Methods and compositions for treating cancer resistant to non-ERK MAPK pathway inhibitors

BVD-523, an ERK inhibitor, addresses cancer resistance to BRAF and MEK inhibitors by targeting specific markers, effectively inhibiting cancer cell proliferation and delaying resistance, particularly in BRAF600 mutation-positive melanoma, with synergistic effects when combined with BRAF inhibitors.

JP2026053745APending Publication Date: 2026-03-25BIOMED VALLEY DISCOVERIES INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-01-07
Publication Date
2026-03-25

AI Technical Summary

Technical Problem

Cancers resistant to non-ERK MAPK pathway inhibitor therapies, such as BRAF and MEK inhibitors, exhibit genetic heterogeneity and adaptive drug resistance, necessitating novel targeted agents that can inhibit diverse segments of the tumorigenetic pathway and induce selective pressure beyond the adaptive capacity of cancer genomes.

Method used

Administering BVD-523, an ERK inhibitor, to subjects with cancer resistant to BRAF or MEK inhibitor therapies, and identifying subjects through markers like switch between RAF isoforms, upregulation of RTK or NRAS signaling, MAPK signaling reactivation, MEK activating mutations, STAT3 upward control, and mutations in the allosteric pocket of MEK to determine therapy effectiveness.

Benefits of technology

BVD-523 effectively inhibits cancer cell proliferation and induces apoptosis in resistant cancers, maintaining sensitivity in BRAF600 mutation-positive melanoma and delaying acquired resistance, demonstrating synergistic antitumor activity with BRAF inhibitors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026053745000047
    Figure 2026053745000047
  • Figure 2026053745000048
    Figure 2026053745000048
  • Figure 2026053745000049
    Figure 2026053745000049
Patent Text Reader

Abstract

To provide methods and compositions for treating cancer resistant to non-ERK MAPK pathway inhibitors. [Solution] The present invention provides, among other things, methods, pharmaceutical compositions, and kits for treating or improving the action of cancers that are antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitor therapy in a subject. Also provided are methods for identifying cancer subjects that would benefit from therapy with ERK inhibitors, and methods for inhibiting RSK phosphorylation in cancer cells that are antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitors. The method comprises administering an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof to a subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-references to related applications This application claims the interests of U.S. Patent Application No. 61 / 919,551 filed on 20 December 2013, a continuation of PCT International Application No. PCT / US2014 / 071749 filed on 19 December 2014, and U.S. Patent Application No. 15 / 161,137 filed on 20 May 2016, all of which are incorporated herein by reference as if they were fully described herein.

[0002] The present invention provides, in particular, methods, pharmaceutical compositions, and kits for treating or improving the action of cancers that are antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitor therapies in a given area. Inclusion by referencing the sequence list

[0003] This application also includes references to amino acid and / or nucleic acid sequences filed concurrently as a sequence listing text file, "0398850pct.txt", with a file size of 351 KB, created on May 20, 2016. The above sequence listing is fully incorporated herein by reference in accordance with §1.52(e)(5) of the U.S. Patent Law Enforcement Rules. [Background technology]

[0004] Drug inhibitors targeting components of the mitogenic factor-activated protein kinase (MAPK) signaling pathway have shown clinical efficacy in various cancers, particularly those with mutations in BRAF protein kinase. RAF and MEK inhibitors are approved for monotherapy in advanced metastatic BRAF-mutated melanoma. BRAF and MEK inhibitor activity, either alone or in combination, is unpredictable in other cancers; efficacy in BRAF-mutated thyroid and lung cancers is promising, but activity in BRAF-mutated colorectal cancer is minimal.

[0005] As with other targeted therapies, the pattern of disease response to RAF and MEK inhibitors appears to be influenced by the inherent genetic heterogeneity present in the cancers in which the drugs are used. For example, certain genetic modifications, including other changes that activate the PTEN and PI3K cell proliferation signaling pathways, have been shown to predict poor initial response and / or relatively rapid progression in BRAF-mutant melanomas treated with the RAF inhibitor vemurafenib. Similarly, direct mutations at the MEK locus appear to emerge in tumors that progress after BRAF, MEK, or combination drug treatment. Several further examples from RAS and RAF gene amplification and splicing mutations suggest that acquired drug resistance is generated when the pleiotropic effects of tumorigenesis encounter the selective pressure of targeted drug treatment.

[0006] Considering the above, there is a need for novel targeted agents that would be effective in combination by ideally inhibiting diverse segments of the tumorigenetic pathway and inducing a load of selective pressure that exceeds the adaptive capacity of diverse cancer genomes. This application aims to meet these and other needs. [Overview of the project] [Means for solving the problem]

[0007] One embodiment of the present invention is a method for treating or improving the action of cancer in a subject that is antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering an effective dose of BVD-523 or a pharmaceutically acceptable salt thereof to the subject.

[0008] Another embodiment of the present invention is a method for treating cancer or improving its effect in a subject. This method is (a) Identify subjects with cancer that has become antitherapy-resistant or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; (b) administering an effective dose of BVD-523 or a pharmaceutically acceptable salt thereof, which is an ERK inhibitor, to subjects with the anti-treatment-resistant cancer. Includes.

[0009] Further embodiments of the present invention are methods for treating or improving the action of cancers in a subject that are antitherapy-resistant or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering an effective dose of BVD-523 or a pharmaceutically acceptable salt thereof to the subject.

[0010] Another embodiment of the present invention is a method for identifying subjects with cancer who would benefit from therapy with an ERK inhibitor. This method is (a) Obtaining biological samples from the subject, (b) The target is the following marker: (i) Switch between RAF isoforms, (ii) Upregulation of receptor tyrosine kinase (RTK) or NRAS signaling, (iii) Reactivation of mitogenic factor-activated protein kinase (MAPK) signaling, (iv) Presence of MEK activating mutations, (v) Amplification of mutant BRAF, (vi) STAT3 upward control, (vii) Mutations in the allosteric pocket of MEK that directly block the binding of inhibitors to MEK or lead to constitutive MEK activity, To screen a sample to determine whether it has one or more of the following: This includes, where the presence of one or more markers confirms that the cancer in question is antitherapy-resistant to BRAF and / or MEK inhibitor therapy, and that the subject would benefit from therapy with an ERK inhibitor, which is BVD-523 or a pharmaceutically acceptable salt thereof.

[0011] A further embodiment of the present invention is a pharmaceutical composition for treating or improving the action of cancers that are antitherapy-resistant or resistant to non-ERK MAPK pathway therapy in a subject. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0012] Another embodiment of the present invention is a kit for treating or improving the action of cancers that are antitherapy-resistant or resistant to non-ERK MAPK pathway therapy in a subject. The kit comprises one of the pharmaceutical compositions according to the present invention, packaged together with instructions for use.

[0013] Another embodiment of the present invention is a method for inhibiting the phosphorylation of RSK in cancer cells that are antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitors. The method comprises exposing cancer cells to an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a time sufficient to inhibit the phosphorylation of RSK in the cancer cells.

[0014] Another embodiment of the present invention is a method for treating a subject having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof.

[0015] Another embodiment of the present invention is a composition for treating subjects having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle. The present invention provides, for example, the following: (Item 1) A method for treating a subject having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising administering to the subject 600 mg BID of BVD-523 or a pharmaceutically acceptable salt thereof. (Item 2) The aforementioned mutation is BRAF V600E A mutation, as described in item 1. (Item 3) The method according to item 1, wherein the mammals are selected from the group consisting of humans, primates, farm animals, and livestock. (Item 4) The method described in item 1, which states that the mammal is human. (Item 5) The method according to item 1, wherein the melanoma has MAPK activity. (Item 6) A composition for treating subjects having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle. (Item 7) The composition according to item 6, wherein the subject is a mammal. (Item 8) The composition according to item 6, wherein the mammal is selected from the group consisting of humans, primates, farm animals and livestock. (Item 9) The composition described in item 6, wherein the mammal is human. (Item 10) The composition according to item 6, wherein the melanoma has MAPK activity. (Item 11) The aforementioned mutation is BRAF V600E A mutation, as described in item 6.

[0016] The patent or application file contains at least one color drawing. A copy of the published patent or application accompanied by the color drawing(s) will be provided by the Patent Office upon request and payment of the necessary fees. [Brief explanation of the drawing]

[0017] [Figure 1AB]Figures 1A to 1C are graphs showing the progress of a dose-escalation study in a human malignant melanoma cell line (A375 cells) at one month. Various treatments (trametinib (type 2 MEK inhibitor), dabrafenib (BRAF inhibitor), and BVD-523 (ERK1 / 2 inhibitor)) are as indicated. [Figure 1C] Same as above.

[0018] [Figure 2A] Figures 2A–2H are graphs showing the results of a proliferation assay tracking changes in sensitivity to dose escalation(s) at month 1. The various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are indicated at the top of the graphs. The explanations on the right of the graphs indicate the different cell types generated in the dose escalation study. For example, "dabrafenib" refers to cells treated with the highest dose of dabrafenib from month 1 of the dose escalation study. "Parent" refers to control cells that have not been treated with any drug. Figures 2A, 2C, and 2G are normalized to the control, while Figures 2D, 2F, and 2H show the raw data. [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above. [Figure 2E] Same as above. [Figure 2F] Same as above. [Figure 2G] Same as above. [Figure 2H] Same as above.

[0019] [Figure 3AB] Figures 3A to 3D are graphs showing the progress of the dose escalation trial in A375 cells at month 2. The various treatments (trametinib, dabrafenib, and BVD-523) are as shown. [Figure 3CD] Same as above.

[0020] [Figure 4A]Figures 4A–4H show the results of growth assays tracking changes in sensitivity to dose escalation(s) at month 2. The various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are shown at the top of the graphs. The explanations on the right of the graphs indicate the different cell types generated in the dose escalation study. For example, "dabrafenib" refers to cells treated with the highest dose of dabrafenib from month 2 of the dose escalation study. "Parent" refers to control cells that have not been treated with any drug. Figures 4A, 4C, and 4G are normalized to the control, while Figures 4D, 4F, and 4H show the raw data. [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 4D] Same as above. [Figure 4E] Same as above. [Figure 4F] Same as above. [Figure 4G] Same as above. [Figure 4H] Same as above.

[0021] [Figure 5A] Figures 5A to 5H are graphs showing only the parental cell line data and BVD-523 cell line data from Figures 4A to 4H. Various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are shown. Figures 5A, 5C, and 5G are normalized to the control, while Figures 5D, 5F, and 5H show the raw data. [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above. [Figure 5E] Same as above. [Figure 5F] Same as above. [Figure 5G] Same as above. [Figure 5H] Same as above.

[0022] [Figure 6AB]Figures 6A to 6D are graphs showing the progress of a dose-escalation study in a human malignant cell line (A375 cells) at 3 months. The various treatments (trametinib, dabrafenib, and BVD-523) are as shown. [Figure 6CD] Same as above.

[0023] [Figure 7] Figure 7 is a histogram showing the results of a growth assay applied to cells grown in a DMSO control well from a dose-escalation assay.

[0024] [Figure 8A] Figures 8A–8D are a set of line graphs showing the proliferation assay for month 3 of the study. The various treatments (trametinib, dabrafenib, BVD-523, and paclitaxel) are shown at the top of the graphs. The explanations on the right side of the graphs indicate the different cell types generated in the dose escalation study. For example, "dabrafenib" refers to cells treated with the highest dose of dabrafenib from month 3 of the dose escalation study. "Parent" refers to control cells that have not been treated with the drug. [Figure 8B] Same as above. [Figure 8C] Same as above. [Figure 8D] Same as above.

[0025] [Figure 9A] Figures 9A to 9D are graphs showing only the parental cell line data, dabrafenib cell line data, and BVD-523 cell line data from Figures 8A to 8D. [Figure 9B] Same as above. [Figure 9C] Same as above. [Figure 9D] Same as above.

[0026] [Figure 10A]Figure 10A is a dose matrix showing the percentage inhibition by the trametinib / dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. Figure 10B is a dose matrix showing bliss excess for the trametinib / dabrafenib combination. Figures 10C and 10D are graphs showing the percentage viability of A375 cells treated with dabrafenib monotherapy and trametinib monotherapy compared to a control treated with DMSO alone, using the Alamar Blue cell viability assay. Figure 10E is a graph showing the percentage viability of A375 cells treated with the dabrafenib and trametinib combination compared to a control treated with DMSO alone, using the Alamar Blue cell viability assay. [Figure 10B] Same as above. [Figure 10CD] Same as above. [Figure 10E] Same as above.

[0027] [Figure 11A] Figure 11A is a dose matrix showing the percentage inhibition by the trametinib / dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. Figure 11B is a dose matrix showing bliss excess for the trametinib / dabrafenib combination. Figures 11C and 11D are graphs showing the percentage viability of A375 cells treated with dabrafenib monotherapy and trametinib monotherapy compared to a control treated with DMSO alone, using the CellTiter-Glo cell viability assay. Figure 11E is a graph showing the percentage viability of A375 cells treated with the dabrafenib and trametinib combination compared to a control treated with DMSO alone, using the CellTiter-Glo cell viability assay. [Figure 11B] Same as above. [Figure 11CD] Same as above. [Figure 11E] Same as above.

[0028] [Figure 12A] Figure 12A is a dose matrix showing the percentage inhibition of the BVD-523 / dabrafenib combination in A375 cells using the Alamar Blue cell viability assay. Figure 12B is a dose matrix showing bliss excess for the BVD-523 / dabrafenib combination. Figures 12C and 12D are graphs showing the percentage viability of A375 cells treated with dabrafenib monotherapy and BVD-523 monotherapy compared to a control treated with DMSO alone, using the Alamar Blue cell viability assay. Figure 12E is a graph showing the percentage viability of A375 cells treated with the dabrafenib and BVD-523 combination compared to a control treated with DMSO alone, using the Alamar Blue cell viability assay. [Figure 12B] Same as above. [Figure 12CD] Same as above. [Figure 12E] Same as above.

[0029] [Figure 13A] Figure 13A is a dose matrix showing the percentage inhibition of the BVD-523 / dabrafenib combination in A375 cells using the CellTiter-Glo cell viability assay. Figure 13B is a dose matrix showing bliss excess for the BVD-523 / dabrafenib combination. Figures 13C and 13D are graphs showing the percentage viability of A375 cells treated with dabrafenib monotherapy and BVD-523 monotherapy compared to a control treated with DMSO alone, using the CellTiter-Glo cell viability assay. Figure 13E is a graph showing the percentage viability of A375 cells treated with the dabrafenib and BVD-523 combination compared to a control treated with DMSO alone, using the CellTiter-Glo cell viability assay. [Figure 13B] Same as above. [Figure 13CD] Same as above. [Figure 13E] Same as above.

[0030] [Figure 14A] Figure 14A is a dose matrix showing the % inhibition of the trametinib / BVD-523 combination in A375 cells using the Alamar Blue cell viability assay. Figure 14B is a dose matrix showing bliss excess for the trametinib / BVD-523 combination. Figures 14C and 14D are graphs showing the % viability of A375 cells treated with BVD-523 monotherapy and trametinib monotherapy compared to a control treated with DMSO alone, using the Alamar Blue cell viability assay. Figure 14E is a graph showing the % viability of A375 cells treated with the BVD-523 and trametinib combination compared to a control treated with DMSO alone, using the Alamar Blue cell viability assay. [Figure 14B] Same as above. [Figure 14CD] Same as above. [Figure 14E] Same as above.

[0031] [Figure 15A] Figure 15A is a dose matrix showing the percentage inhibition of the trametinib / BVD-523 combination in A375 cells using the CellTiter-Glo cell viability assay. Figure 15B is a dose matrix showing bliss excess for the trametinib / BVD-523 combination. Figures 15C and 15D are graphs showing the percentage viability of A375 cells treated with BVD-523 monotherapy and trametinib monotherapy compared to a control treated with DMSO alone, using the CellTiter-Glo cell viability assay. Figure 15E is a graph showing the percentage viability of A375 cells treated with the BVD-523 and trametinib combination compared to a control treated with DMSO alone, using the CellTiter-Glo cell viability assay. [Figure 15B] Same as above. [Figure 15CD] Same as above. [Figure 15E] Same as above.

[0032] [Figure 16AB] Figures 16A–16D are a set of images showing Western blot analysis of MAPK signaling in A375 cells after 4 hours of treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and trametinib (Tram). Unless otherwise indicated, 40 μg of total protein was loaded into each lane. Two sets of samples were collected in this experiment. Figures 16A and 16B show the results from two sets of samples. Similarly, Figures 16C and 16D also show the results from two sets of samples. In Figures 16A and 16B, pRSK1 showed a relatively weak signal in A375 cells compared to other markers. Different pRSK1-S380 antibodies from Cell Signaling (catalog number 11989) were tested but did not yield any detectable signals (data not shown). In Figures 16C and 16D, pCRAF-338 yielded the smallest signal. [Figure 16CD] Same as above.

[0033] [Figure 17AB] Figures 17A–17D are a set of images showing Western blot analysis of MAPK signaling in human colorectal cancer cell lines (HCT116 cells) after 4 hours of treatment with various concentrations (in nM) of BVD-523, dabrafenib (Dab), and trametinib (Tram). Unless otherwise indicated, 40 μg of total protein was loaded into each lane. Two sets of samples were collected in this experiment. Figures 17A and 17B show the results from the two sets of samples. Similarly, Figures 17C and 17D also show the results from the two sets of samples. In Figures 17A and 17B, pRSK1 levels appeared to be very low in HCT116 cells, and in Figures 17C and 17D, the pCRAF-338 signal was also very weak. [Figure 17CD] Same as above.

[0034] [Figure 18AB]Figures 18A–18D are a set of images showing Western blot analysis of cell cycle and apoptotic signaling in A375 melanoma cells after 24 hours of treatment with various concentrations (in nM) of BVD-523 ("BVD523"), trametinib ("tram"), and / or dabrafenib ("Dab"), as indicated. Unless otherwise noted, each lane was loaded with 50 μg of total protein. Two sets of samples were collected in this experiment. Figures 18A and 18B show the results from two sets of samples. Similarly, Figures 18C and 18D also show the results from two sets of samples. In Figures 18A and 18B, a band of size (89 kDa) corresponding to cleaved PARP was not evident. [Figure 18CD] Same as above.

[0035] [Figure 19] Figure 19 shows that BVD-523 can treat acquired resistance to targeted drugs in vivo. The patient-derived strain ST052C was isolated from a BRAFV600E melanoma patient whose disease progressed after 10 months of therapy targeting the MAPK pathway. Ex vivo treatment revealed that ST052C exhibited acquired cross-resistance to dabrafenib at 50 mg / kg BID. Conversely, BVD-523 was effective as a monotherapy in ST052C at 100 mg / kg BID.

[0036] [Figure 20] Figure 20 is a flowchart showing the dose escalation protocol used in this specification.

[0037] [Figure 21] Figure 21 is a schematic diagram of the mitogenic factor-activated protein kinase (MAPK) pathway.

[0038] [Figure 22A]Figures 22A to 22E are graphs showing the results of single-agent growth assays. They show the growth results for treatment with BVD-523 (Figure 22A), SCH772984 (Figure 22B), dabrafenib (Figure 22C), trametinib (Figure 22D), and paclitaxel (Figure 22E). [Figure 22B] Same as above. [Figure 22C] Same as above. [Figure 22D] Same as above. [Figure 22E] Same as above.

[0039] [Figure 23A] Figures 23A to 23O show the results of the combination of BVD-523 and dabrafenib. Figure 23A shows the dose matrix showing the inhibition (%) for the combination in RKO parent cells. Figures 23B to 23C show the results of the monotherapy growth assay for the combination in Figure 23A. Figure 23D shows the Loewe excess for the combination in Figure 23A, and Figure 23E shows the Bliss excess for the combination in Figure 23A. Figure 23F shows the dose matrix showing the inhibition (%) for the combination in RKO MEK1(Q56P / +)-clone 1 cells. Figures 23G to 23H show the results of the monotherapy growth assay for the combination in Figure 23F. Figure 23I shows the Loewe excess for the combination in Figure 23F, and Figure 23J shows the Bliss excess for the combination in Figure 23F. Figure 23K shows the dose matrix showing the inhibition (%) for the combination in RKO MEK1(Q56P / +)-clone 2 cells. Figures 23L to 23M show the results of single-agent growth assays for the combinations in Figure 23K. Figure 23N shows Loewe excess for the combinations in Figure 23K, and Figure 23O shows Bliss excess for the combinations in Figure 23K. [Figure 23BC] Same as above. [Figure 23DE] Same as above. [Figure 23F] Same as above. [Figure 23GH] Same as above. [Figure 23IJ] Same as above. [Figure 23K] Same as above. [Figure 23LM] Same as above. [Figure 23NO] Same as above.

[0040] [Figure 24A] Figures 24A to 24O show the results for the combination of SCH772984 and dabrafenib. Figure 24A shows the dose matrix showing the inhibition (%) for the combination in RKO parent cells. Figures 24B to 24C show the results of the monotherapy growth assay for the combination in Figure 24A. Figure 24D shows the Loewe excess for the combination in Figure 24A, and Figure 24E shows the Bliss excess for the combination in Figure 24A. Figure 24F shows the dose matrix showing the inhibition (%) for the combination in RKO MEK1(Q56P / +)-clone 1 cells. Figures 24G to 24H show the results of the monotherapy growth assay for the combination in Figure 24F. Figure 24I shows the Loewe excess for the combination in Figure 24F, and Figure 24J shows the Bliss excess for the combination in Figure 24F. Figure 24K shows the dose matrix showing the inhibition (%) for the combination in RKO MEK1(Q56P / +)-clone 2 cells. Figures 24L to 24M show the results of single-agent growth assays for the combinations in Figure 24K. Figure 24N shows Loewe excess for the combinations in Figure 24K, and Figure 24O shows Bliss excess for the combinations in Figure 24K. [Figure 24BC] Same as above. [Figure 24DE] Same as above. [Figure 24F] Same as above. [Figure 24GH] Same as above. [Figure 24IJ] Same as above. [Figure 24K] Same as above. [Figure 24LM] Same as above. [Figure 24NO] Same as above.

[0041] [Figure 25A]Figures 25A to 25O show the results for the combination of trametinib and dabrafenib. Figure 25A shows the dose matrix showing the inhibition (%) for the combination in RKO parent cells. Figures 25B to 25C show the results of the monotherapy growth assay for the combination in Figure 25A. Figure 25D shows the Loewe excess for the combination in Figure 25A, and Figure 25E shows the Bliss excess for the combination in Figure 25A. Figure 25F shows the dose matrix showing the inhibition (%) for the combination in RKO MEK1(Q56P / +)-clone 1 cells. Figures 25G to 25H show the results of the monotherapy growth assay for the combination in Figure 25F. Figure 25I shows the Loewe excess for the combination in Figure 25F, and Figure 25J shows the Bliss excess for the combination in Figure 25F. Figure 25K shows the dose matrix showing the inhibition (%) for the combination in RKO MEK1(Q56P / +)-clone 2 cells. Figures 25L to 25M show the results of single-agent growth assays for the combinations in Figure 25K. Figure 25N shows Loewe excess for the combinations in Figure 25K, and Figure 25O shows Bliss excess for the combinations in Figure 25K. [Figure 25BC] Same as above. [Figure 25DE] Same as above. [Figure 25F] Same as above. [Figure 25GH] Same as above. [Figure 25IJ] Same as above. [Figure 25K] Same as above. [Figure 25LM] Same as above. [Figure 25NO] Same as above.

[0042] [Figure 26AB] Figure 26A is a graph showing the Lowe volume for the tested combinations. Figure 26B is a graph showing the Bliss volume for the tested combinations. Figure 26C is a graph showing the synergy score for the tested combinations. [Figure 26C] Same as above.

[0043] [Figure 27A] Figures 27A–27I show changes in MAPK and effector pathway signaling in MEK-acquired resistance. Isogenic RKO parental cells and MEK1(Q56P / +) cells were treated with the compound for 4 or 24 hours, and then immunoblotting was performed using the antibodies shown. Dabrafenib is a BRAF inhibitor, and trametinib is a MEK inhibitor. Figure 27A shows increased signaling in RKO MEK1(Q56P / +) cells. Figures 27B–27C show the results of the 4-hour treatment in Experiment 1 (see Example 7) in RKO parental cells (27B) and RKO MEK1(Q56P / +) cells (27C). Figures 27D–27E show the results of the 4-hour treatment in Experiment 2 (see Example 7) in RKO parental cells (27D) and RKO MEK1(Q56P / +) cells (27E). Figures 27F to 27G show the results of the 4-hour treatment in Experiment 2 (see Example 7) in RKO parental cells (27F) and RKO MEK1 (Q56P / +) cells (27G). Figures 27H to 27I show a summary of the results in RKO parental cells (27H) and RKO MEK1 (Q56P / +) cells (27I). [Figure 27B] Same as above. [Figure 27C] Same as above. [Figure 27D] Same as above. [Figure 27E] Same as above. [Figure 27F] Same as above. [Figure 27G] Same as above. [Figure 27HI] Same as above.

