Methods and compositions for restoring STMN2 levels
Antisense oligonucleotides targeting STMN2 mRNA sequences increase STMN2 protein expression, addressing the limitations of current ALS and FTD treatments by enhancing neuronal health and reducing disease likelihood.
Patent Information
- Application Number
- JP2025181104
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-01-04
- Filing Date
- 2025-10-27
- Publication Date
- 2026-02-18
AI Technical Summary
Current treatments for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are limited, with no effective therapies available for ALS and only modestly effective drugs for FTD, and the underlying molecular pathways for these diseases remain unclear.
The use of antisense oligonucleotides that specifically bind to STMN2 mRNA, pre-mRNA, or nascent RNA sequences to inhibit or prevent defective or altered STMN2 RNA sequences, thereby increasing STMN2 protein expression, which is regulated by TDP-43, a protein implicated in these diseases.
The approach enhances STMN2 protein levels, potentially improving neuronal growth and repair, and may treat or reduce the likelihood of neurodegenerative diseases such as ALS, FTD, inclusion body myositis, Parkinson's disease, Alzheimer's disease, and traumatic brain injury by correcting reduced TDP-43 functionality.
Smart Images

Figure 2026027295000005 
Figure 2026027295000006 
Figure 2026027295000007
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 133,749, filed January 4, 2021, U.S. Provisional Patent Application No. 63 / 063,174, filed August 7, 2020, and U.S. Provisional Patent Application No. 62 / 994,797, filed March 25, 2020, the entire teachings of which are incorporated herein by reference. [Background technology]
[0002] Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by the selective loss of both upper and lower motor neurons (1). Patients with ALS experience progressive paralysis and develop difficulty speaking, swallowing, and eventually breathing (2, 3). They usually die from the disease 1–5 years after diagnosis. With the exception of two FDA-approved drugs that modestly modify disease progression (4), treatment for ALS is limited to supportive care. ALS is now recognized as lying on the same clinical and pathological spectrum as frontotemporal dementia (FTD), the most common cause of presenile dementia. FTD is characterized by behavioral changes, language impairment, and loss of executive function, for which no effective treatment exists (5). While the etiology of most ALS and FTD cases remains unknown, pathological findings and family-based linkage studies have demonstrated overlapping molecular pathways involved in both diseases (1, 6). [Prior art documents] [Non-patent literature]
[0003] [Non-Patent Document 1] Klim JR,Williams LA,Limone F,San Juan War I,Davis-Dusenbery BN,Mordes DA,Burberry A,Steinbaugh MJ,Gamage KK,Kirchner R,Moccia R,Cassel SH,Chen K,Wainger BJ,Woolf CJ,Eggan K.Levels of ALS-implicated protein TDP-43 sustains Nat Neurosci.2019;22(2):167-79.Epub 2019 / 01 / 16.doi:10.1038 / s41593-018-0300-4.PubMed PMID:30643292.
Outdoor Tool2
Outdoor Tools3
Outdoor Tools 4
Non-Patent Document No. 5
Summary of the Invention
Means for Solving the Problems
[0004] TDP-43 is a primarily nuclear DNA / RNA-binding protein with functional roles in transcriptional regulation, splicing, pre-microRNA processing, stress granule formation, and messenger RNA transport and stability. TDP-43 has been found to be a major component of inclusion bodies in many sporadic cases of ALS and FTD. Decreased STMN2 levels are observed in response to abnormal TDP-43 expression. STMN2, also known as SCG10, has been shown to be a regulator of microtubule stability and encodes a protein required for normal human motor neuron growth and repair. Described herein are methods and compositions for restoring or increasing STMN2 levels. Disclosed herein are antisense oligonucleotides that specifically bind to the STMN2 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence, thereby inhibiting or preventing the inclusion of defective or altered STMN2 RNA sequences. In some embodiments, the antisense oligonucleotides do not bind to the polyadenylation site of the STMN2 RNA sequence. In some embodiments, defective or altered STMN2 RNA sequences occur and are abundant when TDP-43 function is reduced or a TDP pathology is present.
[0005] Also disclosed herein are antisense oligonucleotides that specifically bind to an STMN2 mRNA, pre-mRNA, or nascent RNA sequence encoding a cryptic exon, thereby inhibiting or preventing the inclusion of the cryptic exon into STMN2 RNA, but do not bind to the polyadenylation site of the STMN2 mRNA, pre-mRNA, or nascent RNA sequence.
[0006] Further disclosed herein are antisense oligonucleotides that specifically bind to STMN2 mRNA, pre-mRNA, or nascent RNA sequences and increase STMN2 protein expression.
[0007] In some embodiments, the antisense oligonucleotide is designed to target the 5' splice site, the 3' splice site, or the normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide targets one or more splice sites. In some embodiments, the antisense oligonucleotide is designed to target the single-stranded region located between the TDP-43 binding site and the polyadenylation site.
[0008] In some embodiments, the antisense oligonucleotide does not exhibit platelet toxicity.
[0009] Also disclosed herein are antisense oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NOs: 37-85. In some aspects, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 40, 47, 48, 49, 50, 52, 53, 54, 56, and 78, or more specifically, the antisense oligonucleotide may comprise SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 53, 72, and 73, or more specifically, the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
[0010] Further disclosed herein are pharmaceutical compositions comprising one or more antisense oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NOs: 37-85. In some embodiments, the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some embodiments, the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 40, 47, 48, 49, 50, 52, 53, 54, 56, and 78, or more specifically, the one or more antisense oligonucleotides may comprise SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 53, 72, and 73, or more specifically, the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
[0011] Disclosed herein are pharmaceutical compositions comprising multimeric oligonucleotides. The multimeric oligonucleotides comprise one or more sequences selected from the group consisting of SEQ ID NOs: 37-85. In some embodiments, the multimeric oligonucleotides comprise two or more sequences selected from the group consisting of SEQ ID NOs: 37-85. The multimeric oligonucleotides may comprise multiple copies of a sequence, or alternatively may comprise a single copy of multiple sequences.
[0012] In some embodiments, the antisense oligonucleotide suppresses or prevents the inclusion of a cryptic exon in STMN2 RNA. In some embodiments, the antisense oligonucleotide specifically binds, for example, to an STMN2 RNA sequence, pre-mRNA sequence, or nascent RNA sequence encoding the cryptic exon. In some embodiments, the antisense oligonucleotide prevents or delays degradation of STMN2 protein. In some embodiments, the antisense oligonucleotide increases STMN2 protein. In some embodiments, the antisense oligonucleotide is designed to target the 5' splice site, the 3' splice site, or the normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target a single-stranded region, for example, a single-stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide is designed to target a site proximal to a cryptic splice site, a site proximal to an early polyadenylation site, or a site located between a cryptic splice site and an early polyadenylation site. In some embodiments, the antisense oligonucleotide binds to a target region within an unstructured cryptic exon. In some embodiments, the antisense oligonucleotide binds near or adjacent to a 5' splice site regulated by TDP-43. In some embodiments, the antisense oligonucleotide targets a region proximal to a predicted TDP-43 binding site. In some embodiments, the antisense oligonucleotide targets a normal binding site for TDP-43. In some embodiments, the antisense oligonucleotide targets one or more splice sites. In some embodiments, the antisense oligonucleotide inhibits cryptic splicing.
[0013] In some embodiments, the pharmaceutical composition comprises two or more antisense oligonucleotides, and in some aspects, three or more antisense oligonucleotides. In some embodiments, the two or more antisense oligonucleotides are covalently linked. In some embodiments, one or more antisense oligonucleotides increases STMN2 protein expression.
[0014] In some embodiments, the pharmaceutical composition further comprises an agent for treating a neurodegenerative disease, an agent for treating traumatic brain injury, or an agent for treating proteasome inhibitor-induced neuropathy. In some embodiments, the pharmaceutical composition further comprises STMN2 as a gene therapy agent. In some embodiments, the pharmaceutical composition further comprises a JNK inhibitor.
[0015] Also disclosed herein is a method for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in a subject's neuronal cells in need thereof. The method can include contacting the neuronal cells with an antisense oligonucleotide that corrects the reduction in STMN2 protein levels, wherein the agent does not target the polyadenylation site of the target transcript.
[0016] Further disclosed herein is a method for treating or reducing the likelihood of a disease or condition associated with impaired TAR DNA-binding protein 43 (TDP-43) functionality in a neuronal cell of a subject in need thereof, which may include contacting the neuronal cell with an antisense oligonucleotide that increases STMN2 protein expression.
[0017] In some embodiments, the antisense oligonucleotide specifically binds to the STMN2 RNA sequence, pre-RNA sequence, or nascent RNA sequence encoding the cryptic exon. In some embodiments, the antisense oligonucleotide is designed to target the 5' splice site, 3' splice site, or normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target a single-stranded region, for example, a single-stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide is designed to target a site proximal to a cryptic splice site, a site proximal to a premature polyadenylation site, or a site located between a cryptic splice site and a premature polyadenylation site. In some embodiments, the antisense oligonucleotide binds to a target region within an unstructured cryptic exon. In some embodiments, the antisense oligonucleotide binds near or adjacent to a 5' splice site regulated by TDP-43. In some embodiments, the antisense oligonucleotide targets the proximal region of the predicted TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target one or more splice sites. In some embodiments, the antisense oligonucleotide restores normal length or protein-coding STMN2 pre-mRNA or mRNA.
[0018] In some embodiments, the subject exhibits improved neuronal growth and repair. In some embodiments, the disease or condition is a neurodegenerative disease, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, or Alzheimer's disease. In some embodiments, the disease or condition is traumatic brain injury. In some embodiments, the disease or condition is proteasome inhibitor-induced neuropathy. In some embodiments, the disease or condition is associated with altered or reduced levels of TDP-43 in neurons.
[0019] In some embodiments, the method further comprises administering to the subject an effective amount of a second agent. In some embodiments, the second agent is administered to treat a neurodegenerative disease or a traumatic brain injury. In some embodiments, the second agent is STMN2 (e.g., administered as a gene therapy agent).
[0020] Also disclosed herein are methods for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in a neuronal cell of a subject in need thereof. The method can include contacting the neuronal cell with an antisense oligonucleotide that corrects a reduction in STMN2 protein levels, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-85.
[0021] In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78, or more specifically, the antisense oligonucleotide may comprise SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73, or more specifically, the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
[0022] Further disclosed herein are methods for reducing the likelihood of a disease or condition associated with impaired TAR DNA-binding protein 43 (TDP-43) functionality in a neuronal cell of a subject in need thereof. The method can include contacting the neuronal cell with one or more antisense oligonucleotides that inhibit or prevent the inclusion of cryptic exons in STMN2 RNA. In some embodiments, the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 37-85.
[0023] In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78, or more specifically, SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73, or more specifically, the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
[0024] In some embodiments, the antisense oligonucleotide specifically binds to the STMN2 RNA sequence, pre-RNA sequence, or nascent RNA sequence encoding the cryptic exon. In some embodiments, the antisense oligonucleotide is designed to target the 5' splice site, 3' splice site, or normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target a single-stranded region, for example, a single-stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide is designed to target a site proximal to a cryptic splice site, a site proximal to a premature polyadenylation site, or a site located between a cryptic splice site and a premature polyadenylation site. In some embodiments, the antisense oligonucleotide binds to a target region within an unstructured cryptic exon. In some embodiments, the antisense oligonucleotide binds near or adjacent to a 5' splice site regulated by TDP-43. In some embodiments, the antisense oligonucleotide targets the proximal region of the predicted TDP-43 binding site, hi some embodiments, the antisense oligonucleotide targets the normal binding site of TDP-43.
[0025] In some embodiments, the disease or condition is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, and Alzheimer's disease. In some embodiments, the disease or condition is traumatic brain injury. In some embodiments, the disease or condition is proteasome inhibitor-induced neuropathy.
[0026] In some embodiments, the antisense oligonucleotide inhibits cryptic splicing. In some embodiments, the antisense oligonucleotide prevents or delays degradation of the STMN2 protein. In some embodiments, the subject exhibits improved neuronal growth and repair.
[0027] In some embodiments, the method further comprises administering to the subject an effective amount of a second agent, hi some embodiments, the second agent is administered to treat a neurodegenerative disease or a traumatic brain injury.
[0028] Further disclosed herein is a method for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in a neuronal cell of a subject in need thereof, the method comprising contacting the neuronal cell with a multimeric oligonucleotide that corrects reduced levels of STMN2 protein, wherein the multimeric oligonucleotide comprises two or more antisense oligonucleotides selected from the group consisting of SEQ ID NOs: 37-85. In some embodiments, the multimeric oligonucleotide comprises two or more antisense oligonucleotides selected from the group consisting of SEQ ID NOs: 37-74.
[0029] Also disclosed herein are antisense oligonucleotides that correct reduced levels of STMN2 protein, which are designed to target an unstructured region within a cryptic exon. In some embodiments, the unstructured region within the cryptic exon is located between a cryptic splice site and a premature polyadenylation site.
[0030] Also disclosed herein are methods for detecting changes in STMN2 or ELAVL3 protein levels in a subject. The methods include obtaining a sample from the subject and detecting whether STMN2 or ELAVL3 protein levels are altered. In some embodiments, the subject has amyotrophic lateral sclerosis. In some embodiments, detecting whether STMN2 or ELAVL3 levels are altered includes determining whether STMN2 or ELAVL3 levels are decreased (e.g., using ELISA). In some embodiments, the sample is a biological fluid sample (e.g., a CSF sample).
[0031] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]
[0032] [Figure 1A] Figure 1 shows RNA sequencing of TDP-43 knockdown in hMNs. Figure 2 provides a schematic diagram showing hMN differentiation, purification, and RNAi strategies for TDP-43 knockdown in cultured MNs. [Figure 1B] Figure 1 shows RNA sequencing of TDP-43 knockdown in hMNs. Multidimensional scaling analysis of RNA-Seq datasets obtained from two biologically independent MN differentiation and siRNA transfection experiments based on the 500 most differentially expressed genes is provided. [Figure 1C]RNA sequencing of TDP-43 knockdown in hMNs is shown. A volcano plot is provided showing statistically misregulated genes in hMNs treated with siTDP-43 compared to those treated with a scrambled control. Genes identified as significant after differential expression analysis (Benjamini-Hochberg adjusted P-value cutoff 0.05 and log fold change ratio cutoff 0) are highlighted in yellow (for upregulated / increased abundance genes) and blue (for downregulated / decreased abundance genes). [Figure 1D] 1 shows RNA sequencing of TDP-43 knockdown in hMNs. A scatter plot is provided comparing the TPM values for all genes expressed in MNs treated with control siRNA with the fold change in expression of those genes in cells treated with siTDP-43. [Figure 1E] RNA sequencing of TDP-43 knockdown in hMNs is shown. A subset of 11 genes initially identified as "hits" (significantly upregulated) in the TDP43 knockdown experiment was selected for validation by qRT-PCR. A total of 9 of these 11 genes (including TDP-43) showed the predicted response to TDP-43 depletion when their expression was assayed by qRT-PCR (unpaired t-test, P value < 0.05). [Figure 1F] RNA sequencing of TDP-43 knockdown in hMNs is shown. A subset of 11 genes initially identified as "hits" (significantly downregulated) in the TDP43 knockdown experiment was selected for validation by qRT-PCR. A total of 9 of these 11 genes (including TDP-43) showed the predicted response to TDP-43 depletion when their expression was assayed by qRT-PCR (unpaired t-test, P value < 0.05). [Figure 2A] Figure 1 shows a familial ALS model. Figure 2 provides a schematic diagram of the strategy for assessing gene expression in iPS cell-derived hMNs expressing mutant TDP-43. [Figure 2B] 1 shows a familial ALS model. Micrographs are provided showing the morphology of neurons cultured for 10 days derived from iPS cells of healthy controls (11a, 18a, 20b, 17a) and patients with mutations in TARDP (+ / Q343R, + / G298S, + / A315T, and + / M337V). [Figure 2C] Figure 1 shows a familial ALS model. qRT-PCR analysis of genes consistently upregulated after TDP-43 knockdown in neurons differentiated from control or TDP-43 patients (unpaired t-test, P value < 0.05). [Figure 2D] Figure 1 shows a familial ALS model. qRT-PCR analysis of genes consistently downregulated after TDP-43 knockdown in neurons differentiated from control or TDP-43 patients (unpaired t-test, P value < 0.05). [Figure 2E] Figure 1 shows a familial ALS model. qRT-PCR analysis of genes consistently downregulated after TDP-43 knockdown in neurons differentiated from control or TDP-43 patients (unpaired t-test, P value < 0.05). [Figure 2F] Figure 1 shows a familial ALS model. qRT-PCR analysis of genes consistently downregulated after TDP-43 knockdown in neurons differentiated from control or TDP-43 patients (unpaired t-test, P value < 0.05). [Figure 2G] We present qRT-PCR analysis of genes that were consistently downregulated (Figure 2D-2F) or upregulated (Figure 2C) after TDP-43 knockdown in neurons differentiated from control or TDP-43 patients in a familial ALS model (unpaired t-test, P value < 0.05). [Figure 2H] We present qRT-PCR analysis of genes that were consistently downregulated (Figure 2D-2F) or upregulated (Figure 2C) after TDP-43 knockdown in neurons differentiated from control or TDP-43 patients in a familial ALS model (unpaired t-test, P value < 0.05). [Figure 2I-1] A familial ALS model is shown. Representative photomicrographs of control and patient neurons immunostained for TDP-43 (red), β-III tubulin (green), and counterstained with DAPI (blue) are provided. Scale bar, 100 μm. [Figure 2I-2] A familial ALS model is shown. Representative photomicrographs of control and patient neurons immunostained for TDP-43 (red), β-III tubulin (green), and counterstained with DAPI (blue) are provided. Scale bar, 100 μm. [Figure 2J] Figure 1 shows a familial ALS model. Pearson correlation analysis of TDP-43 immunostaining and DAPI fluorescence comparing control neurons with neurons carrying a TDP-43 mutation. Dots represent individual cells (unpaired t-test, P value < 0.05). [Figure 3A] Figure 1 shows the regulation and localization of STMN2. qRT-PCR analysis of STMN2 transcripts in independent experiments using two different sets of primer pairs is provided (unpaired t-test, P value < 0.05). [Figure 3B] Figure 1 shows the regulation and localization of STMN2. Immunoblot analysis of TDP-43 and STMN2 protein levels after partial depletion of TDP-43 by siRNA knockdown is provided. Protein levels are normalized to GAPDH and shown relative to levels in MNs treated with siRED control. [Figure 3C] Figure 1 shows the regulation and localization of STMN2. qRT-PCR analysis for STMN2 transcript analysis in Hb9::GFP+ MNs treated with siRNA targeting three ALS-related genes (TDP-43, FUS, and C9ORF72) is provided (Dunnett's multiple comparison test, alpha value < 0.05). [Figure 3D] Figure 3 shows the regulation and localization of STMN2. Formaldehyde RNA immunoprecipitation was used to identify transcripts bound to TDP-43. After TDP-43 immunoprecipitation (Figure 3D), qRT-PCR analysis was used to test the enrichment of TDP-43 transcripts (Figure 3E) and STMN2 transcripts (Figure 3F) relative to sample input. [Figure 3E] Figure 3 shows the regulation and localization of STMN2. Formaldehyde RNA immunoprecipitation was used to identify transcripts bound to TDP-43. After TDP-43 immunoprecipitation (Figure 3D), qRT-PCR analysis was used to test the enrichment of TDP-43 transcripts (Figure 3E) and STMN2 transcripts (Figure 3F) relative to sample input. [Figure 3F] Figure 3 shows the regulation and localization of STMN2. Formaldehyde RNA immunoprecipitation was used to identify transcripts bound to TDP-43. After TDP-43 immunoprecipitation (Figure 3D), qRT-PCR analysis was used to test the enrichment of TDP-43 transcripts (Figure 3E) and STMN2 transcripts (Figure 3F) relative to sample input. [Figure 3G] Figure 1 shows the regulation and localization of STMN2. Photomicrographs of Hb9::GFP+ MNs immunostained for TDP-43 (red), β-III tubulin (green), and counterstained with DAPI (blue) are provided. [Figure 3H] Figure 1 shows the regulation and localization of STMN2. Photomicrographs of Hb9::GFP+ MNs co-cultured on STMN2 (red) and glia immunostained for MAP2 (green) and GOLGIN97 (green) are provided. [Figure 3I] Figure 1 shows the regulation and localization of STMN2. Photomicrographs of Hb9::GFP+ MNs at day 3 after sorting immunostained for STMN2 (red), MAP2 (green), and counterstained with the F-actin-binding protein phalloidin (white) are provided. Scale bar 5 μm. [Figure 4A] Figure 1 shows STMN2 knockout. A schematic diagram of the knockout strategy using guide RNAs (gRNAs) targeting two constitutive exons, exon 2 and exon 4, of the human STMN2 gene is provided. The intervening DNA segment (approximately 18 Kb) is targeted and deleted as a result of NHEJ (non-homologous end joining) repair of two double-strand breaks (DSBs) introduced by the Cas9 / gRNA nuclease complex. [Figure 4B]Figure 1 shows STMN2 knockout. RT-PCR analysis of genomic DNA confirmed STMN2 knockout in the HUES3 Hb9::GFP strain. [Figure 4C] Figure 1 shows STMN2 knockout. Immunoblot analysis confirms STMN2 knockout in the HUES3 Hb9::GFP line. [Figure 4D] STMN2 knockout is shown. Immunofluorescence confirmed STMN2 knockout in the HUES3 Hb9::GFP strain. [Figure 4E] 1 shows STMN2 knockout and provides the experimental strategy used to evaluate the cellular effects of STMN2 absence in hMNs. [Figure 4F] Shown is the STMN2 knockout. Sholl analysis of hMNs with and without STMN2 in the absence (Figure 4G) or presence (Figure 4H) of a ROCK inhibitor (Y-27632, 10 μM) to stimulate neurite outgrowth (unpaired t-test, P value < 0.05). [Figure 4G] Shown is the STMN2 knockout. Sholl analysis of hMNs with and without STMN2 in the absence (Figure 4G) or presence (Figure 4H) of a ROCK inhibitor (Y-27632, 10 μM) to stimulate neurite outgrowth (unpaired t-test, P value < 0.05). [Figure 4H] Shown is the STMN2 knockout. Sholl analysis of hMNs with and without STMN2 in the absence (Figure 4G) or presence (Figure 4H) of a ROCK inhibitor (Y-27632, 10 μM) to stimulate neurite outgrowth (unpaired t-test, P value < 0.05). [Figure 4I] 1 shows STMN2 knockout and provides the experimental strategy used to evaluate the cellular effects of STMN2 absence in hMNs after axonal injury. [Figure 4J]Figure 1. STMN2 knockout. Figure 2. Axonal regrowth after injury. Representative photomicrographs of hMNs in a microfluidic device before and after axotomy. Measurement of axonal regeneration after axotomy (unpaired t-test, P value < 0.05). [Figure 4K] Showing STMN2 knockout. Showing axonal regrowth after injury. Measurement of axonal regeneration after axotomy. (Unpaired t-test, P value < 0.05). [Figure 5A] We present a sporadic ALS model and provide the experimental strategy used to evaluate the effects of proteasome inhibition on TDP-43 localization in human motor neurons. [Figure 5B] Figure 1 shows a sporadic ALS model. Pearson correlation analysis of TDP-43 immunostaining and DAPI fluorescence in cells treated with MG-132 (1 μM) (Dunnett's multiple comparison test, alpha value < 0.05). [Figure 5C]
[0033] Figure 1 shows a sporadic ALS model. Photomicrographs of HUES3 motor neurons immunostained for TDP-43 (red), β-III tubulin (green), and counterstained with DAPI (blue) are provided, untreated or treated with MG-132. Scale bar 100 μm. [Figure 5D] 1 shows a sporadic ALS model. Immunoblot analysis of TDP-43 in detergent-soluble (RIPA) and detergent-insoluble (UREA) fractions in neurons treated with MG-132 (unpaired t-test, P value < 0.05). [Figure 5E] 1 shows a sporadic ALS model. qRT-PCR analysis of STMN2 expression in motor neurons treated with MG-132 at the indicated concentrations and durations compared to DMSO controls (unpaired t-test, P value < 0.05). [Figure 5F] 1 shows a sporadic ALS model. 2 provides a diagram of the RT-PCR detection strategy for STMN2 cryptic exons. [Figure 5G] 10 shows a sporadic ALS model.
