A method for typing transplant-related genes using a nanopore sequencer.

The method addresses the limitations of conventional NGS by constructing a DNA library using adapter ligation and probe hybridization for nanopore sequencing, achieving accurate and cost-effective typing of HLA and KIR genes.

JP2026054451APending Publication Date: 2026-03-26GENODIVE PHARMA +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-08
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Conventional Next Generation Sequencing (NGS) methods face challenges in accurately determining HLA and KIR genes due to limitations in handling genes with polymorphisms and repetitive sequences, leading to uncertainties and high costs, particularly in clinical settings like donor DNA typing during brain death transplantation.

Method used

A method involving adapter ligation, PCR amplification, hybridization with specific probes, enrichment, and sequencing using a nanopore sequencer to construct a DNA library for efficient typing of transplantation-related genes.

Benefits of technology

Enables accurate and cost-effective typing of HLA and KIR genes, reducing phase ambiguity and PCR bias, suitable for clinical applications and large-scale research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026054451000001_ABST
    Figure 2026054451000001_ABST
Patent Text Reader

Abstract

This invention provides a method for preparing a DNA library analyzable by a nanopore sequencer using a capture method, enabling efficient typing of transplantation-related genes. [Solution] A method for typing transplant-related genes, comprising the steps of (1) attaching a proprietary adapter to DNA contained in a sample obtained from a subject and performing PCR amplification using a proprietary primer to obtain a DNA library; (2) mixing the DNA library obtained in (1) with a probe set that specifically hybridizes to transplant-related genes and performing hybridization; (3) concentrating the DNA library hybridized with the probes; (4) removing the probes from the concentrated DNA library and performing PCR amplification using a proprietary primer; and (5) attaching a motor protein to the DNA library from which the probes have been removed and determining the sequence using a nanopore sequencer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for typing transplantation-related genes such as HLA genes and KIR genes. More specifically, the present invention relates to a method for constructing a library of the transplantation-related genes by a sequence capture method and performing gene typing using a nanopore sequencer.

Background Art

[0002] Due to the advent of "Next Generation Sequencer (NGS)", high-throughput DNA typing has become possible, and human genome decoding has advanced by leaps and bounds. Along with this, the relationship between the genes possessed by each individual and the disease susceptibility has been elucidated. In particular, HLA genes and KIR genes are closely related not only to diseases but also to transplantation compatibility, and thus accurate typing thereof is extremely important clinically.

[0003] Conventional NGS determines sequences by observing DNA extension reactions, and thus the apparatus has inevitably become large. In addition, in short-read NGS using PCR, it is difficult to assemble genes rich in polymorphisms and having many repetitive sequences such as HLA and KIR. Furthermore, short-read NGS has problems such as difficulty in determining complete haplotypes due to the presence of ambiguities or bias due to PCR amplification.

[0004] On the other hand, the "nanopore sequencer" developed recently analyzes sequences based on current changes when DNA molecules pass through minute pores (nanopores) such as proteins arranged on a membrane (Patent Documents 1 and 2). Therefore, the nanopore sequencer apparatus is very small, and the measurement time can be shortened compared to conventional NGS. Furthermore, due to the measurement principle, there is also an advantage that since the input DNA is read as it is, there is no limitation on the DNA length and long-read sequencing is possible (Non-Patent Document 1).

[0005] Using long reads enables complete HLA and KIR haplotype determination, eliminating all uncertainties, including phase ambiguity. Furthermore, bias in PCR amplification is eliminated.