[0044] [Figure 28ABC]Figures 28A to 28E show the results for the combination of BVD-523 and SCH772984. Figure 28A shows the dose matrix indicating inhibition (%) for the combination in A375 cells. Figures 28B to 28C show the results of the monotherapy growth assay for the combination in Figure 28A. Figure 28D shows the Loewe excess for the combination in Figure 28A, and Figure 28E shows the Bliss excess for the combination in Figure 28A. [Figure 28DE] Same as above.

[0045] [Figure 29AB] Figures 29A–29F illustrate the discovery and characterization of the novel ERK1 / 2 inhibitor BVD-523 (urixertinib). Figure 29A demonstrates that BVD-523 exhibits reversible ATP competitive inhibition. This is demonstrated by the linear increase in IC50 value for ERK2 inhibition as ATP concentration increases, as shown in Figure 29B. Figure 29C shows a representative plot of the dose-response curve, and Figure 29D shows a plot of IC50 over time. Figure 29E shows the binding of BVD-523 to ERK2 and phospho-ERK2 (pERK2) compared to the negative control protein p38. Figure 29F shows the binding of BVD-523 to ERK2 compared to the ERK inhibitors SCH772984 and pyrazolylpyrrole. [Figure 29CD] Same as above. [Figure 29EF] Same as above.

[0046] [Figure 30A]Figures 30A to 30D show that BVD-523 inhibits cell proliferation and enhances caspase-3 and caspase-7 activity in vitro. Figure 30A shows that BVD-523 exhibits preferential activity in cells with MAPK pathway mutations, defined by the presence of mutations in RAS family members and RAF. Furthermore, as shown in Figure 30B, BVD-523 blocks susceptible cell lines in the G1 phase of the cell cycle. Figure 30C shows that BVD-523 induced a concentration-dependent and time-dependent increase in caspase activity after 72 hours of exposure in A375, WM266, and LS411N cancer cell lines. Figure 30D shows that in BRAFV600E mutant A375 cells, the MAPK pathway and effector proteins are modulated by short-term (4 hours) and long-term (24 hours) treatment with BVD-523. [Figure 30B] Same as above. [Figure 30CD] Same as above.

[0047] [Figure 31A] Figures 31A-31C are graphs showing the in vivo antitumor activity of BVD-523. BVD-523 monotherapy inhibits tumor growth in (Figure 31A) A375 and (Figure 31B) Colo205 cell line xenograft models (aP<0.0001, vehicle control; compared to CPT-11 administered only on days 14 and 18). Abbreviations: BID, twice daily; CMC, carboxymethylcellulose; QD, daily; Q4D, every four days. Figure 31C shows that in Colo205 xenografts, increased ERK1 / 2 phosphorylation correlates with BVD-523 concentration. [Figure 31B] Same as above. [Figure 31C] Same as above.

[0048] [Figure 32A]Figure 32A shows the effects of ERK1 / 2 inhibitors on signal transduction. Using RPPA, the effects on proteins were measured in cell lines (A375, AN3Ca, Colo205, HCT116, HT29, and MIAPaca2) after treatment with the ERK1 / 2 inhibitors BVD-523 (BVD), Vx11e (Vx), GDC-0994 (GDC), or SCH722984 (SCH). Figure 32B shows that the ERK inhibitors BVD-523, GDC-0994, and Vx11e have a differential effect on phospho-ERK (ERK 1 / 2 T202 Y204) compared to SCH722984. Phospho-RSK (p90 RSK 380) and cyclin D1 are inhibited by the ERK inhibitors tested. Abbreviations: BRAFi, BRAF inhibitor; MEKi, MEK inhibitor. Figure 32C shows Western blot assays of cell and nuclear fractions from RKO cell lines after treatment with BVD-523, trametinib, SCH722984, or dabrafenib. Histone H3 (a protein localized in the nucleus) and HSP90 (a protein localized in the cytoplasm) were included as positive controls to confirm that the nuclear and cytoplasmic fractions were properly enriched; the nuclear fraction was higher in H3, and the cytoplasmic fraction was higher in HSP90. [Figure 32B] Same as above. [Figure 32C] Same as above.

[0049] [Figure 33] Figure 33 shows that the ERK inhibitors BVD-523, Vx11, GDC-0994, and SCH772984 (SCH) exhibit cell line-dependent changes in phospho-ATK levels. Abbreviations: DMSO, dimethyl sulfoxide.

[0050] [Figure 34A]Figures 34A–34D show that BVD-523 is active in a model of resistance to BRAF / MEK inhibition. The emergence of resistance to BVD-523, dabrafenib, or trametinib in BRAFV600EA375 cells after exposure to increasing drug concentrations is shown. A strict set of “criteria” was applied to determine when the dose could be increased, ensuring that the kinetics of resistance acquisition were equivalent between treatments. See Example 1. Time is shown against the IC50 multiplier; each point on the plotted line represents a change in culture medium or cell division. Figure 34A shows that adapting cells to proliferation in the presence of BVD-523 was more difficult than with either dabrafenib or trametinib. Figure 34B shows that BVD-523 sensitivity is retained in A375 cells cultured to acquire resistance to the combination of BRAF inhibition (dabrafenib) + MEK inhibition (trametinib). In Figure 34C, cells were treated with the compound for 96 hours, and their viability was evaluated using CellTiter-Glo®. In BRAFV600ERKO cells, which are cross-resistant to the BRAF inhibitor (dabrafenib) and the MEK inhibitor (trametinib), BVD-523 activity is retained due to endogenous heterozygous knock-in of MEK1Q56P. Figure 34D shows that BVD-523 inhibition of pRSK in the BRAFV600E mutant cell line RKO is maintained in the presence of MEK1Q56P, which confers resistance to MEK and BRAF inhibition. Knock-in of the KRAS mutant allele into the SW48 cell line significantly reduces sensitivity to the MEK inhibitors trametinib and selumetinib, while relatively retaining sensitivity to BVD-523. [Figure 34B] Same as above. [Figure 34C] Same as above. [Figure 34D] Same as above.

[0051] [Figure 35A]Figure 35A is a graph showing the in vivo activity of BVD-523 in xenografts derived from vemurafenib-relapsed patients. Mean tumor volume (±SEM) is shown for BVD-523, 100 mg / kg, BID, monotherapy; dabrafenib, 50 mg / kg, BID, monotherapy; and BVD-523, 100 mg / kg, BID + dabrafenib, 50 mg / kg, BID. Abbreviations: BID, twice daily; SEM, standard error.

[0052] [Figure 36AB] Figures 36A–36D are graphs showing the benefits of the BVD-523 and BRAF inhibition combination. Figures 36A–36B show that in a xenograft model of A375 BRAFV600E mutant melanoma cell line with a starting tumor volume of 75–144 mm3, the BVD-523 + dabrafenib combination showed superior antitumor activity compared to treatment with either drug alone. Figures 36C–36D show similar data from the same model with a larger tumor volume (700–800 mm3) at the start of treatment. Plots of mean tumor growth (left panel) and Kaplan-Meier survival (right panel) are shown for each trial. Abbreviations: BID, twice daily; QD, once daily. [Figure 36CD] Same as above.

[0053] [Figure 37A]Figure 37A is a graph showing that SW48 colorectal cells engineered with KRAS alleles to respond to paclitaxel did not change compared to controls. Figure 37B shows the combined interaction of BVD-523 and vemurafenib, analyzed using Horizon's Chalice, Bioinformatics Software, and evaluated using an 8×10 matrix of concentrations with Loewe Additivity and Bliss Independence Models. Chalice makes it possible to identify potential synergistic interactions by showing the calculated excess inhibition against those predicted to be additive across the dose matrix as a heatmap, and by reporting a quantitative “synergy score” based on the Loewe model. The results suggest that the interaction between BVD-523 and vemurafenib is at least additive, and in some cases synergistic in melanoma cell lines with the BRAFV600E mutation. Figure 37C is a graph showing that the combination of BVD-523 and dabrafenib significantly delays the development of acquired resistance in A375 BRAFV600E melanoma cells. The temporal acquisition of resistance in response to escalating doses of dabrafenib alone or in combination with BVD-523 or trametinib was evaluated. Strict criteria were applied to ensure that the kinetics were equivalent between treatments when dose increases could be made. See Example 1. [Figure 37B] Same as above. [Figure 37C] Same as above.

[0054] [Figure 38] Figure 38 is a graph showing that BVD-523 inhibits ex vivo PMA-stimulated RSK1 / 2 phosphorylation in human whole blood. The mean of the BVD-523 concentration dataset is indicated by (-). n=20 for each BVD-523 concentration. Abbreviations: PBMC, peripheral blood mononuclear cell; RSK, ribosomal S6 kinase.

[0055] [Figure 39A] Figure 39A is a graph showing the steady-state pharmacokinetics of BVD-523 (Cycle 1, Day 15). The red dashed line represents EC50 200 ng / mL HWB. Abbreviations: AUC, Area under the curve; BID, Twice daily; Cmax, Maximum concentration; EC50, 50% maximum effective concentration; HWB, Human whole blood; SD, Standard deviation. Figure 39B is a graph showing the pharmacodynamic inhibition of ERK phosphorylation by BVD-523 in human whole blood. Abbreviations: BID, Twice daily; pRSK, Phospho-RSK; RSK, Ribosomal S6 kinase. [Figure 39B] Same as above.

[0056] [Figure 40A] Figure 40A shows the best radiographic response in patients treated with BVD-523. It includes all patients with disease as measured by RECIST v1.1 who received ≥1 dose of the test treatment and had >1 tumor evaluation during treatment (25 / 27; 2 did not receive both scans for the target lesion). Response was measured as the change from baseline in the sum of the longest diameters of each target lesion. The doses shown are the doses the patient received at the time of response. The dashed line indicates the threshold for partial response according to RECIST v1.1. Abbreviations: CRC, colorectal cancer; NET, neuroendocrine tumor; NSCLC, non-small cell lung cancer; NSGCT, non-seminoma germ cell tumor; PNET, pancreatic NET; PTC, papillary thyroid carcinoma; RECIST v1.1, criteria for evaluating treatment response of solid tumors version 1.1; SLD, sum of the largest diameters. Figure 40B shows a computed tomography scan of a 61-year-old patient with BRAF mutant melanoma treated with BVD-523, demonstrating a confirmed partial response. [Figure 40B] Same as above.

[0057] [Figure 41]Figure 41 shows tumor response and tumor progression. Swimmer plots of tumor response, tumor progression, and duration of treatment are shown in patients treated with BVD-523, for which response is evaluable. The starting point of the vertical axis corresponds to the randomization date or reference start date. Analysis cutoff date: December 1, 2015. Abbreviations: BID, twice daily. [Modes for carrying out the invention]

[0058] One embodiment of the present invention is a method for treating or improving the action of cancer in a subject that is antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitor therapy. The method comprises administering an effective dose of BVD-523 or a pharmaceutically acceptable salt thereof to the subject.

[0059] As used herein, the terms “to treat,” “to treat,” “treatment,” and their grammatical variations mean subjecting an individual subject to a protocol, regimen, process, or therapeutic means from which a physiological response or outcome is desired in that subject, e.g., a patient. In particular, the methods and compositions of the present invention can be used to slow the development of disease symptoms, delay the onset of a disease or condition, or halt the progression of disease development. However, since not all subjects to treat can respond to a particular treatment protocol, regimen, process, or therapeutic means, treatment does not require that the desired physiological response or outcome be achieved in every subject or subject group, e.g., a patient group. Therefore, a given subject or subject group, e.g., a patient group, may not respond to treatment or may respond inadequately.

[0060] As used herein, the terms “improve,” “to improve,” and their grammatical variations mean reducing the severity of the symptoms of a disease in the subject.

[0061] As used herein, “Subject” means a mammal, preferably a human. In addition to humans, the category of mammals within the scope of the present invention includes, for example, farm animals, livestock, laboratory animals, etc. Some examples of farm animals include cattle, pigs, horses, goats, etc. Some examples of livestock include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.

[0062] In this invention, BVD-523 is defined by formula (I): [ka] This corresponds to the compound and its pharmaceutically acceptable salts. BVD-523 can be synthesized, for example, by the method disclosed in U.S. Patent No. 7,354,939. Enantiomers of BVD-523 and racemic mixtures of both enantiomers are also considered to be within the scope of the present invention. BVD-523 is unique and is an ERK1 / 2 inhibitor with a mechanism of action that is considered to differ from certain other ERK1 / 2 inhibitors, e.g., SCH772984 and pyrimidine structures used by Hatzivassiliou et al. (2012). For example, other ERK1 / 2 inhibitors, e.g., SCH772984, inhibit the autophosphorylation of ERK (Morris et al., 2013), while BVD-523 inhibits ERK while still allowing the autophosphorylation of ERK (see, e.g., Figure 18).

[0063] As used herein, the terms “resistance” and “anti-therapeutic” are used interchangeably. To be “resistant” to non-ERK MAPK pathway inhibitor therapy means that the non-ERK MAPK inhibitor has reduced effectiveness in treating cancer.

[0064] As used herein, “non-ERK MAPK inhibitor” means any substance, with the exception of ERK1 / 2 inhibitors, that reduces the activity, expression, or phosphorylation of proteins or other members of the MAPK pathway, resulting in reduced cell proliferation or increased cell death. As used herein, “ERK1 / 2 inhibitor” means (i) a substance that directly interacts with ERK1 and / or ERK2, for example, by binding to ERK1 / 2, and (ii) a substance that reduces the expression or activity of ERK1 and / or ERK2 protein kinases. Therefore, inhibitors that act upstream of ERK1 / 2, such as MEK inhibitors and RAF inhibitors, are not ERK1 / 2 inhibitors according to the present invention (however, they are non-ERK MAPK inhibitors). Non-limiting examples of ERK1 / 2 inhibitors according to the present invention include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523 (BioMed Valley Discoveries, Inc.), SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), pharmaceutically acceptable salts thereof, and combinations thereof.

[0065] An overview of the mammalian MAPK cascade is shown in Figure 21. The MAPK pathway is reviewed, for example, by Akinleye et al. in 2013. Briefly, with respect to the ERK1 / 2 module (pale purple box) in Figure 21, the MAPK1 / 2 signaling cascade is activated by ligands that bind to receptor tyrosine kinases (RTKs). The activated receptor recruits and phosphorylates the adapter proteins Grb2 and SOS, which then interact with the membrane-bound GTPase Ras, causing its activation. In its activated GTP-bound form, Ras recruits and activates RAF kinases (A-RAF, B-RAF, and C-RAF / RAF-1). The activated RAF kinases activate MAPK1 / 2 (MKK1 / 2), which catalyzes the phosphorylation of threonine and tyrosine residues in the activating sequence Thr-Glu-Tyr of ERK1 / 2. Regarding the JNK / p38 module (yellow box in Figure 21), upstream kinases MAP3K, such as MEKK1 / 4, ASK1 / 2, and MLK1 / 2 / 3, activate MAP2K3 / 6 (MKK3 / 6), MAP2K4 (MKK4), and MAP2K7 (MKK7). These MAP2Ks then activate JNK protein kinases, including JNK1, JNK2, and JNK3, as well as p38α / β / γ / δ. To perform their functions, JNK activates several transcription factors, including c-Jun, ATF-2, NF-ATc1, HSF-1, and STAT3. Regarding the ERK5 module (blue box in Figure 21), the upstream kinases (MKK5) of MAP2K5 are MEKK2 and MEKK3. The most characterized downstream target of MEK5 is ERK5, also known as the large MAP kinase 1 (BMK1) because it is twice the size of other MAPKs.

[0066] Non-limiting examples of non-ERK MAPK pathway inhibitors according to the present invention include RAS inhibitors, RAF inhibitors (e.g., inhibitors of A-RAF, B-RAF, C-RAF (RAF-1)), MEK inhibitors, and combinations thereof. Preferably, the non-ERK MAPK pathway inhibitors are BRAF inhibitors, MEK inhibitors, and combinations thereof.

[0067] As used herein, “RAS inhibitor” means a substance that (i) directly interacts with RAS, for example by binding to RAS, and (ii) reduces the expression or activity of RAS. Non-limiting and exemplary RAS inhibitors include, but are not limited to, farnesyltransferase inhibitors disclosed by Maurer (Maurer et al., 2012) (e.g., tipifarnib and ronafarnib), farnesyl group-containing small molecules (e.g., salilasib and TLN-4601), DCAI, and Shima (Shima et al., 2013). Kobe0065 and Kobe2602, HBS3 (Patgiri et al., 2 years) are disclosed. This includes the 2011 model and AIK-4 (Allinky).

[0068] As used herein, “RAF inhibitor” means a substance that (i) directly interacts with RAF, for example by binding to RAF, and (ii) reduces the expression or activity of RAF, such as A-RAF, B-RAF, and C-RAF (RAF-1). Non-limiting and exemplary RAF inhibitors, including BRAF inhibitors, include: [ka] [ka] [ka] [ka] [ka] [ka] [ka] AAL881(Novartis); AB-024(Ambit Biosciences), ARQ-736(ArQule), ARQ-761(ArQule), AZ628(Axon Medchem BV), BeiGene-283(BeiGene), BIIB-024(MLN 2480)(Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al. (2007), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKlin e), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), RAF-265 (Novartis), RAF-365 (Novartis), Regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche, SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof and combinations thereof.

[0069] As used herein, “MEK inhibitor” means a substance that (i) directly interacts with MEK, for example by binding to MEK, and (ii) reduces the expression or activity of MEK. Therefore, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention.Non-exclusive examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chlorophenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxyethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal component of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimacertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), RO092210 (Roche), RO4987655 (Hoffmann-La Roche), RO5126766 (Hoffmann-La This includes Roche, selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.

[0070] In one aspect of this embodiment, substantially all phosphorylation of ribosome s6 kinase (RSK) is inhibited after administration of BVD-523 or a pharmaceutically acceptable salt thereof. As used herein in relation to RSK phosphorylation, “substantially all” means a reduction greater than 50%, preferably greater than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0071] In another aspect of this embodiment, the cancer has MAPK activity. As used herein, "having MAPK activity" means that the proteins downstream of ERK are still active even if the proteins upstream of ERK are inactive. Such cancer may be a solid tumor carcinoma or a hematological carcinoma.

[0072] In this invention, cancer includes both solid and hematological cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, stomach cancer, germ cell tumors, trophoblast tumors during pregnancy, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, colorectal cancer, laryngeal cancer, leukemia, lip and oral cancer, liver tumors / cancers, lung tumors / cancers, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, and myeloproliferative disorders. This includes nasopharyngeal cancer, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell neoplasms, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell carcinoma, transitional cell carcinoma of the pelvis and ureter, salivary gland cancer, Sézary syndrome, skin cancer (such as cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, gastric cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.

[0073] Examples of blood cancers include, but are not limited to, leukemias such as adult / childhood acute lymphoblastic leukemia, adult / childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia and pilocytic cell leukemia; lymphomas such as AIDS-associated lymphoma, cutaneous T-cell lymphoma, adult / childhood Hodgkin lymphoma, mycosis fungoides, adult / childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sézary syndrome, cutaneous T-cell lymphoma and Waldenström macroglobulinemia; and other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma / plasmacytic neoplasms, myelodysplastic syndromes, and spinal cord malformations / myeloproliferative neoplasms.

[0074] Preferably, the cancer is selected from the group consisting of colorectal cancer, breast cancer, pancreatic cancer, skin cancer, and endometrial cancer. More preferably, the cancer is melanoma.

[0075] In another embodiment of this model, the method further comprises administering to a target at least one additional therapeutic agent effective in treating or improving the action of cancer. The additional therapeutic agent can be selected from the group consisting of antibodies or fragments thereof, cytotoxic agents, toxins, radionuclides, immunomodulators, phototherapeutic agents, radiosensitizers, hormones, anti-angiogenic agents, and combinations thereof.

[0076] As used herein, “antibody” includes naturally occurring and non-naturally occurring immunoglobulins, such as single-chain antibodies, chimeric antibodies (e.g., humanized mouse antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Antibody fragments include those that bind to antigens (e.g., Fab', F(ab')2, Fab, Fv, and rIgG). See also, for example, Pierce Catalog and Handbook, 1994–1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd edition, WH Freeman & Co., New York (1998). The term “antibody” also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term “antibody” further includes polyclonal and monoclonal antibodies.

[0077] Examples of therapeutic antibodies that can be used in the present invention include rituximab (Rituxan), cetuximab (Erbitux), bevacizumab (Avastin), and ibritumomab (Zevalin).

[0078] The cytotoxic agents according to the present invention include DNA damaging agents, antimetabolites, antimicrotubule agents, antibiotics, and the like. DNA damaging agents include alkylating agents, platinum-based drugs, inserts, and DNA replication inhibitors. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechloretamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of platinum-based drugs include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of inserts include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-exclusive examples of DNA replication inhibitors include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimetabolites include folate antagonists, e.g., methotrexate and premetrexed; purine antagonists, e.g., 6-mercaptopurine, dacarbazine, and fludarabine; and pyrimidine antagonists, e.g., 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimicrotubule agents include, but are not limited to, vinca alkaloids, paclitaxel (Taxol®), docetaxel (Taxotere®), and ixabepyrone (Ixempra®). Antibiotics include, but are not limited to, actinomycin, anthracyclines, barrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.

[0079] The cytotoxic agents according to the present invention also include inhibitors of the PI3K / Akt pathway. Non-exclusive examples of PI3K / Akt pathway inhibitors include A-674563 (CAS#552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidinedione-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidinedione-2,4-dione), AS-605240 (5-quinoxylin-6-methylene-1,3-thiazolidinedione-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole derivatives, and Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS#32387-96-5), CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98 510-80-6, CCT128930(CAS#885499-61-6), CH5132799(CAS#1007207-67-1), CHR-4432(Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124 (CAS#902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS#937174-76-0), H-89 (CAS#127243-85-0), Founokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS#108068-98-0), Miltefosine, MK-2206 Hydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), Naltrindol Hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), Perifosine, PHT-427 (CAS#1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.)), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway. Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore This includes pharmaceuticals (Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), trisirivine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), and pharmaceutically acceptable salts and combinations thereof.

[0080] In this invention, the term "toxin" means an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or a part thereof.

[0081] In this invention, the term "radionic nuclide" means a radioactive substance administered to a patient, for example, intravenously or orally, which then penetrates into a target organ or tissue through the patient's normal metabolism, where it delivers local radiation for a short period of time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.

[0082] In this invention, the term “immunomodulator” means a substance that modifies the immune response by enhancing or reducing the immune system’s ability to recognize antigens that initiate their production and to produce antibodies or sensitized cells that react with them. Immunomodulators may be recombinant, synthetic, or naturally occurring preparations and include cytokines, corticosteroids, cytotoxic agents, thymosin, and immunoglobulins. Some immunomodulators are naturally occurring in the body, and some of these are available in the form of pharmacological preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), interferons, imiquimod, and cell membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, and synthetic cytosine phosphate-guanosine (CpG).

[0083] In this invention, the term “photoactive therapeutic agent” means a compound or composition that becomes active after exposure. Certain examples of photoactive therapeutic agents are disclosed, for example, in U.S. Patent Application Publication No. 2011 / 0152230A1, “Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy.”

[0084] In this invention, the term "radiosensitizer" refers to a compound that makes tumor cells more sensitive to radiotherapy. Examples of radiosensitizers include misonidazole, metronidazole, tirapazamine, and transcrocetin sodium.

[0085] In this invention, the term "hormone" means a substance released by cells in one part of the body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclins, thromboxanes, amylin, anti-Müllerian hormones, adiponectin, corticosteroids, angiotensinogen, angiotensin, vasopressin, atriopeptin, sodium excretion-increasing peptides, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicular-stimulating hormone, galanin, gastrin, ghrelin, glucagon, and gonadotropins. Prolactin-releasing hormone, prolactin-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrone It contains sterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.

[0086] Some compounds interfere with the activity of certain hormones or inhibit the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds also fall within the scope of the meaning of hormone as used in this invention.

[0087] As used herein, “anti-angiogenic” agents mean substances that reduce or inhibit the proliferation of new blood vessels, such as inhibitors of vascular endothelial growth factor (VEGF) and inhibitors of endothelial cell migration. Anti-angiogenic agents include, but are not limited to, 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitor, endostatin, IFN-α, IL-12, itraconazole, linamide, platelet factor-4, prolactin, SU5416, suramin, tascinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospongin, thrombospongin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs and combinations thereof.

