paraffin, hydrogenated vegetable oil, leucine, polyethylene glycol (PEG), a metal lauryl sulfate (e.g., sodium lauryl sulfate, magnesium lauryl sulfate), sodium chloride, sodium benzoate, sodium acetate, or talc, or a combination thereof.

[0182] In some instances, the excipient comprises a dispersion enhancer, which in some instances comprises starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isomorphous silicates, or microcrystalline cellulose, or any combination thereof as a high HLB emulsifier surfactant.

[0183] In some examples, the excipient comprises a disintegrant. In some examples, the disintegrant comprises a non-effervescent disintegrant. In some examples, the non-effervescent disintegrant comprises starch, such as corn starch, potato starch, pregelatinized starch and modified starch thereof, sweeteners, clay, such as bentonite, microcrystalline cellulose, alginate, sodium starch glycolate, or gum, such as agar, guar gum, carob gum, karaya gum, pectin, and tragacanth, or any combination thereof. In some examples, the disintegrant comprises an effervescent disintegrant. In some examples, suitable effervescent disintegrants include bicarbonate in combination with citric acid and sodium bicarbonate in combination with tartaric acid.

[0184] In some instances, the excipient comprises a sweetener, a flavoring agent, or both. In some instances, sweeteners include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts, such as its sodium salt; dipeptide sweeteners, such as aspartame; dihydrochalcones, glycyrrhizin; Stevia rebaudiana (stevioside); chloro derivatives of sucrose, such as sucralose; and sugar alcohols, such as sorbitol, mannitol, and xylitol, or any combination thereof. In some instances, flavoring agents incorporated into the composition include synthetic flavor oils and flavoring fragrances; natural oils; extracts from plants, leaves, flowers, and fruits; or any combination thereof. In some embodiments, flavoring agents include cinnamon oil; oil of wintergreen; peppermint oil; clover oil; hay oil; anise oil; eucalyptus oil; vanilla; citrus oils, such as lemon oil, orange oil, grape oil, and grapefruit oil; and fruit essences, including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot, or any combination thereof.

[0185] In some examples, the excipient comprises a pH agent (e.g., to minimize oxidation or degradation of components of the composition), a stabilizer (e.g., to prevent denaturation or degradation of components of the composition), a buffer (e.g., to increase temperature stability), a solubilizer (e.g., to increase protein solubility), or any combination thereof. In some examples, the excipient comprises a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient includes sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSa), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HCl, disodium edetate, lecithin, glycerin, xanthan gum, soy isoflavone, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof. In some examples, the excipient includes a cryopreservation agent. In some examples, the excipient includes DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the excipient comprises sucrose, trehalose, starch, a salt of any of these, a derivative of any of these, or any combination thereof.

[0186] In some examples, the pharmaceutical composition includes a diluent. In some examples, the diluent includes water, glycerol, methanol, ethanol, or other similar biocompatible diluents, or any combination thereof. In some examples, the diluent includes an aqueous acid, such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid, or any combination thereof. In some examples, the diluent includes an alkali metal carbonate, such as calcium carbonate; an alkali metal phosphate, such as calcium phosphate; an alkali metal sulfate, such as calcium sulfate; a cellulose derivative, such as cellulose, microcrystalline cellulose, or cellulose acetate; magnesium oxide, dextrin, fructose, dextrose, glyceryl palmitostearate, lactitol, choline, lactose, maltose, mannitol, simethicone, sorbitol, starch, pregelatinized starch, talc, xylitol, and / or an anhydride, hydrate, and / or a pharmaceutically acceptable derivative thereof, or a combination thereof.

[0187] In some instances, the pharmaceutical composition includes a carrier. In some instances, the carrier includes a liquid or solid filler, solvent, or encapsulating material. In some instances, the carrier includes additives such as proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides; derivatized sugars, e.g., alditols, aldol acids, esterified sugars, and the like; and polysaccharides or sugar polymers), alone or in combination.

[0188] delivery An engineered guide RNA (e.g., an engineered guide RNA comprising the polynucleotide sequence of any one of SEQ ID NOS: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) or an engineered polynucleotide (e.g., an engineered polynucleotide encoding an engineered guide RNA (e.g., an engineered polynucleotide comprising the polynucleotide sequence of any one of SEQ ID NOS: 286-292, 325-332, 358-379, 441-776, or 785-792) of the present disclosure can be delivered via a delivery vehicle. In some embodiments, the delivery vehicle is a vector. The vector can facilitate delivery of the engineered guide RNA to a cell to genetically modify the cell. In some examples, the vector comprises DNA, e.g., double-stranded or single-stranded DNA. In some examples, the delivery vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector or a plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette. In some embodiments, the viral vector comprises a viral capsid, an inverted terminal repeat sequence, and the engineered polynucleotide can be used to deliver the engineered guide RNA to a cell.

