Rnai agents for inhibiting expression of pnpla3, pharmaceutical compositions thereof, and methods of use

Abstract

RNAi agents, compositions, and methods for reducing patatin-like phospholipase domain-containing protein-3 (PNPLA3) levels and treating liver disease, such as NAFLD, are provided.SOLUTION: The present invention relates to RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting the expression of PNPLA3 genes. Pharmaceutical compositions comprising the PNPLA3RNAi drugs and methods of use thereof are also disclosed. The disclosed PNPLA3RNAi drugs may be conjugated to targeting ligands to facilitate delivery to cells, including hepatocytes. Delivery of the PNPLA3RNAi agent in vivo provides for inhibition of expression of the PNPLA3 gene. The RNAi agents can be used in methods of treating PNPLA3 associated diseases and disorders, including alcoholic or non-alcoholic liver disease, including non-alcoholic fatty liver disease (NAFLD), non-alcoholic fat liver disease (NASH), liver fibrosis, and cirrhosis.SELECTED DRAWING: None

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application is a continuation of U.S. Provisional Patent Application No. 63 / 000,137, filed March 26, 2020. No. 60 / 629,997, filed on Oct. 1, 2007, which claims the benefit of U.S. Provisional Patent Application No. 60 / 629,997, filed on Oct. 1, 2007, which is incorporated herein by reference in its entirety. do.

[0002] (Sequence Listing) This application has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The above ASCII copy was created on March 25, 2021. The file name is 103693_002475_PCT_SL.txt and the size is 24 It is 8,025 bytes.

[0003] FIELD OF THE INVENTION The present disclosure relates to a method for the detection of patatin-like phospholipase domain-containing protein 3 (Patatin-like phospholipase domain-containing protein 3). RNA interference (RNA interference) for the inhibition of phospholipase domain-containing protein 3 (PNPLA3) A) interference, RNAi) drug, e.g., double-stranded RNAi drug, PNPLA3 RNAi drug and methods of use thereof.

[0004] (background) Nonalcoholic fatty liver disease (NAFLD) is a It is the most common chronic liver disease worldwide, affecting an estimated 20% of the world's population. In some individuals, ectopic fat accumulation in the liver, called steatosis, can lead to inflammation and This leads to liver damage and nonalcoholic steatohepatitis. NAFLD can progress to a more advanced stage of the disease called nonalcoholic steatohepatitis (NASH). Treatment of NAFLD often involves , weight loss, and the treatment of any secondary conditions such as insulin resistance or dyslipidemia. can be.

[0005] Patatin-like phospholipase domain-containing 3 (PNPLA), a type II transmembrane protein 3) is expressed in various cells, including the liver. In hepatocytes, PNPLA3 is expressed in the endoplasmic reticulum. and expressed on lipid membranes, and primarily exhibits triacylglycerol hydrolase activity.

[0006] The present invention is directed to the treatment of liver diseases such as NAFLD by lowering PNPLA3 levels. This provides a novel approach.

[0007] (overview) Any one of the sequences of SEQ ID NOs: 46 to 60, 176, 181 and 188 and 0 or Antisense oligonucleotides containing at least 17 consecutive nucleotides that differ by a single nucleotide a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; Disclosed herein is an RNAi agent for inhibiting expression of the PNPLA3 gene, comprising: can be.

[0008] In some embodiments, the antisense strand is selected from SEQ ID NOs: 46-60, 176, 181, and comprising nucleotides 2 to 18 of any one of the 188 sequences.

[0009] In some embodiments, the sense strand is selected from the group consisting of SEQ ID NOs: 2, 3, 4, 9-20, 214, 21 9, and 220 sense strand sequences differing by 0 or 1 nucleotide. the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides A region of at least 85% complementarity with the antisense strand over seven consecutive nucleotides It has a region.

[0010] In some embodiments, at least one nucleotide of the RNAi agent is a modified nucleotide. or containing modified internucleoside linkages.

[0011] According to some embodiments, nucleic acids of the sense and / or antisense strands of an RNAi agent are All or substantially all of the nucleotides are modified nucleotides.

[0012] In some embodiments, the modified nucleotides are 2'-O-methyl nucleotides, 2' -Fluoronucleotides, 2'-deoxynucleotides, 2',3'-seconucleotides Mimetics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2'- O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino-modified nucleotides nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, vinyl phosphonates 3'-O-methyl-3'-propanol-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl-3'-propanol-containing nucleotides. The nucleotides are selected from the group consisting of methyl nucleotides.

[0013] In other embodiments, all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides. The nucleotides may be nucleotides, 2'-fluoronucleotides, or a combination thereof.

[0014] In some embodiments, the antisense strand comprises a modified version of SEQ ID NOs: 90, 95, and 102. The antisense strand sequence may consist of or essentially consist of any one of the nucleotide sequences of the antisense strand. It consists of or comprises:

[0015] In some embodiments, the sense strand comprises the modified sequences of SEQ ID NOs: 131, 136, and 137. consisting of, or consisting essentially of, the nucleotide sequence of any of the sequences of the base strand; Or includes it.

[0016] In some embodiments, the antisense strand comprises modified sequences of SEQ ID NOs: 90, 95, and 102. The sense strand comprises any one of the nucleotide sequences of SEQ ID NOs: 131, 13 6, and 137 modified sequences.

[0017] In other embodiments, the RNAi agent is linked to a targeting ligand. In some embodiments, the targeting ligand comprises N-acetyl-galactosamine. In this example, the targeting ligand comprises the structure of (NAG37) or (NAG37)s. In embodiments, the targeting ligand is linked to the sense strand. The cation ligand is linked to the 5' end of the sense strand.

[0018] In some embodiments, the sense strand is 18-30 nucleotides in length and the antisense strand is 18-30 nucleotides in length. In another embodiment, the sense strand and the antisense strand are 18 to 30 nucleotides in length. The targeting strands are each 18 to 27 nucleotides in length. Targeting the sense and antisense strands requires 18 to 24 nucleotides, respectively. In yet another embodiment, the sense and antisense strands are each 21 nucleotides in length. Nucleotide length.

[0019] In some embodiments, the RNAi agent has two blunt ends.

[0020] In some embodiments, the sense strand comprises one or two end caps. In this configuration, the sense strand contains one or two inverted abasic residues.

[0021] In some embodiments, the RNAi agent is selected from the group consisting of SEQ ID NOs: (176 and 214) (90 and 1 31), (181 and 219), (95 and 136), (188 and 220), and / or is composed of the sense and antisense strands forming a double-stranded sequence with (102 and 137). become.

[0022] In some embodiments, the sense strand is located at the 3' end of the nucleotide sequence, It further comprises an inverted abasic residue at the 5' end of the string, or both.

[0023] In some embodiments, the RNAi agents provided herein are selected from the group consisting of SEQ ID NOs: 90, 95, and A modified nucleotide sequence differing from one of the 102 nucleotide sequences by 0 or 1 nucleotide. an antisense strand comprising, consisting of, or consisting essentially of a nucleotide sequence; a, c, g, and u represent 2'-O-methyladenosine, cytidine, and guanosine, respectively. Af, Cf, Gf, and Uf represent 2'-fluorouracil and uridine, respectively. represents adenosine, cytidine, guanosine, and uridine, and s represents a phosphorothioate linkage. wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides.

[0024] In some embodiments, the sense strand of the present disclosure is selected from the group consisting of SEQ ID NOs: 214, 219, and 256. A modified nucleotide differs from one of the nucleotide sequences by 0 or 1 nucleotide. comprising, consisting of, or consisting essentially of a, c, g, i, and u are 2'-O-methyladenosine, cytidine, guanosine, inosine, and guanosine, respectively. Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, represents cytidine, guanosine, and uridine; s represents a phosphorothioate linkage; All or substantially all of the nucleotides in the antisense strand are modified nucleotides. In embodiments, the sense strand is a sequence that is located at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, In other embodiments, the RNAi agent further comprises an inverted abasic residue in either or both of the nucleotides. The nucleotide chain is linked to a targeting ligand.

[0025] In some embodiments, the targeting ligand is a parenteral ligand for the asialoglycoprotein receptor. In some embodiments, the targeting ligand is N-acetyl-galactosamine. Including Min.

[0026] In a further embodiment, the targeting ligand is:

[0027] [ka] Includes:

[0028] In a further embodiment, the antisense strand comprises modified nucleotides of SEQ ID NOs: 90, 95, and 102. The sense strand consists of modified nucleotides of SEQ ID NOs: 131, 136, and 137. a, c, g, and u are 2'-O-methyladenosine, Cytidine, guanosine, and uridine, and Af, Cf, Gf, and Uf are, respectively. , 2'-fluoroadenosine, cytidine, guanosine, and uridine, and s is phospho is a holothioate linkage, and (invAb) is an inverted abasic deoxyribose residue. (NAG37)s has the following chemical structure:

[0029] [ka]

[0030] A composition comprising an RNAi agent of the disclosure, further comprising a pharmaceutically acceptable excipient. Compositions are also disclosed.

[0031] A method for inhibiting expression of the PNPLA3 gene in a cell, comprising administering to the cell an effective Also provided herein are methods, including introducing into a subject an amount of an RNAi agent or composition of the disclosure. It is served.

[0032] In some embodiments, the cell is in a subject. In some embodiments, the subject is Human subjects.

[0033] In other embodiments, PNPLA3 gene expression is inhibited by at least about 30%. In some embodiments, PNPLA3 gene expression is at least about 100% in the cytoplasm of hepatocytes. 50% inhibition.

[0034] A method of treating a PNPLA3-associated disease or disorder, comprising administering to a human subject in need thereof Further provided herein are methods comprising administering a therapeutically effective amount of a composition of the present disclosure. .

[0035] In some embodiments, the disease is NAFLD, NASH, liver fibrosis, alcohol-related lipid If you have fatty liver disease or cirrhosis.

[0036] In some embodiments, the RNAi agent is administered at a dose of about 0.05 mg / kg body weight of a human subject. ~ Administered at a dose of approximately 5.0 mg.

[0037] In other embodiments, the RNAi agent is administered in two or three doses.

[0038] Diseases, disorders, or conditions mediated at least in part by PNPLA3 gene expression Also provided herein is a use of an RNAi agent or a composition of the disclosure for the treatment of .

[0039] In some embodiments, the condition is cirrhosis of the liver.

[0040] Diseases, disorders, or conditions mediated at least in part by PNPLA3 gene expression of an RNAi agent of the present disclosure or a composition of the present disclosure for the preparation of a pharmaceutical composition for treating Uses are further provided herein.

[0041] In some embodiments, the disease is a liver disorder, such as NAFLD, NASH, liver fibrosis, or cirrhosis. Alcoholism or alcoholic liver disease. In some embodiments, the RNAi agent is administered at a dose of about 0.05 mg to about 5.0 mg per kg of body weight of a human subject. [Brief explanation of the drawings]

[0042] [Figure 1] Graph showing baseline relative whole liver expression of PNPLA3 by PCR from non-human primates (NHPs) treated with RNAi agents. Study #1: Data are geometric mean ± SD (n=4). [Figure 2] Graph showing mean PNPLA3 mRNA knockdown in the cytoplasm of hepatocytes by quantitative ISH in all animals tested (Study #1 and Study #2). Study #2: Data are mean ± SD (n=14).

[0043] Detailed Description of the Preferred Embodiments The method of the present disclosure is further described in the following detailed description taken in conjunction with the accompanying drawings, which form a part of this disclosure. The method of the present disclosure can be more readily understood by reference to the following description. It is not intended to be limited to the specific methods described and / or illustrated herein, nor is it intended to be limited to the specific methods used herein. The terms used herein are for the purpose of describing particular embodiments by way of example only and are not intended to be limiting unless otherwise specified in the claims. It should be understood that no method limitations are intended.

[0044]

[0023] In this specification, the present invention is described in the context of separate embodiments for clarity. It is to be understood that several features of the illustrated methods may also be provided in combination in a single embodiment. Conversely, methods of the present disclosure that are described as a single embodiment for the sake of brevity should be understood to be The various features of may also be provided separately or in any subcombination.

[0045] definition As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a , mRNA of target messenger RNA (mRNA) in a sequence-specific manner. A RNA or RNA-like (e.g., chemical) molecule capable of reducing or inhibiting translation of a transcript. As used herein, "compositions" refers to compositions comprising modified RNA oligonucleotide molecules. When RNAi drugs are used, they act by inhibiting the RNA interference mechanism (i.e., RNA interference in mammalian cells). RNA interference through interaction with the pathway machinery (RNA-induced silencing complex, RISC) or by any alternative mechanism or pathway. The term RNAi agent, as used herein, refers primarily to agents that utilize the RNA interference mechanism. Although RNAi agents of the present disclosure are believed to act via any particular pathway or mode of action, The present invention is not limited to or bound by any of the above-mentioned mechanisms. The RNAi drug disclosed in the document is composed of a sense strand and an antisense strand, and the RNAi drug short (or small) interfering RNA (siRNP) A), double stranded RNA (dsRNA), microRNA (microRNA) , miRNA), short hairpin RNA (shRNA), and Dicer These include, but are not limited to, dicer substrates. The antisense strand is less likely to be present in the targeted mRNA (i.e., PNPLA3 mRNA). RNAi agents are partially complementary to one or more modified nucleotides and and / or one or more non-phosphodiester linkages.

[0046] As used herein, the term "silence" when referring to the expression of a given gene, "Reduce," "inhibit," "downregulate," or "knock down" means to reduce or inhibit the expression of a gene. expression of the gene in the cell, group of cells, tissue, organ, or subject in which the gene is transcribed The level of transcribed RNA, or the polypeptides, proteins, and young or protein subunit levels in cells, cell populations, tissues, and organs. The organ or subject has been treated with an oligomeric compound, such as an RNAi agent, described herein. Sometimes compared to a second cell, group of cells, tissue, organ, or subject that is not so treated. This means that the amount of radiation has been reduced.

[0047] As used herein, the term "sequence" or "nucleotide sequence" refers to a nucleic acid or It refers to the sequence or order of nucleotides, written as a sequence of letters using standard nomenclature. The nucleic acid molecule may contain unmodified and / or modified nucleotides. The nucleotide sequence may contain unmodified and / or modified nucleotides. and / or may contain modified nucleotides.

[0048] As used herein, "base," "nucleotide base," "nucleotide," or "Nucleobase" means a heterocyclic pyrimidine or purine compound that is a component of a polynucleotide. and the primary purine bases adenine and guanine, and the primary pyrimidine base cytosine Nucleotides include thiamine, thymine, and uracil. Nucleotides can be unmodified. is a base that can be selected from, but not limited to, a universal base, a hydrophobic base, a promiscuous base, , size-expanded bases, and fluorinated bases. odified Nucleosides in Biochemistry,Biot echnology and medicine,Herdewijn,P.ed.Wi (See ley-VCH, 2008). The synthesis of thiol-containing phosphoramidite compounds is well known in the art.

[0049] As used herein, and unless otherwise specified, the term "complementary" refers to a first Nucleic acid base or nucleotide sequence (e.g., the sense strand of an RNAi agent or the mRNA to be targeted) A) to a second nucleic acid base or nucleotide sequence (e.g., the antisense strand of an RNAi agent or When used to describe a single-stranded antisense oligonucleotide, An oligonucleotide or polynucleotide comprising a nucleotide sequence is The hybridization is performed under specific standard conditions with an oligonucleotide or polynucleotide containing the hybridization sequence. reduced (under mammalian physiological conditions (or otherwise suitable in vivo or in vitro) (ii) forming base pair hydrogen bonds under (iii) conditions to form a double-stranded or double-helix structure Those skilled in the art will be able to determine the optimum set of conditions for the hybridization test. The complementary sequences may be selected from Watson-Crick base pairs or non-Watson-Crick base pairs. and at least the hybridization requirements listed above are met. Natural or modified nucleotides or nucleotides, to the extent that they are sufficient Sequence identity or complementarity is independent of modification. For example, mimetics are included as defined herein. a and Af, as defined, are complementary to U (or T) and are used for purposes of determining identity or complementarity. So it is the same as A.

[0050] As used herein, "perfectly complementary" or "fully complementary" refers to a hybrid In a pair of nucleic acid bases or nucleotide sequences of the first oligonucleotide, All (100%) of the bases in the contiguous sequence are the same number as in the contiguous sequence of the second polynucleotide. The contiguous sequence means that the first or second nucleotide It may contain all or part of the sequence.

[0051] As used herein, "partially complementary" means that the hybridized nucleobases or in a pair of nucleotide sequence molecules, the bases in the contiguous sequence of the first polynucleotide At least 70%, but not all, of the sequences in the second polynucleotide have the same number of salts in the contiguous sequence. A contiguous sequence is a sequence that hybridizes to a first or second nucleotide sequence. It may include all or part of the above.

[0052] As used herein, "substantially complementary" refers to hybridized nucleobases or is the total number of bases in the contiguous sequence of the first polynucleotide in a pair of nucleotide sequence molecules. At least about 85%, but not all, of the sequences in the second polynucleotide have the same number of base pairs in the contiguous sequence of the second polynucleotide. A contiguous sequence is a sequence that hybridizes to a first or second nucleotide sequence. It may include all or part of the above.

[0053] As used herein, "complementary," "fully complementary," "partially complementary" and "substantially complementary" refers to the sense and antisense strands of an RNAi agent. or between the antisense strand of the RNAi agent and the sequence of PNPLA3 mRNA. Used in reference to the matching of bases or nucleotides.

[0054] As used herein, the terms "substantially identical" or "substantially identical" refer to nucleic acid sequences. When applied to a sequence, a nucleic acid sequence (or a portion of a nucleotide sequence) is compared to a reference sequence At least about 85% or more sequence identity, preferably at least 90%, at least 95% or at least 99% identity. The percentage of sequence identity is based on the comparison It is determined by comparing two optimally aligned sequences over a window. This percentage determines the number of positions where the same type of nucleobase occurs in both sequences and is used to determine the number of matched positions. The number of positions is taken, the number of matched positions is divided by the total number of positions in the window, and the result is multiplied by 100. to obtain the percent sequence identity. The invention encompasses nucleotide sequences substantially identical to those disclosed herein.

[0055] As used herein, the terms "individual," "patient," and "subject" refer to a bird, Humans and other primates, as well as commercially relevant mammals such as mice, rats, monkeys, and rabbits Other mammalian animal models include rats, pigs, horses, sheep, cats, and dogs. They are used interchangeably to refer to members of any animal species, including but not limited to: Preferably, the subject is a human.

[0056] As used herein, the terms "treat," "treatment," and the like refer to the treatment of a disease or condition in a subject. provides a reduction or alleviation of the number, severity, and / or frequency of one or more symptoms of the condition As used herein, "treating" refers to a method or step taken to treat a disease. "To treat" and "treat" refer to the reduction in the number, severity, and / or severity of one or more symptoms of a disease in a subject. Or may include prevention, management, prophylactic treatment, and / or inhibition or reduction of frequency.

