Multiple myeloma model cell having deletion in short arm of chromosome 17

Abstract

To provide a new technique related to a multiple myeloma model cell having a deletion in the short arm of chromosome 17.SOLUTION: The method for producing the multiple myeloma-model cells having the deletion in the short arm of the chromosome 17 includes a process for deleting a region containing the whole TP53 genes of the short arm of the chromosome 17 of multiple myeloma-cell line. The multiple myeloma-derived cell strain is one of MM. 1S, H929, MOLP8, and SKMM2, and the step includes a step of introducing a first nucleotide encoding spCas9 into the genome of the multiple myeloma-derived cell strain, and a step of introducing a second nucleotide encoding a plurality of sgRNAs into the genome of the multiple myeloma-derived cell strain, the sgRNAs hybridizing to the short arm of chromosome 17 and having different hybridizing regions.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a multiple myeloma model cell line having a deletion in the short arm of chromosome 17. [Background technology]

[0002] Multiple myeloma is a type of blood cancer that has traditionally been known as a cancer of plasma cells. The proliferation of abnormal myeloma cells, which are cancerous plasma cells, can cause symptoms such as bone destruction, kidney damage, decreased immune function, and anemia.

[0003] In recent years, the administration of immunomodulatory drugs has significantly extended the survival time of multiple myeloma patients. For example, Patent Document 1 discloses immunomodulatory compounds as therapeutic agents for various diseases such as multiple myeloma.

[0004] In immunomodulatory drug treatment approaches, one of the important poor prognostic factors is deletion of the short arm of chromosome 17 (17p), which includes the TP53 gene. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Special Publication No. 2006-514689 Summary of the Invention [Problem to be solved by the invention]

[0006] However, no drugs have been found to be specifically effective against deletions in the short arm of chromosome 17. Furthermore, when screening for effective drugs using model cells for multiple myeloma, no method for generating model cells for multiple myeloma with deletions in the short arm of chromosome 17 was previously known.

[0007] The present invention has been made in view of the above circumstances, and aims to provide a multiple myeloma model cell having a deletion in the short arm of chromosome 17, or a novel technique relating to the multiple myeloma model cell. [Means for solving the problem]

[0008] In order to solve the above problems, one aspect of the present invention includes the following aspects. [1] A method for producing a multiple myeloma model cell having a deletion in the short arm of chromosome 17, comprising the step of deleting a region including the entire TP53 gene in the short arm of chromosome 17 of a multiple myeloma cell line, wherein the multiple myeloma cell line is one of MM.1S, H929, MOLP8, and SKMM2, and the step comprises the steps of: introducing a first nucleotide encoding spCas9 into the genome of the multiple myeloma cell line; and introducing a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions.

[0009] [2] The method for producing multiple myeloma model cells described in [1], wherein the second nucleotide comprises a first base sequence encoding a first sgRNA that hybridizes to the SPECC1 gene on the genome and a second base sequence encoding a second sgRNA that hybridizes to the NXN gene on the genome.

[0010] [3] A method for producing multiple myeloma model cells described in [2], wherein the first sgRNA has a base sequence that specifically hybridizes to an intron of the SPECC1 gene, and the second sgRNA has a base sequence that specifically hybridizes to an intron of the NXN gene.

[0011] [4] A method for producing multiple myeloma model cells according to [3], wherein the first sgRNA has the base sequence shown in SEQ ID NO: 1, and the second sgRNA has the base sequence shown in SEQ ID NO: 2.

[0012] [5] The method for producing multiple myeloma model cells described in [1], wherein the second nucleotide comprises a third base sequence encoding a third sgRNA that hybridizes to the CTC1 gene on the genome, and a fourth base sequence encoding a fourth sgRNA that hybridizes to the POLR2A gene on the genome.

[0013] [6] A method for producing multiple myeloma model cells described in [5], wherein the third sgRNA has a base sequence that specifically hybridizes to an intron of the CTC1 gene, and the fourth sgRNA has a base sequence that specifically hybridizes to an intron of the POLR2A gene.

[0014] [7] A method for producing multiple myeloma model cells according to [6], wherein the third sgRNA has the base sequence shown in SEQ ID NO: 3 and the fourth sgRNA has the base sequence shown in SEQ ID NO: 4.

[0015] [8] The method for producing multiple myeloma model cells described in claim 1, wherein the step of deleting a region including the entire TP53 gene on the short arm of chromosome 17 produces cells in which a large region of 7 million bp or more including the entire TP53 gene has been deleted, and cells in which a small region of 4 million bp or less including the entire TP53 gene has been deleted.

[0016] [9] A multiple myeloma model cell line having a deletion in the short arm of chromosome 17, in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 but have different hybridizing regions have been introduced into the genome of one of the multiple myeloma cell lines MM.1S, H929, MOLP8, and SKMM2, and the genomic region including the entire TP53 gene on the short arm of chromosome 17 has been deleted.

[0017]

[10] The multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to [9], wherein the deleted genomic region is 7 million bp or more.

[0018]

[11] A multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to

[10] , wherein the deleted genomic region is the region from the SPECC1 gene to the NXN gene on the short arm of chromosome 17.

[0019]

[12] The multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to [9], wherein the deleted genomic region is 4 million bp or less.

[0020]

[13] A multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to

[12] , wherein the deleted genomic region is the region from the CTC1 gene to the POLR2A gene on the short arm of chromosome 17.

[0021]

[14] A set of multiple myeloma model cells, comprising: a first multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and that have different hybridizing regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted; and a second multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and that have different hybridizing regions have been introduced into the genome of the said multiple myeloma cell line, and a genomic region of 4 million bp or less including the entire TP53 gene on the short arm of chromosome 17 has been deleted.

[0022]

[15] A first multiple myeloma model cell, in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and in which a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted; and a first multiple myeloma model cell, in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of the one multiple myeloma cell line selected from MM.1S, H929, MOLP8, and SKMM2, and in which a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted. a second multiple myeloma model cell into which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 but have different hybridizing regions have been introduced into the genome of the first multiple myeloma cell line, and in which a genomic region of 4 million bp or less including the entire TP53 gene on the short arm of chromosome 17 has been deleted; and a cell set comprising: a first multiple myeloma model cell into which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 but have different hybridizing regions have been introduced into the genome of the first multiple myeloma model cell; and in which the genome has been cleaved by spCas9 but the genomic region including the entire TP53 gene on the short arm of chromosome 17 has not been deleted.

[0023]

[16] A method for screening for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17, comprising: a step of culturing, in the presence of a test substance, multiple myeloma model cells in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and which lack a genomic region including the entire TP53 gene in the short arm of chromosome 17, wherein the method indicates that the test substance is a candidate for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17, wherein the first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions introduced into the genome of the multiple myeloma cell line selected from MM.1S, H929, MOLP8, and SKMM2, and the multiple myeloma model cells lack a genomic region including the entire TP53 gene in the short arm of chromosome 17, wherein the survival rate of the multiple myeloma model cells cultured in the presence of the test substance is lower than that of the multiple myeloma model cells cultured in the absence of the test substance, indicating that the test substance is a candidate for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17.

[0024]

[17] The method for screening a therapeutic agent described in

[16] , wherein the multiple myeloma model cells lacking a genomic region including the entire TP53 gene on the short arm of chromosome 17 include a first multiple myeloma model cell lacking a genomic region of 7 million bp or more including the entire TP53 gene, and a second multiple myeloma model cell lacking a genomic region of 4 million bp or less including the entire TP53 gene.

[0025]

[18] A method for screening a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17, comprising: introducing a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2; and screening a multiple myeloma model cell in which a genomic region including the entire TP53 gene in the short arm of chromosome 17 is deleted; and screening the genome of the one of the multiple myeloma cell lines. and cells in which the first nucleotide and the second nucleotide have been introduced into a target gene, and in which the genome has been cleaved by spCas9 but the genomic region containing the entire TP53 gene on the short arm of chromosome 17 has not been deleted, in the presence of a test substance; and cells in which the genome has been cleaved by spCas9 but the genomic region containing the entire TP53 gene on the short arm of chromosome 17 has not been deleted, in the presence of a test substance; and [Effects of the Invention]

[0026] According to the present invention, it is possible to provide a multiple myeloma model cell having a deletion in the short arm of chromosome 17, or a novel technique relating to the multiple myeloma model cell. [Brief explanation of the drawings]

[0027] [Figure 1]This is an electrophoresis image after PCR of the short arm region spanning cells obtained by introducing the Set A plasmids targeting the introns of SPECC1 and NXN into MM.1S. [Figure 2] This is an electrophoresis image after PCR of the short arm region spanning cells obtained by introducing the Set B plasmids targeting the introns of CTC1 and POLR2A into MM.1S. [Figure 3] This is a fluorescence microscopy image of Ace cells, in which the vicinity of the TP53 gene and the centromere of chromosome 17 were visualized using the FISH method. [Figure 4] This is a fluorescence microscopy image of queen cells, in which the vicinity of the TP53 gene and the centromere of chromosome 17 were visualized using the FISH method. [Figure 5] G-band staining images of Ace, Queen, Koriki, and Cas9 cells. [Figure 6] This is an image showing the results of whole exome sequencing of Ace, Queen, Koriki, and Cas9 cells. [Figure 7] 1 is an image showing the P53 protein band after Western blotting. [Figure 8] 1 is a graph showing the results of measuring the amount of P53 protein by Western blotting. [Figure 9] 1 is a graph showing the viability of cells to which lenalidomide was added. [Figure 10] 1 is a graph showing the viability of cells to which idarubicin was added. DETAILED DESCRIPTION OF THE INVENTION

[0028] Preferred embodiments of the present invention will be described in detail below, but the present invention is not limited to the following embodiments.

