Method and apparatus for separating molecules that bind to target molecules

Abstract

To provide a simple method for separating a second molecule having desired affinity to a first molecule by using a filter.SOLUTION: A method for separating a second molecule having a desired affinity (Kd) for a first molecule using a filter, the method comprising: preparing a sample containing the second molecule to be separated and the first molecule that binds to the second molecule; Bringing a sample containing a second molecule and a first molecule into contact with each other to generate a complex in which the first molecule and the second molecule are bound to each other, flowing a liquid into a container to wash the container, and allowing a molecule that does not bind to the first molecule and a molecule that binds to the first molecule with an affinity lower than a desired affinity to pass through a filter; A method for separating a second molecule having a desired affinity, comprising: collecting a complex in which the second molecule is bound to the first molecule and a free first molecule by permeation at a specific dilution rate; and dissociating the second molecule from the first molecule in the complex.SELECTED DRAWING: Figure 3

Description

[Technical Field]

[0001] The present invention relates to a method for separating molecules that bind to target molecules, and an apparatus and a container used therefor. [Background technology]

[0002] It is known that two molecules, such as an antigen and an antibody or its antigen-binding fragment, a sugar chain and a lectin, an enzyme and its substrate or coenzyme, a protease and its proteinaceous protease inhibitor, a physiologically active substance such as a hormone and its receptor or transport protein, a nucleic acid and its complementary polynucleotide, etc., form complexes based on affinity.

[0003] The affinity Kd is the dissociation rate constant (k off ) / binding rate constant(k on ) is the value expressed as

[0004] When the target molecule is an antigen, the antigen, which is the target molecule in a sample, is separated using a molecule such as an antibody that binds to the antigen. A B / F (Bound / Free) separation method is known, in which a target molecule bound to an antibody is separated from excess antibody (Patent Document 1).

[0005] However, no method is known for easily separating molecules that have a specific affinity for a certain molecule using a filter. In particular, no method has been found for obtaining antibodies with a desired affinity in an open system while filtering out antibodies that do not have the desired affinity. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Japanese Patent Application Publication No. 11-248707 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention addresses the problem of providing a simple method for separating, using a filter, a second molecule that has a desired affinity for a first molecule. [Means for solving the problem]

[0008] A first aspect of the present invention is a method for separating a second molecule having a desired affinity (Kd) for a first molecule using a filter, the method comprising: providing a sample containing a second molecule to be separated and a first molecule that binds to the second molecule; contacting a sample containing a second molecule with a first molecule in a container having a filter to form a complex in which the first molecule and the second molecule are bound; a liquid is passed through the vessel to wash and filter out molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than the desired affinity; Here, the permeation rate from the filter is the initial concentration of the first molecule in the container [R] 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C where Kd = (the dissociation rate constant k between the first molecule and the second molecule) off ) / (binding rate constant k between the first molecule and the second molecule on ) and collecting the complex in which the second molecule is bound to the first molecule and the free first molecule; and dissociating the second molecule from the first molecule in the complex; a method for isolating a second molecule having a desired affinity, comprising: The present invention provides on [R] 0 ≪D C It has been found that by pouring a liquid into a container having a filter so that the filter fills the container, the possibility of rebinding of dissociated molecules can be made negligible, and thus the second molecule bound to the first molecule with the desired affinity Kd can be left in the container. [Effects of the Invention]

[0009] According to the present invention, a second molecule having a desired affinity for a first molecule can be easily separated. [Brief explanation of the drawings]

[0010] [Figure 1] 1 is a schematic diagram illustrating the concept of the present invention. [Figure 2] 1 is a block diagram showing an apparatus according to an embodiment of the present invention; [Figure 3] 1 is a graph showing the relationship between the binding rate constant kon between the first molecule and the second molecule, the washing time (minutes), and the residual rate Φ. [Figure 4] 1 is a schematic diagram of an apparatus according to an embodiment of the present invention. [Figure 5] (a) Top view, (b) side cross-sectional view, (c) side view, and (d) top cross-sectional view of the reaction vessel. [Figure 6] 1A and 1B are a top cross-sectional view and a side cross-sectional view, respectively, of a first modified example of a reaction vessel. [Figure 7] 1A is a top cross-sectional view of a second modified example of a reaction vessel, and FIG. 1B is a side cross-sectional view of the second modified example of a reaction vessel. [Figure 8] 1A is a top cross-sectional view of a third modified example of a reaction vessel, and FIG. 1B is a top cross-sectional view of a fourth modified example of a reaction vessel. [Figure 9] FIG. 1 shows band intensities of electrophoretic mobility in Example 1. [Figure 10] FIG. 1 is a diagram comparing the band intensities of BDA Elute (Sup(3)) in Example 1. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present invention relates to a method for separating a second molecule having a desired affinity Kd for a first molecule using a filter. Examples of combinations of first and second molecules include antigens and antibodies or antigen-binding fragments thereof, sugar chains and lectins, enzymes and their substrates or coenzymes, proteases and their proteinaceous protease inhibitors, physiologically active substances such as hormones and their receptors or transport proteins, and nucleic acids and their complementary polynucleotides.

[0012] The present invention relates to a method for simply obtaining a second molecule, which is a target molecule having a desired affinity for a first molecule, by using a filter to separate a complex formed in a solution between a first molecule and a second molecule, which is a target molecule having a desired affinity for the first molecule, and the free first molecule, from molecules that bind to the first molecule with less than the desired affinity and molecules that do not bind to the first molecule (hereinafter also referred to as third molecules).