[0057] As used herein, the term "introducing into a cell" when referring to an RNAi agent The phrase "functionally delivers" refers to functionally delivering an RNAi agent into a cell. The term refers to the desired biological activity of an RNAi agent, e.g., sequence-specific inhibition of gene expression. By this means delivering an RNAi agent to a cell in a manner that allows it to have a therapeutic effect.

[0058] Unless otherwise noted, symbols used herein

[0059] [ka] The use of any group (or groups) that may be linked in accordance with the scope of the invention described herein. (numerable)

[0060] As used herein, the term "isomers" refers to compounds that have the same molecular formula but differ in their origin. It refers to compounds that differ in the nature or sequence of bonds between the atoms or in the arrangement of the atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers" and are non-superimposable mirror images. Stereoisomers that are image-like are called "enantiomers" or sometimes optical isomers. The carbon atom bonded to the substituent is called a "chiral center."

[0061] As used herein, a molecule specifically identified in a structure as having a particular conformation. Unless otherwise specified, asymmetric centers may exist and may therefore be enantiomers, diastereomers, For each structure in which one or more stereoisomeric configurations occur, each of the structures disclosed herein is The structures are intended to represent all such possible isomers, including their optically pure forms. For example, the structures disclosed herein may be diastereomeric or racemic. The term "stereoisomer" is intended to include mixtures of these as well as single stereoisomers.

[0062] As used herein, the terms "comprising", "including", "Containing" and "characterized by" are interchangeable. interchangeable, generic, open-ended, and does not include any additional unrecited elements or method steps. Any mention of the term "comprises" in this specification specifically refers to the components of the composition. In describing a component or element of a device, a and compositions and methods comprising the same.

[0063] When used in the claims of this application, the phrase "consisting of" means any material that is specifically identified in the claim. When used in the claims of this application, "excludes any element, step, or ingredient not included in the present invention." The phrase "qualitatively" refers to the materials or steps specified, as well as the basis of the claimed patent. Limit the scope of the claims to those that do not materially affect the essential and novel characteristics.

[0064] The compounds and compositions disclosed herein may be used in conjunction with the environment in which the compound or composition is placed. Depending on the It will be readily understood and appreciated by those skilled in the art that the present invention may have the following properties in a crystalline state: As used herein, the structures disclosed herein may be modified to include certain functional groups (e.g., OH It is contemplated that the aryl, aryl, arylsulfonyl ... The disclosure provides information on environmental (e.g., pH)-based protonation, as would be readily understood by one of ordinary skill in the art. The disclosure is intended to encompass the disclosed compounds and compositions regardless of their state. Correspondingly, compounds described herein that have labile protons or basic atoms may be substituted with the corresponding It should be understood that the compounds described herein may be used in the form of free acids, salts, or the like. It may be in free base or salt form. Pharmaceutically acceptable salts of the compounds described herein include: It should be understood that this is within the scope of the present invention.

[0065] As used herein, "linked" refers to a connection between two compounds or molecules. The term "conjugated" or "conjugated" refers to the joining of two compounds or molecules by a covalent bond. Unless otherwise stated, the term "linked" as used herein means that the The terms "conjugated" and "conjugated" refer to groups or atoms with any intervening atom or group of atoms. It may also refer to a connection between a first compound and a second compound without the need for a second compound.

[0066] As used herein, the term "including" is used herein to mean "including "or" means, and is used interchangeably with, the phrase "including, but not limited to" The term "" is used herein to mean "and / or" unless the context clearly indicates otherwise. The term "internal communication" refers to, and is used interchangeably with, the term "internal communication."

[0067] Unless otherwise defined, all technical and scientific terms used herein are understood by those of ordinary skill in the art. The same meaning as that commonly understood by the Although equivalent methods and materials can be used to practice or test the present invention. Suitable methods and materials are described below. All publications, patent applications, and other references mentioned herein are incorporated by reference. , patents, and other references are incorporated herein by reference in their entireties. In case of conflict, the present specification, including definitions, will govern. In addition, materials, methods, and examples are merely exemplary and are not intended to be limiting.

[0068] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, accompanying drawings, and appended claims. This will be clear from the scope of the claims.

[0069] (Detailed explanation) RNAi drugs RNAi agents for inhibiting the expression of the PNPLA3 gene (referred to herein as PNPLA3 RNAi agents or PNPLA3 RNAi triggers) are described herein. Each PNPLA3 RNAi agent comprises a sense strand and an antisense strand. The sense and antisense strands can each be 16 to 49 nucleotides in length. The sense strands can be the same length or different lengths. The sense strand and the antisense strand are each independently 18 to 27 nucleotides in length. In some embodiments, both the sense strand and the antisense strand each have a 21 to 2 In some embodiments, the sense strand and the antisense strand are 6 nucleotides in length. Each of the sense strand and the antisense strand is 21 to 24 nucleotides in length. The sense strands are each independently 19-21 nucleotides in length. In this embodiment, the sense strand is about 19 nucleotides long and the antisense strand is about 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 23 nucleotides in length. In some embodiments, the antisense strand is 21 nucleotides in length. Both the sense and antisense strands are each 21 nucleotides in length. In embodiments, the sense and antisense strands of an RNAi agent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3 0, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides in length In some embodiments, the duplexed RNAi agent has a length of about 16, 17, 18, 19, 20 , 21, 22, 23 or 24 nucleotides in duplex length.

[0070] Examples of nucleotide sequences used to form PNPLA3 RNAi agents are listed in Table 2, Table 3, and Table 4. Including the sense and antisense strand sequences of Tables 2, 3, and 4. Examples of RNAi agent duplexes are shown in Tables 5A and 5B.

[0071] In some embodiments, complete, substantial, or complete cleavage between the sense and antisense strands is achieved. The region of partial complementarity is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length at the 5' end of the antisense strand or nearby (e.g., this region extends from the 5' end of the antisense strand to the entire Separated by 0, 1, 2, 3, or 4 nucleotides that are not substantially or partially complementary (May be included).

[0072] The sense strand of the PNPLA3 RNAi agents described herein is expressed in the PNPLA3 mRNA. a core stretch sequence of the same number of nucleotides (referred to herein as "core stretch" or " at least 16 consecutive sequences that have at least 85% identity with the In some embodiments, the sense strand core stretch sequence comprises nucleotides 100% (perfectly) complementary to the core stretch sequence of the antisense strand, or at least about 85% (substantially) complementary to the sense strand core stretch sequence typically consists of a nucleotide sequence of the same length present in the PNPLA3 mRNA target ( For example, a sequence that is completely identical to or at least about 85% identical to the target sequence (sometimes referred to as the target sequence) In some embodiments, the sense strand core stretch is 16, 17, 18, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, In some embodiments, the sequence is 18, 19, 20, 21, 22, or 23 nucleotides in length. The length of this sense strand core stretch is 17 nucleotides. In this embodiment, the length of this sense strand core stretch is 19 nucleotides long.

[0073] The antisense strand of the PNPLA3 RNAi agents described herein is A core sequence of the same number of nucleotides in the NA and the same number of nucleotides in the corresponding sense strand stretch and at least 16 consecutive nucleotides with at least 85% complementarity. In some embodiments, the antisense strand core stretch comprises PNPLA3 10 for a nucleotide sequence of the same length present in the mRNA target (e.g., target sequence) 0% (fully) complementary, or at least about 85% (substantially) complementary. In some embodiments, the antisense strand core stretch comprises 16, 17, 18, 19 In some embodiments, the amino acid sequence is 20, 21, 22, or 23 nucleotides in length. The antisense strand core stretch is 19 nucleotides in length. The antisense strand core stretch is 17 nucleotides in length. The nucleotide sequence may be the same length as the corresponding antisense core sequence, or may be a different length. It's okay to have it.

[0074] The sense and antisense strands of the PNPLA3 RNAi drug anneal to form a duplex. The sense and antisense strands of the PNPLA3 RNAi agent are, in part, Within the complementary duplex region, the sense strand may be partially or completely complementary to each other. The stretch sequence is at least about 85% complementary to the antisense core stretch sequence or In some embodiments, the sense strand core stretch sequence is 100% complementary. 16, 17, 18, 19, 20, 21, 22, corresponding to the sense strand core stretch sequences or 23 nucleotide sequences, 16, at least 17, at least 18, at least 19, at least 20 a sequence of at least 21, at least 22, or at least 23 nucleotides (i.e., the sense and antisense core stretches of the PNPLA3 RNAi drug) The sequence should consist of at least 16 base pairs that are at least 85% base paired or 100% base paired. , at least 17, at least 18, at least 19, at least 20, at least Both have a region of 21, at least 22, or at least 23 nucleotides. )

[0075] In some embodiments, the antisense oligonucleotides of the PNPLA3 RNAi agents disclosed herein are The sense strand is composed of 0, 1, 2, or 3 nucleotides from either the antisense strand sequence in Table 2 or Table 3. In some embodiments, the PNPLA3 RN polypeptides disclosed herein are different. The sense strand of the Ai drug may be composed of 0, 1, 2, or 3 nucleotides with either the sense strand sequence in Table 2 or Table 4. The nucleotides are different.

[0076] In some embodiments, the sense strand and / or the antisense strand are optionally and independently , at the 3' end, 5' end, or both the 3' and 5' ends of the core stretch sequence The antisense fragment may contain 1, 2, 3, 4, 5, or 6 nucleotides (extensions) of the following: The additional nucleotides in the sense strand, if present, are located at the corresponding The additional nucleotides in the sense strand may or may not be complementary to the sequence. The sequence, if present, may be identical to the corresponding sequence in the PNPLA3 mRNA. The additional nucleotides in the antisense strand, if present, may be: may be complementary to additional nucleotides (if present) in the corresponding sense strand, or may not be complementary.

[0077] As used herein, an extension refers to a sequence that includes the sense strand core stretch sequence and / or the antisense strand core stretch sequence. 1, 2, 3, 4, 5, or 6 at the 5' and / or 3' end of the sense strand core stretch sequence The extension nucleotides of the sense strand contain nucleotides equal to or greater than the corresponding nucleotides of the antisense strand. Nucleotides (either core stretch sequence nucleotides or extender nucleotides) Conversely, the extension of the antisense strand may or may not be complementary to Nucleotides are the same as the corresponding nucleotides of the sense strand (core stretch sequence nucleotides, or any of the extension nucleotides) may or may not be complementary to the In some embodiments, both the sense and antisense strands of an RNAi agent are In some embodiments, one or more of the 3' and 5' extensions of one strand The 3' extension nucleotide of one strand is linked to one or more 5' extension nucleotides of the other strand. In another embodiment, one or more 3' extension nucleotides of one strand are base-paired. The nucleotide does not base pair with one or more of the 5' extension nucleotides of the other strand. In some embodiments, a PNPLA3 RNAi agent is an RNAi agent having a 3' extension. In some embodiments, the sense strand has a 5' extension and the extension has a 5' extension. The nucleotides are unpaired and form an overhang. An "overhang" refers to the hybridizing portion or duplex of an RNAi agent disclosed herein. one located at the end of either the sense or antisense strand that does not form part of the strand moiety Or it refers to a stretch of two or more unpaired nucleotides.

[0078] In some embodiments, the PNPLA3 RNAi agent is 1, 2, 3, 4, 5, or 6 In another embodiment, the PNP comprises an antisense strand having a 3' extension of 5 nucleotides in length. LA3 RNAi agents are antisense RNAi agents with 3' extensions of 1, 2, or 3 nucleotides in length. In some embodiments, one of the antisense strand extension nucleotides Or, two or more contain nucleotides complementary to the corresponding PNPLA3 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides contains nucleotides that are not complementary to the corresponding PNPLA3 mRNA sequence.

[0079] In some embodiments, a PNPLA3 RNAi agent is 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the sense strand comprises a nucleotide-length 3' extension. One or more of the long nucleotides is adenosine, uracil, or thymidine. nucleotide, AT dinucleotide, or nucleotide in the PNPLA3 mRNA sequence In some embodiments, the nucleotide sequence is: The 3' sense strand extension may include, but is not limited to, the following sequences: T, UT, TT, UU, UUT, T TT, or TTTT (listed from 5' to 3', respectively); or consisting of it.

[0080] The sense strand may have a 3' extension and / or a 5' extension. PNPLA3 RNAi agents contain 5' extensions of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, the sense strand extension nucleotides include one or more of the following correspond to nucleotides in the PNPLA3 mRNA sequence, or It includes nucleotides that are identical thereto.

[0081] Examples of nucleotide sequences used to form PNPLA3 RNAi agents are listed in Table 2, The PNPLA3 RNAi agent is provided in Tables 3 and 4. In some embodiments, the PNPLA3 RNAi agent The antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In one embodiment, the PNPLA3 RNAi agent antisense strand comprises any one of the modified sequences in Table 3. In some embodiments, the PNPLA3 RNAi The antisense strand of the drug is a nucleotide sequence of either the sequence in Table 2 or Table 3 (5' end → 3' Terminal) 1~17, 2~15, 2~17, 1~18, 2~18, 1~19, 2~19, 1~ In some embodiments, the PN The sense strand of a PLA3 RNAi agent comprises any of the sequences in Table 2 or Table 4. In some embodiments, the PNPLA3 RNAi agent sense strand has any of the sequences in Table 2 or Table 4. Nucleotides (5' end → 3' end) 1-18, 1-19, 1-20, 1-21, The sequences include 2 to 19, 2 to 20, 2 to 21, 3 to 20, 3 to 21, or 4 to 21. In embodiments, the PNPLA3 RNAi agent sense strand has any one of the modified sequences in Table 4. The modified sequence of

[0082] In some embodiments, the sense and anti-RNAi strands of the RNAi agents described herein The sense strand contains the same number of nucleotides. The sense and antisense strands of a given RNAi agent contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent The ends form blunt ends. In some embodiments, the 3' end of the sense strand and The 5' end of the antisense strand and the 5' end of the antisense strand form a blunt end. Both ends of the Ai agent form blunt ends. As used herein, "blunt end" refers to a fragment of two ends. The terminal nucleotides of the annealed strands are complementary (form complementary base pairs) Refers to the end of the double-stranded RNAi gene.

[0083] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent forms a frayed end. In some embodiments, the sense strand 3' of the RNAi agent The end and the 5' end of the antisense strand form a frayed end. In some embodiments, the ends of the RNAi agent form frayed ends. Neither end of the NAi agent is a frayed end. As used herein, frayed The termini are those where the terminal nucleotides of two annealed strands are paired (i.e., two strands that are not complementary (i.e., do not form a crossover) but are not complementary (i.e., form a non-complementary pair) In some embodiments, the terminus of one strand of a double-stranded RNAi agent One or more unpaired nucleotides at the ends form an overhang. The nucleotide may be on the sense strand or the antisense strand and may have a 3' or 5' overhang. In some embodiments, the RNAi agent forms either a blunt end or Frayed ends, blunt ends and 5' overhang ends, blunt ends and 3' overhang ends Ends, frayed ends and 5' overhangsEnds, frayed ends and 3' overhangs end, two 5' overhang ends, two 3' overhang ends, 5' overhang ends Contains a 3' overhanging end, two frayed ends, or two blunt ends Typically, if present, the overhang may be on the sense strand, antisense strand, or It is located at the 3' end of both the sense and antisense strands.

[0084] The PNPLA3 RNAi agents disclosed herein also include one or more modified nucleotides. In some embodiments, the PNPLA3 RNAi agent may comprise a ribonucleotide. Substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand , a modified nucleotide. The PNPLA3 RNAi agents disclosed herein further comprise: one or more modified internucleoside linkages, e.g., one or more phosphorothioates In some embodiments, a PNPLA3 RNAi agent may comprise a 1 one or more modified nucleotides and one or more modified internucleoside linkages In some embodiments, the 2'-modified nucleotides include modified internucleoside linkages. To be combined.

[0085] In some embodiments, a PNPLA3 RNAi agent is administered as a salt, mixed salt, or free acid. In some embodiments, a PNPLA3 RNAi agent is prepared or provided using a sodium Such forms, which are well known in the art, are not disclosed herein. It is within the scope of the present invention.

[0086] Modified Nucleotides Modified nucleotides, when used in various oligonucleotide constructs, are effective in cells. This allows the activity of the compounds to be maintained while at the same time increasing the serum stability of these compounds. Potential for activating interferon activity in humans upon administration of oligonucleotide constructs can also be minimized.

[0087] In some embodiments, a PNPLA3 RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" includes a ribonucleic acid In some embodiments, the nucleotide is a nucleotide other than a 2'-hydroxyl nucleotide. In the At least 80%, at least 90%, at least 95%, at least 97%, at least 98% At least 99%, or 100%, of the nucleotides are modified nucleotides. As used herein, modified nucleotides include deoxyribonucleotides, nucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, modified Modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3' -Seconucleotide mimics (locked nucleobase analogues), locked nucleotides, 3'- O-Methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides nucleotides, 5'-Me, 2'-fluoronucleotides, morpholinonucleotides, vinylphospho vinylphosphonate-containing nucleotides, and cyclopropyl deoxyribonucleotides. These include, but are not limited to, 2'-propyl phosphonate-containing nucleotides. Modified nucleotides (i.e., nucleotides with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) Examples of nucleotides include 2'-O-methyl nucleotides and 2'-fluoro nucleotides (Honmei nucleotides). (also referred to as 2'-deoxy-2'-fluoronucleotide in the specification), 2'-deoxy Nucleotides, 2'-Methoxyethyl (2'-O-2-Methoxyethyl)) Nucleotides (also called 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides Modifications that uniformly modify all positions in a given compound include, but are not limited to, oxides. Conversely, two or more modifications may be combined in a single PNPLA3 RNAi agent, or in a single RNAi agent. PNPLA3 can be incorporated into the single nucleotide. The sense and antisense strands can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide can be independent of modifications at another nucleotide. do.

[0088] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6, and O-6 substituted purines, (e.g., 2-amino 5-propynyl adenine, 5-propynyl uracil, or 5-propynyl cytosine), 5-methyl Chiral cytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine , hypoxanthine, 2-aminoadenine, 6-alkyl groups of adenine and guanine (e.g. , 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, adenine and 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or is 2-n-butyl) and other alkyl derivatives, 2-thiouracil, 2-thiothymine, 2- Thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynyl Cytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pso 4-Idouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8- Thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and silyls. Tosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaa 7-deazaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deaza Azaadenine is an example.

[0089] In some embodiments, the 5' and / or 3' ends of the antisense strand contain an abasic residue. The base may contain a group (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Patent No. 5,998,203). In this embodiment, the abasic residue may be positioned internally in the nucleotide sequence. In some embodiments, an Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand contains one or more additional abasic residues ( For example, (Ab) or (AbAb)). In some embodiments, UUAb, The UAb, or Ab, may be added to the 3' end of the sense strand. Base (deoxyribose) residues are replaced with ribitol (abasic ribose) residues can be done.