[0088] Another embodiment of the present invention is a method for treating cancer or improving its effect in a subject. This method is (a) Identify subjects with cancer that has become antitherapy-resistant or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or BRAF and MEK inhibitor therapy; (b) administering an effective dose of BVD-523 or a pharmaceutically acceptable salt thereof, which is an ERK inhibitor, to subjects with the anti-treatment-resistant cancer. Includes.

[0089] Suitable and preferred subjects are as disclosed herein. In this embodiment, the method can be used to treat the cancers disclosed above. According to the present invention, cancers may have MAPK activity.

[0090] In one aspect of this embodiment, identifying subjects with cancer that is antitherapy-resistant or resistant to BRAF and / or MEK inhibitor therapy is (a) Obtaining biological samples from the subject, (b) Screening samples to determine whether the subject has become resistant to an inhibitor therapy selected from the group consisting of BRAF inhibitor therapy, MEK inhibitor therapy, and combination thereof. Includes.

[0091] In this invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from the subject by routine procedures and methods known in the art.

[0092] Preferably, screening for cancers that are antitherapy-resistant or resistant to BRAF inhibitor therapy may include, for example, identifying (i) switches between RAF isoforms, (ii) upregulation of RTK or NRAS signaling, (iii) reactivation of mitogenic factor-activated protein kinase (MAPK) signaling, (iv) the presence of MEK-activating mutations, and combinations thereof.

[0093] Switching between RAF isoforms can occur in subjects with acquired resistance to BRAF inhibitor therapy. To detect such switches, BRAF inhibitor-resistant tumor cells can be isolated from patients and analyzed for ERK and phosphoERK levels via Western blotting in the presence of the BRAF inhibitor. Comparison with BRAF inhibitor-sensitive cells treated with the BRAF inhibitor may reveal higher levels of phosphoERK in BRAF inhibitor-resistant tumor cells, suggesting that a switch has occurred in which another RAF isoform phosphorylates ERK instead of BRAF. Confirmation of which RAF isoform occurred may include individual sh / siRNA-mediated knockdown of ARAF and CRAF in BRAF inhibitor-resistant cells exposed to the BRAF inhibitor, followed by subsequent Western blotting for ERK and phosphoERK levels. For example, if ARAF knockdown in BRAF inhibitor-resistant cells exposed to the BRAF inhibitor still results in high levels of phosphoERK, it would indicate that CRAF has taken over the phosphorylation of ERK. Similarly, if CRAF is knocked down in BRAF inhibitor-resistant cells exposed to a BRAF inhibitor, and ERK remains highly phosphorylated, it would mean that ARAF has taken over ERK phosphorylation. RAF isoform switching can also involve the simultaneous knockdown of ARAF and CRAF in BRAF inhibitor-resistant cells in the presence of a BRAF inhibitor, effectively blocking all RAF-mediated phosphorylation. The resulting decrease in ERK phosphorylation would indicate that BRAF inhibitor-resistant cells have the ability to switch between RAF isoforms to phosphorylate ERK (Villanueva et al., 2010).

[0094] Upregulation of RTK or NRAS signaling can also be a cause of BRAF inhibitor resistance. Detection may first involve using a Western blotting protocol with phospho-specific antibodies to analyze, for example, the activation of downstream RAF effectors MEK1 / 2 and ERK1 / 2. If BRAF inhibitor-resistant cells show high activation levels of these proteins in the presence of a BRAF inhibitor, then upregulation of RTK or NRAS may be the cause. Gene expression profiling (or other related methods) of BRAF inhibitor-resistant cells in the presence of a BRAF inhibitor can reveal higher expression levels of KIT, MET, EGFR, and PDGFRβ RTKs compared to BRAF inhibitor-sensitive cells. Real-time quantitative polymerase chain reaction experiments or other similar methods focusing on any of these genes can confirm higher expression levels, while phospho RTK arrays (R&D Systems, Minneapolis, MN) can show tyrosine phosphorylation associated with high activation. Alternatively, NRAS activation can be detected by various gene sequencing protocols. Activating mutations in NRAS, particularly Q61K, may indicate a bypass of B-RAF signaling. In melanoma cells, activated NRAS uses C-RAF to signal MEK-ERK. Therefore, activated NRAS may enable a similar bypass pathway in BRAF inhibitor-resistant cells exposed to BRAF inhibitors. Further confirmation of these mechanisms in a given BRAF inhibitor-resistant sample can be achieved, for example, by using sh / siRNA-mediated knockdown of upregulated RTK or activated NRAS in the presence of a BRAF inhibitor. Any significant level of proliferation inhibition may indicate that upregulation of RTK or NRAS signaling is responsible for BRAF inhibition in that particular sample (Nazarian et al., 2010).

[0095] Detecting reactivation of MAPK signaling in BRAF inhibitor-resistant cells may indicate another bypass mechanism for BRAF inhibitor resistance. COT and C-RAF have been shown to be upregulated in a BRAF V600E background exposed to BRAF inhibitors. For example, quantitative real-time RT-PCR can reveal increased COT expression in BRAF inhibitor-resistant cells in the presence of BRAF inhibitors. Furthermore, sh / siRNA-mediated knockdown of COT in BRAF inhibitor-resistant cells in the presence of BRAF inhibitors can reduce the viability of BRAF inhibitor-resistant cells, suggesting that these specific cells may be sensitive to treatment with COT inhibition and / or combined BRAF inhibitor / MEK inhibitors (Johannessen et al.). , 2010).

[0096] Reactivation of MAPK signaling can also be achieved in a BRAF inhibitor-resistant background by activating mutations in MEK1. Targeted large-scale parallel sequencing of genomic DNA from BRAF inhibitor-resistant tumors can reveal activating mutations in MEK1, e.g., C121S, G128D, N122D, and Y130. Other unreported mutations in MEK1 can be analyzed by expressing specific mutations in BRAF inhibitor-sensitive cell lines, such as A375. Determining the level of growth inhibition in these cells after exposure to BRAF inhibitors can indicate whether MEK1 mutations cause resistance to BRAF inhibitory therapy. To confirm such findings, Western blotting of elevated levels of phospho-ERK1 / 2 in cells ectopically expressing MEK1 mutations can show that MEK1 mutations enable BRAF-resistant tumors to bypass BRAF and promote ERK phosphorylation through MEK1 (Wagle et al., 2011).

[0097] The present invention allows for screening for cancers that are antitherapy-resistant or resistant to MEK inhibitor therapy, which may include, for example, identifying (i) amplification of mutant BRAF, (ii) upregulation of STAT3, (iii) mutations in the allosteric pocket of MEK that directly block the binding of the inhibitor to MEK or lead to constitutive MEK activity, or combinations thereof.

[0098] Amplification of mutant BRAF can induce MEK inhibitor resistance. MEK inhibitor resistance is generally associated with high levels of phosphorylated ERK and MEK in the presence of MEK inhibitors, which can be assessed, for example, through Western blotting. Amplification of mutant BRAF in MEK inhibitor-resistant cell lines can be detected, for example, by fluorescence in situ hybridization (FISH) or quantitative PCR from the genomic DNA of resistant cell lines. Confirmation that BRAF amplification is the primary cause of MEK inhibitor resistance may require the use of BRAF-targeted sh / siRNA in resistant cells. If a significant decrease in MEK or ERK phosphorylation is observed, BRAF amplification may be a suitable target for further therapeutic approaches (Corcoran et al., 2010).

[0099] Identifying STAT3 upregulation can indicate that certain tumor samples are resistant to MEK inhibitor therapy. Genome-wide expression profiling can reveal that the STAT3 pathway is upregulated in tumors. Other techniques, such as Western blotting for phosphoSTAT3 and real-time qPCR for STAT pathway-related genes JAK1 and IL6ST, can reveal upregulated STAT3. Further confirmation that STAT3 upregulation causes MEK inhibitor resistance in specific samples may include the use of sh / siRNA against STAT3 in the sample, followed by activation of MEK and ERK, as well as appropriate Western blotting for phosphoSTAT3 and whole STAT3. Growth inhibition studies may show that STAT3 knockdown makes previously MEK inhibitor-resistant cells sensitive to MEK inhibition. Similar effects can be observed when samples are exposed to STAT3 inhibitors such as JSI-124. Further confirmation that STAT3 upregulation is responsible for MEK inhibitor resistance in specific tumors may arise from Western blotting for BIM expression, including BIM-EL, BIM-L, and BIM-SL. BIM expression leads to MEK inhibitor-induced apoptosis; thus, STAT3 upregulation can reduce BIM levels. STAT3 is known to regulate the expression of miR 17-92, which suppresses BIM expression. Upregulated STAT3 may lead to higher levels of miR 17-92, which reduces BIM levels and promotes resistance to MEK inhibition. Therefore, real-time qPCR of miR 17-92 levels can also help assess whether STAT3 upregulation is causing MEK inhibition resistance in specific samples (Dai et al., 2011).

[0100] Mutations in the allosteric pocket of MEK that can directly block inhibitor binding to MEK or lead to constitutive MEK activity can be detected by the method disclosed below. Such mutations were identified by Emery and colleagues (Emery et al., 2009). (2011) and previously identified by Wang and colleagues (Wang et al., 2011). Other mutations can affect MEK1 codons located within or adjacent to the N-terminal negative regulatory helix, such as P124L and Q56P (ibid.).

[0101] Methods for identifying mutations in nucleic acids, such as the MEK gene identified above, are known in the art. Nucleic acids can be obtained from biological samples. In this invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsies. Biological samples are obtained from subjects by routine procedures and methods known in the art.

[0102] Non-exclusive examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probes, fluorescent in situ hybridization (FISH) assays, and combinations thereof.

[0103] Various sequencing methods are known in the art. These include, but are not limited to, Sanger sequencing (also known as dideoxy sequencing) and, for example, Metzker, 2005. Deep sequencing techniques include various synthetic sequencing (SBS) methods as disclosed, hybridization, ligation (e.g., WO2005021786), degradation (e.g., U.S. Patents 5,622,824 and 6,140,053), and nanopore sequencing (commercially available from Oxford Nanopore Technologies, UK). In deep sequencing techniques, a given nucleotide in the sequence is read two or more times during the sequencing process. Deep sequencing techniques are disclosed, for example, in U.S. Patent Publication No. 20120264632 and International Patent Publication No. WO2012125848.

[0104] PCR-based methods for detecting mutations are well known in the art, employing PCR amplification, where each target sequence in the sample has a corresponding pair of unique, sequence-specific primers. For example, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows for rapid detection of mutations after the genome sequence has been amplified by PCR. Mutations are identified by digestion with specific restriction endonucleases and then identified by electrophoresis. See, for example, Ota et al., 2007. Mutations are detected in real time. Detection can also be performed using PCR. See, for example, International Patent Publication No. WO2012046981.

[0105] Hybrid capture methods are known in the art and are disclosed, for example, in U.S. Patent Application Publication No. 20130203632 and U.S. Patents Nos. 8,389,219 and 8,288,520. These methods are based on the selective hybridization of a target genomic region to user-designed oligonucleotides. Hybridization may be to oligonucleotides immobilized on high or low density microarrays (capture on arrays) or to solution-phase hybridization to oligonucleotides modified with a ligand (e.g., biotin) that can then be immobilized on a solid surface such as beads (capture in solution).

[0106] Molecular inversion probe (MIP) technology is well known in the art, for example, Absalan et al., 2 This method was disclosed in 2008. This method uses the MIP molecule, which is a special "padlock" probe for gene typing (Nilsson et al., 1994). MIP molecules are linear oligonucleotides containing specific regions, general-purpose sequences, restriction sites, and tag (indicator) sequences (16-22 bp). MIPs hybridize directly around the target gene marker / SNP. The MIP method can also use a set of several "padlock" probes that hybridize into genomic DNA in parallel (Hardenbol et al., 2003). In the case of a perfect match, reversal of position (as suggested by the name of the technique) is performed. Genomic homology regions are ligated by forming a circular molecule (as described above). After the first restriction treatment, all molecules are amplified with general-purpose primers. To reserve short fragments for hybridization on the microarray, the amplicons are restricted again. The generated short fragments are labeled and hybridized through the Tag sequence to the cTag (complementary strand for indicator) on the array. After the formation of the Tag-cTag double helix, the signal is detected.

[0107] Tables 1, 2, and 3 below show the sequence numbers of representative nucleic acids and amino acid sequences of wild-type BRAF, N-RAS, and MEK1 from various animals in the sequence listing. These sequences can be used in methods to identify subjects with mutant BRAF, N-RAS, and MEK1 genotypes. [Table 1-1] [Table 1-2] [Table 2] [Table 3]

[0108] In another embodiment of this model, the method further comprises administering at least one further therapeutic agent disclosed herein, preferably an inhibitor of the PI3K / Akt pathway.

[0109] Further embodiments of the present invention are methods for treating or improving the action of cancers in a subject that are antitherapy-resistant or resistant to BRAF inhibitor therapy, MEK inhibitor therapy, or both. The method comprises administering an effective dose of BVD-523 or a pharmaceutically acceptable salt thereof to the subject.

[0110] Suitable and preferred subjects are as disclosed herein. In this embodiment, the method can be used to treat cancers disclosed above, including cancers having the mutation background, resistance profile, and MAPK activity identified above. Methods for identifying such mutations are also shown above.

[0111] In a further embodiment of this model, the method further includes administering at least one further therapeutic agent disclosed herein, preferably an inhibitor of the PI3K / Akt pathway.

[0112] Another embodiment of the present invention is a method for identifying cancer subjects that would benefit from therapy with ERK inhibitors. This method is (a) Obtaining biological samples from the subject, (b) The target is the following marker: (i) Switch between RAF isoforms, (ii) Upregulation of RTK or NRAS signaling, (iii) Reactivation of mitogenic factor-activated protein kinase (MAPK) signaling, (iv) Presence of MEK activating mutations, (v) Amplification of mutant BRAF, (vi) STAT3 upward control, (vii) Mutations in the allosteric pocket of MEK that directly block the binding of inhibitors to MEK or lead to constitutive MEK activity, To screen a sample to determine whether it has one or more of the following: comprising, wherein the presence of one or more of the markers confirms that the cancer of the subject is resistant or refractory to BRAF and / or MEK inhibitor therapy and that the subject would benefit from therapy with an ERK inhibitor that is BVD-523 or a pharmaceutically acceptable salt thereof.

[0113] Suitable, preferred subjects are as disclosed herein. In this embodiment, the method can be used to identify subjects having a cancer as disclosed above, including cancers having the mutation background, resistance profile and MAPK activity identified above. Methods of identifying such mutations are also as shown above.

[0114] In one aspect of this embodiment, the method further comprises administering BVD-523 or a pharmaceutically acceptable salt thereof to a subject having one or more of the markers. Preferably, the method further comprises administering to a subject having one or more of the markers at least one additional therapeutic agent as disclosed herein, preferably an inhibitor of the PI3K / Akt pathway.

[0115] A further embodiment of the invention is a pharmaceutical composition for treating or ameliorating the effects of a cancer in a subject that is resistant or refractory to non-ERK MAPK pathway therapy. The composition comprises a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0116] Suitable, preferred subjects and types of non-ERK MAPK pathway inhibitor therapies are as disclosed herein. In this embodiment, the pharmaceutical composition can be used to treat a cancer as disclosed above, including cancers having the mutation background, resistance profile and MAPK activity identified above. Methods of identifying such mutations are also as shown above.

[0117] In one aspect of this embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent disclosed herein, preferably an inhibitor of the PI3K / Akt pathway.

[0118] Another embodiment of the invention is a kit for treating or improving the action of cancers that are resistant or refractory to non-ERK MAPK pathway therapies in a subject. The kit comprises any pharmaceutical composition according to the invention, in a form packaged together with its instructions for use.

[0119] The kit can also include storage containers suitable for each pharmaceutical composition and other reagents, such as buffers, balanced salt solutions, etc., for use in administering the pharmaceutical composition to a subject, for example, ampoules, vials, tubes, etc. The pharmaceutical composition and other reagents can be present in the kit in any convenient form, for example, in solution form or powder form. The kit can further include a packaging container optionally having one or more compartments for housing the pharmaceutical composition and other optional reagents.

[0120] Suitable, preferred subjects and types of non-ERK MAPK pathway inhibitor therapies are as disclosed herein. In this embodiment, the kit can be used to treat the cancers disclosed above, including cancers having the mutation backgrounds, resistance profiles and MAPK activities identified herein. Methods for identifying such mutations are as shown above.

[0121] In one aspect of this embodiment, the kit further comprises at least one additional therapeutic agent disclosed herein, preferably an inhibitor of the PI3K / Akt pathway.

[0122] Another embodiment of the present invention is a method for inhibiting RSK phosphorylation in cancer cells that are antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitors. The method comprises contacting cancer cells with an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof for a time sufficient to inhibit RSK phosphorylation in the cancer cells. In this embodiment, “contacting” means bringing BVD-523 or a pharmaceutically acceptable salt thereof, and optionally one or more further therapeutic agents, into close proximity to the cancer cells. This can be achieved using conventional techniques for drug delivery to mammals, or in an in vitro setting by, for example, providing BVD-523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to a culture medium in which the cancer cells are located. In an ex vivo setting, contacting can be performed by, for example, providing BVD-523 or a pharmaceutically acceptable salt thereof and optionally other therapeutic agents to cancer tissue.

[0123] Suitable and preferred types of non-ERK MAPK pathway inhibitors are disclosed herein. In this embodiment, cancer cell death can be achieved in cancer cells having the various mutation backgrounds, resistance profiles, and MAPK activities disclosed above. Methods for identifying such mutations are also shown above.

[0124] The methods of this embodiment, which can be performed in vitro, ex vivo, or in vivo, can be used, for example, to perform cancer cell death by killing cancer cells in the cancer types disclosed herein.

[0125] In one aspect of this embodiment, more than 50% of RSK phosphorylation is inhibited. In another aspect of this embodiment, more than 75% of RSK phosphorylation is inhibited. In yet another aspect of this embodiment, more than 90% of RSK phosphorylation is inhibited. In yet another aspect of this embodiment, more than 95% of RSK phosphorylation is inhibited. In yet another aspect of this embodiment, more than 99% of RSK phosphorylation is inhibited. In yet another aspect of this embodiment, 100% of RSK phosphorylation is inhibited.

[0126] In a further embodiment of this design, the cancer cells are mammalian cancer cells. Preferably, the mammalian cancer cells are obtained from mammals selected from the group consisting of humans, primates, farm animals, and livestock. More preferably, the mammalian cancer cells are human cancer cells.

[0127] In a further embodiment of this design, the contact step includes administering BVD-523 or a pharmaceutically acceptable salt to the subject obtained with cancer cells.

[0128] In the present invention, the “effective amount” or “therapeutic effective amount” of a compound or composition disclosed herein is the amount of such compound or composition that is sufficient to achieve the beneficial or desired result described herein when administered to a subject. Effective dosage forms, modes of administration and dosages can be determined empirically, and such determinations are within the scope of the art. It will be understood by those skilled in the art that dosages vary depending on the route of administration, excretion rate, duration of treatment, any other drugs administered, the mammal, e.g., the age, size and species of the human patient, and similar factors well known in the art of pharmaceuticals and veterinary medicines. Generally, a suitable dose of a compound or composition according to the present invention is the amount of composition that is the minimum effective dose to produce the desired effect. Effective doses of the compounds or compositions of the present invention may be administered as 2, 3, 4, 5, 6 or more lower doses, administered separately at appropriate intervals throughout the day.

[0129] Suitable, non-limiting examples of dosages for BVD-523 and other anticancer agents disclosed herein are approximately 1 mg / kg to approximately 2400 mg / kg per day, for example, approximately 1 mg / kg to approximately 1200 mg / kg per day, and approximately 75 mg / kg to approximately 300 mg / kg per day, for example, approximately 1 mg / kg to approximately 100 mg / kg per day. Other typical dosages of such drugs include approximately 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, and 30 mg / kg per day. This includes 0 mg / kg, 400 mg / kg, 500 mg / kg, 600 mg / kg, 700 mg / kg, 800 mg / kg, 900 mg / kg, 1000 mg / kg, 1100 mg / kg, 1200 mg / kg, 1300 mg / kg, 1400 mg / kg, 1500 mg / kg, 1600 mg / kg, 1700 mg / kg, 1800 mg / kg, 1900 mg / kg, 2000 mg / kg, 2100 mg / kg, 2200 mg / kg, and 2300 mg / kg. The effective doses of BVD-523 and other anticancer agents disclosed herein may be administered as 2, 3, 4, 5, 6 or more lower doses, administered separately at appropriate intervals throughout the day.

[0130] BVD-523, other inhibitors, and various other anticancer agents, or the pharmaceutical compositions of the present invention, as disclosed herein, may be administered orally, or as ointments or drops for topical administration to the eyes, or in any suitable way, such as parenteral or other administration by intraperitoneal, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intra-arterial, subarachnoid, or intralymphatic. Furthermore, BVD-523, other inhibitors, and various other anticancer agents, or the pharmaceutical compositions of the present invention, as disclosed herein, may be administered in combination with other therapeutic agents. BVD-523, other inhibitors, and various other anticancer agents, or the pharmaceutical compositions of the present invention, as disclosed herein, may be encapsulated or otherwise protected from stomach or other secretions, as desired.

[0131] The pharmaceutical compositions of the present invention comprise one or more active ingredients in the form of a mixture with one or more pharmaceutically acceptable diluents or carriers, and optionally with one or more other compounds, drugs, components and / or materials. Regardless of the selected route of administration, the drugs / compounds of the present invention are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. For example, Remington, The Science and Practice of Pharmacy (Ph. See 21st edition, Lippincott Williams and Wilkins, Philadelphia, PA.

[0132] Pharmacopoecially acceptable diluents or carriers are well known in the art (e.g., Remington, The Science and Practice of Pharmacy (21st edition, Lippincott Williams and See Wilkins, Philadelphia, PA, and The National Formulary (American Pharmaceutical Association, Washington, DC), for example, sugars (e.g., lacto This includes sucrose, mannitol, and sorbitol, starch, cellulose preparations, calcium phosphate (e.g., dicalcium phosphate, tricalcium phosphate, and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline solution, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's solution), alcohols (e.g., ethyl alcohol, propyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and triglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoester), and poly(anhydrous)), elastomer matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and peanut), cocoa butter, waxes (e.g., suppository wax), paraffin, silicone, talc, salicylate, etc. Each of the pharmaceutically acceptable diluents or carriers used in the pharmaceutical compositions of the present invention must be “acceptable” in the sense that they are compatible with the other components of the formulation and are not harmful to the subject. Suitable diluents or carriers for the selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for the selected dosage form and method of administration can be determined using the ordinary art of the art.

[0133] The pharmaceutical composition of the present invention may optionally contain further components and / or materials commonly used in pharmaceutical compositions. These components and materials are well known in the art and include: (1) fillers or fillers, e.g., starch, lactose, sucrose, glucose, mannitol and silicic acid; (2) binders, e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose and gum arabic; (3) humectants, e.g., glycerol; (4) disintegrants, e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethylcellulose and sodium carbonate; (5) dissolution mitigants, e.g., paraffin; (6) absorption enhancers, e.g., quaternary ammonium compounds; (7) wetting agents, e.g., cetyl alcohol and glycerol monostearate; (8) absorbents, e.g., kaolin and bentonite clay; (9) lubricants, e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycol and sodium lauryl sulfate; (10) suspension (11) Buffering agents, e.g., ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methhydroxyl, bentonite, agar and tragacanth; (12) Excipients, e.g., lactose, polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc, salicylates (13) Zinc oxide, aluminum hydroxide, calcium silicate and polyamide powders; (14) Inert diluents, e.g., water or other solvents; (15) Preservatives; (16) Surfactants; (17) Dispersants; (18) Controlled release or absorption retarders, e.g., hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin and waxes; (19) Emulsifying agents; (20) Adjuvants; (21) Wetting agents; (22) Emulsifying and suspending agents;(22) Solubilizers and emulsifiers, e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzylbenzoic acid, propylene glycol, 1,3-butylene glycol, oils (especially cottonseed, peanut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan; (23) Propellant, e.g., chlorofluoro hydrocarbons and volatile unsubstituted hydrocarbons, e.g., butane and propane; (24) Antioxidants; (25) Agents to make the preparation isotonic with the blood of the intended recipient, e.g., sugars and sodium chloride; (26) Thickeners; (27) Coating materials, e.g., lecithin; and (28) Sweeteners, flavors, colorants, fragrances and preservatives. Each of such components or materials must be “acceptable” in the sense that it is compatible with the other components of the preparation and is not harmful to the subject. Suitable ingredients and materials for the selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for the selected dosage form and method of administration can be determined using the ordinary art of the art.