[0006] Nanopore sequencers, possessing the aforementioned advantages, are expected to have applications in clinical settings, particularly in situations requiring urgency, such as donor DNA typing during brain death transplantation. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] Special Publication No. 2020-524271 [Patent Document 2] Patent No. 7237388 [Non-patent literature]

[0008] [Non-Patent Document 1] Kazuharu Arakawa, "Experimental Medicine," Vol. 36, No. 1, 2018, pp. 2-8. [Overview of the project] [Problems that the invention aims to solve]

[0009] The present invention aims to provide a method for preparing a DNA library analyzable by a nanopore sequencer using a capture method, thereby enabling efficient typing of transplantation-related genes using a nanopore sequencer. [Means for solving the problem]

[0010] The present invention (1) The process of adding adapters indicated by SEQ ID NOs: 2000 and 2001 to the DNA contained in the sample obtained from the subject (ligation), and then performing PCR amplification using primers indicated by SEQ ID NOs: 1992 to 1999 to obtain a DNA library; (2) A step of hybridizing the DNA library obtained in (1) with a probe set that specifically hybridizes to transplant-related genes; (3) A step of enriching the DNA library hybridized with the probe; (4) The step of desorbing the probe from the DNA of the concentrated DNA library and performing PCR amplification using primers indicated by SEQ ID NOs: 1992-1999; and (5) A step in which motor proteins are added to the DNA library obtained in step (4), and the sequence is determined using a nanopore sequencer. This provides a method for typing transplant-related genes, including [specific genes]. [Effects of the Invention]

[0011] This invention allows for the preparation of multiple DNA libraries analyzable by a nanopore sequencer using a capture method by attaching a uniquely developed adapter to the DNA to be analyzed and using primers containing a uniquely developed index as PCR primers. The method of this invention is suitable for the simple and rapid typing of transplantation-related genes.

[0012] Furthermore, when using the probe set specifically designed for HLA genes or KIR genes provided in this invention, it is possible to comprehensively and accurately type 11 genes in the HLA region or 16 genes in the KIR region. In addition, the typing method of this invention can reduce the cost per sample compared to NGS (conventional method) using PCR, making it suitable for large-scale research and clinical applications. [Brief explanation of the drawing]

[0013] [Figure 1] This is a schematic diagram showing a step in one embodiment of the typing method according to the present invention. In the diagram, "adapters" are indicated by sequence numbers 2000 and 2001, and "indexed primers" are indicated by sequence numbers 1992 to 1999. [Figure 2] This figure shows the details of the concentration (capture) process in Figure 1.

Best Mode for Carrying Out the Invention

[0014] The typing method according to the present invention will be described below with reference to the drawings. FIG. 1 is a diagram showing an outline of one aspect of the typing method of the present invention using the capture method.

[0015] · Step (0) First, prepare a DNA sample obtained from a subject (specimen). The DNA contained in the sample obtained from the subject may be fragmented into an appropriate length as needed (''fragmented long-chain DNA'' in FIG. 1). However, since the nanopore sequencer used in the method of the present invention has no limitation on the length of the DNA to be read, the fragmentation step is optional and does not necessarily have to be carried out. For example, when carrying out the fragmentation step for the purpose of improving typing efficiency or the like, the length of the DNA fragment is not particularly limited, but it is usually preferably about 1.5 to 3.0 kb. When performing DNA fragmentation, it can be carried out using a conventional method in the art. For example, fragmentation of DNA using enzymatic cleavage is preferred. The ends of the DNA are repaired (smoothed) as needed and adenine (A) is added.

[0016] · Step (1) Next, an adapter independently developed in the present invention is added (ligated) to the DNA contained in the sample, and PCR amplification is carried out using an independently developed primer (''indexed primer'' in FIG. 1). The adapter independently developed in the present invention has the following base sequences. Adapter 1: GGTGCTGACACGTCTGAACTCCAGTCAC (SEQ ID NO: 2000) Adapter 2: ACACTCTTTCCCTACACGACCAGCACCT (SEQ ID NO: 2001)