[0189] In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentiviral vector (e.g., human or porcine), a herpesvirus vector, an Epstein-Barr virus vector, an SV40 viral vector, a poxvirus vector, or a combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0190] In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be of a specific serotype. In some embodiments, the viral vector is selected from the group consisting of AAV1 serotype, AAV2 serotype, AAV3 serotype, AAV4 serotype, AAV5 serotype, AAV6 serotype, AAV7 serotype, AAV8 serotype, AAV9 serotype, AAV10 serotype, AAV11 serotype, AAV12 serotype, AAV13 serotype, AAV14 serotype, AAV15 serotype, AAV16 serotype, AAV.rh8 serotype, AAV.rh10 serotype, AAV.rh20 serotype, AAV.rh39 serotype, AAV.Rh74 serotype, AAV.RHM4-1 serotype, AAV.hu37 serotype, AAV.Anc80 serotype, AAV.Anc80L65 serotype, AAV.7m8 serotype, AAV.PHP.B serotype , AAV2.5 serotype, AAV2tYF serotype, AAV3B serotype, AAV.LK03 serotype, AAV.HSC1 serotype, AAV.HSC2 serotype, AAV.HSC3 serotype, AAV.HSC4 serotype, AAV.HSC5 serotype, AAV.HSC6 serotype, AAV.HSC7 serotype, AAV.HSC8 serotype, AAV.HSC9 serotype, AAV.HSC10 serotype, AAV.HSC11 serotype, AAV.HSC12 serotype, AAV.HSC13 serotype, AAV.HSC14 serotype, AAV.HSC15 serotype, AAV.HSC16 serotype, and AAVhu68 serotype, a derivative of any of these serotypes, or any combination thereof.

[0191] In some embodiments, the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.

[0192] In some embodiments, the AAV vector may be a recombinant AAV (rAAV) vector. Methods for producing recombinant AAV vectors may be known in the art and, in some cases, typically involve introducing into a producer cell line a plasmid construct containing (1) DNA necessary for AAV replication and AAV capsid synthesis, (b) one or more helper constructs containing viral functions missing from the AAV vector, (c) a helper virus, and (d) the genome of the AAV vector, such as ITRs, a promoter, and an engineered guide RNA sequence. In some instances, the viral vectors described herein may be engineered by synthetic or other suitable means with reference to published sequences, such as those available in the literature. For example, the genome and protein sequences of various AAV serotypes, as well as sequences of natural terminal repeats (TRs), Rep proteins, and capsid subunits, may be known in the art and may be found in the literature or public databases, such as GenBank or the Protein Data Bank (PDB).

[0193] In some examples, a method for producing a delivery vector described herein includes packaging an engineered polynucleotide (e.g., an engineered polynucleotide encoding an engineered guide RNA) disclosed herein into an AAV vector. In some examples, a method for producing a delivery vector described herein includes (a) introducing into a cell (i) a polynucleotide comprising a promoter and an engineered guide RNA disclosed herein, and (ii) a viral genome comprising a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or a modified form thereof; (b) expressing the wild-type AAV capsid protein or a modified form thereof in the cell; (c) assembling AAV particles; and (d) packaging the engineered guide RNA disclosed herein into the AAV particles, thereby generating an AAV delivery vector. In some examples, the recombinant vector includes one or more inverted terminal repeat sequences, including 5' inverted terminal repeat sequences, 3' inverted terminal repeat sequences, and mutant inverted terminal repeat sequences. In some instances, the variant terminal repeat sequences lack terminal dissociation sites, thereby allowing the formation of self-complementary AAV.

[0194] In some examples, hybrid AAV vectors can be produced by capsid conversion, e.g., packaging inverted terminal repeats (ITRs) from a first serotype into a capsid of a second serotype, where the first and second serotypes may not be the same. In some examples, the Rep gene and ITRs from a first AAV serotype (e.g., AAV2) can be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), where the first and second AAV serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising AAV2 ITRs and AAV9 capsid proteins can be designated AAV2 / 9. In some examples, hybrid AAV delivery vectors include AAV2 / 1, AAV2 / 2, AAV2 / 4, AAV2 / 5, AAV2 / 6, AAV2 / 8, or AAV2 / 9 vectors.

[0195] In some examples, the AAV vector can be a chimeric AAV vector. In some examples, the chimeric AAV vector contains foreign amino acids or amino acid substitutions, or capsid proteins from two or more serotypes. In some examples, the chimeric AAV vector can be engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0196] In some instances, the AAV vector comprises a self-complementary AAV genome, which may be generally known in the art and may contain both DNA strands that can anneal to each other to form double-stranded DNA.