[0029] [Method for producing multiple myeloma model cells with deletions in the short arm of chromosome 17] A method for producing a multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to a preferred embodiment of the present invention comprises a step of deleting a region including the entire TP53 gene in the short arm of chromosome 17 of a multiple myeloma cell line. The cells obtained by deleting a region including the entire TP53 gene in the short arm of chromosome 17 of a multiple myeloma cell line are multiple myeloma model cells having a deletion in the short arm of chromosome 17.

[0030] Hereinafter, the process of deleting the region containing the entire TP53 gene on the short arm of chromosome 17 of a multiple myeloma cell line is also referred to as the "short arm deletion process," and the region deleted in the short arm deletion process is also referred to as the "deleted region."

[0031] <Short arm deletion process> The short arm deletion process includes introducing a first nucleotide encoding spCas9 into the genome of a multiple myeloma cell line, and introducing a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions into the genome of the multiple myeloma cell line.

[0032] The multiple myeloma cell lines targeted for deletion of the short arm of chromosome 17 in the short arm deletion process are MM.1S, H929 (NCI-H929), MOLP8, and SKMM2. None of these cell lines are widely used as multiple myeloma cell lines, and the TP53 gene is not deleted.

[0033] The multiple myeloma cell line into which the first nucleotide is introduced and the cell line into which the second nucleotide is introduced are the same cells. Therefore, in the short arm deletion step, both the first and second nucleotides are introduced into the genome of the multiple myeloma cell line in which the short arm of chromosome 17 is to be deleted.

[0034] As a result, multiple sgRNAs expressed from the second nucleotide introduced into the genome of multiple myeloma cell lines each hybridize to a different region of the short arm of chromosome 17. Then, spCas9 expressed from the first nucleotide introduced into the genome forms a complex with the sgRNA and cleaves the genome several bases upstream of the PAM sequence (NGG) on the genome.

[0035] Here, by encoding multiple sgRNAs in which the second nucleotide hybridizes to different regions on the genome, it is possible to delete large areas of the genome between multiple cleavage sites.

[0036] Therefore, by designing two or more sgRNAs on the short arm of chromosome 17 to hybridize, for example, to a region on the long arm side of the TP53 gene and a region on the opposite side (in other words, designing multiple sgRNAs that hybridize outside the TP53 gene so as to span it), and expressing them in cells, it is possible to delete at least the region containing the entire TP53 gene from the short arm of chromosome 17.

[0037] After cutting both ends of the deleted region, some cells may fuse together (fused), while others may not. If the regions on both sides of the deleted region do not fuse, the cells may not survive due to extensive gene loss. Similarly, if the region containing at least the entire TP53 gene is deleted from both alleles, the cells may not survive. Therefore, it is highly likely that cells that survive after deletion of the short arm of chromosome 17 are cells in which deletion has occurred in only one allele.

[0038] The site on the genome where the first and second nucleotides are introduced is not particularly limited. By culturing the cells after the introduction, only cells that can survive in the state where the first and second nucleotides have been introduced are selected.

[0039] The order in which the first nucleotide and the second nucleotide are introduced is not particularly limited. For example, the first nucleotide may be introduced followed by the second nucleotide, the second nucleotide may be introduced followed by the first nucleotide, or the first nucleotide and the second nucleotide may be introduced simultaneously.

[0040] The first and second nucleotides may be located on the same DNA strand or on different DNA strands. If they are located on the same DNA strand (e.g., in the same lentiviral vector), the region encoding spCas9 and the region encoding the multiple sgRNAs are located at different positions on the same DNA strand.

[0041] Furthermore, in the second nucleotide, each region encoding multiple sgRNAs may be on the same DNA strand or on separate DNA strands, i.e., the second nucleotide may be located within a single DNA strand with the same base sequence, or may be distributed among two or more DNA strands with different base sequences, with each sgRNA-encoding region being distributed separately.

[0042] When the regions encoding the multiple sgRNAs are on separate DNA strands, each DNA strand may be introduced into the genome of the multiple myeloma cell line at separate times or simultaneously.

[0043] As used herein, "multiple sgRNAs" refers to multiple sgRNAs that differ from one another in their base sequences. The number of sgRNAs that differ from one another in their base sequences may be, for example, two, three, four, or five or more. When the number of sgRNAs is three or more, the sgRNAs can be designed to hybridize with both ends of the region to be deleted and the regions within them.

[0044] In multiple myeloma patients with a short-arm deletion including the TP53 gene, the size and location of the deleted region vary greatly among patients. Therefore, the genomic region to be deleted in the short-arm deletion process (deletion region) needs to include at least the entire TP53 gene, and the size and location of the region are not particularly limited. Note that the deletion region does not include telomeres.

[0045] The upper limit of the size of the genomic region of the short arm of chromosome 17 to be deleted in the short arm deletion step may be, for example, 750,000 bp, 800,000 bp, 1 million bp, 2 million bp, 3 million bp, 4 million bp, 5 million bp, 6 million bp, 8 million bp, 10 million bp, 13 million bp, 16 million bp, 20 million bp, or 21 million bp.

[0046] Furthermore, the lower limit of the size of the genomic region of the short arm of chromosome 17 to be deleted in the short arm deletion step may be, for example, 25,770 bp, 26,000 bp, 30,000 bp, 50,000 bp, 100,000 bp, 500,000 bp, 700,000 bp, 1 million bp, 2 million bp, 3 million bp, 5 million bp, 7 million bp, 9 million bp, 10 million bp, 15 million bp, 18 million bp, or 19 million bp. The upper and lower limits of the size can be combined arbitrarily. The TP53 gene is approximately 25,760 bp.

[0047] Furthermore, the size of the genomic region of the short arm of chromosome 17 to be deleted in the short arm deletion step may be, for example, 25,770 to 1 million bp, 100,000 to 1 million bp, 500,000 to 1 million bp, 25,770 to 4 million bp, 100,000 to 3 million bp, 1 million to 5 million bp, 7 million to 21 million bp, 15 million to 21 million bp, or 19 million to 20 million bp.

[0048] The second nucleotide may include a first base sequence encoding a single-stranded RNA (first sgRNA) that hybridizes to the SPECC1 gene in the genome. The first base sequence may be a base sequence encoding the first sgRNA that hybridizes to an intron of the SPECC1 gene.

[0049] An example of the first sgRNA that hybridizes to an intron of the SPECC1 gene is an RNA containing as a crRNA the nucleotide sequence set forth in SEQ ID NO: 1. The sgRNA containing the crRNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 specifically hybridizes to a genomic region consisting of bases 20114022 to 20114041 from the 5' end of chromosome 17 in the hg38 human reference genome (see SEQ ID NO: 5 for the nucleotide sequence).

[0050] The second nucleotide may include a second base sequence encoding a single-stranded RNA (second sgRNA) that hybridizes to the NXN gene on the genome. The second base sequence may be a base sequence encoding the second sgRNA that hybridizes to an intron of the NXN gene.

[0051] An example of a second sgRNA that hybridizes to an intron of the NXN gene is an RNA containing as a crRNA the nucleotide sequence shown in SEQ ID NO: 2. The sgRNA containing the crRNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 specifically hybridizes to a genomic region consisting of bases 840640 to 840659 from the 5' end of chromosome 17 in the hg38 human reference genome (see SEQ ID NO: 6 for the nucleotide sequence).

[0052] The second nucleotide may include a third base sequence encoding a single-stranded RNA (third sgRNA) that hybridizes to the CTC1 gene in the genome. The third base sequence may be a base sequence encoding the third sgRNA that hybridizes to an intron of the CTC1 gene.

[0053] An example of a second sgRNA that hybridizes to an intron of the CTC1 gene is an RNA containing as a crRNA the nucleotide sequence shown in SEQ ID NO: 3. The sgRNA containing the crRNA consisting of the nucleotide sequence shown in SEQ ID NO: 3 specifically hybridizes to a genomic region consisting of bases 8228438 to 8228457 from the 5' end of chromosome 17 in the hg38 human reference genome (see SEQ ID NO: 7 for the nucleotide sequence).