[0013] Specifically, a method for separating a second molecule having a desired affinity (Kd) for a first molecule using a filter, the method comprising: providing a sample containing a second molecule to be separated and a first molecule that binds to the second molecule; contacting a sample containing a second molecule with a first molecule in a container having a filter to form a complex in which the first molecule and the second molecule are bound; a liquid is passed through the vessel to wash and filter out molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than the desired affinity; Here, the permeation rate from the filter is the initial concentration of the first molecule in the container [R] 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C where Kd = (the dissociation rate constant k between the first molecule and the second molecule) off) / (binding rate constant k between the first molecule and the second molecule on ) and collecting the complex in which the second molecule is bound to the first molecule and the free first molecule; and dissociating the second molecule from the first molecule in the complex; and a method for isolating a second molecule having a desired affinity, the method comprising:

[0014] The sample is not particularly limited as long as it is a liquid or solid that contains or may contain the second molecule to be separated.

[0015] Examples of combinations of first and second molecules include antigens and antibodies or their antigen-binding fragments, sugar chains and lectins, enzymes and their substrates or coenzymes, proteases and their proteinaceous protease inhibitors, physiologically active substances such as hormones and their receptors or transport proteins, and nucleic acids and their complementary polynucleotides.

[0016] The antibody may be a monoclonal or polyclonal antibody, with monoclonal antibodies being preferred. Antigen-binding fragments include F(ab')2, Fab', Fab, single-chain antibodies (single chain Fv: scFv), and variable domain heavy chain (VHH) antibodies.

[0017] A sample and a liquid containing first molecules are mixed in a reaction vessel 110 having a filter 112 to form a mixture 116. Specifically, the mixture 116 in the reaction vessel 110 is a mixture of first molecules, second molecules, molecules that bind to the first molecules with less than the desired affinity, and molecules that do not bind to the first molecules (hereinafter referred to as third molecules), and over time forms a mixture of a complex of the first molecules and the second molecules (hereinafter also referred to as a first complex), a complex of the first molecules and the third molecules (hereinafter also referred to as a second complex), third molecules that do not bind to the first molecules, and free first molecules.

[0018] To efficiently form a complex (first complex) in which the first molecule and the second molecule are bound, a sample that may contain the first molecule and the second molecule may be shaken mechanically or non-mechanically as appropriate.

[0019] The incubation time until the first molecule and the second molecule form a complex can be appropriately selected depending on the first molecule and the second molecule, but when the first molecule is an antigen and the second molecule is an antibody, it is, for example, 1 to 360 minutes, preferably 10 to 180 minutes, and more preferably 30 to 120 minutes. The incubation temperature is preferably 10 to 50°C, more preferably 20 to 40°C, and even more preferably 25 to 30°C.

[0020] After the complex between the first molecule and the second molecule is formed in the reaction vessel 110, a liquid is introduced into the reaction vessel 110, on [R] 0 ≪D C The substance (third molecule) that does not bind to the first molecule with a specific affinity passes through a filter 112 attached to the reaction vessel 110 and is collected in a collection vessel 100 as needed.

[0021] The filter allows the complex in which the second molecule binds to the first molecule and the free first molecule to remain in the reaction vessel 110. The filter has a separation ability that is used to elute molecules that bind to the first molecule with less than the desired affinity and molecules that do not bind to the first molecule (third molecules). The filter is not particularly limited as long as it can separate the complex in which the second molecule binds to the first molecule and the free first molecule from the molecules that bind to the first molecule with less than the desired affinity and the molecules that do not bind to the first molecule (third molecules) by utilizing the size difference between them.

[0022] The pore size of the filter can be determined appropriately taking into consideration the size of the complex between the first molecule and the second molecule, or, if the first molecule is bound to a solid phase such as beads, the size of the beads. Examples of lower limits for the pore size include 0.05, 0.1, 0.2, 0.3, 0.5, and 1.0 μm. Examples of upper limits for the pore size include 100, 80, 50, 20, 10, 5, and 2 μm.

[0023] For example, when the first molecule is bound to magnetic beads, a filter having a pore size of 0.05 μm to 10 μm can be selected, preferably 0.1 μm to 5 μm, more preferably 0.2 to 1 μm, and even more preferably about 0.65 μm. (Examples of the molecular weight cutoff include filters with a molecular weight cutoff of 10,000, 30,000, 50,000, or 100,000 KDa.)

[0024] The first molecule can also be bound to a spherical structure having a diameter of 0.1 to 10 μm, such as a liposome.

[0025] An example of the filter 112 is a microfiltration membrane. The microfiltration membrane is not particularly limited as long as it is one that is generally used in microfiltration, and examples include membranes made of polypropylene, polyvinyl chloride, polytetrafluoroethylene, polyvinylidene fluoride, acrylic acid copolymer, polyamide, polysulfone, Teflon, cellulose acetate, nitrocellulose, a mixed ester of cellulose acetate and nitrocellulose, or regenerated cellulose.

[0026] Examples of the liquid to be passed through the reaction vessel 110 equipped with the filter 112 include Good's buffer, Tris, PBS, etc. Those skilled in the art can select an appropriate buffer depending on the properties of the first molecule and the second molecule. When the first molecule is an antigen and the second molecule is an antibody, preferred liquids are PBS, Tris, etc., and PBS is more preferred.

[0027] In order to efficiently obtain second molecules having a specific affinity Kd, the liquid flowing through the reaction vessel 110 equipped with the filter 112 must have an initial first molecule concentration [R] in the vessel. 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C (Hereinafter, this will be referred to as Equation (1)) The dilution rate D satisfies C The liquid is allowed to flow at a dilution rate D that satisfies equation (1). C By flowing the liquid into the reaction vessel, the possibility of recombination of the dissociated first and second molecules can be made negligible.

