Method for determining onset risk and / or severity of disease

Abstract

An object of the present invention is to identify an intestinal bacterium capable of detecting disturbance of intestinal bacterial flora leading to a disease in a child, and to provide a simple method for detecting a disease based on the same.SOLUTION: Provided is a method for determining the onset risk and / or severity of a disease associated with an eating disorder in an individual from early childhood to less than 18 years of age, comprising a nucleic acid extraction step of extracting nucleic acids from feces derived from the individual, and a measurement step of measuring the ratio of nucleic acids derived from Blautiawexlerae to total nucleic acids derived from bacteria based on sequence information of the nucleic acids, wherein the ratio lower than a predetermined reference value indicates that the onset risk and / or severity of the disease in the individual is high.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to biomarkers, methods, kits and devices for determining the risk of developing a disease and / or the severity of the disease. [Background technology]

[0002] Abnormalities that occur during childhood, the stage of mental and physical development, often progress to irreversible diseases in adulthood. Even in such cases, it has been suggested that alleviating the severity of the abnormalities during childhood, when they first occur, can significantly change the symptoms of the disease in adulthood.

[0003] In recent years, advances in intestinal microbiota analysis using molecular biological techniques have led to the acquisition of a wealth of knowledge about the intestinal microbiota, which has revealed that the intestinal microbiota is involved not only in digestive disorders but also in various systemic diseases (Non-Patent Document 1).

[0004] Children are no exception to this rule, and there have been reports of a relationship between the intestinal microbiota and various diseases, such as atopic dermatitis, obesity, inflammatory bowel disease, and epilepsy. However, due to the difficulty of collecting samples and other reasons, the number of reports has not been as large as that for adults. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Atarashi K, et al., Cell, 2015, 163: 367-380 Summary of the Invention [Problem to be solved by the invention]

[0006] Research into the relationship between the gut microbiota and disease often focuses on the relationship between the behavior of the gut microbiota as a whole and disease. However, there are few studies, even in adults, that aim to detect disease-related gut microbiota disturbances (dysbiosis) based on only a limited number of intestinal bacteria.

[0007] To realize low-impact testing and treatment applicable to children that will enable early detection of abnormalities, continuous monitoring, and intervention, a simple method for identifying diseases in children based on a limited number of intestinal bacteria is required.

[0008] Therefore, an object of the present invention is to identify intestinal bacteria that can detect disturbances in the intestinal flora that lead to diseases in children, and to provide a simple method for detecting diseases based on the identified bacteria. [Means for solving the problem]

[0009] To solve the above problems, the present inventors conducted a cross-sectional integrated analysis of all studies conducted to date on individual diseases to search for intestinal bacteria that commonly fluctuate across a variety of diseases. As a result, they discovered intestinal bacteria that fluctuate significantly across a variety of diseases associated with eating disorders, and found that their abundance is closely related not only to the presence or absence of the disease but also to its severity. The present invention is based on these novel findings and provides the following:

[0010] [1] A method for determining the risk of developing and / or the severity of a disease associated with an eating disorder in an individual from infancy to under 18 years of age, the method comprising: a nucleic acid extraction step of extracting nucleic acid from feces from the individual; and a measurement step of measuring the ratio of nucleic acid derived from Blautia wexlerae to total nucleic acid derived from bacteria based on sequence information of the nucleic acid, wherein a ratio lower than a predetermined standard value indicates a high risk of developing and / or the severity of the disease in the individual. [2] The method according to [1], wherein the nucleic acid is a 16S rRNA gene and / or an RNA-binding protein gene. [3] The method according to [2], wherein the RNA-binding protein gene is an elongasome regulatory protein gene. [4] The method according to any one of [1] to [3], wherein the disease includes one or more selected from the group consisting of developmental disorders, food allergies, severe physical and mental disabilities, constipation, and diarrhea. [5] A kit for determining the risk of developing and / or the severity of a disease associated with an eating disorder in individuals from infancy to under 18 years of age, comprising a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acid derived from Blautia wexlerae. [6] The kit according to [5], further comprising a primer set for amplifying a 16S rRNA gene and / or an RNA-binding protein gene. [7] A device for determining the risk of developing and / or the severity of a disease associated with an eating disorder in individuals from infancy to under 18 years of age, comprising a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acid derived from Blautia wexlerae. [8] A biomarker for disorders associated with eating disorders in individuals from infancy to under 18 years of age, consisting of nucleic acids derived from Blautia wexlerae. [9] A composition for treating diseases associated with eating disorders in individuals from infancy to under 18 years of age, comprising Blautia wexlerae. [Effects of the Invention]

[0011] According to the method for assessment of the present invention, the risk of developing and / or severity of a disease associated with an eating disorder can be assessed in an individual from infancy to under 18 years of age from whom the feces is derived, based on information on the intestinal bacterial flora obtained from the feces. [Brief explanation of the drawings]

[0012] [Figure 1]This is a graph showing the abundance of Blautia A_141781 bacteria in feces from normal individuals, individuals with food allergies, and individuals with ASD. In the figure, "*" indicates a p-value of <0.05, and "ns" indicates no significant difference. [Figure 2] 1 is a graph showing the abundance ratio of Blautia A_141781 bacteria in feces before and after PHGG administration in ASD individuals administered PHGG. In the figure, "*" indicates a p-value of <0.05. [Figure 3] This is a graph showing the abundance ratio of Blautia A_141781 bacteria in feces from typically developing individuals and individuals with severe physical and mental disabilities. The numbers at the top of the graph indicate p-values. [Figure 4] 4A and 4B are graphs showing the abundance of bacteria (hereinafter referred to as "bacteria 38f") having a 16S rRNA gene containing the base sequence shown in SEQ ID NO: 13 in the feces of various individuals. Figure 4A shows the results for normal individuals, individuals with food allergies, and individuals with ASD. Figure 4B shows the results before and after PHGG administration in individuals with ASD who received PHGG. Figure 4C shows the results for typically developing individuals and individuals with severe physical and mental disabilities. [Figure 5] 5A and 5B are graphs showing the relationship between fecal organic acid concentrations and the abundance ratio of bacteria 38f in individuals aged 2 to 12 years. Figure 5A shows the relationship with fecal acetic acid concentrations, and Figure 5B shows the relationship with fecal total volatile organic acid concentrations. In the figures, dots represent plots of each data point, straight lines represent approximate lines, and shaded areas represent the 95% confidence intervals of the approximate lines. [Figure 6] 6A and 6B are graphs showing the relationship between fecal organic acid concentrations and the abundance ratio of bacteria 38f in individuals aged 19 to 25. FIG. 6A shows the relationship with fecal acetic acid concentrations, and FIG. 6B shows the relationship with fecal total volatile organic acid concentrations. In the figures, dots represent plots of each data point, straight lines represent approximate lines, and shaded areas represent the 95% confidence intervals of the approximate lines. [Figure 7] 1 is a graph showing the relationship between the results for Blautia bacteria and the results for bacteria 38f, in which the formula and R value are shown together with an approximate straight line indicated by a dashed line. [Figure 8]1 is a graph showing the abundance ratio of Blautia bacteria in feces from various individuals, in which each circle represents a plot of each data point, and each black circle represents a plot corresponding to each cutoff value. [Figure 9] 9A and 9B are graphs showing the relationship between the ratio of Blautia wexlerae measured by real-time PCR and the results of metagenomic analysis. Figure 9A shows the relationship with the results of the bacterium 38f in the metagenomic analysis, and Figure 9B shows the relationship with the results of the bacteria of the genus Blautia in the metagenomic analysis. In the figure, the approximate line is shown with a dashed line along with the formula and R value. DETAILED DESCRIPTION OF THE INVENTION

[0013] 1. Biomarkers Overview A first aspect of the present invention is a biomarker for determining the risk of developing and / or the severity of a disease associated with an eating disorder. The biomarker of this aspect can be used in the determination method of the second aspect.

[0014] 1-2.Definition Terms used in this specification are defined below. As used herein, the term "intestine" refers to the human digestive tract from the duodenum onwards, specifically including the small intestine including the duodenum, jejunum, and ileum, and the large intestine including the cecum, appendix, colon, and rectum.

[0015] As used herein, the term "intestinal microbiota" refers to the collection of various bacteria or microorganisms that inhabit the human intestinal tract, and the ecosystem of their microflora. Although its composition varies greatly depending on the individual, age, and diet, a certain balance is maintained within the intestinal tract. The intestinal microbiota is known to not only promote the digestion and absorption of food and antibody production in the intestinal tract, but also to inhibit the colonization and proliferation of foreign microorganisms and contribute to the host's metabolism and immunity. As used herein, "intestinal bacteria" refers to the various bacteria that make up the intestinal microbiota. It is said that there are 100 trillion or so intestinal bacteria in the human intestinal tract, with more than 1,000 species.

[0016] "Blautia wexlerae" is an enterobacterium belonging to the genus Blautia, and is an anaerobic, Gram-positive bacterium. The representative 16S rRNA of Blautia wexlerae has the base sequence shown in SEQ ID NO: 1.

[0017] As used herein, the term "individual" refers to a human individual who is the subject of the determination method of the present invention.

[0018] As used herein, the term "early childhood" refers to the period from after weaning to before starting school. The early childhood period as used herein encompasses both early childhood and late childhood.

[0019] As used herein, the term "feces" broadly refers to intestinal contents. For example, it includes both feces after they have been excreted from the body and intestinal contents before they are excreted. The region of the intestine from which the feces originates is not particularly limited. Specific examples include the small intestine, including the duodenum, jejunum, and ileum, and the large intestine, including the cecum, appendix, colon, and rectum. Feces derived from the large intestine is preferred. When feces originates from the large intestine, it may originate from any region, for example, the ascending colon, transverse colon, descending colon, sigmoid colon, upper rectum, or lower rectum.

[0020] As used herein, the term "nucleic acid" refers to a polynucleotide or oligonucleotide contained in feces, and in principle refers to naturally occurring nucleic acids. Specifically, it includes DNA and RNA.

[0021] As used herein, the term "disease" refers to any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.

[0022] As used herein, the term "disease accompanied by eating disorder" refers to a disease accompanied by abnormalities in eating-related behavior, such as the amount of food eaten and / or the way of eating. Abnormalities in food amount include overeating and anorexia, and abnormalities in eating way include picky eating.

[0023] "Unbalanced diet" refers to completely omitting a particular food that is normally consumed and / or consuming a particular food in greater amounts than normal. It is not particularly limited, but may be, for example, a unbalanced diet based on sensory hypersensitivity or hyposensitivity (taste, smell, touch, etc.).