[0090] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, substantially all of the nucleotides present are nucleotides. RNAi drugs, which are modified nucleotides, are synthesized by combining ribonucleotides (i.e., unmodified) with RNAi drugs. No more than four (i.e., 0, 1, 2, 3, or 4) As used herein, an RNAi agent having nucleotides present is an RNAi agent having nucleotides present. The sense strand, in which substantially all of the nucleotides are modified nucleotides, is ribonucleotides. In the sense strand of the As used herein, substantially all of the nucleotides present are in the sense strand. The antisense strand, which is a modified nucleotide, has a ribonucleotide in the sense strand. , an antisense strand having two or fewer (i.e., 0, 1, or 2) modified nucleotides In some embodiments, one or more nucleotides of an RNAi agent are It is a modified ribonucleotide.

[0091] Modified internucleoside linkages In some embodiments, one or more nucleotides of a PNPLA3 RNAi agent The nucleoside is a nucleotide with a non-standard linkage or backbone (i.e., a modified internucleoside linkage or a modified backbone). The modified internucleoside linkage or backbone is 5'-phosphorothioate. group (represented herein as a lower case "s"), chiral phosphorothioates, Phosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phospho triesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkyl phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g. , 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thiophosphoramidate sphoramidate), thionoalkyl-phosphonates, thionoalkylphosphotriesters Boranophosphates with morpholino linkages, regular 3'-5' linkages, boranophosphite 2'-5' linked analogs of esters, or adjacent nucleoside pair units, 3'-5' to 5' or 2'-5' to 5'-2'. In some embodiments, the modified The modified internucleoside linkage or backbone does not have a phosphorus atom. Interosidic linkages include short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and Alkyl or cycloalkyl intersugar linkages or one or more short chain heteroatoms or include, but are not limited to, heterocyclic intersugar linkages. In some embodiments, Modified internucleoside skeletons include siloxane skeletons, sulfide skeletons, and sulfoxide skeletons. , sulfone skeleton, formacetyl and thioformacetyl skeleton, methyleneformacetyl and thioformacetyl skeleton, alkene-containing skeleton, sulfamate skeleton, methyleneimino and methylenehydrazino skeletons, sulfonate and sulfonamide skeletons, amide skeletons, and Other backbones with mixed N, O, S, and CH2 moieties include, but are not limited to: Not determined.

[0092] In some embodiments, the sense strand of a PNPLA3 RNAi agent is 1, 2, 3, 4, may contain 5 or 6 phosphorothioate linkages, and may be used as antisense oligonucleotides for PNPLA3 RNAi agents. The sense strand may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or Both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioates. In some embodiments, the sense amino acid sequence of a PNPLA3 RNAi agent may include a hydroxyl group. The strand may contain 1, 2, 3, or 4 phosphorothioate linkages, and the PNPLA3 RNA The antisense strand of the drug may contain 1, 2, 3, or 4 phosphorothioate linkages; Both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphorothioates. It may contain an oleate linkage.

[0093] In some embodiments, the sense strand of a PNPLA3 RNAi agent comprises at least two In some embodiments, the nucleoside linkages include phosphorothioate internucleoside linkages. The etheno-internucleoside linkage is between the nucleotides at positions 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is present in the sense at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage In some embodiments, two phosphorothioate nucleotides are present at the 3' end of the nucleotide sequence. An interphosphoriboside linkage is located at the 5' end of the sense strand, and another phosphorothioate linkage is located at the 5' end of the sense strand. In some embodiments, the sense strand has no internucleotide residues. It does not contain phosphorothioate internucleoside linkages, but does contain nucleotides at both the 5' and 3' ends. Contains 1, 2, or 3 phosphorothioate linkages between the terminal nucleotides, optionally In some embodiments, the targeting ligand comprises an inverted abasic residue end cap. , linked to the sense strand via a phosphorothioate linkage.

[0094] In some embodiments, the antisense strand of a PNPLA3 RNAi agent contains four phosphatase inhibitors. In some embodiments, the nucleoside linkages are 4 phosphorothioate. The hydroxylate internucleoside linkage is located at nucleotides 1 to 3 from the 5' end of the antisense strand. Between the 5' end and 19-21, 20-22, 21-23, 22-24, 23-25, or between nucleotides 24 and 26. In some embodiments, three phosphorothioates are present. the oate internucleoside linkage is located between positions 1 and 4 from the 5' end of the antisense strand; A fourth phosphorothioate internucleoside linkage is located 20 to 5' from the 5' end of the antisense strand. 21. In some embodiments, a PNPLA3 RNAi agent is located between positions Contains at least 3 or 4 phosphorothioate internucleoside linkages in the sense strand.

[0095] Capping residues or moieties In some embodiments, the sense strand is what is known in the art as a "cap," "terminal cap," or "terminal " or "capping residues" As used herein, a "capping residue" may comprise a group or moiety. incorporated into one or more ends of the nucleotide sequence of the RNAi agent disclosed herein. The capping residue is a non-nucleotide compound or other moiety that provides an RNAi agent. In some cases, protection against exonuclease degradation may be achieved. In some embodiments, RNAi agents can be provided that have certain beneficial properties. is an inverted abasic residue (invAb) (known in the art as The inverted base site (also called "inverted base site") is added as a capping residue. .Czauderna, Nucleic Acids Res.,2003,31(11 Capping residues are generally those known in the art. For example, reverse abasic residues and terminal C3H7 (propyl), C6H 13 (He Xyl), or C 12 H 25 In some embodiments, the carbon chain comprises a (dodecyl) group. In the present invention, the capping residues are located at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand. In some embodiments, the 5′ end of the sense strand and / or the 3′ end of the sense strand are present. The termini contain two or more inverted abasic deoxyribose moieties as capping residues. obtain.

[0096] In some embodiments, one or more inverted abasic residues (invAb) are present in the sensor. In some embodiments, one or more reverse desalting In some embodiments, a base residue (invAb) is added to the 5' end of the sense strand. One or more inverted abasic nucleosides are linked to the sense strand of the targeting ligand and the RNAi agent. In some embodiments, the sense strand of an RNAi agent may be inserted between the nucleobase sequence of one or more at or near one or both ends of Inclusion of an inverted abasic residue or site in the Desired properties become possible.

[0097] In some embodiments, one or more inverted abasic residues (invAb) are present in the sensor. In some embodiments, one or more reverse desalting A base nucleoside is inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. The inverted abasic residue can be a phosphate, a phosphorothioate (e.g., as described herein). (invAb)s), or linked via other internucleoside linkages. In some embodiments, the terminus or both termini of the sense strand of the RNAi agent may be or by including one or more inverted abasic residues near one or both termini. This may allow for enhanced activity or other desirable properties of the RNAi agent. In this state, the inverted abasic (deoxyribose) residue is replaced by the inverted ribitol (abasic ribose) In some embodiments, the antisense strand core stretch sequence may be replaced with a ) residue. The 3' end, or the 3' end of the antisense strand sequence, may contain an inverted abasic residue. The chemical structures of directional abasic deoxyribose residues are shown in Table 6 below.

[0098] PNPLA3 RNAi drugs The PNPLA3 RNAi agents disclosed herein target the PNPLA3 gene (e.g., It is designed to target a specific location in row number 1).

[0099] NM_025225.2 Homo sapiens patatin-like phospholipase domain-containing 3 (P NPLA3), mRNA (SEQ ID NO: 1): ATGGTCCGAGGGGGGCGGGGCTGACGTCGCGCTGGAAT GCCCTGGCCGAGACACTGAGGCAGGGTAGAGAGCGCTTGC GGGCGCCGGGCGGAGCTGCTGCGGATCAGGACCCGAGCCG ATTCCCGATCCCGACCCAGATCCTAACCCGCGCCCCCGCC CCGCCGCCGCCGCCATGTACGACGCAGAGCGCGGCTGGAG CTTGTCCTTCGCGGGCTGCGGCTTCCTGGGCTTCTACCAC GTCGGGCGACCCGCTGCCTGAGCGAGCACGCCCGCACC TCCTCCGCGACGCGCGCATGTTGTTCGGCGCTTCGGCCGG GGCGTTGCACTGCGTCGGCGTCCTCTCCGGTATCCCGCTG GAGCAGACTCTGCAGGTCCTCTCAGATCTTGTGCGGAAGG CCAGGAGTCGGAACATTGGCATCTTCCATCCATCCTTCAA CTTAAGCAAGTTCCTCCGACAGGGTCTCTGCAAATGCCTC CCGGCCAATGTCCACCAGCTCATCTCCGGCAAAATAGGCA TCTCTCTTACCAGAGTGTCTGATGGGGAAAACGTTCTGGT GTCTGACTTTCGGTCCAAAGACGAAGTCGTGGATGCCTTG GTATGTTCCTGCTTCATCCCCTTCTACAGTGGCCTTATCC CTCCTTCCTTCAGAGGCGTGCGATATGTGGATGGAGGAGT GAGTGACAACGTACCCTTCATTGATGCCAAAACAACCATC ACCGTGTCCCCCTTCTATGGGGAGTACGACATCTGCCCTA AAGTCAAGTCCACGAACTTTCTTCATGTGGACATCACCAA GCTCAGTCTACGCCTCTGCACAGGGAACCTCTACCTTCTC TCGAGAGCTTTTGTCCCCCCGGATCTCAAGGTGCTGGGAG AGATATGCCTTCGAGGATATTTGGATGCATTCAGGTTCTT GGAAGAGAAGGGCATCTGCAACAGGCCCCAGCCAGGCCTG AAGTCATCCTCAGAAGGGATGGATCCTGAGGTCGCCATGC CCAGCTGGGCAAACATGAGTCTGGATTCTTCCCCGGAGTC GGCTGCCTTGGCTGTGAGGCTGGAGGGAGATGAGCTGCTA GACCACCTGCGTCTCAGCATCCTGCCCTGGGATGAGAGCA TCCTGGACACCCTCTCGCCCAGGCTCGCTACAGCACTGAG TGAAGAAATGAAAGACAAAGGTGGATACATGAGCAAGATT TGCAACTTGCTACCCATTAGGATAATGTCTTATGTAATGC TGCCCTGTACCCTGCCTGTGGAATCTGCCATTGCGATTGT CCAGAGACTGGTGACATGGCTTCCAGATATGCCCGACGAT GTCCTGTGGTTGCAGTGGGTGACCTCACAGGTGTTCACTC GAGTGCTGATGTGTCTGCTCCCCGCCTCCAGGTCCCAAAT GCCAGTGAGCAGCCAACAGGCCTCCCCATGCACACCTGAG CAGGACTGGCCCTGCTGGACTCCCTGCTCCCCCAAGGGCT GTCCAGCAGAGACCAAAGCAGAGGCCACCCCGCGGTCCAT CCTCAGGTCCAGCCTGAACTTCTTCTTGGGCAATAAAGTA CCTGCTGGTGCTGAGGGGCTCTCCACCTTTCCCAGTTTTT CACTAGAGAAGAGTCTGTGAGTCACTTGAGGAGGCGAGTC TAGCAGATTCTTTCAGAGGTGCTAAAGTTTCCCATCTTTG TGCAGCTACCTCCGCATTGCTGTGTAGTGACCCCTGCCTG TGACGTGGAGGATCCCAGCCTCTGAGCTGAGTTGGTTTTA TGAAAAGCTAGGAAGCAACCTTTCGCCTGTGCAGCGGTCC AGCACTTAACTCTAATACATCAGCATGCGTTAATTCAGCT GGTTGGGAAATGACACCAGGAAGCCCAGTGCAGAGGGTCC CTTACTGACTGTTTCGTGGCCCTATTAATGGTCAGACTGT TCCAGCATGAGGTTCTTAGAATGACAGGTGTTTGGATGGG TGGGGGCCTTGTGATGGGGGGTAGGCTGGCCCATGTGTGA TCTTGTGGGGTGGAGGGAAGAGAATAGCATGATCCCACTT CCCCATGCTGTGGGAAGGGGTGCAGTTCGTCCCCAAGAAC GACACTGCCTGTCAGGTGGTCTGCAAAGATGATAACCTTG ACTACTAAAAACGTCTCCATGGCGGGGGTAACAAGATGAT AATCTACTTAATTTTAGAACACCTTTTTCACCTAACTAAA ATAATGTTTAAAGAGTTTTGTATAAAAATGTAAGGAAGCG TTGTTACCTGTTGAATTTTGTATTATGTGAATCAGTGAGA TGTTAGTAGAATAAGCCTTAAAAAAAAAAAAATCGGTTGG GTGCAGTGGCACACGGCTGTAATCCCAGCACTTTGGGAGG CCAAGGTTGGCAGATCACCTGAGGTCAGGAGTTCAAGACC AGTCTGGCCAACATAGCAAAACCCTGTCTCTACTAAAAAT ACAAAAATTATCTGGGCATGGTGGTGCATGCCTGTAATCC CAGCTATTCGGAAGGCTGAGGCAGGAGAATCACTTGAACC CAGGAGGCGGAGGTTGCGGTGAGCTGAGATTGCACCATTT CATTCCAGCCTGGGCAACATGAGTGAAAGTCTGACTCAAA AAAAAAAAATTTAAAAAACAAAATAATCTAGTGTGCAGGG CATTCACCTCAGCCCCCCAGGCAGGAGCCAAGCACAGCAG GAGCTTCCGCCTCCTCTCCACTGGAGCACACAACTTGAAC CTGGCTTATTTTCTGCAGGGACCAGCCCCACATGGTCAGT GAGTTTCTCCCCATGTGTGGCGATGAGAGAGTGTAGAAAT AAAGAC

[0100] As defined herein, the antisense strand sequence is a sequence that encodes the PNPLA3 gene. When base pairing with the 5'-terminal nucleic acid base of the antisense strand, the 5'-terminal nucleic acid base of the antisense strand is A given position on a gene when aligned with a position 19 nucleotides downstream (towards the end) For example, as shown in Tables 1 and 2 herein, The antisense strand sequence designed to target the PNPLA3 gene at position 2180 was: When base pairing with the gene, the 5'-terminal nucleobase of the antisense strand is It needs to be aligned with position 2198.

[0101] As provided herein, a core sequence of at least 16 consecutive nucleotides At least 85% complementarity (e.g., at least 100%) of the antisense strand with the gene across the sequence. At least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity), the PNPLA3 RNAi agent It is necessary that the nucleobase at position 1 (5'→3') of the antisense strand is complementary to the gene. For example, the present invention is directed to targeting position 2180 of the PNPLA3 gene. In the case of PNPLA3 RNAi drugs disclosed in the document, The 5'-terminal nucleobase of the second strand must align with position 2198 of the gene; however, However, the 5'-terminal nucleobase of the antisense strand is complementary to position 2200 of the PNPLA3 gene. It may be specific, but should extend over a core stretch sequence of at least 16 consecutive nucleotides. Thus, the antisense strand has at least 85% complementarity with the gene (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 9 9, or 100% complementarity), it is not necessary. As shown in the various examples provided, the antisense strand of the PNPLA3 RNAi agent The specific binding site of the gene (e.g., PNPLA3 RNAi drug) is located at position 2180, 15 To target the PNPLA3 gene at position 86, 1179, or some other position designed or not) is the level of inhibition achieved by PNPLA3 RNAi drugs is important.

[0102] In some embodiments, a PNPLA3 RNAi agent disclosed herein is selected from the group consisting of PNPLA3 RNAi agents listed in Table 1. The PNPLA3 gene is targeted at or near the location of PNPLA3 shown. In embodiments, the antisense strand of a PNPLA3 RNAi agent disclosed herein is The target PNPLA3 19mer sequences disclosed in Table 1 may be fully, substantially, or at least partially It contains at least a partially complementary core stretch sequence.

[0103] [Table 1] 1. When referring to gene locations herein, Applicants refer to the reference gene for human PNPLA3. Use Genebank NM_025225.2 as the clone. February 9, 2020 Around that time, the gene sequence was updated as NM_025225.3. The references to the above will vary the number of "target gene locations" identified in Table 1 above. This does not affect the nucleotide sequences used in the RNAi agents disclosed herein. do not have.

[0104] In some embodiments, a PNPLA3 RNAi agent is an antisense strand (5' to 3' ) can form a base pair with position 1 of the 19mer target sequence disclosed in Table 1. In some embodiments, a PNPLA3 RNAi agent comprises an antisense strand that can Position 1 of the antisense strand (5'→3') corresponds to position 19 of the 19mer target sequence disclosed in Table 1. It contains an antisense strand that is capable of forming base pairs.

[0105] In some embodiments, a PNPLA3 RNAi agent is an antisense strand (5' to 3' ) is known to base pair with position 18 of the 19mer target sequence disclosed in Table 1. In some embodiments, the PNPLA3 RNAi agent comprises an antisense strand that can Positions 2 to 18 of the antisense strand (5'→3') are the 19-mer target sequence disclosed in Table 1 Amino acids that can form base pairs with each of the complementary bases located at positions 18-2 Contains the sense strand.

[0106] In the PNPLA3 RNAi agents disclosed herein, the antisense strand (5' end → 3 The first nucleotide of the 'terminal' sequence may be perfectly complementary to the PNPLA3 gene, or The antisense strand may be non-complementary to the PNPLA3 gene. The nucleotide at position 1 of the 5' end to 3' end is U, A, or dT. In an embodiment, the nucleotide at position 1 of the antisense strand (5' end to 3' end) is It forms A:U or U:A base pairs with the strand.

[0107] In some embodiments, the antisense strand of a PNPLA3 RNAi agent is selected from the group consisting of those listed in Table 2 or Table nucleotides 2 to 18 (5' end to 3' end) of any of the antisense strand sequences in 3; In some embodiments, the sequence includes 2 to 19, 2 to 20, or 2 to 21. 3 The RNAi sense strand is composed of any of the nucleotides (5 'end → 3'end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3 1 to 19, 2 to 19, 1 to 19, 3 to 18, 2 to 18, or 1 to 18.

[0108] In some embodiments, the PNPLA3 RNAi agent antisense strand is SEQ ID NO: 46 nucleotides of any of the antisense strand sequences of ∼60, 176, 181, and 188 Contains the sequence of 2-18, 2-19, 2-20, or 2-21 of the nucleotides (5' end → 3' end) In some embodiments, the PNPLA3 RNAi sense strand is selected from the group consisting of SEQ ID NOs: 2, 3, 4, Any of nucleotides 9 to 20, 214, 219, and 220 in the sense strand sequence (5' end → 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20 , 3 to 19, 2 to 19, 1 to 19, 3 to 18, 2 to 18, or 1 to 18.

[0109] In some embodiments, a PNPLA3 RNAi agent is selected from the group consisting of: (i) an RNAi agent selected from the group consisting of ... 2 to 18 or 2 nucleotides (5' end to 3' end) of any of the sense strand sequences (ii) an antisense strand containing a sequence of 19 or 20; and (iii) a sense strand containing any of the sequences in Table 2 or Table 4. Nucleotides (5' end → 3' end) 3 to 21, 2 to 21, 1 to 21, 3 to 20, 2 ~20, 1~20, 3~19, 2~19, 1~19, 3~18, 2~18, or 1~18 and a sense strand containing the sequence:

[0110] In some embodiments, a PNPLA3 RNAi agent is selected from the group consisting of: (i) SEQ ID NOs: 46-60; Any of nucleotides 176, 181, and 188 of the antisense strand sequence (5' end → 3' end) an antisense strand containing a sequence of 2 to 18 or 2 to 19, and (ii) SEQ ID NO: 2 , 3, 4, 9-20, 214, 219, and 220 of the sense strand sequence Tide (5' end → 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1- 20, 3 to 19, 2 to 19, 1 to 19, 3 to 18, 2 to 18, or 1 to 18 It consists of the sense strand.

