Loss-of-function transcription factor-like genes and inbreeding fagopyrum plants using the same

Abstract

To provide function-deficient transcription factor-like genes and inbreeding Fagopyrum plants using the same.SOLUTION: The function of transcription factor-like genes formed by a group of linked genes governing the length of the male core and the female core of a Fagopyrum plant identified from the result of decoding the genome sequence of the Fagopyrum plant is deleted by mutation induction to produce S-ELF3-PS1 genes which are function-deficient transcription factor-like genes, and an individual having the S-ELF3-PS1 inbreeding genes is cross-cultivated to grow a inbreeding Fagopyrum plant having long male core and female core.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to a loss-of-function transcription factor-like gene and an inseparable buckwheat plant utilizing the same, and more particularly to an inseparable buckwheat plant capable of selfing. [Background technology]

[0002] The genomes of higher organisms contain regions where recombination is highly suppressed, allowing genes controlling multiple distinct traits to form a single gene cluster (supergene), and only specific combinations of traits are observed as complex adaptive traits within a population or species.

[0003] For example, in the bistyled angiosperm buckwheat, a group of linked genes controlling self-incompatibility and the length of the male and female cores forms a SELF-INCOMPATIBILITY locus supergene (S-supergene), which has successfully increased the efficiency of outcrossing.

[0004] As shown in Figure 12, in bistyle plants, there are individuals within a species with a flower type that has a short pistil and a long male core (short style flowers) and individuals with a flower type that has a long pistil and a short male core (long style flowers).The heights of the anthers and stigmas of short style flowers and long style flowers are the same, which increases the pollination efficiency between compatible matings via flower-visiting insects.

[0005] As such, buckwheat plants have both short-styled and long-styled flowers, and pollination between compatible flowers occurs via pollinating insects, resulting in poor pollination efficiency and low yields.

[0006] The use of loss-of-function genes to improve the yield of bistyle plants such as Fagopyrum has attracted attention, and a prior art technique for this is disclosed in Patent Document 1. However, no such technique is known for Fagopyrum plants. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] WO2014 / 115680 publication Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide a loss-of-function transcription factor-like gene and a self-pollinating Fagopyrum plant utilizing the same.

[0009] The S-supergene in buckwheat plants has two alleles, the S and s haplotypes. Short-styled individuals have the S / s genotype, while long-styled individuals have the s / s genotype. The inventors have successfully identified a transcription factor-like gene (S-LOCUS EARLY FLOWERING 3, S-ELF3) that is thought to be one of the components of the S-supergene (Yasui et al. 2012) (Yasui Y, Mori M, Aii J, Abe T, Matsumoto D, et al. (2012) S-LOCUS EARLY FLOWERING 3 Is Exclusively Present in the Genomes of Short-Styled Buckwheat Plants that Exhibit Heteromorphic Self-Incompatibility. PLOS ONE 7(2): e31264. https: / / doi.org / 10.1371 / journal.pone.0031264.).

[0010] This gene was present only in short-styled individuals with the S haplotype, but not in long-styled individuals lacking the S haplotype, suggesting that S-ELF3 plays an important role in controlling the short-style flower trait, but the exact role remained unknown.

[0011] To clarify the function of the S-ELF3 gene and further develop self-fertilizing buckwheat plants that lack bistyle, we developed the S-ELF3-PS1 gene, which encodes a non-functional S-ELF3 protein, using EMS. Buckwheat plants carrying the S-ELF3-PS1 gene are capable of self-fertilization, and we developed self-fertilizing buckwheat plants using this gene. [Means for solving the problem]

[0012] The function-deficient transcription factor-like gene of the invention of claim 1 is characterized in that it is produced by identifying a transcription factor-like gene formed by a group of linked genes that control the length of the male and female cores of Fagopyrum plants from the results of decoding the genome sequence of Fagopyrum plants, and by deleting the function of this identified transcription factor-like gene through mutation induction.

[0013] The invention of claim 2 is characterized in that, in the invention described in claim 1, the transcription factor-like gene is the S-ELF3 gene, which is present only in short-style individuals with the S haplotype and is not present in long-style individuals without the S haplotype.

[0014] The invention of claim 3 is characterized in that, in the invention of claim 1, the mutation induction generates the S-ELF3-PS1 gene by deleting the function of the transcription factor-like gene by treatment with ethyl methanesulfonate.

[0015] The invention of claim 4 is characterized in that, in the invention described in claim 3, the S-ELF3-PS1 gene has the splicing site of the third intron, which corresponds to the 3046th base of the genomic sequence of the S-ELF3 gene, modified from G to A, and the codons 2976-2978 become new stop codons.

[0016] The invention of claim 5 is characterized in that the function of a transcription factor-like gene formed by a group of linked genes that control the length of the male and female cores of buckwheat plants, identified from the results of decoding the genome sequence of buckwheat plants, is deleted through mutation induction to generate the S-ELF3-PS1 gene, which is a functionally defective transcription factor-like gene, and individuals having this S-ELF3-PS1 gene are cultivated by cross-breeding and cultivating them.