[0197] In some examples, the delivery vector can be a retroviral vector. In some examples, the retroviral vector can be a Moloney murine leukemia virus vector, a spleen necrosis virus vector, or a vector derived from Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, or mammary tumor virus, or a combination thereof. In some examples, the retroviral vector can be transfected so that most of the sequences encoding the viral structural genes (e.g., gag, pol, and env) can be removed and replaced with a gene(s) of interest.

[0198] In some examples, the delivery vehicle may be a non-viral vector. In some examples, the delivery vehicle may be a plasmid. In some embodiments, the plasmid comprises DNA. In some examples, the plasmid comprises circular double-stranded DNA. In some examples, the plasmid may be linear. In some examples, the plasmid comprises one or more genes of interest and one or more regulatory elements. In some examples, the plasmid comprises a bacterial backbone including an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the plasmid may be a minicircle plasmid. In some examples, the plasmid contains one or more genes that provide a selectable marker for transducing target cells and maintaining the plasmid. In some examples, the plasmid may be formulated for delivery by injection with a syringe equipped with a needle. In some examples, the plasmid may be formulated for delivery by electroporation. In some examples, the plasmid may be engineered by synthesis or other suitable means known in the art. For example, in some cases, genetic elements can be assembled by restriction digestion of a desired gene sequence from a donor plasmid or organism to generate DNA ends that can then be easily ligated to another gene sequence.

[0199] In some embodiments, the vector containing the engineered guide RNA or engineered polynucleotide is a non-viral vector system. In some embodiments, the non-viral vector system comprises a cationic lipid or polymer. For example, the non-viral vector system may be a liposome or a polymer nanoparticle. In some embodiments, the engineered polynucleotide or the non-viral vector containing the engineered polynucleotide is delivered to cells by hydrodynamic injection or ultrasound.

[0200] Administration Administration can refer to methods that can be used to deliver the compositions described herein (e.g., containing an engineered guide RNA or an engineered polynucleotide encoding the same) to a desired biological site of action. For example, an engineered guide RNA (e.g., an engineered guide RNA containing any one of the polynucleotide sequences set forth in SEQ ID NOS: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) can be contained in a DNA construct, a viral vector, or both, and administered intravenously. Administration as disclosed herein to an area requiring treatment or therapy can be achieved, for example, but not limited to, by oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. In some embodiments, delivery includes inhalation, auricular, intraoral, conjunctival, dental, intracervical, intranasal, intratracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-arterial, intra-articular, intra-biliary, intra-bronchial, intra-synovial, intracardiac, intrachondral, intracavitary, intracavernous, intraluminal, intraventricular, intracisternal, intracorneal, intracoronary, intracoronary, intracavernous, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural. , intraprostatic, intrapulmonary, intrasinus, intraspinal, intrasynovial, intratendon, intratesticular, intrathoracic, intracanalicular, intratumoral, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous infusion, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ocular, oral, oropharyngeal, parenteral, transdermal, periarticular, epidural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, ​​vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic, or any combination thereof. Delivery may include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion), oral administration, inhalation administration, intraduodenal administration, rectal administration, or a combination thereof. Delivery may also include direct application to the affected tissue or area of ​​the body.In some cases, local administration may include administering lotions, solutions, emulsions, creams, balms, oils, pastes, sticks, aerosols, foams, jelly, foams, masks, pads, powders, solids, tinctures, butters, patches, gels, sprays, drops, liquid formulations, or ointments to the external surface of a surface such as the skin. Delivery may include injection into the parenchyma, intrathecal injection, intraventricular injection, or intracisternal injection. The compositions provided herein may be administered by any method. Administration may be by intraarterial injection, intracisternal injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intraspinal injection, intrathecal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection, epidural injection, or any combination thereof. Delivery may also include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion administration). In some aspects, delivery may include nanoparticles, liposomes, exosomes, extracellular vesicles, implants, or combinations thereof. In some cases, delivery may be from a device. In some instances, delivery may be performed by a pump, an infusion pump, or a combination thereof. In some aspects, delivery may be by enema, eye drops, nasal spray, or any combination thereof. In some instances, a subject may administer the composition without supervision. In some instances, a subject may administer the composition under the supervision of a medical professional (e.g., a doctor, nurse, medical assistant, janitor, hospice worker, etc.). In some embodiments, a medical professional may administer the composition.