[0024] As used herein, the term "disease risk" refers to the likelihood of contracting a disease. The term "disease risk" as used herein includes not only the likelihood of contracting a specific disease, but also, for example, the possibility of deterioration in health status (physical characteristics such as weight and height, diet, exercise, sleep, etc.) that may be a preliminary indicator of the onset of a disease.

[0025] As used herein, "base identity" refers to the percentage (%) of identical bases in one polynucleotide relative to the total number of bases in the other polynucleotide, determined by aligning the base sequences of two polynucleotides and, if necessary, introducing gaps into one of the base sequences to maximize the degree of base identity between the two. Percent identity can be easily determined using a known program, such as the homology search program BLAST (Basic local alignment search tool; Altschul, S. F. et al., J. Mol. Biol., 215, 403-410, 1990).

[0026] As used herein, "significant" refers to statistical significance. Statistically significant refers to a significant difference between the measured value of a test subject and the control value when the difference between the two is statistically processed. For example, the significance level of the obtained value is small, specifically, less than 5% (p<0.05), less than 1% (p<0.01), or less than 0.1% (p<0.001). The "p (value)" shown here indicates the probability that a test statistic will take that value by chance in a distribution based on the null hypothesis in a statistical test. Therefore, the smaller the "p", the lower the probability that the test statistic will take that value, meaning that the null hypothesis is more likely to be rejected. The statistical processing test method is not particularly limited and may be any known test method capable of determining the presence or absence of superiority. For example, the Student's t-test, covariate analysis of variance, etc., can be used.

[0027] As used herein, the term "biomarker" refers to a biomolecule (for example, a nucleic acid molecule or a protein molecule) that serves as an indicator for determining whether or not a person is at risk of contracting or developing a disease.

[0028] "One or more" refers to 1 to 10, preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, and particularly preferably 1 or 2.

[0029] 1-3.Configuration The biomarkers of the present invention consist of nucleic acids derived from Blautia wexlerae. The specific species of Blautia wexlerae is not particularly limited. For example, bacteria having a 16S rRNA gene containing the nucleotide sequence shown in SEQ ID NO: 13 (hereinafter referred to as "bacteria 38f") can be preferably used. Note that bacteria having a 16S rRNA gene containing a nucleotide sequence containing one or more base deletions, substitutions, additions, or insertions in the nucleotide sequence shown in SEQ ID NO: 13, and bacteria having a 16S rRNA gene containing a nucleotide sequence with 90% or more nucleotide identity to the nucleotide sequence shown in SEQ ID NO: 13 can also be preferably used.

[0030] The nucleic acid of this embodiment is not particularly limited as long as it can be distinguished as being derived from Blautia wexlerae. Preferably, the nucleic acid of this embodiment can be distinguished from closely related species of Blautia wexlerae. In this case, the closely related species is not particularly limited, and examples thereof include Blautia luti, Blautia glucerasea, Blautia faecis, Blautia massiliensis, Blautia schinkii, Blautia obeum, Blautia caecimuris, Blautia producta, Blautia pseudococcoides, Blautia coccoides, and Blautia hansenii.

[0031] The type of nucleic acid is not particularly limited, but is preferably the genomic DNA of Blautia wexlerae and / or nucleic acid derived therefrom.

[0032] The specific gene region to be used is not particularly limited, but for example, an RNA-binding protein gene region and / or an rRNA gene region can be preferably used.

[0033] "rRNA (ribosomal RNA)" refers to the RNA that constitutes ribosomes. Examples of rRNA found in bacteria include 23S rRNA, 16S rRNA, 5S rRNA, and combinations of these. For example, a representative 16S rRNA gene of Blautia wexlerae has the nucleotide sequence shown in SEQ ID NO: 1.

[0034] An "RNA binding protein" is a protein that binds to RNA and regulates its function and morphology. It usually has one or more RNA binding domains, such as a KH domain or an R3H domain. In particular, an RNA binding protein that has a KH domain is called a KH domain protein. An RNA binding protein gene is a gene that encodes an RNA binding protein.

[0035] The specific type of RNA-binding protein gene is not particularly limited, and examples thereof include KH domain protein genes, specifically, KhpA RNA-binding protein family protein genes and elongasome regulating protein genes.

[0036] Elongasome regulatory protein is another name for the KhpB RNA-binding protein family protein, which contains a KH domain and an R3H domain as RNA-binding domains.

[0037] When an elongasome-regulating protein gene is used, the specific gene is not particularly limited. For example, the Jag / EloR gene can be used. Jag / EloR is a protein that has a Jag domain at its N-terminus. A representative Jag / EloR gene from Blautia wexlerae has the nucleotide sequence shown in SEQ ID NO: 2.

[0038] The biomarkers of the present invention may be nucleic acid fragments constituting a part of the above-mentioned genes. In such cases, the length of the nucleic acid fragment is not particularly limited, as long as the presence of the fragment indicates the expression of the protein or gene of interest, rather than that of other proteins or genes. Specifically, the length may be, for example, 15 or more bases, 17 or more bases, 19 or more bases, 20 or more bases, 25 or more bases, 30 or more bases, 40 or more bases, 50 or more bases, 100 or more bases, 200 or more bases, 300 or more bases, 500 or more bases, 1000 or more bases, 1500 or more bases, or 2000 or more bases.

[0039] The biomarkers of the present invention are biomarkers for diseases associated with eating disorders. The disease accompanied by an eating disorder is not particularly limited. Examples include developmental disorders, food allergies, severe physical and mental disabilities, constipation, diarrhea, obesity, diabetes, etc. Developmental disorders include, for example, autism spectrum syndrome (ASD). Preferably, the disease accompanied by an eating disorder is a disease accompanied by defecation disorders (diarrhea and / or constipation). Preferably, the disease accompanied by an eating disorder is a disease accompanied by disruption of the intestinal flora (dysbiosis). For example, the disease accompanied by an eating disorder may be a disease accompanied by a decrease in the concentration of organic acids in the feces. In this case, the type of organic acid is not particularly limited, but examples thereof include volatile fatty acids. Generally, fatty acids having 1 to 6 carbon atoms are volatile. Specific types of organic acids are not particularly limited, but examples thereof include formic acid, acetic acid, butyric acid, isobutyric acid, propionic acid, valeric acid, isovaleric acid, caproic acid, etc. The organic acid concentration can be measured by any known method (for example, high performance liquid chromatography (HPLC) etc.). Specifically, it can be measured, for example, according to the method described in Tsukahara et al. (2014) (DOI: 10.1111 / asj.12188).

[0040] "Developmental disorders" refer to mental illnesses caused by brain dysfunction that manifest at a young age, including autism spectrum disorder (ASD), learning disabilities, and attention deficit hyperactivity disorder.

[0041] "Autism spectrum disorder (ASD)" refers to a general term for developmental disorders characterized by persistent deficits in social communication and interpersonal interactions, as well as behaviors, interests, or repetitive behaviors, beginning early in development. It broadly encompasses disorders previously classified as early infantile autism, childhood autism, Kanner autism, high-functioning autism, atypical autism, pervasive developmental disorder not otherwise specified, childhood disintegrative disorder, and Asperger's syndrome. ASD is often accompanied by eating disorders such as picky eating, and in some cases, constipation or diarrhea may also occur. ASD can be diagnosed through interviews, behavioral observations, and / or testing. The specific method of judgment is not particularly limited, but examples that can be used include the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-5), the Autism Society of Japan Pervasive Developmental Disorders Rating Scale (PARS), the Infant Autism Checklist (M-CHAT), the Japanese version of the Autism Spectrum Quotient (AQ) test, the WISC-IV intelligence test, the Tanaka-Binet Intelligence Test, the Autism Diagnostic Interview-R (ADI-R), the Autism Diagnostic Observation Scale, 2nd Edition (ADOS-2), the Diagnostic Interview for Social and Communication Disorders (DISCO), the Wechsler Intelligence Scale (WAIS), or a combination thereof.

[0042] "Food allergy" refers to a condition in which an allergic reaction occurs after ingesting or coming into contact with a specific food. Food allergies can be diagnosed by, but are not limited to, tests such as serum allergen-specific IgE antibody tests, skin prick tests, and oral food challenge tests, by interviewing patients about clinical symptoms, or a combination of these.

[0043] "Severe physical and mental disability" refers to a condition in which severe physical disability and severe intellectual or mental disability overlap. Typically, this refers to a condition in which the individual has significant behavioral difficulties and requires assistance in daily life. It is known that this condition is often accompanied by eating disorders such as picky eating, and diarrhea is often present. While not particularly limited, the condition can be determined based on Oshima's classification. Specifically, for example, an individual can be determined to have a severe physical and mental disability if they fall into the range of 1 to 4 in Oshima's classification. Furthermore, for example, an individual may be determined to have a severe physical and mental disability if they fall into level V on the Gross Motor Function Measure (GMFM) and / or level V on the Manual Ability Classification System (MACS). The causes of severe physical and mental disability are not particularly limited, but examples include birth abnormalities, low birth weight, exogenous disorders (e.g., encephalitis), and symptomatic disorders (e.g., epilepsy).

[0044] "Constipation" refers to incomplete bowel movement accompanied by a feeling of incomplete evacuation. Typically, this refers to a state in which spontaneous bowel movements occur less than three times a week or no bowel movements occur for three days or more. Constipation may also be determined based on the condition of the stool. For example, it can be determined based on an evaluation based on the Bristol Stool Form Scale or the moisture content of the stool. For example, constipation can be determined when the score on the Bristol Stool Form Scale is 2 or less, specifically, 1 and / or 2. Furthermore, for example, when based on the moisture content of the stool, constipation can be determined when the moisture content is 70% or less, e.g., 70% or less, 69% or less, or 68.5% or less.

[0045] "Diarrhea" refers to a condition in which the water content in the feces is increased. In this specification, it also includes loose stools. Usually, it refers to a condition in which the water content in the feces is more than 70%, for example, 75% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, or 90% or more. Diarrhea may also be determined based on qualitative criteria, such as, but not limited to, an evaluation based on the Bristol Stool Form Scale. For example, on the Bristol Stool Form Scale, diarrhea can be determined when the score is 6 or more, specifically, 6 and / or 7.

[0046] The target individuals to which the biomarkers of the present invention are applied are not particularly limited, and may be any human individuals from infancy to under 18 years of age. Preferably, the target individuals are human individuals from cultural spheres where rice is one of the staple foods. Examples include residents of East Asia, Central Asia, South Asia, Southeast Asia, and West Asia. Furthermore, the individuals from whom the feces are derived are preferably Mongoloids. Examples include Southern Mongoloids, Northern Mongoloids, Central Mongoloids, Southern Mongoloids, Eskimos, and Amerinds. Specific examples include Japanese, Koreans, Chinese, Taiwanese, Mongolians, Tibetans, Indochinese, and Native Americans. Preferably, the target individuals are Japanese.