[0134] The pharmaceutical compositions of the present invention, suitable for oral administration, may be in the form of capsules, cachets, pills, tablets, powders, granules, solutions or suspensions in aqueous or non-aqueous liquids, emulsions in oil-in-water or water-in-oil liquids, elixirs or syrups, lozenges, boluses, licks or pastes. These formulations can be prepared by methods known in the art, for example, by conventional general coating, mixing, granulation or freeze-drying processes.

[0135] Solid dosage forms for oral administration (capsules, tablets, pills, sugar-coated preparations, powders, granules, etc.) can be prepared, for example, by mixing the active ingredient(s) with one or more pharmaceutically acceptable diluents or carriers, and optionally with one or more fillers, bulking agents, binders, humectants, disintegrants, dissolution mitigants, absorption enhancers, wetting agents, absorbents, lubricants, and / or colorants. Similar types of solid compositions can be used as fillers in soft and hard-filled gelatin capsules using suitable excipients. Tablets can be prepared by compression or molding, optionally with one or more adjuncts. Compressed tablets can be prepared using suitable binders, lubricants, inert diluents, preservatives, disintegrants, surface-active or dispersing agents. Molded tablets can be prepared by molding using suitable machinery. Tablets and other solid dosage forms, such as sugar-coated tablets, capsules, pills, and granules, may optionally be perforated or prepared with coatings and shells, such as enteric coatings and other coatings, which are well known in the pharmaceutical field. They may also be formulated to provide sustained-release or controlled release of the active ingredient therein. They may be sterilized, for example, by filtration through a bacterial-retaining filter. These compositions may optionally contain opacifiers, and may be composed such that they optionally release the active ingredient only to, or preferentially to, a specific portion of the intestinal tract, in a delayed manner. The active ingredient may be in the form of microcapsules.

[0136] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. Liquid dosage forms may contain suitable inert diluents commonly used in the art. In addition to inert diluents, oral compositions may also contain adjuvants such as humectants, emulsifiers, and suspending agents, as well as sweeteners, flavorings, colorants, fragrances, and preservatives. Suspensions may contain suspending agents.

[0137] The pharmaceutical composition of the present invention for rectal or vaginal administration can be provided as a suppository, which can be prepared by mixing one or more active ingredient(s) with one or more suitable non-irritating diluents or carriers that are solid at room temperature but liquid at body temperature and thus melt in the rectal or vaginal cavity to release the active compound. The pharmaceutical compositions of the present invention suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such pharmaceutically acceptable diluents or carriers as are known in the art to be suitable.

[0138] Dosage forms for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants. The active agent(s) / compound(s) can be mixed with suitable pharmaceutically acceptable diluents or carriers under aseptic conditions. Ointments, pastes, creams and gels can contain excipients. Powders and sprays can contain excipients and propellants.

[0139] The pharmaceutical compositions of the present invention suitable for parenteral administration can include one or more drug(s) / compound(s) in the form of a combination with a sterile powder that can be reconstituted in a sterile injectable solution or dispersion containing one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions or, at the time of use, can contain suitable antioxidants, buffers, solutes to render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. For example, by the use of coating materials, in the case of dispersions by maintaining the desired particle size, and by the use of surfactants, appropriate fluidity can be maintained. These pharmaceutical compositions can also contain suitable adjuvants such as wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents. Furthermore, by the inclusion of agents that delay absorption, prolonged absorption of injectable pharmaceutical dosage forms can be achieved.

[0140] In some cases, it is desirable to slow down the absorption of a drug (e.g., a pharmaceutical preparation) from subcutaneous or intramuscular injection in order to prolong its effects. This can be achieved by using a liquid suspension of crystalline or amorphous materials with low water solubility.

[0141] The absorption rate of an active ingredient / drug depends, then, on its dissolution rate, which may then depend on the size and crystalline form of the crystals. Alternatively, delayed absorption of parenterally administered drugs / drugs can be achieved by dissolving or suspending the active ingredient / drug in an oil vehicle. Injectable depot formulations can be prepared by forming a microcapsule matrix of the active ingredient in a biodegradable polymer. The release rate of the active ingredient can be controlled by the ratio of the active ingredient to the polymer and the properties of the specific polymer used. Depot injection formulations are also prepared by incorporating the drug into liposomes or microemulsions that conform to body tissues. Injectable materials can be sterilized, for example, by filtration through a bacterial-retaining filter.

[0142] The formulations can be supplied in unit dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a lyophilized state, requiring only the addition of a sterile liquid diluent or carrier, such as sterile water for injection, immediately before use. Ready-to-use injectable solutions and suspensions can be prepared from the sterile powders, granules, and tablets of the above types.

[0143] This invention discloses combinations that have been shown to provide treatment for cancers that are antitherapy-resistant or resistant to non-ERK MAPK pathway inhibitor therapies and to enhance the effects of ERK inhibitors. In this specification, the applicant has also shown that combinations of different ERK inhibitors are similarly synergistic. Therefore, it is believed that the effects of the combinations described herein can be further enhanced by the use of one or more additional ERK inhibitors. Accordingly, some embodiments of the invention include one or more additional ERK inhibitors.

[0144] The present invention also provides a method for treating a subject having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising administering BVD-523 or a pharmaceutically acceptable salt thereof to the subject at 600 mg BID.

[0145] In some embodiments of the present invention, the mutation is BRAF V600E It is a mutation.

[0146] The present invention also provides compositions for treating subjects having unresectable or metastatic BRAF600 mutation-positive melanoma, comprising 600 mg of BVD-523 or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable carrier, adjuvant, or vehicle.

[0147] To further illustrate the method of the present invention, the following embodiments are provided. These embodiments are illustrative only and are not intended to limit the scope of the present invention. [Examples]

[0148] (Example 1) material and method Cancer cell lines were maintained in cell cultures under standard medium and serum conditions. For dose escalation studies, A375 cells were divided, grown to approximately 40–60% density, and then treated with the initial dose of the specified drug. Table 4 summarizes the treatment with the escalated drugs. [Table 4]

[0149] A monotherapy dose escalation was performed based on Little et al. (2011) and outlined in Figure 20. Cells were then grown to 70-90% density and divided. The division ratio was kept as close to "standard" as possible and reasonably consistent between treatments (e.g., at least 50% of the parent's standard division ratio). The culture medium was replaced every 3-4 days. Once the cells again reached approximately 40-60% density, the dose was escalated. If the 40-60% window was missed, the cells were divided again, and the drug was administered once they reached 40-60% density. The culture medium was again replaced every 3-4 days. The process was repeated as needed (Figure 20).

[0150] For monotherapy, estimate the increase in starting concentration and dose. 50 Starting from [a certain dose], the dose was gradually or gently increased. For the first 4-5 doses, the dose was doubled, for the next 4 doses, the dose was increased by the same increment, and then for subsequent doses, the concentration was increased by 1.5 times.

[0151] Regarding combination treatments, the starting concentration and dose increase of each compound are estimated by the IC 50 Starting at half the dose (combination assays suggest this results in an inhibitory range of approximately 40–70%), the dose was escalated similarly to that of a monotherapy (i.e., the first doubling was administered, then the next four doses were increased by the same increment, and then progressed to a 1.5-fold increase in concentration). Table 5 shows the planned dose increases using these schemes. [Table 5]

[0152] Clonal resistant cell populations were obtained from pooled resistant cells obtained by limiting dilution.

[0153] Growth assays were used to track changes in sensitivity to escalating drug(s) at appropriate time intervals (e.g., monthly, but timing depended on the available number of cells). For the growth assays, cells were seeded at 3000 cells per well in 96-well plates in drug-free DMEM medium containing 10% FBS, allowed to adhere overnight, and then the compound or vehicle control was added. The compounds were prepared from DMSO stock, resulting in the final concentration ranges shown in Figures 2A–2H. The final DMSO concentration was kept constant at 0.1%. The test compounds were incubated with cells at 37°C in a 5% CO2 humidified atmosphere for 96 hours. Then, Alamar Blue 10% (v / v) was added and incubated for 4 hours, and the fluorescence product was detected using a BMG FLUOstar plate reader. The mean background value of the medium only was subtracted, and the data were analyzed using a 4-parameter logistic equation in GraphPad Prism. Paclitaxel was used as a positive control.

[0154] A growth assay for the first month was initiated on day 28 using cells that were growing at the concentrations of each drug shown in Table 6. [Table 6]

[0155] A growth assay for the second month was initiated on day 56 using cells that were growing at the concentrations of each drug shown in Table 7. [Table 7]

[0156] At the end of the 3-month dose escalation period, the cultures were maintained at the highest concentration for 2 weeks, followed by the final round of proliferation assays and potential single-cell cloning. Since the proliferation assays / single-cell cloning require actively growing cells, backup cultures were also maintained at lower concentrations for treatments in which cells grew very slowly at the highest concentration, or for treatments that had been most recently dose escalated (Table 8). For BVD-523 treatments, cultures were maintained at lower concentrations for 2 weeks if the cells appeared to have almost completely stopped growing, and were particularly fragile at the highest concentration (1.8 μM). [Table 8]

[0157] For the growth assay at 3 months, cells growing at the concentrations of each drug shown in Table 9 were used. [Table 9]

[0158] For combination testing, A375 cells (ATCC) were seeded in a triple-sequence 96-well plate in DMEM + 10% FBS at a cell density of 3000 cells per well. After overnight adhesion, the test compound or vehicle control was added. Combinations were tested using a 10×8 dose matrix with a final DMSO concentration of 0.2%. After a 96-hour assay incubation period, Alamar Blue 10% (v / v) was added and incubated for 4 hours, followed by reading with a fluorescence plate reader. After reading the Blue marker, the medium / Alamar Blue mixture was wiped off, 100 μl of CellTiter-Glo / PBS (1:1) was added, and the plate was processed according to the manufacturer's instructions (Promega). After subtracting the background value of the medium only, the data was analyzed. Subsequently, the Bliss additive model was applied.

[0159] Simply put, the predicted inhibition fraction value for a combination of inhibitions is given by equation Cbliss The formula was calculated using =A+B-(A×B) (where A and B are the inhibition fractions obtained at specific concentrations for drug A alone or drug B alone). bliss This is the expected inhibition fraction, indicating whether the combination of two drugs is strictly additive. bliss The "Bliss excess" value is obtained by subtracting the value from the inhibition fraction observed experimentally. A Bliss excess value greater than 0 indicates synergy, while a value less than 0 indicates antagonism. The Bliss excess value is plotted as a heatmap ± SD.

[0160] Single and combined data are also shown as dose-response curves created in GraphPad Prism (plotted using % survival rate compared to a control treated with DMSO alone).

[0161] For intensive combination testing, the Alamar Blue viability assay was performed as described above for combination testing. In addition, the Caspase-Glo 3 / 7 assay was performed. Briefly, HCT116 cells were seeded in 3 rows in McCoy 5A + 10% FBS at a cell density of 5000 cells per well in a white 96-well plate. A375 cells were seeded in DMEM + 10% FBS at a density of 5000 cells per well. After cell adhesion overnight, the test compound or vehicle control was added. The final concentration of DMSO was 0.2%, and 800 nM staurosporine was included as a positive control. 24-hour and 48-hour assay incubation periods were used. Then, Caspase-Glo® 3 / 7 50% (v / v) was added, the plate was mixed in an orbital shaker for 5 minutes, incubated at room temperature for 1 hour, and then read with a luminescent plate reader. The data was analyzed after subtracting the background value from the culture medium alone.

[0162] For differential scanning fluorimetry, SYPRO Orange (5,000× solution, Invitrogen) was diluted (1:1,000) in a buffer solution (10 mM HEPES, 150 mM NaCl, pH 7.5). The final concentration was 1 μM, including inactive ERK2, active ERK2 (ppERK2), or p38α as the His×6-tagged protein. The protein / dye solution and the compound in 100% DMSO were added to the wells (final DMSO concentration 2% v / v) to achieve the desired final concentration, mixed, and placed in an RT-PCR instrument. Next, melting curves were generated from 25 to 95 °C at a rate of 1 °C per minute, and the melting temperature (Tm) of each protein was determined in the absence or presence of the compound. The change in Tm (ΔTm) in the presence of various drug concentrations is shown.

[0163] For the determination of the Ki of ERK1, activated ERK1 (10 nM) was incubated with various concentrations of the compound in 2.5% (v / v) DMSO at 30 °C for 10 minutes in 0.1 M HEPES buffer (pH 7.5), 10 mM MgCl2, 2.5 mM phosphoenolpyruvate, 200 μM nicotinamide adenine dinucleotide (NADH), 150 μg / mL pyruvate kinase, 50 μg / mL lactate dehydrogenase, and 200 μM Erktide peptide. The reaction was initiated by adding 65 μM ATP. The decrease in absorbance (340 nm) was monitored, and the IC 50 was determined according to the inhibitor concentration.

[0164] To determine the Ki of ERK2, the inhibitory activity of BVD-523 against ERK2 was measured using a radiometric assay with the final concentrations of the components being 100 mM HEPES (pH 7.5), 10 mM MgCl2, 1 mM dithiothreitol (DTT), 0.12 nM ERK2, 10 μM myelin basic protein (MBP), and 50 μM of 33The reaction was determined to be P-γ-ATP. All reaction components except ATP and MBP were pre-mixed and dispensed into 96-well plates (33 μL). A 500-fold dilution was prepared using a stock solution of the compound in DMSO; a 1.5 μL aliquot of DMSO or the inhibitor in DMSO was added to each well. Substrate 33 The reaction was initiated by adding P-γ-ATP and MBP (33 μL). After 20 minutes, the reaction was quenched with 20% (w / v) trichloroacetic acid (TCA) (55 μL) containing 4 mM ATP, transferred to a GF / B filter plate, and washed three times with 5% (w / v) TCA. After adding Gold® scintillation agent (50 μL), the samples were counted using Packard TopCount. From the activity-versus-concentration titration curve, the Ki value was determined by fitting the data to an equation relating to competitive close-binding inhibition kinetics using Prism software, version 3.0.

[0165] ERK2 IC 50To determine the activity, it was assayed using a standard conjugated enzyme assay. The final concentrations were as follows: 0.1 M HEPES (pH 7.5), 10 mM MgCl2, 1 mM DTT, 2.5 mM phosphoenolpyruvate, 200 μM NADH, 50 μg / mL pyruvate kinase, 10 μg / mL lactate dehydrogenase, 65 μM ATP, and 800 μM peptide (ATGPLSPGPFGRR). All reaction components except ATP were pre-mixed with ERK and dispensed into assay plate wells. BVD-523 was introduced into each well in DMSO, maintaining a constant DMSO concentration per well. The BVD-523 concentration ranged from 500-fold for each titration. The assay plate was incubated in the plate reader compartment of a spectrophotometer (molecular devices) at 30°C for 10 minutes, after which the reaction was initiated by adding ATP. The change in absorbance at 340 nm was monitored over time; the initial slope corresponds to the reaction rate. The rate versus the concentration titration curve of BVD-523 was used to determine the value of Ki in the competitive close-binding inhibition kinetics equation, or IC. 50 To determine this, a three-parameter fit was performed using Prism software, version 3.0.

[0166] For the apoptosis assay, the cells were placed in a 96-well plate, 2 × 10⁶ cells per well. 4Cells were plated individually and allowed to adhere overnight, or grown to a 50% concentration density. Cells were treated with serial dilutions of BVD-523 in culture medium (final volume 200 μL, concentration range 4–0.25 μM) and incubated at 37°C in a CO2 incubator for 48 hours. Cells were washed with 100 μL of PBS, and 60 μL of radioimmunoprecipitation assay buffer was added (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1.0% [w / v] NP-40, 0.5% [w / v] sodium deoxycholate, 1% [w / v] SDS), and then incubated at 4°C for 10 minutes to lyse the cells. A 30 μL aliquot of the lysate was added to 100 μL of caspase assay buffer (120 mM HEPES, 12 mM EDTA, 20 mM dithiothreitol, 12.5 μg / mL AC-DEVD-AMC caspase substrate) and incubated at RT for 4 hours to overnight. The plate was read using a fluorometer (excitation wavelength 360 nm, emission wavelength 460 nm). The remaining 30 μL of lysate was analyzed for total protein content using the BioRad Protein Assay Kit (sample to working reagent ratio 1:8). The final normalized caspase activity was derived as fluorescence units per μg of protein and converted to a caspase activity increase factor compared to the DMSO control.

[0167] To measure the antitumor activity of A375 xenografts, xenografts were initiated using A375 cells maintained by stepwise subcutaneous transplantation in female thymus-deficient nude mice. Each test mouse was given an A375 tumor fragment (1 mm). 3 The device was implanted subcutaneously in the right flank. The tumor was the target size (80-120 mm). 3 Once the target was reached, the animals were randomized into a treatment group and a control group, and drug treatment was initiated.

[0168] To evaluate BVD-523 monotherapy, BVD-523 in 1% (w / v) carboxymethylcellulose (CMC) was administered orally at doses of 5 mg / kg, 25 mg / kg, 50 mg / kg, 100 mg / kg, or 150 mg / kg. Temozolomide was administered orally once daily (QD) at a dose of 75 mg / kg or 175 mg / kg for a total of 5 treatments (QD x 5) as a positive reference compound.

[0169] The efficacy of the combination of BVD-523 and dabrafenib was evaluated in mice randomized into 9 groups of 15 mice and 1 group of 10 mice (group 10). Dabrafenib was administered 50 mg / kg or 100 mg / kg in QDs and BVD-523 was administered 50 mg / kg or 100 mg / kg in BIDs, both individually and in combination, until the end of the study; this included vehicle-treated control groups and temozolomide-treated control groups (150 mg / kg, QD x 5). Combination therapy was discontinued on day 20, and tumor regrowth was monitored. Animals were monitored individually, and each tumor reached an endpoint volume of 2000 mm³. 3 Euthanasia was performed when the target was reached, or on the final day (day 45), whichever came first, and the median time to endpoint (TTE) was calculated. 228-1008 mm 3When evaluating larger tumors within the range, the combination was also evaluated in the higher-stage A375 model. Here, mice were randomized into one group of 14 mice (Group 1) and four groups of 20 mice (Groups 2-5). Treatment was initiated on day 1 with dabrafenib plus BVD-523 (25 mg / kg dabrafenib + 50 mg / kg BVD-523 or 50 mg / kg dabrafenib + 100 mg / kg BVD-523), and each drug was administered as po or BID until the end of the study. The study included a group receiving 50 mg / kg dabrafenib and 100 mg / kg BVD-523 monotherapy, as well as a vehicle-treated control group. Tumors were measured twice weekly. Combination therapy was stopped on day 42, and tumor regrowth was monitored until the end of the study (day 60). Treatment outcomes were determined from %TGD, defined as the percentage increase in median TTE compared to treated mice versus control mice, and differences between groups were analyzed by log-rank survival analysis. For TGI analysis, %TGI values ​​were calculated and reported for each treatment (T) group versus control (C) using the initial (i) and final (f) tumor measurements based on the following formula: %TGI = 1 - Tf - Ti / Cf - C. Mice were also monitored for CR and PR responses. Animals with CR at the end of the study were further classified as TFS.

[0170] To measure BVD-523 activity in Colo205 xenografts, human Colo205 cells were cultured in RPMI1640 supplemented with 10% (v / v) fetal bovine serum (FBS), 100 units / mL penicillin, 100 μg / mL streptomycin (Invitrogen), and 2 mM L-glutamine. Cells were cultured for fewer than four passages before implantation. 2 × 10⁶ Colo205 cells were administered to female thymus-deficient nude mice (19–23 g) on ​​day 0. 6 The drug was subcutaneously injected into the axillary region on the right dorsal side.

[0171] The approximate tumor volume is 200 mm². 3Mice were randomized into six experimental groups. Vehicle controls were administered weekly in 1% CMC (w / v). BVD-523 was suspended in 1% (w / v) CMC at the desired concentration and homogenized on ice at 6,500 rpm for 50 minutes. BVD-523 suspensions were prepared weekly and administered for 13 days in total daily doses of po, BID, 50 mg / kg, 100 mg / kg, 150 mg / kg, and 200 mg / kg (n=12 / group) on an 8-hour or 16-hour dosing schedule. Vehicle controls (n=12) were administered using the same dosing regimen. CPT-11 was administered as a positive reference compound (n=12). Each 1 mL CPT-11 injection contained 20 mg of irinotecan, 45 mg of sorbitol, and 0.9 mg of lactate. CPT-11 was administered intraperitoneally at a rate of 100 mg / kg per day every four days in two consecutive doses.

[0172] To measure internal standard (ITIS) mass spectrometry (ESM) in Colo205 xenografts tagged with ERK1 / 2 isotopes, frozen tumors were dissolved in 10 volumes of ice-cold lysis buffer (10 mM TRIS-HCl, pH 8.0, 10 mM MgCl2, 1% (v / v) Triton X-100, Complete® protease inhibitor cocktail [Roche, catalog number 1836170], phosphatase inhibitor cocktail I [Sigma, catalog number P-2850], phosphatase inhibitor cocktail II [Sigma, catalog number 5726], and benzonase [Novagen, catalog number 70664]). The lysate was clarified by centrifugation (4°C, 100,000 × g for 60 minutes), and the supernatant was adjusted to 2 mg / mL with the lysis buffer. ERK1 was immunoprecipitated using a pan-anti-ERK1 antibody (Santa Cruz Biotechnology catalog number sc-93ac) coupled with agarose. The immunoprecipitated protein was degraded by SDS-PAGE, stained with SYPRO Ruby (Invitrogen), and the ERK band was cut off with a razor blade. The gel slices were washed with 300 μL of 20 mM NH4HCO3, cut into cubes, and then sliced ​​into Page The gel fragments were placed in an Eraser Tip (The Nest Group, catalog number SEM0007). After reduction and alkylation of the gel fragments, they were digested with trypsin. The trypsin fragments were isolated in 75 μL of 50% (v / v) acetonitrile and 0.2% (v / v) trifluoroacetic acid, and the resulting samples were concentrated to 0-10 μL in SpeedVac.

[0173] For ITIS analysis, heavy atom-labeled peptide standards were added as spikes to the digested samples, and the phosphorylation fraction was quantified by coupled liquid chromatography-tandem mass spectrometry (MS). Nanocapillary chromatography was performed using a Flux Instruments Rheos 2000 binary pump delivering nanoscale flow after 1:750 splitting, an LC Packings Inertsil nano-precolumn (C18, 5 mm, 100 Å, 30 mm ID × 1 mm), and a New Objective PicoFrit AQUASIL resolving column (C18, 5 mm, 75 / 15 mm ID × 10 cm), which also functions as an electrospray ionization (ESI) emitter. An Applied Biosystem API 3000 mass spectrometer coupled to a nanoESI source was used for MS analysis. A proprietary gas nozzle connected to a spray gas source was used to support steady-state nanoflow spraying. Data was acquired in multiple reaction monitoring (MRM) mode: for all MRM channels, spray gas, 3; curtain gas, 7; impacting gas, 5; ion spray voltage, 2150 volts; outlet potential, 10 volts; Q1 / Q3 resolution, low / unit; and residence time, 65 msec. All raw MS data were processed using a combination of the Analyst software suite from Applied Biosystem and custom tools.

[0174] To evaluate drug sensitivity in acquired resistance cell line models, drug sensitivity in dose-escalating A375 cells and isogeneic RKO cells was assessed using a 96-hour proliferation assay. RKO isogeneic cells (McCoy 5A containing 10% [v / v] FBS) or dose-escalated A375 cells (seeded in DMEM containing 10% FBS in 96-well plates, allowed to adhere overnight, and then the compound or vehicle control was added. Note that dose-escalated A375 cells were seeded in the absence of the inhibitor. The compound was prepared from 0.1% (v / v) DMSO stock to obtain the final concentrations shown. The test compound was incubated with cells at 37°C in a 5% CO2 humidified atmosphere for 96 hours. For RKO cells, CellTiter-Glo® reagent (Promega) was added according to the manufacturer's instructions, and luminescence was detected using a BMG FLUOstar plate reader. For the A375 assay, Alamar blue (ThermoFisher) 10% (v / v) was added, incubated for 4 hours, and then the fluorescence product was detected using a BMG FLUOstar. The mean background value of the medium only was subtracted, and the GraphPad We analyzed the data using a four-parameter logistic equation in Prism.