[0201] In some examples, the pharmaceutical compositions disclosed herein may be administered at a dose of from about 0.0001 mg / kg to about 100 mg / kg of subject's body weight, from about 0.001 mg / kg to about 0.05 mg / kg of subject's body weight, from about 0.005 mg / kg to about 0.05 mg / kg of subject's body weight, from about 0.001 mg / kg to about 0.005 mg / kg of subject's body weight, from about 0.05 mg / kg to about 0.5 mg / kg of subject's body weight, from about 0.001 mg / kg to about 0.005 mg / kg of subject's body weight, or from about 0.05 mg / kg to about 0.5 mg / kg of subject's body weight per day to achieve the desired therapeutic, diagnostic, or prophylactic effect. It may be administered one or more times daily at a dosage level sufficient to deliver about 0.01 mg / kg to about 50 mg / kg of subject's body weight, about 0.1 mg / kg to about 40 mg / kg of subject's body weight, about 0.5 mg / kg to about 30 mg / kg of subject's body weight, about 0.01 mg / kg to about 10 mg / kg of subject's body weight, about 0.1 mg / kg to about 10 mg / kg of subject's body weight, or about 1 mg / kg to about 25 mg / kg of subject's body weight.

[0202] Suitable dosages and treatment regimens for the treatment methods described herein vary depending on the particular disease being treated, the gRNA and / or ADAR (or vector encoding the gRNA and / or ADAR) being delivered, and the particular condition of the subject. In some examples, administration can be over a period of time until a desired effect (e.g., symptomatic relief) is achieved. In some examples, administration can be 1, 2, 3, 4, 5, 6, or 7 times per week. In some examples, administration or application of the compositions disclosed herein can be carried out for a treatment period of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or longer. In some examples, administration can be over a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In some instances, administration can be for a period of 2, 3, 4, 5, 6 months or longer. In some instances, administration can be repeated throughout the subject's life, for example, once a month or once a year throughout the subject's life. In some instances, administration can be repeated throughout a significant portion of the subject's life, for example, once a month or once a year for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years or more. In some instances, treatment can be resumed after a period of remission.

[0203] In some examples, administration may be oral ingestion. In some cases, delivery may be a capsule or tablet. Oral ingestion delivery may include tea, elixir, food, beverage, drink, syrup, liquid, gel, capsule, tablet, oil, tincture, or any combination thereof. In some embodiments, the food may be a medical food. In some examples, the capsule may include hydroxymethylcellulose. In some embodiments, the capsule may include gelatin, hydroxypropylmethylcellulose, pullulan, or any combination thereof. In some examples, the capsule may include a coating, for example, an enteric coating. In some aspects, the capsule may include a vegetarian or vegan product, such as a hypromellose capsule. In some embodiments, delivery may include inhalation via an inhaler, diffuser, nebulizer, vaporizer, or combination thereof.

[0204] In some embodiments, methods are disclosed herein that include administering a composition disclosed herein to a subject (e.g., a human) in need thereof. In some examples, the methods can treat (including prevent) a disease in the subject.

[0205] definition Unless otherwise defined, all technical terms, notations, and other technical and scientific or terminology used herein are generally intended to have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some instances, for clarity and / or ready reference, terms having a commonly understood meaning are defined herein, but the inclusion of such definitions herein should not necessarily be construed as indicating a substantial departure from what is commonly understood in the art.

[0206] Throughout this application, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all possible subranges and individual numerical values ​​within that range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0207] As used herein, the term "about" a value may refer to that value plus or minus 10% of that value.

[0208] As disclosed herein, a "base-paired (bp) region" refers to a region of a guide-target RNA scaffold in which a base of the guide RNA (e.g., a base of the targeting sequence of the guide RNA) pairs with an opposing base of a target polynucleotide. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near the other end of the guide-target RNA scaffold. A base-paired region can extend between two structural features. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near a structural feature. A base-paired region can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, the base-paired region is between 1 and 50, 1 and 75, 1 and 100, 1 and 125, 1 and 150, 1 and 175, 1 and 200, 1 and 225, 1 and 250, 1 and 275, 1 and 300, 50 and 75, 50 and 100, 50 and 125, 50 and 150, 50 and 175, 50 and 200, 50 ... 225, 50~250, 50~275, 50~300, 60~75, 60~100, 60~125, 60~150, 60~175, 60~200, 60~225, 60~250, 60~275, 60~300, 70~100, 70~125, 70~150, 70~175, 70~200, 7 0~225, 70~250, 70~275, 70~300, 80~100, 80~125, 80~150, 80~175, 80~200, 80~225, 80~250, 80~275, 80~300, 90~125, 90~150, 90~175, 90~200, 90~225, 90~25 having 0, 90 to 275, 90 to 300, 100 to 125, 100 to 150, 100 to 175, 100 to 200, 100 to 225, 100 to 250, 100 to 275, 100 to 300, 150 to 200, 150 to 225, 150 to 250, 150 to 275, or 150 to 300 base pairs.In some embodiments, the base-paired region is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 67, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 2 07, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 2 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 base pairs.