[0047] The age of the individual is not particularly limited, as long as it is between infancy and under 18 years of age. The lower age limit is not particularly limited, as long as it is after weaning. Specific lower age limits can be, for example, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 2 years, 3 years, 4 years, etc. The upper age limit is not particularly limited. For example, the age may be 17 years or younger, 16 years or younger, 15 years or younger, 14 years or younger, 13 years or younger, 12 years or younger, 11 years or younger, or 10 years or younger.

[0048] The condition of the individual is not particularly limited. For example, the individual may be known to have a particular disease (a disease associated with an eating disorder and / or other disease), may be suspected to be at high risk of developing a particular disease, may be undergoing a particular treatment, or may be a healthy individual.

[0049] 2. Method for determining the risk of developing a disease and / or its severity 2-1. Overview A second aspect of the present invention is a method for determining the risk of developing a disease and / or the severity of the disease. The method of the present invention comprises a nucleic acid extraction step, a measurement step, and a determination step. According to the method of the present invention, the risk of developing a disease and / or the severity of the disease in an individual from which the feces is derived can be determined based on information about nucleic acids contained in the feces.

[0050] 2-2.Process The method of this embodiment includes a nucleic acid extraction step, a measurement step, and a determination step. Each step will be specifically described below.

[0051] 2-2-1. Nucleic acid extraction process The "nucleic acid extraction step" is a step of extracting nucleic acids from feces derived from an individual. The nucleic acid extraction process typically includes a pretreatment step, a lysis step, and a crude nucleic acid extraction step, and optionally further includes a purification step. Each step is described below.

[0052] In the pretreatment step, the feces is suspended in a liquid to enable lysis. The liquid used is not particularly limited, but the feces can be suspended in an appropriate buffer such as PBS or Tris-HCl. If necessary, all or part of the suspension may be further treated by centrifugation and / or filtration before the subsequent lysis step to remove impurities such as undigested matter.

[0053] In the lysis step, a cell lysis solution is added to a portion of the suspension obtained in the pretreatment step, and lysis is promoted at a certain temperature. The cell lysis solution used is not particularly limited. Any cell lysis solution known in the art can be used. Specific examples include digestive enzymes (e.g., protease, polysaccharide-degrading enzyme, etc.), denaturants (e.g., guanidinium salts), surfactants (e.g., SDS, Triton x100, etc.), chelating agents (e.g., EDTA, etc.), and buffers (e.g., Tris-HCl, etc.). Furthermore, the cell lysis solution may contain beads for physically disrupting the cells. The material of the beads used in this step is not particularly limited, but examples include glass, guanidinium, garnet, zirconium, silica, and combinations thereof. When disrupting with beads, a disruption step is usually performed during, before, or after the lysis step. The disruption step can be performed by applying physical stimuli such as shaking or vibration. The conditions used for lysis are known in the art. Therefore, the temperature can be appropriately determined depending on various conditions, such as the composition of the cell lysis solution used, the type of feces, and the type of nucleic acid to be extracted. Specific temperatures for the lysis treatment may be, for example, 50°C or higher, 60°C or higher, 70°C or higher, 80°C or higher, 90°C or higher, or 95°C or higher. Specific times for the lysis treatment are not particularly limited. For example, the treatment may be performed for 5 minutes or more, 10 minutes or more, 15 minutes or more, 20 minutes or more, 25 minutes or more, 30 minutes or more, 40 minutes or more, 50 minutes or more, or 60 minutes or more.

[0054] In the crude nucleic acid extraction step, a fraction containing nucleic acids is separated from the lysate after the lysis treatment. The extraction method used may be any extraction method known in the art. Specific extraction methods include, for example, methods that denature and remove components other than nucleic acids (e.g., phenol-chloroform method and sodium iodide method), methods that adsorb nucleic acids to silica membranes or magnetic glass particles (e.g., spin column method), and combinations of these. Commercially available nucleic acid extraction kits may also be used.

[0055] In the optional purification step, nucleic acids are further purified from the crude nucleic acids obtained in the crude nucleic acid extraction step. The method used in this step is not particularly limited, and any purification method known in the art can be used. Specific purification methods include, for example, methods that increase the purity of all nucleic acids (e.g., alcohol methods and magnetic bead methods), methods that increase the purity of only specific types of nucleic acids (e.g., methods using RNase or DNase), and combinations of these. This purification step does not need to be performed separately from the other steps, and there are no particular limitations on the timing of its performance.

[0056] The form of the feces used in this step is not particularly limited, and the feces may be, for example, liquid or solid.

[0057] For example, solid feces obtained from an individual may be used as is in a solid state, or may be dissolved in a solution or the like and homogenized, and then a portion of the solution may be used in a liquid state. The individual from which the feces is derived is not particularly limited, and may be, for example, an individual described in the first aspect.

[0058] The feces may be stored until it is used in this step. The storage conditions are not particularly limited, and may be, for example, frozen storage, freeze-dried storage, refrigerated storage, room temperature storage, dry storage, or a combination thereof. Specific methods for frozen storage include, for example, cryogenic storage using dry ice, an ultra-low temperature refrigerator, or liquid nitrogen, or storage using a regular household freezer. Specific methods for freeze-dried storage include, for example, a method using a freeze dryer. Specific methods for refrigerated storage include, for example, storing the feces at a temperature of 10°C or below (e.g., in a household refrigerator). When storing at room temperature, it is preferable to store the feces using a method that suppresses contamination and the growth of unwanted bacteria. Specific examples include, for example, a method using a preservation solution containing a component that suppresses the growth of unwanted bacteria, such as guanidine, or a method combining this with a dry storage method. Specific methods for dry storage include, for example, a method using a desiccant, and a method using a dryer (including, for example, a heating dryer).

[0059] The storage period is not particularly limited. Specific storage periods can be, for example, 1 day, 2 days, 3 days, 5 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months. Furthermore, at least a portion of the above-described pretreatment steps may be completed during the storage period.

[0060] The steps of this process may be carried out as a series of steps using, for example, a single commercially available kit.

[0061] 2-2-2.Measurement process The "measuring step" is a step of measuring the ratio of nucleic acid derived from Blautia wexlerae to total nucleic acid derived from bacteria based on the sequence information of the nucleic acid obtained in the nucleic acid extraction step. This step can be performed after or simultaneously with the nucleic acid extraction step.

[0062] The nucleic acid derived from Blautia wexlerae to be measured is as described in the first embodiment. The measurement method used in this step is not particularly limited as long as it is a method that can measure the proportion of nucleic acid derived from a specific bacterium in a nucleic acid-containing sample. Examples of measurement methods that can be used in this step include methods that use different primers or probes for each genus of bacteria to be detected (e.g., specific qPCR, T-RFLP (Terminal-Restriction Fragment Length Polymorphism), FISH (Fluorescence in situ hybridization), and microarray-based methods), methods that use primers common to some or all of the genus of bacteria to be detected (e.g., clone library methods, DGGE / TGGE (Denaturing / Temperature Gradient Gel Electrophoresis), and metagenomic analysis), methods that use primers or probes that can recognize base sequences specific to the bacterial species to be detected (e.g., PCR (including RT-PCR, qPCR, real-time PCR, etc.), hybridization methods (including Northern hybridization, Southern hybridization, Northern blotting, Southern blotting, nucleic acid arrays, etc.)), and combinations thereof. The specific procedures and conditions for these methods can basically be those well known in the field. For example, the methods described in "NGS Applications: Get Started Now! Metagenomic Analysis Experimental Protocols: Tips for Sample Preparation and Analysis from Human Resident Bacteria to Environmental Metagenomics" edited by Shohei Hattori, 2016, Yodosha, etc. can be used.

[0063] For example, when using a hybridization method, particularly a blotting technique, the amount of a target nucleic acid present can be detected and measured by using the probe described in the third embodiment. Specifically, this can be done, for example, by the following procedure. First, a probe (complementary strand) is ionized with a radioisotope ( 32 P, 33 P, 35The nucleic acid is labeled with a reagent such as ATP (e.g., ATP-S) or a fluorescent substance. Next, the nucleic acid in the sample is transferred to a nylon membrane or the like. A labeled probe is applied to this membrane, and the labeled probe and nucleic acid are hybridized. Finally, the signal derived from the label in the formed double strand is detected and measured using a radiation detector, fluorescence detector, or the like.

[0064] When PCR is used, the amount of a target nucleic acid present can be detected and measured by using the primers described in the third aspect. Specifically, this can be done, for example, by the following procedure. First, PCR is performed using DNA prepared from a sample as a template and a pair of primers capable of amplifying a target nucleic acid region, and the resulting double-stranded DNA is detected. Methods for detecting double-stranded DNA include performing the PCR using primers previously labeled with a radioisotope or fluorescent substance, electrophoresing the PCR product on an agarose gel and staining the double-stranded DNA with ethidium bromide or the like for detection, and transferring the produced double-stranded DNA to a nylon membrane or the like according to standard methods and hybridizing it with a labeled probe for detection.

[0065] Furthermore, for example, when using real-time PCR, the amount of nucleic acid present can be measured by the increase in the signal derived from the label accompanying the generation of an amplification product. In this case, the amount of nucleic acid present is generally calculated by substituting the obtained Ct value (Threshold Cycle Value) into a predetermined calibration formula. Here, the Ct value refers to the cycle number at which the amplification product reaches a certain amount. The calibration formula refers to the relationship between the amount of amplification product and the Ct value of each serially diluted sample, obtained by performing a similar amplification reaction using a primer set used for measurement and nucleic acid extracted from a serially diluted sample with a known bacterial count and / or gene copy number as a template. That is, the calibration formula can be derived from a calibration curve created based on the amplification curve showing the amount of amplification product at each dilution step obtained as a result of the amplification reaction, using a serially diluted bacterial solution in which the bacterial count has been measured in advance as a sample. The specific calibration formula is not particularly limited.

[0066] When nucleic acid array analysis is used, an RNA chip or a DNA chip is used in which the probe described in the third aspect is immobilized on a solid phase such as a substrate. In this method, nucleic acid molecules obtained from a sample are applied to the chip, and the presence or absence of the target nucleic acid is detected by detecting the signal from the chip.

[0067] Substrates on which nucleic acids are immobilized are generally called nucleic acid chips, nucleic acid arrays, microarrays, etc. DNA or RNA arrays include DNA or RNA macroarrays and DNA or RNA microarrays. In this specification, the term "chip" is intended to include all of these.