[0028] The complex of the first molecule and the second molecule and the free first molecule are collected in the reaction vessel 110 or in a separately provided collection unit 140. Collection methods include centrifugation, gravitational sedimentation, etc. If the first molecule is bound to magnetic beads, it can be collected using magnetism.

[0029] Next, the second molecule is dissociated from the collected complex of the first molecule and the second molecule. Dissociation may be performed in the reaction vessel 110, or in a separately provided collection section 140 or separation section 160. The dissociation method is not particularly limited as long as it does not decompose the target second molecule and maintains its activity. The second molecule can be dissociated from the complex by a physical method such as adjusting the washing time t during which a liquid is poured into the reaction vessel, or by a chemical method such as contacting the second molecule with an organic solvent such as acetonitrile or an acid such as hydrochloric acid.

[0030] Hereinafter, an embodiment of the present invention will be described in more detail with reference to the drawings.

[0031] FIG. 1 is a schematic diagram illustrating the concept of the present invention. A mixture of a first molecule 10, a second molecule 20 to be separated, and a third molecule not to be separated is introduced into a reaction vessel 110. The second molecule 20 binds to the first molecule 10 to form a complex 40. The second molecule 20 that binds to the first molecule to form the complex 40 has a desired affinity for the first molecule. The third molecule 30 that binds to the first molecule to form the complex 40 has an affinity for the first molecule that is lower than the desired affinity. Therefore, the third molecule may either bind to the first molecule 10 to form the complex 40 or not bind to the first molecule 10 to form the complex 40. Here, the complex between the first molecule 10 and the second molecule 20 may be referred to as a first complex, and the complex between the first molecule 10 and the third molecule 30 may be referred to as a second complex.

[0032] The reaction vessel 110 is charged with an initial first molecule concentration [R] 0 , the binding rate constant k between the first molecule and the second molecule on (mol / dm 3 s) and the liquid flow rate F in the container C Dilution rate D expressed as (L / sec) / container volume V (L) C Regarding k on [R] 0 ≪D C (Hereinafter, this will be referred to as Equation (1)) The dilution rate D satisfies C When the liquid is passed through the filter 112, the third molecule in the second complex that binds to the first molecule with an affinity lower than the desired affinity is released from the first molecule, and the third molecule dissociates from the first molecule. The third molecule 30 dissociated from the first molecule 10 and the third molecule 30 that does not bind to the first molecule flow out of the reaction vessel 110 through the filter 112. As a result, the reaction vessel 110 contains a complex in which the second molecule with the desired affinity binds to the first molecule, i.e., the first complex, and free first molecules, and therefore the second molecule with the desired affinity can be recovered. In other words, the third molecule can be separated from the mixture in the vessel by the filter.

[0033] 2 is a block diagram showing the apparatus according to this embodiment. A mixture 116 containing a first molecule 10, a second molecule 20, and a third molecule 30 is injected into a reaction vessel 110. In order to efficiently obtain a second molecule having a specific affinity Kd, a liquid supply unit 120 supplies a first molecule [R] to the reaction vessel 110 at an initial concentration of the first molecule [R]. 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C (Formula (1)) The dilution rate D satisfies C The liquid is fed to a reaction vessel 110 equipped with a filter 112. The dilution ratio D satisfies equation (1). C By flowing the liquid into the reaction vessel, the possibility of recombination of the dissociated first and second molecules can be made negligible.

[0034] 3 is a graph showing the relationship between the desired affinity Kd between the first molecule and the second molecule, the washing time (minutes), and the residual ratio Φ. Details of this system are described below.

[0035] The concentration of the unbound first molecule is [R], the concentration of the unbound second molecule is [Ls], and the concentration of the complex of the first and second molecules is [Ls R], and the dilution rate Dc of this system is defined as Fc / V, where Fc is the volume of the wash buffer (wash liquid) flowing into the system per unit time, and V is the volume of the system.

[0036] If there is a binding-dissociation reaction in the system, the rate equation for the complex in this system is:

number

number

[0037] Assuming that the supernatant liquid in the system is replaced immediately after the start of washing, the initial condition is the concentration of the complex [Ls·R] (0) is arbitrary, and the concentration of the second molecule [Ls] (0) =0.

[0038] In this case, the exact solution is the concentration of the complex [Ls·R] (t) but,

number

number

[0039] where:

number

number

[0040] Next, the "remaining rate of the second molecule bound to the first molecule" Φ after a certain washing time is calculated as the ratio of the washing time t to the dissociation rate constant k between the first and second molecules. off and function Φ(k off , t) as

number

[0041] The parameters that can be controlled in the experiment are the dilution rate Dc and the concentration of the first molecule [R]. 0 is.

[0042] The binding rate constant k between the first and second moleculeson has a low array dependency, approximately 10 4 ~10 5 m / sec (moles per second).

[0043] The survival rate Φ when satisfying Equation (1) is represented by the following function (a) k on [R] 0 << Dc (the recombination rate of the second molecule < the outflow rate to the outside of the shape) k on [R] 0 << Dc (the recombination rate of the second molecule < the outflow rate to the outside of the shape), in the above equations of Θ1 and Θ2, Λ + Dc ≒ k off + Dc.

[0044] As a result, in the case of the above assumption, the survival rate Φ is

Number

[0045] On the other hand, (b) Dc << k on [R] 0 (the outflow rate to the outside of the shape < the recombination rate of the second molecule), the survival rate is as follows.