[0111] In some embodiments, a PNPLA3 RNAi agent is a core 19m RNAi agent as shown in Table 2 below. er nucleotide sequence.

[0112] [Table 2-1]

[0113] [Table 2-2]

[0114] Sense and antisense strands of PNPLA3 RNAi agents comprising or consisting of the sequences of Table 2 The sense strand can be modified or unmodified nucleotides. In this embodiment, the sense strand sequence and the antisense strand sequence comprise or consist of the sequences in Table 2. The PNPLA3 RNAi agent has all or substantially all modified nucleotides.

[0115] In some embodiments, the antisense oligonucleotides of the PNPLA3 RNAi agents disclosed herein are The sense strand is 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the PNPLA3 RNAi agents disclosed herein are The antisense strands are the antisense strands of SEQ ID NOs: 46 to 60, 176, 181, and 188. In some embodiments, the sequence differs by 0, 1, 2, or 3 nucleotides. The sense strand of the PNPLA3 RNAi agents disclosed herein may be any of the sense strand sequences in Table 2. In some embodiments, The sense strand of the PNPLA3 RNAi agents disclosed herein is set forth in SEQ ID NOs: 2, 3, 4, 9 ~20, 214, 219, and 220 sense strand sequences and 0, 1, 2, or 3 The nucleotides differ.

[0116] As used herein, each N listed in the sequences disclosed in Table 2 represents any and all of nucleobases (including those found in both modified and unmodified nucleotides) In some embodiments, the sequences listed in Table 2 can be independently selected from the sequences listed in Table 2. N nucleotides have a nucleobase complementary to the N nucleotide at the corresponding position on the other strand In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 are have nucleobases that are not complementary to the N nucleotides at the corresponding positions on the other strands. In embodiments, the N nucleotides listed in the sequences disclosed in Table 2 are the corresponding nucleotides on the other strand. In some embodiments, the nucleic acid bases are the same as the N nucleotides at the positions shown in Table 2. The N nucleotides listed in the sequence to be have different nucleobases.

[0117] Specific modified PNPLA3 RNAi drug antisense strand sequences and their underlying unmodified Modified sequences are provided in Table 3. Sense strands of specific modified PNPLA3 RNAi agents, as well as The underlying unmodified sequence is provided in Table 4. In each of the unmodified sequences listed in Tables 3 and 4, and Table 2, supra, Each nucleotide may be a modified nucleotide.

[0118] The PNPLA3 RNAi agents described herein anneal the antisense strand with the sense strand. The sense strand containing the sequence listed in Table 2 or Table 4 is formed by A sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides A sequence listed in Table 2 or Table 3 is considered to be a complement of a sequence of interest if it has a region of at least about 85% complementarity. The nucleotide sequence can be hybridized to any antisense strand containing the nucleotide sequence.

[0119] In some embodiments, the antisense strand of a PNPLA3 RNAi agent is selected from the group consisting of those listed in Table 2 or Table The nucleotide sequence of any one of the three sequences is included.

[0120] In some embodiments, the PNPLA3 RNAi agent is any of those listed in Table 2, Table 3, or Table 4. a duplex having the nucleic acid base sequences of the sense and antisense strands of the sequence, or In some embodiments, the PNPLA3 RNAi agent consists of SEQ ID NO: (176 and 214), (90 and 131), (181 and 219), (95 and 136), (1 88 and 220), and / or (102 and 137), or In some embodiments, the nucleic acid sequence of SEQ ID NOs: (176 and 214), (90 and 1 31), (181 and 219), (95 and 136), (188 and 220), or (1 PNPLA3 RNAi drug duplex sequences, including 02 and 137, are available in sodium salts, mixed salts, and , or prepared or provided as the free acid.

[0121] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing the nucleotides are provided in Table 4.

[0122] As used in Tables 3 and 4, the following nomenclature is used to denote modified nucleotides and linking groups: Use. A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate A UNA = 2',3'-seco-adenosine-3'-phosphate, see Table 6 . A UNA s=2',3'-seco-adenosine-3'-phosphorothioate, see Table 6 I want to be done that. C UNA = 2',3'-seco-cytidine-3'-phosphate, see Table 6. C UNA s=2',3'-seco-cytidine-3'-phosphorothioate, see Table 6 I want to be. G UNA = 2',3'-seco-guanosine-3'-phosphate, see Table 6 . G UNA s=2',3'-seco-guanosine-3'-phosphorothioate, see Table 6 I want to be done that. U UNA = 2',3'-seco-uridine-3'-phosphate, see Table 6. U UNA s=2',3'-seco-uridine-3'-phosphorothioate, see Table 6 I want to be. a_2N = 2'-O-methyl-2-aminoadenosine-3'-phosphate, see Table 6 I want to be illuminated. a_2Ns=2'-O-methyl-2-aminoadenosine-3'-phosphorothioate, See Table 6. (invAb) = inverted abasic deoxyribonucleotide, see Table 6. (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate See Table 6.

[0123] As one of skill in the art will readily appreciate, the amino acid sequence may be selected from the group consisting of nucleotides (e.g., phosphorothioate linkages, "s Unless otherwise indicated (e.g., by "), when present in an oligonucleotide, The tide monomers are linked to each other by 5'-3'-phosphodiester bonds. As will be clearly understood, the host sequences shown in the modified nucleotide sequences disclosed herein The inclusion of a phosphothioate linkage is a phosphodiesterase inhibitor typically present in oligonucleotides. Furthermore, one skilled in the art can easily distinguish between the 3′-terminus of a given oligonucleotide sequence and the 5′-terminus of a given oligonucleotide sequence. The terminal nucleotide is typically substituted ex vivo for a given molecule in place of a phosphate moiety. It is easy to see that each of the monomers has a hydroxyl (-OH) group at the 3' position. Furthermore, in the embodiments disclosed herein, each strand is viewed 5' to 3'. When the reverse abasic residue is formed, the 3' position of the deoxyribose is aligned with the previous mononucleotide on each strand. The nucleotide sequence is inserted so that it is linked to the 3' end of the nucleotide sequence (see, for example, Table 6). As those skilled in the art will readily understand and appreciate, the phosphorothioate chemical structures shown herein The structure typically shows an anion on the sulfur atom, and the invention disclosed herein is directed to all Phosphorothioate tautomers (e.g., where the sulfur atom has a double bond and the anion is an oxygen atom) Unless otherwise expressly stated herein, such understanding by a person skilled in the art is PNPLA3 RNAi Agents and Compositions of PNPLA3 RNAi Agents Disclosed Herein It is used when describing.

[0124] Targeting ligands for use with the PNPLA3 RNAi agents disclosed herein: Specific examples of targeting groups and linking groups are provided below in Table 6. More specifically, targeting groups and and linking groups (which together can form a targeting ligand) are (NAG37) and (N AG37)s, the chemical structures of which are provided in Table 6 below. The antisense strand is conjugated to the 5' and / or 3' end of the sequence, The targeting ligand, targeting group, or linking group may have any of the targeting ligands, targeting groups, or linking groups listed in Table 1, as well as other groups.

[0125] [Table 3-1]

[0126] [Table 3-2]

[0127] [Table 4-1]

[0128] [Table 4-2] (A 2N ) = 2-aminoadenine nucleotide, I = hypoxanthine (inosine) nucleotide Reotide

[0129] The PNPLA3 RNAi agents described herein anneal the antisense and sense strands. The sense strand containing a sequence listed in Table 2 or Table 4 is formed by linking. The two sequences are separated into a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides. 85% complementary region across the nucleotide sequence of the target gene, The sequence can be hybridized to any antisense strand containing the sequence.

[0130] In some embodiments, the antisense oligonucleotides of the PNPLA3 RNAi agents disclosed herein are The sense strand is 0, 1, 2, or 3 nucleotides different from any of the antisense strand sequences in Table 3. In some embodiments, the PNPLA3 RNAi agents disclosed herein are The sense strand differs from any of the sense strand sequences in Table 4 by 0, 1, 2, or 3 nucleotides. become.

[0131] In some embodiments, the antisense strand of a PNPLA3 RNAi agent is selected from the group consisting of those listed in Table 2 or Table In some embodiments, the PNPLA3 The RNAi drug antisense strand consists of either the nucleotides in Table 2 or Table 3 (5' end End → 3' end) 1~17, 2~17, 1~18, 2~18, 1~19, 2~19, 1~2 In some embodiments, the PNP The LA3 RNAi agent antisense strand comprises any one of the modified sequences in Table 3. or consisting of

[0132] In some embodiments, the PNPLA3 RNAi agent sense strand is a sequence of Table 2 or Table 4. In some embodiments, the PNPLA3 RNA comprises the nucleotide sequence of any of The antisense strand of the drug is a nucleotide sequence of either Table 2 or Table 4 (5' end → 3 'Terminal) 1~17, 2~17, 3~17, 4~17, 1~18, 2~18, 3~18, 4 ~18, 1~19, 2~19, 3~19, 4~19, 1~20, 2~20, 3~20, 4 Some embodiments include sequences of 1 to 20, 1 to 21, 2 to 21, 3 to 21, or 4 to 21. In this embodiment, the sense strand of the PNPLA3 RNAi agent contains one of the modification sequences in Table 4. It comprises or consists of the sequence

[0133] In the PNPLA3 RNAi agents disclosed herein, the antisense strand (5' end → 3 The first nucleotide of the 'terminal' sequence may be perfectly complementary to the PNPLA3 gene, or The antisense strand may be non-complementary to the PNPLA3 gene. The nucleotide at position 1 of the 5' end to 3' end is U, A, or dT. In an embodiment, the nucleotide at position 1 of the antisense strand (5' end to 3' end) is It forms A:U or U:A base pairs with the strand.

[0134] The sense strand containing the sequence listed in Table 2 or Table 4 is a sequence of two consecutive sequences, 16, 17, At least about 85% complementarity over a sequence of 18, 19, 20, or 21 nucleotides If the antisense strand has a sequence similar to that of Table 2 or Table 3, In some embodiments, the PNPLA3 RNAi The drug comprises a sense strand consisting of any of the modified sequences in Table 4 and a modified sequence in Table 3. The antisense strand consists of a modified sequence from any of the sequences. are exemplified by the duplex ID numbers shown in Tables 5A and 5B.

[0135] In some embodiments, a PNPLA3 RNAi agent is a duplex as presented herein. comprising or consisting of a duplex represented by any one of the ID numbers; In some embodiments, a PNPLA3 RNAi agent comprises a PNPLA3 RNAi agent as described herein. Any sense strand of a duplex represented by any of the duplex ID numbers presented in this publication and the antisense strand nucleotide sequence. An RNAi agent can be a duplex represented by any of the duplex ID numbers presented herein. the sense and antisense strand nucleotide sequences of any of the above, and a targeting group and / or The targeting group and / or the linking group are covalently bonded to the sense strand or the antisense strand. In some embodiments, In some embodiments, a PNPLA3 RNAi agent may be a nucleic acid sequence encoding any of the duplex ID numbers provided herein. In some embodiments, the PNP comprises a modified nucleotide sequence in the antisense strand. LA3 RNAi agents may be used in combination with the sense strand and any of the duplex ID numbers provided herein. and / or a modified nucleotide sequence of the antisense strand, and a targeting group and / or a linking group, The targeting group and / or linking group are covalently linked to the sense or antisense strand. There are.

[0136] In some embodiments, a PNPLA3 RNAi agent is an RNAi agent selected from the group consisting of: The antisense strand and the sense strand have either of the nucleotide sequences of the antisense strand / sense strand duplex. and a sense strand, and further comprising a targeting group or targeting ligand. PNPLA3 RNAi agents are the antisense / sense strand pairs listed in Table 2 or Tables 5A and 5B. The antisense strand and the sense strand have the nucleotide sequence of either the heavy chain, The glycoprotein receptor ligand further comprises a targeting group.

[0137] The targeting group may be any of those disclosed in Tables 2, 3, and 4, with or without a linker. The linker may be attached to the 5' or 3' end of the sense strand and / or the antisense strand. Any of the sense strands and / or amino acids disclosed in Table 2, Table 3, and Table 4, with or without targeting groups. can be attached to the 5' or 3' end of the antisense strand.

[0138] In some embodiments, the PNPLA3 RNAi agent is a PNPLA3 RNAi agent selected from the group consisting of those listed in Table 2 or Tables 5A and 5B. Antisense strands having either nucleotide sequence of the antisense strand / sense strand duplex The sense and sense strands are (NAG37) and (NAG38), respectively, as defined in Table 6. The method further comprises a targeting ligand selected from the group consisting of NAG37).

[0139] In some embodiments, the PNPLA3 RNAi agent is an antisense amplicons having modified nucleotide sequences in either the sense strand and / or the sense strand nucleotide sequences. It includes both the antisense strand and the sense strand.

[0140] In some embodiments, a PNPLA3 RNAi agent is a duplex of Table 5A and Table 5B. Any modified nucleotides in either the antisense strand and / or sense strand nucleotide sequences The antisense strand and the sense strand having a nucleotide sequence are included in the asialoglycoprotein receptor linker. The compound further comprises a targeting group.

[0141] In some embodiments, a PNPLA3 RNAi agent is a duplex of Table 5A and Table 5B. Comprising, consisting of, or consisting essentially of any.

[0142] [Table 5]

[0143] [Table 6]

[0144] In some embodiments, a PNPLA3 RNAi agent is administered as a salt, mixed salt, or free acid. The RNAi agents described herein are prepared or provided in cells that express PNPLA3. Upon delivery, one or more PNPLA3 genes may be expressed in vivo and / or in vitro. inhibits the expression of

[0145] Targeting Ligands or Groups, Linking Groups, and Delivery Vehicles In some embodiments, a PNPLA3 RNAi agent may comprise a targeting group, a linking group, a targeting linker, a one or two, including but not limited to, a carrier, a delivery polymer, or a delivery vehicle The non-nucleotide group is conjugated to the RNAi agent. Table 6 provides examples of targeting groups and linking groups. The non-nucleotide group may be present in either the sense strand and / or the antisense strand. It may be covalently linked to the 3' and / or 5' ends. 3 RNAi agents contain non-nucleotide groups linked to the 3' and / or 5' ends of the sense strand. In some embodiments, the non-nucleotide group comprises a sensor molecule of a PNPLA3 RNAi agent. The non-nucleotide group is linked to the 5' end of the base strand either directly or via a linker / linking group. can be indirectly linked to the RNAi agent. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile cleavable or reversible bond or linker. can be.

[0146] In some embodiments, the non-nucleotide group is selected from the group consisting of nucleotides, which may be cell-specific or tissue-specific. Fabric and attached to improve cell-specific uptake of RNAi drugs or conjugates These may improve the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent. Can.

[0147] The targeting group or targeting moiety is a targeting group or moiety that allows the conjugate or RNAi agent to be cell-specific (e.g., In some cases, organ-specific (including organ-specific) distribution and cell-specific (or organ-specific) uptake. Attached to improve the pharmacokinetics or biodistribution of the conjugate or RNAi agent The targeting group may be monovalent, divalent, trivalent, tetravalent, or Exemplary targeting groups include those that target cell surface molecules. compounds having affinity for, cell receptor ligands, haptens, antibodies, monoclonal antibodies, These include antibody fragments and antibody mimics that have affinity for cell surface molecules. Not limited to.

[0148] In some embodiments, the targeting group may be a linker, e.g., a PEG linker, or one, two, or three abasic groups, and / or are linked to RNAi agents using ribitol (abasic ribose) residues. In embodiments, the targeting ligand comprises a galactose derivative cluster.

[0149] The PNPLA3 RNAi agents described herein may comprise at the 5' and / or 3' end , synthesized to have a reactive group such as an amino group (also referred to herein as an amine) This reactive group can then be attached to the target using methods typical in the art. It can be used to attach a functional part.

[0150] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand refers to an asialoglycoprotein receptor ligand. A ligand comprising a moiety that has affinity for a protein receptor. Thus, asialoglycoprotein receptors are highly expressed on hepatocytes. In one embodiment, the asialoglycoprotein receptor ligand comprises one or more galactosidases. As used herein, a galactose derivative comprises or consists of a galactose derivative. The term refers to the galactose and its affinity for the asialoglycoprotein receptor. Galactose derivatives with an affinity greater than or equal to galactose are also included. The structures are galactose, galactosamine, N-formylgalactosamine, and N-acetylgalactosamine. N-propionyl-galactosamine, Nn-butanoyl-galactosamine These include, but are not limited to, galactosamine, and N-iso-butanoylgalactosamine. (e.g., S.T. Iobst and K. Drickamer, JBC, 1 (See, e.g., 996,271,6686). Oligonucleotides and other Galactose derivatives and classes of galactose derivatives useful for in vivo targeting of molecules are described in the literature. It is well known in the art (e.g., Baenziger and Fiete, 1980 ,Cell,22,611-620;Connolly et al.,1982,J. Biol. Chem., 257, 939-945).

[0151] Galactose derivatives bind to the asialoglycoprotein receptor expressed on the surface of hepatocytes. It has been used to target molecules to liver cells in vivo via conjugation. Binding of asialoglycoprotein receptor ligands to alloglycoprotein receptors promotes the transport of glycoproteins to hepatocytes. Facilitates cell-specific targeting and endocytosis of molecules into hepatocytes. Protein receptor ligands are monomers (e.g., single galactose, also referred to as monovalent or monodentate). may be a polymer (e.g., having multiple galactose derivatives) or a polymer (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster can be prepared by methods known in the art. The method is used to attach the 3' or 5' end of the sense or antisense strand of the RNAi agent. The preparation of targeting ligands such as galactose derivative clusters can be carried out e.g. For example, the international patent application for Arrowhead Pharmaceuticals, Inc. Patent Application Publication No. 2018 / 044350 and Arrowhead Pharmaceu The present invention is described in International Patent Application Publication No. 2017 / 156012 to Artificials, Inc. and US Pat. No. 6,229,199, the contents of both of which are incorporated herein by reference in their entireties.

[0152] As used herein, a galactose derivative cluster is a cluster of 2 to 4 terminal galactose derivatives. The terminal galactose derivative is attached via its C-1 carbon to In some embodiments, the galactose derivative cluster is attached to a molecule. , a galactose derivative trimer (a tri-branched galactose derivative or a trivalent galactose In some embodiments, the galactose derivative cluster In some embodiments, the galactose derivative comprises N-acetyl-galactosamine. The conductor cluster comprises three N-acetyl-galactosamines. In this case, the galactose derivative cluster is a galactose derivative tetramer (tetrabranched galactose derivative). (also called lactose derivatives or tetravalent galactose derivatives). In this case, the galactose derivative cluster contains four N-acetyl-galactosamines.