[0068] The method for measuring the signal from the chip is not limited, but for example, the signal derived from the label of the detection composition can be detected using an image detector (Typhoon 9410 (GE Healthcare), 3D-Gene (R) Examples of such methods include a method of detecting and measuring using a scanner (such as a scanner manufactured by Toray Industries, Inc.).

[0069] The "Surface Plasmon Resonance (SPR) method" is a highly sensitive method for detecting and quantifying adsorbates on a metal thin film surface using the surface plasmon resonance phenomenon. The surface plasmon resonance phenomenon refers to the phenomenon in which, when the incident angle of a laser beam irradiated onto a metal thin film is changed, the intensity of the reflected light significantly attenuates at a specific incident angle (resonance angle). In the present invention, a nucleic acid probe having a sequence complementary to the base sequence of a biomarker nucleic acid is immobilized on the surface of the metal thin film. After blocking other portions of the metal thin film surface, a liquid sample, such as a nucleic acid solution extracted from a sample, is passed over the metal thin film surface to form base pairs between the target nucleic acid and the nucleic acid probe. The target nucleic acid is then detected and quantified based on the difference in measured values ​​before and after sample passage. Detection and quantification by surface plasmon resonance can be performed, for example, using an SPR sensor commercially available from Biacore. This technology is well known in the art. For example, see Kazuhiro Nagata and Hiroshi Handa, Real-time Analysis Experimental Methods for Bio-Material Interactions, Springer-Verlag Tokyo, Tokyo, 2000.

[0070] The "quartz crystal microbalance (QCM)" method is a mass measurement technique that utilizes the phenomenon that when a substance adsorbs onto the surface of an electrode attached to a quartz crystal, the resonant frequency of the quartz crystal decreases in proportion to the mass of the substance. This technique quantitatively captures trace amounts of adsorbed substances by measuring the change in resonant frequency. Detection and quantification using this method, similar to SPR, can be performed using commercially available QCM sensors. For example, nucleic acid molecules of interest can be detected and quantified by base pairing between a nucleic acid probe immobilized on the electrode surface, which has a sequence complementary to the base sequence of the target nucleic acid, and the target nucleic acid in a sample. This technique is well known in the art; see, for example, J. Christopher Love, L.A. Estroff, J.K. Kriebel, R.G. Nuzzo, and G.M. Whitesides (2005) "Self-Assembled Monolayers of a Form of Nanotechnology," Chemical Review, 105:1103-1170; Toyoe Moriizumi and Takamichi Nakamoto (1997) "Sensor Engineering," Shokodo.

[0071] The calculation of gene expression levels in the present invention is not particularly limited, and statistical processing such as that described in "Statistical Analysis of Gene Expression Microarray Data" (Speed, T., Chapman and Hall / CRC) and "A Beginner's Guide to Microarray Gene Expression Data Analysis" (Causton, H.C. et al., Blackwell Publishing) can be used. For example, the average of the measurements of blank spots on a DNA chip can be added to the standard deviation of the measurements of the blank spots by two, three, or six times, and probe spots with signal values ​​equal to or greater than this value can be considered detection spots. Furthermore, the average of the measurements of the blank spots can be considered the background, and the value obtained by subtracting this from the measurements of the probe spots can be used to determine the gene expression level.

[0072] When using a method that uses different primers and probes for each bacterial genus to be detected, for example, specific qPCR or T-RFLP, nucleic acids can be amplified by PCR using primers specific to the bacterial genus, and the amount of nucleic acid can be measured during or after the amplification reaction. Alternatively, nucleic acids can be detected using probes specific to the bacterial genus without nucleic acid amplification, as in FISH or microarray methods. The primers and probes used in this case may target corresponding regions on the nucleic acid of each genus, or may target different regions. Specifically, when using a 16S rRNA sequence, for example, some or all of the nine variable regions can be targeted.

[0073] Methods using primers common to some or all of the target bacterial genus typically involve the use of a sequencer. The nucleic acid processing prior to sequencing varies depending on the specific method. For example, in the clone library method, a bacterial genus-specific sequence is amplified from extracted nucleic acid, and the amplified product is inserted into a plasmid for sequencing. In the DGGE / TGGE method, the amplified products are separated by electrophoresis according to the nucleic acid strand sequence, extracted from the gel, and sequenced. In metagenomic analysis, nucleic acids are fragmented or amplified, and the products are directly sequenced. The primers used for amplification and sequencing can be the same or different. For example, when using 16S rRNA sequences, primers capable of hybridizing to the conserved region located between the variable regions can be used. Specific primers that can be used are region-specific primers 341F and 806R (as of June 24, 2021), which can amplify the variable regions V3-V4 of the 16S rRNA gene. For sequencing, a sequencer based on the principle of the Sanger method or a next-generation sequencer can be used. Specific sequencing methods can be any method known in the art. Specific sequencing methods include, for example, multiplex sequencing, single-read sequencing, and paired-end sequencing.

[0074] When identifying the genus of bacteria from sequenced sequence information, the method is not particularly limited. For example, analytical methods known in the art that utilize analytical software, databases, etc. can be used. When using a database, bacteria can be identified, for example, by performing a sequence identity search on the accumulated bacterial nucleotide sequences. Specific examples of databases include GenBank, ENA, DDBJ, etc. In addition, the GREENGENES database (http: / / greengenes.secondgenome.com), which is a database specialized in 16S rRNA sequences, can also be used.

[0075] The copy number of the sequence identified as the 16S rRNA gene of each of the above bacteria may be considered to be the bacterial cell count of that bacteria. When using sequence information other than that stored in a database, for example, the sequence of the obtained nucleic acid is compared with the above-mentioned sequence information to calculate the base identity, and if there are genera with a certain level of base identity, the bacterial genus with the highest base identity can be considered to be the bacterial genus from which the obtained nucleic acid originates. For example, if the base sequence of a nucleic acid has 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.9% or more, or 100% base identity with the sequence information used to identify a specific bacterial genus, the nucleic acid is likely to belong to that genus. Typically, the amount of nucleic acid derived from bacteria belonging to a specific genus is considered to directly reflect the amount of bacteria belonging to that genus. Direct reflection means, for example, that the amount of bacterial cells and the amount of nucleic acid are in a 1:1 ratio, or that the amount of bacterial cells multiplied by a certain multiple and the amount of nucleic acid are in a 1:1 ratio.

[0076] The bacterial ratio can be calculated based on the formula (amount of nucleic acid derived from the bacterium of interest) / (amount of nucleic acid derived from all bacteria), and additional processing can be performed as needed. For example, processing such as arithmetic operations, exponentiation, radical roots, or a combination thereof can be performed as needed.

[0077] Furthermore, for example, the ratio of Blautia wexlerae may be calculated based on the measurement results for bacteria of the genus Blautia and / or a specific bacterial strain of Blautia wexlerae (such as bacterium 38f). In this case, the ratio of Blautia wexlerae can be calculated by converting values ​​based on a relational equation showing the relationship between the amount of nucleic acid derived from bacteria of the genus Blautia or a specific bacterial strain of Blautia wexlerae and the amount of nucleic acid of Blautia wexlerae. In this case, the relational equation can be appropriately selected depending on the bacterial strain of interest and the measurement method used. For example, calculations can be performed based on the relationship between the measured values ​​of Blautia wexlerae by real-time PCR and the measured values ​​of bacteria of the genus Blautia by metagenomics, as described in the Examples, and the relationship between the measured values ​​of Blautia wexlerae by real-time PCR and the measured values ​​of bacterium 38f by metagenomics.

[0078] In addition, multiple ratios may be calculated from one stool sample. For example, in this step, a ratio obtained by standardizing the results of multiple measurements may be used. Furthermore, the ratios obtained from the results of multiple measurements may be used as individual data to make the determination described below.

[0079] The nucleic acid extraction step and this step can be carried out as a series of steps using, for example, a single commercially available kit.

[0080] 2-2-3. Judgment process Based on the measured ratio, the risk of developing and / or the severity of the disease in the individual from whom the stool was derived is determined. This step can be performed after or simultaneously with the above-mentioned measuring step.

[0081] In this step, a ratio of nucleic acid derived from Blautia wexlerae that is lower than a predetermined reference value indicates a high risk of developing and / or a high severity of a disease associated with an eating disorder in the individual.

[0082] The method of comparison with the reference value is not particularly limited, and examples thereof include a method of visual comparison, a method using software, etc. Examples of the method using software include a method using calculation software such as Excel, a method using automatic processing by calculation software, and a method using known software capable of sorting based on the reference value.

[0083] The "predetermined reference value" used in this step is not particularly limited as long as it is capable of distinguishing the risk of developing and / or the severity of a disease associated with an eating disorder. It can be appropriately determined based on the stool, nucleic acid, and sequence information used, the specific disease to be assessed, the measurement method used in the measurement step, and the like. Empirical criteria and objective criteria can be used as the predetermined reference value in this step. For example, a cutoff value can be used as the objective criterion.

[0084] As used herein, the term "cutoff value" refers to a value that can be used as a reference to determine the presence or absence of disease risk. Preferably, the cutoff value exhibits sufficiently high values ​​for both sensitivity and specificity. Generally, the cutoff value is derived using a known method from an ROC curve drawn based on a direct comparison between a control group and a disease group to be compared, but is not limited to this. For example, the cutoff value may be set without using an ROC curve. Any known method can be used to determine the cutoff value using an ROC curve. Specific methods include, for example, a method using the Youden Index (sensitivity - (1 - specificity)) and a method using the distance from the upper left corner (the point where both sensitivity and specificity are 100%).

[0085] An "ROC curve (Receiver Operating Characteristic curve)" is created by plotting the true positive rate (TPF: True Position Fraction), or sensitivity, on the vertical axis and the false positive rate (FPF: False Position Fraction), or (1-specificity), on the horizontal axis, varying the threshold for determining which test result values ​​indicate a positive finding, i.e., the cutoff point, as a parameter. Specificity here refers to the rate at which negative cases are accurately determined to be negative.

[0086] "AUC (Area Under the Curve)" refers to the area under the ROC curve, and is a numerical value that represents the discriminatory ability of an index related to the ROC curve. Generally, the closer the AUC is to 1, the higher the discriminatory ability, and the closer it is to 0.5, the lower the discriminatory ability.

[0087] The cutoff value used in the present invention preferably has sufficiently high sensitivity and specificity, for example, a sensitivity and / or specificity of 60% or more, 64% or more, 65% or more, 67% or more, 70% or more, 75% or more, 78% or more, 80% or more, 85% or more, or 90% or more. Furthermore, the AUC, which indicates the discriminatory ability of the biomarker, is preferably 0.75 or more, 0.78 or more, 0.79 or more, 0.8 or more, 0.81 or more, 0.82 or more, 0.85 or more, 0.88 or more, 0.89 or more, or 0.9 or more. Furthermore, it is preferable to use a cutoff value in which the value of sensitivity - (1 - specificity) is 0.4 or more, 0.41 or more, 0.42 or more, 0.43 or more, 0.435 or more, 0.44 or more, or 0.45 or more.