[0046] Dc << k on [R] 0 (the outflow rate to the outside of the shape < the recombination rate of the second molecule), in the above equations of Θ1 and Θ2, Λ + Dc ≒ Λ, and Θ1 is

Number

Number

[0047] Here, k on [R] 0 << k off in the case of, the survival rate Φ is, as above,

Number

[0048] where the affinity of the second molecule for the first molecule (K d ) is K d =k off / k on and the binding rate constant between the first and second molecules is k on is 10 4 ~10 5 Therefore, k on is 10 4 Assuming that d Using Φ(K d , t)≒exp(-10 4 ·K d ·t) It is expressed as:

[0049] In Figure 3, the affinity parameter log 10 K d is less than -9, that is, the binding rate constant k between the first and second molecules on , the dissociation rate constant k between the first and second molecules off If is sufficiently small, the residual ratio Φ hardly decreases even with a long washing time of 10 minutes or more. Therefore, under such conditions, i.e., in the above (a) and (b), k on [R] 0 < <k off In the case of d A second molecule having the formula:

[0050] The liquid flowing into the reaction vessel may be, for example, a buffer. A collection vessel 100 collects the liquid and a third molecule that does not have the desired affinity for the first molecule. The flow rate may be measured, for example, by placing the reaction vessel on a weighing scale (not shown).

[0051] The collection unit 140 collects the complex in which the second molecule having the desired affinity is bound to the first molecule, and the released first molecule. The separation unit 160 is configured to dissociate the second molecule of the complex from the first molecule and separate the second molecule having the desired affinity. on [R] 0 ≪D C The dilution rate D satisfies C By flowing the liquid, the remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k off × t).

[0052] Since the residual rate Φ in the container decreases by increasing the washing time t, dissociation of the first molecule and the second molecule can be achieved by, for example, adjusting t. The separation unit 160 may be omitted, and the dissociation process may be performed in the reaction container 110 or the collection unit 140.

[0053] The structure of the separated second molecule can be analyzed appropriately by known methods.

[0054] FIG. 4 is a schematic diagram of an apparatus according to this embodiment. The mixture 116 shown in FIG. 2 is supplied to a reaction vessel 110. The mixture is a mixture of a first molecule, a second molecule, and a third molecule, and over time, forms a complex between the first molecule and the second molecule, a complex between the first molecule and the third molecule, a mixture of a third molecule that does not bind to the first molecule, and a mixture of free first molecules. For example, the first molecule is an antigen, the second molecule and the third molecule are antibodies or antigen-binding fragments, and the liquid is, for example, PBS buffer. In the figure, L1 indicates the liquid surface.

[0055] The liquid supply unit 120 supplies a liquid, for example, a PBS buffer, to the liquid supply unit 120 by using, for example, a pump (not shown). on [R] 0 ≪D C The dilution rate D satisfies CThe liquid is supplied to the reaction vessel 110 via an injection tube 114. The injection tube is configured to inject the liquid from the liquid supply unit 120 into the reaction vessel 110, and may be, for example, a silicone tube.

[0056] The filter 112 has a pore size that allows the third molecule to pass through but not the first molecule. For example, when the first molecule is bound to magnetic beads, the pore size of the filter may be, for example, 0.3-1.5 micrometers, preferably 0.5-1.0 micrometers, and more preferably 0.65 micrometers.

[0057] Before filtering the mixture, the mixture may be stirred to disperse the mixture in the container.

[0058] 5A shows a top view of the reaction vessel 110, (b) a cross-sectional side view taken along line AA, (c) a side view, and (d) a cross-sectional top view taken along line BB. As shown in FIG. 5D, the liquid injected from the injection tube circulates through the reaction vessel 110 at a flow rate F.

[0059] The shape of the reaction vessel is preferably cylindrical, as this can prevent clogging of the filter. When the vessel is cylindrical, it is desirable to form a filter on at least one of the bottom surfaces. In FIG. 5(b), circular filters are formed on two bottom surfaces of the vessel. In this case, the two filters do not necessarily have to be parallel to each other, and may be inclined. This can increase the filter area.

[0060] The shape of the reaction vessel is not limited to a cylindrical shape, and may be any shape such as a sphere, a cube, a rectangular parallelepiped, a cone, etc. In this case, the shape of the filter may be any shape such as a hemisphere or a rectangle, depending on the shape of the reaction vessel.

[0061] The cross-sectional area of ​​injection tube 114 is preferably smaller than the filter area. This is to facilitate circulation of the liquid within the reaction vessel. For example, when there is one filter, the cross-sectional area of ​​injection tube 114 is preferably 1 / 10 or less of the filter area, more preferably 1 / 20 or less, and even more preferably 1 / 40 or less. When there are two filters, the cross-sectional area of ​​injection tube 114 is preferably 1 / 20 or less of the filter area, more preferably 1 / 40 or less, and even more preferably 1 / 80 or less. In view of the above, when the vessel is cylindrical with a bottom diameter of 3 cm, the tube diameter (inner diameter) is preferably 1 cm or less, more preferably about 0.5 cm, and even more preferably about 0.3 cm.

[0062] The reaction vessel may further have a discharge tube (not shown) for connecting to the separation section 140 or the collection section 160. The discharge tube can be opened and closed, for example, by a valve. Note that when filtering the mixture, the discharge tube must be closed to prevent liquid or complexes from being discharged from the discharge tube.

[0063] 6A and 6B show a top cross-sectional view and a side cross-sectional view, respectively, of a first variation of the reaction vessel. The first variation has two injection tubes. The number of injection tubes is not limited to one or two, but may be three or more.