[0209] As disclosed herein, a "bulge" refers to a structure that is substantially formed only upon formation of the guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposing strand. A bulge can independently have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or a bulge can independently have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, as used herein, a bulge does not refer to a structure in which a single nucleotide involved in the engineered guide RNA and a single nucleotide involved in the target RNA do not base-pair; a single nucleotide involved in the engineered guide RNA and a single nucleotide involved in the target RNA that do not base-pair is referred to herein as a "mismatch." Furthermore, if the number of nucleotides involved on either the guide RNA side or the target RNA side exceeds four, the resulting structure is no longer considered a bulge, but rather an "internal loop." A "symmetric bulge" refers to a bulge where there are the same number of nucleotides on each side of the bulge. An "asymmetric bulge" refers to a bulge where there are different numbers of nucleotides on each side of the bulge.

[0210] The terms "complementary" or "complementarity" refer to the ability of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence, for example, by hydrogen bonding (e.g., conventional Watson-Crick), covalent bonding, or other similar methods. In Watson-Crick base pairing, a double hydrogen bond forms between nucleobases T and A, while a triple hydrogen bond forms between nucleobases C and G. For example, the sequence AGT can be complementary to the sequence TCA. The complementarity percentage indicates the percentage of residues in a nucleic acid molecule that c...

Claims

1. 1. A composition comprising an engineered guide RNA or a polynucleotide encoding said engineered guide RNA, wherein the engineered guide RNA has complementarity to a target sequence of a target SNCA RNA and comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs:2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784; and upon hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA, a guide-target RNA scaffold is formed that has one or more structural features that are not present in the engineered guide RNA prior to the hybridization and are selected from the group consisting of a bulge, an internal loop, and a hairpin; and wherein formation of the guide-target RNA scaffold is characterized by the presence of a polynucleotide sequence that is complementary to a target sequence of a target SNCA RNA. The composition results in knockdown of alpha-synuclein protein encoded by the RNA.

2. 2. The composition of Claim 1, wherein the engineered guide RNA comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs:293-299 or SEQ ID NOs:333-340.

3. 3. The composition of claim 2, wherein the engineered guide RNA comprises the polynucleotide sequence of any one of SEQ ID NOs: 293-299 or 333-340.

4. The composition of claim 1 , wherein the target sequence of the target SNCA RNA comprises a translation start site.

5. The composition of claim 4, wherein the translation start site is the SNCA codon 1 translation start site of exon 2.

6. The composition of claim 5, wherein the translation start site is the SNCA codon 1 translation start site in exon 2, corresponding to position 226 of SNCA transcript variant 1 of accession number NM_000345.

4.

7. 10. The composition of claim 1, wherein the one or more structural features include at least a first 6 / 6 symmetric internal loop and at least a second 6 / 6 symmetric loop.

8. 8. The composition of claim 7, wherein the first 6 / 6 symmetric internal loop is at a position selected from the group consisting of 33, 32, 30, 28, and 26 relative to the target adenosine at position 0.

9. 9. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0.

10. 10. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position −40 relative to position 0, a U / G wobble base at position −36 relative to position 0, a G / U wobble base at position −30 relative to position 0, a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof.

11. 11. The composition of Claim 10, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

337.

12. 10. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position −40 relative to position 0, a U / G wobble base at position −36 relative to position 0, a G / U wobble base at position −30 relative to position 0, a U / G wobble base at position −25 relative to position 0, a U / G wobble base at position −23 relative to position 0, a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof.

13. 13. The composition of Claim 12, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:338 or SEQ ID NO:

339.

14. The one or more structural features may be a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, a U / G wobble base at position -24 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -23 relative to position 0, a G / U wobble base at position -24 relative to position 0, a G / U wobble base at position -25 relative to position 0, a G / U wobble base at position -26 relative to position 0, a G / U wobble base at position -27 relative to position 0, a G / U wobble base at position -29 relative to position 0, a G / U wobble base at position -30 relative to position 0, a G / U wobble base at position -31 relative to position 0, a G / U wobble base at 10. The composition of claim 9, further comprising at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position 6, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a U / G wobble base at position 5 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof.

15. 15. The composition of Claim 14, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

340.

16. 10. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

17. 17. The composition of Claim 16, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:298 or SEQ ID NO:

299.

18. 10. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof.

19. 19. The composition of Claim 18, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

299.

20. 9. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0.