[0153] As used herein, galactose derivative trimers are each linked to a central branch point. As used herein, galactose derivatives include the three galactose derivatives described above. Each tetramer contains four galactose derivatives linked to a central branch point. The sugar derivatives can be attached to the central branch point through the C-1 carbon of the sugar. In some embodiments, the galactose derivative is linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer may be a flexible group such as a PEG group. It is a hydrophilic spacer that can be used (e.g., U.S. Pat. No. 5,885,968, Biess en et al.J.Med.Chem.1995 Vol.39 p.1538-1 In some embodiments, the PEG spacer is a PEG3 spacer. This branch point allows the attachment of three galactose derivatives, and The branch point can be any small molecule that allows for the attachment of a branch point to an RNAi agent. Examples of branch point groups are dilysine or diglutamate. Attachment of branch points to RNAi agents The linking can be via a linker or spacer. The linker or spacer may be a flexible hydrophilic spacer (e.g., a PEG spacer). In some embodiments, the linker includes, but is not limited to, In some embodiments, the galactose derivative comprises a rigid linker (e.g., a cyclic group). The conductor comprises or consists of N-acetyl-galactosamine. In the present invention, the galactose derivative cluster is composed of a galactose derivative tetramer, can be, for example, an N-acetyl-galactosamine tetramer.

[0154] Embodiments of the present disclosure provide a method for delivering PNPLA3 RNAi agents to hepatocytes in vivo. Such pharmaceutical compositions include, for example, pharmaceutical compositions containing galactose derivatives conjugated to the galactose derivative group. In some embodiments, the GALA3 RNAi agent may comprise a gated PNPLA3 RNAi agent. The galactose derivative cluster is composed of a galactose derivative trimer (which is e.g., N-acetyl -galactosamine trimers), or galactose derivative tetramers (which may be, for example, N-acetyl-galactosamine tetramers).

[0155] The targeting ligand or targeting group is a molecule that binds to the PNPLA3 RNAi agents disclosed herein. The nucleotide sequence can be linked to the 3' or 5' end of the sense or antisense strand.

[0156] Targeting ligands include (NAG37) and (NAG37)s as defined in Table 6. Other ligands include, but are not limited to, galactose cluster targeting ligands. Targeting groups and targeting ligands are known in the art.

[0157] In some embodiments, a linking group is conjugated to the RNAi agent. , facilitating covalent attachment of the drug to the targeting group or delivery polymer or delivery vehicle. The linking group is attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the sense strand of the RNAi agent. In some embodiments, the linking group is at the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the sense strand of the RNAi agent. Examples of linking groups include reactive groups, such as primary amino groups. amines and alkynes, alkyl groups, abasic nucleosides, ribitol (abasic ribose), and These may include, but are not limited to, a hydroxyl group and / or a PEG group.

[0158] In some embodiments, the targeting group is a targeting group that ... In some embodiments, the targeting group is linked internally to a nucleotide on the strand. It is linked to the RNAi drug via an anchor.

[0159] A linker or linking group is a group that connects one chemical group ( RNAi agents) or segments of interest, attached to another chemical group (e.g., a targeting group or delivery polymer) A labile bond is a bond between two atoms that connects a labile bond or segment. A linkage may optionally include a spacer that increases the distance between the two bond atoms. Spacers can add additional flexibility and / or length to the link. The spacer may be an alkyl group, an alkenyl group, an alkynyl group, an aryl group, an aralkyl group, or an aryl group. These include, but are not limited to, aryl, aralkenyl, and aralkynyl groups. Each contains one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars Spacer groups are well known in the art and the above list is not intended to be limiting of the scope of this specification. is not meant to limit

[0160] In some embodiments, when two or more RNAi agents are included in a single composition, In this case, each RNAi agent may have the same targeting group or two different targeting groups (i.e., different chemical structures). In some embodiments, the targeting group may be linked to a targeting group having an additional linked to a PNPLA3 RNAi agent disclosed herein without the use of a linker In some embodiments, the targeting group itself is readily available for conjugation. Some experiments have been designed with linkers or other moieties to facilitate the binding of the In embodiments, when two or more PNPLA3 RNAi agents are included in a single molecule: Each RNAi agent may have the same linker or different linkers (i.e., different chemical structures). Linker) may be used.

[0161] Any of the PNPLA3 RNAi agent nucleotide sequences listed in Table 2, Table 3, or Table 4 These may include 3' and / or 5' targeting or linking groups, whether modified or unmodified. Alternatively, a 3' or 5' targeting or linking group can be used as listed in Table 3 or Table 4. Any of the PNPLA3 RNAi agent sequences described herein may be 3' or or may not include a 5' targeting group or linking group, or may include those shown in Table 6. These may include, but are not limited to, different 3' or 5' targeting or linking groups. Any of the PNPLA3 RNAi agent duplexes listed in Table 5A and Table 5B may be modified Targeting groups or groups, whether modified or unmodified, including but not limited to those shown in Table 6 can further comprise a linking group, and the targeting group or linking group is It can be attached to the 3' or 5' end of either the sense or antisense strand. can.

[0162] A targeting group and a linking group (which when combined can form a targeting ligand) Examples of targeting groups or linkages attached to the 5' or 3' termini are provided in Table 6. Table 4 shows examples of targeting groups or linkages attached to the 5' or 3' termini.

[0023] Several embodiments of a sense strand of a PNPLA3 RNAi agent having a group are provided.

[0163] [Table 7-1]

[0164] [Table 7-2]

[0165] [Table 7-3]

[0166] In each of the above structures in Table 6, NAG is a nucleotide analogue of the above structure and the nucleotide analogues provided herein. The N-acetyl-gas compound will be understood by those skilled in the art to be incorporated in light of the following description. Contains lactosamine or another galactose derivative.

[0167] Each (NAGx) may contain a phosphate group (as in (NAG37)) or a phosphorothioate group. PNPLA via an oate group (as in (NAG37)s) or another linking group 3 may be attached to an RNAi drug.

[0168] [ka]

[0169] Other linking groups known in the art may also be used.

[0170] In some embodiments, a delivery vehicle is used to deliver an RNAi agent to a cell or tissue. The delivery vehicle can be a compound that improves delivery of the RNAi agent to a cell or tissue. Delivery vehicles include polymers (e.g., amphiphilic polymers, membrane-active polymers) , peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified poly The present invention may also include a polymer or peptide, or a reversibly modified membrane-active polyamine. In some embodiments, the RNAi agent comprises, but is not limited to, a lipid, Nanoparticles, polymers, liposomes, micelles, DPCs, or other polymers available in the art. RNAi agents can also be combined with targeting groups, lipids (cholesterols), and delivery systems. and cholesteryl derivatives), nanoparticles, polymers , liposomes, micelles, DPCs (e.g., WO 2000 / 05372 ... Nos. 008 / 0022309, 2011 / 104169, and 2012 / 083 See No. 185, No. 2013 / 032829, and No. 2013 / 158141 , each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, proteinaceous vectors, or are suitable for delivery of nucleic acids or oligonucleotides, as well as other nucleic acid delivery systems known and available in the art. The compound can be chemically conjugated to a delivery system of

[0171] Pharmaceutical Compositions and Formulations The PNPLA3 RNAi agents disclosed herein may be used in pharmaceutical compositions or formulations (referred to herein as "pharmaceutical compositions or formulations"). In some embodiments, the pharmaceutical The pharmaceutical compositions include at least one PNPLA3 RNAi agent. , particularly useful for inhibiting expression of a target mRNA in a target cell, cell population, tissue, or organism. is.

[0172] The pharmaceutical composition is intended to reduce the level of target PNPLA3 mRNA or inhibit the expression of a target gene. used to treat a subject with a disease, disorder, or condition that would benefit from The pharmaceutical composition can be used to reduce the level of a target mRNA or the expression of a target gene. and treating a subject at risk for developing a disease, disorder, or condition that would benefit from inhibition of In one embodiment, the method can be used to treat a target as described herein. The method includes administering to the subject a PNPLA3 RNAi agent linked to a targeting ligand. In some embodiments, one or more pharmaceutically acceptable excipients (vehicles, carriers, etc.) may be added. a pharmaceutical composition (including a carrier, a diluent, and / or a delivery polymer) comprising a PNPLA3 RNAi agent; and thereby creating a pharmaceutical formulation or composition suitable for in vivo delivery to a subject, including a human. is formed into a medicine.

[0173] Pharmaceutical compositions and methods comprising the PNPLA3 RNAi agents disclosed herein have therapeutic benefits. an effective amount of a PNPLA3 RNAi agent described herein is administered to the subject, thereby providing By inhibiting the expression of PNPLA3 in cells, cell groups, cell populations, tissues, organs, or reducing the level of a target mRNA in the subject. In some embodiments, the subject and the pathogenic upregulation of the target gene in the targeted cell or tissue. In some embodiments, the subject has been previously identified or diagnosed with NAFLD, NASH, or have alcoholic or non-alcoholic liver disease, such as liver fibrosis, and / or cirrhosis In some embodiments, the subject has previously been identified or diagnosed with NAFLD, NA Related to alcoholic or non-alcoholic liver diseases such as SH, liver fibrosis, and / or cirrhosis suffers from related symptoms.

[0174] In some embodiments, the described pharmaceutical compositions comprising a PNPLA3 RNAi agent include NAFLD, including cirrhosis, NASH, liver fibrosis, alcoholic or non-alcoholic liver disease in subjects Treating or managing clinical symptoms associated with chronic liver disease and / or overexpression of PNPLA3 In some embodiments, a therapeutically (including prophylactically) effective amount of one or Two or more pharmaceutical compositions are administered to a subject in need of such treatment. In embodiments, administration of any PNPLA3 RNAi agent of the present disclosure reduces or eliminates a disease in a subject. The compounds can be used to reduce the number, severity, and / or frequency of symptoms of

[0175] The described pharmaceutical compositions comprising a PNPLA3 RNAi agent inhibit the expression of PNPLA3 mRNA. At least one of the following is a target gene for a disease or disorder that would benefit from reduced or inhibited expression: In some embodiments, the compound may be used to treat at least one symptom. The subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising a PNPLA3 RNAi agent. In other embodiments, a subject is administered a prophylactically effective amount of one of or two or more PNPLA3 RNAi agents are administered, thereby improving at least one symptom. Prevent or inhibit the condition.

[0176] The route of administration is the route by which the PNPLA3 RNAi agent comes into contact with the body. Methods for administering drugs and oligonucleotides and nucleic acids for the treatment of diseases are well known in the art. are well known in the art and can be applied to the administration of the compositions disclosed herein. The PNPLA3 RNAi drugs are designed to target specific pathways in tailored preparations. Administration can be via any suitable route, thereby allowing the use of the pharmaceutical compositions described herein. The pharmaceutical composition can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein can be administered transdermally. It is administered by subcutaneous injection.

[0177] Pharmaceutical compositions containing the PNPLA3 RNAi agents described herein can be prepared using methods known in the art. to a cell, group of cells, tissue, or subject using the oligonucleotide delivery technology of Generally, the techniques for delivering nucleic acid molecules (in vitro or in vivo) are Any suitable method recognized in the art may be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, topical administration). , systemic administration, subcutaneous administration, intravenous administration, intraperitoneal administration, or intracranial administration (e.g., intraventricular, intraparenchymal, and intrathecal administration). intracavitary), intramuscular, transdermal, respiratory (aerosol), nasal, oral, rectal, or topical (oral and In certain embodiments, the administration may be parenteral, including sublingual. The compositions are administered by subcutaneous or intravenous infusion or injection.

[0178] In some embodiments, the pharmaceutical compositions described herein contain one or more pharmaceutical The pharmaceutical compositions described herein can be formulated for administration to a subject. It will be transformed.

[0179] As used herein, a pharmaceutical composition or medicament refers to a pharmacologically effective amount of a described at least one of a therapeutic compound and one or more pharmaceutically acceptable excipients Pharmaceutically acceptable excipients (vehicles) are substances intentionally used in drug delivery systems. Active Pharmaceutical Ingredients (APIs, therapeutic products, e.g. Excipients are substances other than the intended therapeutic agent at the intended dose. excipients are those that have no effect or are not intended to have any effect. b) to improve the stability, bioavailability, if any, of the API, to aid in the processing of the drug delivery system during or act to protect, support, or enhance patient acceptance; and c) assist in product identification. and / or d) improve the overall safety, effectiveness, and / or safety of the API during storage or use. Pharmaceutically acceptable excipients may act to enhance the efficacy, efficacy, or any other attribute of delivery. It may or may not be an inert material.

[0180] Excipients include absorption enhancers, anti-adhesion agents, anti-foaming agents, antioxidants, binders, buffers, carriers, Coating agents, colorants, delivery enhancers, delivery polymers, detergents, Strain, dextrose, diluent, disintegrant, emulsifier, extender, filler, flavoring agent, lubricant, Moisturizers, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants (su rfactants), suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, repellents These include, but are not limited to, water agents and humectants.

[0181] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions. and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Suitable carriers include saline, bacteriostatic water, Cremophor® EL™ ( BASF, Parsippany, NJ), or phosphate buffered saline (PBS). Suitable carriers must be stable under the conditions of manufacture and storage and must resist bacteria, fungi, etc. The carrier must be protected from the contaminating action of microorganisms such as water, ethanol, Polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) The solvent or dispersion medium may be a solvent or dispersion medium containing a suitable mixture thereof. The use of coatings such as cysteine ​​can help maintain the required particle size in the case of dispersions, or In addition, the use of surfactants can maintain proper fluidity. In addition, for example, sugars, polyhydric alcohols such as mannitol and sorbitol, and sodium chloride It is preferred to include an isotonic agent such as aluminum monostearate in the composition. Injectable compositions can be made to last longer by including an agent that delays absorption, such as PEG and gelatin. This can result in long-term absorption.

[0182] Sterile injectable solutions may be prepared by mixing the active compound in the required amount with one or more of the ingredients enumerated above, as required. The compound is prepared by adding it to a suitable solvent and sterilizing it by filtration. Generally, dispersions are prepared by incorporating the active compound into a basic dispersion medium and any other suitable dispersion medium as enumerated above. It is prepared by incorporating it into a sterile vehicle containing other ingredients. In the case of bacterial powder, the method of preparation involves extracting the active ingredient and any additional ingredients from a previously sterile filtered solution thereof. Examples of suitable methods include vacuum drying and freeze drying, which produce powders of the desired components.

[0183] In some embodiments, the PNPLA3 RN disclosed herein is suitable for subcutaneous administration. Pharmaceutical formulations containing Ai drugs can be prepared in aqueous sodium phosphate buffers (e.g., For example, 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic in water PNPLA3 RNAi drug formulated with

[0184] Formulations suitable for intra-articular administration are in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. The drug may be in the form of a sterile aqueous preparation of the drug. Liposomal formulations or biodegradable polymer systems may also be used. It can be used to administer drugs for both intra-articular and intraocular administration.

[0185] Formulations suitable for oral administration of the PNPLA3 RNAi agents disclosed herein can also be prepared. In some embodiments, the PNPLA3 RNAi agents disclosed herein can In some embodiments, the PNPLA3 RN disclosed herein is administered orally. Ai drugs are formulated in capsules for oral administration.

[0186] The active compound may be administered in a controlled release formulation, including implants and microencapsulated delivery systems. The compound can be formulated with a carrier that will protect it from rapid elimination from the body, such as Ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyortho Biodegradable biocompatible polymers such as esters and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions may also be used in pharmaceutical preparations. These can be used as carriers for the preparation of pharmaceutical compositions. It can be prepared according to methods well known to those skilled in the art, such as those described in US Pat. No. 6,449,999.

[0187] The PNPLA3 RNAi drug is available in a dosage unit form for ease of administration and uniformity of dosage. A dosage unit form can be formulated as a unit dose for a subject to be treated. "Pharmaceutical" refers to physically distinct units suitable for administering the desired therapeutic agent in association with the required pharmaceutical carrier. The dosage unit forms of the present disclosure contain a predetermined amount of active compound calculated to produce a therapeutic effect. The specifications for the formulation depend on the inherent properties of the active compound, the therapeutic effect to be achieved, and the individual dictated by limitations inherent in the art of formulating such active compounds for therapeutic purposes, Directly dependent.

[0188] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include anti-itch agents, astringents, local anesthetics, pain relievers, and anti-history agents. Anti-inflammatory or anti-inflammatory drugs (e.g., acetaminophen, NSAIDs, diphenhydramine) RNAi agents expressing the RNAi agents defined herein include, but are not limited to, or cells, tissues, or isolated organs containing the same may also be used as "pharmaceutical compositions." As used herein, the terms "pharmacologically effective amount," "therapeutically effective amount," or simply An "effective amount" is an amount of an RNAi agent that produces a pharmacological, therapeutic, or prophylactic result.

[0189] In some embodiments, the methods disclosed herein comprise the step of: In addition to administering the drug, the method further includes administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another PNPLA3 RNAi agent (e.g., PN PNPLA3 RNAi drugs targeting different sequences within the PLA3 target. In embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0190] In some embodiments, the described PNPLA3 RNAi agents optionally comprise one or Combined with two or more additional therapeutic agents. PNPLA3 RNAi agent and additional therapeutic agent The compounds can be administered in a single composition, or they can be administered separately. In some embodiments, the one or more additional therapeutic agents are in a separate dosage form from the RNAi agent. (e.g., PNPLA3 RNAi drugs are administered by subcutaneous injection) (The additional treatment used in the method of the therapeutic administration regimen is administered orally.) In one embodiment, the described PNPLA3 RNAi agents are administered to a subject in need thereof by subcutaneous injection. The drug is administered by oral administration, but one or more optional additional therapeutic agents are administered orally. Together, these factors contribute to the development of alcoholic or nonalcoholic liver diseases, including NAFLD, NASH, liver fibrosis, and / or cirrhosis. The present invention provides treatment regimens for diseases and conditions associated with non-alcoholic liver disease. In some embodiments, the described PNPLA3 RNAi agents are administered to a subject in need thereof. The drug is administered by subcutaneous injection, and one or more optional additional therapeutic agents are administered by separate subcutaneous injection. In some embodiments, a PNPLA3 RNAi agent and one or more The two or more additional therapeutic agents may be combined into a single dosage form (e.g., a single composition for subcutaneous injection). PNPLA3 RNAi drugs are combined in a single or double-stranded "cocktail." In combination with one or more excipients, with or without these additional therapeutic agents. These can be combined to form a pharmaceutical composition.