[0064] FIG. 7 shows (a) a top cross-sectional view and (b) a side cross-sectional view of a second variant of the reaction vessel. The second variant has one injection tube. The offset angle, which is the angle of the longitudinal axis of the injection tube relative to the center line X of the reaction vessel, is approximately 30°. This configuration facilitates circulation of the liquid flow F within the reaction vessel, effectively preventing clogging of the filter. The offset angle may be greater than 0° and less than or equal to 90°.

[0065] FIG. 8 shows (a) a top cross-sectional view of a reaction vessel modified example 3 and (b) a top cross-sectional view of a reaction vessel modified example 4. Variation 3 has two injection tubes. The offset angle, which is the angle of the longitudinal axis of the injection tube with respect to the center line X of the vessel, is approximately 30°. Variation 4 has three injection tubes. Even with this configuration, the liquid flow F in the reaction vessel is easily circulated, effectively preventing clogging of the filter.

[0066] The above-described embodiments are examples of the following aspects. (Aspect 1) 1. A method for isolating a second molecule having a desired affinity (Kd) for a first molecule using a filter, the method comprising: providing a sample containing a second molecule to be separated and a first molecule that binds to the second molecule; contacting a sample containing a second molecule with a first molecule in a container having a filter to form a complex in which the first molecule and the second molecule are bound; a liquid is passed through the vessel to wash and filter out molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than the desired affinity; Here, the permeation rate from the filter is the initial concentration of the first molecule in the container [R] 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C where Kd = (the dissociation rate constant k between the first molecule and the second molecule) off ) / (binding rate constant k between the first molecule and the second molecule on ) and collecting the complex in which the second molecule is bound to the first molecule and the free first molecule; and dissociating the second molecule from the first molecule in the complex; a method for isolating a second molecule having a desired affinity, comprising: (Aspect 2) k on is 10 4 ~10 5 M / sec (molar per second) The remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k off × t), where t is the cleaning time (seconds), k off is the dissociation rate constant between the first molecule and the second molecule, and the affinity and the initial binding rate constant k on It is expressed as a product of 2. The method of embodiment 1. (Aspect 3) 2. The method according to claim 1, wherein the pore size of the filter is 0.1 to 100 μm. (Aspect 4) 2. The method of embodiment 1, wherein the second molecule is an antibody or antigen-binding fragment. (Aspect 5) 2. The method of embodiment 1, wherein the first molecule is bound to a magnetic bead. (Aspect 6) The method of embodiment 1, wherein the first molecule is bound to a spherical structure having a diameter of 0.1 to 10 μm. (Aspect 7) 1. An apparatus for separating a second molecule having a desired affinity Kd for a first molecule using a filter, the apparatus comprising: a container having at least one filter and an inlet port, the container configured to contact a sample containing a second molecule with a first molecule to form a complex in which the first molecule and the second molecule are bound; the device configured to flush a liquid through the container to wash the first molecule and to permeate molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than a desired affinity through the filter; the permeation from the filter is an initial first molecule concentration [R] in the container; 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C where Kd = (the dissociation rate constant k between the first molecule and the second molecule) off ) / (binding rate constant k between the first molecule and the second molecule on ) a container, a collection section that collects a complex in which the second molecule binds to the first molecule and free first molecules; a separation unit that dissociates a second molecule from a first molecule in the complex and separates the second molecule of the complex; An apparatus comprising: (Aspect 8) k on is 10 4 ~10 5 M / sec (molar per second) The remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k off × t), where t is the cleaning time (seconds), k off is the dissociation rate constant between the first molecule and the second molecule, and the affinity and the binding rate constant k on It is expressed as a product of 8. The apparatus of embodiment 7. (Aspect 9) 8. The device according to embodiment 7, wherein the pore size of the filter is 0.1 to 100 μm. (Aspect 10) 8. The apparatus of embodiment 7, further comprising a collection vessel configured to collect the third molecule released from the second complex. (Aspect 11) 1. A container for use in an apparatus for separating a second molecule having a desired affinity Kd for a first molecule, the container comprising: at least one filter for separating the second molecule; Inlet port and Equipped with the container is configured to bring a sample containing a second molecule into contact with the first molecule to generate a complex in which the first molecule and the second molecule are bound; the container is configured to allow molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than a desired affinity to pass through the at least one filter via the inlet port; The permeation from the at least one filter is determined by the initial first molecule concentration [R] in the container. 0 , the binding rate constant k between the first molecule and the second molecule on and the flow rate F of the liquid in the container C Dilution ratio D expressed as / volume V of the container C Regarding k on [R] 0 ≪D C where Kd = (the dissociation rate constant k between the first molecule and the second molecule) off ) / (binding rate constant k between the first molecule and the second molecule on ) a container. (Aspect 12) k on is 10 4 ~10 5 M / sec (molar per second) The remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k off × t), where t is the cleaning time (seconds), k off is the dissociation rate constant between the first molecule and the second molecule, and the affinity and the binding rate constant k on 12. The container of embodiment 11, wherein the container is represented by the product of (Aspect 13) 12. The container according to aspect 11, wherein the pore size of the at least one filter is 0.1 to 100 μm. (Aspect 14) Aspect 12. The container of aspect 11, wherein the container is cylindrical and has at least one bottom surface provided with the at least one filter. (Aspect 15) 13. The container of claim 12, wherein the inlet port is a first inlet port, and the container further comprises a second inlet port separate from the first inlet port. (Aspect 16) Aspect 16. The container of any one of aspects 11-15, wherein the cross-sectional area of ​​the fill tube is no more than 1 / 10 of the area of ​​the filter. The present invention will be described below based on examples. However, the following examples are for the purpose of illustrating the present invention and are not intended to limit the present invention. [Example]

[0067] [Example 1] Fabrication of a device that uses a filter to separate a second molecule that has a desired affinity for a first molecule

[0068] A 50 mL centrifuge tube with its lid removed was sliced ​​into 8 mm slices approximately 1.3 cm from the opening. Two 4.8 cm diameter holes were drilled in the side of the tube using a drill press. Polyvinylidene fluoride (PVDF) membrane filters (Durapore® DVPP04700, Merck) were then glued to both ends using a glue gun (HOT BOND HB-80, Taiyo Electric). Silicone tubing (outer diameter / inner diameter: 5 mm / 3 mm) was then inserted and secured in place with instant adhesive (Super Multi-Purpose 2, 3M). Before use, the tubes were washed with PBS buffer, immersed in 200 mL of blocking buffer for at least 30 minutes, and then washed again with PBS buffer. The constructed apparatus is shown schematically in Figures 4 to 7.