21. 21. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

22. 22. The composition of Claim 21, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

333.

23. 21. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position −40 relative to position 0, a U / G wobble base at position −36 relative to position 0, a G / U wobble base at position −33 relative to position 0, a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

24. 24. The composition of Claim 23, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

334.

25. 21. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position −40 relative to position 0, a U / G wobble base at position −36 relative to position 0, a G / U wobble base at position −33 relative to position 0, a G / U wobble base at position −30 relative to position 0, a U / G wobble base at position −25 relative to position 0, a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

26. 26. The composition of Claim 25, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

335.

27. The one or more structural features may be a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, a G / U wobble base at position -6 relative to position 0, a U / G wobble base at position -19 relative to position 0, a G / U wobble base at position -24 relative to position 0, a G / U wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, a G / U wobble base at position -26 relative to position 0, a G / U wobble base at position -28 relative to position 0, a G / U wobble base at position -29 relative to position 0, a G / U wobble base at position -30 relative to position 0, a G / U wobble base at position -31 relative to position 0, a G / U wobble base at position -32 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -34 relative to position 0, a G / U wobble base at position -35 relative to position 0, a G / U wobble base at position -36 relative to position 0, a G / U wobble base at position -37 relative to position 0, a G / U wobble base at position 21. The composition of claim 20, further comprising at least one structural feature selected from the group consisting of two 6 / 6 symmetric internal loops, a G / U wobble base at position -3 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

28. 28. The composition of Claim 27, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

336.

29. 21. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

30. 30. The composition of Claim 29, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

295.

31. 9. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 30 relative to the target adenosine at position 0.

32. 32. The composition of claim 31 , wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −18 relative to position 0, a 3 / 3 symmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof.

33. 33. The composition of Claim 32, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

297.

34. 9. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0.

35. 35. The composition of claim 34, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −8 relative to position 0, an A / C mismatch at position 0, a G / U wobble base pair at position 2 relative to position 0, and any combination thereof.

36. 36. The composition of Claim 35, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

293.

37. 35. The composition of claim 34, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −10 relative to position 0, a 0 / 1 asymmetric bulge at position −6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof.

38. 38. The composition of Claim 37, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

294.

39. 9. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 26 relative to the target adenosine at position 0.

40. 40. The composition of claim 39, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position −6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof.

41. 41. The composition of Claim 40, wherein the engineered guide RNA comprises at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO:

296.

42. The composition of claim 1 , wherein the one or more structural features include the bulge, and the bulge is a symmetrical bulge.

43. The composition of claim 1 , wherein the one or more structural features include the bulge, and the bulge is an asymmetric bulge.

44. The composition of claim 1 , wherein the one or more structural features include the internal loop, and the internal loop is a symmetric internal loop.

45. The composition of claim 1 , wherein the one or more structural features include the internal loop, and the internal loop is an asymmetric internal loop.

46. 2. The composition of claim 1, wherein the guide-target RNA scaffold comprises a wobble base pair.

47. 2. The composition of claim 1, wherein the one or more structural features comprise the hairpin, and the hairpin is a recruiting hairpin or a non-recruiting hairpin.

48. 48. The composition of any one of claims 1-47, wherein, upon hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA, the engineered guide RNA promotes RNA editing of one or more adenosines in the target sequence of the target SNCA RNA by an RNA editing agent.

49. 49. The composition of claim 48, wherein the RNA editing agent comprises ADAR1, ADAR2, ADAR3, or any combination thereof.

50. 50. The composition of any one of claims 1 to 49, comprising said engineered polynucleotide encoding said engineered guide RNA.

51. 51. The composition of claim 50, wherein the engineered polynucleotide is contained in or present on a vector.

52. 52. The composition of claim 51, wherein the vector is a viral vector and the engineered polynucleotide is encapsidated in the viral vector.

53. 52. The composition of claim 51, wherein the viral vector is an adeno-associated viral (AAV) vector or a derivative thereof.

54. 54. The composition of claim 53, wherein the viral vector is an adeno-associated viral (AAV) vector, and the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant of any of them.

55. 55. The composition of any one of claims 53 to 54, wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

56. 2. The composition of claim 1, wherein the target sequence of the target SNCA RNA has a polynucleotide sequence that is at least 80% identical to SEQ ID NO:

300.

57. 57. The composition of any one of claims 42-56, wherein the engineered guide RNA comprises the sequence of any one of SEQ ID NOs:2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784.

58. 1. A composition comprising an engineered guide RNA or a polynucleotide encoding said engineered guide RNA, wherein the engineered guide RNA has a length of 85-100 nucleotides and hybridizes to at least 80 bases of a target RNA sequence, wherein the target RNA sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to GCCAUUCGACGACAGUGUGGUGUAAAGGAAUUCAUUAGCCAUGGAUGUAUUCAUGAAAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUGCUGAG (SEQ ID NO: 300).