[0175] ERK1 IC 50 The determination was measured in the final reaction volume of 25 μL. ERK1 (human) (5-10 mU) was reacted with 25 mM Tris (pH 7.5), 0.02 mM glycol ether diaminetetraacetic acid (ethyleneglycoltetracetic acid), 250 μM peptide, 10 mM magnesium acetate, and γ- 33 The reaction was incubated with P-ATP (specific activity approximately 500 cpm / pmol, concentration as needed). The reaction was initiated by adding Mg ATP. After incubation at room temperature (RT) for 40 minutes, the reaction was stopped by adding 5 μL of 3% (w / v) phosphoric acid solution. Then, 10 μL of the reaction mixture was spotted onto a P30 filter mat and washed three times with 75 mM phosphoric acid for 5 minutes each, followed by one wash with methanol, after which it was dried and scintillated.

[0176] RKO MEK1 Q56P isogeneic cells were generated by Horizon Discovery (Cambridge, UK; #HD 106-019) using a recombinant AAV-mediated gene targeting strategy. Briefly, rAAV virus was generated after transfection of HEK293T cells with appropriate targeting and helper vectors, purified using an AAV purification kit (Virapur, San Diego, USA), and titrated using qPCR. Subsequently, parental homozygous RKO cells (homozygous wild-type for MEK1) were infected with rAAV virus, and clones incorporating the selection cassette were identified by G418 selection and expanded. Strictly targeted clones that were heterozygous for knock-in of a single MEK1 Q56P point mutation were identified by PCR and sequencing.

[0177] Mutant KRAS (De Roock et al., 2010, JAMA, Vol. 304, pp. 1812-182) Regarding the knock-in of (page 0), heterozygous isogeneic SW48 cell lines were obtained from Horizon Discovery (catalog numbers: HD 103-002, HD 103-006, HD 103-007, HD 103-009, HD 103-010, HD (103-011, HD 103-013). For the proliferation assay, cells were seeded in McCoy's 5A medium supplemented with 10% FBS in 96-well plates, allowed to adhere overnight, and then the compound or vehicle control was added. The test compound was incubated with the cells at 37°C in a 5% CO2 atmosphere for 96 hours. Viability was then assessed using Alamar blue.

[0178] At Upstate Discovery, we performed our own KinaseProfiler assay and profiled the selectivity of BVD-523 for a panel of 70 kinases using radiometric detection similar to that used by Davies et al.

[0179] Drug sensitivity analysis was performed as part of The Genomics of Drug Sensitivity in Cancer Project, using the high-throughput screening method previously described (Yang et al., 2013).

[0180] For Western blot analysis, A375 cells were seeded in 10 cm dishes in Dulbecco's Modified Eagle Medium plus 10% (v / v) FBS. After cell adhesion overnight, the test compound or vehicle was added. For experiments using RKO cells, these cells were seeded in 6-well plates or 10 cm dishes with McCoy 5A + 10% (v / v) FBS. The cells were then treated with the desired concentration and duration. Cells were harvested by trypsin treatment, pelletized, and snap-frozen. Lysates were prepared using RIPA buffer supplemented with a protease and phosphatase inhibitor cocktail (Roche), clarified by centrifugation at 11,000 rpm for 10 minutes, and quantified by bicinchoninic acid assay. The samples were degraded by SDS-PAGE, blotted onto polyvinylidene fluoride membranes, and probed using antibodies targeting the indicated targets (i.e., pRB[Ser780], catalog number 9307; CCND1, catalog number ab6152; BCL-xL, catalog number 2762; PARP, catalog number 9542; DUSP6, catalog number 3058S).

[0181] For Reverse Phase Protein Analysis (RPPA), A375 cells, MIAPaCa-2 cells, HCT116 cells, Colo205 cells, HT-29 cells, and AN3Ca cells (ATCC) were plated at 80% density and allowed to recover overnight (MIAPaCa-2 cells were plated at 30% density and allowed to recover for 3 days). These were then treated with 10 μM of each compound (i.e., BVD-523, SCH722984, GDC-0994, or Vx-11e) at 37°C for 6 hours. Control wells were treated with 0.1% (v / v) DMSO for 6 hours before cell lysate generation. Samples were then analyzed using reverse-phase protein microarray technology (Theranostics Health).

[0182] To analyze pERK IHC in Colo205 xenografts, xenograft tumors were treated overnight with 70%–100% graded ethanol, clarified with two xylene changes, infiltrated with paraffin, and embedded in paraffin blocks. 5 μm sections were then cut and placed on positively charged glass slides, and baked at 60°C for at least 30 minutes, but less than 1 hour. Single sections from each animal and dose group were probed with anti-phospho p42 / p44 MAPK antibody (pERK[1:100], CST; catalog number 9101; lot number 16), counterstained with hematoxylin, and then analyzed at the microscopic level using a Zeiss Axioplan 2 microscope. An isotype control (rabbit, Zymed laboratories, catalog number 08-6199, lot number 40186458) was used as a negative control.

[0183] For FACS analysis, cells were scraped, pelletized at 1,500 rpm for 5 minutes, resuspended in 1 mL of buffer, and frozen at -70°C. The frozen cells were thawed, centrifuged again, and then resuspended in 0.25 mL of buffer A (trypsin in spermine tetrahydrochloride surfactant buffer) for 10 minutes to deaggregate cell aggregates and digest the cell membrane and cytoskeleton. Buffer B (trypsin inhibitor and ribonuclease I in buffer, 0.2 mL) was added in the dark for 10 minutes. The resulting DNA-stained nuclei were filtered and analyzed by FACS. Histograms were analyzed to establish the proportion of cells in the G1, S, and G2 / M phases of the cell cycle based on the presence of n and 2n DNA (or higher) content.

[0184] To measure the combination activity in vitro, 5000 G-361 cells were seeded into 96-well plates containing McCoy 5A with 10% (v / v) FBS in a triple configuration and allowed to adhere overnight. The vemurafenib / BVD-523 combination was tested using a 10 × 8 dose matrix. The compounds were incubated with cells at 37°C in a 5% CO2 humidified atmosphere for 72 hours. CellTiter-Glo reagent was added according to the manufacturer's instructions, and luminescence was detected using an MBG FLUOstar plate reader. Interactions across the dose matrix were determined using Loewe additiveity and Bliss independent models with Horizon's Chalice Combination Analysis Software.

[0185] To induce compound resistance in vitro through dose escalation, A375 parent cells (ATCC CRL-1619) were grown to approximately 40-60% density in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated FBS and penicillin / streptomycin, and then the initial dose of BVD-523, trametinib, or dabrafenib was administered alone or in combination to induce IC of each compound. 50 Treatment was performed using either or slightly lower doses; in combination tests, the initial dose was the IC of each compound.50 The dose was halved. Cells were grown to approximately 70-90% density and then divided; the medium was replaced every 3-4 days. When the cells again reached approximately 40-60% density, the dose was gradually increased by the same increment (equal to the starting concentration), then moved to a 1.5-fold increase in concentration, and then to a further 2-fold increase if the cells continued to adapt rapidly (for example, the first six doses of dabrafenib escalation were 5 nM, 10 nM, 15 nM, 20 nM, 25 nM, and 37.5 nM). This process was repeated as needed.

[0186] The cell viability assay shown in Figure 30A was performed using the Resazurin (Alamar Blue) metabolic assay under high glucose conditions in sufficient serum after 5 days of drug treatment. Cells were seeded at approximately 15-50% density in 384-well microplates in medium with 10% FBS and penicillin / streptavidin + high glucose (18-25 mM). The optimal cell count was determined for each cell line to optimize growth during drug treatment. After overnight incubation for cell line attachment, the cells were treated with each compound at nine concentrations (a series of 2x dilutions) using liquid handling robotics and returned to the incubator for assay at 96 hours. For suspension cell lines, the cells were treated with the compound immediately after plating and returned to the incubator at 96 hours. The cells were then stained for 4 hours with 55 μg / ml Resazurin (Sigma) prepared in glutathione-free medium. Fluorescence signal intensity was quantified using a fluorescence plate reader with excitation and emission wavelengths of 535 / 595 nm for resazurin. All screening plates were subjected to stringent quality control standards. The effect on cell viability was measured, and a curve fitting algorithm was applied to the raw dataset to determine the maximum half-percentage inhibitory concentration (IC). 50 We derived a multi-parameter description of the drug response, including ). 50 This is an IC in μM units. 50 It can be expressed as the natural logarithm of (LN_IC 50 EXP is in the μm range of IC 50 (Return to IC) 50Extrapolation considered cases yielding very high values. If desired, IC at the maximum test concentration (and the minimum test concentration for low values) 50 By setting an upper limit on the values, the data was restricted to the test concentration range.

[0187] BRAF that became clinically resistant to vemurafenib V600E Regarding the efficacy study of BVD-523 in patient-derived xenografts (AT052C) representing patient-derived melanoma. Tumor fragments were harvested from host animals and implanted in immunodeficient mice. The average tumor volume was approximately 170 mm². 3 At that point, the study was initiated, and animals were randomized into four groups: a control (1% [v / v] CMC po, BID × 31) and three treatment groups (BVD-523 [100 mg / kg], dabrafenib [50 mg / kg], or BVD-523 / dabrafenib [100 / 50 mg / kg], n=10 / group); all treatment drugs were administered po on a BID × 31 schedule.

[0188] IC on the inhibition of PMA-stimulated RSK1 phosphorylation in human whole blood samples by BVD-523 50 To determine the efficacy of BVD-523-mediated inhibition of PMA-stimulated RSK1 phosphorylation, an 8-point concentration curve ranging from 10 μM to 5 nM was used for 10 healthy donors (22-61 years old) to determine the efficacy of BVD-523-mediated inhibition of PMA-stimulated RSK1 phosphorylation. 50 The values ​​were determined. The control group consisted of three unstimulated samples and three PMA-stimulated samples from each donor. For each sample, both the phospho-RSK (pRSK) level and the total RSK level were determined, and the data were calculated using the pRSK / RSK level.

[0189] 30 ml of blood was collected from each donor and placed in a sodium heparin vacuum. 1 ml of whole blood was added to each of 22 2 mL microtubes per donor. The microtubes were labeled with the donor number (1-10), followed by the treatment name: "A" was PMA stimulation only (maximum), "B" was a sample containing BVD-523 and receiving PMA stimulation; and "C" was an unstimulated sample (minimum). Dimethyl sulfoxide (DMSO) was added to all tubes in groups A and C to a final concentration of 0.1%. The samples were then gently shaken at room temperature.

[0190] BVD-523 (10 mM in 100% DMSO) was serially diluted using a 3-fold dilution to 100% DMSO. These serially diluted BVD-523 samples in 100% DMSO were then 10-fold diluted in Dulbecco's Modified Eagle Medium containing 10% fetal bovine serum and penicillin / streptomycin / glutamine. For each specified BVD-523 concentration, 10 μL of each of these diluted standard solutions was added per 1 mL of blood. Two runs were performed for each BVD-523 concentration, and 16 complete samples were obtained from two 1 mL blood samples for a complete 8-point concentration curve. The samples were then gently agitated at room temperature for a minimum of 2 hours but less than 3 hours.

[0191] For all donors, human whole blood samples from groups A and B were stimulated with PMA at a final concentration of 100 nM at room temperature for 20 minutes. Samples from group C were not treated with PMA but were handled by shaking in the same manner as all other samples.

[0192] After each sample was treated with PMA, peripheral blood mononuclear cells were isolated from human whole blood. 1 ml of blood from each sample was gently placed in a 2 mL microcentrifuge tube on 0.75 mL of room temperature Histopaque 1077. The samples were centrifuged in an Eppendorf microcentrifuge at 16,000 × g for 2 minutes. The interface and upper layer were removed and added to a tube containing 1 mL of cold Dulbecco's phosphate-buffered saline (DPBS). These samples were then centrifuged at 16,000 × g for 30 seconds to pellet the cells. The supernatant of the buffer was removed by aspiration, and the pellet was resuspended in 1 mL of cold DPBS. The pellets from each sample were then re-pelled as described above. The buffer was removed by aspiration, and the pellet was dissolved as shown below.

[0193] The complete lysis buffer consisted of Meso Scale Discovery Tris lysis buffer, 1× Halt protease inhibitor cocktail, 1× phosphatase inhibitor cocktail 2, 1× phosphatase inhibitor cocktail 3, 2 mM phenylmethanesulfonyl fluoride, and 0.1% sodium dodecyl sulfate. The lysis buffer for each sample group was kept fresh on ice. The final cell pellet was lysed by adding 120 μL of complete lysis buffer. The samples were vortexed until the cell pellet disappeared, and then rapidly frozen on dry ice. The samples were stored at -20°C before measuring pRSK and total RSK by ELISA.

[0194] For the pRSK ELISA (PathScan), the thawed lysate was combined 1:1 with the sample diluent (provided in the ELISA kit): 120 μL of the lysate was added to 120 μL of the sample diluent in a round-bottom 96-well plate. This combination was then transferred to pRSK microwells at a rate of 100 μL per well. For the total RSK ELISA (PathScan), 20 μL of the lysate, which had already been diluted 1:1 in the sample diluent, was further diluted in 200 μL of the sample diluent in a round-bottom 96-well plate. This combination was then transferred to total RSK microwells at a rate of 100 μL per well. The plate was sealed with a plate seal and incubated at 4°C for 16–18 hours, the time shown to yield the best detection of the target protein. Both ELISAs were developed according to the kit instructions.

[0195] Patients aged 18 years or older were eligible to participate if they had an incurable, histologically confirmed metastatic or advanced-stage malignancy; an ECOG performance status of 0 or 1; adequate renal, hepatic, bone marrow, and cardiac function; and a life expectancy of at least 3 months. Patients may have received up to two prior-line chemotherapy regimens for metastatic disease. Exclusion criteria included known uncontrolled brain metastases; gastrointestinal conditions that could impair absorption of the study drug; a history or current evidence / risk of retinal vein occlusion or central serous retinopathy; and concurrent therapy with drugs known to be potent inhibitors or potent inducers of CYP1A2, CYP2D6, and CYP3A4. All participants were presented with informed consent before the commencement of any study procedure.

[0196] Patients who received at least one dose of BVD-523 were included in the analysis using SAS (version 9.3) software. The data cutoff was December 1, 2016. This trial is registered under ClinicalTrials.gov number NCT01781429.

[0197] This invention presents data from an open-label, multicenter Phase I trial to evaluate the safety, pharmacokinetics, and pharmacodynamics of escalating doses of BVD-523 in patients with advanced malignant tumors. The dosing regimen combined both accelerated titration and a standard cohort 3+3 dose escalation scheme, and these were used together to identify the MTD and RP2D of BVD-523 in patients with advanced solid tumors. One to six patients per treatment cohort were assigned to receive orally administered BVD-523, starting with a 10 mg BID and gradually increasing in dose, on a BID schedule (12-hour intervals) in a 21-day cycle. BVD-523 was administered in 21-day cycles at the following doses: 10 mg (n=1); 20 mg (n=1); 40 mg (n=1); 75 mg (n=1); 150 mg (n=1); 300 mg (n=4); 600 mg (n=7); 750 mg (n=4); and 900 mg (n=7).

[0198] Patients received the BID oral dose until clinical observations met disease progression, unacceptable toxicity, or other discontinuation criteria. Dose escalation was performed in single-patient cohorts in increments of up to 100%, until one patient developed a Grade 2 or higher toxicity (excluding alopecia or diarrhea). The cohort was then expanded to at least three patients each, and subsequent dose escalation increments were reduced from up to 100% to up to 50%. If at least one DLT occurred in a cohort of three patients, up to three additional patients were treated at this dose level. If more than one DLT occurred in six or fewer patients, this dose level was defined as an untolerable dose, and dose escalation was stopped. Intra-patient dose escalation was permitted if the patient receiving the highest current dose had been observed for at least three weeks, and fewer than two of the six patients assigned to a given dose reported dose-limiting adverse events. In patients with DLT or unacceptable toxicity, treatment was discontinued until the toxicity returned to Grade 1 or lower. Subsequently, treatment with BVD-523 was resumed at the next lowest test dose level, or reduced by 20%–30%, in accordance with the capsule dosage.

[0199] The primary objective of the Phase I trial was to define the safety and tolerability of BVD-523 by determining dose-limiting toxicity, MTD, and RP2D. Secondary objectives included determining the pharmacokinetic profile of BVD-523 in patients with advanced malignancies and investigating any preliminary clinical effects on tumor responses assessed by physical or radiological examinations using RECIST v1.1. Exploratory objectives included evaluating pharmacodynamic marker (biomarker) metrics and as shown. 18 This included a preliminary investigation of the clinical effects on tumor response as assessed by F-FDG-PET.

[0200] For determining MTD, DLT, and RP2D, MTD was defined as the highest dose cohort in which BVD-523-related DLT occurred in 33% or less of patients during the first 21 days of treatment. DLT was defined as BVD-related toxicity resulting from a Grade 4 or higher hematological toxicity lasting >1 day during the first 21 days of treatment; a Grade 3 hematological toxicity with complications (e.g., thrombocytopenia with bleeding); a Grade 3 or higher non-hematological toxicity other than untreated nausea, vomiting, constipation, pain, and rash (these constitute DLT if AEs persist despite appropriate treatment); or a BVD-related toxicity resulting from a treatment interruption of more than 3 days in Cycle 1 (or failure to enter Cycle 2 for >7 days) due to a BVD-523-related toxicity.

[0201] The RP2D could be set to the same level as the MTD, as determined through discussions with the principal investigator, medical monitors, and sponsors. Pharmacokinetic, pharmacodynamic, and any cumulative toxicity observed after multiple cycles were included in the rationale supporting the RP2D.

[0202] For safety assessment, adverse events (AEs) were defined as any undesirable medical event occurring in a patient receiving the drug, not necessarily causally related to BVD-523, and were coded using the MedDRA coding dictionary. SAEs were defined as any undesirable medical event occurring at any dose that is fatal, life-threatening, requires hospitalization or extension of current hospitalization, or results in permanent or significant disability / impairment or birth defects / absences. The severity of AEs was graded according to the National Cancer Institute Common Terminology Criteria for Adverse Events, Grading Scale, version 4.

[0203] Safety assessments were performed at baseline, on days 8, 15, 22, 29, 36, and 43, and every three weeks for patients continuing treatment, or thereafter if clinically required. Each assessment included physical and clinical examinations. Electrocardiograms were repeated if clinically significant and at the discretion of the investigator. The investigator determined whether an adverse event (AE) was related to the study drug and followed the patient until the AE resolved or stabilized, or until it was determined to no longer be clinically significant.

[0204] For pharmacokinetic analysis, the pharmacokinetic population consisted of patients who received at least one dose of BVD-523 and had evaluable pharmacokinetic data for plasma and / or urine. Blood samples were collected pre-administration, and then at 0.5 hours (±5 min), 1 hour (±5 min), 2 hours (±10 min), 4 hours (±10 min), 6 hours (±10 min), 8 hours (±10 min), and 12 hours (±2 min) after morning administration on day 1 (visit 2; baseline / treatment initiation) and day 15 (visit 4; steady state). On day 22, a final blood sample was collected before dose administration for pharmacokinetic analysis. Urine samples were collected on day 1 and day 15, pre-administration, and at intervals of 1–6 hours and 6–12±2 hours after administration. Plasma and urine samples were analyzed for BVD-523 and metabolites using effective LC / MS / MS methods. Standard pharmacokinetic parameters were obtained using Phoenix WinNonlin (Pharsight) and the non-compartmental method. The relationship between dose and exposure was calculated using standard least-squares regression analysis.

[0205] For pharmacodynamic confirmation of targeted inhibition by BVD-523, targeted ERK inhibition by BVD-523 was determined by investigating pRSK as a targeted biomarker in human whole blood samples obtained from patients with advanced solid tumors (N=27) who received different doses of BVD-523 (10-900 mg BID) during a Phase I trial. The activity of BVD-523 from four time points (before administration at baseline, 4 hours after administration at baseline, before administration on day 15, and 4 hours after administration on day 15) was expressed as the percentage activity (pRSK) of PMA-stimulated blood incubated with BVD-523.

[0206] Regarding the measurement of the antitumor response, tumor measurements based on physical examination were performed at baseline and on day 1 of each treatment cycle. CT and other evaluations were performed every 2-3 cycles. Findings were evaluated according to RECIST v1.1: CR was defined as the disappearance of all target lesions; PR was defined as a reduction of 30% or more in the sum of the longest diameters of target lesions, with baseline measurements as reference; and stable disease was defined as not having a reduction sufficient to qualify as PR, nor an increase sufficient to qualify as progressive disease, with baseline measurements as reference. Metabolic responses were, 18 Tumor uptake of F-glucose 18 F-FDG-PET scans were evaluated by visualization before receiving the first dose of BVD-523 and on day 15 (visit 4). (Example 2) Dose escalation and growth assay - Month 1 Progression of dose escalation - Month 1

[0207] A375 cells were subjected to dose escalation using BVD-523, dabrafenib, and trametinib, either as monotherapy or in combination. The dose was gradually increased during the first month. Except for a significant decrease in proliferation rate, the cells generally tolerated the escalation well, and the dose was planned to be more aggressively escalated using larger increments in the second month. Figures 1A–1C show the progress of the dose escalation study at the first month. Growth assay results - Month 1

[0208] Growth assays were performed to evaluate the response of escalated cell lines versus the parental cell line to treatment with BVD-523, dabrafenib, and trametinib.

[0209] Figures 2A–2H show normalized and unprocessed growth assay results from month 1 of the study. Note that the differences in maximum signal in the DMSO control between different treatments (Figures 2D, 2F, and 2H) suggest differential growth rates between treatments. These differences may affect the strain's response to the inhibitor in the growth assay. Table 10 shows the IC for the first month of the exam. 50 The data is shown. [Table 10]

[0210] Cells grown in the presence of escalating doses of dabrafenib or trametinib, either as monotherapy or in combination, showed early, slight signs of reduced response to these two drugs in growth assays.

[0211] In the early part of the second month, the proliferation rate of cells treated with dabrafenib alone increased significantly compared to the early part of the first month. This suggested that an increase in the rate of progression was possible, and that resistance was beginning to emerge. (Example 3) Dose escalation and growth assay - Month 2 Progress of dose escalation - Month 2

[0212] At two months into the trial, most treatments were observed to move to a phase of dose increases with larger increments (1.5 times) compared to the initial mild escalation phase. Dabrafenib monotherapy and trametinib monotherapy showed the most rapid escalations, with cells reaching 100× parental cell IC. 50 Cells proliferated at the same concentrations (Figures 3A and 3B). Increasing the BVD-523 monotherapy dose progressed more slowly compared to dabrafenib and trametinib (Figure 3C). See Figure 3D for a comparison of monotherapy dose increases. Cells treated with BVD-523 dose increases had a more "fragile" appearance and contained more suspension cells compared to the dabrafenib and trametinib dose increase populations.

[0213] Gradual increases in combination drugs progressed more slowly than monotherapy. The BVD-523 / trametinib combination was particularly effective in preventing cell progression. Growth assay results - Month 2

[0214] Growth assays of monotherapy-escalated dabrafenib and trametinib cell populations revealed moderate shifts in the dose-response curves, suggesting that additional escalation periods may be beneficial for further enriching resistant cells. Interestingly, the growth assays provided evidence suggesting that cells exposed to BVD-523 proliferated less favorably upon discontinuation of the inhibitor, possibly indicating a level of addiction.

[0215] Figures 4A–4H show normalized and unprocessed growth assay results from month 2 of the study. Note that the differences in maximum signal in the DMSO control between different treatments (Figures 4D, 4F, and 4H) suggest differential growth rates between treatments. These differences may affect the strain's response to the inhibitor in the growth assay.

[0216] Figures 5A–5H show the normalized and unprocessed growth assay results from month 2 of the study, focusing only on data from the parent and BVD-523 strains.

[0217] Table 11 shows the IC for the second month of the exam. 50 The data is shown. Relative IC 50 This was determined by four-parameter curve fitting in Prism. [Table 11] (Example 4) Dose escalation and growth assay - Month 3 Progress of dose escalation - Month 3

[0218] Figures 6A to 6C show the gradual increase in monotherapy and combination therapy at the third month of the study. Figure 6D shows a comparison of monotherapy gradual increase. Growth assay results - 3 months

[0219] Figure 7 shows the evaluation of growth during the growth assay in the DMSO control well. Figures 8A to 8D show the results from month 3 of the study. Figures 9A to 9D show the results from month 3 of the study, focusing on single-treatment cell lines.