[0088] Specific cutoff values ​​that can be used, for example, for ratios based on real-time PCR, include values ​​such as 0.0129, 0.0140, and 0.0050.

[0089] Multiple reference values ​​can be set. For example, a cutoff value for determining the presence or absence of a risk of developing a disease accompanied by an eating disorder and a cutoff value for determining the severity of a disease accompanied by an eating disorder can be set. Furthermore, cutoff values ​​for determining the risk of developing a more specific disease and the severity can be set, respectively.

[0090] For example, when the ratio of Blautia wexlerae is below the cutoff value for determining whether or not there is a risk of developing a disease associated with eating disorders, but is not below the cutoff value for determining the severity of the disease associated with eating disorders, it can be determined that the individual has a risk of developing a disease associated with eating disorders.Alternatively, for example, the degree of risk of developing and the degree of severity can be classified into multiple stages, and cutoff values ​​can be set for each.

[0091] The type of determination result in this step is not particularly limited. For example, the result can be used to determine whether or not there is a risk of developing a disease accompanied by an eating disorder, whether or not there is an onset of a disease accompanied by an eating disorder, the risk of developing and / or the onset of a more specific disease, the severity of a disease accompanied by an eating disorder and / or a more specific disease, and the effectiveness of a specific treatment.

[0092] In this step, in addition to the determination using the biomarkers of the present invention, determination may be made based on known diagnostic criteria. In this case, the diagnostic criteria are not particularly limited, and for example, the diagnostic methods exemplified in the definitions of each disease can be used.

[0093] 2-3.Effects According to the method of this aspect, it is possible to easily detect disruption of the intestinal flora (dysbiosis) and objectively determine the risk of developing and / or the severity of a disease accompanied by an eating disorder, thereby enabling the condition of an individual at risk of developing a disease accompanied by an eating disorder or an individual suffering from such a disease to be easily monitored using an objective indicator.

[0094] For example, by applying the method of this embodiment to an individual undergoing a particular treatment, the effectiveness of the treatment can be determined. Thus, the method of this embodiment can be used as a screening method for treatment methods for diseases associated with eating disorders.

[0095] Furthermore, when extracted nucleic acid is provided, by carrying out a measurement step and a determination step, and when information regarding the composition ratio of intestinal bacteria is provided, by carrying out a determination step, it can be used as a method for determining the risk of developing and / or the severity of a disease associated with an eating disorder in an individual from whom the nucleic acid or information is derived.

[0096] 3. Kit Overview A third aspect of the present invention is a kit. The kit of the present invention contains, as an active ingredient, a probe or primer capable of detecting the biomarker described in the first aspect, and is configured to measure the abundance and / or ratio of Blautia wexlerae present in feces. Use of the kit of the present invention makes it possible to determine the presence or absence of a risk of developing a disease and / or the severity thereof.

[0097] 3-2.Configuration 3-2-1. Probes and primers The kit of the present invention comprises, as an essential component, a probe that hybridizes to the base sequence of the 16S rRNA gene and / or the RNA-binding protein gene in nucleic acid derived from Blautia wexlerae, and, as an optional component, a primer set that amplifies the 16S rRNA gene and / or the RNA-binding protein gene.

[0098] The base sequences of the primers and probes in the kit of the present invention are not particularly limited as long as they perform the above-mentioned functions, and examples thereof include the following polynucleotides: (1) a polynucleotide consisting of 15 or more consecutive bases selected from the base sequence shown in SEQ ID NO: 1 or 2; (2) A polynucleotide containing one or more base deletions, substitutions, additions, or insertions in the base sequence of the polynucleotide of (1); (3) A polynucleotide having 90% or more base identity to the base sequence of the polynucleotide of (1); (4) a polynucleotide that hybridizes under highly stringent conditions with a polynucleotide consisting of 15 or more consecutive bases selected from a base sequence complementary to the base sequence shown in SEQ ID NO: 1 or 2; and (5) A polynucleotide having a base sequence complementary to the base sequence of the polynucleotides of (1) to (4).

[0099] As used herein, the term "probe" includes polynucleotides capable of specifically recognizing and detecting DNA, RNA produced by gene expression, or polynucleotides derived therefrom, polynucleotides complementary thereto, and aptamers.

[0100] As used herein, the term "primer" encompasses polynucleotides capable of specifically recognizing and amplifying DNA, RNA produced by gene expression, or polynucleotides derived therefrom, as well as polynucleotides complementary thereto.

[0101] The term "complementary" refers to a relationship in which nucleic acid bases can form base pairs with each other via hydrogen bonds, such as Watson-Crick base pairs (natural base pairs) or Hoogsteen base pairs.

[0102] As used herein, the terms "hybridize" or "hybridizable" refer to polynucleotides having complementary base sequences base pairing to form a completely or partially complementary double strand.

[0103] As used herein, "stringent conditions" refers to conditions under which a nucleic acid probe hybridizes to its target sequence to a greater extent than to other sequences (for example, a measured value of at least the average of background measurements plus twice the standard error of the background measurement). Stringent conditions are sequence-dependent and vary depending on the environment in which hybridization occurs.

[0104] As used herein, "highly stringent conditions" refer to environmental conditions that make it difficult for nonspecific hybridization to occur. Under highly stringent conditions, a nucleic acid having a target nucleotide sequence can form a hybrid, but a nucleic acid having a nonspecific nucleotide sequence cannot substantially form a hybrid. Generally, highly stringent conditions refer to conditions with a low salt concentration and a high temperature. A low salt concentration is, for example, 15 to 750 mM, preferably 15 to 500 mM, 15 to 300 mM, or 15 to 200 mM. Examples include 1.5 to 3.5×SSC, 2 to 3×SSC, and 2 to 2.5×SSC. Furthermore, a high temperature is, for example, 50 to 68°C or 55 to 70°C. Another condition that defines stringent conditions is post-hybridization washing conditions, such as washing at 65°C with 0.1×SSC and 0.1% SDS. It is desirable that the polynucleotide contained in the kit of the present invention maintains a hybridized state with the target positive strand even when washed under such conditions.

[0105] Other examples of "stringent conditions" for these hybridizations are described, for example, in Sambrook, J. & Russell, D., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, published January 15, 2001, Vol. 1, 7.42-7.45, Vol. 2, 8.9-8.17, and can be used in the present invention.

[0106] The identity value indicates a value calculated using software (e.g., FASTA, DNASIS, and BLAST) that calculates the identity between multiple base sequences with default settings. The identity value of base sequences is calculated by aligning a pair of base sequences to maximize the degree of identity, calculating the number of matching bases, and calculating the ratio of the number of matching bases to the total number of bases in the compared base sequences. Here, if there are gaps, the total number of bases mentioned above is the number of bases counted with one gap as one base. For details on how to determine identity, see, for example, Altschul et al., Nuc. Acids. Res. 25, 3389-3402, 1977 and Altschul et al., J. Mol. Biol. 215, 403-410, 1990.

[0107] The length of consecutive bases in these polynucleotides is not particularly limited as long as it is 15 or more bases, and can be, for example, 17 or more bases, 18 or more bases, 19 or more bases, 20 or more bases, 21 or more bases, etc.

[0108] The level of identity is preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.9% or more, or 100%.

[0109] Furthermore, these polynucleotides may include polynucleotides containing a base sequence that has a certain level of identity to a continuous partial base sequence contained in the base sequence of the target gene or its complementary base sequence.

[0110] In the case of a primer, it preferably contains the above-mentioned consecutive bases on the 3'-end side, which is the extension direction. It also preferably contains, from the 3'-end, a base sequence region consisting of a base sequence that is 100% identical to the target base sequence, and a base sequence region consisting of a base sequence that has a certain level of identity or higher to the target base sequence. The length of the base sequence region consisting of a base sequence identical to the target base sequence is not particularly limited, but may be, for example, 2 or more bases, 3 or more bases, 5 or more bases, 10 or more bases, 15 or more bases, 17 or more bases, or 19 or more bases.

[0111] In this case, any additional base sequence may be included at the 5'-end. The total number of bases in the primer is not particularly limited, but may be, for example, 50 bases or less, 40 bases or less, or 30 bases or less.

[0112] Specific primer sets include, for example, a set of polynucleotides having or consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 for the 16S rRNA gene; a set of polynucleotides having or consisting of the nucleotide sequences of SEQ ID NOs: 5 and 6 for the Jag / EloR gene; or a set of polynucleotides (2) to (5) when these polynucleotides are used as the polynucleotide (1).

[0113] Examples of conditions for carrying out PCR using the primers in the kit of the present invention include using a PCR buffer with a composition such as 10 mM Tris-HCl (pH 8.3), 50 mM KCL, and 1 to 2 mM MgCl2, and treating for approximately 15 seconds to 1 minute at a temperature that is 5 to 10°C above the Tm value calculated from the primer sequence. Methods for calculating the Tm value include Tm value = 2 × (number of adenine residues + number of thymine residues) + 4 × (number of guanine residues + number of cytosine residues).

[0114] The nucleic acid constituting the probe contained in the kit of the present invention for use in the hybridization method may generally be DNA, which can be synthesized at low cost and is highly stable, but if necessary, may also contain, in whole or in part, chemically modified nucleic acids or pseudonucleic acids such as PNA (Peptide Nucleic Acid), BNA (Bridged Nucleic Acid) / LNA (Locked Nucleic Acid), methylphosphonate DNA, phosphorothioate DNA, 2'-O-methyl RNA, or combinations thereof. Furthermore, the probe contained in the kit of the present invention may contain modified substances such as fluorescent dyes (e.g., fluorescamine and its derivatives, rhodamine and its derivatives, DIG, FITC, Cy3, Cy5, FAM, HEX, and VIC), quencher substances (TAMRA, DABCYL, BHQ-1, BHQ-2, or BHQ-3), biotin or (strept)avidin, or magnetic beads, or radioisotopes (e.g., 32 P, 33 P, 35 The hybridization can be performed under stringent conditions of low salt concentration and high temperature in order to eliminate non-specifically hybridizing nucleic acids other than the target nucleic acid.

[0115] Any polynucleotide or fragment thereof used in the kit of the present invention may be DNA or RNA.

[0116] The polynucleotides used in the kit of the present invention can be prepared using common techniques such as DNA recombinant technology, PCR, and methods using an automatic DNA / RNA synthesizer.