[0069] [Example 2] (1) mRNA transcription The DNA was transcribed using the T7 RiboMAX™ Express Large Scale RNA Production System to obtain mRNA. The composition and conditions of the reaction solution are as follows:

[0070] [Table 1]

[0071] The resulting solution (total volume: 10 μL) was incubated at 37°C for 30 minutes, after which 1 μL of RQ1 Rnase-Free Dnase was added and incubated at 37°C for 15 minutes. After the incubation, purification was immediately carried out using RNAClean™ XP. The method of use was according to the attached manual.

[0072] The template DNA sequences of BDA and PDO are as shown in SEQ ID NOs: 1 and 2 below.

[0073] SEQ ID NO:1: Sequence name: T7Ω-BDA-His-Ytag Sequence (367mer) 5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGATAACAAATTCAACAAAGAACAACAAAATGCTTTCTATGAAATCTTACATTTACCTAACTTAAAC GAAGAACAACGCAATGGTTTCATCCAAAGCCTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAAGCACCAAAAGCTGACAACAAATTCAACGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGGGGAAA-3'

[0074] SEQ ID NO:2: Sequence name: T7Ω-PDO-His-Ytag Sequence (391mer) 5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGACCTTGAGGAGCTTGAGCAGTTTGCCAAGACCTTCAAACAAAGACGAATCAAACTTGGATTCACTCAGGGTGATGTT GGGCTCGCTATGGGGAAACTATATGGAAATGACTTCAGCCAAACTACCATCTCTCGATTTGAAGCCTTGAACCTCAGCTTTAAGAACATGGCTAAGTTGAAGCCACTTTTAGAGAAGTGGCTAAATGATGCAGAGGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGGGGAAA-3'

[0075] Newleft of SEQ ID NO: 3 was used as a primer for PCR of template DNA of BDA or PDO.

[0076] SEQ ID NO:3: Sequence name: Newleft Sequence (33mer) 5'-GATCCCGCGAAATTAATACGACTCACTATAGGG-3'

[0077] (2) Ligation reaction of linker and RNA The cnvK polyA linker and the mRNA synthesized in (1) were hybridized by annealing. Then, a ligation reaction was performed by photocrosslinking with UV irradiation. This resulted in a linker-mRNA conjugate. The composition of the reaction solution and reaction conditions are described below.

[0078] [Table 2]

[0079] The resulting solution, with a total volume of 20 μL, was annealed at 90-25° C. for 46 minutes using a T3 Thermocycler (Biometra), and then irradiated with UV light (366 nm, 405 mJ).

[0080] (3) Translation The linker-mRNA conjugate synthesized in (2) was used to synthesize a linker-protein conjugate using a nuclease-treated rabbit reticulocyte lysate, a cell-free translation system. The composition and conditions of the reaction solution are as follows:

[0081] [Table 3]

[0082] A total of 150 μL of the solution was incubated at 30°C for 20 minutes, followed by the addition of 72 μL of 3M KCl and 18 μL of 1M MgCl2, followed by incubation at 37°C for 60 minutes, followed by the addition of 54 μL of 0.5M EDTA, followed by incubation at 37°C for 5 minutes.

[0083] (4) Creation of cDNA display An equal volume of 2x SA Binding Buffer was added to the post-translation linker-protein conjugate sample, and the mixture was added to magnetic beads (MyOne Streptavidin C1) washed with 1x SA Binding Buffer. The reaction was then stirred at room temperature for 30 minutes using a cooled thermoblock rotator (Nisshin Rika). The magnetic beads were adjusted to 60 μL per 6 pmol of linker. The mixture was then placed on a magnetic stand and the supernatant was removed. Next, 300 μL of 1x SA Binding Buffer was added, followed by tapping, and the mixture was placed on a magnetic stand and the supernatant was removed. This procedure was repeated twice, after which 300 μL of 1x ReverTra Ace Buffer was added and the supernatant was removed as before. The following reverse transcription reaction solution was then added, and the reaction was stirred at 42°C for 30 minutes using a cooled thermoblock rotator (Nisshin Rika) to synthesize cDNA. The composition of the reaction solution is as follows:

[0084] [Table 4]

[0085] After the reaction, the cDNA display molecules were recovered by nucleic acid enzyme treatment. First, the mixture was placed on a magnetic stand and the supernatant was removed. 300 μL of His Tag Binding Buffer was added, followed by tapping. The mixture was then placed on the magnetic stand and the supernatant was removed. Next, 58.5 μL of His Tag Binding Buffer and 1.5 μL of RNase T1 were added and the reaction was stirred at 37°C for 15 minutes (using a cooled thermoblock rotator, Nisshin Rika). The cDNA display molecules were then His-tag purified. 60 μL of the recovered cDNA display sample was placed on 60 μL of His Mag Sepharose Ni, washed with 300 μL of His Tag Binding Buffer, and left overnight at 4°C. The mixture was then placed on a magnetic stand and the supernatant was removed. 300 μL of His Tag Binding Buffer was added, pipetted three times, and the supernatant was removed. This procedure was repeated twice, and then 60 μL of His-tag Elute Buffer was added. The mixture was stirred at room temperature for 10 minutes using a microtube mixer (MT-360, TOMY), and the supernatant was collected. Buffer exchange was then performed using Micro Bio-spin™ 6 Columns, and the supernatant solution was replaced with PBS. The procedure was as described in the attached manual.