[0191] Generally, an effective amount of a PNPLA3 RNAi agent is about 0.1 to about 100 mg / kg body weight / Doses range, for example, from about 1.0 to about 50 mg / kg body weight / dose. In this embodiment, the effective amount of the active compound is about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, the effective amount of the active ingredient is in the range of about 0. The dosage ranges from about 5 to about 4 mg / kg body weight. The dosage, activity level of a particular PNPLA3 RNAi agent, and the desired inhibition for a particular subject Depending on the level of harm, this may be weekly, biweekly, monthly, or any other interval. The examples provide suitable levels for inhibition in particular animal species. Dosage should be adjusted based on the overall health of the patient. the condition, the relative biological potency of the compound being delivered, the drug formulation, and the excipients in the formulation. The initial dose administered will depend on variables such as the presence and type of Doses may be administered above the upper levels to rapidly achieve desired blood or tissue levels. The initial dose may be increased or may be less than the optimal dose. It will be understood that.

[0192] To treat a disease or to form a medicament or composition for treating a disease Therefore, pharmaceutical compositions described herein that include a PNPLA3 RNAi agent may contain an excipient or a second therapeutic agent or treatment (such as a second or other RNAi agent, small molecule agent, antibody, antibody fragment, in combination with It is possible.

[0193] The described PNPLA3 RNAi agents are administered in a pharmaceutically acceptable excipient or adjuvant. If so, it may be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein can be administered in pre-filled syringes, pen injectors, auto-injectors, and the like. The composition may be packaged in a container, an infusion bag / device, or a vial.

[0194] Treatment methods and expression inhibition methods The PNPLA3 RNAi agents disclosed herein benefit from the administration of compounds for use in treating a subject (e.g., a human or mammal) with a disease or disorder that may In some embodiments, the RNAi agents disclosed herein can be used to treat PN Reducing and / or inhibiting PLA3 mRNA expression and / or PNPLA3 protein levels Subjects (e.g., humans) who would benefit from harm, e.g., NAFLD, NASH, Symptoms associated with alcoholic or non-alcoholic liver disease, including liver fibrosis or cirrhosis can be used to treat subjects diagnosed with or suffering from Cut.

[0195] In some embodiments, the subject is administered a therapeutically effective amount of any one or more of PNPLA. 3. An RNAi agent is administered. Treatment of a subject includes therapeutic and / or prophylactic treatment. A subject may be administered a therapeutically effective amount of any one or more PNPLA3s described herein. An RNAi agent is administered. The subject can be a human, a patient, or a human patient. The administration of the pharmaceutical compositions described herein may be to a human or animal. It can be for.

[0196] The PNPLA3 RNAi agents described herein are useful for treating a PNPLA3-associated disease or disorder. or a disease or conditions mediated at least in part by PNPLA3 gene expression. or may be used to treat at least one symptom in a subject with a disorder. In some embodiments, a PNPLA3 RNAi agent inhibits or reduces PNPLA3 mRNA. benefit from or are mediated at least in part by reduction of PNPLA3 mRNA The present invention is used to treat or manage the clinical symptoms of a subject having a disease or disorder. a therapeutically effective amount of one or two of the PNPLA3 RNAi agents described herein. or a PNPLA3 RNAi agent-containing composition is administered. The methods disclosed herein include administering to a subject a composition comprising a PNPLA3 RNAi agent described herein. In another embodiment, the subject is administered a prophylactically effective amount of a composition comprising: Any one or more of the listed PNPLA3 RNAi agents are administered, and This treats the subject by preventing or inhibiting at least one symptom.

[0197] In certain embodiments, the present disclosure provides a method for treating a cancer that is at least in part mediated by PNPLA3 gene expression. A method for the treatment of a disease, disorder, condition, or pathology mediated by a medicament comprising administering to a patient ... The present invention provides methods comprising administering any of the PNPLA3 RNAi agents described in

[0198] In some embodiments, in subjects administered a described PNPLA3 RNAi agent The gene expression level and / or mRNA level of the PNPLA3 gene in Subjects before receiving RNAi drugs or subjects who have not received PNPLA3 RNAi drugs In comparison, at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 6 5%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or The level of gene expression and / or mRNA in the subject is reduced by more than 99%. The level can be reduced in cells, cell populations, and / or tissues of interest. In this condition, PNPLA3 gene expression is measured in a subject or was found to be less abundant in the cytoplasm of hepatocytes compared to subjects not receiving the PNPLA3 RNAi drug. At least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70% , or is inhibited by more than 70%.

[0199] In some embodiments, in subjects administered a described PNPLA3 RNAi agent PNPLA3 protein levels in the 100% CI, 0.01 to 0.01% were measured in the 100% CI, 0.01 to 0.01% and 0.01% of the 100% CI, 0.01 to 0.01%. or at least about 30%, 3, or 5%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 8 5%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% reduction Protein levels in a subject may be determined by measuring the level of the protein in the subject's cells, cell populations, tissues, blood, and / or tissues. It can be reduced in other body fluids.

[0200] The reduction of PNPLA3 mRNA levels and PNPLA3 protein levels is achieved by methods known in the art. It can be assessed by any method known in the art. As used herein, P A reduction or decrease in NPLA3 mRNA levels and / or protein levels is herein collectively, reduction or decrease of PNPLA3 or inhibition or reduction of PNPLA3 expression The examples described herein are directed to methods for assessing inhibition of PNPLA3 gene expression. Known methods are exemplified. Those skilled in the art will appreciate that PNPLA3 Suitable methods for assessing inhibition of gene expression may also be known.

[0201] In some embodiments, the present invention relates to an anti-cancer agent, including NAFLD, NASH, liver fibrosis, and / or cirrhosis. Diseases, disorders, or symptoms caused by alcoholic or non-alcoholic liver disease A method for the treatment (including prophylactic or preventative treatment) of In a subject in need thereof, a portion of PNPLA3 mRNA having the sequence of Table 1 is inserted at least a therapeutically effective amount of a PNPLA3 RNAi agent comprising an antisense strand that is also partially complementary to In some embodiments, a method is disclosed herein that comprises administering NAF Alcoholic or non-alcoholic, including LD, NASH, liver fibrosis, and / or cirrhosis Treatment of diseases or symptoms caused by liver disease (prophylactic or preventive) 2. A method of administering to a subject in need thereof a compound according to any one of Tables 2 or 3 (including preventative treatment). and an antisense strand containing any of the sequences of the sequences at least partially corresponding to the antisense strand. a sense strand comprising any of the sequences of Table 2 or Table 4 to which it is complementary; and a therapeutically effective amount of PNP comprising: Disclosed herein are methods that include administering an LA3 RNAi agent. In embodiments, the present invention is directed to treating alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis. or for the treatment (prophylaxis) of diseases or symptoms caused by non-alcoholic liver disease. a method for the treatment of a patient in need thereof, including lactic or preventative treatment a sense strand comprising any of the sequences of Table 2 or Table 4, and a sequence at least partially corresponding to the sense strand; an antisense strand comprising a sequence of any of the sequences of Table 2 or Table 3, which is complementary to the sequence of the therapeutic agent; Disclosed herein are methods comprising administering an effective amount of a PNPLA3 RNAi agent.

[0202] In some embodiments, a method for inhibiting expression of the PNPLA3 gene in a cell is provided. a method for detecting a PNPLA3 mRNA fragment having a sequence at least partially corresponding to a portion of the PNPLA3 mRNA fragment having a sequence of Table 1; administering to the cell a PNPLA3 RNAi agent containing a complementary antisense strand. Disclosed herein are methods for expressing the PNPLA3 gene in a cell. 10. A method for inhibiting expression of a gene comprising administering to a cell an antibody comprising any of the sequences of Table 2 or Table 3. the antisense strand and a sequence of Table 2 or Table 4 that is at least partially complementary to the antisense strand and a PNPLA3 RNAi agent comprising: In some embodiments, methods are disclosed herein that include transfecting a cell with PNPLA. 3. A method for inhibiting the expression of a gene, comprising administering to a subject a sense strand comprising any of the sequences of Table 2 or Table 4. and any of the sequences in Table 2 or Table 3 that are at least partially complementary to the sense strand. and an antisense strand comprising: Disclosed herein.

[0203] The use of PNPLA3 RNAi drugs has been shown to be effective in treating a range of conditions, including NAFLD, NASH, liver fibrosis, and cirrhosis. Alcoholic or non-alcoholic liver disease and / or enhanced or improved PNPLA 3 expression. The proposed PNPLA3 RNAi drug mediates RNA interference to inhibit the expression of the PNPLA3 protein. PNPLA3 RNAi drugs inhibit the expression of one or more genes required for the production of PNPLA3. and alcoholic or non-alcoholic liver diseases, including NAFLD, NASH, liver fibrosis, and / or cirrhosis. For use in treating or preventing a variety of diseases, disorders, or conditions, including alcoholic liver disease Furthermore, compositions for delivering PNPLA3 RNAi agents to liver cells in vivo can be used. is described.

[0204] Cells, tissues, organs, and non-human organisms Cells, tissues, and organs comprising at least one of the PNPLA3 RNAi agents described herein The cells, tissues, organs, or non-human organisms are contemplated. into a cell, tissue, organ, or non-human organism.

[0205] Illustrative Embodiments Exemplary embodiments of the techniques of the present disclosure are provided herein. These statements are for illustrative purposes only and are not intended to limit the scope of this disclosure or the claims appended hereto. stomach.

[0206] Embodiment 1. An RNAi agent for inhibiting expression of the PNPLA3 gene, comprising: Any one of the sequences of SEQ ID NOs: 46 to 87, 174 to 211, and 257 to 258 Contains at least 17 consecutive nucleotides that differ from each other by 0 or 1 nucleotide an antisense strand and a nucleotide sequence at least partially complementary to the antisense strand; and a sense strand comprising the RNAi drug.

[0207] Embodiment 2. The antisense strand is selected from SEQ ID NOs: 46-87, 174-211, and 257- 258 sequences of any one of nucleotides 2 to 18 of embodiment 1. RNAi drugs.

[0208] Embodiment 3: The sense strand is selected from the sense strand sequences of SEQ ID NOs: 2 to 45 and 212 to 256 At least 17 consecutive nucleotides that differ from any one of the the sense strand contains the nucleotide sequence of the nucleotides of Embodiment 1 or embodiment 2, having a region of at least 85% complementarity with the antisense strand. The RNAi drug described in

[0209] Embodiment 4. At least one nucleotide of the RNAi agent is a modified nucleotide or a modified internucleoside linkage. i medicine.

[0210] Embodiment 5. All or substantially all of the nucleotides of the sense and antisense strands of an RNAi agent 4. The RNAi method according to any one of embodiments 1 to 3, wherein essentially all of the nucleotides are modified nucleotides. medicine.

[0211] Embodiment 6. The modified nucleotide is a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide. Nucleotides, 2'-deoxynucleotides, 2',3'-seconucleotide mimics, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methyl nucleotide Nucleotide, inverted 2'-deoxynucleotide, 2'-amino modified nucleotide, 2' -Alkyl-modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleosides 6. The RNAi agent of embodiment 4 or 5, wherein the RNAi agent is selected from the group consisting of:

[0212] Embodiment 7. All or substantially all of the modified nucleotides are 2'-O-methyl nucleotides 6. The method of claim 5, wherein the nucleotides are 2'-fluoronucleotides, 2'-dinucleotides, or combinations thereof. RNAi drugs.

[0213] Embodiment 8. The antisense strand is a modified antisense strand sequence of SEQ ID NOs: 88-128. 8. The R according to any one of embodiments 1 to 7, comprising any one of the nucleotide sequences NAi drugs.

[0214] Embodiment 9. The sense strand is a modified sense strand sequence of SEQ ID NOs: 129 to 173. 9. The RNAi agent of any one of embodiments 1 to 8, comprising any of the nucleotide sequences .

[0215] Embodiment 10. The antisense strand is any one of the modified sequences of SEQ ID NOs: 88 to 128. The sense strand comprises one nucleotide sequence selected from the modified sequences of SEQ ID NOs: 129 to 173. 2. The RNAi agent of embodiment 1, comprising the nucleotide sequence of any one of:

[0216] Embodiment 11. The method of any one of embodiments 1 to 10, wherein the RNAi agent is linked to a targeting ligand. The RNAi agent according to any one of the preceding claims.

[0217] Embodiment 12. The targeting ligand of embodiment 1 comprises n-acetyl-galactosamine. The method described in 1.

[0218] Embodiment 13. The targeting ligand comprises the structure of (NAG37) or (NAG37)s , the RNAi agent of embodiment 11 or 12.

[0219] Embodiment 14. The method of any one of embodiments 11 to 14, wherein the targeting ligand is linked to the sense strand. The RNAi agent according to any one of the preceding claims.

[0220] Embodiment 15. The method of embodiment 1, wherein the targeting ligand is linked to the 5' end of the sense strand. 5. The RNAi agent according to claim 5.

[0221] Embodiment 16. The sense strand is 18 to 30 nucleotides in length and the antisense strand is 1 17. The RNAi agent of any one of embodiments 1-16, which is 8 to 30 nucleotides in length.

[0222] Embodiment 17. The sense strand and the antisense strand are each 18 to 27 nucleotides in length. 18. The RNAi agent of embodiment 17, wherein

[0223] Embodiment 18. The sense strand and the antisense strand are each 18 to 24 nucleotides in length. 20. The RNAi agent of embodiment 18, wherein

[0224] Embodiment 19. The sense strand and the antisense strand are each 21 nucleotides in length 20. The RNAi agent of embodiment 19.

[0225] Embodiment 20. Any of Embodiments 17-20, wherein the RNAi agent has two blunt ends. or an RNAi agent according to any one of claims 1 to 10.

[0226] Embodiment 21. The method of any one of embodiments 1 to 21, wherein the sense strand comprises one or two end caps. The RNAi agent according to any one of the preceding claims.

[0227] Embodiment 22. The sense strand comprises one or two inverted abasic residues. 3. The RNAi agent of any one of claims 2 to 3.

[0228] Embodiment 23. The RNAi agent is one of the duplexes having a SEQ ID NO: listed in Table 5B. The present invention relates to embodiment 1, which comprises a sense strand and an antisense strand forming one of the double-stranded sequences. RNAi drugs as described.

[0229] Embodiment 24. The sense strand is a nucleotide sequence having a nucleotide sequence at the 3' end, a nucleotide sequence having a nucleotide sequence at the 5' end, and a nucleotide sequence having a nucleotide sequence at the 3' end. 24. Any one of embodiments 1 to 23, further comprising an inverted abasic residue at one or both ends. RNAi drugs as described.

[0230] Embodiment 25. One of the nucleotide sequences of SEQ ID NOs: 88 to 128 and 0 or 1 The nucleotides may comprise, consist of, or essentially consist of a modified nucleotide sequence that differs a, c, g, and u are 2'-O-methyladenosine, cytidine, Af, Cf, Gf, and Uf represent 2'-, guanosine, and uridine, respectively. Fluoro represents adenosine, cytidine, guanosine, and uridine, and s represents phosphorothioate. all or substantially all of the nucleotides in the sense strand are modified nucleotides 2. The RNAi agent of embodiment 1, wherein the RNAi agent is a

[0231] Embodiment 26. The sense strand is one of the nucleotide sequences of SEQ ID NOs: 129-173. and a modified nucleotide sequence that differs by zero or one nucleotide from a, c, g, i, and u are each 2'- Af represents O-methyladenosine, cytidine, guanosine, inosine, and uridine; Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, and guanosine, respectively. and uridine, s represents a phosphorothioate linkage, and the nucleotides of the antisense strand 2. The RNA of embodiment 1, wherein all or substantially all of the nucleotides are modified nucleotides. i medicine.

[0232] Embodiment 27. The sense strand is a nucleotide sequence having a nucleotide sequence at the 3' end, a nucleotide sequence having a nucleotide sequence at the 5' end, and a nucleotide sequence having a nucleotide sequence at the 3' end. 27. Any one of embodiments 24-26, further comprising an inverted abasic residue at one or both ends. The RNAi drug described in

[0233] Embodiment 28. An embodiment in which the sense strand of the RNAi agent is linked to a targeting ligand 28. The RNAi drug according to any one of 24 to 27.

[0234] Embodiment 29. The targeting ligand has affinity for the asialoglycoprotein receptor. 29. The RNAi agent of embodiment 28, wherein

[0235] Embodiment 30. The targeting ligand comprises N-acetyl-galactosamine. 9. An RNAi agent according to claim 9.

[0236] Embodiment 31. The targeting ligand is

[0237] [ka] 2. The RNAi agent of embodiment 1, comprising:

[0238] Embodiment 32. The antisense strand is selected from the group consisting of modified nucleotide sequences of SEQ ID NOs: 88-128. and the sense strand consists of modified nucleotide sequences of SEQ ID NOs: 129 to 173, g and u are 2'-O-methyladenosine, cytidine, guanosine, and u, respectively. lysine, Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, and uridine, and s is a phosphorothioate linkage; invAb) is an inverted abasic deoxyribose residue, and (NAG37)s is 2. The RNAi agent of embodiment 1, having the chemical structure:

[0239] [ka]

[0240] Embodiment 33. A composition comprising the RNAi agent of any one of embodiments 1-32, The composition further comprising a pharmaceutically acceptable excipient.

[0241] Embodiment 34. A method for inhibiting the expression of the PNPLA3 gene in a cell, comprising: and administering to the cell an effective amount of the RNAi agent of any one of embodiments 1 to 32 or embodiment 3. 3. A method comprising introducing a composition according to any one of claims 1 to 3.

[0242] Embodiment 35. The method of embodiment 34, wherein the cell is in a subject.

[0243] Embodiment 36 The method of embodiment 35, wherein the subject is a human subject.

[0244] Embodiment 37. An embodiment in which PNPLA3 gene expression is inhibited by at least about 30%. 37. The method according to any one of claims 34 to 36.

[0245] Embodiment 38. A method for treating a PNPLA3-associated disease or disorder, comprising administering to a subject in need thereof 34. A method comprising administering to a human subject a therapeutically effective amount of the composition of embodiment 33.

[0246] Embodiment 39. The disease is NAFLD, NASH, liver fibrosis, or alcoholic fatty liver disease. 39. The method of embodiment 38, wherein the tumor is ulcerative colitis, ... or cirrhosis.

[0247] Embodiment 40. The RNAi agent is administered in a dose of from about 0.05 mg / kg to about 5.0 mg / kg of body weight of a human subject. The method of any one of embodiments 34-39, wherein the dose is administered in mg.

[0248] Embodiment 41. The RNAi agent is administered in two or more doses. 40. The method according to any one of claims 1 to 40.

[0249] Embodiment 42. A disease mediated at least in part by PNPLA3 gene expression. 33. The RNAi agent or agents of any one of embodiments 1 to 32 for the treatment of a disorder or condition. Use of the composition of embodiment 33.

[0250] Embodiment 43. The use of embodiment 42, wherein the condition is cirrhosis of the liver.

[0251] Embodiment 44. A disease mediated at least in part by PNPLA3 gene expression. Any of embodiments 1 to 32 for the preparation of a pharmaceutical composition for treating a disorder or condition. 34. Use of an RNAi agent according to any one of claims 1 to 33 or a composition according to claim 33.