[0017] The primers for PCR have the following base sequences. Primer 1: AAGGTTAATAGGGAAACACGATAGAATCCGAACAGCACCT (Sequence ID: 1992) Primer 2: AAGGTTAAAAGGATTCATTCCCACGGTAACACCAGCACCT (Sequence ID: 1993) Primer 3: AAGTTAATCCATTCCCTCCGATAGATGAAACCAGCACCT (Sequence ID: 1994) Primer 4: AAGGTTAACCAAACCCAACAACCTAGATAGGCCAGCACCT (Sequence ID: 1995) Primer 5: AAGGGTTAATGAAACCTAAGAAGGCACCGTATCCAGCACCT (Sequence ID: 1996) Primer 6: AAGGTTAAGGACGAAGAACTCAAGTCAAAGGCCAGCACCT (Sequence ID: 1997) Primer 7: AAGGTTAATAGTTTGGATGACCAAGGATAGCCCAGCACCT (Sequence ID: 1998) Primer 8: AAGGTTAAAGTAGAAAGGGTTCCTTCCCACTCCAGCACCT (Sequence ID: 1999)

[0018] By adding the aforementioned adapter (ligation) and performing PCR amplification, a DNA library is obtained in which a different index sequence is attached to each subject (sample). Adapters 1 and 2, and primers 1 to 8 are based on the nucleotide sequences of Sequence IDs 1992 to 2001, but may also have nucleotide sequences in which one to several (for example, 10 or fewer, 5 or fewer, 3 or fewer, or 2 or fewer) nucleotides constituting each adapter or primer are substituted, deleted, added, or inserted. However, this is limited to those that perform the function intended in the present invention. At this stage, the DNA fragment length and DNA concentration may be measured.

[0019] Next, a capture process is carried out. This capture process includes the following steps (2) to (4), as shown in Figure 2. ·Process (2) The aforementioned DNA library is mixed with a probe set that specifically hybridizes to transplant-related genes, and then hybridized. Before hybridization, it is necessary to attach a label to each probe in the probe set that can be bound to a label supported on a separation carrier such as magnetic beads in a later process. Biotin is preferably used as the substance for labeling the probes.

[0020] ·Process (3) Next, the DNA library hybridized with the probe is concentrated. For example, a DNA library hybridized with a biotin-labeled probe is adsorbed onto streptavidin-immobilized beads (magnetic beads). DNA that did not hybridize with the probe is removed by washing, and the target DNA library adsorbed onto the magnetic beads is concentrated.

[0021] The present invention provides a method suitable for typing transplant-related genes. Human leukocyte antigen (HLA) genes and natural killer cell immunoglobulin-like receptor (KIR) genes, which are part of the human major histocompatibility complex (MHC), are transplant-related genes that contribute to transplant compatibility and are known to be highly polymorphic.

[0022] The present invention provides a novel probe set particularly useful for enriching HLA genes or KIR genes, which are transplantation-related genes. In the case of HLA genes, the probe set contains 448 oligonucleotides, each having the nucleotide sequence shown in SEQ ID NOs: 1544-1991. In the case of the KIR gene, the probe set contains 1543 oligonucleotides, each having the nucleotide sequence shown in SEQ ID NOs: 1 to 1543. These probe sets are novel probe sets suitable for specifically capturing individual genes in the HLA or KIR regions.

[0023] Each probe included in the aforementioned probe set is based on having the base sequence shown in Sequence IDs 1 to 1991, but may also have a base sequence in which one to several bases (or within 10%, preferably within 5%, more preferably within 3%, and even more preferably within 1%) of the bases constituting each probe are substituted, deleted, added, or inserted. However, this is limited to probes that perform the probe function intended in the present invention.

[0024] ·Process (4) Next, the probe is detached from the concentrated DNA library and amplified by PCR. Probe detachment can be performed according to standard procedures. PCR amplification is performed using the primers indicated by sequence numbers 1992-1999.

[0025] ·Process (5) Finally, as shown in Figure 1, the motor protein is added (ligated) to the DNA library from which the probe has been removed, and the sequence is determined using a nanopore sequencer. Motor proteins play a role in controlling the speed at which DNA strands pass through nanopores in nanopore sequencers, and DNA-binding enzymes such as polymerases and helicases are used.