59. 59. The composition of Claim 58, wherein upon hybridization of the engineered guide RNA to the at least 80 bases of the target RNA sequence, the engineered guide RNA promotes RNA editing of one or more adenosines in the at least 80 bases of the target RNA sequence by an RNA editing agent.

60. 60. The composition of Claim 59, wherein the engineered guide RNA, upon hybridization to the at least 80 bases of the target RNA sequence, forms a guide-target RNA scaffold comprising one or more structural features.

61. 61. The composition of claim 60, wherein the one or more structural features include a bulge, and the bulge is a symmetrical bulge.

62. 61. The composition of claim 60, wherein the one or more structural features include a bulge, and the bulge is an asymmetric bulge.

63. 61. The composition of claim 60, wherein the one or more structural features comprises an internal loop, and the internal loop is a symmetric internal loop.

64. 61. The composition of claim 60, wherein the one or more structural features comprises an internal loop, and the internal loop is an asymmetric internal loop.

65. 61. The composition of claim 60, wherein the one or more structural features comprise a wobble base pair.

66. 61. The composition of claim 60, wherein the one or more structural features comprise a hairpin, and the hairpin is a recruiting hairpin or a non-recruiting hairpin.

67. 67. The composition of any one of claims 59-66, wherein the RNA editing agent comprises ADAR1, ADAR2, ADAR3, or any combination thereof.

68. 59. The composition of Claim 58, comprising an engineered polynucleotide encoding said engineered guide RNA.

69. 69. The composition of Claim 68, wherein the engineered polynucleotide encoding the engineered guide RNA is contained in or present on a vector.

70. 69. The composition of claim 68, wherein the vector is a viral vector and the engineered polynucleotide encoding the engineered guide is encapsidated in the viral vector.

71. 71. The composition of claim 70, wherein the viral vector is an adeno-associated viral (AAV) vector, or a derivative thereof.

72. 72. The composition of claim 71, wherein the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant thereof.

73. 73. The composition of claim 71 or 72, wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

74. 1. A pharmaceutical composition comprising: a) a composition according to any one of claims 1 to 73; b) a pharmaceutically acceptable excipient, carrier, or diluent.

75. 1. A method of treating a disease or condition in a subject in need thereof, comprising: The method comprises administering to the subject a therapeutically effective amount of the composition of any one of claims 1 to 73, or the pharmaceutical composition of claim 74.

76. 76. The method of claim 75, wherein the disease or condition comprises a synucleinopathy.

77. 76. The method of claim 75, wherein the synucleinopathy comprises Parkinson's disease.

78. 78. The method of any one of claims 75 to 77, wherein the subject is a human or non-human animal.

79. 79. The method of any one of claims 75 to 78, wherein the pharmaceutical composition or composition is in unit dosage form.

80. 80. The method of any one of claims 75-79, wherein said administering is sufficient to treat one or more symptoms of said disease or condition.

81. 81. The method of claim 80, wherein the disease or condition is a synucleinopathy.

82. 81. The method of claim 80, wherein the one or more symptoms treated comprise rigid muscle tone, bradykinesia, resting tremor, or any combination thereof.

83. 83. The method of claims 75-82, wherein said administering is sufficient to reduce aggregation of alpha-synuclein protein compared to: (a) the level of aggregation before said administration; (b) the level of aggregation that accumulates in the subject in the absence of said administration; or (c) Both.

84. 1. A method of treating Parkinson's disease in a subject in need thereof, comprising: The method comprising administering to the subject a composition according to any one of claims 1 to 73, or a pharmaceutical composition according to claim 74, in an amount sufficient to treat the Parkinson's disease in the subject.

85. 85. The method of claim 84, wherein said administering is sufficient to treat one or more symptoms of Parkinson's disease in said subject compared to before said administering.

86. 85. The method of claim 84, wherein the one or more symptoms treated comprise rigid muscle tone, bradykinesia, resting tremor, or any combination thereof.

87. 87. The method of any one of claims 84-86, wherein the subject after said administering exhibits an increased Unified Parkinson's Disease Rating Scale (UPDRS) score compared to the UDRS score before said administering.

88. 100. A method of reducing expression of alpha-synuclein protein in a subject in need thereof, comprising administering to the subject a composition according to any one of claims 1 to 73, wherein said administration is sufficient to reduce the expression of alpha-synuclein protein in the subject compared to the amount of alpha-synuclein protein before said administration as determined by an in vitro assay, thereby reducing the expression of said alpha-synuclein protein in the subject.