[0033] Figure 10 provides a tapestation analysis of STMN2 cryptic exons in hMN control cells treated with MG-132 (1 μM). [Figure 6A]ALS patient data are shown. Histological analysis of adult human lumbar spinal cord samples from postmortem specimens taken from subjects with no evidence of spinal cord disease (control) (Figure 6A) or two patients diagnosed with sporadic ALS (Figures 6B-6C) is provided. Immunoreactivity for STMN2 was detected in the perinuclear region of spinal motor neurons (indicated by arrows) but not in surrounding glial cells. STMN2 immunoreactivity in lumbar motor neurons from controls and ALS cases was scored as "strong" [as indicated by arrows in the control (Figure 6A) and sporadic ALS (Figure 6B)] or "absent" [as indicated by arrowheads in sporadic ALS (Figure 6C)]. Scale bar 50 μm. [Figure 6B] ALS patient data are shown. Histological analysis of adult human lumbar spinal cord samples from postmortem specimens taken from subjects with no evidence of spinal cord disease (control) (Figure 6A) or two patients diagnosed with sporadic ALS (Figures 6B-6C) is provided. Immunoreactivity for STMN2 was detected in the perinuclear region of spinal motor neurons (indicated by arrows) but not in surrounding glial cells. STMN2 immunoreactivity in lumbar motor neurons from controls and ALS cases was scored as "strong" [as indicated by arrows in the control (Figure 6A) and sporadic ALS (Figure 6B)] or "absent" [as indicated by arrowheads in sporadic ALS (Figure 6C)]. Scale bar 50 μm. [Figure 6C] ALS patient data are shown. Histological analysis of adult human lumbar spinal cord samples from postmortem specimens taken from subjects with no evidence of spinal cord disease (control) (Figure 6A) or two patients diagnosed with sporadic ALS (Figures 6B-6C) is provided. Immunoreactivity for STMN2 was detected in the perinuclear region of spinal motor neurons (indicated by arrows) but not in surrounding glial cells. STMN2 immunoreactivity in lumbar motor neurons from controls and ALS cases was scored as "strong" [as indicated by arrows in the control (Figure 6A) and sporadic ALS (Figure 6B)] or "absent" [as indicated by arrowheads in sporadic ALS (Figure 6C)]. Scale bar 50 μm. [Figure 6D]ALS patient data are shown, showing that the percentage of lumbar motor neurons with strong STMN2 immunoreactivity was significantly lower in ALS tissue samples (n = 3 controls and 3 ALS cases; approximately 40 MNs were scored for each subject; two-tailed t-test, P value < 0.05). [Figure 6E] ALS patient data are shown. Gene expression analysis of STMN2 from previously published datasets: Rabin et al. (2009) (Figure 6E), Highley et al. (2014) (Figure 6F), and D'Erchia et al. (2017) (two-tailed t-test, P value < 0.05). [Figure 6F] ALS patient data are shown. Gene expression analysis of STMN2 from previously published datasets: Rabin et al. (2009) (Figure 6E), Highley et al. (2014) (Figure 6F), and D'Erchia et al. (2017) (two-tailed t-test, P value < 0.05). [Figure 6G] ALS patient data are shown. Gene expression analysis of STMN2 from previously published datasets: Rabin et al. (2009) (Figure 6E), Highley et al. (2014) (Figure 6F), and D'Erchia et al. (2017) (two-tailed t-test, P value < 0.05). [Figure 6H] We present data from ALS patients and provide a molecular model for the pathogenesis of ALS. [Figure 7A] Figure 1 shows the production of differentiated human motor neurons. Strategies for differentiation, purification, and culture of hMNs are presented. [Figure 7B] Figure 1 shows the production of differentiated human motor neurons. Flow cytometry analysis of differentiated HUES3 Hb9::GFP cells is provided. Cells not treated with RA or SHH pathway agonists were used as a negative control for gating GFP expression. [Figure 7C]Figure 7C shows the production of differentiated human motor neurons. Photomicrographs and quantification of purified Hb9::GFP+ cells immunostained for HB9 and counterstained with DAPI (Figure 7C) (scale bar = 10 μm) or immunostained for ISL1 and the neuronal markers β-III tubulin and MAP2 (Figure 7E) (scale bar = 20 μm) are provided. [Figure 7D] Figure 7C shows the production of differentiated human motor neurons. Photomicrographs and quantification of purified Hb9::GFP+ cells immunostained for HB9 and counterstained with DAPI (Figure 7C) (scale bar = 10 μm) or immunostained for ISL1 and the neuronal markers β-III tubulin and MAP2 (Figure 7E) (scale bar = 20 μm) are provided. [Figure 7E] Figure 7C shows the production of differentiated human motor neurons. Photomicrographs and quantification of purified Hb9::GFP+ cells immunostained for HB9 and counterstained with DAPI (Figure 7C) (scale bar = 10 μm) or immunostained for ISL1 and the neuronal markers β-III tubulin and MAP2 (Figure 7E) (scale bar = 20 μm) are provided. [Figure 7F] Figure 7C shows the production of differentiated human motor neurons. Photomicrographs and quantification of purified Hb9::GFP+ cells immunostained for HB9 and counterstained with DAPI (Figure 7C) (scale bar = 10 μm) or immunostained for ISL1 and the neuronal markers β-III tubulin and MAP2 (Figure 7E) (scale bar = 20 μm) are provided. [Figure 7G] Figure 1 shows the production of differentiated human motor neurons. The differentiated MNs are electrophysiologically active as determined by whole-cell patch clamp recordings. Upon depolarization in voltage-clamp mode, the cells exhibit a fast inward current followed by a slow outward current, indicating the expression and opening of voltage-activated sodium and potassium channels, respectively. [Figure 7H]Figure 1 shows the production of differentiated human motor neurons. Differentiated MNs are electrophysiologically active as determined by whole-cell patch clamp recording. In current-clamp mode, depolarization evoked the firing of repetitive action potentials. [Figure 7I] Figure 1 shows the production of differentiated human motor neurons. Differentiated MNs are electrophysiologically active as determined by whole-cell patch clamp recording. Responses to kainate are consistent with the expression of functional receptors for excitatory glutamatergic transmitters. [Figure 8A] Figure 1 shows TDP-43 knockdown in cultured hMNs. Figure 2 provides an RNAi strategy for TDP-43 knockdown in cultured MNs. [Figure 8B] 1 shows TDP-43 knockdown in cultured hMNs. Phase and red fluorescence micrographs of cultured hMNs after 4 days of treatment with various siRNAs, including scrambled siRNA conjugated to Alexa Fluor 555, are shown. [Figure 8C] 1 shows TDP-43 knockdown in cultured hMNs. Flow cytometry analysis of hMNs after treatment with various siRNAs is provided. [Figure 8D] Figure 1 shows TDP-43 knockdown in cultured hMNs. Relative levels of TDP-43 mRNA are shown in MNs exposed to various siRNAs for 2, 4, or 6 days. Levels in each sample were normalized to GAPDH and expressed relative to the untransfected control. [Figure 8E] Figure 1 shows TDP-43 knockdown in cultured hMNs. Immunoblot analysis of hMNs after RNAi treatment with the indicated siRNAs is provided. Each sample was normalized using GAPDH to calculate TDP-43 protein levels relative to the control sample treated with siSCR_555. [Figure 9A]Figure 1 shows RNA-Seq of motor neurons. Global transcriptional analysis of motor neurons treated as indicated, presented as a heat map. Unsupervised clustering of expression profiles revealed that samples separated based on batch for motor neuron production and analysis. [Figure 9B] Figure 1 shows RNA-Seq of motor neurons, providing an analysis of TDP-43 transcript abundance after knockdown was confirmed by RNA sequencing (Benjamini-Hochberg adjusted P-value cutoff 0.05). [Figure 9C] 1 shows RNA-Seq of motor neurons. Altered splicing patterns of the POLDIP3 gene were detected as a result of TDP-43 knockdown, with siTDP43-treated cells showing a significant reduction in isoform 1 and increased levels of spliced variant 2 (lacking exon 3) (false discovery rate "FDR" >0.05). [Figure 10-1] Figure 1 shows pluripotent stem cell genotyping sequencing chromatograms of exon 6 of TARDBP in the indicated iPS cell lines to confirm heterozygous mutations in patient lines. [Figure 10-2] Figure 1 shows pluripotent stem cell genotyping sequencing chromatograms of exon 6 of TARDBP in the indicated iPS cell lines to confirm heterozygous mutations in patient lines. [Figure 11A] Neuronal sorting is shown. Cell surface marker screening was used to identify antibodies that enriched in GFP+ motor neurons (quadrant 1) and GFP- cells (quadrant 3). [Figure 11B] Neuronal cell sorting. After sorting of NCAM+ and EpCAM- cells, high-content imaging was used to determine whether the sorting method could deplete cultures of mitotic cells (EdU+) and significantly enrich for motor neurons (Isl1+) and neurons (MAP2+). N=6 different iPS cell lines. Statistical analysis was performed using a two-tailed Student's t-test. [Figure 11C]Figure 1 shows sorting of neurons. qRT-PCR analysis of sorted cultures for the motor neuron marker ISL1 revealed enrichment and a more homogeneous culture compared to unsorted cultures. [Figure 11D] Figure 1 shows sorting of neural cells. qRT-PCR analysis of sorted cultures for the neuronal marker βIII-tubulin revealed enrichment and a more homogeneous culture compared to unsorted cultures. [Figure 11E-1] Neuronal sorting is shown. Flow cytometry analysis of differentiated cultures from the indicated healthy control (gray) and TDP-43 mutant (red) lines using phycoerythrin (PE)-conjugated antibodies against EpCAM (anti-epCAM-PE) and Alexa Fluor 700-conjugated antibodies against NCAM (anti-NCAM-AF700). [Figure 11E-2] Neuronal sorting is shown. Flow cytometry analysis of differentiated cultures from the indicated healthy control (gray) and TDP-43 mutant (red) lines using phycoerythrin (PE)-conjugated antibodies against EpCAM (anti-epCAM-PE) and Alexa Fluor 700-conjugated antibodies against NCAM (anti-NCAM-AF700). [Figure 11F] Neuronal cell sorting is shown. The percentage of NCAM+ cells for the indicated lines from 4–6 independent differentiations is shown. No significant differences were observed between mutant and control lines in terms of their ability to produce NCAM+ cells. Statistical analysis was performed using a two-tailed Student's t-test, P value <0.05. [Figure 12A] Figure 1 shows the relationship between TDP-43 and STMN2. qRT-PCR validation of ALS gene downregulation upon siRNA treatment is provided. TDP-43 expression was assessed for all controls and each siRNA used (unpaired t-test, P value < 0.05). [Figure 12B]Figure 1 shows the relationship between TDP-43 and STMN2. qRT-PCR validation of ALS gene downregulation upon siRNA treatment is provided. FUS expression was assessed for all controls and each siRNA used (unpaired t-test, P value < 0.05). [Figure 12C] Figure 1 shows the relationship between TDP-43 and STMN2. qRT-PCR validation of ALS gene downregulation upon siRNA treatment is provided. Expression of C9ORF72 was assessed for all controls and each siRNA used (unpaired t-test, P value < 0.05). [Figure 12D] Figure 1 shows the relationship between TDP-43 and STMN2. Western blot analysis of STMN2 protein in various cell types along motor neuron differentiation is provided. [Figure 12E] Figure 1 shows the relationship between TDP-43 and STMN2. RNA-Seq expression levels of stathmin family members in motor neurons treated with either siSCR(-) or siTDP-43(+) oligos. Only STMN2 levels were altered after TDP-43 knockdown. [Figure 12F] Figure 12 shows the relationship between TDP-43 and STMN2. TDP-43 binding sites within stathmin family genes (Figure 12F), normalized to gene length (Figure 12G), are shown. STMN2 has the highest number of binding motifs. [Figure 12G] Figure 12 shows the relationship between TDP-43 and STMN2. TDP-43 binding sites within stathmin family genes (Figure 12F), normalized to gene length (Figure 12G), are shown. STMN2 has the highest number of binding motifs. [Figure 13A] Figure 1 shows that STMN2 regulates neuronal growth. CRISPR-mediated STMN2 knockout in the WA01 line was confirmed by RT-PCR analysis of genomic DNA. [Figure 13B] Figure 1 shows that STMN2 regulates neuronal growth. CRISPR-mediated STMN2 knockout in the WA01 line was confirmed by immunoblot analysis. [Figure 13C]Figure 1 shows that STMN2 regulates neuronal growth. CRISPR-mediated STMN2 knockout in the WA01 line was confirmed by immunofluorescence. [Figure 13D] Showing that STMN2 regulates neuronal growth, Sholl analysis of hMNs with and without STMN2 in the presence of the ROCK inhibitor Y-27632 (10 μM) is provided (FIG. 13F) (unpaired t-test, P value < 0.05). [Figure 13E] Showing that STMN2 regulates neuronal growth, Sholl analysis of hMNs with and without STMN2 in the presence of the ROCK inhibitor Y-27632 (10 μM) is provided (FIG. 13F) (unpaired t-test, P value < 0.05). [Figure 13F] Showing that STMN2 regulates neuronal growth, Sholl analysis of hMNs with and without STMN2 in the presence of the ROCK inhibitor Y-27632 (10 μM) is provided (FIG. 13F) (unpaired t-test, P value < 0.05). [Figure 13G] Figure 1 shows that STMN2 regulates neuronal outgrowth. Figure 2 shows axonal regrowth after injury. Figure 3 shows representative photomicrographs of hMNs in a microfluidic device before and after axotomy. [Figure 13H] Figure 1 shows that STMN2 regulates neuronal growth. Figure 2 shows axonal regrowth after injury. Analysis of axonal regrowth after axotomy (unpaired t-test, P value < 0.05). [Figure 14A] Cell viability and proteasome activity assays are shown. Cell Titer Glo uses ATP from metabolically active cells to generate light. A direct relationship exists between luminescence and the number of cells in culture over several orders of magnitude. [Figure 14B] Cell viability and proteasome activity assays are shown. Cell Titer Glo uses ATP from metabolically active cells to generate light. The assay can detect differences in neuronal survival in the absence of growth factors. N = 6 separate wells of neurons (unpaired t-test, P value < 0.05). [Figure 14C] Figure 1 shows cell viability and proteasome activity assays, Cell Titer Glo uses ATP from metabolically active cells to generate light, and a schematic of the MG-132 neuron survival experiment. [Figure 14D] Cell viability and proteasome activity assays are shown. Dose-response curves of motor neurons cultured with the indicated concentrations of MG-132 for the indicated times are shown. N = triplicate wells. Cells were viable one day after treatment at all concentrations tested, with lower concentrations showing longer-term resistance. [Figure 14E] Cell viability and proteasome activity assays are shown. Following proteasomal cleavage, the luciferase substrate is released, allowing for quantitative measurement of proteasome activity. MG-132-treated neurons show a significant decrease in proteasome activity. N = 4 separate wells of neurons (unpaired t-test, P value < 0.05). [Figure 15A] Figure 1 shows that TDP-43 regulates cryptic exon splicing in hMN. Visualization of cryptic exons in PFKP for cells treated with scrambled siRNA or siRNA targeting the TDP-43 transcript. Read coverage and splice junctions are shown for alignment to the human HG19 genome. [Figure 15B] Figure 1 shows that TDP-43 regulates cryptic exon splicing in hMN. Visualization of cryptic exons in ELAVL3 for cells treated with scrambled siRNA or siRNA targeting the TDP-43 transcript. Read coverage and splice junctions are shown for alignment to the human HG19 genome. [Figure 15C]Figure 1 shows that TDP-43 regulates cryptic exon splicing in hMN. Visualization of cryptic exons in STMN2 for cells treated with scrambled siRNA or siRNA targeting the TDP-43 transcript. Read coverage and splice junctions are shown for alignment to the human HG19 genome. [Figure 15D] Figure 1 shows that TDP-43 regulates cryptic exon splicing in hMN2. Figure 2 provides a diagram of the RT-PCR detection strategy for STMN2 cryptic exons. [Figure 15E] Figure 1 shows that TDP-43 regulates cryptic exon splicing in hMN2. Figure 2 provides a diagram of Sanger sequencing of PCR products that confirmed splicing of STMN2 exon 1 with the cryptic exon. [Figure 16A] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples is provided. A graph summarizing patient sample data for latent STMN2 normalized to healthy controls is provided. [Figure 16B] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples is provided. A graph summarizing patient sample data for latent STMN2 normalized to healthy controls is provided. [Figure 16C] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples is provided. A graph summarizing patient sample data for latent STMN2 normalized to healthy controls is provided. [Figure 16D] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples is provided. A graph summarizing patient sample data for latent STMN2 normalized to healthy controls is provided. [Figure 16E] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16F]qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16G] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16H] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16I] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16J] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16K] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16L] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16M] qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples are provided. Graphs showing details for individual patient samples are provided. [Figure 16N] qPCR data of latent STMN2 transcripts from cerebrospinal fluid (CSF) samples of patients is provided. A graph showing survival time after diagnosis is provided. [Figure 16O] 1 provides qPCR data for latent STMN2 transcripts from cerebrospinal fluid (CSF) samples of patients. 2 provides a graph showing age at death. [Figure 16P] 1 provides qPCR data for latent STMN2 transcripts from patient cerebrospinal fluid (CSF) samples. 2 provides a graph showing vital capacity. [Figure 17A]Figure 1 shows an STMN2 multiplex qPCR assay. Figure 2 shows a Q-RT PCR assay for STMN2 in body fluids. An experimental scheme is provided showing that the STMN2 multiplex TaqMan assay simultaneously detects latent STMN2, normal STMN2 transcripts, and the housekeeping gene RNA 18S5. RNA can be collected from CSF-derived exosomes, then converted to cDNA and assayed for full and latent STMN2 transcripts, as well as control RNA for normalization. [Figure 17B] Figure 1 shows an STMN2 multiplex qPCR assay. Figure 2 shows in vitro validation of the multiplex assay in cells in which TDP-43 levels were reduced using either ASO or siRNA. [Figure 17C] 1 shows the STMN2 multiplex qPCR assay. The STMN2 multiplex qPCR assay was used to probe cryptic STMN2 transcript levels in cDNA samples generated from MGH CSF samples. STMN2 cryptic splicing is significantly induced in ALS patients. [Figure 18A] 1 shows a sandwich ELISA for detecting STMN2 protein. 2 provides a schematic diagram of the STMN2 sandwich ELISA. [Figure 18B] 1 shows a sandwich ELISA for detecting STMN2 protein. The sensitivity of the STMN2 ELISA to picogram amounts is shown. [Figure 18C] 1 shows a sandwich ELISA for detecting STMN2 protein. The sandwich ELISA was validated using recombinant STMN2 protein, and demonstrates that the sandwich ELISA can detect picogram levels of STMN2. [Figure 18D] 1 shows a sandwich ELISA for detecting STMN2 protein, and demonstrates that STMN2 levels are reduced in the cerebrospinal fluid (CSF) of patients as assessed using the STMN2 ELISA. [Figure 19]A diagram showing the inheritance of ALS is provided, plotting each gene against the year it was discovered. See Alsultan et al. Degenerative Neurological and Neuromuscular Disease. 2016, 6, 49-64. [Figure 20] We demonstrate that TDP-43 is a multifunctional nucleic acid-binding protein. TDP-43 has been shown to play a variety of functions, including RNA splicing, miRNA processing, autoregulation of its own transcript, RNA transport and stability, and stress granule formation. TDP-43 transcript regulation is highly species- and cell-type-dependent. See Buratti and Baralle, Trends in Biochem. Sci. 2012, 6, 237-247. [Figure 21] We provide a strategy for measuring the transcriptional effects of TDP-43 depletion. A schematic diagram shows the differentiation, purification, and culture strategy for hMNs. This strategy uses small molecules that mimic early development to convert stem cells into postmitotic neurons in 2 weeks. We developed various methods to sort and test neurons. We used siRNA technology combined with RNA sequencing to identify transcripts regulated by TDP-43. [Figure 22] We show that TDP-43 binds to STMN2. When ALS patient spinal cords were stained for STMN2, we observed a decrease in STMN2 protein in ALS patients based on fold enrichment relative to PGK1 (fRIP). See Klim et al. Nature Neuroscience vol. 22, pages 167-179 (2019). [Figure 23] Figure 1 shows splicing changes after TDP-43 depletion. Differential exon usage analysis was performed on RNA-seq samples from motor neurons treated with siTDP. Splicing changes were observed in STMN2. [Figure 24]This shows that TDP-43 represses cryptic exons in STMN2. Using the Integrative Genome Viewer, we examined where RNA-seq reads mapped to the human genome (number of reads in the graph above) and how the reads reconnected between exons (splice track). The graph shows the number of reads mapped to gene regions. [Figure 25] We provide an overview of the STMN2 splicing defect. Under normal conditions, STMN2 is transcribed with all five exons, resulting in mRNA that is translated into the 20-kDa STMN2 protein. After TDP-43 perturbation, only the 17-amino acid polypeptide can be translated because the cryptic exons interfere with transcription. [Figure 26] We show that STMN2 is consistently down-regulated. We compared the overlap of down-regulated transcripts in three human RNA-seq datasets (ALS patient dataset and siTDP43 stem cell motor neuron dataset), and STMN2 is the only transcript down-regulated in all three datasets. [Figure 27] This figure shows that STMN2 cryptic exons are present in the spinal cord of ALS patients. Read coverage and splice junctions are shown for alignment to the human HG19 genome. Observation of reads mapped to the human genome in ALS patients revealed that reads mapped to cryptic exons and splicing spanned cryptic exons in 5 out of 6 patients, but not in any of the controls. [Figure 28] Figure 1 shows that TDP-43 depletion results in defects in neurite outgrowth and axonal regrowth. Representative photomicrographs of hMNs treated with the indicated siRNAs and immunostained for β-III tubulin are provided to perform Sholl analysis. Sholl analysis of hMNs after siRNA treatment is provided. Lines represent sample means, and shading represents sem. An unpaired t-test (two-tailed, P<0.05) between siTDP43 and siSCR is used. [Figure 29]Figure 1 shows a microfluidic device for investigating axon regeneration, which contains a somatic compartment (left panel) and an axonal compartment (right panel). [Figure 30] Figure 1 shows that TDP-43 depletion results in defects in neurite outgrowth and axonal regrowth. (A) Representative photomicrographs of hMNs in a microfluidic device after axotomy. Scale bar: 150 μM. (B) Measurements of axonal regrowth and regeneration after axotomy (unpaired t-test, two-tailed, P values < 0.05, 18 h ≤ 0.0001, 24 h ≤ 0.0001, 48 h ≤ 0.0001, and 72 h ≤ 0.0001). [Figure 31] We show that STMN2 is a c-Jun N-terminal kinase (JNK) target in the axon degeneration pathway. We show that JNK1 binds to and phosphorylates STMN2, and that phosphorylated STMN2 is rapidly degraded. See J. Eun Shin et al. PNAS 2012, 109, E3696-3705. [Figure 32] We provide a strategy for determining whether JNKi can rescue the siTDP43 phenotype. See Klim et al. Nature Neuroscience vol. 22, pages 167-179 (2019). [Figure 33] We show that a JNK inhibitor (SP600125) boosts STMN2 levels. STMN2 protein levels increased in neurons treated with JNKi and were able to rescue the lower levels observed in cells treated with siTDP43. [Figure 34] Figure 1 shows that JNKi (SP600125) increases neurite outgrowth. Cells treated with JNKi showed increased neurite branching. [Figure 35] JNKi (SP600125) Increases Neurite Outgrowth Sholl analysis confirmed that JNKi increased neurite branching and regrowth after injury under all conditions. [Figure 36]JNKi Increases Axonal Regeneration Using a microfluidic device, we confirmed that JNKi increased neurite branching and regrowth after injury under all conditions. [Figure 37] We provide a model for proteasome inhibition: disruption of proteostasis leads to mislocalization of TDP-43 and altered STMN2 levels, which disrupts axon biology. [Figure 38] TDP-43 localization is shown. TDP-43 is normally nuclear (A), but after compound washout, a clear loss of nuclear TDP-43 staining was observed (B). No cytoplasmic aggregation was observed; only a loss of nuclear TDP-43 was observed. [Figure 39] We show that TDP-43 mislocalization is reversible. [Figure 40] Figure 1 shows that STMN2 transcripts were reduced after TDP-43 mislocalization, and the reduction in STMN2 was even more pronounced than in cells expressing mutant TDP-43. [Figure 41] We provide a table summarizing recent ALS genes in various ALS and FTD cohorts and related pathways, along with their relative mutation frequencies. Advances in WGS and WES have led to the identification of genes harboring rare causative variants, namely TBK1, CHCHD10, TUBA4A, MATR3, CCNF, NEK1, C21orf2, ANXA11, and TIA1. TBK1 has been shown to have the highest mutation frequency (3-4%) in ALS-FTD across various cohorts. See Nguyen, et al., Trends in Genetics, 2018. [Figure 42] Atg7 and TBK1 act at different points in autophagy. See Hansen, et al., Nature Reviews Molecular Cell Biology. 2018. [Figure 43] We show that depletion of TBK1 shares similarities with, but is distinct from, blocking autophagy initiation. [Figure 44]We show that TBK1 knockout reduces functional TDP-43 and STMN2 levels, whereas ATG7 ablation has no effect. Loss of TBK1 induces TDP-43 pathology in motor neurons via an autophagy-independent mechanism. [Figure 45] We show that loss of TBK1 impairs axonal regeneration after axonal injury. [Figure 46-1] We show that proteasome inhibition induced mislocalization of TDP-43 in TBK1 mutant motor neurons. [Figure 46-2] We show that proteasome inhibition induced mislocalization of TDP-43 in TBK1 mutant motor neurons. [Figure 47A] 1 shows targeting of STMN2 introns using CRISPR. The CRISPR strategy for STMN2 targeting and STMN2 genotyping are provided. [Figure 47B] 1 shows targeting of STMN2 introns using CRISPR. The CRISPR strategy for STMN2 targeting and STMN2 genotyping are provided. [Figure 47C] 1 shows targeting of STMN2 introns using CRISPR. A table summarizing CRISPR targeting strategies and genotyping for STMN2 is provided. [Figure 48] We show that STMN2 mice are significantly smaller than Rosa26 control mice and exhibit deficits in motor performance tasks without signs of progression of these deficits over time. [Figure 49] We show that STMN2 mice are significantly smaller than Rosa26 control mice and exhibit deficits in motor performance tasks without signs of progression of these deficits over time. [Figure 50] 1 shows that behavioral outcomes and total distance traveled in the open field assay appear to be similar between the two cohorts of mice. [Figure 51] 1 shows that STMN2 transcript levels are significantly reduced or absent in brain tissue from the mutant cohort. [Figure 52] 1 provides Western blots of brain tissue verifying loss or significant reduction of STMN2 protein in mutant mouse cohorts. [Figure 53] STMN2 is shown to be predominantly localized to ChAT+ motor neurons in the ventral horn of the adult mouse spinal cord. [Figure 54] 1 shows that the STMN2 cohort exhibits a significant reduction in the number of STMN2+ / ChAT+ motor neurons on the ventral horn of the spinal cord. [Figure 55] Graphs are provided showing the difference in organ or muscle weight between control and STMN2 mice, with STMN2 mice showing lighter lower limb muscles (see the two boxed graphs). [Figure 56] Figure 1 shows pre- and postsynaptic staining of STMN2 and Rosa26 control gastrocnemius (GA) muscles, suggesting de-innervation in STMN2- / - animals. [Figure 57] Figure 1 shows pre- and postsynaptic staining of STMN2 gastrocnemius (GA) and Rosa26 control gastrocnemius (GA), suggesting denervation in STMN2- / - animals. [Figure 58] We show that neuromuscular junction (NMJ) morphology confirms active denervation in the gastrocnemius muscle of STMN2 mutants. [Figure 59] We show that mutant TDP-43 does not exhibit pathological mislocalization. Staining of control and ALS patient neurons for TDP-43 shows that TDP-43 was predominantly nuclear in both control and ALS patient neurons. [Figure 60] Various classes of proteasome inhibitors are identified and their chemical structures are provided. [Figure 61] 1 shows the reduction of full-length STMN2 expression in hMNs upon treatment with structurally distinct proteasome inhibitors. [Figure 62]PCR assay of hMN treated with MG-132 or bortezomib. Full-length STMN2 was detected in all samples as a control. The presence of transcripts containing the STMN2 cryptic exon was specific to cells treated with proteasome inhibitors. [Figure 63] An in vitro assay for TDP-43 binding to STMN2 RNA is shown. Genomic DNA was used to in vitro transcribe RNA containing the TDP-43 binding site from the cryptic exon region of STMN2 (A). The RNA was used to assess whether IP TDP-43 protein could be pulled down from human neuronal protein lysates. The in vitro assay shows that transcripts containing the cryptic exon region pulled down TDP-43 (B). [Figure 64] Figure 6 shows an in vitro assay for TDP-43 binding to STMN2 RNA. RNA containing the 5' and 3' TDP-43 binding regions was in vitro transcribed as described in Figure 63. Both the 5' and 3' transcripts can pull down some TDP-43, but the enrichment is not as strong as the complete cryptic exon. [Figure 65] Figure 1 shows the gRNA design for generating targeted mutant cell lines lacking the cryptic exon. A strategy was developed to delete 105 nucleotides within a cryptic exon within the STMN2 intron between exon 1 and exon 2. The deletion removes the TDP-43 binding motif but does not affect the predicted polyadenylation site. [Figure 66] Confirmation of mutation status is shown. The mutation status of the clones was analyzed using TIDE analysis, and sequence alignment to control cells was confirmed to obtain a more precise view of the size and location of the deletion. One cell line contained a homozygous 105-nt deletion, which was consistent with gel electrophoresis. The deletion removed the TDP-43 binding motif but did not affect the predicted polyadenylation site. [Figure 67]We demonstrate that the TDP-43 binding site is a potential negative regulator of STMN2 expression. Three cell lines, HUES3, IG2 (Stmn2 KO), and CN7 (cryptic exon deletion), were stressed by treating them with standard medium or medium plus 1 μM MG132 for 24 hours. In HUES3 cells, stressed conditions resulted in 52% lower STMN2 mRNA expression compared to unstressed conditions. In IG2 (Stmn2 KO), expression was 13% lower in unstressed cells, whereas stressed conditions increased expression to 42%. Expression levels in the CN7 (cryptic exon deletion) cell line were significantly higher than those in the other two cell lines, with expression levels of 729% higher in unstressed cells and 473% higher in stressed cells. While knockout of several exons reduced expression, removal of the TDP-43 binding site increased expression. [Figure 68A] We show that deletion of the putative TDP-43 binding site leads to increased STMN2 protein levels. Consistent with gene expression data, deletion of the TDP-43 binding region within the STMN2 cryptic exon leads to increased protein expression. [Figure 68B] We show that deletion of the putative TDP-43 binding site leads to increased STMN2 protein levels. Consistent with gene expression data, deletion of the TDP-43 binding region within the STMN2 cryptic exon leads to increased protein expression. [Figure 69A-1] Conservation of the STMN2 locus is shown. Human STMN2 is located on the long arm of chromosome 8 and is generally transcribed as several isoforms containing five canonical exons. The locations of cryptic exons are highlighted in orange. Conservation along the locus among 100 vertebrate species reveals strong conservation in exons and several intronic regions. [Figure 69A-2]Conservation of the STMN2 locus is shown. Human STMN2 is located on the long arm of chromosome 8 and is generally transcribed as several isoforms containing five canonical exons. The locations of cryptic exons are highlighted in orange. Conservation along the locus among 100 vertebrate species reveals strong conservation in exons and several intronic regions. [Figure 69B] Conservation of the STMN2 locus is shown. Nucleotide analysis combined with multiple sequence alignments for 12 primates and two rodents provides a higher-resolution genomic view of the STMN2 cryptic exons (orange). Prominent features of the human gene and their degree of conservation down the list of species are underlined, including the splice acceptor site (dark teal), putative coding region (yellow), stop codon (red), TDP-43 binding motif (blue), and polyA signal (purple). [Figure 70] 1 shows a multiplex assay for detecting latent STMN2. [Figure 71] Figure 1 shows that siTDP-43 and TDP-43 ASO induce reduction of STMN2 and induction of cryptic exons. The relative expression levels of TARDBP (A), STMN2 exons 3-4 (B), and cryptic STMN2 (C) are shown when treated with SCR ASO, TDP ASO, or siTDP. [Figure 72] Relative mRNA levels of TARDP (A), STMN2 (B), and latent STMN2 (C) are shown after 6 days of treatment with scrambled ASO, TDP-43 ASO, or SOD1 ASO. [Figure 73] Figure 1 shows latent STMN2 expression. Figure 2 shows mRNA levels of latent STMN2 expression after treatment with scrambled ASO, TDP-43 ASO, SOD1 ASO, siTDP-43, and