[0054] The second nucleotide may include a fourth base sequence encoding a single-stranded RNA (fourth sgRNA) that hybridizes to the POLR2A gene in the genome. The fourth base sequence may be a base sequence encoding the fourth sgRNA that hybridizes to an intron of the POLR2A gene.

[0055] An example of the second sgRNA that hybridizes to an intron of the POLR2A gene is an RNA containing as a crRNA the nucleotide sequence shown in SEQ ID NO: 4. The sgRNA containing the crRNA consisting of the nucleotide sequence shown in SEQ ID NO: 4 specifically hybridizes to a genomic region consisting of bases 7498527 to 7498546 from the 5' end of chromosome 17 in the hg38 human reference genome (see SEQ ID NO: 8 for the nucleotide sequence).

[0056] For example, when the nucleotides of the first and second base sequences are introduced into the genome of a multiple myeloma cell line, i.e., when the second nucleotide sequence contains both the first and second base sequences, the cleavage activity of spCas9 deletes the region from the SPECC1 gene to the NXN gene on the short arm of chromosome 17. In this case, depending on the cleavage site, the deleted region is approximately 19.27 million bp (the size of the deleted region for Ace in the examples).

[0057] Furthermore, for example, when the nucleotides of the third and fourth base sequences are introduced into the genome of a multiple myeloma cell line, i.e., when the second nucleotide sequence contains the third and fourth base sequences, the cleavage activity of spCas9 deletes the region from the CTC1 gene to the POLR2A gene on the short arm of chromosome 17. In this case, depending on the cleavage site, the deleted region is approximately 730,000 bp (the size of the deleted region in Queen in the Examples).

[0058] Furthermore, for example, when the nucleotides of the first base sequence and the nucleotides of the fourth base sequence are introduced into the genome of a multiple myeloma cell line, i.e., when the second nucleotide sequence contains the first and fourth base sequences, the cleavage activity of spCas9 deletes the region from the SPECC1 gene to the POLR2A gene on the short arm of chromosome 17. In this case, the deleted region is approximately 12.61 million bp, depending on the cleavage site.

[0059] Furthermore, for example, when the nucleotides of the second base sequence and the nucleotides of the third base sequence are introduced into the genome of a multiple myeloma cell line, i.e., when the second nucleotide contains the second and third base sequences, the cleavage activity of spCas9 deletes the region from the NXN gene to the CTC1 gene on the short arm of chromosome 17. In this case, the deleted region is approximately 7.39 million bp, depending on the cleavage site.

[0060] In all four of these deletion patterns, the deleted region includes the entire TP53 gene in the human genome.

[0061] The genomic region to which the second sgRNA hybridizes, i.e., the cleavage site by spCas9, is not particularly limited as long as it is on the short arm of chromosome 17, and may be, for example, an exon region, intron region, promoter region, enhancer region, or region not involved in protein or RNA synthesis of SPECC1, NXN, CTC1, or POLR2A, or other genes located on the short arm of chromosome 17. However, as described in detail in the Examples below, by designing sgRNAs (crRNAs) to hybridize to the introns of each gene, binding between the regions outside the two cleavage sites has been confirmed after single-cell cloning.

[0062] The first and second nucleotides are, for example, linked to a promoter and incorporated into a plasmid vector, viral vector, or the like, and then introduced into the genome of a multiple myeloma cell line.

[0063] The efficiency of cleavage by spCas9 can be increased by linking the first nucleotide downstream of a promoter that can constitutively express at high levels, such as the EF1α promoter, CAG promoter, CMV promoter, or EFS promoter. However, the type of promoter that controls the transcription of the first nucleotide into spCas9-encoding RNA is not limited to these.

[0064] The efficiency of spCas9 cleavage can be increased by linking the second nucleotide downstream of a promoter that can constitutively express at high levels, such as the hU6 promoter, H1 promoter, or EF1α promoter. However, the type of promoter that controls the transcription of the second nucleotide into sgRNA is not limited to these.

[0065] The method for introducing (transfecting) the gene into the genome of a multiple myeloma cell line is not particularly limited, but examples include electroporation, lipofection, and methods using viruses.

[0066] In the viral transfer method, a plasmid containing the first nucleotide and / or the second nucleotide is incorporated into a lentivirus, adeno-associated virus, adenovirus, etc., and then introduced into the cells of a multiple myeloma cell line. This allows the plasmid containing the first nucleotide and / or the second nucleotide to be introduced into the genome of the multiple myeloma cell line.

[0067] In the method for producing multiple myeloma model cells of this embodiment, the short arm deletion step may be used to produce first multiple myeloma model cells in which a relatively large region including the entire TP53 gene has been deleted, and second multiple myeloma model cells in which a relatively small region including the entire TP53 gene has been deleted.

[0068] As described above, the deleted region varies greatly among multiple myeloma patients with deletion of the short arm of chromosome 17. Therefore, as will be described in detail later in an embodiment of a method for screening for a therapeutic agent, by using a first multiple myeloma model cell in which a relatively large region has been deleted and a second multiple myeloma model cell in which a relatively small region has been deleted, it is possible to screen for candidate therapeutic agents that are effective for many multiple myeloma patients, regardless of the size of the deleted region.

[0069] The multiple myeloma cell line subjected to the short arm deletion process to produce the first multiple myeloma model cell and the multiple myeloma cell line subjected to the short arm deletion process to produce the second multiple myeloma model cell are the same type of cell line, namely, MM.1S, H929, MOLP8, and SKMM2.

[0070] The lower limit of the size range of the deleted region in the first multiple myeloma model cell in which a relatively large region has been deleted may be, for example, 5 million bp, 6 million bp, 7 million bp, 8 million bp, 10 million bp, 13 million bp, 16 million bp, or 19 million bp.

[0071] The upper limit of the size range of the deleted region in the first multiple myeloma model cell in which a relatively large region has been deleted may be, for example, 21 million bp, or may be 20 million bp.

[0072] The lower and upper limits of the size range of the deleted region in the first multiple myeloma model cell can be arbitrarily combined. In this specification, the size of the deleted region specifically refers to the size of the region deleted from the original genome, and does not refer to the size obtained by subtracting the deleted genome size from the original genome size. As will be explained in the Examples below, when DNA fragments are combined after genome cleavage, DNA fragments may be incorporated between the DNA fragments, so the size obtained by subtracting the deleted genome size from the original genome size does not necessarily match the size of the deleted region.

[0073] The lower limit of the size range of the deleted region in the second multiple myeloma model cell in which a relatively small region has been deleted may be, for example, 25,770 bp, 100,000 bp, 500,000 bp, 700,000 bp, 1 million bp, or 2 million bp.

[0074] The upper limit of the size range of the deleted region in the second multiple myeloma model cell in which a relatively small region has been deleted may be, for example, 750,000 bp, 800,000 bp, 1 million bp, 2 million bp, 3 million bp, 4 million bp, or 5 million bp.

[0075] The lower and upper limits of the size range of the deleted region in the second multiple myeloma model cells can be combined in any manner.

[0076] It is preferable to perform single-cell cloning on each of the multiple myeloma model cells, first multiple myeloma model cells, and second multiple myeloma model cells prepared as described above after deletion of the short arm of chromosome 17. The cells obtained after single-cell cloning are also one of the multiple myeloma model cells obtained by the production method of this embodiment.

[0077] [Multiple myeloma model cells with deletions in the short arm of chromosome 17] In another preferred embodiment of the present invention, a multiple myeloma model cell having a deletion in the short arm of chromosome 17 is a model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and in which the genomic region including the entire TP53 gene on the short arm of chromosome 17 is deleted.

[0078] The model cells of this embodiment are cells produced by the method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17 according to the above embodiment, or cells obtained by single-cell cloning of such cells.

[0079] Therefore, the deleted genomic region (deleted region) may be, for example, 7 million bp or more or 4 million bp or less, and may be the region from the SPECC1 gene to the NXN gene on the short arm of chromosome 17, or the region from the CTC1 gene to the POLR2A gene. When the deleted region includes the region from the SPECC1 gene to the NXN gene, the deleted region may include only a portion of the SPECC1 gene or only a portion of the NXN gene (i.e., the genome after the deletion may include both a portion of the SPECC1 gene and a portion of the NXN gene). Similarly, when the deleted region includes the region from the CTC1 gene to the POLR2A gene, the deleted region may include only a portion of the CTC1 gene or only a portion of the POLR2A gene (i.e., the genome after the deletion may include both a portion of the CTC1 gene and a portion of the POLR2A gene).

[0080] Furthermore, the model cells of this embodiment may include the first multiple myeloma model cells and the second multiple myeloma model cells described above.