[0117] The DNA recombinant DNA technology and PCR method can be described, for example, in Ausubel et al., Current Protocols in Molecular Biology, John Willey & Sons, US (1993); Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, US (1989).

[0118] The target nucleotide sequence is known, and as described above, the method for obtaining it is also known. Therefore, by cloning this gene, polynucleotides usable as probes or primers in the kit of the present invention can be prepared.

[0119] Such probes or primers can be chemically synthesized using an automated DNA synthesizer. The phosphoamidite method is generally used for this synthesis, and this method allows automated synthesis of single-stranded DNA up to about 100 bases. Automated DNA synthesizers are commercially available from, for example, Polygen, ABI, Thermo Fishers, etc. Alternatively, they can be prepared by cDNA cloning.

[0120] The kit of the present invention may contain probes and / or primers in any combination, but typically contains primers as a primer pair of a forward primer and a reverse primer.

[0121] The kit of the present invention may further comprise probes and / or primers for any known gene that can be used as a biomarker capable of determining the presence or absence of a risk of developing a disease associated with an eating disorder and / or the severity thereof.

[0122] The kits of the present invention need not include primers when used with already amplified nucleic acids.

[0123] 3-2-2.Other configurations The kit of the present invention may further include a reagent for extracting nucleic acid (e.g., total RNA) or polypeptide from body fluids, cells, or tissues, a fluorescent labeling substance, an enzyme and culture medium for amplifying nucleic acid, instructions for use, a dilution or reaction buffer containing components necessary for measurement, a washing solution, a color-developing reagent, a reaction vessel, etc.

[0124] The kit of the present invention may include a container. The material of the container is not limited as long as it is made of a material that does not contaminate the contents or is not contaminated by the contents. Examples of materials that can be used for the container include plastics such as polypropylene and polystyrene, glass, and paper with a specially coated surface.

[0125] The detection device is not particularly limited. The detection method can be appropriately selected depending on the label and reagent used, the properties of the sample, and other factors, and the device required for that detection method can be used. For example, when a fluorescent dye or luminescent substance is used, detection can be performed by visual inspection, using a microscope (e.g., a fluorescence microscope), using a detector (e.g., fluorescence-activated cell sorting (FACS), a luminescence spectrometer, an absorption spectrometer, etc.), or a combination thereof. When a non-colored small molecule that acts as an enzyme substrate or antigen is used as a label, detection can be performed, for example, after treatment such as enzyme treatment, using a detection method similar to that used when a fluorescent dye or luminescent substance is used. When a radioisotope is used as a label, detection can be performed, for example, by autoradiography, a scintillation counter, positron emission tomography (PET), or a combination thereof.

[0126] The kit of the present invention can include, for example, serially diluted samples with known bacterial counts that can be used in the measurement of the second embodiment.

[0127] The kit of the present invention may optionally include an instruction manual for use. The kit of the present invention may optionally include an application means such as a syringe, a dropper, a micropipette, or the like, and a storage means.

[0128] The kit of the present invention is a kit that can be used for the method according to the second aspect. Therefore, the kit of the present invention can be configured as a kit for any purpose according to the second aspect.

[0129] 4. Devices Overview A fourth aspect of the present invention is a device for determining the risk of developing and / or the severity of a disease associated with an eating disorder in an individual from infancy to under 18 years of age. The device of this aspect can detect and / or measure the amount of the biomarker described in the first aspect.

[0130] 4-2.Configuration The device of the present invention comprises, as an essential component, a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acid derived from Blautia wexlerae.

[0131] The probe has been described in detail in the third embodiment, and therefore will not be described here. Other configurations also basically conform to the description of the third embodiment.

[0132] The device of the present invention may, if necessary, additionally comprise a means for collecting feces from an individual, a container for collecting and storing the feces, a means for measuring the amount of biomarkers, a means for calculating the ratio, etc.

[0133] The device of the present invention is, for example, a device for measuring a biomarker in which a nucleic acid such as the polynucleotide of the present invention described above, a mutant thereof, a derivative thereof, or a fragment thereof is bound or attached to a solid phase. Examples of materials for the solid phase include plastic, paper, glass, and silicon, with plastic being a preferred material due to its ease of processing. The shape of the solid phase is arbitrary, for example, square, round, strip-shaped, film-shaped, and the like. The device of the present invention includes, for example, a device for measurement by hybridization technology, and specific examples thereof include a blotting device and a nucleic acid array (e.g., a microarray, a DNA chip, an RNA chip), etc.

[0134] Nucleic acid array technology is a technique in which the above-mentioned nucleic acids are bound or attached one by one to the surface of a solid phase that has been subjected to surface treatment such as L-lysine coating or the introduction of functional groups such as amino groups or carboxyl groups as necessary, to produce an array such as a chip, and then the array is used to measure the target nucleic acid by hybridization. Methods for binding or attaching nucleic acids include, for example, spotting nucleic acids using a high-density dispenser called a spotter or arrayer, spraying nucleic acids onto a solid phase using an inkjet that ejects minute droplets from a nozzle using a piezoelectric element, or sequentially synthesizing nucleotides on the solid phase.

[0135] 5. Therapeutic composition Overview A fifth aspect of the present invention is a therapeutic composition. The therapeutic composition of the present invention contains Blautia wexlerae as an active ingredient as an essential component. The composition of the present invention can treat diseases associated with eating disorders in individuals from infancy to under 18 years of age.

[0136] 5-2.Configuration 5-2-1. Components The components of the therapeutic composition of the present invention will be described. The therapeutic composition of the present invention contains Blautia wexlerae as an active ingredient as an essential component, and a solvent and / or carrier as optional components. Each component will be specifically described below.

[0137] (1) Active ingredient The therapeutic composition of the present invention contains Blautia wexlerae as an essential active ingredient, and may contain one or more species of bacteria, if desired.

[0138] The description of Blautia wexlerae is the same as that of the first embodiment. The therapeutic composition of the present invention can contain one or more types of Blautia wexlerae. The form of Blautia wexlerae contained in the therapeutic composition of the present invention is not particularly limited, but is configured so that the administered Blautia wexlerae can grow in the intestine. The form of Blautia wexlerae contained in the composition is not particularly limited, but it is preferably live or dormant and capable of waking up under specific conditions.

[0139] The content of the active ingredient contained in the therapeutic composition of the present invention is not particularly limited. Generally, the content varies depending on the type of active ingredient, the dosage form, and the type of solvent and carrier, which are other components described below. Therefore, it can be determined appropriately taking into account each condition. It is sufficient that a single dose of the therapeutic composition contains an effective amount of the active ingredient. However, if a large amount of the therapeutic composition is required to be administered to a subject to achieve the pharmacological effect of the active ingredient, it can be administered in several divided doses to reduce the burden on the subject. In this case, the total amount of the active ingredient is sufficient as long as it contains an effective amount. An "effective amount" refers to the amount necessary to exert the function of the active ingredient and to cause little or no harmful side effects in the subject to which it is applied. This effective amount may vary depending on various conditions, such as the subject's information, the route of application, and the number of applications. Therefore, when the therapeutic composition is used as a medicine, the content of the active ingredient is ultimately determined by the judgment of a physician, pharmacist, or other such person.

[0140] As used herein, the term "subject" refers to a target for the therapeutic composition of this embodiment. The subject in this embodiment is particularly a human individual from infancy to under 18 years of age. In the present invention, the subject may be healthy or may be suffering from some disease, and includes, for example, individuals suspected of suffering from a disease accompanied by an eating disorder. For example, the present invention can be applied to individuals who are the target of the method described in the first embodiment.

[0141] As used herein, "subject information" refers to various information relating to the characteristics and condition of a subject, such as age, weight, sex, general health condition, presence or absence of disease, progression and severity of disease, drug sensitivity, presence or absence of concomitant medication, and resistance to treatment.

[0142] The composition may further contain one or more known active ingredients for treating intestinal flora disruption (dysbiosis). In this case, the additional ingredient is not particularly limited and may be, for example, intestinal bacteria or an ingredient having an intestinal regulating effect, such as dietary fiber (e.g., guar bean-derived water-soluble dietary fiber (PHGG)).

[0143] (2) Solvent The therapeutic composition of the present invention may contain a pharmaceutically acceptable solvent, if necessary. The term "pharmaceutically acceptable solvent" refers to a solvent commonly used in the pharmaceutical formulation field. Examples include water, an aqueous solution, or an organic solvent. Aqueous solutions include, for example, physiological saline, an isotonic solution containing glucose or other adjuvants, a phosphate buffer solution, and a sodium acetate buffer solution. Adjuvants include, for example, D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other low-concentration nonionic surfactants, polyoxyethylene sorbitan fatty acid esters, etc. Organic solvents include ethanol.

[0144] (3) Carrier The therapeutic composition of the present invention may contain a pharmaceutically acceptable carrier, if necessary. The term "pharmaceutically acceptable carrier" refers to an additive commonly used in the pharmaceutical technology field. Examples include excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, human serum albumin, etc.

[0145] Excipients include, for example, sugars such as monosaccharides, disaccharides, cyclodextrins and polysaccharides, metallic salts, citric acid, tartaric acid, glycine, polyethylene glycol, Pluronic®, kaolin, silicic acid, or combinations thereof.

[0146] Examples of binders include starch paste using vegetable starch, pectin, xanthan gum, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, shellac, paraffin, polyvinylpyrrolidone, and combinations thereof.

[0147] Disintegrants include, for example, the above-mentioned starches, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, laminaran powder, sodium bicarbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, or salts thereof.

[0148] Examples of fillers include petrolatum, the aforementioned sugars and / or calcium phosphate.

[0149] Examples of emulsifiers include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.

[0150] Examples of flow regulators and lubricants include silicates, talc, stearates or polyethylene glycol.

[0151] In addition to the above, if necessary, the composition may appropriately contain solubilizers, suspending agents, diluents, dispersing agents, surfactants, soothing agents, stabilizers, absorption promoters, bulking agents, moisturizing agents, humectants, wetting agents, adsorbents, flavoring agents, disintegration inhibitors, coating agents, coloring agents, preservatives, antiseptics, antioxidants, fragrances, flavoring agents, sweeteners, buffers, isotonic agents, and the like, which are commonly used in therapeutic compositions and the like.

[0152] The carrier is used to avoid or suppress the decomposition of the active ingredient by enzymes and the like in the subject's body, as well as to facilitate formulation and administration methods and maintain the dosage form and medicinal efficacy, and may be used appropriately as needed.