siRED. Treatments were performed using NeuroPorter5, NeuroPorter1, RNAiMAX, or LipoFecamine, with RNAiMAX being the most effective. [Figure 74]A schematic diagram illustrating the strategy for testing STMN2 splice-switching ASOs is provided. [Figure 75A] 1 provides a schematic diagram of the ASO screening setup plate 1. [Figure 75B] 1 provides a schematic diagram of ASO screening set-up plate 2. [Figure 75C] Schematic diagram of ASO screening set-up plate 3 is provided. [Figure 75D] 1 provides a schematic diagram of the ASO screening set-up plate 4. [Figure 76] The results of ASO screening using cDNA comparable to all wells are provided. The ASOs screened were ASOs targeting the STMN2 intron. [Figure 77] We provide the results of an ASO screen showing that ASOs near splice junctions suppress the inclusion of cryptic exons. [Figure 78] The best hits from the ASO screen that show dose-dependence or inhibition to the lowest concentration are provided. [Figure 79A] We present the protein structure, pathogenic mutations, and function of TDP-43. We show that TDP-43 contains six domains: an N-terminal region (aa 1-102) containing a nuclear localization signal (NLS, aa 82-98); two RNA recognition motifs: RRM1 (aa 104-176) and RRM2 (aa 192-262); a nuclear export signal (NES, aa 239-250); a C-terminal region (aa 274-414) encompassing a prion-like glutamine / asparagine-rich (Q / N) domain (aa 345-366); and a glycine-rich region (aa 366-414). Forty-six dominant mutations, primarily located in the C-terminal glycine-rich region, have been identified in TDP-43 from patients with sporadic and familial ALS and rare FTLD. [Figure 79B]We present the protein structure, pathogenic mutations, and function of TDP-43. We demonstrate that prominent TDP-43 functions are strongly implicated in disease pathogenesis. The most common motif identified for TDP-43 is (TG)n, which corresponds to the (UG)n RNA-binding motif. TDP-43's interaction with RNA allows it to regulate pre-mRNA splicing, inhibiting the inclusion of cryptic exons, and also influence polyadenylation site selection. TDP-43's cytosolic roles include transport of RNA along neurites and responding to stresses, including those affecting proteostasis, which can induce nuclear export and localization of TDP-43 to stress granules. Many of these essential molecular functions contribute to TDP-43 autoregulation, including splicing and polyadenylation. [Figure 80A] The structure and function of the STMN2 protein are shown. STMN2 contains two domains that can be further subdivided: 1) an N-terminal domain containing a conserved Golgi-specific sequence and two palmitoylation sites that enable membrane insertion; and 2) a stathmin-like domain containing two tubulin-binding repeats (TBR1 and TBR2), each of which binds tubulin. The proline-rich domain (PRD) harbors two phosphorylation sites that could potentially regulate STMN2's ability to interact with tubulin via JNK and promote its degradation. The stathmin N-terminal domain (SLDN) contains a peptide that inhibits tubulin polymerization. Post-translational modifications (PTMs) identified using PhosphositePlus are displayed alongside the protein structure. [Figure 80B] The structure and function of STMN2 protein are shown. The reported subcellular localization of STMN2 protein is shown. STMN2 is localized to the Golgi apparatus and is found in vesicles that are transported throughout dendrites and axons, concentrating within the growth cones of developing neurons and at the tips of regenerating axons after injury. [Figure 81]We present a proposed model for TDP-43 regulation of STMN2. A pathological hallmark of ALS is the nuclear loss of TDP-43 and its aggregation. We propose a model for TDP-43 regulation of STMN2 in which TDP-43 binds to STMN2 pre-mRNA in the intron between exons 1 and 2. Either reduced TDP-43 levels or nuclear export leads to premature polyadenylation and splicing of the cryptic exon, resulting in a truncated STMN2 mRNA transcript. The blunted transcript encodes a predicted 17-amino acid polypeptide, thus reducing STMN2 protein levels. Loss of STMN2 leads to reduced neurite outgrowth and axonal repair after injury. [Figure 82] The antisense oligonucleotides and their locations relative to the STMN2 sequence are shown. The sequences, chemistries, and alignments of the ASOs to the STMN2 locus are shown. Prominent features of the human gene are highlighted, including the splice acceptor site (dark teal), putative coding region (yellow), stop codon (red), TDP-43 binding motif (orange), and polyA signal (purple). ASOs highlighted in yellow have locked nucleic acid chemistry. [Figure 83A] Investigating the cryptic exon-containing region of STMN2 pre-mRNA. We provide the sequence of the cryptic exon-containing region of STMN2 pre-mRNA, highlighting various salient features. [Figure 83B] Investigating the cryptic exon-containing region of STMN2 pre-mRNA. We provide the predicted RNA structure of the cryptic exon-containing region of STMN2 pre-mRNA, with the region highlighted in green being partially unstructured, indicating that different binding interactions with similar energies are available. [Figure 83C] Investigating the cryptic exon-containing region of STMN2 pre-mRNA. We provide the predicted RNA structure of the cryptic exon-containing region of STMN2 pre-mRNA, with the region highlighted in green being partially unstructured, indicating that different binding interactions with similar energies are available. [Figure 84] Characterization of patient-specific induced pluripotent stem cells. A provides a micrograph showing undifferentiated patient iPS cells. B provides a sequencing chromatogram of PCR products amplified from exon 8 of TBK1 in the indicated iPS cell lines, confirming the non-significant heterozygous L306I non-pathological variant in the patient line. C-D provide micrographs showing motor neurons differentiated from patient iPS cells. [Figure 85] Figure 1 shows the reduction of nuclear TDP-43 observed in patient neurons. (A) Representative photomicrographs of control and patient neurons immunostained for TDP-43 (red), β-III tubulin (green), and counterstained with DAPI (blue), which labels nuclei. Scale bar: 100 μm. (B) Pearson correlation analysis of TDP-43 immunostaining and DAPI fluorescence comparing control neurons with patient neurons. Dots represent individual cells, and the results are shown as the mean + sd of at least 25 cells from n = 4 control and 1 patient line (unpaired t-test, two-tailed, P < 0.05). [Figure 86] Figure 1 shows that patient motor neurons produce truncated STMN2 in response to TDP-43 depletion. RNA levels were analyzed by qRT-PCR analysis after TDP-43 knockdown with siTARDBP in motor neurons differentiated from patient iPSCs. A shows the RNA level of TDP-43. B shows the RNA level of full-length STMN2. C shows the RNA level of latent STMN2 compared to the control (siCTRL). [Figure 87A] 1 shows STMN2 locus sequencing of a patient. Sequencing results of PCR products amplified from the first intron of STMN2 in patient iPS cell lines aligned to the reference sequence. [Figure 87B] STMN2 locus sequencing of the patient is shown, identifying one mismatch between the patient and the reference sequence consisting of a common single nucleotide variant (SNP). [Figure 87C]Figure 1 shows STMN2 locus sequencing for a patient. Sequencing chromatogram of PCR products amplified from the ASO-targeted region in the first intron of STMN2 confirms the absence of heterozygosity at this locus and highlights the ASO match. [Figure 88A] 1 shows the levels of latent and full-length STMN2 RNA in patient motor neurons using SJ+94 ASO (SEQ ID NO: 73). 1 shows the RNA levels of latent STMN2. [Figure 88B] Figure 1 shows latent and full-length STMN2 RNA levels in patient motor neurons with SJ+94 ASO (SEQ ID NO: 73). Figure 2 shows full-length STMN2 RNA levels after TDP-43 reduction with siTARDP in patient motor neurons. Neurons were cultured with 30, 3, 0.3, or 0.03 nM STMN2-targeting ASO (SJ+94) or non-targeting control ASO (NTC), from left to right. [Figure 89] We show that full-length STMN2 RNA is increased by ASO SJ+94 in patient motor neurons after suppression by nuclear depletion of TDP43. qRT-PCR analysis of full-length STMN2 after proteasome inhibition with MG-132 (1 μM), which induces nuclear depletion of TDP-43, in patient neurons results in decreased STMN2 expression. Full-length STMN2 RNA is increased by ASO SJ+94 under these conditions compared to those treated with a non-targeting control ASO (NTC). [Figure 90-1] Immunoblot analysis of STMN2 protein levels after siRNA-mediated TDP-43 reduction. Protein input was normalized by BCA, and STMN2 levels are shown relative to levels in hMNs treated with control siRNA. Data are shown as mean + SD of technical replicates from n = 3 independent experiments (unpaired t-test, two-tailed, P < 0.05). [Figure 90-2]Immunoblot analysis of STMN2 protein levels after siRNA-mediated TDP-43 reduction. Protein input was normalized by BCA, and STMN2 levels are shown relative to levels in hMNs treated with control siRNA. Data are shown as mean + SD of technical replicates from n = 3 independent experiments (unpaired t-test, two-tailed, P < 0.05). [Figure 91A] We show that the growth defect following TDP-43 depletion can be rescued by STMN2 ASO SJ+94 in patient motor neurons. We outline the experimental strategy used to assess the cellular impact of STMN2 restoration in hMNs following axonal injury. [Figure 91B] We demonstrate that the growth defect following TDP-43 depletion in patient motor neurons can be rescued by STMN2 ASO SJ+94. Representative photomicrographs of patient motor neurons in a microfluidic device 18 hours after axotomy are provided. Fields highlighted by red rectangles for NTC and SJ+94 are enlarged in images (i) and (ii), respectively. [Figure 91C] Figure 1 shows that the growth defect after TDP-43 depletion can be rescued by STMN2 ASO SJ+94 in patient motor neurons. Individual neurite lengths, expressed as dots, are shown along with the mean and standard deviation (unpaired t-test, two-tailed). [Figure 91D] We demonstrate that the growth defect following TDP-43 depletion in patient motor neurons can be rescued by STMN2 ASO SJ+94. Representative photomicrographs of patient motor neurons in a microfluidic device 18 hours after axotomy are provided. Fields highlighted by red rectangles for NTC and SJ-1 are enlarged in images (i) and (ii), respectively. [Figure 91E] Figure 1 shows that the growth defect after TDP-43 depletion can be rescued by STMN2 ASO SJ+94 in patient motor neurons. Individual neurite lengths, expressed as dots, are shown along with the mean and standard deviation (unpaired t-test, two-tailed). [Figure 92]Figure 1 shows that the neurite outgrowth defect after TDP-43 depletion can be rescued by STMN2 ASOs SJ-1, SJ+94, and SJ+101. Individual neurites are represented as small dots. [Figure 93] We show that STMN2 can be restored by STMN2 ASOs SJ-1, SJ+94, and SJ+101 in TDP-43-depleted neurons. [Figure 94] We show that latent STMN2 can be reduced by STMN2 ASOs SJ-1, SJ+94, and SJ+101 in TDP-43-depleted neurons. [Figure 95] Figure 1 shows the levels of latent and full-length STMN2 RNA in patient motor neurons with SJ-1 ASO. A shows latent STMN2 RNA levels. B shows full-length STMN2 RNA levels after TDP-43 reduction with siTARDBP (siTDP-43) in patient motor neurons. Neurons were cultured with 30, 3, 0.3, or 0.03 nM STMN2-targeting ASO (SJ-1) or non-targeting control ASO (NTC), from left to right. [Figure 96] We show that full-length STMN2 RNA is increased by ASO SJ-1 in patient motor neurons after suppression of TDP3 nuclear mislocalization. qRT-PCR analysis of full-length STMN2 after proteasome inhibition with MG-132 (1 μM), which induces TDP-43 nuclear mislocalization, in patient neurons results in decreased STMN2 expression. Full-length STMN2 RNA is increased by ASO SJ-1 under these conditions compared to treatment with a non-targeting control ASO (NTC). [Figure 97]STMN2 protein levels measured by Western blot in patient motor neurons after siRNA-mediated TDP-43 reduction are shown. Protein loading was normalized to total protein content, and STMN2 levels are shown relative to levels in control siCTRL-treated hMNs. Data are shown as mean + SD of technical replicates from n = 3 independent experiments. p values for the increase in STMN2 levels induced by SJ-1, SJ+94, and SJ+101 compared to the non-targeting control (NTC) are shown above each result. In all cases, the increase is significant (unpaired t-test, two-tailed, P < 0.05). DETAILED DESCRIPTION OF THE INVENTION
[0033] Mislocalization or depletion of the RNA-binding protein TDP-43 leads to decreased expression of STMN2, which encodes a microtubule regulator. STMN2 is essential for normal axon growth and regeneration. Reduced TDP-43 function results in a truncated or altered STMN2 RNA sequence, which leads to reduced expression of the STMN2 protein. STMN2 may be a promising therapeutic target and a biomarker for disease risk (e.g., neurodegenerative diseases).
[0034] The studies described herein relate to compositions and methods for suppressing or preventing the inclusion of cryptic exons in STMN2 mRNA. The inclusion of cryptic exons in STMN2 mRNA can result in truncated transcripts and proteins. In some embodiments, the inclusion of cryptic exons results in premature polyadenylation. STMN2 expression can be restored through the suppression of cryptic spliced forms of STMN2, which occur when TDP-43 is sequestered or its function is reduced, by blocking the appearance or accumulation of the cryptic form (e.g., by administering antisense oligonucleotides) and reconverting it into or restoring functional STMN2 RNA. Furthermore, the studies described herein relate to compositions and methods for increasing STMN2 protein synthesis, i.e., increasing STMN2 protein expression.
[0035] Drugs and Pharmaceutical Compositions The present disclosure contemplates agents (e.g., antisense oligonucleotides) that specifically bind to STMN2 mRNA, pre-mRNA, or nascent RNA sequences that arise and are increased in abundance when TDP-43 function is impaired or a TDP pathology is present, thereby suppressing or preventing the inclusion of defective or altered STMN2 RNA sequences. In some embodiments, the agent prevents degradation of STMN2 protein. In some embodiments, the agent restores STMN2 protein levels. In some embodiments, the agent suppresses or prevents the inclusion of cryptic exons in STMN2 RNA. In certain embodiments, the agent specifically binds to STMN2 mRNA, pre-mRNA, or nascent RNA sequences that encode cryptic exons.
[0036] In some embodiments, the present disclosure further contemplates an agent (e.g., an antisense oligonucleotide) that specifically binds to the ELAVL3 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence. ELAVL3 can be downregulated when TDP-43 function is impaired or a TDP pathology is present. In some embodiments, the agent inhibits or prevents cryptic splicing of ELAVL3.
[0037] In some embodiments, an agent (e.g., an antisense oligonucleotide) binds to an STMN2 RNA sequence (e.g., a truncated or altered STMN2 RNA sequence). In some aspects, binding of the agent to a short, truncated, or altered STMN2 RNA sequence results in continuous production by RNA polymerase. For example, the agent may directly suppress premature transcription termination at the polyadenylation site of a cryptic exon or may alter transcription termination at a cryptic exon by mimicking the activity of TDP-43 binding at its target site. In some aspects, the agent suppresses or prevents the inclusion of a cryptic exon into STMN2 RNA. In some aspects, the agent prevents degradation of STMN2 protein. In some aspects, the agent increases STMN2 levels (e.g., through exon skipping). In some aspects, the agent restores normal-length or protein-coding STMN2 RNA (e.g., pre-mRNA or mRNA). In some aspects, the agent increases the amount or activity of STMN2 RNA. In some aspects, the agent increases STMN2 protein expression.
[0038] The term "increased" or "increase" is generally used herein to mean an increase by a statistically significant amount. For the avoidance of doubt, the term "increased" or "increase" means an increase of at least 10% compared to a reference level, for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or an increase of up to 100%, or any increase between 10 and 100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold or more compared to a reference level.
[0039] In some embodiments, the agent increases the amount or activity of STMN2 RNA by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold. In some embodiments, the agent increases STMN2 protein expression by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold.
[0040] In some embodiments, the agent (e.g., an antisense oligonucleotide) targets one or more sites, e.g., the 5' splice site, the 3' splice site, the canonical binding site, and / or the polyadenylation site of the STMN2 transcript. In some aspects, the agent targets one or more sites, e.g., a site proximal to the 5' splice site, a site proximal to the 3' splice site, a site proximal to the canonical binding site, and / or a site proximal to the polyadenylation site of the STMN2 transcript. In certain embodiments, the agent targets one or more sites including a 5' splice site regulated by TDP-43, a canonical binding site for TDP-43, and / or a cryptic polyadenylation site. In some embodiments, the agent targets a single-stranded site. In certain embodiments, the agent targets a single-stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the agent targets a site proximal to a cryptic splice site. In some embodiments, the agent targets a site proximal to the premature polyadenylation site. In some embodiments, the agent targets a region located between the cryptic splice site and the premature polyadenylation site. In some embodiments, the agent does not target or bind to the polyadenylation site. In some embodiments, the agent does not target or bind to the polyadenylation site of the STMN2 transcript. In some embodiments, the agent does not target or bind to the cryptic polyadenylation site. In some aspects, the agent targets and promotes splicing of STMN2 exon 2 to exon 1.
[0041] STMN2 exon 1 It may have the sequence of AGCTCCTAGGAAGCTTCAGGGCTTAAAGCTCCACTCTACTTGGACTGTACTATCAGGCCCCCAAAATGGGGGGAGCCGACAGGGAAGGACTGATTTCCATTTCAAACTGCATTCTGGTACTTTGTACTCCAGCACCATTGGCCGATCAATATTTAATGCTTGGAGATTCTGACTCTGCGGGAGTCATGTCAGGGGACCTTGGGAGCCAATCTGCTTGAGCTTCTGAGTGATAATTATTCATGGGCTCCTGCCTCTTGCTCTTTCTCTAGCACGGTCCCACTCTGCAGACTCAGTGCCTTATTCAGTCTTCTCTCTCGCTCTCTCCGCTGCTGTAGCCGGACCCTTTGCCTTCGCCACTGCTCAGCGTCTGCACATCCCTACAATGGCTAAAACAGCAATGGGACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCATGTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCGGCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAGC (SEQ ID NO: 1).
[0042] STMN2 exon 2 It may have the sequence of CCTACAAGGAAAAAATGAAGGAGCTGTCCATGCTGTCACTGATCTGCTCTTGCTTTTACCCGGAACCTCGCAACATCAACATCTATACTTACGATGG (SEQ ID NO: 2).
[0043] The cryptic exon may have the sequence GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCATGTGTGCGTGTGTGCGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCGGCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAGC (SEQ ID NO: 3).
[0044] Exemplary types of agents that can be used include small organic or inorganic molecules; saccharin; oligosaccharides; polysaccharides; biopolymers selected from the group consisting of peptides, proteins, peptide analogs and derivatives; peptidomimetics; nucleic acids selected from the group consisting of siRNA, shRNA, antisense RNA, ribozymes, and aptamers; extracts made from biological material selected from the group consisting of bacteria, plants, fungi, animal cells, and animal tissues; naturally occurring or synthetic compositions; antibodies; and any combination thereof.
[0045] In some embodiments, the agent is an oligonucleotide, a protein, or a small molecule. In some embodiments, the agent comprises one or more oligonucleotides. In some aspects, the oligonucleotide is a splice-switching oligonucleotide. In particular aspects, the oligonucleotide is an antisense oligonucleotide (ASO). In some embodiments, the agent is not an antisense oligonucleotide. In some embodiments, the agent is a small molecule (e.g., branapram (Novartis) or risdiplam (Roche)) that can bind to a target site (e.g., STMN2 transcript) and shift the target's metabolism.
[0046] In some embodiments, the agent is an oligonucleotide, a protein, or a small molecule. In some embodiments, the agent comprises one or more oligonucleotides. An agent comprising multiple oligonucleotides may be considered a multimeric compound. In some aspects, the agent comprises one or more copies of an oligonucleotide. In some aspects, the agent comprises one or more copies of multiple oligonucleotides. In some aspects, multiple oligonucleotides may be covalently linked. In some aspects, the oligonucleotide is a splice-switching oligonucleotide. In certain aspects, the oligonucleotide is an antisense oligonucleotide (ASO). In some embodiments, the agent is a small molecule (e.g., branapram (Novartis) or risdiplam (Roche)) that can bind to a target site (e.g., STMN2 transcript) and shift the target's metabolism. In some aspects, the agent does not exhibit toxicity, e.g., platelet toxicity.
[0047] The agent may target one or more of the 5' splice site, the 3' splice site, the canonical binding site, or the polyadenylation site. In some aspects, the agent targets one or more of the 5' splice site proximal site, the 3' splice site proximal site, the canonical binding site proximal site, and / or the polyadenylation site proximal site of the STMN2 transcript. In some embodiments, the agent targets the cryptic splice site proximal site. In some embodiments, the agent targets the premature polyadenylation site proximal site. In some embodiments, the agent targets a single-stranded region of the STMN2 transcript. In some embodiments, the agent targets a single-stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the agent targets a region located between the cryptic splice site and the premature polyadenylation site. In some aspects, the polyadenylation site is the polyadenylation site of the STMN2 transcript. In some aspects, the polyadenylation site is a polyadenylation site of a cryptic exon (e.g., a cryptic polyadenylation site). In some embodiments, the agent does not target a 5' splice site (e.g., a 5' splice site of TDP-43). In some embodiments, the agent does not target a normal binding site (e.g., a normal TDP-43 binding site). In some embodiments, the agent does not target a polyadenylation site (e.g., a cryptic polyadenylation site). In some aspects,
[0048] In certain embodiments, the antisense oligonucleotide may target one or more of the 5' splice site, the 3' splice site, the canonical binding site, or the polyadenylation site. In some embodiments, the antisense oligonucleotide does not target the 5' splice site (e.g., the 5' splice site of TDP-43). In certain aspects, the antisense oligonucleotide targets one or more of the 5' splice site proximal site, the 3' splice site proximal site, the canonical binding site proximal site, and / or the polyadenylation site proximal site of the STMN2 transcript. In some embodiments, the antisense oligonucleotide targets a single-stranded region of the STMN2 transcript. In certain embodiments, the antisense oligonucleotide targets a single-stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide targets a proximal site of a cryptic splice site (e.g., targets the -1 site from the cryptic splice site). In some embodiments, the antisense oligonucleotide targets a site proximal to a premature polyadenylation site. In some embodiments, the antisense oligonucleotide targets a region located between a cryptic splice site and a premature polyadenylation site. In some aspects, the antisense oligonucleotide targets a region between +90 and +105, or more specifically +94 or +101, relative to the cryptic splice junction. In some embodiments, the antisense oligonucleotide does not target a normal binding site (e.g., a normal TDP-43 binding site). In some embodiments, the antisense oligonucleotide does not target a polyadenylation site (e.g., a cryptic polyadenylation site).
[0049] In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-85. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some aspects, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In certain aspects, the antisense oligonucleotide comprises SEQ ID NO: 52. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In one embodiment, the antisense oligonucleotide comprises SEQ ID NO: 73. In one embodiment, the antisense oligonucleotide comprises SEQ ID NO: 72.
[0050] Table 1 provides a list of exemplary antisense oligonucleotides, and in some cases, indicates the corresponding target site within the STMN2 intron. The underlined bases in SEQ ID NOs: 93-108 represent bases adjacent to cryptic splice sites. The underlined bases in SEQ ID NOs: 112-114 represent the binding site for the TDP-43 protein. The oligonucleotides described herein were synthesized with multiple chemical modifications. For example, the antisense oligonucleotides of SEQ ID NOs: 37-74 have the following structure: [ka] The oligonucleotide was fully modified with MOE sugars and phosphorothioate linkages having the formula: Additional modifications can also be tested. [Table 1-1] [Table 1-2] [Table 1-3]
[0051] Oligonucleotides (e.g., antisense oligonucleotides) can be designed to bind to regions of mRNA that prevent ribosome association at the 5′ cap, prevent polyadenylation during mRNA maturation, or affect splicing events (Bennett and Swayze, Annu. Rev. Pharmacol. Toxicol., 2010; Watts, each incorporated herein by reference). and Corey, J. Pathol., 2012; Kole et al., Nat. Rev. Drug Discov., 2012; Saleh et al., In Exon Skipping: Methods and Protocols, 2012). In some embodiments, oligonucleotides (e.g., antisense oligonucleotides) are designed to target one or more sites, including, for example, the 5' TDP-3 splice site or the normal binding site of TDP-43. In some embodiments, the oligonucleotide targets one or more splice sites. In some embodiments, the oligonucleotide targets one or more of the 5' splice site regulated by TDP-43 or the normal binding site of TDP-43. In some embodiments, the antisense oligonucleotide is designed not to target a polyadenylation site (e.g., a cryptic polyadenylation site). In some embodiments, the oligonucleotide targets an unstructured region located between the cryptic splice site and the polyadenylation site (see Figure 83).
[0052] Antisense oligonucleotides are small sequences of DNA (e.g., about 8-50 base pairs in length) that target RNA transcripts through Watson-Crick base pairing, resulting in reduced or modified protein expression. Oligonucleotides consist of a phosphate backbone and a sugar ring. In some embodiments, the oligonucleotide is unmodified. In other embodiments, the oligonucleotide contains one or more modifications, e.g., to improve the solubility, binding, potency, and / or stability of the antisense oligonucleotide. Modified oligonucleotides may contain at least one modification relative to unmodified RNA or DNA. In some embodiments, the oligonucleotide is modified to include an internucleoside linkage modification, a sugar modification, and / or a nucleobase modification. Examples of such modifications are known to those of skill in the art.
[0053] In some embodiments, the oligonucleotide is modified by replacing at least one nucleotide with a modified nucleotide, so that the in vivo stability is enhanced compared to the corresponding unmodified oligonucleotide.In some aspects, the modified nucleotide is a sugar-modified nucleotide.In another aspect, the modified nucleotide is a nucleobase-modified nucleotide.
[0054] In some embodiments, the oligonucleotide may contain at least one modified nucleotide analog. The nucleotide analog may be located, for example, in the 5'-end and / or 3'-end regions of the oligonucleotide molecule at a position where the target-specific activity, such as splice site selection modulating activity, is not substantially affected. In some aspects, the termini may be stabilized by introducing modified nucleotide analogs.
[0055] In some embodiments, preferred nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., modifications to the phosphate-sugar backbone). For example, the phosphodiester bond of a ribonucleotide can be modified to include at least one nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides, the phosphate group linking adjacent ribonucleotides is replaced with a modified group, e.g., a phosphothioate group. In preferred sugar-modified ribonucleotides, the 2'-OH group is replaced with a group selected from H, OR, R, halo, SH, SR, NH, NHR, NR, or ON, where R is C1-C6 alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I.
[0056] In some embodiments, a modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, a modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleobase. In some embodiments, a modified oligonucleotide comprises one or more modified internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises at least two of one or more modified nucleosides comprising a modified sugar moiety, one or more modified nucleosides comprising a modified nucleobase, and one or more modified internucleoside linkages. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety, one or more modified nucleosides comprising a modified nucleobase, and one or more modified internucleoside linkages.
[0057] sugar modification In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to substitutions in other types of modified sugar moieties.
[0058] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety, comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be present at any position on the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety is branched.
[0059] In some embodiments, the modified sugar moiety comprises a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety, hi some aspects, the bicyclic sugar moiety comprises a bridge between the 4' and 2' furanose ring atoms.
[0060] In some aspects, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. In some embodiments, LNA nucleosides exist in the α-L configuration. In some embodiments, LNA nucleosides exist in the β-D configuration.
[0061] In some embodiments, oligonucleotide modifications include locked nucleic acids (LNAs), in which a 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (-CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom, where n is 1 or 2. LNAs and their preparation are described in WO98 / 39352 and WO99 / 14226, the entire contents of which are incorporated herein by reference.
[0062] In some embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituted and a 4'-2'-bridging sugar).
[0063] In some embodiments, the modified sugar moiety is a sugar surrogate. In some aspects, the oxygen atom of the sugar moiety is replaced, for example, by a sulfur, carbon, or nitrogen atom. In some aspects, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. In some aspects, the sugar surrogate includes a ring with more than five atoms. In certain aspects, the sugar surrogate includes a six-membered tetrahydropyran ("THP"). In some aspects, the sugar surrogate includes an acyclic moiety.
[0064] Nucleobase Modification Modified oligonucleotides can comprise one or more nucleosides that contain unmodified nucleobases.In some embodiments, modified oligonucleotides comprise one or more nucleosides that contain modified nucleobases.In some embodiments, modified oligonucleotides comprise one or more nucleosides that do not contain nucleobases.
[0065] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl(-C°-C]¹¹)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine), 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.
[0066] Also preferred is nucleobase-modified ribonucleotide, that is, ribonucleotide that contains at least one non-naturally occurring nucleobase instead of naturally occurring nucleobase.Examples of modified nucleobase include but are not limited to uridine and / or cytidine modified at 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at 8-position, such as 8-bromoguanosine; deazanucleotide, such as 7-deaza-adenosine; O-alkylated and N-alkylated nucleotide, such as N6-methyladenosine.The oligonucleotide reagent of the present invention can also be modified with chemical moieties that improve the in vivo pharmacological properties of oligonucleotide reagent.
[0067] Internucleoside Modifications In some embodiments, the nucleosides of modified oligonucleotides are linked together using any internucleoside linkage. Two main classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphate, including phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P=S"), and phosphorodithioate ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-); siloxane (-O-SiH-O-); and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Modified internucleoside linkages can be used to alter (usually increase) the nuclease resistance of oligonucleotides compared to naturally occurring phosphate linkages. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.
[0068] Further modifications will be known to those skilled in the art, and examples can be found in WO2019 / 241648, US 10,307,434, US 9,045,518, and US 10,266,822, each of which is incorporated herein by reference.
[0069] The oligonucleotides can be of any size and / or chemical composition sufficient to target defective or altered STMN2 RNA. In some embodiments, the oligonucleotides are about 5-300 nucleotides or modified nucleotides. In some aspects, the oligonucleotides are about 10-100, 15-85, 20-70, 25-55, or 30-40 nucleotides or modified nucleotides. In certain aspects, the oligonucleotides are about 15-35, 15-20, 20-25, 25-30, or 30-35 nucleotides or modified nucleotides.