[0081] Whether a cell prior to introduction of the first and second nucleotides corresponds to any of MM.1S, H929, MOLP8, and SKMM2 (in other words, whether a multiple myeloma model cell having a deletion in the short arm of chromosome 17 is a cell in which the above-described first and second nucleotides have been introduced into the genome of a multiple myeloma cell line selected from MM.1S, H929, MOLP8, and SKMM2, resulting in a deleted region) can be determined by a person skilled in the art, for example, by performing PCR using the primers of SEQ ID NOs: 9 to 12 used in the Examples described below, performing short tandem repeat (STR) analysis, or by comparing the genomic base sequence of a multiple myeloma model cell extensively read by next-generation sequencing with the genomic base sequence of any of the cell lines selected from MM.1S, H929, MOLP8, and SKMM2. However, methods for determining whether a cell prior to introduction of the first and second nucleotides corresponds to any of MM.1S, H929, MOLP8, and SKMM2 are not limited to these.

[0082] [A set of multiple myeloma model cells with a deletion in the short arm of chromosome 17] In yet another preferred embodiment of the present invention, the set of multiple myeloma model cells includes a first multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and that have different hybridizing regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted; and a second multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and that have different hybridizing regions have been introduced into the genome of the above-mentioned multiple myeloma cell line, and a genomic region of 4 million bp or less including the entire TP53 gene on the short arm of chromosome 17 has been deleted.

[0083] The model cells included in the set of this embodiment are the first and second multiple myeloma model cells detailed in the embodiment of "Method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17." Note that the second nucleotide used to produce the first multiple myeloma model cells differs from the second nucleotide used to produce the second multiple myeloma model cells in the base sequence of at least one sgRNA among the multiple sgRNAs they encode.

[0084] The multiple myeloma cell line subjected to the short arm deletion step for producing the first multiple myeloma model cell and the multiple myeloma cell line subjected to the short arm deletion step for producing the second multiple myeloma model cell are the same type of cell line, MM.1S, H929, MOLP8, and SKMM2.

[0085] The model cells included in the set of this embodiment can be used for screening therapeutic agents for multiple myeloma having a deletion in the short arm of chromosome 17. Specifically, this will be described in detail in an embodiment of a method for screening therapeutic agents for multiple myeloma having a deletion in the short arm of chromosome 17.

[0086] [Cell set] In yet another preferred embodiment of the present invention, the cell set includes: a first multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and that hybridize to different regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted; a second multiple myeloma model cell in which the first and second nucleotides have been introduced into the genome of the above-mentioned multiple myeloma cell line, and a genomic region of 4 million bp or less including the entire TP53 gene on the short arm of chromosome 17 has been deleted; and cells in which the first and second nucleotides have been introduced into the genome of a multiple myeloma cell line, and cleavage by spCas9 has occurred, but the genomic region including the entire TP53 gene on the short arm of chromosome 17 has not been deleted (hereinafter also referred to as "TP53-maintaining cells").

[0087] The first and second multiple myeloma model cells included in the cell set of this embodiment are the same as the first and second multiple myeloma model cells described in detail in the aforementioned embodiment of [Set of multiple myeloma model cells having a deletion in the short arm of chromosome 17] and the aforementioned embodiment of [Method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17]. Note that the second nucleotide introduced to produce the first multiple myeloma model cells differs from the second nucleotide introduced to produce the second multiple myeloma model cells in the base sequence of at least one sgRNA among the multiple sgRNAs they encode.

[0088] TP53-maintaining cells are cells in which the first and second nucleotides were introduced into the genome of a multiple myeloma cell line, resulting in genome cleavage by spCas9, but recombination occurred due to DNA repair mechanisms, and no large-scale deletion including the entire TP53 gene occurred.

[0089] For example, if the second nucleotide comprises a first base sequence encoding a first sgRNA that hybridizes to the SPECC1 gene and a second base sequence encoding a second sgRNA that hybridizes to the NXN gene, the TP53 gene-maintaining cells are cells in which gene knockout itself has occurred due to cleavage of the SPECC1 gene and the NXN gene and the accompanying small-scale deletion or insertion of nucleotides of several to several tens of bases, but no large-scale deletion has occurred in the genomic region between the SPECC1 gene and the NXN gene, including at least the entire TP53 gene. Therefore, those skilled in the art can easily determine whether a cell that has undergone the short arm deletion step is a TP53-maintaining cell by, for example, reading the nucleotide sequence near multiple cleavage sites by Sanger sequencing. The same applies when the second nucleotide comprises a third base sequence encoding a third sgRNA that hybridizes to the CTC1 gene and a fourth base sequence encoding a fourth sgRNA that hybridizes to the POLR2A gene.

[0090] TP53-maintaining cells exhibit significantly different cellular properties (phenotypes) compared with uncut multiple myeloma cell lines (MM.1S, H929, MOLP8, or SKMM2) that lack the first and second nucleotides, due to gene cleavage by spCas9, resulting in the insertion or deletion of nucleotides.

[0091] Therefore, for example, when selecting a candidate substance for a therapeutic drug, contacting the test substance with the first multiple myeloma model cells and the second multiple myeloma model cells, as well as TP53-maintaining cells as a comparison example, enables accurate selection that takes into account the effects of cleavage, compared to contacting the test substance with an uncleaved multiple myeloma cell line.

[0092] The multiple myeloma cell line into which the first and second nucleotides were introduced when the first multiple myeloma model cells were produced, the multiple myeloma cell line into which the first and second nucleotides were introduced when the second multiple myeloma model cells were produced, and the multiple myeloma cell line into which the first and second nucleotides were introduced when the TP53-maintaining cells were produced are the same type of cell line, namely, MM.1S, H929, MOLP8, and SKMM2.

[0093] [Screening method 1 for therapeutic agents for multiple myeloma with deletions in the short arm of chromosome 17] In another preferred embodiment of the present invention, a method for screening therapeutic agents for multiple myeloma having a deletion in the short arm of chromosome 17 includes a step of culturing, in the presence of a test substance, a multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of a multiple myeloma cell line selected from the group consisting of MM.1S, H929, MOL, and SKMM2, and in which a genomic region including the entire TP53 gene in the short arm of chromosome 17 has been deleted (hereinafter also referred to as the "first culture step").

[0094] If the results of the first culture step show that the survival rate of the multiple myeloma model cells after culture in the presence of the test substance is lower than that of the multiple myeloma model cells after culture in the absence of the test substance, this indicates that the test substance is a candidate for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17.

[0095] Therefore, a test substance that, as a result of the first culture step, shows a lower viability of multiple myeloma model cells cultured in the presence of the test substance compared to multiple myeloma model cells cultured in the absence of the same test substance can be screened as a candidate substance for a therapeutic drug. The candidate substance is preferably a substance that, when multiple myeloma model cells and normal non-cancerous cells are cultured in the presence of the candidate substance, has a smaller effect (decreasing degree) on the viability of the normal cells than the effect (decreasing degree) on the viability of the multiple myeloma model cells.

[0096] The first nucleotide, the second nucleotide, and the multiple myeloma model cells of this embodiment are the same as the first nucleotide, the second nucleotide, and the multiple myeloma model cells described in detail in the above-mentioned embodiment of [Method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17]. Therefore, the multiple myeloma model cells used in the screening method of this embodiment are cells obtained by carrying out the above-mentioned short arm deletion step, or cells obtained by single-cell cloning of cells obtained as a result of the short arm deletion step.

[0097] The type of test substance to be subjected to the screening method of this embodiment is not particularly limited, and examples include an existing drug library, a natural compound library, a synthetic compound library, a metabolite library, and the like.

[0098] The number of days for the first culture step may be one day or more, one week or more, two weeks or more, one month or more, three months or more, or six months or more, but is not particularly limited.

[0099] The concentration of the test substance in the culture medium for culturing the multiple myeloma model cells and the concentration of the test substance in the culture medium for culturing the comparative TP53-maintaining cells are not particularly limited, as long as they are the same.

[0100] The multiple myeloma model cells may include a first multiple myeloma model cell lacking a genomic region of 7 million bp or more including the entire TP53 gene, and a second multiple myeloma model cell lacking a genomic region of 4 million bp or less including the entire TP53 gene. The first and second multiple myeloma model cells of this embodiment are the same as the first and second multiple myeloma model cells described in detail in the embodiment of "Method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17" above.