[0086] (5) Immobilization of IgG on magnetic beads Biotinylated IgG was immobilized on magnetic beads (Dynabeads M-270 Streptavidin) using a biotinylation reagent (EZ-Link™ Sulfo-NHS-SS-Biotin). First, 150 µL of IgG dissolved in PBS at 1 mg / mL was added to 1 µL of 10 mM EZ-Link™ NHS-SS-Biotin in PBS and incubated at 25°C for 30 minutes (Cool Stat 5200) to biotinylate the IgG. Next, buffer exchange was performed using Zeba™ spin desalting columns (7K), and the solution was replaced with 1x SA binding buffer. The procedure was as described in the attached manual. The biotin-IgG solution was stored at -80°C. Next, 5 μL of Biotin-IgG solution and 45 μL of 1× SA Binding Buffer were added to 50 μL of Dynabeads M-270 Streptavidin, which had been washed with 100 μL of 1× SA Binding Buffer, and the mixture was incubated with stirring at 25°C for 20 minutes (cooled thermoblock rotator, Nisshin Rika) to immobilize the IgG.

[0087] (6)k off -Selection To evaluate the device prepared in Example 1, model selection was performed using the IgG-targeting BDA cDNA display and the negative control PDO cDNA display. 50 μL of IgG-Beads prepared in (5) were washed three times with 100 μL of PBS, and 20 μL of BDA cDNA display and 20 μL of PDO cDNA display prepared in (4) were added and stirred at 25°C for 60 minutes (cooled thermoblock rotator, Nisshin Rika) to bind the IgG and BDA cDNA displays. The mixture was then placed on a magnetic stand, and the supernatant was collected (Sup(1)). 200 μL of PBS was added, and after tapping, the mixture was analyzed using the device prepared in Example 1. on [R] 0 ≪D CThe beads were washed for 5, 10, or 30 minutes at a dilution rate that met the above criteria. After washing, the IgG-Beads solution was recovered from the device and placed on a magnetic stand. 100 μL of the supernatant was then collected (Sup(2)). The disulfide bonds between the IgG and biotin were cleaved with DTT, a reducing agent, to elute the IgG-BDA cDNA display complex. 50 μL of 100 mM PBS was added, and the mixture was stirred at 50°C for 30 minutes (cooled thermoblock rotator, Nisshin Rika). The mixture was then placed on the magnetic stand and the supernatant was collected (Sup(3)). 100 μL of 0.1% (v / v) SDS in PBS was then added, and the mixture was stirred at room temperature for 10 minutes using a microtube mixer (MT-360, TOMY). The mixture was then placed on the magnetic stand and the supernatant was collected (Sup(4)).

[0088] (7)k off -PCR for confirmation of selection Nucleic acid PAGE off To confirm the results of the -selection, the recovered cDNA display molecules were amplified by PCR. PCR was performed using a 10-fold diluted solution of Sup(1), (2), (3), and (4) with UPDW as the DNA template, and the PCR products were analyzed by 8M urea 4% PAGE. A 100 bp DNA ladder was used as a marker. The composition and conditions of the PCR reaction solution are as follows:

[0089] [Table 5]

[0090] Step 1: 98℃ (30 seconds) Step 2: 95℃ (15 seconds) Step 3: 68°C (5 seconds) Step 4: 72°C (23 seconds) Step 5: 72°C (2 minutes) Step 6: 4℃ (Pause) [Step 2 → 4, 30 cycles]

[0091] Here, New Y tag poly A for cnvK and T7omegaNew are sequences represented by the following SEQ ID NOs: 4 and 5, respectively.

[0092] SEQ ID NO:4: Sequence name: New Ytag poly A for cnvK Sequence (22mer) 5'-TTTCCCCGCCGCCCCCCGTCCT-3'

[0093] SEQ ID NO:5: Sequence name: T7omegaNew: Sequence (60mer) 5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACA-3'

[0094] As a result of electrophoresis, a band with the same electrophoretic mobility as the reference sample was detected, and when the band intensity of the DTT eluate was compared relative to the washing time, the band intensity decreased over time. off -Check that selection is being performed.

[0095] The results are shown in Figure 9. The band intensity ratio is shown in Figure 10 as a percentage, which indicates what percentage the intensity of each band accounts for relative to the total intensity of all bands in Sup(3) (DTT eluate).