[0070] In some embodiments, the oligonucleotide and the target RNA sequence (e.g., an incomplete or altered STMN2 RNA) have 100% sequence complementarity. In some aspects, the oligonucleotide may contain sequence variations, such as insertions, deletions, and single point mutations, compared to the target sequence. In some embodiments, the oligonucleotide has at least 70% sequence identity or complementarity to the target RNA (e.g., STMN2 mRNA, pre-mRNA, or nascent RNA). In certain embodiments, the oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to the target sequence.
[0071] Antisense oligonucleotides targeting defective or altered STMN2 RNA sequences (e.g., STMN2 mRNA, pre-mRNA, or nascent RNA sequences) can be designed by any method known to those of skill in the art. In certain embodiments, one or more oligonucleotides are synthesized.
[0072] In some embodiments, STMN2 is administered as a gene therapy agent. In some embodiments, STMN2 is administered in combination with an agent described herein.
[0073] In some embodiments, the agent is an inhibitor of c-Jun N-terminal kinase (JNK). In some aspects, the JNK inhibitor is selected from the group consisting of: small organic or inorganic molecules; saccharin; oligosaccharides; polysaccharides; biopolymers selected from the group consisting of peptides, proteins, peptide analogs, and derivatives; peptidomimetics; nucleic acids selected from the group consisting of siRNA, shRNA, antisense RNA, ribozymes, and aptamers; extracts made from biological materials selected from the group consisting of bacteria, plants, fungi, animal cells, and animal tissues; naturally occurring or synthetic compositions; antibodies; and any combination thereof. In certain aspects, the agent is a small molecule inhibitor, an oligonucleotide (e.g., designed to reduce JNK expression), or a gene therapy drug (e.g., designed to inhibit JNK). In some aspects, inhibition of JNK restores or increases STMN2 protein levels. In certain embodiments, the agent is an oligonucleotide (e.g., an antisense oligonucleotide) targeting JNK.
[0074] The present disclosure further contemplates pharmaceutical compositions comprising an agent (e.g., an antisense oligonucleotide) that binds to an incomplete or altered STMN2 RNA sequence. In some embodiments, the pharmaceutical composition comprises an agent that binds to an STMN2 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence encoding a cryptic exon. In some embodiments, the pharmaceutical composition comprises an agent that prevents degradation of the STMN2 protein. In some embodiments, the pharmaceutical composition comprises an agent that increases expression of the STMN2 protein, e.g., activates expression of the STMN2 protein. In some aspects, the composition comprises an oligonucleotide, protein, or small molecule. In some embodiments, the composition comprises an oligonucleotide (e.g., an antisense oligonucleotide) that specifically binds to an STMN2 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence encoding a cryptic exon. In some aspects, the agent (e.g., an antisense oligonucleotide) suppresses or prevents inclusion of the cryptic exon in STMN2 RNA. In some aspects, the agent suppresses cryptic splicing.
[0075] In some embodiments, the pharmaceutical composition comprises an agent (e.g., an antisense oligonucleotide) that targets one or more sites, e.g., one or more splice sites, binding sites, or polyadenylation sites. In some embodiments, the pharmaceutical composition comprises an agent that targets one or more splice sites (e.g., a 5' splice site regulated by TDP-43). In some embodiments, the pharmaceutical composition comprises an agent that targets a normal binding site (e.g., a normal TDP-43 binding site). In some embodiments, the pharmaceutical composition comprises an agent that targets a polyadenylation site (e.g., a cryptic polyadenylation site). In some embodiments, the pharmaceutical composition comprises an agent that targets a site proximal to a cryptic splice site or a site proximal to a polyadenylation site (e.g., an early polyadenylation site). In some embodiments, the pharmaceutical composition comprises an agent that targets a site located between a cryptic splice site and a polyadenylation site. In some embodiments, the pharmaceutical composition comprises an agent that does not target one or more splice sites (e.g., a 5' splice site regulated by TDP-43). In some embodiments, the pharmaceutical composition includes an agent that does not target a normal binding site (e.g., a normal TDP-43 binding site). In some embodiments, the pharmaceutical composition includes an agent that does not target a polyadenylation site (e.g., a cryptic polyadenylation site).
[0076] In some embodiments, the pharmaceutical composition comprises a multimeric compound, for example, a compound comprising two or more antisense oligonucleotides. The two or more antisense oligonucleotides may comprise two or more antisense oligonucleotides with the same sequence, or alternatively, may comprise two or more antisense oligonucleotides with different sequences. In some embodiments, the two or more antisense oligonucleotides are covalently linked. In some embodiments, the pharmaceutical composition comprises two or more antisense oligonucleotides. Furthermore, the two antisense oligonucleotides may comprise a combination of multiple copies of the same antisense oligonucleotide and / or individual copies of multiple different antisense oligonucleotides.
[0077] In certain embodiments, the pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOs: 37-85. In some embodiments, the pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some aspects, the pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In certain aspects, the pharmaceutical composition comprises an antisense oligonucleotide comprising SEQ ID NO: 52. In some embodiments, the pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In certain embodiments, the pharmaceutical composition comprises an antisense oligonucleotide comprising SEQ ID NO: 73.
[0078] In some embodiments, the pharmaceutical composition comprises an effective amount of an agent (e.g., an antisense oligonucleotide) that binds to a STMN2 mRNA sequence encoding a cryptic exon and an effective amount of a second agent. In some aspects, the second agent is an agent that treats or inhibits a neurodegenerative disorder. In some aspects, the second agent is an agent that treats or inhibits traumatic brain injury. In some aspects, the second agent is an agent that treats or inhibits proteasome inhibitor-induced neuropathy.
[0079] In some embodiments, the pharmaceutical composition comprises an effective amount of an agent (e.g., an antisense oligonucleotide) that binds to a defective or altered STMN2 RNA sequence and an effective amount of STMN2 (e.g., administered as a gene therapy agent).
[0080] In some embodiments, the pharmaceutical composition comprises an effective amount of a first agent (e.g., an antisense oligonucleotide) that binds to a defective or altered STMN2 RNA sequence and a second agent that inhibits JNK.
[0081] In some embodiments, the pharmaceutical composition comprises an effective amount of an agent (e.g., an antisense oligonucleotide) that binds to an STMN2 mRNA, pre-mRNA, or nascent RNA sequence encoding a cryptic exon, an effective amount of a second agent, and a pharmaceutically acceptable carrier, diluent, or excipient.
[0082] Compositions containing agents (e.g., antisense oligonucleotides) that bind to defective or altered STMN2 RNA sequences can be used to treat diseases or conditions associated with impaired TDP-43 function or TDP pathology. In some embodiments, compositions containing agents (e.g., antisense oligonucleotides) that bind to defective or altered STMN2 RNA sequences can be used to treat diseases or conditions associated with mutated or reduced levels of STMN2 protein (e.g., in neuronal cells), as described herein.
[0083] Treatment method The present disclosure contemplates various treatment methods utilizing compositions containing agents (e.g., antisense oligonucleotides) that restore normal-length STMN2 RNA or protein-encoding STMN2 RNA. In some embodiments, the agents (e.g., antisense oligonucleotides) specifically bind to STMN2 mRNA, pre-mRNA, or nascent RNA sequences that arise and increase in abundance when TDP-43 function is reduced or a TDP pathology is present, thereby suppressing or preventing the inclusion of defective or altered STMN2 RNA sequences. In some embodiments, the agents restore expression of normal full-length STMN2 RNA or protein-encoding STMN2 RNA. In some embodiments, the agents suppress or prevent the inclusion of cryptic exons in STMN2 RNA. In some embodiments, the agents activate STMN2 protein expression.
[0084] In some aspects, the present disclosure contemplates the treatment of any disease or condition in which the disease is associated with impaired TDP-43 function or a TDP pathology. In some embodiments, the inventions disclosed herein relate to methods of treating mutated or reduced levels of TDP-43 in neuronal cells (e.g., diseases or conditions with TDP-43-associated pathology). In some embodiments, the inventions disclosed herein relate to methods of treating TDP-43-associated dementia (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease, or TBI).
[0085] In some embodiments, the invention disclosed herein relates to methods for treating a disease or condition associated with altered, increased, or decreased levels of TDP-43. In some embodiments, the invention disclosed herein relates to methods for treating a disease or condition associated with mislocalized TDP-43. In some embodiments, the invention disclosed herein relates to methods for treating a disease or condition associated with altered or decreased levels of STMN2 protein and / or mislocalization of STMN2 protein. In some embodiments, the invention disclosed herein relates to methods for treating a disease or condition associated with proteasome inhibitor-induced neuropathy (e.g., neuropathy resulting from a reduced amount of functional nuclear TDP-43). In some embodiments, the invention disclosed herein relates to methods for treating a neurodegenerative disorder. In some embodiments, the invention disclosed herein relates to methods for treating a disorder or condition associated with or resulting from TBI (e.g., concussion).
[0086] In some embodiments, mutation or reduction of the level of TDP-43 (e.g., nuclear TDP-43) mutates or reduces the level of STMN2 protein. Mislocalization of TDP-43 can increase the level of TDP-43 in the cytosol but reduce the level of nuclear TDP-43. Furthermore, STMN2 levels can be reduced as a result of mutation of TDP-43. In some embodiments, mutation or increase of the level of TDP-43 (e.g., nuclear TDP-43) mutates or reduces the level of STMN2 protein.
[0087] In some embodiments, treatment methods include increasing the level of STMN2 protein and / or preventing degradation or slowing of STMN2 protein. In some embodiments, treatment methods include correcting altered or reduced levels of STMN2 protein. In some embodiments, treatment methods include increasing the amount or activity of STMN2 RNA. In some embodiments, treatment methods include increasing the amount of STMN2 protein, e.g., increasing activation of protein expression. In some embodiments, treatment methods include suppressing or preventing the inclusion of cryptic exons in STMN2 RNA (e.g., STMN2 mRNA). In some embodiments, treatment methods include rescuing neurite outgrowth and axon regeneration.
[0088] In some embodiments, the treatment method comprises administering to a subject an effective amount of an agent (e.g., an antisense oligonucleotide) that prevents degradation of STMN2 protein. In some embodiments, the treatment method comprises administering to a subject an effective amount of an agent that encodes normal-length STMN2 RNA or protein. In some embodiments, the treatment method includes administering to a subject an effective amount of an agent that binds to the defective or altered STMN2 RNA sequence. In some embodiments, the treatment method includes administering to a subject an effective amount of an agent that suppresses or prevents the inclusion of a cryptic exon in STMN2 RNA (e.g., in neuronal cells). In some aspects, the agent increases STMN2 levels through exon skipping. In some aspects, the agent is an oligonucleotide, a protein, or a small molecule. For example, the agent can be an oligonucleotide (e.g., an antisense oligonucleotide) that specifically binds to the STMN2 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence encoding the cryptic exon.
[0089] In certain embodiments, a method of treatment comprises administering to a subject an effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-85. In some aspects, a method of treatment comprises administering to a subject an effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some embodiments, a method of treatment comprises administering to a subject an effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In some embodiments, a method of treatment comprises administering to a subject an effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises SEQ ID NO: 52. In some embodiments, a method of treatment comprises administering to a subject an effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In some embodiments, a method of treatment comprises administering to a subject an effective amount of an antisense oligonucleotide, wherein the antisense oligonucleotide comprises SEQ ID NO: 73. In some embodiments, a method of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease, or TBI) comprises administering to a subject an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOs: 37-85, or alternatively from the group consisting of SEQ ID NOs: 37-74. In some embodiments, a method of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease, or TBI) comprises administering to a subject an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78.In some embodiments, a method of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease, or TBI) comprises administering to a subject an antisense oligonucleotide comprising SEQ ID NO: 52. In some embodiments, a method of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease, or TBI) comprises administering to a subject an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In some embodiments, a method of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease, or TBI) comprises administering to a subject an antisense oligonucleotide comprising SEQ ID NO: 73. In some embodiments, the method of treatment comprises administering a second agent.
[0090] In some embodiments, the agent (e.g., antisense oligonucleotide) is administered in an amount effective to increase and / or restore STMN2 protein levels (e.g., in in vitro or in vivo).
[0091] In some aspects, the agent (e.g., an antisense oligonucleotide) suppresses cryptic splicing. In some embodiments, subjects treated with an agent that suppresses or prevents the inclusion of cryptic exons in STMN2 RNA exhibit improved growth and / or repair of neurons (e.g., motor axons). In some aspects, the agent prevents degradation of STMN2 protein. In some aspects, the agent improves symptoms of neurodegenerative diseases, including ataxia, neuropathy, synaptic dysfunction, cognitive deficits, and / or reduced lifespan.
[0092] In some embodiments, inclusion of cryptic exons into STMN2 RNA is suppressed or prevented using genome editing (e.g., CRISPR / Cas).
[0093] As used herein, "treat," "treatment," "treating," or "palliative," when used in reference to a disease, disorder, or condition, refers to therapeutic treatment of a condition, the purpose of which is to reverse, alleviate, relieve, inhibit, slow, or halt the progression or severity of the symptoms or condition. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if the progression of the condition is reduced or halted. That is, "treatment" includes not only the improvement of symptoms or markers, but also the halting or at least slowing of the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of one or more symptom(s), a reduction in the degree of deficit, a stabilized (i.e., non-worsening) state (e.g., of a neurodegenerative disorder), a delay or slowing of the progression of a neurodegenerative disorder, and an increase in lifespan compared to that expected in the absence of treatment.
[0094] "Neurodegenerative disorder" refers to a disease state involving neuronal loss mediated or at least partially characterized by at least one of alterations of neural stem cells and / or progenitor cells. Non-limiting examples of neurodegenerative disorders include polyglutamine expansion disorders (e.g., HD, dentatorubral-pallidoluysian atrophy, Kennedy disease (also known as spinal-bulbar muscular atrophy), and spinocerebellar ataxias (e.g., types 1, 2, 3 (also known as Machado-Joseph disease), 6, 7, and 17)), other trinucleotide repeat expansion disorders (e.g., Fragile X syndrome, Fragile XE mental retardation, Friedreich's ataxia, myotonic dystrophy, spinocerebellar ataxia type 8, and spinocerebellar ataxia type 12), Alexander disease, Alpers disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), ataxia-telangiectasia, Batt's disease, and others. These include: Spillmeyer-Voigt-Sjögren-Batten disease, Canavan disease, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, Guillain-Barré syndrome, ischemic stroke, Krabbe disease, kuru, dementia with Lewy bodies, multiple sclerosis, multiple system atrophy, non-Huntington's chorea, Parkinson's disease, Pelizaeus-Merzbacher disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum disease, Sandhoff disease, Schilder's disease, spinal cord injury, spinal muscular atrophy (SMA), Steele-Richardson-Olszewski disease, frontotemporal dementia (FTD), and tabes dorsalis. In some circumstances, neurodegenerative disorders involve nerve injury or damage to the CNS or PNS associated with physical injury (e.g., head trauma, mild to severe traumatic brain injury (TBI), diffuse axonal injury, cerebral contusion, acute brain swelling, etc.).
[0095] In some embodiments, the neurodegenerative disorder is a disorder associated with altered or reduced levels of TDP-43 in neurons. In some embodiments, the neurodegenerative disorder is a disorder associated with altered or reduced levels of STMN2 protein and / or mislocalization of STMN2 protein. In some embodiments, the neurodegenerative disorder is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), frontotemporal lobar degeneration (FTLD), Alzheimer's disease, Parkinson's disease, inclusion body myositis (IBM), and combinations thereof. In some aspects, the neurodegenerative disorder is ALS. In some aspects, the neurodegenerative disorder is ALS in combination with FTD and / or FTLD. In some aspects, the neurodegenerative disorder is Alzheimer's disease. In some aspects, the neurodegenerative disorder is Parkinson's disease.
[0096] "Proteasome inhibitor-induced neuropathy" is used herein to refer to a disorder or condition resulting from a reduction in the amount of functional nuclear TDP-43. Nuclear TDP-43 may be reduced at a global level, or the reduction in levels may result from increased cytoplasmic aggregation of TDP-43, which induces the excretion of nuclear TDP-43. In some embodiments, proteasome inhibition leads to a reduction in STMN2 expression.
[0097] "Traumatic brain injury" or "TBI" refers to intracranial injury that occurs when an external force damages the brain. TBI can be classified based on its severity (e.g., mild, moderate, or severe), mechanism (e.g., closed or penetrating head injury), or other characteristics (e.g., location). TBI can result in physical, cognitive, social, emotional, and behavioral symptoms. Conditions associated with TBI include concussion. TBI and TBI-related conditions are associated with TDP-43 pathology. In some embodiments, alterations in STMN2 occur in TBI or related conditions.
[0098] In some embodiments, the traumatic brain injury is or results in a disorder associated with altered levels of TDP-43 in neurons. In some embodiments, the traumatic brain injury is or results in a disorder associated with altered or reduced levels of STMN2 protein and / or mislocalization of STMN2 protein. In some embodiments, the severity of the traumatic brain injury is measured based on a decrease in functional TDP-43 in neurons. In some embodiments, the severity of the concussion is measured based on a decrease in functional TDP-43 in neurons.
[0099] For administration to a subject, the agents disclosed herein can be provided in pharmaceutically acceptable compositions that comprise a therapeutically effective amount of one or more of the agents formulated together with one or more pharmaceutically acceptable carriers (excipients) and / or diluents. The pharmaceutical compositions of the present invention can be specially formulated for administration in solid or liquid form, including those suitable for: (1) oral administration, e.g., drench (aqueous or non-aqueous solution or suspension), gavage, lozenge, dragee, capsule, pill, tablet (e.g., buccal, sublingual, and those intended for systemic absorption), bolus, powder, granule, paste for application to the tongue; (2) parenteral administration, e.g., by subcutaneous, intramuscular, intrathecal, intercranially, intravenous, or epidural injection, as a sterile solution or suspension, or sustained release formulation; (3) topical application, e.g., as a cream, ointment, or controlled-release patch applied to the skin, or spray; (4) vaginal or rectal, e.g., as a pessary, cream, or foam; (5) sublingual; (6) intraocular; (7) transdermal; (8) transmucosal; or (9) nasal. Additionally, the agent can be implanted in the patient or injected using a drug delivery system (see, e.g., Urquhart, et al., Ann. Rev. Pharmacol. Toxicol. 24:199-236 (1984); Lewis, ed., "Controlled Release of Pesticides and Pharmaceuticals" (Plenum Press, New York, 1981); U.S. Pat. Nos. 3,773,919; and 353,270,960, the contents of all of which are incorporated herein by reference).
[0100] As used herein, the term "pharmaceutically acceptable" refers to agents, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0101] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium, calcium, or zinc stearate, or steric acid), or solvent encapsulating material, that is involved in the carrying or transport of a subject drug from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of substances that can function as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols such as propylene glycol, (11) polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol (PEG), (12) esters such as ethyl oleate and ethyl laurate, (13) agar, (14) buffers such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffers, (21) polyesters, polycarbonates, and / or polyanhydrides, (22) bulking agents such as polypeptides and amino acids, (23) serum components such as serum albumin, HDL, and LDL, and (24) C2-C3 ethanol. 12These include alcohols, and (23) other non-toxic compatible substances used in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, fragrances, preservatives, and antioxidants may also be present in the formulation. The terms "excipient," "carrier," "pharmaceutically acceptable carrier," and the like are used interchangeably herein.
[0102] As used herein, the phrase "therapeutically effective amount" refers to an amount of a drug, substance, or composition, including a drug described herein, that is effective to produce some desired therapeutic effect in at least a subpopulation of cells in an animal at a reasonable benefit / risk ratio applicable to any medical treatment. For example, the amount of drug administered to a subject is sufficient to produce a statistically significant and measurable increase in the function of TDP-43.
[0103] Determining a therapeutically effective amount of the agents and compositions disclosed herein is well within the capabilities of one of ordinary skill in the art. Generally, a therapeutically effective amount may vary depending on the subject's history, age, condition, sex, and administration of other pharmaceutically active agents.
[0104] As used herein, the term "administering" refers to the placement of an agent or composition into a subject (e.g., a subject in need thereof) by a method or route that results in at least partial localization of the agent or composition at a desired site so that a desired effect occurs. Routes of administration suitable for the methods of the present invention include both local and systemic routes of administration. Generally, local administration delivers more of the administered agent to a specific location compared to the entire body of the subject, whereas systemic administration delivers the agent to substantially the entire body of the subject.
[0105] The compositions and medicaments disclosed herein can be administered by any suitable route known in the art, including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical administration (including buccal and sublingual). Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ingestion. "Injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracranial, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In preferred embodiments of the aspects described herein, the compositions are administered by intravenous infusion or injection.
[0106] As used herein, "subject" refers to a human or an animal (e.g., a mammal). Typically, an animal is a vertebrate, such as a primate, rodent, livestock, or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques (e.g., rhesus monkeys). Livestock and game animals include cows, horses, pigs, deer, bison, water buffalo, feline species, such as domestic cats, canine species, such as dogs, foxes, wolves, avian species, such as chickens, emus, ostriches, and fish, such as trout, catfish, and salmon. A patient or subject includes any subset of the foregoing, e.g., all of the above except one or more groups or species, such as humans, primates, or rodents. In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate (e.g., a human). The terms "patient" and "subject" are used interchangeably herein. A subject may be male or female. In some embodiments, the subject is suffering from a disease or condition associated with mutated or reduced levels of TDP-43 (e.g., in neuronal cells).
[0107] Screening Method The present disclosure contemplates a method for screening one or more test agents (e.g., one or more antisense oligonucleotides) to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with a TDP pathology. In some embodiments, the disease or condition is associated with mutations or a reduction in the level of TDP-43 (e.g., in neuronal cells). The present disclosure further contemplates a method for screening one or more test agents to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with either mutations or a reduction in the level of STMN2 protein.
[0108] In some embodiments, the method includes providing neuronal cells having reduced TDP-43 levels; contacting the cells with one or more test agents; determining whether the contacted cells have an increased level of STMN2 protein; and identifying the test agent as a candidate agent if the contacted cells have an increased level of STMN2 protein. In some aspects, determining whether the contacted cells have an increased level of STMN2 protein includes measuring the level of STMN2 protein in the contacted cells. In some aspects, the STMN2 protein level is measured using ELISA (e.g., sandwich ELISA), dot blot, and / or Western blot. In some aspects, determining whether the contacted cells have an increased level of STMN2 protein includes assessing the morphology or function of the contacted cells. For example, neurons lacking STMN2 may have an altered morphology from that of neurons having STMN2. In some aspects, the morphology or function of the contacted cells is assessed using immunoblotting and / or immunocytochemistry. In some aspects, the contacted cells are further assessed to determine whether they express full-length STMN2. It can be determined whether or not STMN2 RNA is expressed. STMN2 RNA expression can be measured using qRT-PCR.
[0109] In some embodiments, the method includes providing neuronal cells with altered TDP-43 levels; contacting the cells with one or more test agents; determining whether the contacted cells have an increased level of STMN2 protein; and identifying the test agent as a candidate agent if the contacted cells have an increased level of STMN2 protein. In some embodiments, determining whether the contacted cells have an increased level of STMN2 protein includes measuring the level of STMN2 protein in the contacted cells. In some embodiments, the STMN2 protein level is measured using ELISA, dot blot, and / or Western blot. In some embodiments, determining whether the contacted cells have an increased level of STMN2 protein includes assessing the morphology or function of the contacted cells. For example, neurons lacking STMN2 or having reduced amounts of STMN2 may have an altered morphology from that of neurons with normal levels of STMN2 (i.e., levels of STMN2 from a control sample). In some embodiments, the morphology or function of the contacted cells is assessed using immunoblotting and / or immunocytochemistry. In some embodiments, the contacted cells can be further evaluated to determine whether they express full-length STMN2 RNA. STMN2 RNA expression can be measured using qRT-PCR.
[0110] In some embodiments, the method includes providing neuronal cells with reduced TDP-43 levels; contacting the cells with one or more test agents; and determining whether the contacted cells have a cryptic exon in STMN2 RNA. The contacted cells can be evaluated using FISH RNA, or RT-PCT, qPCR, qRT-PCR, or RNA sequencing to identify whether a cryptic exon is present in STMN2 RNA. In some embodiments, the method includes providing neuronal cells with reduced TDP-43 levels; contacting the cells with one or more test agents; and determining whether the contacted cells express full-length STMN2 RNA. The contacted cells can be evaluated using RNA FISH, or RT-PCT, qPCR, qRT-PCR, or RNA sequencing.
[0111] In some embodiments, the method includes providing neuronal cells with altered TDP-43 levels; contacting the cells with one or more test agents; and determining whether the contacted cells have a cryptic exon in STMN2 RNA. The contacted cells can be evaluated using FISH RNA, or RT-PCT, qPCR, or RNA sequencing to identify whether a cryptic exon is present in STMN2 RNA. In some embodiments, the method includes providing neuronal cells with altered TDP-43 levels; contacting the cells with one or more test agents; and determining whether the contacted cells express full-length STMN2 RNA. The contacted cells can be evaluated using RNA FISH, RT-PCT, qPCR, qRT-PCR, or RNA sequencing.
[0112] Biomarkers In some embodiments, the present disclosure contemplates the use of STMN2 and / or ELAVL3 as biomarkers for diseases or conditions associated with diminished TDP-43 functionality (e.g., diseases or conditions with substantial TDP-43-associated pathology). In some embodiments, STMN2 and / or ELAVL3 can function as biomarkers for the presence of a disease or condition. In other embodiments, STMN2 and / or ELAVL3 can function as biomarkers for monitoring the progression of a disease or condition. In some embodiments, STMN2 and / or ELAVL3 protein levels are assessed. In some embodiments, STMN2 and / or ELAVL3 transcript levels are assessed.
[0113] In some embodiments, the disease or condition is associated with altered or decreased levels of TDP-43 in neuronal cells. In some embodiments, the disease or condition is associated with altered or increased levels of TDP-43 in neuronal cells. In some embodiments, the disease or condition is a neurodegenerative disease (e.g., amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemporal dementia (FTD)). In some embodiments, the disease or condition is associated with or results from traumatic brain injury.
[0114] In some aspects, methods for detecting a disease or condition associated with diminished TDP-43 functionality include obtaining a sample from a subject and evaluating the sample to determine whether it exhibits either altered or reduced levels of STMN2 and / or ELAVL3 protein. In some embodiments, STMN2 and / or ELAVL3 protein levels are measured using any method known to those of skill in the art, including immunoblotting, immunocytochemistry, dot blot, and / or ELISA. In certain aspects, STMN2 and / or ELAVL3 protein levels are measured using ELISA. In some aspects, methods for detecting a disease or condition associated with diminished TDP-43 functionality include obtaining a sample from a subject and evaluating the sample to determine whether it exhibits reduced levels of STMN2 and / or ELAVL3 transcripts. In some embodiments, STMN2 and / or ELAVL3 transcript levels are measured using any method known to those of skill in the art, including RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain embodiments, STMN2 and / or ELAVL3 transcript levels are measured using qRT-PCR. A decrease in STMN2 and / or ELAVL3 protein and / or transcript levels can be an indicator of a decline in TDP-43 functionality as a result of a disease or disorder. In some embodiments, the progression of a disease or condition associated with a decline in TDP-43 functionality is assessed by analyzing multiple samples from a subject over time (e.g., depending on a treatment protocol) and monitoring STMN2 and / or ELAVL3 protein and / or transcript levels.
[0115] In some embodiments, a method for detecting a neurodegenerative disease (e.g., ALS, FTD, Parkinson's disease, Alzheimer's disease) in a subject includes obtaining a sample (e.g., a biological fluid sample) from the diseased subject and determining whether the sample contains altered levels of STMN2 and / or ELAVL3 protein. In certain embodiments, the determination is performed using ELISA. In some embodiments, a method for detecting a neurodegenerative disease (e.g., ALS, FTD, Parkinson's disease, Alzheimer's disease) in a subject includes obtaining a sample (e.g., a biological fluid sample) from the diseased subject and determining whether the sample contains reduced levels of STMN2 and / or ELAVL3 transcripts. Screening of the sample can be performed using RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain embodiments, STMN2 and / or ELAVL3 transcript levels are measured using qRT-PCR. Decreased levels of STMN2 and / or ELAVL3 protein and / or transcripts may be an indicator of diminished functionality of TDP-43 as a result of a neurodegenerative disease or disorder.
[0116] In some embodiments, a method for detecting traumatic brain injury (TBI) in a subject includes obtaining a sample (e.g., a biological fluid sample) from the subject and determining whether the sample contains altered levels of STMN2 and / or ELAVL3 protein. In certain embodiments, the determination is performed using ELISA. In some embodiments, a method for detecting traumatic brain injury (TBI) in a subject includes obtaining a sample (e.g., a biological fluid sample) from the subject and screening the sample for reduced levels of STMN2 and / or ELAVL3 transcripts. Screening the sample can be performed using RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain embodiments, STMN2 and / or ELAVL3 transcript levels are measured using qRT-PCR. A reduction in STMN2 and / or ELAVL3 protein and / or transcript levels can be an indicator of impaired TDP-43 functionality as a result of TBI.