[0101] When the multiple myeloma model cells include first multiple myeloma model cells and second multiple myeloma model cells, the result of the first culture step may be that the viability of the first multiple myeloma model cells cultured in the presence of the test substance is lower than the viability of the first multiple myeloma model cells cultured in the absence of the test substance, and that the viability of the second multiple myeloma model cells cultured in the presence of the test substance is lower than the viability of the second multiple myeloma model cells cultured in the absence of the test substance, which may indicate that the test substance is a candidate substance for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17. That is, when the viability of the first multiple myeloma model cells cultured in the presence of the test substance is lower than that in the absence of the test substance, and when the viability of the second multiple myeloma model cells cultured in the presence of the test substance is lower than that in the absence of the test substance, the test substance may be selected as a candidate substance for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17.

[0102] In this way, by using the first multiple myeloma model cell and the second multiple myeloma model cell in screening for therapeutic agents for multiple myeloma, it is possible to select candidate therapeutic agents that are effective for both multiple myeloma patients with a relatively small deletion region in the short arm of chromosome 17 and multiple myeloma patients with a relatively large deletion region in the short arm of chromosome 17. Examples of therapeutic agents include, but are not limited to, anticancer agents and immunomodulatory agents.

[0103] [Screening method 2 for therapeutic agents for multiple myeloma with deletions in the short arm of chromosome 17] According to yet another preferred embodiment of the present invention, a method for screening a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17 includes a step of culturing, in the presence of a test substance, a multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 but have different hybridizing regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, thereby resulting in a deletion of a genomic region containing the entire TP53 gene on the short arm of chromosome 17, and a cell in which the first and second nucleotides have been introduced into the genome of the above-mentioned multiple myeloma cell line, thereby resulting in genomic cleavage by spCas9 but not a deletion of a genomic region containing the entire TP53 gene on the short arm of chromosome 17 (the above-mentioned TP53-maintaining cell).

[0104] Furthermore, the results of the second culture step show that the survival rate of the multiple myeloma model cells is lower than that of the TP53-maintaining cells, indicating that the test substance is a candidate therapeutic agent for multiple myeloma with a deletion in the short arm of chromosome 17.

[0105] Therefore, a test substance that, as a result of the second culture step, shows a lower viability of multiple myeloma model cells after culture in the presence of the test substance compared to the viability of TP53-maintaining cells cultured in the presence of the same test substance can be selected as a candidate therapeutic drug. The candidate substance is preferably a substance that, when multiple myeloma model cells and normal non-cancer cells are cultured in the presence of the candidate substance, has a smaller effect (decreased extent) on the viability of normal cells compared to the effect (decreased extent) on the viability of multiple myeloma model cells.

[0106] By comparing the viability of multiple myeloma model cells in the presence of the test substance with that of TP53-maintaining cells, it is possible to select therapeutic agents that are specifically effective in patients with deletions in the short arm of chromosome 17, and to make accurate selections that take into account the effects of the cleavage caused by spCas9.

[0107] The first nucleotide, the second nucleotide, and the multiple myeloma model cells of this embodiment are the same as the first nucleotide, the second nucleotide, and the multiple myeloma model cells described in detail in the above-mentioned embodiment of [Method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17]. Therefore, the multiple myeloma model cells used in the screening method of this embodiment are cells obtained by carrying out the above-mentioned short arm deletion step, or cells obtained by single-cell cloning of cells obtained by the short arm deletion step.

[0108] The type of test substance to be subjected to the screening method of this embodiment is not particularly limited, and examples thereof include an existing drug library, a natural compound library, a synthetic compound library, a metabolite library, etc. Examples of therapeutic drugs include, but are not limited to, anticancer drugs and immunomodulatory drugs.

[0109] The number of days for the second culture step may be one day or more, one week or more, two weeks or more, one month or more, three months or more, or six months or more, but is not particularly limited.

[0110] The concentration of the test substance in the culture medium for culturing the multiple myeloma model cells and the concentration of the test substance in the culture medium for culturing the comparative TP53-maintaining cells are not particularly limited, as long as they are the same.

[0111] The multiple myeloma model cells may include a first multiple myeloma model cell lacking a genomic region of 7 million bp or more including the entire TP53 gene, and a second multiple myeloma model cell lacking a genomic region of 4 million bp or less including the entire TP53 gene. The first and second multiple myeloma model cells of this embodiment are the same as the first and second multiple myeloma model cells described in detail in the embodiment of "Method for producing multiple myeloma model cells having a deletion in the short arm of chromosome 17" above. However, the size of the deleted region is 7 million bp or more or 4 million bp or less.

[0112] When the multiple myeloma model cells include first multiple myeloma model cells and second multiple myeloma model cells, if the result of the second culture step shows that the viability of the first multiple myeloma model cells cultured in the presence of the test substance is lower than the viability of the TP53-maintaining cells cultured in the presence of the test substance, and that the viability of the second multiple myeloma model cells cultured in the presence of the test substance is lower than the viability of the TP53-maintaining cells cultured in the presence of the test substance, this may indicate that the test substance is a candidate substance for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17. In other words, if the viability of the first multiple myeloma model cells cultured in the presence of the test substance is lower than the viability of the TP53-maintaining cells, and the viability of the second multiple myeloma model cells cultured in the presence of the test substance is lower than the viability of the TP53-maintaining cells, the test substance may be selected as a candidate substance for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17.

[0113] In this way, by using the first multiple myeloma model cells, the second multiple myeloma model cells, and the TP53-maintaining cells to screen for therapeutic agents for multiple myeloma, it is possible to select candidate therapeutic agents that are effective in both multiple myeloma patients with relatively small deletions in the short arm of chromosome 17 and multiple myeloma patients with relatively large deletions in the short arm of chromosome 17, while also taking into account the effects of cleavage by spCas9. [Example]

[0114] The present invention will be described below with reference to examples, but the present invention is not limited to these examples. [Experimental Example 1] In this experiment, multiple myeloma model cells having a deletion of a genomic region containing the entire TP53 gene were prepared on the short arm of chromosome 17.

[0115] [Design of sgRNA] Loci where deletions are likely to occur were selected from the database. Then, using CRISPick of the BROAD institute, sgRNAs shown in Table 1 that specifically bind to introns of SPECC1, NXN, CTC1, or POLR2A were designed. "sgRNA target sequence" means the nucleotide sequence of the genomic region to which the sgRNA hybridizes. The first sgRNA has the nucleotide sequence shown in SEQ ID NO: 1 as crRNA. The second sgRNA has the nucleotide sequence shown in SEQ ID NO: 2 as crRNA. The third sgRNA has the nucleotide sequence shown in SEQ ID NO: 3 as crRNA. The fourth sgRNA has the nucleotide sequence shown in SEQ ID NO: 4 as crRNA. Also, these sgRNAs have the nucleotide sequence shown in SEQ ID NO: 19 as the gRNA scaffold.

[0116] [Table 1]

[0117] Also, sgRNAs that bind to exons of SPECC1 shown below and sgRNAs that bind to exons of NXN were separately designed. SPECC1 Exon sg1: CGTGAGCTCCGAGATGGCTC (SEQ ID NO: 9) SPECC1 Exon sg2: AGGAAGTACCGCTGCATCGG (SEQ ID NO: 10) NXN Exon sg1: CCAAACACTCACCCAATGTG (SEQ ID NO: 11) NXN Exon sg2: ACCCGGGTGAGGCTTCGGCA (SEQ ID NO: 12)

[0118] After designing the sgRNA, an oligonucleotide having the base sequence corresponding to each sgRNA (sequence with uracil substituted by thymine) and a pair of oligonucleotides containing a base sequence complementary to the corresponding base sequence were synthesized.

[0119] <Preparation of plasmid encoding sgRNA> (Annealing of oligonucleotides) First, the synthesized oligonucleotides were prepared to 40 μM (mol / L) with ultrapure water and resuspended. Then, a mixture was prepared in a 200 μL volume PCR tube with the following composition. 1.5 μL oligonucleotide (forward, 40 μM) <http: / / www.patent-information.com / search / 1.5 μL oligonucleotide (reverse, 40 μM) 5 μL NEBuffer™ r3.1 42 μL ultrapure water

[0120] Then, by executing the following program on a thermal cycler, annealing of the oligonucleotide pair was performed and stored at -20 °C until cloning into the plasmid vector. 95 °C 5 minutes 70 °C 5 minutes Temperature was gradually decreased from 70 °C to 25 °C over 45 minutes 25 °C hold

[0121] (Cloning of sgRNA target sequence into plasmid vector) First, a mixture was prepared in a 200 μL volume PCR tube with the following composition. 0.5 μL plasmid vector (B: LentiGuide - Hygro, Addgene, #139462, C: LentiGuide - Puro, Addgene, #52963) 1 μL annealed oligonucleotide pair 1.5 μL DNA Ligation Mighty Mix (Takara Bio Inc., #6023)

[0122] The above-mentioned plasmid vector B is a vector that is linked to an oligonucleotide containing a first base sequence (see SEQ ID NO: 5) encoding a first sgRNA that specifically binds to an intron of the SPEECC1 gene, or an oligonucleotide containing a fourth base sequence (see SEQ ID NO: 8) encoding a fourth sgRNA that specifically binds to an intron of the POLR2A gene.