[0220] Table 12 shows the IC for the third month of the exam. 50 The data is shown. Relative IC 50 This was determined by 4-parameter curve fitting in Prism. Cell lines treated with trametinib did not proliferate during the assay, so IC was not used. 50 The value was not determined (ND: Not performed). [Table 12]

[0221] Figure 19 shows the escalation of monotherapy and combination therapy for month 3 of the study. Dabrafenib or trametinib were observed in parent A375 cells. 50 We obtained a cell line variant that could grow in the presence of the substance at a concentration more than 100 times higher than that of the parent. In comparison, cell lines resistant to BVD-523 showed resistance to the parent IC 50 The concentration could only be maintained at less than 10x. Susceptibility testing showed that dabrafenib-resistant and trametinib-resistant cell lines remained relatively susceptible to BVD-523; IC for BVD-523 in resistant cell lines. 50 The increase in "shift" corresponds to the IC after treatment with dabrafenib or trametinib. 50 It was suggested that the increase was more moderate than expected. Similarly, compared to treatment with dabrafenib or trametinib, BVD-523 was found to have an IC in the parent A375 strain. 50 When treated with a concentration 10 times higher, a more thorough inhibition of cell proliferation was observed. Overall, the patterns of resistance and cross-sensitivity suggest that BVD-523 may remain effective even in situations of acquired resistance. (Example 5) Combination test results

[0222] As expected, A375 cells with the BRAF(V600E) mutation were sensitive to dabrafenib. Monotherapy IC calculated using Alamar Blue. 50 The values ​​(Figures 10A–10E, 12A–12E, and 14A–14E) were generally slightly lower for dabrafenib and BVD-523 compared to those derived using CellTiter-Glo (Figures 11A–11E, 13A–13E, and 15A–15E). Published ICs for dabrafenib and trametinib in 72-hour CellTiter-Glo assays. 50 The values ​​were 28±16 nM and 5±3 nM, respectively (Greger et al., 2012; King et al., 2013)—the results for monotherapy reported herein are consistent with these values. There was some evidence of a synergistic window in all treatments. Although there was little variation among the three series, there was some evidence of edge effects that may explain the apparent enhancement of growth observed in some treatments compared to the untreated control (e.g., particularly evident in the trametinib / BVD-523 combination). This makes the interpretation of the Bliss analysis more difficult, as some treatments may have induced an artificial enhancement of the level of synergy.

[0223] The combination assay was repeated against A375 cells. The efficacy of the single agents BVD-523, trametinib, and dabrafenib was consistent with that reported in previous studies disclosed herein.

[0224] In summary, the data indicates that MEK and BRAF-resistant cells could be overcome by treatment with the ERK inhibitor BVD-523. (Example 6) BVD-523 altered markers of MAPK kinase activity and effector function.

[0225] For Western blot testing, HCT116 cells (5 × 10 6 A375 cells (2.5 × 10) were sown in a 10cm dish using McCoy 5A + 10% FBS. 6 Cells were seeded in a 10 cm dish with DMEM + 10% FBS. After allowing the cells to adhere overnight, the indicated amounts of the test compound (BVD-523) or vehicle control were added. After treating the cells for either 4 hours or 24 hours as specified below, the total cell protein lysate was isolated. Cells were harvested by trypsin treatment, pelletized, and snap-frozen. The lysates were prepared using RIPA (radioimmunoprecipitation) buffer, clarified by centrifugation, and quantified by bicinchoninate assay (BCA). 20-50 μg of protein were degraded by SDS-PAGE electrophoresis, blotted onto PVDF membrane, and probed using the antibodies detailed in Table 13 (for 4-hour treatment) and Table 14 (for 24-hour treatment) below. [Table 13] [Table 14]

[0226] Figures 16A–16D, 17A–17D, and 18A–18D show Western blot analyses of cells treated with BVD-523 at various concentrations for the following: 1) MAPK signaling components in A375 cells after 4 hours; 2) cell cycle and apoptotic signaling in A375 cells treated with varying amounts of BVD-523 for 24 hours; and 3) MAPK signaling in HCT-116 cells treated over 4 hours. The results indicate that both short-term and long-term treatment with BVD-523 in RAF and RAS mutant cancer cells in vitro affects both substrate phosphorylation and ERK kinase effector targets. The concentrations of BVD-523 required to induce these changes are generally in the low micromolar range.

[0227] Changes in several specific activity markers are noteworthy. Firstly, the abundance of the slow-evolving isoform of ERK kinase increases after treatment with BVD-523; moderate changes can be observed in the short term, and increases after prolonged treatment. This may indicate an increase in the enzymatically active phosphorylated form of ERK, but it is still noteworthy that numerous proteins that are both directly and indirectly regulated by ERK remain "off" after treatment with BVD-523. Firstly, the RSK1 / 2 protein shows decreased phosphorylation at residues (T359 / S363) that are strictly ERK-dependent in terms of protein modification. Secondly, treatment with BVD-523 induces complex changes in the MAPK feedback phosphatase, DUSP6: the slow-evolving protein isoform decreases after short-term treatment, but the total protein level drops significantly after prolonged treatment with BVD-523. Both of these findings are consistent with the decreased activity of ERK kinase, which regulates DUSP6 function through both post-translational and transcriptional mechanisms. Overall, despite the increase in ERK in cell morphologies generally considered active, cellular ERK enzyme activity appears likely to be completely inhibited after short-term or long-term treatment with BVD-523.

[0228] Consistent with these observations, effector genes requiring MAPK pathway signaling are altered after treatment with BVD-523. The G1 / S cell cycle apparatus is regulated by MAPK signaling at both post-translational and transcriptional levels, and cyclin-D1 protein levels are significantly reduced after prolonged treatment with BVD-523. Similarly, apoptotic effector gene expression and protein abundance often require intact MAPK signaling, and total Bim-EL levels are elevated after prolonged treatment with BVD-523. However, as noted above, PARP protein cleavage and increased apoptosis were not observed in the A375 cell background; this suggests that additional factors may influence whether alterations in BVD-523 / ERK-dependent effector signaling translate to final events such as cell death and cell cycle arrest.

[0229] Consistent with the cellular activity of BVD-523, marker analysis suggests that ERK inhibition alters various molecular signaling events in cancer cells, thereby making cancer cells more susceptible to both decreased cell proliferation and survival.

[0230] In other words, Figures 16A–16D, 17A–17D, and 18A–18D show that BVD-523 inhibits the MAPK signaling pathway and may be more advantageous in this context compared to RAF or MEK inhibition.

[0231] Finally, due to its properties, BVD-523 may be a preferred agent for use as an ERK inhibitor compared to other agents with similar activity. It is known that kinase inhibitors exhibit unique and specific interactions with their enzyme targets, and that their efficacy is strongly influenced by both the mode of direct inhibition and susceptibility to adaptive changes that occur after treatment. For example, inhibitors of ABL, KIT, EGFR, and ALK kinases are effective only when their corresponding targets are found in active or inactive configurations. Similarly, certain of these inhibitors are uniquely sensitive to either secondary gene mutations or post-translational adaptive changes in the protein target. Lastly, RAF inhibitors exhibit differential efficacy against RAF kinases present in certain protein complexes and / or intracellular localizations. In summary, since all ERK kinases are known to exist in diverse, fluctuating, and complex biochemical states, BVD-523 appears likely to be distinct from other agents and capable of interacting with and inhibiting these targets in a highly preferred manner. (Example 7) Effects of BVD-523 and benchmark ERK, BRAF, and MEK inhibitors on survival capacity and MAPK signaling Single-agent growth assay

[0232] Cells were seeded in McCoy 5A 96-well plates containing 10% FBS at the densities shown in Table 15, allowed to adhere overnight, and then the compound or vehicle control was added. The compound was prepared from DMSO stock to obtain the desired final concentration. The final DMSO concentration was kept constant at 0.1%. The test compound was incubated with cells for 96 hours at 37°C in a 5% CO2 humidified atmosphere. CellTiter-Glo® reagent (Promega, Madison, WI) was added according to the manufacturer's instructions, and luminescence was detected using a BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany). The mean background value of the medium only was subtracted, and the data were analyzed using a 4-parameter logistic equation (GraphPad Software, La Jolla, CA) with GraphPad Prism. Combination growth assay

[0233] Cells were seeded in triple-row 96-well McCoy 5A plates containing 10% FBS at the densities shown in Table 15, allowed to adhere overnight, and then the test compound or vehicle control was added. Combinations were tested using a 10 × 8 dose matrix. The final DMSO concentration was kept constant at 0.2%.

[0234] The test compound was incubated with cells for 96 hours at 37°C in a 5% CO2 humidified atmosphere. The cells were stained with Hoechst stain, and fluorescence was detected as described above. The data was analyzed after subtracting the mean background value of the culture medium alone.

[0235] Interactions across the combined dose matrix were determined using Chalice® Combination Analysis Software (Horizon Discovery Group, Cambridge, MA) and the Loewe additive and Bliss independent models, as outlined in the user manual (available at chalice.horizondiscovery.com / chalice-portal / documentation / analyzer / home.jsp). Synergy was determined by comparing the experimentally observed level of inhibition at each combination point with the expected value for additiveity derived from monotherapy responses along the matrix edges. Potential synergistic interactions were identified by showing calculated excess inhibition beyond what was predicted to be additive across the dose matrix as a heatmap, and by reporting a quantitative “synergy score” based on the Loewe model. Monotherapy data derived from the combined assay plates are presented as dose-response curves created in Chalice®. [Table 15] Western blotting

[0236] Cells were seeded in 6-well plates (Experiment 1) or 10 cm dishes (Experiment 2) at the densities shown in Table 15 using McCoy 5A containing 10% FBS, and allowed to adhere overnight before the compound or vehicle control was added. The test compound was added and incubated with the cells in a humidified atmosphere at 37°C for 4 or 24 hours. Cells were harvested by trypsin treatment, pelletized by centrifugation, and snap-frozen on dry ice.

[0237] The lysates were prepared using RIPA buffer (50 mM Tris hydrochloride, pH 8.0; 150 mM sodium chloride; 1.0% Igepal CA-630 (NP-40); 0.5% sodium deoxycholate; 0.1% sodium dodecyl sulfate; 1 × fully EDTA-free protease inhibitor cocktail (Roche, Nutley, NJ; catalog 05 892 791 001); 1 × phosSTOP phosphatase inhibitor cocktail (Roche Nutley, NJ; catalog 04 906 837 001)) and clarified by centrifugation at 11,000 rpm for 10 minutes using a benchtop centrifuge.

[0238] The total protein in the lysate was quantified by BCA assay according to the manufacturer's instructions (Pierce® BCA Protein Assay Kit; Thermo Scientific, Waltham, MA; Catalog 23225), boiled in sample buffer (NuPAGE LDS Sample Buffer; (Invitrogen, Carlsbad, CA; Catalog NP0007)), and stored at -80°C.

[0239] Equivalent amounts of protein (40 μg) were separated on a NuPAGE 4-12% Bis-Tris gel (Invitrogen, Carlsbad, CA; catalog WG1402BOX) and blotted onto a PVDF membrane using an iBlot gel transfer device (Invitrogen Carlsbad, CA) and an iBlot gel transfer stack (Invitrogen, Carlsbad, CA; catalog IB4010-01) according to the manufacturer's instructions.

[0240] The blots were probed using the antibodies and blocking conditions detailed in Table 16. Western blots were developed using Pierce® ECL2 Western blotting substrate (Thermo Scientific, Waltham, MA; catalog 80196) and imaged using FluorChem M Western blot imager (ProteinSimple, San Jose, CA). [Table 16]

[0241] A class of clinically relevant MEK1 / 2 activating mutations known to upregulate the MAPK pathway and drive acquired resistance to BRAF or MEK inhibitors is exemplified by the MEK1(Q56P) mutation.

[0242] In this study, using pairs of RKO BRAF(V600E) cell lines with isogenic genotypes, we evaluated the effects of the activating MEK mutation in response to the novel ERK inhibitor BVD-523 compared to other benchmark MAPK inhibitors.

[0243] The effect on cell viability was evaluated by quantifying cellular ATP levels using CellTiter-Glo® after 96 hours. Monotherapy assays demonstrated that double mutant BRAF(V600E)::MEK1(Q56P) cells showed significantly reduced sensitivity to inhibition with benchmark clinical BRAF inhibitors (exemplified by dabrafenib) or MEK inhibitors (exemplified by trametinib) compared to parental BRAF(V600E) cells, thus demonstrating the suitability of this isogeneic model for replicating acquired resistance known to be associated with this class of mutations in clinical settings (Table 17). [Table 17]

[0244] In contrast, the response to BVD-523 was identical in both parental and double mutant cells, indicating that BVD-523 is less susceptible to acquired resistance mechanisms.

[0245] These results were identical in two independently obtained double mutant BRAF(V600E)::MEK1(Q56P) cell line clones, confirming that the differences in their responses to the parental cells are specifically related to the presence of the MEK1 mutation and not to unrelated clonal artifacts (Figures 22A-22E). Similar results were observed when using a second, mechanistically distinct benchmark ERK inhibitor (SCH772984), supporting the idea that these observations are specifically related to ERK inhibition and not due to off-target effects.

[0246] The effects of combining BVD-523 with a BRAF inhibitor (exemplified by dabrafenib) were also evaluated across the concentration matrix in these cell lines using Horizon's Chalice® combination analysis software with Loewe additive or Bliss independent models (Figures 23–23O and 24A–24O). The presence of potential synergistic interactions was then assessed by showing calculated excess inhibition beyond what was predicted to be additive across the dose matrix as a heatmap, and by calculating a “Volume Score” indicating whether the overall response to the combination was synergistic (positive value), antagonistic (negative value), or additive (approximately 0).

[0247] The results suggest that the BVD-523::dabrafenib combination was primarily additive in both the parental and mutant cell lines. In contrast, the combination of a MEK inhibitor (trametinib) and dabrafenib was mostly additive in the parental cell line, but showed strong synergy in the double mutant BRAF(V600E)::MEK1(Q56P) cell line (Figures 25A-25O). Loewe volume, Bliss volume, and synergy scores for the tested combinations are shown in Tables 18-20, and graphed in Figures 26A-26C. [Table 18] [Table 19] [Table 20]

[0248] The effect on MAPK pathway signaling was evaluated by Western blotting. In the MEK1(Q56P)-expressing strain, the level of basal ERK phosphorylation (DMSO sample) was significantly upregulated compared to the parent, further confirming that this isogeneic model faithfully reproduces the expected phenotype for the expression of MEK-acquired resistance mutations.

[0249] In parental BRAF(V600E)RKO cells, a decrease in RSK1 / 2 phosphorylation levels was observed after short-term treatment with pharmacologically active concentrations of RAF, MEK, and ERK kinase inhibitors. In contrast, isogeneic double mutant BRAFV600E::MEK1Q56P cells did not show a decrease in RSK phosphorylation after treatment with BRAF or MEK inhibitors, but BVD-523 remained effective at similar concentrations (Figures 27A-27I). The dotted lines indicate that samples treated with trametinib (plus a matching DMSO control) and blots originated from a different experiment than those treated with BRAFi and BVD-523.

[0250] After prolonged treatment with inhibitors, changes in effector gene signaling consistent with the cell proliferation inhibition pattern are observed. In the parental RKO strain, a decrease in phosphorylated pRB levels is observed after prolonged treatment with MEK inhibitors and ERK inhibitors. In terms of pRB modulation levels, MEK1 mutant strains appear to be insensitive to low concentrations of MEK inhibitors but remain effective at higher concentrations. Crucially, the efficacy of BVD-523 on pRB activity does not appear to be strongly influenced by MEK mutations. Surprisingly, treatment with RAF inhibitors does not affect pRB status, despite strongly inhibiting upstream signaling in both parental and MEK mutant backgrounds.

[0251] In summary, these results indicate that BVD-523 is less susceptible to acquired resistance driven by MEK-activating mutations such as MEK1(Q56P). Furthermore, in combination, the interaction between BVD-523 and BRAFi (exemplified by dabrafenib) is suggested to be additive regardless of the presence of MEK-activating mutations. (Example 8) Combinatorial interactions between ERK inhibitors

[0252] RAF mutant melanoma cell line A375 cells were cultured in DMEM with 10% FBS and seeded in a triple 96-well plate at an initial density of 2000 cells per well. After 72 hours, the combined interaction between the ERK inhibitor BVD-523 and SCH772984 was analyzed as described above in Example 4. Viability was determined using CellTiter-Glo® reagent (Promega, Madison, WI) according to the manufacturer's instructions, and luminescence was detected using a BMG FLUOstar plate reader (BMG Labtech, Ortenberg, Germany).

[0253] Visualization of Loewe and Bliss's "excess inhibition" heatmaps suggested that the combination of BVD-523 and SCH772984 is primarily additive, with a potential synergistic window at intermediate doses (Figures 28A-28E).

[0254] In summary, these results suggest that the interaction between BVD-523 and SCH772984 is at least additive, and in some cases synergistic. (Example 9) Targeting the MAPK signaling pathway in cancer: Promising activity of a novel selective ERK1 / 2 inhibitor, BVD-523 (urixertinib)

[0255] Cancer treatment strategies have evolved from classical cytotoxicity-based approaches to drugs that counteract the effects of genetic lesions driving abnormal signaling essential for tumor growth and survival. For example, the ERK module (RAS-RAF-MEK-ERK) of the mitogenic factor-activated protein kinase (MAPK) signaling cascade (Cargnello and Rouxx, 2011) can be activated by several receptor tyrosine kinases (e.g., EGFR and ErbB-2), in addition to constitutively activated mutations of pathway components such as RAS and BRAF (Gollob et al., 2006). Through abnormal activation of ERK signaling, genetic alterations in RAS or BRAF lead to rapid tumor growth, increased cell survival, and resistance to apoptosis (Poulikakos et al., 2011; Corcoran et al., 2010; Nazarian et al., 2010; Shi et al., 2014; Wagle et al., 2011). Activating mutations in RAS family members KRAS and NRAS are found in approximately 30% of all human cancers, with particularly high incidences in pancreatic cancer (Kanda et al., 2012) and colorectal cancer (Arrington et al., 2014). Constitutively activating mutations in the BRAF gene, which normally encodes valine at amino acid 600, have been observed in melanoma, thyroid cancer, colorectal cancer, and non-small cell lung cancer (Hall et al., 2014). Cancers with gene mutations that result in changes in downstream components ERK and MEK have also been reported (Ojesina et al., 2014, Arcila et al., 2015). Activation-induced changes are also frequently observed in the context of resistance to targeted therapy (Groenendijk et al.). (2014). Therefore, targeting MAPK pathway terminal master kinases (ERK1 / 2) is a promising strategy against tumors with such pathway activation alterations (e.g., BRAF, NRAS, and KRAS).

[0256] Drugs targeting three MAPK pathways: Vemurafenib and dabrafenib, which are BRAF inhibitors, and trametinib, which is a MEK inhibitor, target BRAFV600 It is approved by the U.S. Food and Drug Administration (FDA) for monotherapy of unresectable or metastatic cutaneous melanoma with mutations. Furthermore, the combination of dabrafenib and trametinib is also approved for this indication (Queirolo et al., 2015 and Massey et al., 2015). The additional MEK inhibitor cobimetinib is approved for this indication as part of a combination regimen with a BRAF inhibitor. Clinical experience with these drugs validates the MAPK pathway as a therapeutic target. BRAF V600 In Phase III trials in patients with mutant melanoma, vemurafenib and dabrafenib monotherapy demonstrated superior response rates (approximately 50% vs. 5-19%) and median progression-free survival (PFS, 5.1-5.3 months vs. 1.6-2.7 months) compared to cytotoxic chemotherapy (dacarbazine) (Chapman et al., 2011; Hauschild et al., 2012). Furthermore, clinical combination therapy with BRAF+MEK targeted therapy demonstrated the ability to enhance the magnitude and duration of response by simultaneously targeting different nodes in the MAPK pathway. First-line use of BRAF+MEK targeted agents (dabrafenib / trametinib or cobimetinib / vemurafenib) further improved median overall survival compared to monotherapy with BRAF inhibition (Robert et al., 2015; Long et al., 2015; Larkin et al., 2014). Therefore, the BRAF-targeted therapy / MEK-targeted therapy combination is BRAF V600 This is a beneficial treatment option for patients with metastatic melanoma accompanied by mutations.

[0257] Despite the improved clinical outcomes observed with BRAF inhibitor / MEK inhibitor combination therapy, the lasting benefits are limited by the development of eventual acquired resistance and subsequent disease progression, with a median PFS ranging from approximately 9 to 11 months (Robert et al., 2015; Long et al., 2015; Larkin et al., 2014; and Flaherty et al., 2012). The mechanisms of genetic acquired resistance to monotherapy BRAF inhibition are actively studied, and the identification of resistance mechanisms has been linked to BRAF splice variants (Poulikakos et al., 2011), BRAF V600E Amplification (Corcoran et al., 2010), MEK mutation (Wagle et al., 2014), NRAS mutation This includes natural mutations and RTK activation (Nazarian et al., 2010 and Shi et al., 2014). Hmm. Resistance mechanisms are beginning to emerge in the context of BRAF inhibitor / MEK inhibitor combination therapy, and these reflect the mechanisms of BRAF monotherapy resistance (Wagle et al., 2014). (Long et al., 2014). All of these genetic events share the common ability to reactivate ERK signaling. In fact, reactivated MAPK pathway signaling, as measured by ERK transcription targets, is frequently observed in tumor biopsy material from BRAF inhibitor-resistant patients (Rizos et al., 2014). Furthermore, ERK1 / 2 reactivation is associated with the inheritance of resistance. It has been observed in the absence of the child mechanism (Carlino et al., 2015). Therefore, persistent In the search for achieving clinical benefits, researchers have increasingly focused on evaluating additional agents targeting ERK1 / 2, downstream MAPK components. Inhibition of ERKs may offer significant clinical benefits in patients resistant to acquired BRAF / MEK inhibitors. ERK family kinases have shown promise as therapeutic targets in preclinical cancer models, including cancers resistant to BRAF or MEK inhibitors (Morris et al., 2013 and Hatzivassiliou et al., 2012). However, the potential use of such ERK1 / 2 inhibitors extends beyond acquired resistance in melanoma.

[0258] Targeting ERK1 / ERK2 is a rational strategy not only for patients with relapsed cancer on BRAF / MEK therapy, but also for any tumor type with known MAPK drivers. Since ERK1 and ERK2 are located downstream in the pathway, this is a particularly attractive treatment strategy within the MAPK cascade, as it can circumvent upstream resistance mechanisms. This specification reports the preclinical characterization of BVD-523 (urixertinib) in models of MAPK pathway-dependent cancer, including drug-naive models and BRAF / MEK therapy-acquired resistance models. Results from the Phase I dose-finding trial of BVD-523 are included in a corresponding article in this journal. See Examples 17-24.

[0259] This invention demonstrates that BVD-523 is a potent, highly selective, reversible, small molecule ATP competitive inhibitor of ERK1 / 2, exhibiting anticancer activity in vitro and in vivo.

[0260] BVD-523 (urixertinib) was identified and characterized as a novel, reversible, ATP-competitive ERK1 / 2 inhibitor with high potency and ERK1 / 2 selectivity. BVD-523 induced reduced proliferation and enhanced caspase activity, particularly in cells with MAPK (RAS-RAF-MEK) pathway mutations. In vivo BRAF V600EIn xenograft studies, BVD-523 demonstrated dose-dependent inhibition of growth and tumor regression. Interestingly, BVD-523 inhibited phosphorylation of target substrates despite increased phosphorylation of ERK1 / 2. BVD-523 also demonstrated antitumor activity in models of acquired resistance to monotherapy and BRAF / MEK targeted therapy combinations. BVD-523 also showed BRAF inhibition when combined with BRAF inhibition. V600E A synergistic antiproliferative effect was demonstrated in a xenograft model of mutant melanoma cell lines. These studies suggest that BVD-523 has potential as a treatment for ERK-dependent cancers, including those in which tumors have acquired resistance to other treatments targeting upstream nodes of the MAPK pathway. (Example 10) Discovery and initial characterization of a novel ERK1 / 2 inhibitor, BVD-523 (urixertinib)

[0261] Following extensive optimization using high-throughput small molecule screening of the initially identified leads (Aronov et al., 2009), a novel adenosine triphosphate (ATP) competing ERK1 / 2 inhibitor, BVD-523 (urixertinib), was identified (Figure 29A). BVD-523 is a K-1 / 2 inhibitor competing against ERK2. i BVD-523 is a potent ERK inhibitor with an IC2 value of 0.04 ± 0.02 nM. BVD-523 shows increased IC25 50 The linear increase in the IC2 showed that it is a reversible competitive inhibitor of ATP (Figures 29B and 29C). 50 The ratio remained nearly constant over incubation periods of 10 minutes or more, suggesting rapid equilibrium and binding of BVD-523 and ERK2 (Figure 29D). BVD-523 is also a close-binding inhibitor of recombinant ERK1 (Rudolph et al., 2015), with a K content of less than 0.3 nM. i This indicates.