[0026] A commercially available nanopore sequencer can be used in the method of the present invention. Examples of currently available nanopore sequencers include Oxford Nanopore Technologies (ONT)'s "MinION," and "GridION" and "PromethION," which have an increased number of flow cells.

[0027] The aforementioned commercially available product is very compact and can be used on a desk, making it possible to respond to urgent typing requests by placing it in each clinical setting.

[0028] The present invention will be explained below with specific examples. However, the following examples do not limit the scope of the present invention. Also, the number attached to "Sample" in the table below is a number that identifies the individual (subject or specimen) from whom the DNA sample was collected. "copy" represents the number of copy number variations detected. "X" means that the corresponding gene (allele) was not detected in the sample. [Examples]

[0029] Example 1: HLA Typing For eight DNA samples, PCR (PCR amplification) was performed using eight primers with sequence numbers 1992 to 1999. Then, the target DNA library was enriched using the sequence capture method with 448 probes having the nucleotide sequences shown in base sequence numbers 1544 to 1991. After the probes were removed, the sequences were determined using a nanopore sequencer.

[0030] The specific steps are as follows: A DNA library for HLA gene sequencing was prepared using a commercially available kit. Specifically, DNA was cleaved into fragments of approximately 1.5–3.0 kb using an enzyme, followed by end repair and adenine addition. The DNA library was then prepared by ligation using in-house prepared (proprietary developed) adapters with SEQ ID NOs: 2000 and 2001. The adapters were prepared by PCR using primers with SEQ ID NOs: 1992–1999 to add eight different index sequences to each sample.

[0031] Using reagents from xGen(registered trademark) Hybridization and Wash v2 Reagents (Integrated DNA Technologies), the DNA library obtained above was hybridized with probes numbered 1544 to 1991 according to the manufacturer's protocol.

[0032] The DNA library was enriched and the probes were removed according to standard procedures. Next, after PCR amplification using primers complementary to the adapter sequence, end repair and adenine addition were performed to attach the nanopore motor protein to the DNA library.

[0033] The DNA libraries from the eight obtained samples were sequenced using a nanopore sequencer. The results are shown in Table 1 below.

[0034] [Table 1]

[0035] As shown in Table 1, using the method described above, we were able to type the DNA of each sample not only in the first region (2-digit level) for identifying serological HLA types and the second region (4-digit level) for identifying alleles with amino acid substitutions within the same serological HLA type, but also in the third region (6-digit level) for identifying alleles with base substitutions without amino acid mutations. In bone marrow transplantation, it is said that if the HLA types of the transplant recipient and the transplant provider (donor) are perfectly matched at the four-digit level, the success rate of the transplant will improve and the frequency of rejection and severe GVHD will decrease. In light of this, the typing method of the present invention has been confirmed to be a method for obtaining clinically useful information.

[0036] Example 2: KIR Typing For eight DNA samples, KIR gene typing was performed using a nanopore sequencer in the same manner as in Example 1, except that a KIR gene probe set with the nucleotide sequences shown in SEQ ID NOs: 1 to 1543 was used. The results are shown in Table 2 below.

[0037] [Table 2]

[0038] As shown in Table 2, the above method allowed us to identify the presence or absence of 16 types of KIR genes (allyles) in the DNA of each sample. Furthermore, if the corresponding gene was present, we were able to type it not only in the first region (2-digit level) for determining the genotype and the second region (4-digit level) for determining alleles with amino acid substitutions within the same genotype, but also in the third region (6-digit level) for determining alleles with base substitutions without amino acid mutations.

[0039] • Comparison with conventional methods in HLA typing Example 3 (The present invention) For the eight DNA samples listed in Tables 3 and 4 below, the capture method and typing using a nanopore sequencer were performed in accordance with the method described in Example 1. Equipment used: PromethION (manufactured by ONT Corporation)

[0040] Comparative Example 1 (Conventional Method) The eight DNA samples mentioned above were subjected to typing using PCR and NGS (conventional methods). Reagents used: AllTypeNGS11-LociAmplification Kit (Manufactured by OneLambda) Equipment used: NextSeq2000 (manufactured by Illumina) Methods and conditions: The procedure was carried out according to the manufacturer's protocol.