[0117] In some aspects, the present disclosure contemplates the use of cryptic variants of STMN2 as biomarkers for diseases or conditions associated with impaired TDP-43 functionality (e.g., diseases or conditions with substantial TDP-43-associated pathology). In some embodiments, the disease or condition is a neurodegenerative disease (e.g., ALS, FTD, Alzheimer's disease, Parkinson's disease). In some embodiments, the disease or condition is associated with or results from traumatic brain injury.
[0118] In some embodiments, a method for detecting a disease or condition associated with reduced functionality of TDP-43 includes obtaining a sample from a subject and evaluating the sample to determine whether it contains a cryptic variant of STMN2. In some embodiments, the STMN2 transcript is evaluated using RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain embodiments, the STMN2 transcript is measured using qRT-PCR. The presence of a cryptic variant of STMN2 can be an indicator of reduced functionality of TDP-43.
[0119] In some embodiments, a method for detecting a neurodegenerative disease includes obtaining a sample (e.g., a biological fluid sample) from a subject and screening the sample for a potential STMN2 variant. The sample screening can be performed using PCR. The presence of a potential STMN2 variant can be an indicator of a decrease in TDP-43 functionality as a result of a neurodegenerative disease or disorder.
[0120] In some embodiments, a method for detecting TBI includes obtaining a sample (e.g., a biological fluid sample) from a subject and screening the sample for a potential STMN2 variant. The sample screening can be performed using PCR. The presence of a potential STMN2 variant can be an indicator of a decrease in TDP-43 functionality as a result of traumatic brain injury. [Example]
[0121] Example 1: In a landmark finding, TDP-43 (TAR DNA-binding protein 43) was found to be a major component of ubiquitin-positive inclusions in many sporadic cases of ALS and in a large subset of FTD (7). TDP-43 is a primarily nuclear DNA / RNA-binding protein (8) with functional roles in transcriptional regulation (9), splicing (10, 11), pre-miRNA processing (12), stress granule formation (13, 14), and mRNA transport and stability (15, 16). Subsequently, autosomal dominant, clearly causative TARDBP mutations were identified in both ALS and FTD families, linking genetics to neurodegenerative pathology (17-21). Therefore, elucidating the role that TDP-43 mislocalization and mutations play in disease is essential to understanding both sporadic and familial ALS.
[0122] It remains unclear whether neurodegeneration associated with TDP-43 pathology results from a loss-of-function mechanism, a gain-of-toxicity mechanism, or a combination of both (22). Early studies showed that overexpression of both wild-type and mutant TDP-43 led to its aggregation and loss of nuclear localization (22). These studies, along with the autosomal dominant inheritance pattern of TARDBP mutations, seem to support the gain-of-toxicity view, but suggest that loss of nuclear TDP-43 (commonly associated with its aggregation) may also impair its normal function. Subsequent findings revealed that depletion of TDP-43 in developing embryos or postmitotic motor neurons can have profound consequences (23-27).
[0123] Given the myriad roles that TDP-43 plays in neuronal RNA metabolism, an important question arose: what RNA substrates are misregulated upon TDP-43 mislocalization and how do they contribute to motor neuropathy? Early efforts to answer this question utilized crosslinking and immunoprecipitation with RNA sequencing (RNA-seq) of whole brain homogenates from either patients or mice with TARDBP knockdown (11, 28). These resulting findings led to the general understanding that many transcripts are regulated by TDP-43, with a preference for long RNAs containing UG repeats and long introns. However, the predominance of glial RNAs in the brain homogenates sequenced in these experiments limited insight into the specific neuronal targets of TDP-43. As a result, few clear connections could be made between TDP-43 target RNAs and mechanisms of motor neuron degeneration.
[0124] To identify substrates that, when misregulated, contribute to neuronal degeneration, we sought to identify RNAs regulated by TDP-43 in purified human motor neurons. Because vulnerable motor neurons from living ALS patients are inherently difficult to obtain for isolation and experimental perturbation, directed differentiation approaches have been developed to induce human pluripotent stem cells into motor neurons (hMNs) to study ALS and other neurodegenerative conditions in vitro (29-31). Here, we performed RNA-seq of hMNs after TDP-43 knockdown to identify transcripts whose abundance is positively or negatively regulated by TDP-43 deficiency. In total, we identified 885 transcripts that require TDP-43 to maintain normal RNA levels. While misregulation of any number of these targets may play a minor role in motor neuron degeneration, we observed that one of the most abundant transcripts in motor neurons, encoding STMN2, was particularly sensitive to TARDBP attenuation but not to FUS or C9ORF72 activity. Furthermore, STMN2 levels were found to be reduced in hMNs expressing mutant TDP-43 and in hMNs in which the proteasome was pharmacologically inhibited, which was shown to induce the cytoplasmic accumulation and aggregation of TDP-43 in rodent neurons (32). Furthermore, STMN2, a known regulator of microtubule stability, was shown to encode a protein required for the growth and repair of normal human motor neurons. Importantly, the loss of STMN2 function as a result of the loss of TDP-43 activity may be functionally relevant to people with ALS, as its expression was also found to be reproducibly reduced in motor neurons of ALS patients.
[0125] result Differentiation and purification of human motor neurons (hMNs) To generate hMNs, the human embryonic stem cell line HUES3 Hb9::GFP (33, 34) was differentiated into GFP+ hMNs under adherent culture conditions (35, 36) using a modified 14-day strategy (Figure 7A). This approach relies on neural induction via small molecule inhibition of SMAD signaling, accelerated neural differentiation via inhibition of FGF and NOTCH signaling, and MN patterning via activation of the retinoic acid (RA) and sonic hedgehog signaling pathways (Figure 7A). At day 14 of differentiation, cultures containing approximately 18–20% GFP+ cells were routinely obtained (Figure 7B). Two days after fluorescence-activated cell sorting (FACS), more than 95% of the resulting cells expressed the transcription factor HB9 (Figure 7C–7D). After an additional 8 days, the cultures consisted of neurons expressing the transcription factor Islet-1 (80%) and the pan-neuronal cytoskeletal proteins β-III tubulin (97%) and microtubule-associated protein 2 (MAP2) (90%) (Figures 7E–7F). FACS and whole-cell patch-clamp recordings after 10 days of culture in glial-conditioned medium supplemented with neurotrophic factors revealed that these purified hMNs were electrophysiologically active (Figures 7G–7I). Upon depolarization, hMNs exhibited an initial fast inward current followed by a slow outward current, consistent with the expression of functional voltage-activated sodium and potassium channels, respectively (Figure 7G). Furthermore, hMNs fired repetitive action potentials (Figure 7H) and responded to the excitatory neurotransmitter kainate (Figure 7I). Together, these data demonstrated that these purified hMN cultures possessed the expected functional properties.
[0126] RNA-Seq of hMNs with reduced levels of TDP-43 The reduction of nuclear TDP-43 observed in ALS is emerging as a possible cellular mechanism that may contribute to downstream neurodegenerative events (7, 37). Therefore, we sought to identify specific RNAs regulated by TDP-43 in purified hMN populations by combining knockdown and RNA-Seq approaches. Using short interfering RNA conjugated to Alexa Fluor 555, we first verified transfection conditions for achieving high levels (approximately 94.6%) of siRNA delivery to hMNs (Figures 8A-8C). We then analyzed TDP-43 expression in purified hMNs at three different time points (days 2, 4, and 6) after siRNA delivery using two distinct siRNAs targeting the TDP-43 transcript (siTDP43) and two control siRNAs with scrambled sequences that do not target any specific gene (siSCR and siSCR_555). RNAi was performed (Figure 8A). After siRNA transfection, total RNA and protein were isolated from neurons. qRT-PCR assays confirmed downregulation of TDP-43 mRNA levels at all time points in MNs treated with siTDP43, but not in those treated with the scrambled control, with maximum knockdown occurring 4 days after siRNA transfection (Figure 8D). Furthermore, TDP-43 depletion was also confirmed at the protein level by immunoblot assay, with siTDP43-treated MNs showing a 54-65% reduction in TDP-43 levels (Figure 8E).
[0127] To capture global changes in gene expression in response to partial loss of TDP-43 in hMNs, RNA-Seq libraries were prepared from siRNA-treated cells (Figure 1A). Next-generation sequencing yielded expression data for each gene, annotated as transcripts per million (TPM). Initial unsupervised hierarchical clustering revealed transcriptional effects based on the batch of MN production (experiment 1 vs. experiment 2) (Figure 9A). Subsequent principal component analysis of the RNA-Seq samples focused on the 500 most differentially expressed genes. Separating samples based on siTDP-43 treatment (pc1) showed that reduced TDP-43 levels resulted in robust transcriptional differences, followed by the batch of MN production (pc2) (Figure 1B). Examination of TPM values for TDP-43 transcripts confirmed that their abundance was significantly reduced only in MNs treated with siTDP43 (Figure 9B). We then performed differential gene expression analysis using the DESeq2 bioinformatics tool suite (38) and identified a total of 885 statistically differentially expressed genes in hMNs after TDP-43 knockdown at a 5% false discovery rate (FDR) (Figures 1C-1D). In these cells, TPM values were significantly higher for 392 genes ("upregulated") and significantly lower for 493 genes ("downregulated") compared to TPM values in MNs treated with a scrambled-sequence siRNA control (Figures 1C-1D).
[0128] In addition to altering the overall transcription levels of hundreds of genes in the mammalian CNS (11), reduced levels of TDP-43 can also affect gene splicing (11, 39-42). Comprehensive analysis of splice variants traditionally requires splice-sensitive exon arrays (11, 39), but the development of computational approaches for isoform deconvolution of RNA-Seq reads is rapidly evolving (43-45). Limited testing of the data using the bioinformatics algorithm Cuffdiff 2 (45) indeed detected the POLDIP3 gene as a prime candidate for differential splicing involving two significant isoform switching events (Figure 9C), which has previously been associated with loss of TDP-43 function both in vitro and in vivo (42, 46).
[0129] Among the 885 genes identified as significantly misregulated after TDP-43 knockdown, a subset of candidates was selected for further validation. First, we considered genes enriched in neuronal expression (STMN2 (47, 48), ELAVL3 (49)) and genes associated with neurogenesis and neurological disorders (RCAN1 (50), NAT8L (51)). Additionally, we considered genes with adequate expression levels (TPM ≥ 5) and high fold changes (SELPLG, NAT8L) as "positive controls," as these candidates were hypothesized to be more potent and promising for validation. Next, we obtained RNA from independent biological replicates after TDP-43 knockdown and determined the relative expression levels of 11 candidate genes, including TARDBP, by qRT-PCR. Notably, differential gene expression of 9 of these 11 genes was confirmed in cells treated with either siTDP-43 compared to those treated with the scrambled control (Figures 1E-1F). These results demonstrate reproducible expression differences among selected genes and confirm the findings from the RNA-Seq analysis.
[0130] STMN2 levels are downregulated in hMNs expressing mutant TDP-43 Next, we asked whether any of the RNAs whose abundance changed after TDP-43 depletion were also perturbed by the expression of mutant forms of TDP-43 that cause ALS. To this end, we investigated putative TDP-43 target RNAs that showed reproducible changes in expression after TDP-43 knockdown in motor neurons derived from patient iPSCs harboring pathogenic mutations in TARDBP (Figure 10). Based on previous experience with pluripotent stem cells, directed differentiation approaches were known to tend to produce heterogeneous cultures, making quantitative comparative analysis difficult (52). Furthermore, the presence of mitotic progenitor cells is particularly problematic, as they can overwhelm the culture and distort results. To overcome these obstacles, we performed unbiased FACS-based immunoprofiling analysis on the differentiated HUES3 Hb9::GFP cell line using 242 antibodies against cell surface markers (53) and identified signatures enriched in GFP+ and GFP cells (Figure 11A). By sorting NCAM+ / EpCAM- cells, we were able to identify proliferating EdU cells from the culture. + We found that this cell surface signature can be used to normalize the number of MAP2+ / Islet-1+ neurons across multiple induced pluripotent stem cell differentiations (Figures 11B-11D). We used this cell surface signature to differentiate five control iPSC lines (11a, 15b, 17a, 18a, and 20b) and four iPSC lines with different TDP-43 mutations (36a (Q343R), 47d (G298S), CS (M337V), and RB20 (A325T)), and FACS-purified the resulting MNs. As expected, each iPSC line expressed NCAM. + They showed a unique propensity to differentiate into MNs (Figures 11E-11F). However, after sorting, homogeneous neuronal cultures were obtained for all iPSC lines (Figure 2B).
[0131] After an additional 10 days of neuronal culture, total RNA from these FACS-purified MNs was harvested and qRT-PCR was performed to examine the levels of the gene products most reproducibly affected by TDP-43 depletion (ALOX5AP, STMN2, ELAVL3, and RCAN1). Significant reductions in transcript levels were observed for two of the genes (STMN2 and ELAVL3) (Figures 2C–2F). Consistent with the TDP-43 depletion experiments, no significant changes in the abundance of the closely related STMN1 RNA were observed, suggesting a specific relationship between TDP-43 and STMN2 (Figures 2H, 12E). Furthermore, no significant differences in TDP-43 transcript levels were observed between mutant and control neurons (Figure 2G). Taken together, these data imply that the presence of pathogenic point mutations in TDP-43 can alter the mRNA levels of STMN2 and ELAVL3 without affecting their own levels.
[0132] We next investigated how ALS-associated mutations could interfere with TDP-43's ability to regulate target transcripts. Previous studies have reported that hMNs derived from iPSC lines expressing mutant TDP-43 recapitulate several aspects of TDP-43 pathology, including its accumulation in both soluble and insoluble cellular protein extracts (54, 55) and cytoplasmic mislocalization (56). Because the reduction in nuclear TDP-43 in mutant neurons could resemble the partial loss induced by siRNA, we examined signs of TDP-43 mislocalization using immunofluorescence. However, we observed primarily nuclear staining of TDP-43 in both control and mutant neurons (Figure 2I). Pearson's correlation coefficient analysis confirmed these observations, revealing a strong correlation between TDP-43 immunostaining and DNA counterstaining for both mutant and control neurons (Figure 2J). These results are consistent with some TDP-43 iPS disease modeling studies (56) but not others (54), raising the possibility that additional cellular perturbations may be required to induce TDP-43 mislocalization (57). Collectively, the data suggest that a subset of genes affected after TDP-43 depletion are also altered in neurons expressing mutant TDP-43, and that these changes precede the characteristic cytoplasmic aggregation of TDP-43. Thus, at least from the perspective of these limited number of transcripts, the data suggest that TDP-43 mutations may partially contribute to loss-of-function transcriptional phenotypes.
[0133] STMN2 levels are regulated by TDP-43 in hMNs It was intriguing to observe a decrease in stathmin-like 2 (STMN2) transcripts both in neurons expressing mutant TDP-43 and after TDP-43 depletion. STMN2 is one of four proteins (STMN1, STMN2, SCLIP / STMN3, and RB3 / STMN4) belonging to the stathmin family of microtubule-associated proteins, which have functional roles in regulating the neuronal cytoskeleton and axon regeneration pathways (47, 48, 58-62). In humans, the STMN1 and STMN3 genes are ubiquitously expressed, whereas STMN2 and STMN4 are enriched in CNS tissues (63). Given the relevance of the cytoskeletal pathway in ALS (64-66) and growing evidence of its enrichment within the CNS, we focused on further characterizing the relationship between STMN2 and TDP-43.
[0134] First, we tested whether the significant downregulation of STMN2 transcripts also reduced STMN2 protein levels. In independent RNAi experiments, qRT-PCR was performed using two different sets of primer pairs that bind to STMN2 mRNA. Significant downregulation (approximately 50-60%) was observed in siTDP43-treated hMNs compared to controls (Figure 3A). Next, immunoblot assays were performed on hMN protein lysates, revealing that STMN2 protein levels were also reduced in siTDP-43-treated hMNs (Figure 3B).
[0135] Next, we investigated whether downregulation of two other ALS-associated genes, FUS or C9ORF72 (5, 67), also alters STMN2 levels in human MNs. The FUS protein, structurally similar to TDP-43, is also involved in RNA metabolism (68), and FUS variants have been detected in familial ALS and FTD cases (69). The function of C9ORF72 is an area of active research, and large repeat expansions in the intronic region of C9ORF72 are responsible for a significant number of familial and sporadic ALS and FTD cases (70-72). Following induction of RNAi targeting TDP-43, FUS, or C9ORF72, significant downregulation of the respective siRNA target genes was observed by qRT-PCR (Figures 12A-12C). Downregulation of TDP-43 did not alter the expression levels of FUS or C9ORF72, and reduction of either FUS or C9ORF72 expression had no effect on other ALS-related genes (Figures 12A-12C). Knockdown of TDP-43 further reduced the levels of STMN2, but not FUS or C9ORF72 (Figure 3C). Importantly, these results demonstrate that downregulation of STMN2 is not a consequence of RNAi induction but is a specific molecular mechanism in response to partial loss of TDP-43.
[0136] TDP-43 can bind and regulate RNA molecules through a highly conserved RNA recognition motif (73). To determine whether TDP-43 directly associates with STMN2 RNA, which shares many canonical TDP-43-binding motifs (Figures 12F-12G), we formulated conditions for TDP-43 immunoprecipitation (Figure 3D), followed by formaldehyde RNA immunoprecipitation (fRIP). After reversing crosslinking, quantitative qRT-PCR was performed to detect bound RNA molecules. We sought amplification from TDP-43 RNA transcripts, as this autoregulation is well established, as is STMN2 transcripts (11). In both cases, enrichment after TDP-43 pulldown was observed, but not for the IgG control or when a different ALS-associated protein, SOD-1, was pulled down (Figures 3E-3F). Taken together, the results indicate that TDP-43 directly associates with STMN2 mRNA and that reduction of TDP-43 levels leads to reduction of STMN2 levels.
[0137] Function of STMN2 in hMN Next, we investigated the function of STMN2 in hMNs. First, we examined STMN2 expression throughout the differentiation process that produces MNs (Figure 12D). Supporting previous expression studies (62, 63, 74), STMN2 protein was not detectable in stem cells or neuronal progenitor cells, indicating its selective expression in differentiated neurons (Figure 12D). We then used immunocytochemistry to explore the subcellular localization of STMN2, revealing that it was localized to individual cytoplasmic puncta at the tips of neurites, with a particular enrichment in the perinuclear region (Figure 3G). Using a human-specific antibody against the Golgi-associated protein GOLGIN97, we confirmed that this region corresponds to the Golgi apparatus (Figure 3H), confirming the prediction that the STMN2 N-terminus is a palmitoylation target for vesicle transport and membrane binding (75). STMN2 has also been predicted to function in growth cones during neurite outgrowth and injury (47). When hMNs were stained immediately after differentiation and sorting, strong staining for STMN2 was observed at the interface between microtubules and F-actin bundles, a component that defines the growth cone (Figure 3I). These findings support a role for STMN2 in microtubule dynamics in the growth cone. Taken together, the data indicate that STMN2 may function in the cytoskeletal defects and altered axonal transport pathways involved in the pathogenesis of ALS (76).
[0138] To investigate the cellular consequences of reducing STMN2 levels in hMNs, we generated STMN2 knockout stem cells. Specifically, we used a CRISPR / Cas9-mediated genome editing strategy (Figure 4A) to generate a large deletion in the human STMN2 locus in two hES cell lines (WA01 and HUES3 Hb9::GFP). After performing a primary PCR screen to identify clones harboring an 18-kb deletion in the STMN2 gene (Figure 4B), protein knockout in differentiated hMNs was confirmed by both immunoblotting and immunocytochemistry (Figures 4C-4D). As expected, hMNs derived from the candidate deletion clones exhibited a complete lack of STMN2 staining when compared to the parental STMN2+ / + line.
[0139] Given the reported role of STMN2 in regulating axon growth by promoting microtubule dynamic instability (77), we performed a phenotypic assay to characterize neurite outgrowth in STMN2- / - hMNs. After 7 days in culture, sorted hMNs were fixed and stained for β-III-tubulin to label neurites (Figure 4E). Sholl analysis (78), which quantifies the number of crossovers at a given distance from the center of the soma, revealed that STMN2 + / + Compared with STMN2 - / - A significant reduction in neurite outgrowth was evident in the STMN line (Figures 4F-4G). Separately, neurons were cultured in the presence of the ROCK inhibitor Y-27632, which has been shown to increase neurite outgrowth. The difference in neurite outgrowth was due to the presence of STMN. + / + Enhances the growth of strains but STMN - / - This was even more striking in these experiments with molecules that did not enhance the growth of the line, suggesting a role for STMN2 in this signaling cascade (Figure 4H). Similar results were observed in the WA01 cell line (Figure S13).
[0140] Next, we asked whether STMN2 functions not only in neuronal growth but also in neuronal repair after injury. To test these hypotheses, sorted hMNs were seeded into a microfluidic device that allows for the independent cultivation of axons from neuronal cell bodies (79) (Figure 4I). Cells cultured in the somatic compartment of the device for 7 days extended axons through the microchannel into the axonal chamber (Figure 4J). Vacuum aspiration and reperfusion of the axonal chamber were repeatedly performed until the axons were substantially severed without disturbing the cell bodies in the somatic compartment. Next, to assess axonal repair after injury, we measured the length of the neurites from the microchannel over time. Analysis revealed that STMN2 was expressed at all measured time points. + / + STMN2 compared to - / -A significant reduction in regrowth was evident in the WA01 cell line (Figure 4K). Similar results were observed in the WA01 cell line (Figure 13). Taken together, these data indicate that reducing STMN2 levels can have a measurable phenotypic effect on neurite outgrowth and complexity in hMNs, as well as repair after axotomy.
[0141] Proteasome function regulates TDP-43 localization and STMN2 levels Previous studies have demonstrated that proteasome inhibition in hMNs can induce the accumulation of mutant SOD-1 (31). Therefore, as a potential model of sporadic ALS, we tested whether MG-132-mediated proteasome inhibition affects TDP-43 localization in hMNs. First, we established the range and timing of small molecule treatments that can inhibit the proteasome without inducing overt cytotoxicity (Figures 14A–14D). We confirmed that neurons could tolerate an overnight 1 μM treatment, which reduced proteasome activity to less than 10% of normal activity (Figure 14E). Next, we performed pulse-chase experiments to confirm the effects of proteasome inhibition on TDP-43 localization (Figure 5A). Surprisingly, using Pearson's correlation coefficient analysis as previously described, we observed that nuclear TDP-43 staining was significantly reduced after a 24-hour 1 μM pulse of MG-132 (Figures 5B–5C). Notably, after washout, TDP-43 staining was found to be indistinguishable from that of unexposed neurons after 4 days (Figures 5B-5C). Thus, proteasome inhibition in hMNs induces reversible TDP-43 mislocalization. These findings are similar to stress-conditioning studies on primary cortical and hippocampal neurons, in which proteasome inhibition similarly caused a loss of TDP-43 nuclear staining (32).
[0142] To determine what happened to TDP-43 after proteasome inhibition, we examined TDP-43 levels by immunoblot analysis in both detergent-soluble and detergent-insoluble fractions. Soluble lysates from control neurons treated with low doses of MG-132 (Figure 5A) showed a significant decrease in TDP-43 levels (Figure 5D). Probing the UREA, or insoluble fraction, we found that proteasome inhibition induces TDP-43 to become insoluble (Figure 5D). Finally, we examined STMN2 levels in neurons treated with either short-term high doses or long-term low doses of MG-132. In both cases, we observed a significant decrease in STMN2 mRNA levels (Figure 5E). Together, these data link proteostasis to TDP-43 localization and STMN2 levels.
[0143] TDP-43 suppresses the emergence of cryptic exons in hMNs TDP-43 plays a crucial role in the nucleus regulating RNA splicing, and recent studies have shed light on its ability to suppress nonconserved or cryptic exons to maintain intron integrity (80). When RNA transcripts contain cryptic exons, their inclusion can often affect the normal levels of gene products by disrupting their translation or promoting nonsense-mediated decay (80). Interestingly, no overlap in genes regulated by TDP-43 cryptic exon suppression has been observed between mice and humans (80). We examined sequencing data for evidence of cryptic exons in genes observed to be reproducibly regulated by TDP-43 in human cancer cells (81). Nine of these 95 genes contained reads mapping to cryptic exons, including PFKP, which was consistently downregulated in RNA-Seq experiments (Figure 15A, Figure 3C). Based on this observation, we also examined RNA-Seq reads mapping to other genes consistently misregulated in hMNs after TDP-43 depletion. We found strong evidence for cryptic exon inclusion in both ELAVL3 and STMN2 (Figures 15B-15C). We next asked whether cryptic exon inclusion could contribute to the reduced STMN2 levels in hMNs after proteasome inhibition. To this end, we developed an RT-PCR assay to detect transcripts containing cryptic exons (Figure 5F). Only hMNs treated with proteasome inhibitors had detectable levels of the expected PCR product (Figure 5G), and Sanger sequencing of the PCR product confirmed the expected splice junction (Figures 15D-15E). Taken together, the data suggest that the mechanism of STMN2 downregulation is similar for both TDP-43 depletion and mislocalization.
[0144] STMN2 is expressed in human adult primary spinal cord MNs and is altered in ALS Finally, we sought to test whether our in vitro findings are relevant to motor neurons in ALS patients in vivo. To this end, we investigated STMN2 expression in controls and ALS patients using immunohistochemistry of human adult spinal cord tissue. We predicted that STMN2 protein levels would be altered in postmortem spinal cord MNs from sporadic ALS cases, which typically show pathological loss of nuclear TDP-43 staining and accumulation of cytoplasmic TDP-43 immunoreactive inclusions (7, 37). Similar to what was observed in stem cell-derived hMNs, strong STMN2 immunoreactivity was present in the cytoplasmic region of human adult lumbar spinal cord MNs but not in surrounding glial cells (Figures 6A–6C). We measured the percentage of MNs showing strong STMN2 immunoreactivity in lumbar spinal cord tissue sections from three control cases (no evidence of spinal cord disease) and three ALS cases. Consistent with our hypothesis, we observed that the percentage of lumbar spinal cord MNs with clear immunoreactivity for STMN2 antibodies was significantly reduced in tissue samples collected from sporadic ALS cases (Figure 6D). This finding is further supported by several independent expression studies of ALS postmortem samples. Three studies have performed laser dissection of motor neurons from ALS patients to perform expression studies. (82-84) When examining this data, we observed decreased STMN2 transcript levels in ALS patient samples compared to control samples (Figures 6E-6F).
[0145] Consideration These studies suggest that the abundance of hundreds of transcripts may be regulated by TDP-43 in human motor neurons, including several RNAs previously identified in relation to ALS research. For example, the findings suggest that BDNF expression may be partially regulated by TDP-43, which is noteworthy given previously observed decreased expression of this neurotrophin (85). MMP9 has previously been shown to define the population of motor neurons most susceptible to degeneration in the SOD1 ALS mouse model (86). These studies suggest that reduced TDP-43 function may induce more widespread expression of this factor, which may increase the susceptibility of motor neurons to degeneration. Further investigation of the transcripts identified here may provide insight into how perturbations to TDP-43 lead to motor neuron dysfunction.
[0146] An important unresolved question was what the mechanistic significance of familial TDP-43 mutations is and how their effects relate to the events that occur when TDP-43 pathologically relocalizes in patients with sporadic disease. The identification of motor neuron transcripts regulated by TDP-43 provided an opportunity to investigate the potential effects of different manipulations of TDP-43 associated with both familial and sporadic disease. First, we asked whether the subset of target RNAs identified as reduced after TDP-43 depletion would show significant expression changes in motor neurons from patients with TDP-43 mutations. Interestingly, we observed small but significant changes in the expression of the RNA-binding protein ELAVL3 and the microtubule regulator STMN2, but not the other identified putative targets. Therefore, reduced expression of target RNAs appears to be a TDP-43 phenotype, and the patient's mutation showed partial loss-of-function effects.
[0147] Mutant TDP-43 has previously been shown to be prone to aggregation when overexpressed (22). Several studies have also suggested that mutant TDP-43 is similarly prone to aggregation when expressed at native levels in patient-specific motor neurons (54, 56, 57). Experiments carefully monitored TDP-43 in these patient motor neurons to determine whether aggregation or loss of nuclear mutant TDP-43 could contribute to the reduced expression of STMN2 and ELAVL3, but no such defects were identified. While we cannot rule out the possibility that some loss or insolubility of nuclear TDP-43 below the detection range could account for the observed reduction in STMN2 and ELAVL3 expression, this finding is consistent with the idea that the affinity or ability of the mutant protein to process specific substrates may simply be reduced. Further biochemical experiments beyond the scope of this study may be required to distinguish between these potential hypotheses.