[0262] The binding of BVD-523 to ERK2 was demonstrated using calorimetry and compared with data generated using the ERK inhibitor SCH772984 and pyrazolyl pyrrole (Arovov et al., 2007). All compounds bound to and stabilized inactive ERK2 at elevated concentrations, as indicated by positive ΔTm values ​​(Figure 29E). The 10°C–15°C change in ΔTm observed with BVD-523 and SCH-772984 is consistent with compounds having low nanomolar binding affinity (Fedorov et al., 2012). BVD-523 BVD-523 showed strong binding affinity to both phosphorylated ERK2 (pERK2) and inactive ERK2 (Figure 29F). Stronger affinity was observed for pERK2 compared to inactive ERK2. BVD-523 did not interact with the negative control protein p38α MAP kinase (Figure 29F).

[0263] BVD-523 demonstrated excellent ERK1 / 2 kinase selectivity based on biochemical counterscreening against ERK1 and ERK2, as well as 75 other kinases. ATP concentration was K in all assays. m It was almost equivalent. The kinases inhibited by more than 50% with 2 μM BVD-523 were retested. i Values ​​(or apparent Ki; Table 21) were generated. Of the 14 kinases, 12 had a K value of less than 1 μM. i The selectivity of BVD-523 for ERK2 was >7000-fold for all tested kinases except ERK1, which were inhibited with Ki less than 0.3 nM (10-fold). Therefore, BVD-523 is a very potent and selective inhibitor of ERK1 / 2. [Table 21] (Example 11) In vitro, BVD-523 preferentially inhibits cell proliferation and enhances caspase-3 / 7 activity in cancer cell lines with MAPK pathway activating mutations.

[0264] BVD-523 cell activity was evaluated in a panel of approximately 1,000 cancer cell lines from various lineages and genetic backgrounds (Figure 30A and Table 22). Cell lines were classified as MAPK wild-type (wt) or mutant based on the presence or absence of mutations in RAS family members and BRAF. While some MAPK-wt cell lines were sensitive to BVD-523, generally, the proliferation of cells with altered MAPK pathways was preferentially inhibited by BVD-523.

[0265] Next, the effects of BVD-523 treatment on proliferation and survival of susceptible cells were characterized. BRAF V600E Mutant melanoma cell line UACC-62 was treated with BVD-523 at 500 nM or 2000 nM for 24 hours, followed by fluorescence-activated cell sorting (FACS) analysis. Treated cells arrested in the G1 phase of the cell cycle in a concentration-dependent manner (Figure 30B).

[0266] Furthermore, caspase-3 / 7 activity was analyzed as an indicator of apoptosis in numerous human cancer cell lines. After 72 hours of treatment with BVD-523, a concentration-dependent and cell-line-dependent increase in caspase-3 / 7 was observed (Figure 30C). As a result of treatment with BVD-523, BRAF V600 Clear caspase-3 / 7 induction was observed in a subset of MAPK-activated cell lines containing mutations (A375, WM266, and LS411N). This is consistent with previous observations regarding the preferential inhibition of proliferation by BVD-523 in MAPK pathway mutant cancer cell lines (Figure 30A).

[0267] To further characterize the mechanism of action and effects on signal transduction induced by BVD-523, BRAF treated with BVD-523 was examined. V600ELevels of various effector and MAPK-related proteins were evaluated in mutant A375 melanoma cells (Figure 30D). Phospho-ERK1 / 2 levels increased in a concentration-dependent manner after 4-hour and 24-hour treatment with BVD-523. Despite a significant concentration-dependent increase in pERK1 / 2 observed with 2 μM BVD-523 treatment, phosphorylation of the ERK1 / 2 target RSK1 / 2 decreased at both 4-hour and 24-hour time points, which is consistent with sustained inhibition. Total protein levels of DUSP6, a distal marker of ERK1 / 2 activity, were also attenuated at both 4-hour and 24-hour time points. After 24-hour treatment with BVD-523, the apoptosis marker BIM-EL increased in a dose-dependent manner, while cyclin D-1 and pRB were attenuated at 2 μM. All effects are consistent with on-target ERK1 / 2 inhibition. (Example 12) BVD-523 is BRAF V600E Mutant cancer cell lines exhibit in vivo antitumor activity in xenograft models.

[0268] Based on our in vitro findings that BVD-523 reduced proliferation in a concentration-dependent manner and induced apoptosis, we administered BVD-523 via oral nutritional supplementation to demonstrate its in vivo antitumor activity in a MAPK / ERK pathway-dependent model. We used a xenograft model of melanoma (cell line A375) and a xenograft model of colorectal cancer (cell line Colo205), both of which were BRAF models. V600E It was a mutant.

[0269] In A375 cell line xenografts, the efficacy of BVD-523 was compared with the control cytotoxic alkylating agent temozolomide after 14 days of treatment. BVD-523 showed significant dose-dependent antitumor activity, starting at 50 mg / kg twice daily (BID) (Figure 31A). Tumor growth was significantly attenuated at doses of 50 mg / kg BID and 100 mg / kg BID, with tumor growth inhibition (TGI) rates of 71% (P=0.004) and 99% (P<0.001), respectively. Seven partial regressions (PRs) were observed in the 100 mg / kg BID group; no regression response was observed in any of the other groups. The observed efficacy was favorably comparable to that of temozolomide, which yielded moderate dose-dependent TGIs of 34% (P>0.05) and 78% (P=0.005) when administered at 75 mg / kg and 175 mg / kg, respectively.

[0270] Furthermore, BVD-523 demonstrated antitumor efficacy in a Colo205 human colorectal cancer cell line xenograft model (Figure 31B). BVD-523 also showed significant dose-dependent tumor regression at doses of 50 mg / kg BID, 75 mg / kg BID, and 100 mg / kg BID, resulting in mean tumor regression T / Ti (T=end of treatment, Ti=start of treatment) of -48.2%, -77.2%, and -92.3% (all P<0.0001). No regression was observed at the lowest dose of BVD-523 (25 mg / kg BID); however, significant inhibition of tumor growth was observed with a T / C (T=treatment, C=control) of 25.2% (P<0.0001). Although not well tolerated, the positive control chemotherapeutic agent irinotecan (CPT-11) showed significant antitumor activity, inhibiting Colo205 tumor growth by 6.4% T / C (P<0.0001). However, even at its maximum tolerated dose in mice, CPT-11 was not as effective as BVD-523 at doses of 50 mg / kg BID, 75 mg / kg BID, or 100 mg / kg BID.

[0271] To establish the relationship between pharmacokinetics and pharmacodynamics, plasma concentrations of BVD-523 and pERK1 / 2 levels were measured and compared in tumors over 24 hours after a single oral administration of 100 mg / kg of BVD-523 by immunohistochemical analysis and isotope-tagged internal standard mass spectrometry (Figure 31C). ERK1 / 2 phosphorylation was low in untreated tumors (0 hours). After treatment with BVD-523, ERK1 / 2 phosphorylation steadily increased from 1 hour to 8 hours post-administration, reaching a maximum level, and then returned to pre-administration levels by 24 hours. This increase in pERK1 / 2 correlated with the plasma concentration of BVD-523. The in vivo observation of the increase in pERK1 / 2 associated with BVD-523 treatment was consistent with previous in vitro findings (Figure 30D). (Example 13) BVD-523 leads to ERK1 / 2 substrate inhibition despite increased ERK1 / 2 phosphorylation.

[0272] To investigate the effects of BVD-523 on signaling compared to other known ERK1 / 2 inhibitors (SCH772984, GDC-0994, and Vx-11e) (Morris et al., 2013 and Liu et al., 2015), various ERK-sensitive organisms were studied. Large-scale reversed-phase protein arrays (RPPAs) of approximately 40 proteins were used in the following cell lines. Cell lines with common changes in BRAF and RAS were assayed: BRAF V600E Mutant strains A375, Colo205, and HT29;KRAS G12C Mutant somatic cell line MIAPACa-2;KRAS G13D mutant somatic cell line HCT116; and atypical HRAS F82LMutant AN3Ca cells. Protein level changes are shown as percentage changes from parental controls treated with dimethyl sulfoxide (DMSO) (Figure 32A and Table 23). All ERK inhibitors elicited qualitatively similar effects on proteins, except for ERK1 / 2 phosphorylation (pERK1 / 2[ERK1 / 2-T202, -Y204]); pERK1 / 2 was inhibited in all cell lines in SCH7722984, but significantly increased in BVD-523, GDC-0994, and Vx-11e. Phospho-p90 RSK (pRSK1) and cyclin D1, the proximal and distal targets of pERK1 / 2, respectively, were similarly inhibited by all inhibitors tested, regardless of the degree of ERK1 / 2 phosphorylation (Figure 32B). These independent findings regarding BVD-523 are consistent with protein binding studies demonstrating BVD-523 binding and stabilization of pERK1 / 2 and inactive ERK1 / 2 (Figures 29E and 29F), as well as Western blotting in A375 cells showing that phosphorylation of the ERK1 / 2 substrate RSK1 / 2 remained inhibited despite a dramatic increase in pERK1 / 2 (Figure 32D). Therefore, measuring the elevation of pERK1 / 2 levels can be considered a clinical pharmacodynamic biomarker for BVD-523, and simultaneously, quantifying inhibition of ERK1 / 2 targets such as pRSK1 and DUSP6 may also serve a similar purpose.

[0273] Additional protein changes in this RPPA dataset are noteworthy (Figure 32A). The decrease in pS6-ribosomal protein is demonstrated for all compounds in all cell lines and appears to be another pharmacodynamic marker of ERK1 / 2 inhibition (Figure 32B). Furthermore, each ERK1 / 2 inhibitor induces pAKT in cell lines A375 and AN3CA, and the significant induction of pAKT appears to be a cell line-dependent observation (Figure 33). Interestingly, the degree of inhibition of the survival marker pBAD appears to differ among compounds, with pBAD inhibition by GDC-0994 being slight compared to the other ERK1 / 2 inhibitors tested (Figure 32A).

[0274] Next, BVD-523 is BRAF V600E We investigated how it affects the cellular localization of ERK1 / 2 and its downstream target pRSK in mutant RKO colorectal cell lines (Figure 32C). In resting cells, ERK1 / 2 is localized in the cytoplasm, and upon stimulation, pERK1 / 2 moves to target organelles, particularly the nucleus, where its transcriptional target is activated (Wainstein et al., 2016). In control cells treated with DMSO, pERK1 / 2 This is evident in both the nuclear and cytoplasmic fractions, and this indicates that BRAF is present in this cell line. V600E This may reflect MAPK pathway activity resulting from the presence of [the compound]. Treatment with BVD-523 resulted in elevated pERK1 / 2 levels in the nucleus and cytoplasm, as well as a moderate increase in total nuclear ERK1 / 2, compared to cells treated with DMSO, suggesting that some nuclear translocation is stimulated by the stabilization of pERK1 / 2 induced by the compound. Despite the increase in pERK1 / 2 in both compartments, pRSK levels in the cytoplasmic and nuclear compartments were lower compared to the DMSO control. Comparators, MAPK signaling inhibitors (i.e., trametinib, SCH7722984, dabrafenib), inhibited ERK1 / 2 phosphorylation and RSK, as reflected by lower levels in the nuclear and cytoplasmic compartments. These data, reiterated, suggest a BVD-523-related increase in pERK1 / 2 in both the cytoplasm and nucleus; however, this does not translate into activation of target substrates. This is consistent with the data presented in Figures 30D and 32A. (Example 14) BVD-523 showed activity in in vitro models of BRAF inhibitor and MEK inhibitor resistance.

[0275] The emergence of resistance to BRAF and MEK inhibitors limits their clinical efficacy. Therefore, this experiment explores a model to compare the development of resistance to BRAF (dabrafenib), MEK (trametinib), and ERK1 / 2 (BVD-523) inhibitors in vitro. Over several months, BRAF V600E Mutant A375 cells were cultured with progressively increasing levels of each inhibitor. Drug-resistant A375 cell lines were readily obtained after proliferation under high concentrations of trametinib or dabrafenib, but it was difficult to develop cell lines resistant to BVD-523 (Figure 34A). Overall, these in vitro data suggest that at concentrations that produce similar targeted inhibition, resistance to BVD-523 is delayed compared to dabrafenib or trametinib and may translate into a persistent clinical response.

[0276] Reactivation and dependence of ERK1 / 2 signaling are common features of acquired resistance to BRAF / MEK inhibition (Morris et al., 2013 and Hatzivassiliou et al., 2012); therefore, we evaluated the activity of BVD-523 in an in vitro model of acquired resistance. First, we obtained an A375 population resistant to the dabrafenib and trametinib combination using the described dose-increasing method. ICs from parent A375 for dabrafenib, trametinib, and BVD-523 in the population resistant to the BRAF / MEK combination were obtained. 50 and IC 50 The magnification changes are shown in Table 24. IC of BVD-523 50 While resistance shifted moderately (2.5 times), the shift was more significant with dabrafenib and trametinib (8.5 times and 13.5 times, respectively) (Table 24). Paclitaxel, a cytotoxic agent, was tested as a control, and a slight shift in potency was observed. These data support the investigation of BVD-523 in the context of resistance to BRAF / MEK therapy, although the mechanisms of resistance in this cell population have not yet been characterized. [Table 24]

[0277] To further investigate the tractability of ERK1 / 2 inhibition in models with known BRAF inhibitor resistance mechanisms, AAV-mediated gene targeting was used to generate isogenic RKO BRAF Q56P homozygous pairs with or without engineered heterozygous knock-ins of MEK1 V600E activating mutations (Trunzer et al., 201 3 and Emery et al., 2009). MEK1 Q56P mutations, including MEK1 have been implicated in both acquired resistance to single-agent BRAF and combination BRAF / MEK therapies in patients (Wagle et al., 2011, Wagle et al., 2014, Emery et al., 20 09 and Johnson et al., 2015). By single-agent assays, the double mutant BRAF V600E : :MEK1 wt cells were demonstrated to show significantly reduced sensitivity to the BRAF inhibitors vemurafenib and dabrafenib, as well as the MEK inhibitor trametinib, compared to parental BRAF V600E ::MEK1 Q56P cells (Figure 34B). In contrast, the response to BVD-523 was essentially identical in both parental and MEK Q56P mutant cells, indicating that BVD-523 is less susceptible to mechanisms of acquired resistance. These results were confirmed in two independently derived double mutant BRAF V600E ::MEK1 Q56P cell line clones and thus the results are not due to unrelated clonal artifacts but rather to MEK1 Q56PIt has been verified to be specifically related to the presence of mutations (data not shown). Similar results were observed when using a second mechanistically distinct ERK1 / 2 inhibitor (SCH772984), which supports that the expectation of these observations is specifically related to the mechanistic inhibition of ERK1 / 2 and not due to off-target compound effects.

[0278] BRAF of BVD-523 V600E ::MEK1 Q56P To further characterize the mechanistic effects on MAPK pathway signaling in cell lines, protein levels were evaluated by Western blot (Figure 34C). In parental BRAF V600E In RKO cells, after treatment with a BRAF inhibitor (vemurafenib), a MEK inhibitor (trametinib), or an ERK1 / 2 inhibitor (BVD-523) at pharmacologically active concentrations for 4 hours, a decrease in the level of pRSK1 / 2 was observed. In contrast, the isogenic double mutant BRAF V600E ::MEK1 Q56P cells did not show a decrease in RSK phosphorylation after treatment with the BRAF inhibitor or the MEK inhibitor, but BVD-523 remained effective in inhibiting pRSK1 / 2 to levels comparable to parental RKO. Similarly, pRB decreased, which indicates that cell cycle arrest at G0 / G1 occurs by 24 hours of treatment with BVD-523 in both parental RKO and BRAF V600E ::MEK1 Q56P cells.

[0279] Acquired KRAS mutations are also a known driver of resistance to MAPK pathway inhibitors. To understand the susceptibility of BVD-523 to this resistance mechanism, we used an isogeneic panel of clinically relevant KRAS mutations in the colorectal cell line SW48. Susceptibility to BVD-523 was compared to that of the MEK inhibitors selumetinib and trametinib (Figure 34D). Susceptibility to paclitaxel remained unchanged (Figure 37A). While some mutant KRAS alleles conferred robustness to resistance to intermediate levels of MEK inhibition, susceptibility to BVD-523 remained unchanged by the majority of alleles, and a shift in susceptibility was observed to a degree not seen with trametinib or selumetinib. Overall, these data suggest that BVD-523 is more effective than MEK inhibitors in this context. (Example 15) BVD-523 exhibits in vivo activity in a melanoma xenograft model derived from BRAF inhibitor-resistant patients.

[0280] To confirm and expand upon the antitumor effect of BVD-523 observed in an in vitro model of acquired resistance to BRAF- / MEK, a BRAF-resistant xenograft model derived from patients resistant to vemurafenib was used. BVD-523 was administered orally at a dose of 100 mg / kg BID for 28 days, either alone or in combination with dabrafenib at a dose of 50 mg / kg BID (Figure 35). As expected, minimal antitumor activity was demonstrated for dabrafenib monotherapy (22% TGI). BVD-523 activity was significantly greater than that of the vehicle control (P ≤ 0.05), with a TGI of 78%. In this model, the combination of BVD-523 and dabrafenib resulted in a TGI of 76% (P ≤ 0.05); therefore, in this model of acquired resistance to BRAF, no further benefit was obtained with respect to the combination compared to BVD-523 monotherapy. (Example 16) Combination therapy with BVD-523 and a BRAF inhibitor yields promising antitumor activity.

[0281] Patients with BRAF-mutated cancer may develop resistance to BRAF / MEK combination therapy (Wagle et al., 2014), which can lead to other mutations within the MAPK pathway. The consideration of this combination method is justified. The antiproliferative effect of combining BVD-523 and the BRAF inhibitor vemurafenib is considered in relation to BRAF V600E The drug was evaluated in the mutant melanoma cell line G-361. As expected, both BVD-523 and vemurafenib were active as monotherapy, and a moderate synergy was observed when combined (Figure 37B). This led to the development of BRAF. V600E In melanoma cell lines with mutations, the combination of BVD-523 and a BRAF inhibitor is shown to be at least additive and potentially synergistic. Furthermore, BRAF V600E Acquired resistance was difficult to induce in vitro after continuous culture of the mutant somatic cell line (A375) under the BRAF inhibitor + BVD-523. In contrast, resistance to dabrafenib alone developed relatively rapidly (Figure 37C). Similar resistance to the dabrafenib and trametinib combination appeared before dabrafenib + trametinib.

[0282] The benefits of the BRAF inhibition and ERK inhibition combination are that the concentration is not limited by tolerability. In vitro combination studies may not fully realize this. To understand the benefits of combinations, BRAF V600EEfficacy was evaluated in vivo using xenografts of mutant human melanoma cell line A375. Due to a notable response to the combination treatment, drug administration in the combination group was stopped on day 20 to monitor tumor regrowth and resumed on day 42 (Figure 36A). Tumors were measured twice weekly until the end of the study on day 45. The median time to endpoint (TTE) for the control group was 9.2 days, with 35.8 days, the maximum possible tumor growth delay (TGD), defined as 100%. Temozolomide treatment resulted in a TGD of 1.3 days (4%), with no regression. Dabrafenib monotherapy at 50 mg / kg and 100 mg / kg resulted in TGDs of 6.9 days (19%) and 19.3 days (54%), respectively, a significant survival benefit (P<0.001), and one PR in the 100 mg / kg group. BVD 523 monotherapy at 100 mg / kg resulted in a TGD of 9.3 days (26%), a significant survival benefit (P<0.001), and two permanent complete responses. The combination of dabrafenib and BVD-523 resulted in the maximum possible 100% TGD with a notable regression response, and statistically superior overall survival compared to their corresponding monotherapies (P<0.001). The lowest-dose combination resulted in a notable 7 / 15 tumor-free survival (TFS), and the three high-dose combinations resulted in a total of 43 / 44 TFS, consistent with curative or near-curative activity (Figure 36B). In summary, the combination of dabrafenib and BVD-523 resulted in a greater number of TFS and superior efficacy than either monotherapy.

[0283] The starting tumor volume is approximately 75-144 mm. 3 Based on the activity of BVD-523 + dabrafenib in the A375 xenograft model, follow-up experiments were conducted to determine the "higher stage" of A375 xenografts (average tumor starting volume, 700-800 mm²). 3The efficacy of combination therapy was determined in the control group (Figure 36C). The median TTE for the control group was 6.2 days, which established the maximum possible TGD of 53.8 days, defined as 100% TGD for the 60-day trial. Monotherapy with BVD-523 100 mg / kg resulted in a negligible TGD (0.7 days, 1%) and no significant survival difference compared to the control group (P>0.05). The distribution of TTE and the two PRs suggested the possibility of a subset of responders being affected by treatment with BVD-523 alone. Monotherapy with dabrafenib 50 mg / kg was effective, resulting in a TGD of 46.2 days (86%) and a significant survival benefit compared to the control group (P<0.001). This group had 5 PRs and 5 CRs, including 3 TFSs, among 11 evaluable mice (Figure 36D). All combinations of dabrafenib and BVD-523 resulted in up to 100% TGD and a significant survival benefit compared to the control group (P<0.001). While regression activity differed between combinations, 100% regression response was achieved among evaluable mice. The 25 mg / kg dabrafenib and 50 mg / kg BVD-523 combination yielded 2 PRs and 8 CRs, with a TFS of 6 / 10, while the 50 mg / kg dabrafenib and 100 mg / kg BVD-523 combination had a TFS of 11 / 11 at day 60 (Figure 36D). Overall, these data suggest that BRAF is beneficial. V600 The rationale for the cutting-edge combination of BVD-523 and BRAF-targeted therapy in mutant melanoma has been validated, and this may be extended to other tumor types with this mutation. Consideration

[0284] BVD-523 is a potent, highly selective, reversible, small molecule ATP-competitive inhibitor of ERK1 / 2 with activity in in vivo and in vitro cancer models. In vitro, BVD-523 showed potent inhibition against several human tumor cell lines, particularly those with activating mutations in the MAPK signaling pathway, consistent with its mechanism of action. BVD-523 induced inhibition of pRSK, a direct substrate of ERK1 / 2, and alterations in downstream target and effector proteins, including total DUSP6 protein levels. These findings are consistent with previous studies (Morris et al., 2013 and Hatzivassiliou et al., 2012) demonstrating effective suppression of pRSK using ERK1 / 2 inhibition. Interestingly, treatment with BVD-523 resulted in a significant increase in ERK1 / 2 phosphorylation in vitro and in vivo. Similar to our findings, an increase in pERK1 / 2 levels has been reported with the ERK1 / 2 inhibitor Vx11e; conversely, pERK1 / 2 inhibition occurs with SCH772984 (Morris et al., 2013). Differences in pERK1 / 2 levels were observed among the various ERK1 / 2 inhibitors tested, but downstream effectors (i.e., pRSK1 and total DUSP6) were also inhibited. These findings suggest that the quantification of ERK1 / 2 target substrates such as pRSK1 can function as a reliable pharmacodynamic biomarker for BVD-523-mediated inhibition of ERK1 / 2 activity.

[0285] BRAF inhibitors (dabrafenib, vemurafenib) and MEK inhibitors (trametinib, cobimetinib) can affect the MAPK pathway, particularly BRAF. V600 While it is being validated as a therapeutic target in patients with mutations, the antitumor response is limited by the emergence of acquired resistance and subsequent disease progression. Resistance is associated with the upregulation and activation of compensatory signaling molecules (Nazarian et al., 2010; Villanueva et al., 2010; Johannessen et al., 2010). (10 years and Wang et al., 2011), amplification of target genes (Corcoran et al., 2010), and activation mutations of pathway components (e.g., RAS, MEK) (Wagle et al., 2011) This is due to the ERK1 / 2 pathway (Emery et al., 2009 and Wang et al., 2011). Reactivation of MEK is one of the common consequences of acquired resistance mechanisms. Q56P ga BRAF V600E When introduced into the mutant melanoma cell line A375, resistance to MEK inhibition and BRAF inhibition is conferred (Wagle et al., 2011). In contrast, BVD-523 This is an engineered MEK Q56PIt retains its potent inhibitory activity in cell lines, demonstrating that ERK1 / 2 inhibition is effective in situations of upstream activation changes that may occur in response to BRAF / MEK treatment. As further evidence of BVD-523's role in acquired resistance, its efficacy was evident in a xenograft model derived from tumor samples from patients whose disease progressed with vemurafenib; the BRAF inhibitor dabrafenib was ineffective in this model. These data support the role of targeting ERK1 / 2 in BRAF / MEK resistance situations and complement previously published findings (Morris et al., 2013 and Hatzivassiliou et al., 2012). To further characterize resistance to MAPK pathway inhibitors, the emergence of resistance to BVD-523 itself was investigated. Monotherapy with BVD-523 has been found to be persistent in cancer cells, and resistance is less likely to develop compared to other drugs that target upstream MAPK signaling components (i.e., dabrafenib, trametinib). This may suggest that acquiring resistance to ERK1 / 2-targeted agents is more difficult than acquiring resistance to BRAF or MEK therapy, potentially due to the fact that BVD-523 preferentially targets a more conserved and active conformation of the ATP-binding site. However, in vitro studies with other ERK1 / 2 inhibitors have identified specific ERK1 / 2 mutants that drive resistance (Jha et al., 2016 and Goetz et al., 2014); these specific mutations have not yet been identified in clinical samples from patients who have relapsed with ERK1 / 2 inhibitors.