89. 89. The method of Claim 88, wherein the engineered guide RNA has sufficient complementarity to the target sequence of the target SNCA RNA such that the engineered guide RNA hybridizes to the target sequence of the target SNCA RNA, the target sequence comprising a translation start site in the target SNCA RNA.

90. 90. The method of claim 89, wherein the translation start site is the SNCA codon 1 translation start site of exon 2.

91. 90. The method of claim 89, wherein the target SNCA RNA comprises a pre-mRNA transcript of SNCA.

92. 92. The method of Claim 91, wherein hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA results in editing of one or more adenosines in the target sequence by an RNA editing agent present in the subject.

93. 93. The method of claim 92, wherein at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the pre-mRNA transcripts of SNCA have the edit of the one or more adenosines in the target sequence.

94. 93. The method of claim 92, wherein said editing of the one or more adenosines in the target sequence of the target SNCA RNA promotes said reduction in expression of alpha-synuclein protein in the subject.

95. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 10% reduction compared to the amount of alpha-synuclein protein present before said administration.

96. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 20% reduction compared to the amount of alpha-synuclein protein present before said administration.

97. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 25% reduction compared to the amount of alpha-synuclein protein present before said administration.

98. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 30% reduction compared to the amount of alpha-synuclein protein present before said administration.

99. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 35% reduction compared to the amount of alpha-synuclein protein present before said administration.

100. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 30% reduction compared to the amount of alpha-synuclein protein present before said administration.

101. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 40% reduction compared to the amount of alpha-synuclein protein present before said administration.

102. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 45% reduction compared to the amount of alpha-synuclein protein present before said administration.

103. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is at least a 50% reduction compared to the amount of alpha-synuclein protein present before said administration.

104. 95. The method of claim 94, wherein the reduction in expression of alpha-synuclein protein is from about 10% to up to 20% compared to the amount of alpha-synuclein protein present before said administration.

105. 95. The method of claim 94, wherein said reduction in expression of alpha-synuclein protein is from about 20% to up to about 30% compared to the amount of alpha-synuclein protein present before said administration.

106. 95. The method of claim 94, wherein said reduction in expression of alpha-synuclein protein is from about 30% to up to about 40% compared to the amount of alpha-synuclein protein present before said administration.

107. 95. The method of claim 94, wherein said reduction in expression of alpha-synuclein protein is from about 40% to up to about 50% compared to the amount of alpha-synuclein protein present before said administration.

108. 95. The method of claim 94, wherein said reduction in expression of alpha-synuclein protein is from about 50% to up to about 60% compared to the amount of alpha-synuclein protein present before said administration.

109. 95. The method of claim 94, wherein said reduction in expression of alpha-synuclein protein is from about 60% to up to about 70% compared to the amount of alpha-synuclein protein present before said administration.

110. 100. The method of any one of claims 89-99, wherein the target sequence of the target SNCA RNA comprises a sequence that is at least 80% identical to SEQ ID NO:

300.

111. 92. The method of Claim 91, wherein hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA results in exon skipping in the pre-mRNA transcript of SNCA.

112. 112. The method of claim 111, wherein the exon skipping generates an SNCA mRNA alternative splice variant that does not contain exon 2 of the wild-type SNCA mRNA transcript.

113. 113. The method of claim 111 or 112, wherein the exon skipping results in a reduction of alpha-synuclein protein.

114. 89. The method of claim 88, wherein said reducing expression of alpha-synuclein protein in said subject comprises a decrease in alpha-synuclein protein levels in a biological sample from said subject as determined by an in vitro assay compared to: (i) the level of alpha-synuclein protein in a biological sample obtained from said subject prior to said administration; or (ii) Reference alpha-synuclein protein levels obtained from subjects with Parkinson's disease.

115. 89. The method of claim 88, further comprising reducing the level of an alpha-synuclein RNA transcript that includes exon 2 in the subject as determined by an in vitro assay compared to: (i) the level of an alpha-synuclein RNA transcript containing exon 2 in a biological sample obtained from the subject prior to said administration; or (ii) Reference levels of α-synuclein RNA transcripts containing exon 2 obtained from subjects with Parkinson's disease.

116. 116. The method of any one of claims 88 to 115, for treating a disease or condition in the subject.

117. The method of claim 116, wherein the disease or condition is at least one selected from the group consisting of neurodegenerative diseases, Parkinson's disease, tremors, muscle rigidity, muscle rigidity, bradykinesia, dementia with Lewy bodies (DLB), multiple system atrophy (MSA), pure autonomic dysfunction (PAF), and REM sleep behavior disorder (RBD).

Images