[0153] (4) Drug delivery system particles (DDS particles) The therapeutic composition of the present invention may optionally contain DDS particles. DDS particles are particles that encapsulate active ingredients or other carriers, deliver the contents, particularly the active ingredients, to the target site without degradation, and can control the time and quantity of drug distribution in the body. Since the active ingredient of the therapeutic composition of the present invention is a bacterium and must be delivered to the intestine, the use of DDS particles is preferable to protect it from degradation by digestive enzymes and the like in the body after administration. The type of DDS particle is not important.

[0154] 5-2-2. Dosage form The dosage form of the therapeutic composition of the present invention is not particularly limited, as long as it is in a form that allows the active ingredient to be delivered to the target site in the subject's body without being inactivated.

[0155] The specific dosage form varies depending on the application method, which will be described later. The application method can be roughly divided into parenteral administration and oral administration, so a dosage form suitable for each administration method may be used.

[0156] For example, preferred dosage forms include solids (including tablets, capsules, drops, and lozenges), granules, powders, powders, topical preparations (ointments, etc.), topical liquid preparations (injections, etc.), sustained-release preparations, and liquid preparations (including oral solutions, emulsions, and syrups).Solid preparations can be made into dosage forms coated with a coating known in the art, such as sugar-coated tablets, gelatin-encapsulated tablets, enteric-coated tablets, film-coated tablets, double tablets, and multi-layer tablets, as needed.

[0157] The specific shape and size of each of the above dosage forms are not particularly limited as long as they are within the range of dosage forms known in the art. The therapeutic composition of the present invention may be formulated according to a conventional method in the art.

[0158] 5-3. Application method The therapeutic composition of the present invention may be administered orally or parenterally, including nasal, enteral and transmucosal administration.

[0159] Furthermore, the therapeutic composition of the present invention can be used in combination with one or more other known compositions for treating disruption of intestinal flora (dysbiosis). The therapeutic composition of the present invention can also be provided in the form of a supplement or food or drink. [Example]

[0160] <Example 1: Comprehensive analysis of the relationship between diseases associated with eating disorders and the intestinal microbiota> (the purpose) By comprehensively analyzing data on the intestinal microbiota obtained in relation to diseases accompanied by eating disorders, we will identify the intestinal bacteria that are deeply involved in diseases accompanied by eating disorders.

[0161] (method) We performed an integrated analysis of gut microbiota data obtained in previous studies by the present inventors (R. Inoue et al., 2016: DOI:10.1080 / 09168451.2016.1222267; R. Inoue et al., 2017: DOI:10.1080 / 09168451.2017.1383849; R. Inoue et al., 2019: DOI:10.3164 / jcbn.18-105). The methods for obtaining data on the intestinal microbiota in each study are outlined below.

[0162] 1. Data from ASD patients (R. Inoue et al., 2016: hereafter referred to as "Study 1") Feces and blood samples were collected from children aged 3 to 5 years (6 ASD individuals and 6 normal individuals). None of the individuals had any significant intestinal disorders for at least one month prior to the sample collection period, and they were not taking antibiotics or antiallergic drugs.

[0163] ASD was diagnosed as follows: First, individuals were classified according to the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-5). Individuals suspected of having ASD were then diagnosed with ASD using the Japan Autism Society Pervasive Developmental Disorders Rating Scale (PARS) and the Childhood Autism Checklist (M-CHAT).

[0164] Freshly excreted feces were collected aseptically and placed in a sterile container (Stool Cary, Atect) kept at −20°C. The sterile container was transported to the laboratory within 24 hours of excretion and stored at −80°C until further use. Nucleic acid extraction and purification was carried out using 25 mg of feces as follows.

[0165] Nucleic acids were extracted from feces in nucleic acid preservation solution using the QuickGene DNA tissue kit S (Kurabo). First, 25 mg of feces and 250 μL of the MDT buffer included with the kit were added to a 2 mL screw-cap tube containing zirconia beads and mixed. Bacteria were then disrupted using the beads, and 25 μL of EDT buffer was added and incubated at 55°C for 60 minutes. After centrifugation (15,000 × g, 10 minutes), 200 μL of the supernatant was transferred to a microcentrifuge tube. Subsequent procedures were carried out according to the kit's instructions.

[0166] The extracted nucleic acids were used to prepare libraries for DNA sequencing using a MiSeq desktop sequencer (Illumina) according to the manufacturer's protocol. To do this, the V3-4 region of the 16S rRNA gene in each sample was amplified. The amplification reaction was performed by PCR using KAPA HiFi HotStart Ready Mix (Kapa Biosciences, Wilmington). The following primers, 341F (SEQ ID NO: 3) and 806R (SEQ ID NO: 4), were used: Forward primer: 341F primer (SEQ ID NO: 11; 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3') with an overhang adapter for Illumina MiSeq linked to the 5' end. Reverse primer: 806R primer (SEQ ID NO: 12; 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTATCTAATCC-3') with an overhang adapter for Illumina MiSeq linked to the 5' end.

[0167] The amplification products were purified using NucleoFast (R) The DNA was purified using a 96 PCR (Takara Bio) and a second PCR was performed using a KAPA HiFi TM The PCR was performed using HotStart Ready Mix. Each sample was ligated with an adapter sequence consisting of a combination of a double-index sequence (I5 index and I7 index) and an Illumina sequencing adapter. The amplification products of the second PCR were purified and analyzed using SequalPrep. TM The concentrations were normalized using a Normalization Plate Kit (Life Technologies). The normalized amplification products were pooled equally and concentrated using AMPure XP beads (Beckman Coulter).

[0168] The 11 pM library was sequenced using MiSeq with phiX Control v3 (Illumina). Results were further analyzed using MiSeq Reporter. Default parameters were used for these analyses.

[0169] 2. Data from food allergy patients (R. Inoue et al., 2017: hereafter referred to as "Study 2") Feces were collected from children aged 18 months to 6 years and 7 months (four food-allergic individuals and four normal individuals). None of the individuals had taken antibiotics for at least one month prior to the sample collection period.

[0170] Food allergy was diagnosed using clinical symptoms and serum allergen-specific IgE tests. Fecal collection, nucleic acid extraction, sequencing, etc. were performed in the same manner as in Study 1.

[0171] 3. Data from patients with ASD who received dietary fiber (R. Inoue et al., 2019: hereafter referred to as "Study 3") Feces and blood samples were collected from 13 children aged 4 to 9 years old with ASD. None of the children had taken medications to treat constipation or ASD for at least one month prior to the sample collection period.

[0172] All subjects received 6 g of soluble dietary fiber (PHGG) derived from guar beans per day for at least two months. PHGG was administered in food or beverages.

[0173] The parents of all rats recorded weekly defecation frequency from the week immediately prior to the start of PHGG administration to the week immediately prior to the end of PHGG administration. Feces were collected the day before the start of PHGG administration and the day of the end of PHGG administration. Behavioral symptoms were scored using the Abnormal Behavior Checklist (Japanese version, ABC-J) at the same time as feces collection. ASD diagnosis, fecal collection, nucleic acid extraction, sequencing, etc. were performed in the same manner as in Study 1.

[0174] 4. Integrated analysis of gut bacteria Linear discriminant analysis for Studies 1 and 2 was performed using the statistical software JMP Pro (version 17.2). Bacterial species were classified based on the Greengenes2 (2022.10) database. The confidence level for identifying bacterial genera was set at 0.7.

[0175] Comparisons of the proportions of Blautia A_141781 between populations were performed using the Wilcoxon rank-sum test with the statistical software R (version 4.1.2). Comparisons of the proportions of Blautia A_141781 before and after PHGG administration were performed using the Wilcoxon signed-rank test. A significance level of p = 0.05 was used.

[0176] (result) The results are shown in Figures 1 and 2. Linear discriminant analysis identified the genus Blautia A_141781 as a bacterium whose abundance in the intestinal microbiota is highly correlated with the presence or absence of disease in both studies. Generally, a tendency for the proportion of Blautia A_141781 to be higher in normal populations was suggested, and the log (log ) derived from the ratio of the intraclass variation in normal populations to the interclass variation in diseased populations was 10 The LDA value was extremely high at approximately 4.5, indicating that the proportion of Blautia A_141781 bacteria is an indicator for distinguishing between normal and diseased populations with extremely high accuracy.

[0177] When the proportion of Blautia A_141781 bacteria was compared between the results of each population in Studies 1 and 2, the proportion of Blautia A_141781 bacteria was consistently and significantly lower in both ASD and food allergy patients compared to normal individuals (Figure 1).

[0178] Furthermore, the proportion of Blautia A_141781 bacteria was compared before and after PHGG administration in the data from Study 3. The proportion of Blautia A_141781 bacteria significantly increased after PHGG administration (Figure 2). Study 3 demonstrated that PHGG administration significantly increased the number of bowel movements in ASD individuals, improving constipation tendencies, and significantly reduced irritability scores and inflammatory symptoms, which indicate excited behavior. Therefore, the proportion of Blautia A_141781 bacteria was strongly correlated not only with the presence or absence of the disease, but also with its severity.

[0179] Although food allergies and ASD may at first glance seem to have little to do with each other, food allergies are known to cause a tendency toward picky eating due to the inability to ingest foods containing allergens, and individuals with ASD are also known to have a tendency toward picky eating. Therefore, it was suggested that the presence or absence of disorders associated with eating disorders and their severity are strongly correlated with the proportion of Blautia A_141781 bacteria.

[0180] Example 2: Analysis of the relationship between severe physical and mental disabilities and the ratio of Blautia A_141781 bacteria (the purpose) We investigate the relationship between severe physical and mental disorders, known as disorders accompanied by eating disorders such as picky eating, and the proportion of Blautia A_141781 bacteria.

[0181] (method) The following tests were approved by the ethics committees of Kyoto University, Setsunan University, and Todaiji Welfare and Rehabilitation Hospital, and written informed consent was obtained from the guardians of the children to use fecal and blood samples for research purposes. Furthermore, the tests were conducted while maintaining the personal information of the children.

[0182] As samples, feces were collected from children aged 2 to 12 years (13 severely mentally and physically disabled individuals and 13 normal individuals (typically developing individuals)).

[0183] The diagnosis of severe physical and mental disability was made at Todaiji Welfare and Rehabilitation Hospital based on Oshima's classification. Fecal collection, nucleic acid extraction, sequencing, etc. were performed in the same manner as in Study 1.

[0184] The extracted nucleic acids were also analyzed by real-time PCR using a LightCycler 480 (Roche). Primers and probes for the Jag / EloR gene were used. The primers, probes, and amplification conditions used were as follows: Forward primer for Blautia wexlerae: GCCAAAAGAGAAACAAGTCAGAGAA (SEQ ID NO: 5); Reverse primer for Blautia wexlerae: GACGCAAATACATCACGAAGGAATA (SEQ ID NO: 6); Forward primer for Blautia luti: CATAGCGTGTCCAGTTCCGAAAG (SEQ ID NO: 7); Reverse primer for Blautia luti: GACCATTTTTGCAAGCTGGTACTGT (SEQ ID NO: 8); Amplification conditions: initial denaturation: 95°C, 30 seconds; (denaturation: 95°C, 5 seconds; annealing and extension reaction: 60°C, 30 seconds) x 40 cycles.