[0252] Embodiment 45. The pre-disease is an alcohol-related disorder such as NAFLD, NASH, liver fibrosis, or cirrhosis. 45. The method according to any one of embodiments 42 to 44, wherein the patient has alcoholic or non-alcoholic liver disease. Use of RNAi drugs.

[0253] Embodiment 46. The RNAi agent is administered in a dose of from about 0.05 mg / kg to about 5.0 mg / kg of body weight of a human subject. 34. Use of the composition of embodiment 33, wherein the composition is administered in a dose of mg.

[0254] The above-described embodiments and items will now be illustrated in the following non-limiting examples. [Example]

[0255] Example 1. Synthesis of PNPLA3 RNAi agents. The PNPLA3 RNAi agent duplexes shown in Tables 5A and 5B above were prepared according to the following general procedure: was synthesized according to:

[0256] A. Synthesis. Based on the solid-phase phosphoramidite technology used in oligonucleotide synthesis, R The sense and antisense strands of the NAi drug were synthesized. Such standard syntheses are generally Depending on the scale, MerMade96E® (Bioau) tomation), MerMade12® (Bioautomation) or OP Pilot 100 (GE Healthcare) was used. Porous glass (CPG, 500Å or 600Å, Prime Synthesis, The synthesis was carried out on a solid support made of PEG (obtained from Aston, PA, USA). The monomer located at the 3' end of each strand was attached to a solid support as the starting point for synthesis. All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific. scientific(Milwaukee,WI,USA) or Hongene Bio tech (Shanghai, PRC). Examples of the nitrites include: (5'-O-dimethoxytrityl-N 6 -(Benzoi 2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropyl) Propylamino)phosphoramidite, 5'-O-dimethoxytrityl-N 4 -(Acetate 2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl) (5'-O-dimethoxytrityl-N 2 -(Iso Butyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N- diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2' -O-Methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) 2'-Deoxy-2'-fluoro-phosphoramidite is a 2'-deoxy-2'-fluoro-phosphoramidite. 5'-(4,4'-dimethoxybenzoate) 2'-benzoyl-3'-[(2-cyanoethyl) (N,N-diisopropyl)-phosphoramidites were also synthesized by Thermo Fisher Scientific. r Scientific or Hongene Biotech. Methoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N, N-diisopropylamino)phosphoramidites were obtained from Glen Research (Vision). It was purchased from either Brginia or Hongene Biotech. -O-Dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl- N,N-diisopropylamino)phosphoramidites were purchased from ChemGenes (Wilm Purchased from SAFC (St. Louis, MO, USA) or SAFC (St. Louis, MO, USA). 5'-O-Dimethoxytrityl-N 2 ,N 6 -(phenoxyacetate)-2' -O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropyl (amino) phosphoramidites were obtained from ChemGenes or Hongene Biotech. Obtained from ch.

[0257] The phosphoramidite containing the targeting ligand was dissolved in anhydrous dichloromethane or anhydrous acetonite. All other amidites were dissolved in anhydrous acetonitrile (50 mM) or was dissolved in anhydrous dimethylformamide and molecular sieves (3 Å) were added. benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethyl Thio-1H-tetrazole (ETT, 250 mM in acetonitrile) was added as an activator solution The binding times were 12 minutes (RNA), 15 minutes (targeted ligand), and 90 seconds. The time periods were 60 seconds (2'OMe) and 60 seconds (2'F). To achieve this, 3-phenyl 1,2,4-dithiazolin-5-one (POS, PolyOr in anhydrous acetonitrile (obtained from Sigma-Aldrich, Inc., Leominster, MA, USA) A 100 mM solution was used. This is particularly useful as a "naked" RNAi drug with no targeting ligand present. Unless otherwise specified, each PNPLA3 RNAi agent duplex synthesized and tested in the examples below refers to N-acetyl-galactosamine as " in the targeting ligand chemical structure shown in Table 6. It was used as NAG.

[0258] B. Cleavage and deprotection of the support-bound oligomer. After the solid phase synthesis was completed, the dried solid support was dissolved in 40% by weight methylamine in water and 1:1 volume solution with 28% ammonium hydroxide solution (Aldrich) for 1.5 hours The reaction was carried out at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0259] C. Purification. TSKgel SuperQ-5PW 13 μm column and Shimadzu LC- The crude oligomer was purified by anion exchange HPLC using the 8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, 20% acetonitrile Buffer B was the same as Buffer A, but with the addition of 1.5M sodium chloride. The UV trace was recorded at 260 nm. Appropriate fractions were pooled and then purified by S GE Healthcare XK 26 filled with ephadex G-25 fine Run the samples through a size-exclusion HPLC using a 1 / 40 column and eluate in filtered DI water or 100 mM bicarbonate. ammonium (pH 6.7) and 20% acetonitrile was used as the running buffer. .

[0260] D. Annealing. The complementary strands were diluted in equal amounts in 1× phosphate buffered saline (Corning, Cellgro). Molar amounts of RNA solutions (sense and antisense) are mixed together to form the RNAi drug. Some of the RNAi drugs were lyophilized and stored at -15 to -25°C. By measuring the solution absorbance using a UV-Vis spectrometer in physiological saline. The duplex concentration was then calculated by multiplying the solution absorbance at 260 nm by the conversion factor and dilution factor. The duplex concentration was calculated using the conversion factor 0.050 mg / (mL cm). or calculated from experimentally determined extinction coefficients.

[0261] Example 2. PNPLA3-SEAP mouse model. To evaluate specific PNPLA3 RNAi drugs, we used the PNPLA3-SEAP mouse model. We used 6- to 8-week-old female C57BL / 6 albino mice or mice with ES cells, depending on availability. ICR mice were treated at least 29 days before administration of the PNPLA3 RNAi drug or control. Transiently transfect plasmids in vivo by hydrodynamic tail vein injection Two types of SEAP plasmids were prepared. The first plasmid was SEAP(sec reted human placental alkaline phosphata se, secreted human placental alkaline phosphatase) reporter gene 3'UTR The human PNPLA3 cDNA sequence (GenBank NM_025225.2 (SEQ ID NO: Due to the perceived instability of the full-length transcript over time, human PNPLA3 The cDNA sequence (specifically nucleotide 5 of GenBank NM_025225.2) A second plasmid containing the sequences 01-2210 was synthesized. Selected mice were transfected in Ringer's solution at a total volume of 10% of the animal's body weight. 50 μg of each plasmid was injected into mice via the tail vein to produce PNPLA3-SEA P model mice were prepared by incision with a 27-gauge needle for 5–7 seconds as previously described. The solution was injected after the injection (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasm id DNA.”Human Gene Therapy 1999 Vol.10, p. 1735-1737.) Inhibition of PNPLA3 expression by PNPLA3 RNAi drugs , resulting in simultaneous inhibition of SEAP expression measured. ) with the Phospha-Light™ SEAP Reporter Gene Assay System SEAP expression levels in serum were measured by ELISA (Invitrogen) and the average expression level of each mouse was 100%. They were grouped according to SEAP level.

[0262] Anesthetize the mouse with 2–3% isoflurane and collect blood samples from the submandibular region into serum separator tubes ( Sarstedt AG & Co., Numbrecht, Germany) The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were then centrifuged at 8,000 x g for 3 minutes. Serum was separated by centrifugation and stored at 4°C. Serum was collected and analyzed according to the manufacturer's instructions. , Phospha-Light™ SEAP Reporter Gene Ass Serum SEAP of each animal was measured using the Day System (Invitrogen). Levels were measured using a vehicle to account for the non-treatment-related decrease in PNPLA3 expression in this model. The results can be normalized to a control group of mice injected with a control. First, the SEAP level of each animal at a given time point was compared with the expression level before treatment in that animal. The expression ratios were then divided by the baseline (day -1) to determine the "normalized to pre-treatment" expression ratio. The "normalized to pre-treatment" ratios for individual animals were calculated based on the normal vehicle control group. at a particular time point by dividing by the average "normalized to pretreatment" ratio for all mice. Expression was normalized to the control group. Alternatively, serum SEAP levels for each animal were measured against the control group before treatment. was assessed by normalizing to levels only.

[0263] Example 3. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing the full-length human PNPLA3 transcript was used to generate the PNPLA3-SEAP plasmid. The mouse model was used as described above in Example 2. On day 1, each mouse received the following doses: 7, 3.0 mg / kg (mpk) PNPLA3 R formulated in saline 200 mg / kg of 200 ribonucleotides containing either an RNAi drug or a vehicle control (saline without an RNAi drug). A single subcutaneous dose of 1 μl / 20 g animal weight was administered.

[0264] [Table 8]

[0265] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. The sense strand is a targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand). (NAG37) Specific modifications and structural information related to PNPLA3 RNAi drugs containing s ligands (See Tables 3 to 5 for details.) PNPLA3 RNAi drug J1D00001 (Group 2) and and J1D00002 (group 3) inhibit the expression of the PNPLA3 gene at position 688 of the gene. PNPLA3 RNAi drug J1D0000 4 (Group 4) was designed to inhibit the expression of the PNPLA3 gene at position 1586 of the gene. PNPLA3 RNAi drug J1D00008 (Group 5) contains the nucleotide sequence Nucleotide sequences designed to inhibit expression of the PNPLA3 gene at position 2180 of the gene PNPLA3 RNAi drugs J1D00010 (Group 6) and J1D0001 1 (Group 7) was designed to inhibit the expression of the PNPLA3 gene at position 1179 of the gene. The PNPLA3 RNAi drug J1D00012 (Group 8) contains the nucleotide sequence A nucleotide designed to inhibit the expression of the PNPLA3 gene at position 571 of the gene The PNPLA3 RNAi drug J1D00016 (Group 9) contains the 1745th gene sequence. The vector contained a nucleotide sequence designed to inhibit expression of the PNPLA3 gene in offspring. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced PNPLA3 gene. ).

[0266] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 8 and 9 below.

[0267] [Table 9] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0268] [Table 10]

[0269] Example 4. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing the full-length human PNPLA3 transcript was used to generate the PNPLA3-SEAP plasmid. The mouse model was used as described above in Example 2. On day 1, each mouse received the following doses: 3.0 mg / kg (mpk) PNPLA3 formulated in saline according to 10 20 containing either an RNAi drug or a vehicle control (saline without an RNAi drug) A single subcutaneous dose of 0 μl / 20 g animal weight was administered.

[0270] [Table 11]

[0271] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. A targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) was used. It contained a modified nucleotide conjugated at the 5' end of the strand. (NAG37) For specific modification and structural information on PNPLA3 RNAi agents containing s ligands, see See Tables 3 to 5). PNPLA3 RNAi drug J1D00008 (Group 2) Nucleotide sequences designed to inhibit expression of the PNPLA3 gene at position 2180 of the gene The PNPLA3 RNAi drug J1D00014 (group 3) contains the 886th position of the gene. a nucleotide sequence designed to inhibit expression of the PNPLA3 gene in the offspring, NPLA3 RNAi drug J1D00015 (group 4) targeted the 1584th gene to PNPLA It contains a nucleotide sequence designed to inhibit the expression of the PNPLA3 R gene. NAi drug J1D00021 (group 5) inhibits the expression of the PNPLA3 gene at position 553. The RNAi drug J1D0 contains a nucleotide sequence designed to inhibit PNPLA3. 0022 (Group 6) is designed to inhibit the expression of the PNPLA3 gene at position 680 of the gene. PNPLA3 RNAi drug J1D00005 (Group 7) containing the designed nucleotide sequence The gene expression inhibitor, PNPLA3, was designed to inhibit the expression of the PNPLA3 gene at position 1182. PNPLA3 RNAi drug J1D00024 (Group 8) contains the nucleotide sequence at position 746. Contains a nucleotide sequence designed to inhibit the expression of the PNPLA3 gene (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced PNPLA3 gene. stomach).

[0272] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 11 and 12 below.

[0273] [Table 12] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0274] [Table 13]

[0275] Example 5. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing a truncated human PNPLA3 transcript was used to generate PNPLA3-SEAP The mouse model was used as described in Example 2 above. On day 1, each mouse received the following: 3.0 mg / kg (mpk) PNPL formulated in saline according to Table 13 below A3: Containing either an RNAi drug or a vehicle control (saline without an RNAi drug). A single subcutaneous dose of 200 μl / 20 g animal weight was administered.

[0276] [Table 14]

[0277] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. A targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) was used. It contained a modified nucleotide conjugated at the 5' end of the strand. (NAG37) Specific modifications and structural information related to PNPLA3 RNAi drugs containing s ligands (See Tables 3 to 5 for details.) PNPLA3 RNAi drug J1D00012 (Group 2), J1D00027 (group 3), J1D00028 (group 4), and J1D00029 (group 5) are Each gene was designed to inhibit the expression of the PNPLA3 gene at position 571. The PNPLA3 RNAi drugs J1D00011 (Group 6) and J1D 00017 (group 7) is a gene at position 1179 that inhibits the expression of the PNPLA3 gene. The PNPLA3 RNAi drug J1D00004 (group 8), J1D00003 (group 9), and J1D00041 (group 10) are the 1586th gene. a nucleotide sequence designed to inhibit the expression of the PNPLA3 gene; PNPLA3 RNAi drug J1D00008 (group 11) targets PNP at position 2180 of the gene. The nucleotide sequences were designed to inhibit the expression of the LA3 gene (e.g., See SEQ ID NO: 1 and Table 2 for the referenced PNPLA3 gene).

[0278] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 14 and 15 below.

[0279] [Table 15] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0280] [Table 16]

[0281] Each PNPLA3 RNAi agent in each treatment group (i.e., groups 2-11) was administered in a vehicle-controlled Compared to controls (Group 1), there was a decrease in SEAP at all measurement time points.

[0282] Example 6. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing a truncated human PNPLA3 transcript was used to generate PNPLA3-SEAP The mouse model was used as described in Example 2 above. On day 1, each mouse received the following: 3.0 mg / kg (mpk) PNPL formulated in saline according to Table 16 below A3: Containing either an RNAi drug or a vehicle control (saline without an RNAi drug). A single subcutaneous dose of 200 μl / 20 g animal weight was administered.

[0283] [Table 17]

[0284] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. A targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) was used. It contained a modified nucleotide conjugated at the 5' end of the strand. (NAG37) Specific modifications and structural information related to PNPLA3 RNAi drugs containing s ligands (See Tables 3 to 5 for details.) PNPLA3 RNAi drug J1D00008 (Group 2), J1D00046 (group 3), J1D00047 (group 4), and J1D00048 (group 5) were designed to inhibit the expression of the PNPLA3 gene at position 2180, respectively. PNPLA3 RNAi drug J1D00011 (group 6), J 1D00043 (group 7), J1D00044 (group 8), and J1D00045 (group 9) , a nucleoside designed to inhibit the expression of the PNPLA3 gene at position 1179 of the gene. The PNPLA3 RNAi drug J1D00020 (Group 10) contains the 544th position of the Contains a nucleotide sequence designed to inhibit expression of the PNPLA3 gene , PNPLA3 RNAi drug J1D00026 (group 11) inhibited PN at position 1195 of the gene. It contained a nucleotide sequence designed to inhibit expression of the PLA3 gene. (SEQ ID NO: 1) See SEQ ID NO: 1 and Table 2 for the referenced PNPLA3 gene).

[0285] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 17 and 18 below:

[0286] [Table 18] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0287] [Table 19]

[0288] Example 7. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing a truncated human PNPLA3 transcript was used to generate PNPLA3-SEAP The mouse model was used as described in Example 2 above. On day 1, each mouse received the following: PNPL at 1.5 mg / kg (mpk) formulated in saline according to Table 19 below A3: Containing either an RNAi drug or a vehicle control (saline without an RNAi drug). A single subcutaneous dose of 200 μl / 20 g animal weight was administered.

[0289] [Table 20]

[0290] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. A targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) was used. It contained a modified nucleotide conjugated at the 5' end of the strand. (NAG37) Specific modifications and structural information related to PNPLA3 RNAi drugs containing s ligands (See Tables 3 to 5 for details.) PNPLA3 RNAi drug J1D00008 (Group 2) , a nucleoside designed to inhibit the expression of the PNPLA3 gene at position 2180 of the gene. The PNPLA3 RNAi drugs J1D000018 (Group 3) and J1D00 019 (group 4) is designed to inhibit the expression of the PNPLA3 gene at position 538 of the gene. PNPLA3 RNAi drug J1D00013 (Group 5) contains the nucleotide sequence , a nucleotide sequence designed to inhibit the expression of the PNPLA3 gene at position 687 of the gene. PNPLA3 RNAi drugs J1D000006 (Group 6) and J1D000 07 (Group 7) is designed to inhibit the expression of the PNPLA3 gene at position 751 of the gene. The PNPLA3 RNAi drug J1D00035 (Group 8) contains the nucleotide sequence Nucleotide sequences designed to inhibit expression of the PNPLA3 gene at position 1181 of the gene The PNPLA3 RNAi drug J1D00033 (Group 9) contains 685 copies of the gene. A nucleotide sequence designed to inhibit expression of the PNPLA3 gene at the gene position The PNPLA3 RNAi drug J1D00032 (group 10) inhibited the PNPLA3 gene at position 373. Contains a nucleotide sequence designed to inhibit expression of the NPLA3 gene, A3 RNAi drug J1D00040 (group 11) targets the PNPLA3 gene at position 1837. It contained a nucleotide sequence designed to inhibit gene expression (see, e.g., (See SEQ ID NO: 1 and Table 2 for the PNPLA3 gene.)

[0291] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 20 and 21 below:

[0292] [Table 21] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0293] [Table 22]

[0294] Example 8. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing a truncated human PNPLA3 transcript was used to generate PNPLA3-SEAP The mouse model was used as described in Example 2 above. On day 1, each mouse received the following: PNPL at 1.5 mg / kg (mpk) formulated in saline according to Table 22 below A3: Containing either an RNAi drug or a vehicle control (saline without an RNAi drug). A single subcutaneous dose of 200 μl / 20 g animal weight was administered.

[0295] [Table 23]

[0296] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. A targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) was used. It contained a modified nucleotide conjugated at the 5' end of the strand. (NAG37) Specific modifications and structural information related to PNPLA3 RNAi drugs containing s ligands (See Tables 3 to 5 for details.) PNPLA3 RNA in each group (i.e., groups 2 to 10) The drugs are designed to inhibit the expression of the PNPLA3 gene at position 2180. (For example, for the PNPLA3 gene referenced See SEQ ID NO: 1 and Table 2 for the sequence.

[0297] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 23 and 24 below:

[0298] [Table 24] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0299] [Table 25]

[0300] Each PNPLA3 RNAi agent in each treatment group (i.e., groups 2-10) was administered in a vehicle-controlled Compared to the control (Group 1), there was a reduction in SEAP at all measured time points.