[0148] If mutant TDP-43 aggregates or loses nuclear accumulation in motor neurons of familial patients, it would be detectable. We observed that proteasome inhibition induces dramatic nuclear loss of TDP-43, accompanied by its insoluble accumulation. The idea for this procedure arose after discovering that proteasome inhibition leads to the accumulation of insoluble SOD1 in motor neurons derived from SOD1 ALS patient-specific stem cells but not in control motor neurons carrying only normal SOD1 (31). Interestingly, as clearly observed by others in a different context (32), proteasome inhibition caused the loss of nuclear TDP-43 and its insoluble accumulation, regardless of whether it was under the control of the disease genotype. This result was intriguing because it suggested that disruption of proteostasis induced by any number of ALS-related mutations or events may be upstream of the most common histopathological findings in sporadic ALS. This finding further suggested that relocalization of TDP-43 to the cytoplasm may initially provide a protective and adaptive response to disrupted proteostasis (87). However, the biochemical nature of this response and the liquid crystal conversion that these complexes may undergo could result in a transient response, leading to a pathological condition in which motor neurons are chronically depleted of key TDP-43-regulated RNAs (88). The finding that TDP-43 targets are depleted from motor neurons after proteasome inhibition is consistent with this model.
[0149] Although hundreds of RNAs were found to be affected by TDP-43 depletion, not all transcripts appeared to be equally affected by TDP-43 alterations; some, including those encoding STMN2 and ELAVL3, were found to be particularly sensitive. This observation raises an important question with substantial therapeutic implications: whether the primary effects of TDP-43 pathology in patients and its potential role in motor neuropathy and degeneration are propagated through a small number of target RNAs. If so, understanding the function of these important TDP-43 targets, the mechanisms by which they are disrupted, and whether they can be restored may be important, as it could direct attention to pathways downstream of TDP-43 pathology to restore motor neuron functionality. Given the established function of STMN orthologs and the magnitude of the effect of TDP-43 depletion on STMN2 levels, we wondered whether it could be such a target.
[0150] Stathmin family proteins are recognized as regulators of microtubule stability and have been demonstrated to modulate the biology of fly motor axons (77). Using gene editing, we confirmed whether STMN2 plays a critical function in human stem cell-derived motor neurons, finding that the absence of this protein severely impaired both motor axon growth and repair. While in vitro-generated hMNs share many molecular and functional properties with authentic MNs (29), in vivo validation of findings from stem cell-based models of ALS is an important test of their relevance to disease mechanisms and therapeutic strategies (89). Therefore, we used human adult spinal cord tissue to provide in vivo evidence substantiating the finding that STMN2 levels are altered in ALS. A possible mechanism for reduced STMN2 expression is the emergence of a cryptic exon. Appropriately targeted antisense oligonucleotides could inhibit this splicing event and restore STMN2 expression.
[0151] Materials and Methods Cell culture and differentiation of hESCs and hiPSCs into MNs Pluripotent stem cells were grown on tissue culture dishes coated with Matrigel™ (BD Biosciences) in mTeSR1 medium (Stem Cell Technologies) and maintained at 37°C in a 5% CO2 incubator. Stem cells were passaged as small aggregates of cells after treatment with 1 mM EDTA. 10 μM ROCK inhibitor (Sigma, Y-27632) was added to the cultures 16–24 hours after dissociation to prevent cell death. MNs were differentiated using a modified protocol based on adherent culture conditions combined with dual inhibition of SMAD signaling, inhibition of NOTCH and FGF signaling, and patterning by retinoic acid and SHH signaling. Briefly, ES cells were dissociated into single cells using accutase™ (Stem Cell Technologies) and plated at 80,000 cells / cm on Matrigel-coated culture plates in mTeSR1 medium (Stem Cell Technologies) supplemented with ROCK inhibitor (10 μM Y-27632, Sigma). 2 Cells were seeded at a density of 100%. When the cells reached 100% confluency, the medium was changed to differentiation medium (1 / 2 Neurobasal (Life Technologies™) 1 / 2 DMEM-F12 (Life Technologies™) supplemented with 1x B-27 Supplement (Gibco®), 1x N-2 Supplement (Gibco®), 1x Gibco® GlutaMAX™ (Life Technologies™), and 100 μM non-essential amino acids (NEAAs). This time point was defined as day 0 (d0) of motor neuron differentiation. Small molecule treatment was performed as follows: from d0 to d5, 10 μM SB431542 (Custom On d6–d14, 5 μM DAPT (Custom Synthesis), 4 μM SU-5402 (Custom Synthesis), 1 μM retinoic acid (Sigma), and 1 μM Smoothend agonist (Custom Synthesis).
[0152] Fluorescence-activated cell sorting (FACS) of GFP+MN On day 14, differentiation cultures were dissociated into single cells using accutase treatment for 1 hour in a 5% CO2 / 37°C incubator. Single cell preparation was achieved using gentle repeated pipetting (10-20 times) using a 1000 μL Pipetman®. Cells were spun down, washed once with PBS, and sorted in sorting buffer (1x cation-free PBS pH 7, 15 mM HEPES (Gibco®), 1% Cells were resuspended in BSA (Gibco®), 1x penicillin-streptomycin (Gibco®), 1 mM EDTA, and DAPI (1 μg / mL). Immediately prior to FACS analysis and purification, cells were passed through a 45 μm filter. Hb9::GFP was routinely isolated using a BD FACS Aria II cell sorter. + Cells were treated with 10 μM Cells were purified into collection tubes containing MN medium (Neurobasal (Life Technologies™), 1x N-2 supplement (Gibco®), B-27 supplement (Gibco®), GlutaMax, and NEAA) containing ROCK inhibitor (Sigma, Y-27632) and 10 ng / mL of the neurotrophic factors GDNF, BDNF, and CNTF (R&D). DAPI signal was used to characterize cell viability, and differentiated cells not exposed to MN patterning molecules (RA and SAG) were used as a negative control for gating on green fluorescence. For lines not containing the Hb9::GFP reporter, single-cell suspensions were incubated with antibodies against NCAM (BD Bioscience, BDB557919, 1:200) and EpCAM (BD Bioscience, BDB347198, 1:50) in sorting buffer for 25 min, then washed once with PBS 1x and resuspended in sorting buffer. 200,000 GFP per well for RNA-Seq experiments + Cells were seeded onto 24-well tissue culture dishes pre-coated with Matrigel. Purified MNs were fed and matured using MN medium supplemented with 10 ng / mL each of GDNF, BDNF, and CNTF (R&D Systems). RNA-Seq experiments and most downstream assays were performed on plates containing d10 purified MNs (cultured for 10 days after FACS) coated with 0.1 mg / mL poly-D lysine (Invitrogen) and 5 μg / mL laminin (Sigma-Aldrich) at approximately 130,000 cells / cm. 2 The concentration was
[0153] RNAi Purified GFP +RNAi in MN cultures was induced using Silencer® Select siRNA (Life Technologies™) targeting TDP-43 mRNA or a non-targeting siRNA control with a scrambled sequence not predicted to bind to any human transcripts. Lyophilized siRNA was resuspended in nuclease-free water and stored at -20°C as a 20 μM stock until ready for use. For transfection, siRNA was diluted in Optimem (Gibco®) and mixed with RNAiMAX (Invitrogen) according to the manufacturer's instructions. After a 30-minute incubation, the mixture was added dropwise to MN cultures to achieve a final siRNA concentration of 60 nM in each well in 1:1 Optimem:MN medium (Neurobasal (Life Technologies™), N2 supplement (Gibco®), B-27 supplement (Gibco®), GlutaMax, and NEAA), and 10 ng / mL each of GDNF, BDNF, and CNTF (R&D). Twelve to sixteen hours after transfection, the medium was changed. RNA-Seq experiments and validation assays were performed using material harvested four days after transfection.
[0154] immunocytochemistry For immunofluorescence, cells were fixed with ice-cold 4% PFA for 15 minutes at 4°C, permeabilized with 0.2% Triton-X in 1x PBS for 45 minutes, and blocked with 10% donkey serum in 1x PBS-T (0.1% Tween®-20) for 1 hour. Cells were then incubated with primary antibodies (diluted in blocking solution) overnight at 4°C. After at least four washes with 1x PBS-T (5 minutes each), cells were incubated with secondary antibodies (diluted in blocking solution) at room temperature for 1 hour. Nuclei were stained with DAPI. The following antibodies were used in this study: Hb9 (1:100, DSHB, MNR281.5C10-c), TUJ1 (1:1000, Sigma, T2200), MAP2 (1:10000, Abcam ab5392), Ki67 (1:400, Abcam, ab833), GFP (1:500, LifeTechnologies™, A10262), Islet1 (1:500, Abcam ab20670), TDP-43 (1:500, ProteinTech Group), STMN2 (1:4000, Novus), and AlexaFluor™ 647-Phalloidin (1:200). The secondary antibodies used (488, 555, 594, and 647) were AlexaFluor™ (1:1000, Life Technologies™) and DyLight (1:500, Jackson ImmunoResearch Laboratories). Photomicrographs were analyzed using FIJI software to determine correlation coefficients.
[0155] Immunoblot assay For analysis of TDP-43 and STMN2 protein expression levels, d10 MN cells were lysed in RIPA buffer (150 mM sodium chloride; 1% Triton X-100; 0.5% sodium deoxycholate; 0.1% SDS; 50 mM Tris pH 8.0) containing protease and phosphatase inhibitors (Roche) on ice for 20 min and centrifuged at high speed. 200 μL of RIPA buffer was routinely used per well of a 24-well culture, yielding approximately 20 μg of total protein as determined by BCA (Thermo Scientific). After washing twice with RIPA buffer, the insoluble pellet was resuspended in 200 μl of UREA buffer (Bio-Rad). For immunoblot assays, 2–3 μg of total protein was separated by SDS-PAGE (BioRad), transferred to PDVF membranes (BioRad), and probed with antibodies against TDP-43 (1:1000, ProteinTech Group), GAPDH (1:1000, Millipore), and STMN2 (1:3000, Novus). Insoluble pellets were loaded based on the protein concentration of their corresponding RIPA-soluble counterparts. The same PDVF membrane was immunoassayed two to three times using Restore™ PLUS Western Blot Stripping Buffer (Thermo Scientific). GAPDH levels were used to normalize each sample, and protein band signals were quantified using LiCor software.
[0156] RNA preparation, qRT-PCR, and RNA sequencing For RNA-seq experiments and validation assays, total RNA was isolated from d10 MN cells according to the manufacturer's instructions using Trizol LS (Invitrogen). 500 μL was added per well of a 24-well culture. A total of 300–1000 ng of total RNA was used to synthesize cDNA by reverse transcription according to the iSCRIPT kit (Bio-Rad). Quantitative RT-PCR (qRT-PCR) was then performed using SYBR Green (Bio-Rad) and the iCycler system (Bio-Rad). Quantitative levels of all assayed genes were normalized using GAPDH expression. Normalized expression was expressed relative to the relevant control samples (mostly siredox-treated MN cells or cells with 1x TDP-43 levels). For comparisons between patient lines, normalized expression was expressed relative to the mean of the pooled data points. All primer sequences are available upon request. For next-generation RNA sequencing (RNA-Seq), at least two technical replicates per siRNA sample or AAVS1-TDP43 genotype were included in the analysis. After RNA extraction, samples with an RNA integrity number (RIN) of >7.5, as determined by bioAnalyzer, were used for library preparation. Briefly, RNA sequencing libraries were generated from approximately 250 ng of total RNA using the Illumina TruSeq RNA Kit v2 according to the manufacturer's instructions. Libraries were sequenced on a HiSeq2000 platform at the Harvard Bauer Core Sequencing Facility. All FASTQ files were analyzed using the bcbioRNASeq workflow and toolchain (90). FASTQ files were aligned to the GRCh37 / hg19 reference genome. Differential expression studies were performed using the DESeq2 bioinformatics suite (38). Differential splicing was identified using the Cuffdiff module in Cufflinks. Counts were generated using Salmon and loaded at the gene level using tximport (91, 92). All p-values were then corrected for multiple comparisons using the method of Benjamini and Hochberg (93).
[0157] Electrophysiological recordings GFP + MNs were plated at 5,000 cells / cm on poly-D-lysine / laminin-coated coverslips. 2 The cells were seeded at a density of 100 μg / cm and cultured for 10 days in MN medium, acclimated with mouse glial cells for 2–3 days, and supplemented with 10 ng / mL each of GDNF, BDNF, and CNTF (R&D Systems). Electrophysiological recordings were performed as previously described (31, 94). Briefly, the cells were cultured in a Multiclamp 700B (Molecular Whole-cell voltage-clamp or current-clamp recordings were performed at room temperature (21–23°C) using a Digidata 1440A A / D interface and recorded using pCLAMP 10 software (Molecular Devices). Data were digitized with a Digidata 1440A A / D interface and recorded using pCLAMP 10 software (Molecular Devices). Data were sampled at 20 kHz and low-pass filtered at 2 kHz. Patch pipettes were pulled from borosilicate glass capillaries on a Sutter Instruments P-97 puller, with resistances ranging from 2–4 mW. Pipette capacitance was reduced by wrapping the shank in parafilm and compensated using an amplifier circuit. Series resistance was typically 5–10 mW, always less than 15 mW, and was at least 80% compensated. Linear leakage current was digitally subtracted using a P / 4 protocol. Voltages were evoked from a holding potential of −80 mV to test potentials ranging from −80 mV to 30 mV in 10 mV increments. The intracellular solution was potassium-based and contained: K-gluconate 135; MgCl2 2; KCl 6; HEPES 10; Mg ATP 5; 0.5 (pH 7.4 with KOH). The extracellular solution was sodium-based and contained: NaCl 135; KCl 5; CaCl2 2; MgCl2 1; glucose 10; HEPES 10 (pH 7.4 with NaOH). Kainic acid was purchased from Sigma.
[0158] Formaldehyde RNA immunoprecipitation One well (2 million cells) of a 6-well plate of hMNs was crosslinked and processed according to the MagnaRIP instructions (Millipore). The following antibodies were used in this study: SOD1 (Cell Signaling Technologies), TDP-43 (FL9, a gift from Dr. Cleveland), and mouse IgG (Cell Signaling Technologies). The Ct value of each RIP RNA fraction was normalized to the Ct value of the input RNA fraction from the same qPCR assay to account for differences in RNA sample preparation. To calculate dCt [normalized RIP], Ct [RIP] - (Ct [input] - log2 (input dilution factor)) was determined, where the dilution factor was 100 or 1%. To determine fold enrichment, ddCt was calculated by subtracting dCt [normalized RIP] from dCt [normalized IgG], followed by fold enrichment = 2^-ddCt.
[0159] Generation of STMN2 knockout STMN2 guide RNAs were designed using the following web resource: CHOPCHOP from the Schier Lab (chopchop.rc.fas.harvard.edu) (95). Guides were cloned into a vector containing the human U6 promoter (custom synthesized by the Broad Institute, Cambridge), followed by cloning into an accessible cloning site via BbsI digestion and ampicillin resistance. To facilitate cloning, all gRNAs were modified before being directed. To generate overhangs compatible with the BbsI cohesive end, the 5' nucleotide of the sense strand was removed and replaced with G if it was not G; for the reverse complement, the 3'-most nucleotide was removed and replaced with C, while AAAC was added to the 5' end. The resulting modified STMN2 gRNA sequence was used for Cas9 nuclease genome editing (guide 1: 5'CACCGTATAGATGTTGATGTTGCG3' (exon 2) (SEQ ID NO: 4), guide 2: 5'CACCTGAAACAATTGGCAGAGAAG3' (exon 3) (SEQ ID NO: 5), guide 3: 5'CACCAGTCCTTCAGAAGGCTTTGG3' (exon 4) (SEQ ID NO: 6)). Cloning was performed by first annealing and phosphorylating both gRNAs in a PCR tube. 1 μL of both strands at a concentration of 100 μM was added to 1 μL of T4 PNK (New England Biolabs), 1 μL of T4 ligation buffer, and 6 μL of HO. The tube was placed in a thermocycler and incubated at 37°C for 30 minutes, followed by 95°C for 5 minutes, and then slowly ramped down to 25°C at a rate of 5°C / min. The annealed oligos were then diluted 1:100 and 2 μL was added to a ligation reaction containing 2 μL of 100 μM pUC6 vector, 2 μL of NEB buffer 2.1, 1 μL of 10 mM DTT, 1 μL of 10 mM ATP, 1 μL of BbsI (New England Biolabs), 0.5 μL of T7 ligase (New England Biolabs), and 10.5 μL of HO. This solution was incubated in a thermocycler for a total of six cycles at 37°C for 5 minutes, followed by 21°C for 5 minutes.The vector was then cloned into OneShot Top10 (ThermoFisher Scientific) cells, plated onto LB-ampicillin agar plates, and incubated overnight at 37°C. The vector was isolated using a Qiagen MIDIprep kit (Qiagen), and DNA concentration was measured using a Nanodrop. Proper cloning was confirmed by sequencing the vector using Genewiz with the M13F(-21) primer.
[0160] Stem cell transfection was performed using the Neon Transfection System (ThermoFisher Scientific) with a 100 μL kit (ThermoFisher Scientific). Prior to transfection, stem cells were incubated in mTeSR1 containing 10 μM Rock inhibitor for 1 hour. Cells were then dissociated by adding accutase and incubating at 37°C for 5 minutes. Cells were counted using a Countess and counted at 2.5 × 10 6 The cells were resuspended in R medium at a concentration of 1000 cells / mL. The cell solution was then added to a tube containing 1 μg of each guide-containing vector and 1.5 μg of pSpCas9n(BB)-2A-Puro(PX462) V2.0 (a gift from Feng Zhang (Addgene)). When transfected with the puromycin resistance vector, the electroporated cells were immediately released into pre-incubated mTeSR medium containing 10 μM Rock inhibitor at 37°C in a 10 cm dish. 24 hours after transfection with the puromycin resistance vector, selection began. The medium was aspirated and replaced with mTESR1 medium containing different concentrations of puromycin (1 μg / μL, 2 μg / μL, and 4 μg / μL). After another 24 hours, the medium was aspirated and replaced with mTeSR1 medium. After culturing the cells for 10 days, colonies were picked and the cells were placed in 24-well plates and expanded.
[0161] Genomic DNA was extracted from puromycin-selected colonies using the Qiagen DNeasy Blood and Tissue Kit (Qiagen) and PCR screened to confirm the presence of the desired deletion in the STMN2 gene. PCR products were analyzed after electrophoresis on a 1% agarose gel. Briefly, the target sequence was PCR-amplified with a pair of primers outside the deletion, designed to generate an 1100-bp deletion band to detect deletion clones. The sequences of the primers used were as follows: OUT_FWD, 5'GCAAAGGAGTCTACCTGGCA3' (SEQ ID NO: 7) and OUT_REV, 5'GGAAGGGTGACTGACTGCTC3' (SEQ ID NO: 8). The knockout strain was further confirmed using immunoblot analysis.
[0162] Neurite outgrowth assay Individual Tuj1-positive neurons were randomly selected for Sholl analysis and imaged using a Nikon Eclipse TE300 with a 40x objective. Neurites were traced using the ImageJ (NIH) plugin NeuronJ (78), and Sholl analysis was performed using the Sholl tool in Fiji (96) to quantify the number of crossovers at 10-μm intervals from the cell body. Statistical analysis was performed using Prism6 (Graph Pad, La Jolla, CA, USA) by comparing the number of crossovers between the KO clones and the parental WT strain at each 10-μm interval. Significance was assessed by a standard Student's t-test, and a p-value of p<0.05 was considered significant.
[0163] axotomy Sorted motor neurons were cultured at a density of approximately 250,000 neurons per device in standard neuronal microfluidic devices (SND150, XONA Microfluidics) mounted on glass coverslips coated with 0.1 mg / ml poly-D-lysine (Sigma-Aldrich) and 5 μg / ml laminin (Invitrogen). On day 7 of culture, axotomy was performed by repeated vacuum aspiration and reperfusion of the axonal chamber until the axons were substantially severed without disturbing the cell bodies in the somatic compartment.
[0164] Immunohistochemical analysis of TDP-43 and STMN2 In compliance with Partners and Harvard IRB protocols, postmortem specimens from three sporadic ALS cases and three controls (without evidence of spinal cord disease) were collected from the Massachusetts Alzheimer's Disease Research Center (ADRC). Histological analysis of TDP-43 immunoreactivity (rabbit polyclonal, ProteinTech Group) was performed to confirm the diagnosis. For STMN2 analysis, formalin-fixed lumbar spinal cord sections were stained using standard immunohistochemical procedures, except that citrate buffer antigen retrieval was performed before blocking. Briefly, samples were rehydrated, rinsed with water, blocked in 3% hydrogen peroxide and then normal serum, incubated with primary STMN2 rabbit-derived antibody (1:100 dilution, Novus), followed by incubation with the appropriate secondary antibody (anti-rabbit IgG conjugated to horseradish peroxidase, 1:200), exposed to the ABC Vectastain kit and DAB peroxidase substrate, briefly counterstained with hematoxylin, and mounted. Multiple levels were tested for each sample.
[0165] STMN2 splicing analysis Total RNA was isolated from neurons using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. A total of 300–1000 ng of total RNA was used to synthesize cDNA by reverse transcription according to the iSCRIPT kit (Bio-Rad). Next, RT-PCR was performed using one cryptic exon-specific primer, followed by analysis using an Agilent 2200 Tapestation.
[0166] statistical analysis The statistical significance of the qRT-PCR assay and STMN2 immunohistochemical analysis was assessed using an unpaired two-tailed Student's t-test, and a p-value of *p<0.05 was considered significant. Type II error was controlled at the conventional level of 0.05.