[0017] The invention of claim 6 is characterized in that, in the invention described in claim 5, the hybrid cultivation is carried out by crossing an individual having the S-ELF3-PS1 gene with an individual with long-style flowers, and separating individuals with long male and female cores. [Effects of the Invention]

[0018] According to the present invention, the function of a transcription factor-like gene formed by a group of linked genes that control the length of the male and female cores in buckwheat plants, identified from the results of decoding the genome sequence of buckwheat plants, is deleted by inducing mutation to generate the S-ELF3-PS1 gene, which is a function-deficient transcription factor-like gene, and an indeterminate buckwheat plant is obtained by cross-breeding and cultivating an individual having this S-ELF3-PS1 gene, thereby achieving the effect of providing an indeterminate buckwheat plant that can produce a high yield. [Brief explanation of the drawings]

[0019] [Figure 1] FIG. 1 shows the genomic base sequence of the normal S-ELF3 gene (SEQ ID NO: 1). [Figure 2] FIG. 2 shows the genomic base sequence of the normal S-ELF3 gene (SEQ ID NO: 1). [Figure 3] FIG. 3 shows the genomic base sequence of the normal S-ELF3 gene (SEQ ID NO: 1). [Figure 4] FIG. 4 shows the genomic base sequence of the normal S-ELF3 gene (SEQ ID NO: 1). [Figure 5] FIG. 5 shows the genomic base sequence of the normal S-ELF3 gene (SEQ ID NO: 1). [Figure 6] FIG. 6 shows the genomic base sequence (SEQ ID NO: 2) of the mutant S-ELF3-PS1 gene generated in the present invention. [Figure 7] FIG. 7 shows the genomic base sequence (SEQ ID NO: 2) of the mutant S-ELF3-PS1 gene generated in the present invention. [Figure 8] FIG. 8 shows the genomic base sequence (SEQ ID NO: 2) of the mutant S-ELF3-PS1 gene generated in the present invention. [Figure 9] FIG. 9 shows the genomic base sequence (SEQ ID NO: 2) of the mutant S-ELF3-PS1 gene generated in the present invention. [Figure 10] FIG. 10 shows the genomic base sequence (SEQ ID NO: 2) of the mutant S-ELF3-PS1 gene generated in the present invention. [Figure 11] FIG. 11 is a photograph showing a Fagopyrum plant produced according to the present invention. [Figure 12] FIG. 11 is a photograph illustrating pollination between compatible plants of the genus Buckwheat. DETAILED DESCRIPTION OF THE INVENTION

[0020] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings.

[0021] First, we cultivate a mutant population in which the function of the S-ELF3 gene, a transcription factor-like gene, is deleted.

[0022] Mutation induction population development To eliminate the function of S-ELF3, we performed mutagenesis using EMS (ethyl methanesulfonate). Approximately 4,600 seeds were treated with 0.33% EMS (ethyl methanesulfonate) for 15 hours and cultivated at the Kyoto University Farm. Three to six seeds were harvested from each plant, yielding 7,490 seeds. These seeds were then treated with 0.6% EMS for 15 hours, and finally, seeds were harvested from 2,710 plants. One to two seeds were harvested per plant. These seeds were sown and cultivated at the Kyoto University Farm, and seeds were collected individually from 3,336 plants. Furthermore, DNA was extracted from equal amounts of leaves from 12 plants during cultivation, resulting in 278 DNA bulks (12 plants x 278 bulks = 3,336).

[0023] Next, we will explain the method for developing S-ELF3-PS1, a loss-of-function transcription factor-like gene, by utilizing mutation detection of the S-ELF3 gene.

[0024] Development of S-ELF3-PS1 using mutation detection PCR primers for S-ELF3 were designed, and PCR amplification was performed using 278 DNA bulk as a template under the following conditions.

[0025] 98 degrees 2 minutes, (98 degrees 10 seconds, 58 degrees 5 seconds, 72 degrees 90 seconds) x 30 times, 72 degrees 5 seconds The PCR primers are as follows: TILL-2NEW_S-ELF3-RH_Fw, TGGGCTTCCATATTTTTAATCGTC TILL-2NEW_S-ELF3-RH_Rv, GTAAGTCCTCAAAAGGGCAAATGA After PCR, the PCR products were bulk-prepared into libraries using the Nextera XT DNA Library Prep kit (Illumina), and sequence reads were obtained using Hiseq X (Illumina). Reads were then cleaned using trimmomatic 0.3.2 and mapped to the reference sequence (S-ELF3 sequence) using BWA (Li and Durbin, 2009) (Fast and accurate short read alignment with Burrows-Wheeler transform, Bioinformatics, 25, 1754–1760.).