[0286] The potential clinical utility of ERK1 / 2 inhibition using BVD-523 extends beyond the context of BRAF / MEK-resistant patients. Since ERK1 / 2 is a downstream master node in this MAPK pathway, its inhibition is attractive in the context of numerous cancers where tumor growth depends on MAPK signaling. Approximately 30% of all cancers have RAS mutations; therefore, targeting downstream ERK1 / 2 with BVD-523 is a rational treatment approach for these cancers. Furthermore, results from Hayes et al.'s study demonstrate that prolonged ERK1 / 2 inhibition in KRAS-mutated pancreatic cancer is accompanied by senescence-like growth suppression (Hayes et al., 2016). However, in the context of RAS mutations... Combination techniques may be necessary for the maximum and most permanent attenuation of MAPK signaling. For example, MEK inhibition in KRAS mutant colorectal cancer cells elicits an adaptive response of ErbB family activation, which reduces the response to MEK inhibition (Sun et al., 2014). A similar situation-specific adaptive response using BVD-523 This may occur after ERK1 / 2 inhibition. The optimal combination of treatments for various gene profiles and cancer histological examinations is a subject of ongoing research. BRAF V600 In addition to mutations and RAS mutations, other changes that drive MAPK are emerging. For example, novel RAF fusions that promote RAF dimerization and atypical non-V600 BRAF mutations activate the MAPK pathway (Yao et al., 2015). V600 BRAF inhibitors such as vemurafenib and dabrafenib, which inhibit mutant monomeric proteins, have been shown to be inactive in atypical RAF alterations that drive MAPK signaling in a dimerization-dependent manner (Yao et al., 2015). However, in these tumors... Treatment using BVD-523 to target downstream ERK1 / 2 could be a novel approach to address this unmet medical need.

[0287] BRAF V600In the context of mutant melanoma tumors, the combination of BRAF inhibition and MEK inhibition exemplifies how treatment response and duration are improved by drugs targeting different nodes in the same pathway. (BRAF inhibition in human melanoma cell line A375) V600E Our combination studies on mutant xenografts provide support for combination therapy with BVD-523 and BRAF inhibitors. The combination demonstrated superior benefits compared to monotherapy, including results consistent with a curative response. The clinical efficacy and tolerability of BRAF / BVD-523 combination therapy have not yet been determined. It is not unreasonable to expect that the BRAF / ERK1 / 2 combination will be at least equivalent in efficacy to the targeted BRAF / MEK combination. Furthermore, in vitro observations that achieving acquired resistance to BVD-523 is more difficult compared to other MAPK pathway inhibitors suggest that the BRAF / BVD-523 inhibitor combination has the potential to produce a more persistent response.

[0288] Significant progress has been made using immunotherapy for melanoma. The US FDA has approved a variety of immune checkpoint inhibitors for the treatment of advanced melanoma, including the cytotoxic T lymphocyte antigen 4 targeting agent ipilimumab and the programmed death-1 inhibitors pembrolizumab and nivolumab. Combining BVD-523 with such immunotherapy is an attractive treatment option; exploring dosing schedules and evaluating whether a synergistic response can be achieved would be good reasons for further investigation.

[0289] Based on preclinical data, BVD-523 shows promise for treating patients with MAPK signaling-dependent malignancies, including those with acquired resistance to other treatments. The clinical development of BVD-523 is described below. See Examples 17-24. (Example 17) Phase I dose-escalation study of BVD-523 (urixertinib), a novel oral ERK1 / 2 kinase inhibitor and a breakthrough drug in patients with advanced solid tumors.

[0290] This invention describes a first-in-human dose-escalation study of an ERK1 / 2 inhibitor for treating patients with advanced solid tumors. BVD-523 has an acceptable safety profile with favorable early evidence of pharmacokinetic and clinical activity.

[0291] The mitogenic factor-activated protein kinase (MAPK) signaling pathway via the RAS-RAF-MEK-ERK cascade plays a crucial role in carcinogenesis; therefore, it attracts significant interest as a therapeutic target. This ubiquitous pathway consists of the RAS, upstream of the cascade of protein kinases RAF, MEK1 / 2, and ERK1 / 2. RAS is activated by GTP binding, which in turn sequentially activates each protein kinase. While these appear to be simply physiological substrates of MEK1 / 2, ERK1 / 2 has numerous targets in the cytoplasm and nucleus, including the transcription factors Elk1, c-Fos, p53, Ets1 / 2, and c-Jun (Shaul et al., 2007). / 2 activation and kinase activity are involved in various processes related to cell proliferation, differentiation, and survival, including the activation of ribosomal S6 kinase (RSK) family members (Romeo et al., 2012). It exerts influence through mechanisms (Rasola et al., 2010).

[0292] Constitutive, abnormal activation of the RAS-RAF-MEK1 / 2-ERK1 / 2 signaling pathway has been identified and is associated with the development or maintenance of many cancers (Schubbert et al., 2 (Schubbert et al., 2007 and Gollob et al., 2006). Mutations in RAS family genes such as KRAS, NRAS, and HRAS are the most common, and activating RAS mutations occur in about 30% of human cancers (Schubbert et al., 2007). KRAS mutations affect the pancreas. (>90%) (Kanda et al., 2012), biliary tract cancer (3%~50%) (Hezel et al., 2014), colorectal cancer (30%~50%) (Arrington et al., 2012), lung cancer (27%) %) (Pennycuick et al., 2012), ovarian cancer (15%~39%) (Dobrzycka et al., 2012) NRAS mutations are widely seen in endometrioid endometrial cancer (18%) (O'Hara and Bell, 2012), and in melanoma (20%) (Khattak et al., 2013). Bimyeloid leukemia (8%–13%) (Yohe, 2015) is widespread, and HRAS mutations are also widespread in bladder cancer (12%) (Fernandez-Medarde and Santos, 2011). Mutations in the RAF family genes, particularly BRAF, are especially common in melanoma. BRAF mutations have been identified in 66% of malignant melanomas and about 7% of a wide range of other cancers (Davies et al., 2002), while MEK mutations are rarer, accounting for an overall incidence of 8% in melanoma (Nikolaev et al., 2012). In contrast, ERK mutations that lead to tumorigenesis have rarely been reported to date (Deschenes-Simard et al., 2014).

[0293] The U.S. Food and Drug Administration (FDA) has designated two selective BRAF inhibitors, vemurafenib and dabrafenib, as BRAF inhibitors. V600 It is approved as monotherapy for patients with mutant metastatic melanoma (Taflinar [package insert] and Zelboraf [package insert]). The response rate for these targeted therapies is BRAF V600 While the response rate can be as high as 50% in patients with mutations, the duration of the response is often measured in months rather than years (Hauschild et al., 2012 and McArthur et al.). (2014). Trametinib, a MEK1 / 2 inhibitor, is also approved as a monotherapy in this situation (Mekinist [package insert]), but more commonly, it is used in combination with dabrafenib, a BRAF inhibitor. The first-line use of trametinib and dabrafenib combination therapy has resulted in a much greater improvement in overall survival compared to vemurafenib monotherapy without an increase in overall toxicity (Robert et al., 2015), highlighting the potential utility of simultaneously targeting multiple proteins in this MAPK signaling pathway. This therapeutic combination also resulted in lower incidences of MEK inhibitor-related skin lesions and BRAF inhibitor-induced hyperproliferative skin lesions compared to each monotherapy alone (Flaherty et al., 2012). Recently, a Phase III trial showed that BRAF V600E / K In patients with mutation-positive melanoma, dabrafenib plus trametinib demonstrated significant improvements compared to dabrafenib alone in overall survival (25.1 months vs. 18.7 months, hazard ratio [HR] 0.71, P=0.0107), progression-free survival (PFS) (11.0 months vs. 8.8 months, HR 0.67, P=0.0004), and overall response (69% vs. 53%; P=0.0014) (Long et al., 2015). Similarly, the combination of cobimetinib and vemurafenib demonstrated significant improvements in PFS (9.9 months vs. 6.2 months, HR 0.51, P<0.001) and complete response (CR) or partial response (PR) rates (68% vs. 45%; P<0.001) compared to vemurafenib alone (Larkin et al., 2014). For this purpose, BRAF V600E / K The combination of vemurafenib and cobemetinib for mutant melanoma In contrast, FDA approval was recently granted. Based on these and related findings, the combination of a BRAF inhibitor + MEK inhibitor is considered to be effective against BRAF V600E / K It has become the standard targeted treatment option for patients with metastatic melanoma containing mutations.

[0294] While BRAF / MEK-targeted combination therapy has been demonstrated to provide significant additional benefits over monotherapy options, resistance and disease progression eventually occur in the majority of patients after approximately 12 months (Robert et al., 2015; Flaherty et al., 2012; and Long et al., 2015). Several mechanisms of acquired resistance after either monotherapy or combination therapy have been identified, including the generation of BRAF splicing variants, BRAF amplification, the development of NRAS or MEK mutations, and the upregulation of bypass pathways (Poulikakos et al., 2011; Corcoran et al., 2010; Nazarian et al., 2010; Shi et al., 2014; Johannessen et al., 2010; Wagle et al., 2011; Wagle et al., 2014; and Ahronian et al., 2015). At the heart of many of these resistance mechanisms is the reactivation of ERK signaling, which enables rapid recovery of MAPK pathway signaling and escape of tumor cells from monotherapy BRAF or BRAF / MEK inhibitor therapy combinations (Paraiso et al., 2010). Since RK is the most distal master kinase in this MAPK signaling pathway, ERK inhibition may provide an opportunity to circumvent or overcome resistance from upstream mechanisms. This is supported by preclinical evidence that inhibition of ERK with small molecule inhibitors acts to inhibit the emergence of resistance and to overcome acquired resistance to BRAF and MEK inhibitors (Morris et al., 2013 and Hatzivassiliou et al., 2012).

[0295] BVD-523 is a highly potent, selective, reversible, ATP-competitive ERK1 / 2 inhibitor that has been shown to reduce tumor growth and induce tumor regression in BRAF and RAS mutant xenograft models. Furthermore, monotherapy with BVD-523 inhibited human xenograft models that were cross-resistant to both BRAF and MEK inhibitors. See Examples 9–16. Therefore, an open-label, first-in-human trial of oral BVD-523 (Clinicaltrials.gov identifier, NCT01781429) was initiated to identify the maximum tolerated and recommended dose for further study. This trial also aimed to evaluate the pharmacokinetic and pharmacodynamic properties and preliminary efficacy in patients with advanced cancer. (Example 18) Patient characteristics

[0296] A total of 27 patients were enrolled and received at least one dose of the study drug from April 4, 2013 to December 1, 2015. Baseline demographics and disease characteristics are shown in Table 25. The median age of patients was 61 years (range, 33–86 years). 52 percent (14 / 27) of patients were male, and 63% (17 / 27) had Eastern Cooperative Oncology Group (ECOG) performance status 1. Melanoma was the most common cancer (30%; BRAF mutations were present in 7 / 8 of these patients). The remaining patients had colorectal cancer (19%; 5 / 27), papillary thyroid cancer (15%; 4 / 27), or non-small cell lung cancer (NSCLC) (7%; 2 / 27), and 8 (30%) were classified as having other cancers (2 with pancreatic cancer, 1 with appendiceal cancer, 1 with non-seminoma germ cell carcinoma, 1 with ovarian cancer, and 3 with cancer of unknown primary origin). The majority of patients were receiving two or more pre-emptive systemic therapies, with 41% (11 / 27) receiving two to three pre-emptive systemic therapies and 48% (13 / 27) receiving >3 pre-emptive systemic therapies. [Table 25] (Example 19) Effect of BVD-523 on RSK1 / 2 phosphorylation in ex vivo

[0297] To demonstrate the inhibitory effect of BVD-523 on ERK activity, we developed an ex vivo biomarker assay that can be used to support clinical trials. This assay expands on preclinical cytological data showing that MAPK signaling inhibitors such as BVD-523, dabrafenib, trametinib, and vemurafenib inhibit RSK phosphorylation in BRAF mutant cancer cell lines in a concentration-dependent manner. See Examples 9-16. Specifically, we used ERK inhibitor-dependent inhibition of phorbol 12-myristate 13-acetate (PMA)-stimulated phosphorylation of the ERK substrate RSK1 in whole blood as a target marker. When BVD-523 was directly added to whole blood from healthy volunteers, PMA-stimulated RSK phosphorylation decreased with increasing concentrations of BVD-523 (Figure 38). Average IC for cumulative data 50 The RSK phosphorylation level for BVD-523 was 461 ± 20 nM, and the maximum inhibition was 75.8 ± 2.7% with 10 μM BVD-523. Maximum inhibition was defined as RSK phosphorylation measured in the presence of 10 μM BVD-523. Patient-derived whole blood samples collected immediately before or at defined time points after BVD-523 administration were similarly tested to quantify the level of RSK phosphorylation. (Example 20) Dose escalation, dose-limiting toxicity (DLT), maximum tolerated dose (MTD), and recommended Phase II dose (RP2D)

[0298] As per the protocol, a cohort of five single patients (10–150 mg, twice daily [BID]) was continued without evidence of DLT. The 300 mg BID cohort was expanded to more characterize BVD-523 exposure. Of the six patients who received 600 mg BID, one developed DLT, a grade 3 rash. The 900 mg BID dose exceeded the MTD, resulting in one patient with grade 3 pruritus and elevated aspartate aminotransferase (AST), and another with grade 3 diarrhea, vomiting, dehydration, and elevated creatinine (Table 26). The subsequent intermediate dose, 750 mg BID, also exceeded the MTD, resulting in one patient with grade 3 rash and grade 2 diarrhea, as well as grade 2 hypotension, and another with elevated creatinine and anemia, resulting in DLT. Therefore, the MTD and RP2D were determined to be 600 mg BID. [Table 26] (Example 21) Adverse events (AEs)

[0299] The principal investigator evaluated treatment-related adverse events (AEs) in 26 out of 27 patients (96%), regardless of grade. The most common treatment-related AEs (>30%) were rash (primarily acne-like) (70%), fatigue (59%), diarrhea (52%), and nausea (52%) (Table 27). No patients experienced grade 4 or 5 treatment-related AEs, nor were treatments discontinued due to treatment-related AEs. The majority of events were grade 1-2, with grade 3 treatment-related events occurring in 13 out of 27 patients (48%). The only grade 3 treatment-related events present in more than 10% of patients were diarrhea (15%) and elevated liver function test values ​​(11%), all of which occurred above the 600 mg BID dose. [Table 27]

[0300] A total of 28 serious adverse events (SAEs) occurred in 14 patients. Of these, 9 patients were considered by the principal investigator to be related to or likely related to BVD-523, and these SAEs included dehydration, diarrhea, or elevated creatinine (2 patients each), vomiting, nausea, and fever (1 patient each). All other SAEs were considered unrelated to treatment with BVD-523. During the study, dose reductions due to AEs were performed in 3 patients: one patient was reduced from 600 mg BID to 300 mg BID, and two patients were reduced from 900 mg BID to 600 mg BID. (Example 22) Pharmacokinetics

[0301] The single-dose and steady-state pharmacokinetics of BVD-523 are summarized in Figure 39A and Table 28. Generally, in patients with advanced malignant tumors, orally administered BVD-523 is absorbed slowly. Maximum concentration (C max After reaching ), plasma BVD-523 levels persist for approximately 2-4 hours. Thereafter, plasma drug concentrations gradually decrease. Since plasma drug concentrations were only measured up to 12 hours after morning dosing, it was impossible to calculate the effective or terminal phase elimination rate. The pharmacokinetics of BVD-523, when administered at a maximum dose of 600 mg BID, are C max Both the exposure curve and the area under the curve (AUC) were linear and proportional to the dose. No further increase in exposure was observed when the dose was increased from 600 to 900 mg BID. max For all doses exceeding 20 mg BID, based on ex vivo whole blood assay (approximately 200 ng / mL), EC 50 The level reached this point. Furthermore, steady-state exposure, for dose levels of ≥150 mg BID, was maintained throughout the entire duration of treatment for the target EC. 50or remained above that level. The minimum plasma accumulation of BVD-523 and its metabolites was observed at low (<75 mg BID) dose levels on day 15, while accumulation at higher dose levels ranged from approximately 1.3 to 4.0 times. Pre-dose concentrations on day 22 were generally similar to those on day 15, indicating that a steady state had already been reached by day 15 (data not shown). Inter-patient variability regarding plasma exposure to BVD-523 and its metabolites was moderate and considered acceptable. [Table 28]

[0302] Urinary excretion of BVD-523 after the first dose and at steady state was negligible at all dose levels within 12 hours post-administration (<0.2% of the dose) and was dose-independent within this very low percentage range. Renal clearance appeared to be dose-independent. Individual renal clearance values ​​ranged from 0.128 to 0.0895 L / hr (n=1 per dose level), with a mean value ranging from 0.0149 to 0.0300 L / hr (n≧3). (Example 23) Pharmacodynamic confirmation of targeted inhibition by BVD-523

[0303] To confirm on-target and pathway inhibition by BVD-523, RSK-1 phosphorylation was investigated as a targeted biomarker in human whole blood samples from patients with solid tumors who received BVD-523. Steady-state whole blood samples from BVD-523-treated patients, collected immediately before administration on day 15, showed concentration-dependent inhibition of PMA-stimulated ERK activity (Figure 39B), ranging from 0% ERK inhibition with 10 mg BID to 93±8% ERK inhibition with 900 mg BID. Plasma BVD-523 concentrations that resulted in 50% inhibition of ERK phosphorylation were similar regardless of whether BVD-523 was directly spiked into the plasma of healthy volunteers or present after oral administration in patients. (Example 24) antitumor effect

[0304] Tumor response to BVD-523 was evaluated in 25 patients evaluable using the Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST v1.1); two patients did not undergo both scans for the target lesion and therefore were not evaluated using RECIST v1.1. No patients achieved a complete response, but three patients (all patients had BRAF) achieved complete response. V600 Partial response was achieved in patients with mutant melanoma (129 days [naive to BRAF / MEK inhibitors], continued for 294 days [anti-treatment to previous BRAF / MEK inhibitors], continued for 313 days until the data cutoff [intolerant to other BRAF / MEK inhibitors]) (Figure 40A). Interestingly, all three partial responders had BRAF mutant melanoma. In one partial responder who received BVD-523 at a dose of 450 mg BID, the total target lesions were reduced by approximately 70% from baseline, while the other partial responders showed reductions of 47.0% and 33.6%, respectively. Disease stability was demonstrated in 18 patients, six of whom remained stable for longer than 6 months, and six additional patients remained stable for longer than 3 months. In this study, four patients showed disease progression at the first evaluation time.

[0305] Figure 40B shows a computed tomography (CT) scan of one of three partial responders (RECIST v1.1) whose disease progressed with previous treatment with vemurafenib and subsequent treatment with dabrafenib / trametinib; a persistent partial response was observed after administration of BVD-523 at 600 mg BID for >300 days. Fluorodeoxyglucose-positive emission tomography ( 18 Using F-FDG-PET, BVD-523 was associated with metabolic responses in 5 out of 16 evaluable patients.

[0306] Figure 41 shows the time to efficacy and duration of response in the study population. Two patients who responded to BVD-523 remained in the study at the study cutoff date (>500 days) and continued treatment with BVD-523; in addition, one patient with bronchoalveolar NSCLC (not sufficient tissue for molecular profiling) was treated with stable disease for >700 days. Of the 27 patients, 24 (90%) discontinued treatment due to progression (22 / 27, 82%) or other reasons (2 / 27, 7%). The mean duration of treatment with BVD-523 before discontinuation was 4.7 months. Consideration

[0307] This invention presents results from a first-in-human study evaluating the safety, pharmacokinetics, pharmacodynamics, and preliminary efficacy of BVD-523 in 27 patients with advanced solid tumors. In this dose-escalation study, treatment with oral BVD-523 resulted in both a radiographic response according to RECIST v1.1 (3 partial responses) and prolonged disease stabilization in some patients, the majority of whom had been treated with two or more prior systemic therapies. 18 Imaging of tumor uptake of F-glucose established evidence of BVD-523-dependent inhibition of metabolic responses in tumors in a subset of patients. Drug exposure increased linearly with increasing dose up to 600 mg BID, and exposure at 600 mg BID resulted in nearly complete 24 / 7 inhibition of ERK-dependent substrate (RSK-1) phosphorylation in ex vivo whole blood assays. Furthermore, tolerability of BVD-523 was manageable when administered up to its determined MTD and RP2D at 600 mg BID.

[0308] BVD-523 was generally well-tolerated and possessed manageable and reversible toxicity. The most common adverse events (AEs) were skin rash (usually acne-like), fatigue, and gastrointestinal side effects including nausea, vomiting, and diarrhea. The safety profile of BVD-523 is consistent with its selective inhibition of the MAPK pathway; the AE profile indicates a potential overlap with that of MEK inhibitors. However, toxicity associated with any targeted therapy can depend on both the specific mechanism and degree of targeted inhibition, as well as any off-target effects (Zelboraf [package insert] and Hauschild et al., 2012). Subsequent investigations will extend to both the efficacy and safety profiles demonstrated in this dose-escalation study, providing guidance on how the unique profile of the ERK inhibitor BVD-523 can be used as a monotherapy or in combination with other drugs.

[0309] Persistent responses to RAF and MEK inhibitors are often limited by endogenous and acquired tolerance, which are frequently characterized by the involvement of ERK pathway reactivation (Poulikakos et al., 2011; Corcoran et al., 2010; Nazarian et al., 2010; Shi et al., 2014; Johannessen et al., 2010; Wagle et al., 2010). (Wagle et al., 2011; Ahronian et al., 2014; Paraiso et al., 2015; Paraiso et al., 2010). Therefore, ERK inhibition using BVD-523 alone or in combination with other MAPK signaling pathway inhibitors may have the potential to delay the development of resistance to existing therapies and benefit a broader patient population. ERK inhibitors, including BVD-523 which retains efficacy in BRAF-resistant and MEK-resistant cell lines, provide preclinical evidence for the use of ERK inhibitors in patients with acquired resistance to standard treatment (BRAF / MEK combination therapy). See, for example, Examples 9-16. Importantly, in this study, patients whose cancer progressed after disease stabilization when initially treated with a BRAF inhibitor (vemurafenib) and then subsequently treated with a combination of a BRAF inhibitor and a MEK inhibitor (dabrafenib / trametinib) showed a partial response to BVD-523 monotherapy. This patient continued to undergo the trial for a total of 708 days as of the trial cutoff date reported herein. Based in part on the antitumor effects observed in this patient, the FDA has declared that unresectable or metastatic BRAF is resistant to treatment with BRAF and / or MEK inhibitors(s), or has progressed after treatment. V600 The study of BVD-523 for the treatment of patients with mutation-positive melanoma has been designated as a Fast Track development program. Additional clinical trials are needed to precisely define how BVD-523 can best support patient care (e.g., as a monotherapy or in various combinations).

[0310] In summary, this embodiment presents data from the initial dose-escalation portion of a Phase I trial evaluating BVD-523, a novel, groundbreaking ERK inhibitor, as a treatment for patients with advanced cancer. Treatment with continuous, twice-daily oral BVD-523 resulted in antitumor effects in several patients, including those naive to or who had progressed with available MAPK pathway-targeted therapies. BVD-523 was generally well-tolerated in this advanced cancer patient population, and toxicity was manageable; the MTD and RP2D were 600 mg BID. Exposure to BVD-523 increased linearly up to RP2D, demonstrating robust pharmacodynamic effects at this dose level. To confirm and expand upon the observations made during the dose-escalation phase, an expansion of this Phase I clinical study is currently underway. Specifically, patients will be enrolled in expanded cohorts molecularly classified across various histological values ​​(e.g., NRAS, BRAF, MEK, or ERK changes). Furthermore, the expanded cohort will evaluate the use of BVD-523 in patients who are naive to available MAPK pathway therapies or in patients with cancer whose disease has progressed with such treatments. document [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0311] All documents cited in this application are thus incorporated by reference in the same way as they are enumerated herein.

[0312] While exemplary embodiments of the present invention are described herein, it should be understood that the present invention is not limited to the embodiments described herein, and that those skilled in the art can make various other changes or modifications without departing from the scope or spirit of the invention.

Claims

[Claim 1] The method described in the specification.