[0167] References 1.Pasinelli, P. & Brown, RHMolecular biology of amyotrophic lateral sclerosis:insights from genetics.Nat.Rev.Neurosci.7,710-723(2006). 2.Rowland,LP& Shneider,NAAmyotrophic Lateral sclerosis.New England Journal of Medicine 344,1688-1700(2001). 3.Ravits,J.et al.Deciphering amyotrophic Lateral sclerosis:What phenotype, neuropathology and genetics are telling us about pathogenesis.Amyotroph Lateral Scler Frontotemporal Degener 14,5-18(2013). 4.Miller,R.G.,Mitchell,J.D.& Moore,D.H.Riluzole for amyotrophic lateral sclerosis(ALS) / motor neuron disease(MND).Cochrane Database Syst Rev 3,CD001447(2012). 5.Ling,S.-C.,Polymenidou,M.& Cleveland,D.W.Converging mechanisms in ALS and FTD:disrupted RNA and protein homeostasis.Neuron 79,416-438(2013). 6.Dion,P.A.,Daoud,H.& Rouleau,G.A.Genetics of motor neuron disorders:new insights into pathogenic mechanisms.Nat.Rev.Genet.10,769-782(2009). 7.Neumann,M.et al.Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis.Science 314,130-133(2006). 8.Chen-Plotkin,A.S.,Lee,V.M.-Y.& Trojanowski,J.Q.TAR DNA-binding protein 43 in neurodegenerative disease.Nature Reviews Neurology 6,211-220(2010). 9.Ignatius,S.H.,Wu,F.,Harrich,D.,GarciaMartinez,L.F.& Gaynor,R.B.Cloning and Characterization of a Novel Cellular Protein,Tdp-43,That Binds to Human-Immunodeficiency-Virus Type-1 Tar Dna-Sequence Motifs.J Virol 69,3584-3596(1995). 10.Buratti,E.et al.Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping.EMBO J 20,1774-1784(2001). 11.Polymenidou,M.et al.Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43.Nat Neurosci 14,459-468(2011). 12.Kawahara,Y.& Mieda-Sato,A.TDP-43 promotes microRNA biogenesis as a component of the Drosha and Dicer complexes.P Natl Acad Sci Usa 109,3347-3352(2012). 13.Liu-Yesucevitz,L.et al.Tar DNA Binding Protein-43(TDP-43)Associates with Stress Granules:Analysis of Cultured Cells and Pathological Brain Tissue.PLoS ONE 5,(2010). 14.Parker,S.J.et al.Endogenous TDP-43 localized to stress granules can subsequently form protein aggregates.Neurochem.Int.60,415-424(2012). 15.Alami,N.H.et al.Axonal transport of TDP-43 mRNA granules is impaired by ALS-causing mutations.Neuron 81,536-543(2014). 16.Volkening,K.,Leystra-Lantz,C.,Yang,W.,Jaffee,H.& Strong,M.J.Tar DNA binding protein of 43 kDa(TDP-43),14-3-3 proteins and copper / zinc superoxide dismutase(SOD1)interact to modulate NFL mRNA stability.Implications for altered RNA processing in amyotrophic lateral sclerosis(ALS).Brain Research 1305,168-182(2009). 17.Benajiba,L.et al.TARDBP mutations in motoneuron disease with frontotemporal lobar degeneration.Ann Neurol.65,470-473(2009). 18.Rutherford,N.J.et al.Novel Mutations in TARDBP(TDP-43)in Patients with Familial Amyotrophic Lateral Sclerosis.PLoS Genet 4,(2008). 19.Sreedharan,J.et al.TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis.Science 319,1668-1672(2008). 20.Van Deerlin,V.M.et al.TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology:a genetic and histopathological analysis.The Lancet Neurology 7,409-416(2008). 21.Yokoseki,A.et al.TDP-43 mutation in familial amyotrophic lateral sclerosis.Ann Neurol.63,538-542(2008). 22.Lee,E.B.,Lee,V.M.-Y.& Trojanowski,J.Q.Gains or losses:molecular mechanisms of TDP43-mediated neurodegeneration.Nat.Rev.Neurosci.13,38-50(2012). 23.Kraemer,B.C.et al.Loss of murine TDP-43 disrupts motor function and plays an essential role in embryogenesis.Acta Neuropathol 119,409-419(2010). 24.Sephton,C.F.et al.TDP-43 is a developmentally regulated protein essential for early embryonic development.J.Biol.Chem.285,6826-6834(2010). 25.Wu, L.-S., Cheng, W.-C.& Shen, C.-K.J.Targeted depletion of TDP-43 expression in the spinal cord motor neurons leads to the development of amyotrophic lateral sclerosis-like phenotypes in mice.J.Biol.Chem.287,27335-27344(2012). 26.Yang,C.et al.Partial loss of TDP-43 function causes phenotypes of amyotrophic lateral sclerosis.Proc.Natl.Acad.Sci.U.S.A.111,E1121-9(2014). 27.Iguchi,Y.et al.Loss of TDP-43 causes age-dependent progressive motor neuron degeneration.Brain 136,1371-1382(2013). 28.Tollervey,J.R.et al.Characterizing the RNA targets and position-dependent splicing regulation by TDP-43.Nat Neurosci 14,452-458(2011). 29.Davis-Dusenbery,B.N.,Williams,L.A.,Klim,J.R.& Eggan,K.How to make spinal motor neurons.Development 141,491-501(2014).30.Han, S.S.W., Williams, L.A.& Eggan, K.C.Constructing and deconstructing stem cell models of neurological disease.Neuron 70,626-644(2011). 31.Kiskinis,E.et al.Pathways disrupted in human ALS motor neurons identified through genetic correction of mutant SOD1.Cell Stem Cell 14,781-795(2014). 32.van Eersel,J.et al.Cytoplasmic accumulation and aggregation of TDP-43 upon proteasome inhibition in cultured neurons.PLoS ONE 6,e22850(2011). 33.Di Giorgio,F.P.,Boulting,G.L.,Bobrowicz,S.& Eggan,K.C.Human Embryonic Stem Cell-Derived Motor Neurons Are Sensitive to the Toxic Effect of Glial Cells Carrying an ALS-Causing Mutation.Stem Cell 3,637-648(2008). 34.Amoroso,M.W.et al.Accelerated high-yield generation of limb-innervating motor neurons from human stem cells.J Neurosci 33,574-586(2013). 35.Chambers,S.M.et al.Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling.Nat Biotechnol 27,275-280(2009). 36.Chambers,S.M.et al.Combined small-molecule inhibition accelerates developmental timing and converts human pluripotent stem cells into nociceptors.Nat Biotechnol 30,715-720(2012). 37.Mackenzie,I.R.A.et al.Pathological TDP-43 distinguishes sporadic amyotrophic lateral sclerosis from amyotrophic lateral sclerosis with SOD1 mutations.Ann Neurol.61,427-434(2007). 38.Love,M.I.,Huber,W.& Anders,S.Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.Genome Biology 15,550(2014). 39.Arnold,E.S.et al.ALS-linked TDP-43 mutations produce aberrant RNA splicing and adult-onset motor neuron disease without aggregation or loss of nuclear TDP-43.Proc.Natl.Acad.Sci.U.S.A.110,E736-45(2013). 40.Fiesel,F.C.,Weber,S.S.,Supper,J.,Zell,A.& Kahle,P.J.TDP-43 regulates global translational yield by splicing of exon junction complex component SKAR.Nucleic Acids Res 40,2668-2682(2012). 41.Prudencio,M.et al.Misregulation of human sortilin splicing leads to the generation of a nonfunctional progranulin receptor.P Natl Acad Sci Usa 109,21510-21515(2012). 42.Yang,C.et al.Partial loss of TDP-43 function causes phenotypes of amyotrophic lateral sclerosis.Proc.Natl.Acad.Sci.U.S.A.111,E1121-9(2014). 43.Bernard,E.,Jacob,L.,Mairal,J.& Vert,J.-P.Efficient RNA isoform identification and quantification from RNA-Seq data with network flows.Bioinformatics 30,2447-2455(2014). 44.Bryant,D.W.,Priest,H.D.& Mockler,T.C.Detection and quantification of alternative splicing variants using RNA-seq.Methods Mol Biol 883,97-110(2012). 45.Trapnell,C.et al.Differential analysis of gene regulation at transcript resolution with RNA-seq.Nat Biotechnol 31,46-53(2013). 46.Shiga,A.et al.Alteration of POLDIP3 Splicing Associated with Loss of Function of TDP-43 in Tissues Affected with ALS.PLoS ONE 7,(2012). 47.Grenningloh,G.,Soehrman,S.,Bondallaz,P.,Ruchti,E.& Cadas,H.Role of the microtubule destabilizing proteins SCG10 and stathmin in neuronal growth.J.Neurobiol.58,60-69(2004). 48.Shin,J.E.,Geisler,S.& DiAntonio,A.Dynamic regulation of SCG10 in regenerating axons after injury.Exp Neurol 252,1-11(2014). 49.Kasashima,K.,Sakashita,E.,Saito,K.& Sakamoto,H.Complex formation of the neuron-specific ELAV-like hu RNA-binding proteins.Nucleic Acids Res 30,4519-4526(2002). 50.Martin,K.R.et al.Over-expression of RCAN1 causes Down syndrome-like hippocampal deficits that alter learning and memory.Human Molecular Genetics 21,3025-3041(2012). 51.Ariyannur,P.S.et al.Methamphetamine-induced neuronal protein NAT8L is the NAA biosynthetic enzyme:implications for specialized acetyl coenzyme A metabolism in the CNS.Brain Research 1335,1-13(2010). 52.Boulting,G.L.et al.A functionally characterized test set of human induced pluripotent stem cells.Nat Biotechnol 29,279-286(2011). 53.Yuan,S.H.et al.Cell-surface marker signatures for the isolation of neural stem cells,glia and neurons derived from human pluripotent stem cells.PLoS ONE 6,e17540(2011). 54.Egawa,N.et al.Drug Screening for ALS Using Patient-Specific Induced Pluripotent Stem Cells.Sci Transl Med 4,145ra104-145ra104(2012). 55.Serio,A.et al.Astrocyte pathology and the absence of non-cell autonomy in an induced pluripotent stem cell model of TDP-43 proteinopathy.Proc.Natl.Acad.Sci.U.S.A.110,4697-4702(2013). 56.Bilican,B.et al.Mutant induced pluripotent stem cell lines recapitulate aspects of TDP-43 proteinopathies and reveal cell-specific vulnerability.Proc.Natl.Acad.Sci.U.S.A.109,5803-5808(2012). 57.Zhang,Z.et al.Downregulation of MicroRNA-9 in iPSC-Derived Neurons of FTD / ALS Patients with TDP-43 Mutations.PLoS ONE 8,e76055(2013). 58.Mason,M.,Lieberman,A.R.,Grenningloh,G.& Anderson,P.N.Transcriptional upregulation of SCG10 and CAP-23 is correlated with regeneration of the axons of peripheral and central neurons in vivo.Mol Cell Neurosci 20,595-615(2002). 59.Morii,H.,Shiraishi-Yamaguchi,Y.& Mori,N.SCG10,a microtubule destabilizing factor,stimulates the neurite outgrowth by modulating microtubule dynamics in rat hippocampal primary cultured neurons.J.Neurobiol.66,1101-1114(2006). 60.Shin,J.E.et al.SCG10 is a JNK target in the axonal degeneration pathway.P Natl Acad Sci Usa 109,E3696-E3705(2012). 61.Sobczak,A.et al.Calmyrin1 binds to SCG10 protein(stathmin2)to modulate neurite outgrowth.Biochim Biophys Acta 1813,1025-1037(2011). 62.Stein,R.,Mori,N.,Matthews,K.,Lo,L.C.& Anderson,D.J.The NGF-inducible SCG10 mRNA encodes a novel membrane-bound protein present in growth cones and abundant in developing neurons.Neuron 1,463-476(1988). 63.Bieche,I.et al.Expression of stathmin family genes in human tissues:non-neural-restricted expression for SCLIP.Genomics 81,400-410(2003). 64.Smith,B.N.et al.Exome-wide rare variant analysis identifies TUBA4A mutations associated with familial ALS.Neuron 84,324-331(2014). 65.Wu,C.-H.et al.Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis.Nature 488,499-503(2012).66.Nicolas,A.et al.Genome-wide Analyses Identify KIF5A as a Novel ALS Gene.Neuron 97,1268-1283.e6(2018). 67.Guerreiro,R.,Bras,J.& Hardy,J.SnapShot:Genetics of ALS and FTD.Cell 160,798-U485(2015). 68.Lagier-Tourenne,C.et al.Divergent roles of ALS-linked proteins FUS / TLS and TDP-43 intersect in processing long pre-mRNAs.Nat Neurosci 15,1488-1497(2012). 69.Lattante,S.,Rouleau,G.A.& Kabashi,E.TARDBP and FUS Mutations Associated with Amyotrophic Lateral Sclerosis:Summary and Update.Hum.Mutat.34,812-826(2013). 70.DeJesus-Hernandez,M.et al.Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS.Neuron 72,245-256(2011). 71.Renton,A.E.,Chio,A.& Traynor,B.J.State of play in amyotrophic lateral sclerosis genetics.Nat Neurosci 17,17-23(2014).72.Renton,A.E.et al.A Hexanucleotide Repeat Expansion in C9ORF72 Is the Cause of Chromosome 9p21-Linked ALS-FTD.Neuron 72,257-268(2011). 73.Buratti,E.& Baralle,F.E.Multiple roles of TDP-43 in gene expression,splicing regulation,and human disease.Front Biosci 13,867-878(2008). 74.Sugiura,Y.& Mori,N.SCG10 expresses growth-associated manner in developing rat brain,but shows a different pattern to p19 / stathmin or GAP-43.Brain Res.Dev.Brain Res.90,73-91(1995). 75.Levy,A.D.et al.Subcellular Golgi localization of stathmin family proteins is promoted by a specific set of DHHC palmitoyl transferases.Mol Biol Cell 22,1930-1942(2011). 76.Taylor,J.P.,Brown,R.H.& Cleveland,D.W.Decoding ALS:from genes to mechanism.Nature 539,197-206(2016). 77.Chauvin,S.& Sobel,A.Neuronal stathmins:A family of phosphoproteins cooperating for neuronal development,plasticity and regeneration.Progress in Neurobiology 126,1-18(2015). 78.Meijering,E.et al.Design and validation of a tool for neurite tracing and analysis in fluorescence microscopy images.Cytometry Part A 58A,167-176(2004). 79.Taylor,A.M.et al.A microfluidic culture platform for CNS axonal injury,regeneration and transport.Nat Methods 2,599-605(2005). 80.Ling,J.P.,Pletnikova,O.,Troncoso,J.C.& Wong,P.C.TDP-43 repression of nonconserved cryptic exons is compromised in ALS-FTD.Science 349,650-655(2015). 81.Humphrey,J.,Emmett,W.,Fratta,P.,Isaacs,A.M.& Plagnol,V.Quantitative analysis of cryptic splicing associated with TDP-43 depletion.BMC Med Genomics 10,38(2017). 82.Rabin,S.J.et al.Sporadic ALS has compartment-specific aberrant exon splicing and altered cell-matrix adhesion biology.Human Molecular Genetics 19,313-328(2009). 83.Highley,J.R.et al.Loss of nuclear TDP-43 in amyotrophic lateral sclerosis(ALS)causes altered expression of splicing machinery and widespread dysregulation of RNA splicing in motor neurones.Neuropathology and Applied Neurobiology 40,670-685(2014). 84.D’Erchia,A.M.et al.Massive transcriptome sequencing of human spinal cord tissues provides new insights into motor neuron degeneration in ALS.Sci Rep 7,10046(2017). 85.Henriques,A.,Pitzer,C.& Schneider,A.Neurotrophic growth factors for the treatment of amyotrophic lateral sclerosis:where do we stand? Front Neurosci 4,32(2010). 86.Kaplan,A.et al.Neuronal Matrix Metalloproteinase-9 Is a Determinant of Selective Neurodegeneration.Neuron 81,333-348(2014). 87.Markmiller,S.et al.Context-Dependent and Disease-Specific Diversity in Protein Interactions within Stress Granules.Cell 172,590-604.e13(2018). 88.Taylor,J.P.,Brown,R.H.& Cleveland,D.W.Decoding ALS:from genes to mechanism.Nature 539,197-206(2016). 89.de Boer,A.S.et al.Genetic validation of a therapeutic target in a mouse model of ALS.Sci Transl Med 6,248ra104-248ra104(2014). 90.Steinbaugh,M.J.et al.bcbioRNASeq:R package for bcbio RNA-seq analysis.F1000Research 6,1976(2017). 91.Patro,R.,Duggal,G.,Love,M.I.,Irizarry,R.A.& Kingsford,C.Salmon provides fast and bias-aware quantification of transcript expression.Nat Methods 14,417-419(2017). 92. Soneson, C., Love, M. I. & Robinson, M. D. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. F1000Research 4, 1521 (2016). 93. Benjamini, Y. & Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. http: / / www.jstor.org / stable / 2346101 1, 289 - 300 (1995). 94. Son, E. Y. et al. Conversion of mouse and human fibroblasts into functional spinal motor neurons. Cell Stem Cell 9, 205 - 218 (2011). 95. Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B. & Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Res 44, W272 - W276 (2016). 96. Ferreira, T. A. et al. Neuronal morphometry directly from bitmap images. Nat Methods 11, 982 - 984 (2014).
[0168] Example 2: Recently, the identification of mRNA transcripts regulated by the RNA-binding protein TDP-43 in human motor neurons was reported. See Klim, JR, et al. (2019). The ALS-associated protein TDP-43 maintains the levels of STMN2, a mediator of motor neuron growth and repair. Nat Neurosci, 2019.22(2):pp.167-179. TDP-43 regulates hundreds of transcripts in human motor neurons, but one of the transcripts most affected by TDP-43 depletion was STMN2. STMN2 is a protein involved in microtubule assembly and is one of the most abundant transcripts expressed by neurons. Further analysis of the data revealed that TDP-43 suppresses a cryptic exon in the STMN2 transcript. Inclusion of this cryptic exon prevents expression of the full-length form, resulting in a dramatic reduction in STMN2 protein levels. Knockdown of TDP-43 in cell cultures and postmortem tissue from patients with TDP-43 pathology show altered STMN2 splicing. The cryptic exon-containing transcript contains its own stop and start sites, potentially encoding a 17-amino acid peptide. This alteration in human models was verified with RNA sequencing data from postmortem spinal cord. Therefore, we investigated whether the cryptic STMN2 transcript or the peptide it encodes could serve as a CSF / body fluid biomarker for people with or experiencing ALS, or other patients with TDP-43 proteinopathies (e.g., Parkinson's disease, traumatic brain injury, Alzheimer's disease).
[0169] Figures 17A-17C show that RNA can be readily harvested from CSF-derived exosomes, then converted to cDNA and assayed for full and cryptic STMN2 transcripts, as well as control RNA for normalization (Figure 17A). A TaqMan Q-RT-PCR assay was validated to demonstrate that this assay simultaneously detects both full and cryptic STMN2 transcripts in human neurons using a TDP-43 knockdown approach. STMN2 transcripts are normalized to the housekeeping ribosomal subunit RNA 18S5. TDP-43 levels were reduced in cultured human neurons using either an antisense oligonucleotide (ASO) that depletes cells of TDP-43 or an siRNA that induces TDP-43 knockdown. In both conditions, robust induction of cryptic exons was observed compared to controls (Figure 17B). Using a validated multiplex qPCR assay, we next isolated RNA from CSF-derived exosomes and determined the levels of cryptic STMN2 using 300 μl of patient samples (n = 7 healthy controls, n = 2 disease mimics, and n = 9 ALS patients). Compared to control samples, the majority of ALS samples showed above-average levels of STMN2 cryptic exons, with some samples showing levels several orders of magnitude higher (Figure 17C). Note that even in this relatively small sample set, the increase in cryptic exon expression in ALS patients was highly significant (P < 0.005). It is further noteworthy that two individuals with non-ALS motor neuron disease (mimics) showed control levels of splicing. Finally, there is an interesting "texture" in the patient data, with some patients showing high levels of expression and others showing more normal levels. It is hypothesized that patients with relatively low levels may either be early in the disease or have non-TDP-43 disease.
[0170] The most common pathological hallmark of ALS is the cytoplasmic accumulation and nuclear clearance of TDP-43. Many groups and companies are interested in developing therapeutics to rescue these changes in TDP-43 localization and function. However, to date, there are no biomarkers that can be used in living individuals to monitor TDP-43 dysfunction or its rescue. The assay described here can be used in exactly this way. Furthermore, interest has focused on STMN2 and its cryptic splicing as targets in ALS. This assay allows for direct measurement of target engagement in patients undergoing clinical trials.
[0171] Example 3 Patient background The patient, a 40-year-old man, first experienced ALS symptoms in April 2017, with weakness in his left hand. The weakness gradually worsened and spread to include atrophy of both hands and arms. Around May 2018, the patient developed spasticity, weakness, and atrophy of the legs, as well as dysarthria, which gradually worsened. A diagnosis of ALS was confirmed clinically in November 2017 and confirmed by EMG testing in March 2018. There was no family history of ALS, and comprehensive exome and genome scanning did not reveal any proven ALS-causing mutations, such as mutations in the C9ORF72 or SOD1 genes.
[0172] The patient is taking three FDA-approved medications for ALS: riluzole, edaravone, and Nuedexta. Additionally, the patient underwent autologous mesenchymal stem cell treatment in South Korea in June and November 2019. Despite these treatments, the patient's clinical course and the progression of ALSFRS have accelerated.
[0173] Project rationale Stathmin 2 (STMN2) is a 179-amino acid protein expressed exclusively in the CNS (most notably in spinal motor neurons) that regulates microtubule stability. Long studied as SCG10 (superior cervical ganglion 10), STMN2 is essential for axonal regrowth after injury. Surprisingly, two seminal papers independently demonstrated in 2019 that stathmin 2 function is suppressed in many cases of sporadic ALS, as well as in ALS caused by mutations in the genes encoding TDP43 and C9ORF72 (1, 2). These findings were recently independently confirmed by a third laboratory (3).
[0174] Importantly, these studies identified STMN2, one of the most abundant transcripts in human motor neurons, as a central RNA that interacts with TDP-43. They also supported a mechanism in sporadic ALS in which disruption of proteostasis due to aging, environmental exposure, injury, or ALS / FTD-causing mutations leads to TDP43 mislocalization, aggregation, and altered RNA metabolism—pathologies present in nearly all sporadic ALS cases. While loss of TDP-43 function alters the abundance of many transcripts, the rapid loss of STMN2 after TDP-43 knockdown or loss of function provides compelling evidence linking STMN2 to TDP-43 pathology and disruption of mechanisms that protect axons and prevent neuropathy.
[0175] Given this impressive recent literature, we sampled tissue from patients and devised culture conditions to model the effects on their motor neurons. A series of experiments on this pathway and patient cells were performed to examine the mechanism of TDP-43 regulation of STMN2, in which TDP-43 binds to the STMN2 pre-mRNA in the intron between exons 1 and 2. Either reduction of TDP-43 levels or nuclear export leads to the same outcome for STMN2: premature polyadenylation and splicing of the cryptic exon, resulting in a truncated STMN2 mRNA transcript at the expense of the full-length transcript (Figure 81). Thus, given the success of nusinersen for spinal muscular atrophy, TDP-43 regulation of STMN2 appears to have the potential to serve as a disease biomarker or even a therapeutic target for splice-switching antisense oligonucleotides.
[0176] After extensive screening, we identified a panel of three ASOs, one of which (SJ+94) (i) effectively corrects TDP-43-induced STMN2 missplicing in patient motor neurons and (ii) is non-toxic. Further analysis of the other two ASOs in the panel was performed.
[0177] Patient motor neurons have less nuclear TDP-43 than healthy controls The scientific discoveries that ultimately led to the ASOs in the panel, including SJ+94 and SJ-1, are that (1) sporadic ALS patients have mislocalized TDP-43, i.e., they have less nuclear TDP-43 when compared to healthy individuals, and (2) this TDP-43 mislocalization causes mis-splicing of STMN2 in sporadic ALS patients, resulting in a truncated cryptic STMN2 that accelerates disease progression in patients.
[0178] Cells were reprogrammed from patient-donated cells to generate the induced pluripotent stem cell (iPSC) MGH 138 (Figure 84A). The genotype of the stem cell line (MGH 138) was confirmed to be that of the patient using sequence analysis (Figure 84B). Following this confirmation, stem cell-derived motor neurons (hMNs) were generated from the patient's iPS cells (Figures 84C-84D). The patient's motor neurons were then used in all in vitro proof-of-concept studies described herein.
[0179] After generating patient motor neurons, we decided to confirm whether there were any differences in nuclear TDP-43 between patient motor neurons and healthy controls. As previously mentioned, loss of nuclear TDP-43, which can manifest as cytoplasmic mislocalization, is a pathological hallmark of sporadic ALS based on multiple analyses of postmortem CNS tissue. Although detection in motor neurons is much more difficult than in postmortem tissue, at least one previous study reported that iPSC-derived neurons from ALS patients can recapitulate TDP-43 pathology, including its cytoplasmic mislocalization.
[0180] Neurons were isolated from the patient's iPSCs and five healthy control iPSC cell lines. Immunocytochemistry was used to explore the subcellular localization of TDP-43 in neurons (Figure 85A). In control neurons, predominantly nuclear TDP-43 staining was observed using Pearson's coefficient analysis, revealing a strong correlation between TDP-43 immunostaining and DNA counterstaining (Figure 85B). In contrast, patient iPSC-derived neurons showed a decreased correlation between TDP-43 and nuclear staining, indicating lower levels of nuclear TDP-43 in patient motor neurons compared with controls, confirming TDP-43 pathology in the patient (Figure 85B).
[0181] Patient-Specific In Vitro Models Over the past two years, three independent published studies have demonstrated that nuclear TDP-43 depletion in sporadic ALS patients leads to STMN2 truncation. However, these studies included postmortem tissue from sporadic ALS patients. Therefore, patient motor neurons were examined to confirm whether STMN2 in these patients is similarly regulated by TDP-43. Thus, while we have demonstrated reduced nuclear TDP-43 levels in patient motor neurons compared with non-ALS controls, we further reduced these levels in in vitro cell assays to more clearly assess the efficacy (if any) of potential ASOs in suppressing latent STMN2 in patient motor neurons. This approach was necessary because definitive confirmation that TDP-43 and STMN2 are dysfunctional requires detailed analysis and dissection of CNS tissue, which is not an option for living ALS patients. Furthermore, this in vitro approach is fully consistent with in vivo TDP-43 pathology (loss of functional TDP-43) in sporadic ALS patients.
[0182] To test whether STMN2 in a patient is regulated by TDP-43, we treated the patient's motor neurons with siTARDBP RNA to reduce TDP-43 levels. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed to measure TDP-43 mRNA levels, confirming that TDP-43 mRNA levels were reduced in the patient's motor neurons compared to those exposed to non-targeting siRNA (siCTRL) (Figure 86A). We further confirmed that TDP-43 depletion in the patient's motor neurons resulted in a reduction in STMN2 full-length transcripts and a strong induction of a truncated (misspliced) form of STMN2 RNA (Figures 86B-86C).
[0183] These results therefore confirmed that STMN2 in the patient was regulated by TDP-43. Furthermore, we established that depletion of TDP-43 levels in the patient's motor neurons directly led to mis-splicing of STMN2, resulting in a truncated cryptic STMN2 mRNA transcript at the expense of the full-length transcript. These results were used to further evaluate whether the pathological effects in the patient's motor neurons were amenable to therapeutic modulation using antisense oligonucleotides (a pharmacological approach used for nusinersen, eteplirsen, mipomersen, milasen, and jacifusen).
[0184] ASO design and screening To ensure that the designed ASO matched the patient's genetic signature, we PCR-amplified the region surrounding the STMN2 cryptic exon (an intronic region retained during TDP-43 dysfunction) from genomic DNA extracted from the patient's iPS cells. We focused on this region because we hypothesized that targeting the RNA region from the cryptic splice site to the cryptic polyadenylation site (which contains the TDP-43 binding site) with an ASO would rescue the STMN2 transcription defect. Next, we performed Sanger sequencing of the PCR products to confirm that the target region matched perfectly between the patient's sequence and the reference genome (Figure 87A, Figure 87C).
[0185] To attempt to correct the splicing defect observed in the STMN2 transcript in patient motor neurons, we designed and synthesized ASOs targeting this region. Specifically, we designed several ASOs to be complementary to a region of the pre-mRNA that was predicted to be unstructured and therefore potentially accessible to ASOs (bases 94–121, following the cryptic splice site). These ASOs were synthesized using two different chemistries: 2'-O-methoxyethyl RNA (MOE) and a chimera of MOE and locked nucleic acid; all sequences contained phosphorothioate linkages. They were aligned along the intron, just 5' to the 3' polyadenylation site of the cryptic exon (Figure 82). Because the compounds do not contain DNA, these targeted ASOs were expected to bind to the transcript and sterically interact to promote proper STMN2 splicing.
[0186] A total of 51 ASOs were screened for their ability to (1) suppress the production of truncated STMN2 transcripts and (2) restore full-length STMN2 transcripts in patient motor neurons. ASOs SJ+94 and SJ-1 were selected as candidates after repeated screening experiments described below based on their ability to suppress cryptic splicing of STMN2 and restore full-length STMN2 RNA (in two separate experiments) in patient motor neurons, boost STMN2 protein levels in patient motor neurons, and promote axonal regrowth in patient motor neurons (i.e., creating the potential for true clinical benefit).
[0187] In the first experiment, we treated the patient's motor neurons with siTARDBP and then cultured them with various ASOs over a range of concentrations (30 nM to 0.03 nM) before extracting total RNA. The extracted RNA was used to synthesize cDNA by reverse transcription. The levels of both truncated and full-length STMN2 RNA, normalized using RNA18S5 expression, were assessed using qRT-PCR. While many ASOs showed promising results, the results of ASO SJ+94 stood out because it was able to dose-dependently (i) suppress cryptic splicing (Figure 88A) and (ii) restore full-length STMN2 RNA (Figure 88B) in the patient's motor neurons compared with the nontargeting control ASO-NTC. Furthermore, ASO SJ-1 was effective and safe in (i) suppressing cryptic splicing (Figure 95A) and (ii) restoring full-length STMN2 RNA (Figure 95B) in patient motor neurons compared with the non-targeting control ASO-NTC.
[0188] Overview of ASO effectiveness We demonstrated that ASO(SJ+94) and ASO(SJ-1) inhibited cryptic splicing of STMN2 and restored full-length STMN2 RNA in patient motor neurons when nuclear TDP-43 was reduced. We next assessed whether this would prove effective in a different experimental paradigm when TDP-43 was mislocalized. Examination of postmortem tissue showed that TDP-43 mislocalization and its aggregation in the cytoplasm are hallmarks of sporadic ALS. Several groups have reported that cytoplasmic aggregation of TDP-43, similar to that observed in postmortem tissue from sporadic ALS patients, occurs in response to pharmacological inhibition of the proteasome (1, 4). This TDP-43 mislocalization has also been shown to cause altered expression of its transcripts, including STMN2.
[0189] Proteasome inhibition (MG-132 (1 μM)) in patient neurons, which induces nuclear depletion of TDP-43, resulted in decreased expression of STMN2 (Figure 89). Indeed, patient motor neurons treated with ASO SJ+94 maintained significantly higher levels of full-length STMN2 RNA than those treated with the non-targeting control ASO (NTC) (p-value 0.0024) (Figure 89). Furthermore, patient motor neurons treated with ASO SJ-1 maintained significantly higher (30% higher) levels of full-length STMN2 RNA than those treated with the non-targeting control ASO (NTC) (this translates to a p-value of 0.0003) (Figure 96).
[0190] After establishing and validating that the STMN2 ASO could affect transcript levels, we sought to determine whether it could also rescue the decrease in protein levels observed after TDP-43 reduction. Patient motor neurons were treated with siRNA and either a non-targeting ASO (NTC) or one of the lead compounds from the screening (Figure 90, Figure 97). As a positive control, patient motor neurons were cultured with SP600125, an established JNK inhibitor (JNKi) previously demonstrated to boost STMN2 protein levels (1, 5). Subsequent immunoblot analysis showed that STMN2 protein levels decreased after loss of nuclear TDP-43 with siTDP and increased after JNK inhibition (Figure 90). Unlike cells treated with the non-targeting control ASO (NTC), we observed that STMN2 was restored to the level of the siRNA control in the lead candidate. These combined results demonstrated that the tested ASOs prevented the processing of nascent STMN2 RNA transcripts into truncated forms in favor of full-length transcripts, restoring protein levels to normal.
[0191] Overview of ASO efficacy on axonal regeneration It has previously been demonstrated that TDP-43 depletion leads to reduced axonal regrowth after injury (1). A similar phenotype was observed in hMNs with reduced or completely absent STMN2 levels, which could be rescued by restoring STMN2 or posttranslational stabilization of STMN2 (1, 2). These results strongly link STMN2 to the motor neuropathy observed in ALS. To test whether ASO SJ+94 can rescue axonal regrowth after TDP-43 depletion and injury, patient motor neurons were cultured in a microfluidic device that allows axonal growth into a chamber separate from the neuronal cell body (Figure 91A). Neurons cultured in the somatic compartment of the device for 7 days extended axons through the microchannels into the axonal chamber. Neurons were treated with siTARDBP and ASO SJ+94, and then axons were severed without disturbing the cell bodies in the somatic compartment. Next, axonal outgrowth was measured from the microchannels to assess regrowth after injury (Figure 91B, Figure 91D). Analysis revealed a significant increase in regrowth with ASO SJ+94 compared to the non-targeting control ASO (Figure 91C). Analysis further revealed a significant increase in regrowth with ASO SJ-1 compared to the non-targeting control ASO, with mean values of 243 μm and 176 μm, respectively (p-value 0.0014) (Figure 91E).
[0192] References 1. Klim JR, Williams LA, Limone F, Guerra San Juan I, Davis-Dusenbery BN, Mordes DA, Burberry A, Steinbaugh MJ, Gamage KK, Kirchner R, Moccia R, Cassel SH, Chen K, Wainger BJ, Woolf CJ, Eggan K. ALS-implicated protein TDP-43 sustains levels of STMN2,a mediator of motor neuron growth and repair.Nat Neurosci.2019;22(2):167-79.Epub 2019 / 01 / 16.doi:10.1038 / s41593-018-0300-4.PubMed PMID:30643292. 2.Melamed Z,Lopez-Erauskin J,Baughn MW,Zhang O,Drenner K,Sun Y,Freyermuth F,McMahon MA,Beccari MS,Artates JW,Ohkubo T,Rodriguez M,Lin N,Wu D,Bennett CF,Rigo F,Da Cruz S,Ravits J,Lagier-Tourenne C,Cleveland DW.Premature polyadenylation-mediated loss of stathmin-2 is a hallmark of TDP-43-dependent neurodegeneration.Nat Neurosci.2019;22(2):180-90.Epub 2019 / 01 / 16.doi: 10.1038 / s41593-018-0293-z.PubMed PMID:30643298;PMCID:PMC6348009.3.Prudencio M,Humphrey J,Pickles S,Brown AL,Hill SE,Kachergus J,Shi J,Heckman M,Spiegel M,Cook C,Song Y,Yue M,Daughrity L,Charlemagne Y,Jansen-West K,Fernandez De Castro C,DeTure M,Koga S,Wang YC,Sivakumar P,Bodo C,Candalija A,Talbot K,Selvaraj BT,Burr K,Chandran S,Newcombe J,Lashley T,Hubbard I,Catalano D,Kim D,Propp N,Fennessey S,Fagegaltier D,Phatnani H,Secrier M,Fisher EM,Oskarsson B,van Blitterswijk M,Rademakers R,Graff-Radford NR,Boeve B,Knopman DS,Petersen R,JosephS [ PMC free article ] [ PubMed ] [ Cross Ref ] K, Thompson EA, Raj T, Ward ME, Dickson D, Gendron TF, Fratta P, Petrucelli L.Truncated stathmin-2 is a marker of TDP-43 pathology in frontotemporal dementia.J Clin Invest.2020.Epub 2020 / 08 / 14.doi:10.1172 / JCI139741.PubMed PMID:32790644. 4.van Eersel J,Ke YD,Gladbach A,Bi M,Gotz J,Kril JJ,Ittner LM.Cytoplasmic accumulation and aggregation of TDP-43 upon proteasome inhibition in cultured neurons.PLoS One.2011;6(7):e22850.Epub doi:10.1371 / journal.pone.0022850.PubMed PMID:21829535;PMCID:PMC3146516. 5.Shin JE,Miller BR,Babetto E,Cho Y,Sasaki Y,Qayum S,Russler EV,Cavalli V,Milbrandt J,DiAntonio A.Proc Natl Acad Sci US A.2012;109(52):E3696-705.Epub doi:10.1073 / pnas.1216204109.PubMed PMID:23188802;PMCID:PMC3535671.