[0026] The sequences were then processed (BAM conversion, sorting, and mpileup) using samtools (Li et al., 2009) (The Sequence Alignment / Map format and SAMtools, Bioinformatics, 25, 2078-2079.), Vcf generation was performed using VarScan (Koboldt et al., 2009) (VarScan: variant detection in massively parallel sequencing of individual and pooled samples. Bioinformatics (Oxford, England), 25, 2283-2285 PMID: 19542151), and mutation detection was performed using SnpEff (Cingolani et al., 2012) (A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3.).

[0027] As a result, as shown in bold and underlined in Figure 9, the splicing site of the third intron, which corresponds to the 3046th base in the genomic sequence of S-ELF3, was modified from G to A, thereby developing the S-ELF3-PS1 gene.

[0028] In the S-ELF3-PS1 gene, the third intron remains in the mRNA without being spliced, as shown in bold and underlined in Figure 9, resulting in new stop codons at positions 2976-2978, which is thought to result in loss of function of the S-ELF3-PS1 protein.

[0029] Figures 1 to 5 show the genomic sequence of the normal S-ELF3 gene, and Figures 6 to 10 show the genomic sequence of the mutant S-ELF3-PS1 gene generated by the present invention. In Figures 1 to 10, the sequences of internal introns are shown in lowercase letters, and the positions of mutations and new stop codons generated due to the inability to splice are shown in bold and underlined.

[0030] Next, a method for developing an inseminate buckwheat plant (inseminate buckwheat) using the S-ELF3-PS1 gene will be described.

[0031] Development of self-fertilizing buckwheat When the flowers of buckwheat individuals carrying the S-ELF3-PS1 gene were examined, both the staminate core 20 and the pistil 10 were found to be longer, as shown in Figure 11. Figure 11(A) is an enlarged photograph of a flower of an inseminate buckwheat plant carrying the S-ELF3-PS1 gene, and Figure 11(B) shows the vigorous self-pollination of a flower of an inseminate buckwheat plant carrying the S-ELF3-PS1 gene.

[0032] Furthermore, this individual produced self-fertilized seeds. Because this individual possessed the S-haplotype, it should have been a short-styled individual. However, the presence of the S-ELF3-PS1 gene resulted in a longer pistil, which is thought to have led to self-fertilization. This suggests that the S-ELF3-PS1 gene converted both the long pistil length and self-incompatibility traits of short-styled flowers into a long-styled pistil.

[0033] When a self-pollinating individual with long male and female cores (genotype: S-ELF3-PS1 / s) heterozygous for the S-ELF3-PS1 gene was crossed with a self-incompatible individual with long styled flowers (genotype: s / s), 13 self-pollinating individuals with long male and female cores and 28 long-styled individuals were obtained in the next generation. All 13 self-pollinating individuals with long male and female cores possessed S-ELF3-PS1, while all 28 self-incompatible individuals with long styled flowers did not possess S-ELF3-PS1.

[0034] By retaining the S-ELF3-PS1 gene in this way, we were able to develop inbred buckwheat. The genotype was determined by PCR amplification of the S-ELF3-PS1 gene under the above conditions. The mutation site in the amplified S-ELF3-PS1 gene was confirmed by the Sanger method. The following primers were used for the Sanger method.

[0035] S-ELF3_Fw3004_seq, GCAAAGGATCTTCTCGATTCA The present invention is not limited to the above-described embodiments, and many modifications can be made by those skilled in the art using their ordinary creative abilities within the scope of the technical concept of the present invention. [Explanation of symbols]

[0036] 10...Female core 20…male core

Claims

1. From the results of the genome sequence of buckwheat plants, a transcription factor-like gene that forms a linked gene group that controls the length of the male and female cores of buckwheat plants was identified. A loss-of-function transcription factor-like gene is produced by deleting the function of the identified transcription factor-like gene through mutation induction.

2. The transcription factor-like gene is The S-ELF3 gene is present only in short-style individuals with the S haplotype, but is absent in long-style individuals without the S haplotype. The loss-of-function transcription factor-like gene according to claim 1 .

3. The mutagenesis may be The function of the transcription factor-like gene is deleted by ethyl methanesulfonate treatment to generate the S-ELF3-PS1 gene. The loss-of-function transcription factor-like gene according to claim 1 .

4. The S-ELF3-PS1 gene is The splicing site of the third intron, which corresponds to base 3046 of the genomic sequence of the S-ELF3 gene, was changed from G to A, and the codons at positions 2976-2978 became new stop codons. The loss-of-function transcription factor-like gene according to claim 3 .

5. The function of a transcription factor-like gene formed by a linked gene group that controls the length of the male and female cores of buckwheat plants, identified from the results of decoding the buckwheat genome sequence, was eliminated by inducing mutation to generate the S-ELF3-PS1 gene, a loss-of-function transcription factor-like gene. This S-ELF3-PS1 inbred gene was cultivated by cross-breeding and cultivating the individual. A self-pollinating buckwheat plant characterized by:

6. The hybrid cultivation is The plant is cultivated by crossing an individual having the S-ELF3-PS1 gene with an individual with long-style flowers, and then separating individuals with long male and female cores. The self-pollinating buckwheat plant according to claim 5.

Images