[0096] Using the device prepared in Example 1, it was shown that increasing the washing time (shown on the horizontal axis) to 5 minutes (300 seconds), 10 minutes (600 seconds), and 30 minutes (1800 seconds) correlated with a decrease in band intensity ratio, enabling the acquisition of second molecules with high affinity. Specifically, in this example, the B domain of Protein A (BDA, corresponding to the second molecule) with a Kd of approximately 10 nM relative to IgG (corresponding to the first molecule) was used, and the figure shows that the bound molecules peeled off over time in correlation with the washing time, resulting in fewer remaining molecules. It can be seen that the smaller the Kd (the stronger the binding), the more likely the molecule is to remain even with a longer washing time. In other words, it is selected. [Explanation of symbols]

[0097] 10 1st molecule 20 Second molecule 30 Third molecule 40 Complex 100 Collection container 110 Reaction vessel 112 filters 114 Injection tube 116 Mixture 120 Liquid supply section 140 Collection Department 160 Separation section Fc flow rate L1 liquid level V flow velocity

Claims

1. 1. A method for isolating a second molecule having a desired affinity (Kd) for a first molecule using a filter, the method comprising: providing a sample containing a second molecule to be separated and a first molecule that binds to the second molecule; contacting a sample containing a second molecule with a first molecule in a container having a filter to form a complex in which the first molecule and the second molecule are bound; a liquid is passed through the vessel to wash and filter out molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than a desired affinity; Here, the permeation from the filter is the initial first molecule concentration in the container [R] ０ , the binding rate constant k between the first molecule and the second molecule ｏｎ and the flow rate F of the liquid in the container Ｃ / Dilution ratio D expressed as the volume V of the container Ｃ Regarding k ｏｎ [R] ０ ≪D Ｃ where Kd = (dissociation rate constant k between the first molecule and the second molecule) ｏｆｆ ) / (binding rate constant k between the first molecule and the second molecule ｏｎ ) and collecting the complex in which the second molecule is bound to the first molecule and the free first molecule; and dissociating the second molecule from the first molecule in the complex; a method for isolating a second molecule having a desired affinity, comprising:

2. k ｏｎ is 10 ４ ~10 ５ M / sec (molar per second), The remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k ｏｆｆ × t), where t is the cleaning time (seconds), k ｏｆｆ is the dissociation rate constant between the first molecule and the second molecule, and the affinity and the binding rate constant k ｏｎ It is expressed as a product of The method of claim 1.

3. 2. The method according to claim 1, wherein the pore size of the filter is 0.1 to 100 μm.

4. The method of claim 1 , wherein the second molecule is an antibody or antigen-binding fragment.

5. The method of claim 1 , wherein the first molecule is bound to a magnetic bead.

6. 2. The method of claim 1, wherein the first molecule is bound to a spherical structure having a diameter of 0.1 to 10 μm.

7. 1. An apparatus for separating a second molecule having a desired affinity Kd for a first molecule using a filter, the apparatus comprising: a container having at least one filter and an inlet port, the container being configured to contact a sample containing a second molecule with a first molecule to form a complex in which the first molecule and the second molecule are bound; the device being configured to flush a liquid through the container to wash the first molecule and to permeate molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than a desired affinity through the filter; the permeation from the filter is an initial first molecule concentration [R] in the container; ０ , the binding rate constant k between the first molecule and the second molecule ｏｎ and the flow rate F of the liquid in the container Ｃ / Dilution ratio D expressed as the volume V of the container Ｃ Regarding k ｏｎ [R] ０ ≪D Ｃ where Kd = (dissociation rate constant k between the first molecule and the second molecule) ｏｆｆ ) / (binding rate constant k between the first molecule and the second molecule ｏｎ ) a container, a collection section that collects a complex in which the second molecule binds to the first molecule and free first molecules; a separation unit that dissociates a second molecule from a first molecule in the complex and separates the second molecule of the complex; An apparatus comprising:

8. k ｏｎ is 10 ４ ~10 ５ M / sec (molar per second), The remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k ｏｆｆ × t), where t is the cleaning time (seconds), k ｏｆｆ is the dissociation rate constant between the first molecule and the second molecule, and the affinity and the binding rate constant k ｏｎ It is expressed as a product of 8. The apparatus of claim 7.

9. 7. The device according to claim 6, wherein the pore size of the filter is 0.1 to 100 μm.

10. The apparatus of claim 7 , further comprising a collection vessel configured to collect the third molecule released from the second complex.

11. 1. A container for use in an apparatus for separating a second molecule having a desired affinity, Kd, ​​for a first molecule, the container comprising: at least one filter for separating the second molecule; Inlet port and Equipped with the container is configured to bring a sample containing a second molecule into contact with the first molecule, thereby generating a complex in which the first molecule and the second molecule are bound; the container is configured to allow molecules that do not bind to the first molecule and molecules that bind to the first molecule with less than a desired affinity to pass through the at least one filter via the inlet port; The permeation from the at least one filter is determined by the initial first molecule concentration in the container [R] ０ , the binding rate constant k between the first molecule and the second molecule ｏｎ and the flow rate F of the liquid in the container Ｃ / Dilution ratio D expressed as the volume V of the container Ｃ Regarding k ｏｎ [R] ０ ≪D Ｃ where Kd = (dissociation rate constant k between the first molecule and the second molecule) ｏｆｆ ) / (binding rate constant k between the first molecule and the second molecule ｏｎ ) a container.

12. k ｏｎ is 10 ４ ~10 ５ M / sec (molar per second), The remaining rate Φ of the complex formed by binding the first molecule and the second molecule in the container is Φ=exp(-k ｏｆｆ × t), where t is the cleaning time (seconds), k ｏｆｆ is the dissociation rate constant between the first molecule and the second molecule, and the affinity and the binding rate constant k ｏｎ The container of claim 11, wherein the container is expressed as a product of

13. 12. The container of claim 11, wherein the pore size of the at least one filter is between 0.1 and 100 μm.

14. 12. The container according to claim 11, wherein the container is cylindrical and has at least one bottom surface provided with the at least one filter.

15. 13. The container of claim 12, wherein the inlet port is a first inlet port, and the container further comprises a second inlet port separate from the first inlet port.

16. 16. A container according to any one of claims 11 to 15, wherein the cross-sectional area of ​​the injection tube is no more than 1 / 10 of the area of ​​the filter.

Images