[0301] Example 9. In Vivo Efficacy of PNPLA3 RNAi Agents in PNPLA3-SEAP Mice Bo exam. A plasmid containing a truncated human PNPLA3 transcript was used to generate PNPLA3-SEAP The mouse model was used as described in Example 2 above. On day 1, each mouse received the following: 1.5 mg / kg (mpk) formulated in saline, including dose groups according to Table 25 below PNPLA3 RNAi drug or vehicle control (saline without RNAi drug) A single subcutaneous dose of 200 μl / 20 g animal weight was administered.

[0302] [Table 26]

[0303] Each PNPLA3 RNAi agent has a modified sequence as described in the duplex structure herein. A targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) was used. It contained a modified nucleotide conjugated at the 5' end of the strand. (NAG37) Specific modifications and structural information related to PNPLA3 RNAi drugs containing s ligands (See Tables 3 to 5 for details.) PNPLA3 RNAi drug J1D00008 (Group 2) , a nucleoside designed to inhibit the expression of the PNPLA3 gene at position 2180 of the gene. The PNPLA3 RNAi drug J1D00081 (group 3) contains the 887th position of the gene. a nucleotide sequence designed to inhibit the expression of the PNPLA3 gene; PNPLA3 RNAi drug J1D00083 (group 4) targets the PNPL gene at position 1185. A3 gene expression inhibitor, comprising a nucleotide sequence designed to inhibit the expression of the PNPLA3 RNAi drugs J1D00084 (group 5) and J1D00085 (group 6) were ranked 1191st, respectively. The gene contains a nucleotide sequence designed to inhibit the expression of the PNPLA3 gene. The PNPLA3 RNAi drug J1D00087 (group 7) inhibited the PNNPLA3 gene at position 1746. PNPLA, which contains a nucleotide sequence designed to inhibit expression of the PLA3 gene 3 RNAi drug J1D00082 (group 8) targets the PNPLA3 gene at position 1173. (e.g., the referenced PN See SEQ ID NO: 1 and Table 2 for the PLA3 gene).

[0304] The injection is given in the loose skin over the neck and shoulder area, between the skin and muscle (i.e., subcutaneous injection). Four mice were tested in each group (n=4). The treatment was performed on days -1 (before treatment), 8, 15 Serum was collected on days 22, 29, and 30, and SEAP expression levels were analyzed as described in Example 2 above. The experimental data are shown in Tables 26 and 27 below:

[0305] [Table 27] * As described in Example 2 above, a time course in the vehicle control group (Group 1) The stepwise reduction of SEAP suppresses SEAP in mouse cells due to natural cell replication in animals. This is due to loss of the EAP reporter gene and not the result of an inhibitory compound.

[0306] [Table 28]

[0307] Example 10. In vivo testing of PNPLA3 RNAi agents in cynomolgus monkeys. PNPLA3 RNAi drugs J1D00003, J1D00008, and J1D0001 7 was evaluated in cynomolgus monkeys (cynos). On days 1 and 43, each group (n=4) Four cynomolgus monkeys were given 4.0 mg / kg (10 mg / kg) of benzodiazepine formulated in saline. 0.4mL / kg (according to animal weight) of each PNPLA3 RNAi drug Subcutaneous injection of 1000 mg of the RNAi drug (approximately 1.5 mL volume) or 1000 mg of the RNAi drug to serve as a control. The untreated control group received saline vehicle alone (see Table 28 below).

[0308] [Table 29]

[0309] The PNPLA3 RNAi drug contains a conjugate at the 5' end of the sense strand, as shown in Tables 3 to 6. Conjugated modified nucleotides and tridentate N-acetyl-galactosamine-containing targeting ligases The PNPLA3 RNAi drug J1D00003 (Group 2) ) is a nucleic acid designed to inhibit the expression of the PNPLA3 gene at position 1586 of the gene. The PNPLA3 RNAi drug J1D00008 (Group 3) contains the nucleotide sequence. A nucleotide sequence designed to inhibit expression of the PNPLA3 gene at the gene position The PNPLA3 RNAi drug J1D00017 (Group 4) inhibited the PNPLA3 gene at position 1179. It contained a nucleotide sequence designed to inhibit expression of the NPLA3 gene.

[0310] Liver biopsies were taken on days -13 (before administration), 15, 29, 57, and 76. On each biopsy collection day, cynomolgus monkeys were anesthetized and approximately 80 mg of each sample was taken using a laparoscope. Two liver tissue samples of 120 mg each were extracted. The biopsies were then homogenized and The level of PNPLA3 mRNA in monkey liver was measured by RT-qPCR. The obtained values ​​were then compared with the pre-administration (in this case, day -13) PNPLA3 mRNA measurement. The mRNA data obtained is reflected in Table 29 below.

[0311] [Table 30]

[0312] Example 11. In vivo evaluation of PNPLA3 RNAi drug J1D00008 in cynomolgus monkeys In vivo testing The purpose of this study was to investigate the expression of wild-type PNPLA3 m in the liver of cynomolgus monkeys (cynos). RNAi drug J1D00008 for both depth and duration of RNA knockdown The knockdown was assessed by liver biopsy taken before administration for each animal. The results were normalized to the baseline measurements taken.

[0313] Materials and Methods Study 1: Cynomolgus monkeys were divided into two groups based on their body weight (2-5 kg): a saline-treated group (Group 1) or The monkeys were divided into RNA treatment groups (groups 2 to 4), with n = 4 per group. The animals were subcutaneously administered twice at 4 mg / kg in saline solution in ml / kg on days 1 and 43. Cynomolgus monkeys were fasted overnight for at least 12 hours before administration and blood sampling. Liver biopsies were collected from all animals on study days 15, 29, 57, and 76. For each animal, liver biopsy samples (two each, approximately 100 mg) were analyzed by qPCR and in situ. For quantification of PNPLA3 mRNA by in situ hybridization (ISH), Each animal was analyzed before administration and on days 15, 29, 57, and 76 after administration. Blood was collected from the femoral vein of the left lateral liver. For all animals, groups, and time points, RNA was extracted from the left lateral liver. qRT-PCR was performed on the isolated leaves, and the data were analyzed for a housekeeping gene (ARFGAP 2) and relative expression was compared to baseline / pre-treatment biopsy. At the end of the study, PNPLA3 expression was measured in the lateral left and right and medial liver lobes from groups 1 and 3. It was confirmed that expression does not vary by liver lobe and that the lateral left liver lobe is representative. RNAscope®-based in situ hybridization of cinnamon-eating monkey liver biopsies Image-based quantification was performed using a quantification assay (ACDbio, Newark, CA). Software Analysis (HALO™ Software System, Indica Labs) , Albuquerque, NM) to measure total PNPL in a given liver cell population. A3 mRNA copies were quantified.

[0314] Study 2: A second non-human primate study was conducted as described in Study 1 with the following modifications or additions: Cynomolgus monkeys were divided into two RNAi treatment groups based on body weight (2–5 kg). Animals were treated with 4 mg / kg saline on days 1 and 29, with n=10 per group. The treatment was subcutaneously administered for 57 days.

[0315] result From Study 1, the RNAi drug J1D00008 was used to measure PNPLA3 expression by PCR. Measurements are shown in Figure 1. PNPLA3 mRNA was measured at baseline and housekeeping gene expression levels. Normalized to offspring, the respective time points were reduced by 51%, 55%, 47%, and 37% Following these results, in situ hybridization (ISH) was performed to The subcellular (cytoplasmic vs. nuclear) distribution of PNPLA3 mRNA was assessed. Approximately 50% of the mRNA was observed to be distributed within the nucleus. D00008 binds PNPLA3 at the site of protein translation (i.e., the cytoplasm of hepatocytes). Although knockdown at the whole cell level significantly reduced PNPLA3 mRNA, residual nuclear PNPLA3 This suggests that qPCR may have underestimated the mRNA pool due to confounding. Therefore, cytoplasmic PNPLA3 mRNA knockdown was quantified.

[0316] IS performed on liver biopsies from cynomolgus monkeys treated with the RNAi drug J1D00008 H revealed significant residual PNPLA3 mRNA retention in the cell nucleus This pool resulted in confounding knockdown results in whole liver as assessed by qPCR. This supports the view that

[0317] Quantification of ISH images revealed that treatment with the RNAi drug J1D00008 significantly reduced PNPLA3 expression. mRNA was shown to be reduced by 44–63% in the cytoplasm over the entire 76 days (Table 30) GalNAc-RNAi drugs such as RNAi drug J1D00008 have been shown to specifically target hepatocytes. PNPLA3 knockdown in whole liver mediates target mRNA degradation in the cytoplasm Quantification of PNPLA3 from non-targeted cell types (e.g., astrocytes and Kupffer cells) The relative contribution of mRNA to the signal transduction pathway is therefore attenuated. A model-based analysis was performed to specifically estimate the reduction of NPLA3 mRNA. Table 31 shows the hepatocyte PNPLA3 mRNA expression used in the modeling. List relevant assumptions about organ physiology.

[0318] [Table 31] Data are means relative to baseline ± SD (n=4).

[0319] [Table 32]

[0320] Using this model, PNPLA3 mRNA was expressed in 4-HT16 cells using the RNAi drug J1D00008. After administration of a single SC dose of 100 mg / kg, 81% and 10% of the cytoplasm of hepatocytes were This modeling was repeated in Study 2, resulting in a 78% reduction at day 15 and day 29, respectively. At day 29 and 30, a 66% and 65% reduction in PNPLA3 mRNA was achieved. On average, for all NHPs (n=14) tested with drug J1D00008, PNPLA 3 mRNA was reduced by 70% in the cytoplasm of hepatocytes on days 15 and 29 (Fig. 2).

[0321] Example 12. Safety The preclinical safety of the RNAi drug J1D00008 administered for up to 3 months was evaluated for up to 5 months. It was evaluated in rats and monkeys at doses of 00 mg / kg and 300 mg / kg. The RNAi drug J1D00008 was well tolerated and showed no toxicity up to the highest dose evaluated. No adverse sexual symptoms were observed.

[0322] Other embodiments Although the present invention has been described with reference to its detailed description, the foregoing description is not intended to be limiting and should not be construed as limiting the scope of the present invention. The invention is not intended to limit the scope of the invention. It is understood that the appended claims are defined by the appended claims. Other aspects, advantages, and modifications are set forth below. Within the scope of the claims below.

Claims

1. An RNAi agent for inhibiting expression of the PNPLA3 gene, comprising: Any one of the sequences of SEQ ID NOs: 46 to 60, 176, 181, and 188 and 0 or is an antisense fragment containing at least 17 consecutive nucleotides that differ by one nucleotide. and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand and a strand.

2. The antisense strand is a sequence of SEQ ID NOs: 46-60, 176, 181, and 188. The RNAi agent of claim 1, comprising nucleotides 2 to 18 of any one of the following:

3. The sense strand is selected from the group consisting of SEQ ID NOs: 2, 3, 4, 9-20, 214, 219, and 220. at least 17 sequences that differ from any one of the base strand sequences by 0 or 1 nucleotide the sense strand comprises a nucleotide sequence of 17 consecutive nucleotides, having a region of at least 85% complementarity with the antisense strand over a range of nucleotides. The RNAi agent of claim 1 or 2.

4. at least one nucleotide of the RNAi agent is a modified nucleotide; or The RNAi agent of any one of claims 1 to 3, comprising a modified internucleoside linkage.

5. All or part of the nucleotides of the sense and / or antisense strand of the RNAi agent The RN according to any one of claims 1 to 3, wherein substantially all of AI medicine.

6. The modified nucleotide may be a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, or nucleotides, 2'-deoxynucleotides, 2',3'-seconucleotide mimics, locked nucleotides nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, desalted Base nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methyl nucleotide nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, From cyclopropylphosphonate-containing nucleotides and 3'-O-methyl nucleotides The RNAi agent of any one of claims 4 to 5, selected from the group consisting of:

7. All or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2 6. The RNAi method according to claim 5, wherein the nucleotides are 2-fluoro-nucleotides, 3-fluoro-nucleotides, 4-fluoro-nucleotides, 5-fluoro-nucleotides, 6-fluoro-nucleotides, 7-fluoro-nucleotides, 8-fluoro-nucleotides, 9-fluoro-nucleotides, 10-fluoro-nucleotides, 11-fluoro-nucleotides, 12-fluoro-nucleotides, 13-fluoro-nucleotides, 14-fluoro-nucleotides medicine.

8. the antisense strand is a modified antisense strand sequence of SEQ ID NOs: 90, 95, and 102 consisting of, consisting essentially of, or consisting of any one of the nucleotide sequences The RNAi agent of any one of claims 1 to 7, comprising:

9. the sense strand is any one of the modified sense strand sequences of SEQ ID NOs: 131, 136, and 137 any nucleotide sequence comprising, consisting essentially of, or comprising Item 9. The RNAi agent according to any one of items 1 to 8.

10. the antisense strand is any of the modified sequences of SEQ ID NOs: 90, 95, and 102 the sense strand comprises one nucleotide sequence selected from SEQ ID NOs: 131, 136, and 137 The RNAi of claim 1, comprising any one of the nucleotide sequences of the modified sequences medicine.

11. 11. Any one of claims 1-10, wherein the RNAi agent is linked to a targeting ligand. The RNAi agent described in

12. 12. The R of claim 11, wherein the targeting ligand comprises N-acetyl-galactosamine. NAi drugs.

13. 10. The method of claim 1, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s.

13. The RNAi agent according to 1 or 12.

14. Any of claims 11 to 13, wherein the targeting ligand is linked to the sense strand. The RNAi agent of claim 1.

15. 15. The method of claim 14, wherein the targeting ligand is linked to the 5' end of the sense strand. RNAi drugs.

16. The sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 3 16. The RNAi agent of any one of claims 1-15, which is 0 nucleotides in length.

17. The sense strand and the antisense strand are each 18 to 27 nucleotides in length.

17. The RNAi agent of claim 16.

18. The sense strand and the antisense strand are each 18 to 24 nucleotides in length.

18. The RNAi agent of claim 17.

19. wherein the sense strand and the antisense strand are each 21 nucleotides in length. Item 19. The RNAi agent according to item 18.

20. 20. The method of any one of claims 16-19, wherein the RNAi agent has two blunt ends. RNAi drugs.

21. 21. Any one of claims 1 to 20, wherein the sense strand comprises one or two end caps. The RNAi agent described in

22. 23. Any of claims 1 to 22, wherein the sense strand contains one or two inverted abasic residues. The RNAi agent of claim 1.

23. The RNAi agent is selected from the group consisting of SEQ ID NOs: (176 and 214), (90 and 131), (181 and and 219), (95 and 136), (188 and 220), and / or (102 and 13 7) The sense strand and the antisense strand forming a double-stranded sequence having the RNAi drugs described above.

24. The sense strand has a nucleotide sequence at the 3' end and a nucleotide sequence at the 5' end. or both, further comprising an inverted abasic residue RNAi drugs.

25. One of the nucleotide sequences of SEQ ID NOs: 90, 95, and 102 and 0 or 1 nucleotide The nucleotides may comprise, consist of, or consist essentially of different modified nucleotide sequences. an antisense strand comprising: a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, Af, Cf, Gf, and Uf represent 2'-fluorouracil and uridine, respectively. represents adenosine, cytidine, guanosine, and uridine, and s represents a phosphorothioate linkage. wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides. The RNAi agent of claim 1, wherein

26. the sense strand is one of the nucleotide sequences of SEQ ID NOs: 214, 219, and 256 comprises or consists of a modified nucleotide sequence that differs from one nucleotide by zero or one nucleotide or consisting essentially of a, c, g, i, and u are 2'-O-methyladenosine, cytidine, guanidine, and guanidine, respectively. Af, Cf, Gf, and Uf represent 2 '-fluoroadenosine, cytidine, guanosine, and uridine, and s represents phosphoro thioate linkages, and all or substantially all of the nucleotides of the antisense strand is a modified nucleotide.

27. The sense strand has a nucleotide sequence at the 3' end and a nucleotide sequence at the 5' end.

27. The method of claim 24, further comprising an inverted abasic residue in either or both of the amino acid sequences. RNAi drugs described above.

28. 24-2, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

8. The RNAi agent of any one of 7.

29. 10. The method of claim 9, wherein the targeting ligand has affinity for the asialoglycoprotein receptor.

28. An RNAi agent according to 28.

30. 30. The R of claim 29, wherein the targeting ligand comprises N-acetyl-galactosamine. NAi drugs.

31. the targeting ligand is 【Chemistry 1】 The RNAi agent of claim 1, comprising:

32. the antisense strand is selected from the group consisting of modified nucleotide sequences of SEQ ID NOs: 90, 95, and 102 and the sense strand is selected from the modified nucleotide sequences of SEQ ID NOs: 131, 136, and 137. And then, a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, Af, Cf, Gf, and Uf are 2'-fluorouracil and uridine, respectively. adenosine, cytidine, guanosine, and uridine, and s is a phosphorothioate linkage (invAb) is an inverted abasic deoxyribose residue; (NAG37) s is the following chemical structure: 【Chemistry 2】 2. The RNAi agent of claim 1, having:

33. A composition comprising the RNAi agent of any one of claims 1 to 32, wherein the composition is pharmaceutically acceptable. The composition further comprises an excipient suitable for administration.

34. A method for inhibiting expression of the PNPLA3 gene in a cell, comprising administering to the cell an effective amount of an amount of the RNAi agent of any one of claims 1 to 32 or the composition of claim 33 20. A method comprising:

35. 35. The method of claim 34, wherein the cell is in a subject.

36. 36. The method of claim 35, wherein the subject is a human subject.

37. 37. The method of claim 34, wherein the PNPLA3 gene expression is inhibited by at least about 30%.

10. The method according to any one of claims 1 to 9.

38. A method of treating a PNPLA3-associated disease or disorder, comprising administering to a human subject in need thereof 34. A method comprising administering a therapeutically effective amount of the composition of claim 33.

39. The disease is NAFLD, NASH, liver fibrosis, alcoholic fatty liver disease, or cirrhosis.

39. The method of claim 38, wherein:

40. the RNAi agent is administered in an amount of from about 0.05 mg / kg to about 5.0 mg / kg of body weight of the human subject 40. The method of any one of claims 34 to 39, wherein the dose is administered in a single dose.

41. 41. The method of claim 34, wherein the RNAi agent is administered in two or more doses.

1. The method according to claim 1.

42. Diseases, disorders, or conditions mediated at least in part by PNPLA3 gene expression The RNAi agent of any one of claims 1 to 32 or claim 33 for the treatment of Use of the composition described above.

43. 43. The use of claim 42, wherein the condition is cirrhosis of the liver.

44. Diseases, disorders, or conditions mediated at least in part by PNPLA3 gene expression A method for preparing a pharmaceutical composition for treating 34. Use of an NAi agent or a composition according to claim 33.

45. The disease is an alcoholic or non-alcoholic disorder such as NAFLD, NASH, liver fibrosis, or cirrhosis. The use according to any one of claims 42 to 44, wherein the treatment is for non-alcoholic liver disease.

46. the RNAi agent is administered in an amount of from about 0.05 mg / kg to about 5.0 mg / kg of body weight of the human subject The use according to any one of claims 42 to 45, wherein the compound is administered in a dose of

Images