[0123] The above-mentioned C plasmid vector is a vector that is linked to an oligonucleotide containing a second base sequence (see SEQ ID NO: 6) encoding a second sgRNA that specifically binds to an intron of the NXN gene, or an oligonucleotide containing a third base sequence (see SEQ ID NO: 7) encoding a third sgRNA that specifically binds to an intron of the CTC1 gene.

[0124] Next, the mixture was incubated in a thermal cycler at 16°C for 30 minutes, and the entire volume was added to 25 µL of stellar competent cells and mixed.

[0125] The mixture was then incubated on ice for 30 minutes, heat shocked at 42°C for 45 seconds, and immediately incubated on ice for 2 minutes. 250 μL of SOC medium was then added and the mixture was incubated at 37°C for 30 minutes with shaking.

[0126] Next, 180 μL of the mixture was dropped onto an LB plate (containing 100 μg / mL of ampicillin) and streaked with a needle (overnight at 37° C.).

[0127] (Plasmid isolation) A single colony was selected and inoculated into LB medium containing 100 μg / mL ampicillin, and cultured overnight at 37°C with shaking. Plasmids were then extracted using a QIAprep Spin Miniprep Kit (Qiagen, #27104). Thus, a plasmid containing the first base sequence, a plasmid containing the second base sequence, a plasmid containing the third base sequence, and a plasmid containing the fourth base sequence were obtained.

[0128] <Production of Lentivirus of the First Nucleotide and the Second Nucleotide> (Preparation of Lenti-X) One day before transfection, Lenti-X was seeded.

[0129] (Production of Lentivirus) First, Lipofectamine™ 2000 (Thermo Fisher Scientific, #11668019) was diluted to 4% with Opti-MEM medium and incubated for 3 minutes.

[0130] Next, in another tube, lentiCas9-Blast (Addgene, #52962) or the plasmid containing the prepared second nucleotide (5.3 μg / mL), psPAX2 (Addgene, #12260) (5.3 μg / mL), and pMD2.G (Addgene, #12259) (0.6 μg / mL) were mixed with Opti-MEM medium and incubated for 3 minutes.

[0131] Then, the diluted Lipofectamine™ 2000 solution and the DNA solution were mixed in equal amounts and incubated for 30 minutes to prepare a lipid-DNA complex.

[0132] Next, the medium of Lenti-X was removed, the lipid-DNA complex solution was allowed to equilibrate, incubated at 37°C for 30 minutes, DMEM + 10% FBS (Fetal Bovine Serum) was added, and incubated overnight at 37°C, and the medium was changed the next day.

[0133] On the day after that, the cell supernatant was filtered through a 0.45 μm filter, collected, and stored at -80°C until used as the virus supernatant.

[0134] (Transduction of Cas9 Virus (Virus Containing the First Nucleotide)) [[ID=三十二]] 1 million cells of MM.1S (ATCC, #CRL-2974) were suspended in 1 mL of RPMI-1640 + 10% FBS + 1% PS, and 10 μL of HEPES and polybrene (6 μg / mL) were added.

[0135] Next, 1 mL of the supernatant of MM.1S and Cas9 virus (pLX_311-Cas9 addgene #96924) was placed in a 24-well plate and centrifuged at 32 °C and 1500 G for 90 minutes. Then, it was incubated overnight at 37 °C and the medium was changed. Selection of cells into which the first nucleotide was introduced was started with 8 μg / mL of blasticidin 2 days later and the selection was completed after one week.

[0136] <Transduction of sgRNA virus (virus containing the second nucleotide)> First, 1 million cells of MM.1S Cas9 were suspended in 1 mL of RPMI-1640 + 10% FBS + 1% PS, and 10 μL of HEPES and polybrene (6 μg / mL) were added.

[0137] Next, 500 μL each of the supernatant of MM.1S into which the first nucleotide was introduced and sgRNA virus were placed in a 24-well plate in the following combinations and centrifuged at 32 °C and 1500 G for 90 minutes. Table 2 below shows the cell line names into which the plasmid containing the first base sequence (31B) and the plasmid containing the second base sequence (30C) were introduced into MM.1S, and the cell line names into which the plasmid containing the third base sequence (35C) and the plasmid containing the fourth base sequence (34B) were introduced into MM.1S.

[0138]

Table 2

[0139] After the centrifugation, the cells were incubated overnight at 37°C. Two days after the medium change, selection of cells into which the second nucleotide had been introduced was initiated using puromycin (2 μg / mL) and hygromycin (350 μg / mL), and the selection was completed one week later. The resulting cells were confirmed by PCR to have the outer regions of the two cleavage sites linked together. The PCR conditions were the same as those used in Experimental Example 2 below.

[0140] [Experimental Example 2] In this experiment, gene editing of the cells obtained in Experimental Example 1 was confirmed.

[0141] (single cell cloning) Cells obtained by introducing plasmids 31B and 30C (plasmids of Set A targeting SPECC1 and NXN) into MM.1S, and cells obtained by introducing plasmids 34B and 35C (plasmids of Set B targeting CTC1 and POLR2A) into MM.1S (all cells other than those in which binding between the outer regions was confirmed by the above PCR) were prepared as cell suspensions of 100 cells / 72 mL.

[0142] Next, 180 μL of the cells (cell suspension) was seeded onto four 96-well plates, and the plates were cultured for two months to select colonies.

[0143] (PCR selection) The primer sequences were designed so that the PCR amplification product would be approximately 500 bp when a deletion in the region between the two cleavage sites was present, upstream of the deletion start point and downstream of the deletion end point (i.e., outside the two cleavage sites). The primer sequences are shown in Table 3 below.

[0144] [Table 3]

[0145] After single cell cloning, 2 million cells were collected and genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN, #51304).

[0146] Next, the primers shown in Table 3 were resuspended in ultrapure water to 10 μM, and a mixed solution with the following composition was prepared in a 200 μL PCR tube. 2.5μL forward primer (10μM) 2.5μL reverse primer (10μM) variable (250 ng) gDNA 25μL 2X Phusion Master Mix (Thermo Fisher Scientific, #F531) 1.5 μL DMSO Ultrapure water to make the total mixture 50 μL

[0147] The resulting mixture was then subjected to PCR using a thermal cycler under the following conditions: Steps 2 to 4 were performed for 30 cycles. STEP 1: 98℃ 30 seconds STEP 2: 98℃ 10 seconds STEP3: 65℃ 20 seconds STEP4: 72℃ 20 seconds STEP5: 72℃ 5 minutes 4℃ hold

[0148] After PCR, the amplified products were electrophoresed on a 2% agarose gel (containing ethidium bromide 1 μg / mL), and bands were confirmed using a UV transilluminator.

[0149] Furthermore, the gel bands were excised, and the amplification products were extracted using a QIAquick Gel Extraction Kit (QIAGEN, #28706), followed by DNA sequencing.

[0150] FIG. 1 shows electrophoresis images after PCR of the short arm region spanning cells obtained by introducing the Set A plasmids targeting the introns of SPECC1 and NXN into MM.1S.

[0151] As shown in Figure 1, when the Set A plasmids targeting the SPECC1 and NXN introns were introduced, a single band surrounded by a square was observed at approximately 500 bp. Therefore, in the cells in this lane, it was confirmed that the region between the cleavage site on the intron of the SPECC1 gene and the cleavage site on the intron of the NXN gene had been deleted, and the outer regions had joined together. Sequencing of DNA fragments extracted from this band confirmed the joining of the outer regions of the two cleavage sites and the insertion of a 37-base DNA fragment between the outer regions. Herein, multiple myeloma model cells in which a large deletion, including the entire TP53 gene, had occurred due to the introduction of the Set A plasmids encoding sgRNAs targeting the SPECC1 and NXN introns is also referred to as "Ace."

[0152] In addition, in cells in other lanes, no band was observed at a position of approximately 500 bp, and separate sequencing revealed that although cleavage had occurred in the introns of the SPECC1 gene and the NXN gene (knockout of both genes), repair had not resulted in a large-scale deletion including the entire TP53 gene.

[0153] In cells obtained by introducing Set A plasmids targeting the SPECC1 and NXN introns or exons, a band of approximately 500 bp (i.e., a large-scale deletion including the entire TP53 gene) was confirmed in one clone out of 60 clones. Table 4 below shows the combinations of sgRNA hybridization regions (two spCas9 cleavage sites) in 60 cell clones and the number of cell lines in which a large-scale deletion including the entire TP53 gene was confirmed. The "SPECC1 intron" in Table 4 corresponds to the first sgRNA in Table 1, and the "NXN intron" in Table 4 corresponds to the second sgRNA in Table 1.