[0185] The total amount of bacterial nucleic acid was measured using the following primers and probe: Forward primer for total nucleic acid: GGTGAATACGTTCCCGG (SEQ ID NO: 9); Reverse primer for total nucleic acid: TACGGCTACCTTGTTACGACTT (SEQ ID NO: 10).

[0186] (result) The results are shown in Figure 3. When the proportion of Blautia A_141781 bacteria was compared between normal individuals (typically developing individuals) and individuals with severe physical and mental disabilities, the proportion of Blautia A_141781 bacteria was significantly lower than in normal individuals, as was the case in ASD and food allergies (Figure 3).

[0187] These results confirmed that there is a strong correlation between the presence or absence of diseases associated with eating disorders in children and the severity of the diseases and the proportion of Blautia A_141781 bacteria.

[0188] <Example 3: Identification of species of bacteria belonging to the genus Blautia A_141781> (the purpose) To identify the detailed classification of the genus Blautia A_141781, whose abundance has been shown to be strongly associated with disorders involving eating disorders such as picky eating.

[0189] (method) Bacteria belonging to the genus Blautia A_141781 registered in the Greengenes2 database were searched for those exhibiting the same behavior as in Examples 1 and 2, using amplicon sequence variants (ASVs) as taxonomic units.

[0190] The search was carried out by linear discriminant analysis of the data from Studies 1 to 3 and Example 2 for ASV belonging to the genus Blautia A_141781, and log 10 For ASVs with an (LDA) value of 3 or more, the abundance ratios of each population were compared in the same manner as in Examples 1 and 2, and ASVs exhibiting similar behavior to Examples 1 and 2 were identified.

[0191] (result) The results are shown in Figure 4. Among the bacteria of the genus Blautia A_141781, a bacterium closely related to the bacteria Blautia wexlerae and Blautia luti and having a 16S rRNA gene containing the base sequence shown in SEQ ID NO: 13 (hereinafter referred to as "bacterium 38f") was identified as an ASV that behaves similarly to Examples 1 and 2.

[0192] As with the Blautia A_141781 genus, the proportion of 38f bacteria was significantly lower in food-allergic and ASD individuals compared to normal individuals (Fig. 4A), increased with PHGG administration (Fig. 4B), and was also significantly lower in severely mentally and physically disabled individuals compared to normal individuals (typically developing individuals) (Fig. 4C).

[0193] These results suggest that the predominant bacterium in the Blautia A_141781 genus, which is strongly correlated with the presence and severity of eating disorders in children, is bacterium 38f.

[0194] Example 4: Analysis of the relationship between bacteria 38f and fecal organic acid concentrations (the purpose) Analyze the relationship between bacterial 38f and fecal organic acid concentrations.

[0195] (method) As samples from children, feces were collected from 59 children aged 2 to 12 years (23 severely physically and mentally disabled children, constipated children, individuals with abnormal CBCL values, and 36 normal individuals).

[0196] Feces were collected from 81 adult individuals aged 19 to 25 years (56 individuals with diarrhea or loose stools, 2 individuals with constipation, and 23 individuals with normal stools). None of the individuals had taken antibiotics for at least one month prior to the sample collection period.

[0197] The diagnosis of CBCL abnormalities was based on the Child Behavior Checklist (CBCL: version 1.5-5 or 6-18) administered to all individuals (children and adults). Individuals scoring 60 or above on the CBCL were diagnosed as abnormal.

[0198] Diagnosis of constipation in children was based on an interview with the child or guardian. Based on the Bristol Stool Form Scale, a score of "1" was considered constipation. Diagnosis of constipation in adults was based on the moisture content of the stool, with diarrhea being considered when the moisture content of the stool was 78% or more and constipation being considered when the moisture content was 68.5% or less.

[0199] Fecal organic acid concentrations were measured by high-performance liquid chromatography (HPLC) according to the method described by Tsukahara et al. (2014) (DOI: 10.1111 / asj.12188). A sample suspension was prepared by diluting 0.5–1 g of collected feces three times with distilled water, and an LC-10 series (Shimadzu Corporation) HPLC system was used. The values ​​for acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid, and valeric acid were used as the total amount of volatile organic acids.

[0200] The concentrations of total volatile organic acids and acetic acid were calculated as molar concentrations relative to the volume of the sample. Fecal collection, nucleic acid extraction, sequencing, etc. were performed in the same manner as in Study 1.

[0201] The correlation between the abundance of bacteria 38f and the concentration of organic acids in feces was determined using the statistical software R by linear regression analysis and Spearman rank correlation test.

[0202] (result) The results are shown in Figures 5 and 6. In children, acetic acid concentration (Fig. 5A) and total volatile organic acid concentration (Fig. 5B) were significantly positively correlated with the abundance of bacteria 38f (p=0.01, p=0.03, respectively).

[0203] On the other hand, in adult individuals, neither the acetic acid concentration (FIG. 6A) nor the total volatile organic acid concentration (FIG. 6B) showed a significant correlation with the abundance of bacterium 38f (p=0.32, p=0.29, respectively).

[0204] These results suggest that the abundance of bacteria 38f is closely related to the concentration of organic acids in feces only in children.

[0205] <Example 5: Analysis of the possibility of diagnosing various diseases> (the purpose) We will examine whether it is possible to diagnose the disease based on the ratio of bacteria present for each type of disease.

[0206] (method) The correlation between the abundance ratio of Blautia bacteria and the abundance ratio of 38f bacteria was analyzed by drawing a linear approximation line in Excel based on the data obtained in Examples 1 and 2.

[0207] In addition, ROC analysis was performed using the statistical software JMP pro (version 17.2) to calculate the cutoff value for distinguishing between normal and diseased individuals.

[0208] (result) The results are shown in Figures 7 and 8 and Table 1. The abundance ratio of Blautia bacteria showed a very high correlation with the abundance ratio of bacterium 38f.

[0209] Therefore, we analyzed whether it is possible to determine diseased individuals based on the abundance ratio of Blautia bacteria by calculating a cutoff value.

[0210] As shown in Figures 7 and 8, the abundance ratio of Blautia bacteria behaved similarly to that of bacterium 38f. Furthermore, even among individuals classified as normal, the abundance ratio of Blautia bacteria tended to decrease in individuals that showed abnormal values ​​on the Child Behavior Checklist (CBCL) ("Abnormal behavior" in Figure 8) or constipated individuals ("Constipation" in Figure 8).

[0211] [Table 1]

[0212] The ROC curve based on the abundance ratio of Blautia bacteria demonstrated high discrimination ability between the presence and absence of disease, with an AUC (area under curve) of 0.80, indicating reliability. The cutoff value with the highest sensitivity-(1-specificity) value, which indicates accuracy of determination, was 0.0570761 (corresponding to the position of the lower black circle for "ASD (pre-administration)" in Figure 8). This cutoff value demonstrated that diseased individuals could be discriminated with a sensitivity of 0.78 and a specificity of 0.67. Furthermore, the cutoff value with a sensitivity of 0.8 was 0.0620042 (corresponding to the position of the upper black circle for "ASD (pre-administration)" in Figure 8), and the extremely high specificity of 0.96 was 0.0222935 (corresponding to the position of the black circle for "constipation" in Figure 8). Regardless of the cutoff value used, diseased individuals could be discriminated with high accuracy.

[0213] <Example 6: Identification of the species name of bacterium 38f> (the purpose) The species name of bacterium 38f is identified based on the correlation between the abundance ratio of bacterium 38f and the abundance ratio of closely related species.

[0214] (method) Based on the data on the abundance ratios of Blautia wexlerae and Blautia luti obtained in Example 3 based on the real-time PCR method and the data on the abundance ratios obtained by metagenomic analysis in Studies 1 to 3 and Example 3, the correlation was analyzed by drawing a linear approximation line in Excel.

[0215] (result) The results are shown in Figure 9. Among the bacterial species closely related to bacterium 38f, the abundance ratio of bacterium 38f was strongly correlated with Blautia wexlerae (Figure 9A). On the other hand, the abundance ratio of bacterium 38f was not correlated with Blautia luti (R value = 0.34). This result was similar to the correlation between the abundance ratio of Blautia bacteria and the abundance ratio of Blautia luti (R value = 0.38).

[0216] This suggested that bacterium 38f was Blautia wexlerae.

[0217] In addition, Blautia wexlerae was strongly correlated with the abundance ratio of Blautia bacteria (Figure 9B). Based on this relationship, the cutoff value based on the abundance ratio of Blautia wexlerae was calculated, as shown in Table 2.

[0218] [Table 2]

[0219] These results suggest that the presence and severity of diseases associated with eating disorders can be detected with high accuracy based on the abundance ratio of Blautia wexlerae.

Claims

1. A method for determining the risk of developing and / or the severity of a disease associated with an eating disorder in an individual from infancy to under 18 years of age, comprising: a nucleic acid extraction step of extracting nucleic acid from feces derived from the individual; and a measuring step of measuring the ratio of nucleic acid derived from Blautia wexlerae to total nucleic acid derived from bacteria based on the sequence information of the nucleic acid; Including, A ratio lower than a predetermined reference value indicates a high risk of developing and / or a high severity of the disease in the individual. The method.

2. The method of claim 1, wherein the nucleic acid is a 16S rRNA gene and / or an RNA-binding protein gene.

3. The method of claim 2, wherein the RNA-binding protein gene is an elongasome regulatory protein gene.

4. The method according to any one of claims 1 to 3, wherein the disease comprises one or more selected from the group consisting of developmental disorders, food allergies, severe physical and mental disabilities, constipation, and diarrhea.

5. A kit for determining the risk of developing and / or the severity of a disease associated with an eating disorder in individuals from infancy to under 18 years of age, comprising a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acid derived from Blautia wexlerae.

6. The kit according to claim 5 , further comprising a primer set for amplifying a 16S rRNA gene and / or an RNA-binding protein gene.

7. A device for determining the risk of developing and / or the severity of a disease associated with an eating disorder in individuals from infancy to under 18 years of age, comprising a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acid derived from Blautia wexlerae.

8. A biomarker for disorders associated with eating disorders in individuals from infancy to under 18 years of age, consisting of nucleic acids derived from Blautia wexlerae.

9. A composition for treating diseases involving eating disorders in individuals from infancy to under 18 years of age, comprising Blautia wexlerae.

Images