[0193] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. The scope of the invention is not intended to be limited to the detailed description or the details set forth therein. Articles such as "a," "an," and "the" can mean one or more, unless indicated to the contrary or otherwise clear from the context. A claim or description including "or" or "and / or" between one or more elements of a group is considered to be satisfied when one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process, unless indicated to the contrary or otherwise clear from the context. The invention includes embodiments in which exactly one member of a group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which two or more, or all group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it should be understood that the present invention encompasses all variations, combinations, and permutations of one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the claims (whether originally or later added) introduced into another claim (whether originally or later added). For example, any claim that depends on another claim may be amended to include one or more element(s), feature(s), or limitation(s) found in any other claim, e.g., any other claim that depends from the same base claim. Any one or more claims may be amended to explicitly exclude any one or more embodiment(s), element(s), feature(s), etc. For example, any particular sideroflexin, sideroflexin modulator, cell type, cancer type, etc. may be excluded from any one or more claims.
[0194] It is to be understood that (i) any classification method, prediction method, treatment selection method, treatment method, etc. may include the step of providing a sample, e.g., a sample obtained from a subject in need of classification, prediction, treatment selection, or treatment for cancer, e.g., a cancer sample obtained from a subject; and (ii) any classification method, prediction method, treatment selection method, treatment method, etc. may include the step of providing such classification, prediction, treatment selection, or treatment for cancer to a subject in need thereof.
[0195] Where a claim recites a method, certain aspects of the invention provide articles of manufacture, such as kits, agents, or compositions suitable for carrying out the method.
[0196] Where elements are presented as a list, e.g., in Markush group format, each subgroup of elements is also disclosed, and any element(s) can be removed from the group. While for brevity only some of these embodiments are specifically described herein, the present disclosure encompasses all such embodiments. Generally, when the invention, or aspects of the invention, are referred to as comprising certain elements, features, etc., it should also be understood that the particular embodiment of the invention or aspect of the invention consists of or consists essentially of such elements, features, etc.
[0197] When a range of values is mentioned herein, the invention includes embodiments in which the endpoints are included, embodiments in which both endpoints are excluded, and embodiments in which one endpoint is included and the other is excluded. Both endpoints should be assumed to be inclusive unless otherwise indicated. Furthermore, unless otherwise indicated or otherwise apparent from the context and the understanding of one of ordinary skill in the art, values expressed as ranges can take any reasonable value or subrange within the stated range of different embodiments of the invention, down to the tenth of the unit of the lower limit of that range, unless the context clearly dictates otherwise. When phrases such as "less than X," "greater than X," or "at least X" are used (where X is a number or percentage), it should be understood that any reasonable value can be selected as the lower or upper limit of the range. When a list of numerical values is set forth herein (whether preceded by "at least"), it should also be understood that the invention includes embodiments relating to any intervening value or range defined by any two values in the list, with the lowest value considered to be a minimum value and the highest value considered to be a maximum value. Furthermore, when a list of numbers, such as percentages, begins with "at least," the term applies to each number in the list. For any embodiment of the invention where a numerical value begins with "about" or "approximately," the invention includes embodiments in which the exact value is recited. For any embodiment of the invention where a numerical value does not begin with "about" or "approximately," the invention includes embodiments in which the value begins with "about" or "approximately." "Approximately" or "about" generally includes numbers within 1%, or in some embodiments, 5%, or in some embodiments, 10% of the number in either direction (greater or less than that number), unless otherwise stated or otherwise clear from the context (e.g., where such number unacceptably exceeds 100% of the possible value).
[0198] Unless expressly indicated to the contrary, in any method claimed herein that includes two or more acts, the order of the method acts is not necessarily limited to the order in which the method acts are described, but it should be understood that the present disclosure encompasses embodiments in which the order is so limited. In some embodiments, the method may be performed by an individual or entity. In some embodiments, the method steps may be performed by two or more individuals or two or more entities such that the method is performed collectively. In some embodiments, the method may be performed at least in part by requesting or permitting another individual or entity to perform one, two or more, or all steps of the method. In some embodiments, the method includes requesting two or more entities or two or more individuals to each perform at least one step of the method. In some embodiments, the performance of two or more steps is coordinated such that the method is performed collectively. It should also be understood that any product or composition described herein may be considered "isolated" unless otherwise indicated or apparent from the context. Where applicable, unless otherwise indicated or clear from the context, any method or step of a method that may be adapted to be performed mentally or as a mental step, or to be performed using a writing implement such as a pen or pencil and a surface suitable for writing, such as paper, may be explicitly shown as being performed at least in part, substantially, or wholly by a machine, e.g., a computer, device, or system, which, in some embodiments, may be specially adapted or designed to be able to perform such method or step, or portions thereof.
[0199] The section headings used herein should not be construed as limiting in any sense, and it is expressly contemplated that subject matter presented under any section heading may be applicable to any aspect or embodiment described herein.
[0200] An embodiment or aspect herein may relate to any agent, composition, article, kit, and / or method described herein. It is contemplated that any one or more embodiments or aspects may be freely combined with any one or more other embodiments or aspects, wherever appropriate. For example, any combination of two or more agents, compositions, articles, kits, and / or methods that are not mutually inconsistent is provided. It will be understood that any explanation or illustration of a term anywhere in this specification may apply wherever such term appears herein (e.g., in any aspect or embodiment to which such term is associated), unless otherwise indicated or clearly evident. The present invention provides, for example, the following items. (Item 1) An antisense oligonucleotide that specifically binds to the STMN2 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence and increases STMN2 protein expression. (Item 2) an antisense oligonucleotide that specifically binds to an STMN2 mRNA sequence, a pre-mRNA sequence, or a nascent RNA sequence, thereby inhibiting or preventing the inclusion of defective or altered STMN2 RNA sequences, The antisense oligonucleotide does not bind to the polyadenylation site of the STMN2 RNA sequence. (Item 3) 2. The antisense oligonucleotide of item 1, wherein the defective or altered STMN2 RNA sequence occurs and is abundant when TDP-43 function is reduced or a TDP pathology is present. (Item 4) an antisense oligonucleotide that specifically binds to an STMN2 mRNA sequence, a pre-mRNA sequence, or a nascent RNA sequence encoding a cryptic exon, thereby inhibiting or preventing the inclusion of the cryptic exon into STMN2 RNA; The antisense oligonucleotide does not bind to the polyadenylation site of the STMN2 mRNA, pre-mRNA, or nascent RNA sequence. (Item 5) 5. The antisense oligonucleotide of any one of items 1 to 4, wherein the antisense oligonucleotide is designed to target the 5' splice site, the 3' splice site, or the normal TDP-43 binding site. (Item 6) 5. The antisense oligonucleotide according to any one of items 1 to 4, which is designed to target the single-stranded region. (Item 7) 7. The antisense oligonucleotide of item 6, which is designed to target the single-stranded region located between the TDP-43 binding site and the polyadenylation site. (Item 8) 8. The antisense oligonucleotide according to any one of items 1 to 7, which targets one or more splice junctions. (Item 9) An antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOs: 37 to 85. (Item 10) 10. The antisense oligonucleotide according to item 9, comprising a sequence selected from the group consisting of SEQ ID NOs: 37 to 74. (Item 11) SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 10. The antisense oligonucleotide of item 9, comprising a sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. (Item 12) 10. The antisense oligonucleotide of item 9, comprising SEQ ID NO: 52. (Item 13) 10. The antisense oligonucleotide of item 9, comprising a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. (Item 14) 10. The antisense oligonucleotide of item 9, comprising SEQ ID NO: 73. (Item 15) 10. The antisense oligonucleotide of item 9, comprising SEQ ID NO: 53. (Item 16) 10. The antisense oligonucleotide of item 9, which inhibits or prevents the inclusion of cryptic exons in STMN2 RNA. (Item 17) 10. The antisense oligonucleotide of item 9, which specifically binds to an STMN2 RNA sequence, pre-mRNA sequence, or nascent RNA sequence encoding a cryptic exon. (Item 18) 10. The antisense oligonucleotide of item 9, which increases STMN2 protein. (Item 19) 10. The antisense oligonucleotide of item 9, wherein the antisense oligonucleotide is designed to target the 5' splice site, the 3' splice site, or the normal TDP-43 binding site. (Item 20) 10. The antisense oligonucleotide of item 9, which is designed to target a site proximal to a cryptic splice site, a site proximal to an early polyadenylation site, or a site located between a cryptic splice site and an early polyadenylation site. (Item 21) 10. The antisense oligonucleotide of item 9, which is designed to target the single-stranded region. (Item 22) 10. The antisense oligonucleotide of item 9, which is designed to target the single-stranded region located between the TDP-43 binding site and the polyadenylation site. (Item 23) 10. The antisense oligonucleotide according to item 9, which binds to a target region within an unstructured cryptic exon. (Item 24) 10. The antisense oligonucleotide of item 9, which binds near or adjacent to a 5' splice site regulated by TDP-43. (Item 25) 10. The antisense oligonucleotide of item 9, which targets a region proximal to a predicted TDP-43 binding site. (Item 26) 10. The antisense oligonucleotide of item 9, which targets the normal binding site of TDP-43. (Item 27) A pharmaceutical composition comprising one or more antisense oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NOs: 37 to 85. (Item 28) The one or more antisense oligonucleotides are selected from the group consisting of SEQ ID NOs: 37 to 74. 28. The pharmaceutical composition according to item 27, comprising a sequence selected from: (Item 29) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. (Item 30) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 52. (Item 31) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. (Item 32) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 73. (Item 33) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 53. (Item 34) 28. The pharmaceutical composition of item 27, wherein the composition comprises two or more antisense oligonucleotides. (Item 35) 28. The pharmaceutical composition of item 27, wherein the two or more antisense oligonucleotides are covalently linked. (Item 36) 28. The pharmaceutical composition of item 27, wherein the composition comprises three or more antisense oligonucleotides. (Item 37) 28. The pharmaceutical composition of claim 27, wherein the one or more antisense oligonucleotides increase STMN2 protein expression. (Item 38) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides are designed to target the 5' splice site, the 3' splice site, or the normal TDP-43 binding site. (Item 39) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides are designed to target a site proximal to a cryptic splice site, a site proximal to an early polyadenylation site, or a site located between a cryptic splice site and an early polyadenylation site. (Item 40) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides are designed to target a single-stranded region. (Item 41) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides are designed to target a single-stranded region located between the TDP-43 binding site and the polyadenylation site. (Item 42) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides bind to a target region within an unstructured cryptic exon. (Item 43) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides bind near or adjacent to a 5' splice site regulated by TDP-43. (Item 44) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides target a region proximal to a predicted TDP-43 binding site. (Item 45) 28. The pharmaceutical composition of item 27, wherein the antisense oligonucleotide targets the normal binding site of TDP-43. (Item 46) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides target one or more splice junctions. (Item 47) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides specifically bind to STMN2 mRNA, pre-mRNA, or nascent RNA sequences, thereby inhibiting or preventing the inclusion of defective or altered STMN2 RNA sequences. (Item 48) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides specifically bind to an STMN2 mRNA sequence, a pre-mRNA sequence, or a nascent RNA sequence encoding a cryptic exon. (Item 49) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides suppress or prevent the inclusion of a cryptic exon into STMN2 RNA. (Item 50) 28. The pharmaceutical composition of item 27, wherein the one or more antisense oligonucleotides inhibit cryptic splicing. (Item 51) 28. The pharmaceutical composition according to item 27, further comprising an agent for treating a neurodegenerative disease. (Item 52) 28. The pharmaceutical composition according to item 27, further comprising an agent for treating traumatic brain injury. (Item 53) 28. The pharmaceutical composition according to item 27, further comprising an agent for treating proteasome inhibitor-induced neuropathy. (Item 54) 28. The pharmaceutical composition of item 27, further comprising STMN2 as a gene therapy drug. (Item 55) 28. The pharmaceutical composition according to item 27, further comprising a JNK inhibitor. (Item 56) A pharmaceutical composition comprising a multimeric oligonucleotide comprising one or more sequences selected from the group consisting of SEQ ID NOs: 37 to 85. (Item 57) 57. The pharmaceutical composition according to item 56, wherein the multimeric oligonucleotide comprises two or more sequences selected from the group consisting of SEQ ID NOs: 37 to 85. (Item 58) 1. A method for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in a neuronal cell of a subject in need thereof, comprising: Antisense oligonucleotides correcting the reduction in STMN2 protein levels contacting the neuronal cell, wherein the agent does not target the polyadenylation site of the target transcript. (Item 59) 1. A method for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in a neuronal cell of a subject in need thereof, comprising: The method comprises contacting the neuronal cell with an antisense oligonucleotide that increases STMN2 protein expression. (Item 60) 60. The method of claim 59, wherein the antisense oligonucleotide specifically binds to an STMN2 RNA sequence, a pre-RNA sequence, or a nascent RNA sequence encoding a cryptic exon. (Item 61) 60. The method of claim 59, wherein the antisense oligonucleotide is designed to target the 5' splice site, the 3' splice site, or the normal TDP-43 binding site. (Item 62) 60. The method of claim 59, wherein the antisense oligonucleotide is designed to target a site proximal to a cryptic splice site, a site proximal to an early polyadenylation site, or a site located between a cryptic splice site and an early polyadenylation site. (Item 63) 60. The method of claim 59, wherein the antisense oligonucleotide is designed to target a single-stranded region. (Item 64) 60. The method of claim 59, wherein the antisense oligonucleotide is designed to target a single-stranded region located between the TDP-43 binding site and the polyadenylation site. (Item 65) 60. The method of claim 59, wherein the antisense oligonucleotide binds to a target region within an unstructured cryptic exon. (Item 66) 60. The method of claim 59, wherein the antisense oligonucleotide binds near or adjacent to a 5' splice site regulated by TDP-43. (Item 67) 60. The method of claim 59, wherein the antisense oligonucleotide targets a region proximal to a predicted TDP-43 binding site. (Item 68) 60. The method of claim 59, wherein the antisense oligonucleotides are designed to target one or more splice junctions. (Item 69) 60. The method of claim 59, wherein the antisense oligonucleotide restores normal length or protein-coding STMN2 pre-mRNA or mRNA. (Item 70) 60. The method of claim 59, wherein the subject exhibits improved neuronal growth and repair. (Item 71) 60. The method of claim 59, wherein the disease or condition is a neurodegenerative disease. (Item 72) the disease or condition is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, and Alzheimer's disease. Item 59. The method according to Item 59. (Item 73) 60. The method of claim 59, wherein the disease or condition is traumatic brain injury. (Item 74) 60. The method of claim 59, wherein the disease or condition is proteasome inhibitor-induced neuropathy. (Item 75) 60. The method of claim 59, wherein the disease or condition is associated with altered or reduced levels of TDP-43 in neuronal cells. (Item 76) 60. The method of claim 59, further comprising administering to the subject an effective amount of a second agent. (Item 77) 77. The method of claim 76, wherein the second agent is administered to treat a neurodegenerative disease. (Item 78) 77. The method of claim 76, wherein the second agent is administered to treat traumatic brain injury. (Item 79) 77. The method of item 76, wherein the second agent is STMN2 administered as a gene therapy agent. (Item 80) 1. A method for treating or reducing the likelihood of a disease or condition associated with impaired functionality of TAR DNA-binding protein 43 (TDP-43) in a neuronal cell of a subject in need thereof, the method comprising: The method comprises contacting the neuronal cell with one or more antisense oligonucleotides that correct a reduction in STMN2 protein levels, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 37 to 85. (Item 81) 81. The method of item 80, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 37 to 74. (Item 82) 81. The method of claim 80, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NO:40, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:56, and SEQ ID NO:78. (Item 83) 81. The method of item 80, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 52. (Item 84) 81. The method of item 80, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. (Item 85) 81. The method of item 80, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 73. (Item 86) 81. The method of item 80, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 53. (Item 87) Diseases associated with decreased functionality of TAR DNA-binding protein 43 (TDP-43) 1. A method of treating a disease or condition or reducing the likelihood of said disease or condition in a neuronal cell of a subject in need thereof, comprising: The method comprises contacting the neuronal cell with one or more antisense oligonucleotides that suppress or prevent the inclusion of cryptic exons into STMN2 RNA, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 37 to 85. (Item 88) 88. The method of item 87, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 37 to 74. (Item 89) 88. The method of item 87, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NO:40, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:56, and SEQ ID NO:78. (Item 90) 88. The method of item 87, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 52. (Item 91) 88. The method of item 87, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. (Item 92) 88. The method of item 87, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 73. (Item 93) 88. The method of item 87, wherein the one or more antisense oligonucleotides comprise SEQ ID NO: 53. (Item 94) 88. The method of claim 87, wherein the one or more antisense oligonucleotides specifically bind to an STMN2 RNA sequence, a pre-RNA sequence, or a nascent RNA sequence encoding a cryptic exon. (Item 95) 88. The method of claim 87, wherein the one or more antisense oligonucleotides are designed to target a 5' splice site, a 3' splice site, or a normal TDP-43 binding site. (Item 96) 88. The method of claim 87, wherein the one or more antisense oligonucleotides are designed to target a site proximal to a cryptic splice site, a site proximal to an early polyadenylation site, or a site located between a cryptic splice site and an early polyadenylation site. (Item 97) 88. The method of claim 87, wherein the one or more antisense oligonucleotides are designed to target a single-stranded region. (Item 98) 88. The method of item 87, wherein the one or more antisense oligonucleotides are designed to target a single-stranded region located between the TDP-43 binding site and the polyadenylation site. (Item 99) 88. The method of claim 87, wherein the one or more antisense oligonucleotides bind to a target region within the unstructured cryptic exon. (Item 100) 88. The method of claim 87, wherein the one or more antisense oligonucleotides bind near or adjacent to a 5' splice site regulated by TDP-43. (Item 101) 88. The method of claim 87, wherein the one or more antisense oligonucleotides target a region proximal to a predicted TDP-43 binding site. (Item 102) 88. The method of claim 87, wherein the one or more antisense oligonucleotides target a normal binding site of TDP-43. (Item 103) 88. The method of item 87, wherein the disease or condition is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, and Alzheimer's disease. (Item 104) 88. The method of item 87, wherein the disease or condition is traumatic brain injury. (Item 105) 88. The method of claim 87, wherein the disease or condition is proteasome inhibitor-induced neuropathy. (Item 106) 88. The method of claim 87, wherein the antisense oligonucleotide suppresses cryptic splicing. (Item 107) 88. The method of claim 87, wherein the antisense oligonucleotide increases STMN2 protein expression. (Item 108) 88. The method of item 87, wherein the subject exhibits improved neuronal growth and repair. (Item 109) 88. The method of claim 87, further comprising administering to the subject an effective amount of a second agent. (Item 110) 110. The method of claim 109, wherein the second agent is administered to treat a neurodegenerative disease. (Item 111) 110. The method of claim 109, wherein the second agent is administered to treat traumatic brain injury. (Item 112) 1. A method for treating or reducing the likelihood of a disease or condition associated with impaired functionality of TAR DNA-binding protein 43 (TDP-43) in a neuronal cell of a subject in need thereof, the method comprising: The method includes contacting the neuronal cell with a multimeric oligonucleotide that corrects the decrease in STMN2 protein level, wherein the multimeric oligonucleotide comprises two or more antisense oligonucleotides selected from the group consisting of SEQ ID NOs: 37 to 85. Item 113. The method of item 112, wherein the multimeric oligonucleotide comprises two or more antisense oligonucleotides selected from the group consisting of SEQ ID NOs: 37 to 74. (Item 114) An antisense oligonucleotide that corrects a decrease in the level of STMN2 protein, The antisense oligonucleotide is designed to target an unstructured region within a cryptic exon. (Item 115) 115. The antisense oligonucleotide of item 114, wherein the unstructured region within the cryptic exon is located between a cryptic splice site and a premature polyadenylation site. (Item 116) 1. A method for detecting an alteration in the level of STMN2 or ELAVL3 protein in a subject, comprising: obtaining a sample from said subject; and detecting whether the level of the STMN2 or ELAVL3 protein is altered. (Item 117) Item 117. The method of item 116, wherein the subject has amyotrophic lateral sclerosis. (Item 118) 117. The method of claim 116, wherein the subject has a traumatic brain injury. (Item 119) 119. The method of any one of items 116 to 118, wherein detecting whether the level of STMN2 or ELAVL3 is altered comprises determining whether the level of STMN2 or ELAVL3 is decreased compared to a reference sample. (Item 120) 120. The method of any one of items 113 to 119, wherein detecting whether the level of STMN2 or ELAVL3 is altered comprises using ELISA. (Item 121) 121. The method according to any one of items 113 to 120, wherein the sample is a biological fluid sample.
Claims
1. An antisense oligonucleotide that specifically binds to an STMN2 mRNA sequence, a pre-mRNA sequence, or a nascent RNA sequence, wherein the anti-oligosense nucleotide increases STMN2 protein expression in cells and comprises the sequence shown in SEQ ID NO: 73 or SEQ ID NO:
72.
2. An antisense oligonucleotide that specifically binds to the STMN2 mRNA sequence, pre-mRNA sequence, or nascent RNA sequence described in claim 1, wherein the specific binding of the antisense oligonucleotide inhibits or prevents the inclusion of incomplete or altered STMN2 RNA sequences within the cells.
3. The antisense oligonucleotide described in claim 2, wherein the incomplete or altered STMN2 RNA sequence occurs and is present in increased amounts when TDP-43 function is reduced or a TDP lesion is present.
4. An antisense oligonucleotide consisting of an array selected from SEQ ID NO: 73 and SEQ ID NO:
72.
5. An antisense oligonucleotide described in claim 4, consisting of the sequence shown in sequence number 73.
6. An antisense oligonucleotide described in claim 4, which suppresses or prevents the inclusion of cryptic exons in STMN2 RNA in the cell.
7. The antisense oligonucleotide of claim 4, wherein contacting a cell with the antisense oligonucleotide increases the level of STMN2 protein.
8. A pharmaceutical composition comprising one or more antisense oligonucleotides comprising an array selected from the group consisting of SEQ ID NO: 73 or 72.
9. The pharmaceutical composition described in claim 8, wherein the one or more antisense oligonucleotides comprise sequence number 73.
10. The pharmaceutical composition described in claim 8, wherein the composition comprises two or more antisense oligonucleotides.
11. The pharmaceutical composition described in claim 8, wherein the two or more antisense oligonucleotides are covalently linked.
12. The pharmaceutical composition described in claim 8, wherein the composition comprises three or more antisense oligonucleotides.
13. The pharmaceutical composition described in claim 8, wherein administration of the pharmaceutical composition to a subject increases STMN2 protein expression.
14. The pharmaceutical composition described in claim 8, wherein the one or more antisense oligonucleotides specifically bind to STMN2 mRNA sequences, pre-mRNA sequences, or nascent RNA sequences in cells, thereby suppressing or preventing the inclusion of incomplete or altered STMN2 RNA sequences.
15. The pharmaceutical composition described in claim 8, wherein the one or more antisense oligonucleotides suppress or prevent the inclusion of cryptic exons into STMN2 RNA.
16. The pharmaceutical composition described in claim 8, wherein the one or more antisense oligonucleotides inhibit cryptic splicing.
17. The pharmaceutical composition of claim 8, further comprising a drug for treating a neurodegenerative disease.
18. The pharmaceutical composition of claim 8, further comprising an agent for treating traumatic brain injury.
19. The pharmaceutical composition of claim 8, further comprising an agent for treating proteasome inhibitor-induced neuropathy.
20. The pharmaceutical composition described in claim 8, further comprising STMN2 as a gene therapy drug.
21. The pharmaceutical composition of claim 8, further comprising a JNK inhibitor.
22. A pharmaceutical composition comprising a multimeric oligonucleotide comprising one or more sequences selected from the group consisting of SEQ ID NOs: 73 and 72.
23. The pharmaceutical composition described in claim 22, wherein the multimeric oligonucleotide further comprises one or more sequences selected from the group consisting of SEQ ID NOs: 37-72 and 74-85.
24. A composition for use in a method of treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in neuronal cells in a subject in need thereof, the composition comprising an antisense oligonucleotide that corrects reduced levels of STMN2 protein, the method comprising: The composition comprises contacting the neuronal cell with the antisense oligonucleotide, wherein the antisense oligonucleotide does not target a polyadenylation site of a target transcript, and the antisense oligonucleotide comprises the sequence set forth in SEQ ID NO: 73 or SEQ ID NO:
72.
25. A composition for use in a method for treating or reducing the likelihood of a disease or condition associated with decreased functionality of TAR DNA-binding protein 43 (TDP-43) in neuronal cells in a subject in need thereof, the composition comprising an antisense oligonucleotide that increases STMN2 protein expression, the method comprising: The composition, comprising contacting the neuronal cell with the antisense oligonucleotide, wherein the antisense oligonucleotide comprises the sequence set forth in SEQ ID NO: 73 or SEQ ID NO:
72.
26. The composition described in claim 25, wherein the antisense oligonucleotide restores normal length or protein-coding STMN2 pre-mRNA or mRNA.
27. The composition described in claim 25, wherein the subject exhibits improved neuronal growth and repair.
28. The composition described in claim 25, wherein the disease or condition is a neurodegenerative disease.
29. The composition described in claim 25, wherein the disease or condition is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, and Alzheimer's disease.
30. The composition described in claim 25, wherein the disease or condition is traumatic brain injury.
31. The composition described in claim 25, wherein the disease or condition is proteasome inhibitor-induced neuropathy.
32. The composition described in claim 25, wherein the disease or condition is associated with mutations or reduced levels of TDP-43 in neuronal cells.
33. The composition described in claim 25, characterized in that the composition is administered to the subject in combination with a second drug.
34. The composition of claim 33, wherein the second agent is administered to treat a neurodegenerative disease.
35. The composition of claim 33, wherein the second agent is administered to treat traumatic brain injury.
36. The composition described in claim 33, wherein the second drug is STMN2 administered as a gene therapy drug.
37. The composition described in claim 25, wherein the one or more antisense oligonucleotides comprise sequence number 73.
38. A composition for use in a method for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in neuronal cells in a subject in need thereof, the composition comprising one or more antisense oligonucleotides that inhibit or prevent inclusion of a cryptic exon in STMN2 RNA, the method comprising: The composition comprising contacting the neuronal cell with the one or more antisense oligonucleotides, wherein the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOs: 73 and 72.
39. The composition described in claim 38, wherein the one or more antisense oligonucleotides comprise sequence number 73.
40. The composition described in claim 38, wherein the disease or condition is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, and Alzheimer's disease.
41. The composition described in claim 38, wherein the disease or condition is traumatic brain injury.
42. The composition described in claim 38, wherein the disease or condition is proteasome inhibitor-induced neuropathy.
43. The composition described in claim 38, wherein the antisense oligonucleotide suppresses cryptic splicing.
44. The composition described in claim 38, wherein the antisense oligonucleotide increases STMN2 protein expression.
45. The composition described in claim 38, wherein the subject exhibits improved neuronal growth and repair.
46. The composition described in claim 38, characterized in that the composition is administered to the subject in combination with a second drug.
47. The composition described in claim 46, wherein the second agent is administered to treat a neurodegenerative disease.
48. The composition of claim 46, wherein the second agent is administered to treat traumatic brain injury.
49. A composition for use in a method for treating or reducing the likelihood of a disease or condition associated with reduced functionality of TAR DNA-binding protein 43 (TDP-43) in neuronal cells in a subject in need thereof, the composition comprising a multimeric oligonucleotide that corrects reduced levels of STMN2 protein, the method comprising: contacting the neuronal cell with the multimeric oligonucleotide, wherein the multimeric oligonucleotide comprises two or more antisense oligonucleotides having sequences independently selected from the group consisting of SEQ ID NOs: 73 and 72.
50. A method for detecting an alteration in the level of STMN2 or ELAVL3 protein in a sample obtained from a subject, comprising: detecting whether the level of the STMN2 or ELAVL3 protein is altered.
51. The method described in claim 50, wherein the subject has amyotrophic lateral sclerosis.
52. The method of claim 50, wherein the subject has a traumatic brain injury.
53. A method described in any one of claims 50 to 52, wherein detecting whether the level of STMN2 or ELAVL3 has changed comprises determining whether the level of STMN2 or ELAVL3 has decreased compared to a reference sample.
54. A method according to any one of claims 50 to 53, wherein detecting whether the level of STMN2 or ELAVL3 has changed comprises using ELISA.
55. A method described in any one of claims 50 to 54, wherein the sample is a biological fluid sample.
Citation Information
Patent Citations
Compounds and methods for increasing STMN2 expression
WO2019241648A1