[0154] [Table 4]

[0155] As shown in Table 4, large-scale deletions including the entire TP53 gene were not observed in cell lines in which at least one of the sgRNAs targeting SPECC1 or NXN hybridized to an exon; large-scale deletions were observed only in cell lines in which both sgRNAs were introns (1 clone out of 8 clones). Furthermore, cells in which the Set A plasmids targeting the SPECC1 intron and the NXN intron were introduced but no large-scale deletions including the entire TP53 gene were observed, and in which the SPECC1 and NXN genes were knocked out ("koriki," TP53-maintaining cells) were used in subsequent experiments.

[0156] On the other hand, Figure 2 shows the electrophoresis image after PCR of the short arm region spanning the cells obtained by introducing the Set B plasmids targeting the introns of CTC1 and POLR2A into MM.1S.

[0157] As shown in Figure 2, when the Set B plasmid was introduced, a band surrounded by a square was observed at a position of approximately 500 bp in four lanes. In the cells in these lanes, it was confirmed that the region between the intron of the CTC1 gene and the intron of the POLR2A gene had been deleted, and the outer regions had joined together.

[0158] Sequencing of DNA fragments extracted from this band revealed a junction between the outer ends of the two cleavage sites and an insertion of several dozen bases between the outer ends. The inserted nucleotides varied depending on the lane (cell line). In this specification, the multiple myeloma model cell line, in which a large deletion including the entire TP53 gene was induced using Set B plasmids targeting the CTC1 and POLR2A introns, is also referred to as "Queen."

[0159] In addition, in cells in other lanes, no band was observed at a position of approximately 500 bp, and separate sequencing revealed that although cleavage had occurred in the introns of the CTC1 gene and the POLR2A gene, it had been repaired and no large-scale deletion including the entire TP53 gene had occurred.

[0160] In the cells obtained by transfecting Set B, a band of about 500 bp (i.e., a large deletion including the entire TP53 gene) was confirmed in 4 out of 19 clones.

[0161] (Short arm deletion confirmed by FISH) For Ace's cells and Queen's cells, slide specimens were prepared using a probe that specifically binds to the TP53 gene on the short arm of chromosome 17 and multiple genes in its vicinity, and a probe that specifically binds to the centromere of chromosome 17 (CytoCell P53 (TP53) Deletion (Oxford Gene Technology, LPH017)), and the deletion of the short arm was confirmed by the FISH (Fluorescence in situ hybridization) method.

[0162] Figure 3 shows fluorescence microscopy images of Ace cells, in which the vicinity of the TP53 gene and the centromere of chromosome 17 were visualized by FISH. Figure 4 shows fluorescence microscopy images of Queen cells, in which the vicinity of the TP53 gene and the centromere of chromosome 17 were visualized by FISH. In Figures 3 and 4, the arrow A1 indicates the green fluorescence indicating the position of the centromere, and the arrow A2 indicates the red fluorescence indicating the position of the TP53 gene.

[0163] As shown in Figures 3 and 4, the fluorescence indicating the location of the centromere of chromosome 17 (see A1) was observed in two locations in each Ace cell and Queen cell, whereas the fluorescence indicating the location of the TP53 gene (see A2) was observed in only one location in each Ace cell and Queen cell. Therefore, the FISH method also confirmed the deletion of the short arm of chromosome 17, including the entire TP53 gene.

[0164] (Confirmation of short arm deletion by G-banding) G-band staining was performed on Ace cells obtained by introducing the Set A plasmid, Queen cells obtained by introducing the Set B plasmid, Koriki cells obtained by introducing the Set A plasmid and in which a large-scale deletion including the entire TP53 gene did not occur, and Cas9 cells in which the first nucleotide was introduced but not the second nucleotide, and the morphology of chromosome 17 was observed.

[0165] Figure 5 shows G-banded images of Ace, Queen, Koriki, and Cas9 cells.

[0166] As shown in Figure 5, Ace had a relatively large deletion in the short arm of chromosome 17. In Queen, the deletion in the short arm was so small that it was impossible to visually identify the deletion.

[0167] (Short arm deletion confirmed by whole exome sequencing) Figure 6 shows images showing the results of whole exome sequencing of Ace, Queen, Koriki, and Cas9 cells.

[0168] As shown in Figure 6, it was confirmed that the copy number of the portion of the short arm of chromosome 17 containing the entire TP53 gene (see the circular or oval box) was reduced in the cells of Ace and Queen, i.e., deletion had occurred.

[0169] [Experimental Example 3] In this experiment, the amount of P53 protein expressed from the TP53 gene was measured by Western blotting in Ace cells, Queen cells, Koriki cells, TP53KO cells obtained by knocking out the TP53 gene in the MM.1S cell line using sgRNA with the base sequence shown in SEQ ID NO: 17 and spCas9, and OR cells (cutting control) obtained by knocking out the OR2H1 gene in the MM.1S cell line using sgRNA with the base sequence shown in SEQ ID NO: 18 and spCas9.

[0170] Materials and Methods (Sample creation) First, 72 μL of RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific) and 8 μL of Protease / Phosphatase Inhibitor Cocktail (100X) (Cell Signaling Technology, #5872) were added to 5 million cells of each target cell type, and the mixture was incubated on ice for 10 minutes, followed by centrifugation at 15,000 rpm at 4°C for 10 minutes.

[0171] The protein concentration of the supernatant was then measured, and the supernatant was mixed with NuPAGE™ Sample Reducing Agent (10X) (Thermo Fisher Scientific, #NP0009), 4X Bolt™ DS Sample Buffer (Thermo Fisher Scientific, #B0007), and ultrapure water to a final protein concentration of 1 mg / mL, followed by incubation at 70°C for 10 minutes.

[0172] (Western blotting) Proteins were separated by SDS-PAGE using Bolt™ Bis-Tris Plus Mini Protein Gels 4-12%, 1.0 mm, WedgeWell™ format (Thermo Fisher Scientific, #NW04125BOX) and 20 μL of MOPS / SDS Running Buffer [20X] (Geno Technology, #786-926).

[0173] Next, proteins were transferred from the gel to a membrane by tank transfer using Immobilon®-P PVDF Membrane (Merck, #IPVH00010) and Transfer Buffer (10X, Electroblotting) (Boston BioProducts, #BP-190).

[0174] Then, the sections were blocked with 5% Non-Fat Dry Milk Powder (bioWORLD, #BR-306200742) / Tris Buffered Saline with Tween 20 (TBS-T).

[0175] The cells were then incubated overnight at 4°C with shaking in 1% Non-Fat Dry Milk Powder / TBS-T supplemented with P53 antibody (Cell Signaling Technology, CST#9282) at 1:1000.

[0176] After washing with TBS-T, the plate was shaken for 90 minutes in 1% non-fat dry milk powder / TBS-T containing anti-rabbit IgG, HRP-linked antibody (Cell Signaling Technology, #7074).

[0177] After washing with TBS-T, chemiluminescence using SuperSignal™ West Dura Stable Peroxide (Thermo Fisher Scientific, #34076) was measured using an ImageQuant™ LAS 4000 (General Electric Company).

[0178] After washing with TBS-T, the cells were shaken for 90 minutes in 1% Non-Fat Dry Milk Powder / TBS-T containing GAPDH (14C10) Rabbit mAb (HRP Conjugate) (Cell Signaling Technology, #3683S).

[0179] Thereafter, the plate was washed with TBS-T, and chemiluminescence using SuperSignal™ West Dura Stable Peroxide was measured using an ImageQuant™ LAS 4000.

[0180] <Result> Figure 7 is an image showing the P53 protein band after Western blotting, and Figure 8 is a graph showing the results of measuring the amount of P53 protein by Western blotting.

[0181] As shown in Figures 7 and 8, the expression levels of P53 protein were significantly reduced in Ace cells, Queen cells, and cells with the TP53 gene knocked out compared to Koriki cells without the TP53 gene deletion. Therefore, the P53 protein expression levels also confirmed that Ace and Queen cells had deletion of the short arm of chromosome 17, which contains one allele of the TP53 gene.

[0182] [Experimental Example 4] In this experiment, a therapeutic drug (lenalidomide or idarubicin) was added to multiple myeloma model cells in which deletion of the short arm of chromosome 17 was confirmed in Experimental Examples 2 and 3, and the survival rate was confirmed. A control system in which dimethyl sulfoxide (DMSO) was added instead of the therapeutic drug was also prepared separately.

[0183] Materials and Methods 1000 cells / well were seeded into a 384-well plate, and the therapeutic agents were added at the concentrations shown in Figures 9 and 10. The cells were then incubated in a CO2 incubator. The incubation time was 120 hours for lenalidomide and 72 hours for idarubicin.

[0184] Then, CellTiter-Glo® 2.0 Cell Viability Assay (Promega, #G9242) was added in an amount of 1 / 10 of the liquid volume in the well, and the plate was incubated in a CO 2 incubator for 30 minutes.

[0185] Finally, the luminescence intensity was measured using a SpectraMax i3x (Molecular Devices).

[0186] (result) FIG. 9 is a graph showing the viability of cells to which lenalidomide was added.

[0187] As shown in Figure 9, the viability of all cell lines was reduced in a lenalidomide concentration-dependent manner compared to the system containing dimethyl sulfoxide. This suggests that lenalidomide is effective in treating both multiple myeloma with a relatively large deletion in the short arm of chromosome 17, such as Ace cells, and multiple myeloma with a relatively small deletion in the short arm of chromosome 17, such as Queen cells.

[0188] Furthermore, the degree of decrease in survival rate was greater in Koriki (a multiple myeloma cell line in which the SPECC1 and TP53 genes were knocked out but without deletion of the short arm of chromosome 17) than in Ace or Queen, suggesting that cells with deletion of the short arm of chromosome 17 exhibit reduced sensitivity to lenalidomide. These results suggest that lenalidomide is particularly effective in treating multiple myeloma without deletion of the short arm of chromosome 17.

[0189] On the other hand, FIG. 10 is a graph showing the survival rate of cells to which idarubicin was added. As shown in Figure 10, the viability of all cell lines was reduced in a concentration-dependent manner up to 25 nM idarubicin compared to the system containing dimethyl sulfoxide. This suggests that idarubicin is effective in treating both multiple myeloma with a relatively large deletion in the short arm of chromosome 17 and multiple myeloma with a relatively small deletion in the short arm of chromosome 17.

[0190] Furthermore, the degree of decrease in survival rate was greater in Ace and Queen than in Koriki, suggesting that cells with deletions of the short arm of chromosome 17 exhibit increased sensitivity to idarubicin. These results suggest that idarubicin may be particularly effective in treating multiple myeloma with deletions of the short arm of chromosome 17, including the entire TP53 gene. [Industrial Applicability]

[0191] INDUSTRIAL APPLICABILITY The present invention can provide multiple myeloma model cells having a deletion in the short arm of chromosome 17, and is therefore industrially applicable. [Explanation of symbols]

[0192] A1: Green fluorescence indicating the position of the centromere, A2: Red fluorescence indicating the position of the TP53 gene

Claims

1. A method for producing a multiple myeloma model cell having a deletion in the short arm of chromosome 17, comprising: The method comprises a step of deleting a region including the entire TP53 gene on the short arm of chromosome 17 of a multiple myeloma cell line, the multiple myeloma cell line is one of MM.1S, H929, MOLP8, and SKMM2; introducing a first nucleotide sequence encoding spCas9 into the genome of the multiple myeloma cell line; and introducing into the genome of the multiple myeloma cell line a second nucleotide encoding a plurality of sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions.

2. the second nucleotide is A first base sequence encoding a first sgRNA that hybridizes to the SPEC1 gene on the genome; The method for producing multiple myeloma model cells according to claim 1, further comprising: a second base sequence encoding a second sgRNA that hybridizes to the NXN gene on the genome.

3. The first sgRNA has a base sequence that specifically hybridizes to an intron of the SPEC1 gene; The method for producing multiple myeloma model cells according to claim 2, wherein the second sgRNA has a base sequence that specifically hybridizes to an intron of the NXN gene.

4. The method for producing a multiple myeloma model cell according to claim 3, wherein the first sgRNA has the base sequence shown in SEQ ID NO: 1, and the second sgRNA has the base sequence shown in SEQ ID NO:

2.

5. the second nucleotide is A third base sequence encoding a third sgRNA that hybridizes to the CTC1 gene on the genome; The method for producing multiple myeloma model cells according to claim 1, further comprising: a fourth base sequence encoding a fourth sgRNA that hybridizes to the POLR2A gene on the genome.

6. The third sgRNA has a base sequence that specifically hybridizes to an intron of the CTC1 gene; The method for producing multiple myeloma model cells according to claim 5, wherein the fourth sgRNA has a base sequence that specifically hybridizes to an intron of the POLR2A gene.

7. The method for producing multiple myeloma model cells according to claim 6, wherein the third sgRNA has the base sequence shown in SEQ ID NO: 3, and the fourth sgRNA has the base sequence shown in SEQ ID NO:

4.

8. In the step of deleting a region containing the entire TP53 gene on the short arm of chromosome 17, The method for producing multiple myeloma model cells according to claim 1, wherein cells are produced in which a large region of 7 million bp or more including the entire TP53 gene has been deleted, and cells are produced in which a small region of 4 million bp or less including the entire TP53 gene has been deleted.

9. A multiple myeloma model cell having a deletion in the short arm of chromosome 17, in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions are introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and the genomic region containing the entire TP53 gene on the short arm of chromosome 17 is deleted.

10. The multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to claim 9, wherein the deleted genomic region is 7 million bp or more.

11. The multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to claim 10, wherein the deleted genomic region is the region from the SPEC1 gene to the NXN gene on the short arm of chromosome 17.

12. The multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to claim 9, wherein the deleted genomic region is 4 million bp or less.

13. The multiple myeloma model cell having a deletion in the short arm of chromosome 17 according to claim 12, wherein the deleted genomic region is the region from the CTC1 gene to the POLR2A gene on the short arm of chromosome 17.

14. A first multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding a plurality of sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of one of multiple myeloma cell lines selected from MM.1S, H929, MOLP8, and SKMM2, and in which a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted; A set of multiple myeloma model cells, comprising: a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions introduced into the genome of the multiple myeloma cell line; and a second multiple myeloma model cell in which a genomic region of 4 million bp or less including the entire TP53 gene on the short arm of chromosome 17 has been deleted.

15. The genomes of the following multiple myeloma cell lines: MM.1S, H929, MOLP8, and SKMM2. a first nucleotide sequence encoding spCas9; and A first multiple myeloma model cell into which a second nucleotide encoding a plurality of sgRNAs that hybridize to the short arm of chromosome 17 and that hybridize to different regions from each other has been introduced, and in which a genomic region of 7 million bp or more including the entire TP53 gene on the short arm of chromosome 17 has been deleted; a second multiple myeloma model cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding a plurality of sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of the one type of multiple myeloma cell line, and in which a genomic region of 4 million bp or less including the entire TP53 gene on the short arm of chromosome 17 has been deleted; a cell set comprising: a cell in which a first nucleotide encoding spCas9 and a second nucleotide encoding multiple sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions have been introduced into the genome of the multiple myeloma cell line, and in which cleavage of the genome by spCas9 has occurred but the genomic region including the entire TP53 gene on the short arm of chromosome 17 has not been deleted.

16. A method for screening a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17, comprising: The genomes of the following multiple myeloma cell lines: MM.1S, H929, MOLP8, and SKMM2. a first nucleotide sequence encoding spCas9; and The method includes culturing, in the presence of a test substance, a multiple myeloma model cell into which a second nucleotide encoding a plurality of sgRNAs that hybridize to the short arm of chromosome 17 and that hybridize to different regions from each other has been introduced, and in which a genomic region including the entire TP53 gene on the short arm of chromosome 17 has been deleted; A method for screening a therapeutic agent, wherein the survival rate of multiple myeloma model cells cultured in the presence of the test substance is lower than that of multiple myeloma model cells cultured in the absence of the test substance, indicating that the test substance is a candidate substance for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17.

17. The method for screening a therapeutic agent according to claim 16, wherein the multiple myeloma model cells in which a genomic region containing the entire TP53 gene on the short arm of chromosome 17 is deleted include first multiple myeloma model cells in which a genomic region of 7 million bp or more containing the entire TP53 gene is deleted, and second multiple myeloma model cells in which a genomic region of 4 million bp or less containing the entire TP53 gene is deleted.

18. A method for screening a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17, comprising: The genomes of the following multiple myeloma cell lines: MM.1S, H929, MOLP8, and SKMM2. a first nucleotide sequence encoding spCas9; and A multiple myeloma model cell in which a second nucleotide encoding a plurality of sgRNAs that hybridize to the short arm of chromosome 17 and have different hybridizing regions has been introduced, and in which a genomic region including the entire TP53 gene on the short arm of chromosome 17 has been deleted; a cell in which the first nucleotide and the second nucleotide have been introduced into the genome of the one type of multiple myeloma cell line, and in which cleavage of the genome by spCas9 has occurred but a genomic region containing the entire TP53 gene on the short arm of chromosome 17 has not been deleted, in the presence of a test substance; A method for screening a therapeutic agent, wherein the viability of the multiple myeloma model cells is lower than the viability of the cells in which the genomic region containing the entire TP53 gene is not deleted, indicates that the test substance is a candidate substance for a therapeutic agent for multiple myeloma having a deletion in the short arm of chromosome 17.

Images