[0041] Tables 3 and 4 show the DNA typing results for each sample obtained using the conventional method (Comparative Example 1) and the method of the present invention (Example 3), respectively. "TRUE" in the table indicates that the typing results for Comparative Example 1 and Example 3 were identical. As shown in Tables 3 and 4, the DNA typing results obtained using the conventional method (Comparative Example 1) and the method of the present invention (Example 3) were completely identical for all measured samples. In other words, it was confirmed that the method of the present invention enables accurate DNA typing similar to conventional methods using PCR and NGS. In addition, the cost required for the method of the present invention is lower than that required for conventional methods, and the cost per sample using the method of the present invention was reduced by approximately 47% compared to conventional methods.

[0042] [Table 3]

[0043] [Table 4]

[0044] Comparison with conventional methods in KIR typing Example 4 (The present invention) For the eight DNA samples listed in Tables 5 and 6 below, the capture method and typing using a nanopore sequencer were performed according to the method described in Example 2. Equipment used: PromethION (manufactured by ONT Corporation)

[0045] Comparative Example 2 (Conventional Method) The eight DNA samples mentioned above were subjected to typing using PCR and NGS (conventional methods). Reagents used: NGSgo-AmpX KIR (GenDX Corporation) Equipment used: NextSeq2000 (manufactured by Illumina) Methods and conditions: The procedure was carried out according to the manufacturer's protocol.

[0046] Tables 5 and 6 show the typing results for each sample DNA obtained using the conventional method with PCR and NGS (Comparative Example 2) and the method of the present invention (Example 4). In the tables, "TRUE" means that the typing results for Comparative Example 2 and Example 4 were the same, and "FALSE" means that they were not the same. "Blank" indicates that typing of the corresponding gene was not possible.

[0047] [Table 5]

[0048] [Table 6]

[0049] As shown in Tables 5 and 6, the conventional method using PCR and NGS (Comparative Example 2) was not capable of typing the eight genes KIR2DL5, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR2DP1, and KIR3DP1.

[0050] For the remaining eight genes that could be typed using the conventional method (Comparative Example 2), the DNA typing results obtained using the conventional method (Comparative Example 2) and the method of the present invention (Example 4) were often consistent. On the other hand, the discrepancy in DNA typing results between the conventional method (Comparative Example 2) and the method of the present invention (Example 4) was due to phase ambiguity, and it was confirmed that the method of the present invention (Example 4), which uses long reads, eliminated phase ambiguity and enabled accurate typing.

[0051] In other words, the method of the present invention enables the typing of KIR genes, which could not be typed using conventional methods using PCR and NGS, and its accuracy has been confirmed to be higher than that of conventional methods. In addition, the cost required for the method of the present invention is lower than that required for conventional methods, and the cost per sample using the method of the present invention was reduced by approximately 60% compared to conventional methods.

Claims

1. (1) A step of adding adapters indicated by SEQ ID NOs: 2000 and 2001 to DNA contained in a sample obtained from a subject, and then performing PCR amplification using primers indicated by SEQ ID NOs: 1992 to 1999 to obtain a DNA library; (2) A step of hybridizing the DNA library obtained in (1) with a probe set that specifically hybridizes to transplant-related genes; (3) A step of concentrating the DNA library hybridized with the probe; (4) The step of detaching the probe from the concentrated DNA library and performing PCR amplification using primers indicated by SEQ ID NOs: 1992-1999; and (5) A step of adding a motor protein to the DNA library from which the probe has been removed and determining the sequence using a nanopore sequencer. A method for typing transplant-related genes, including [specific genes].

2. The typing method according to claim 1, further comprising the step of fragmenting the DNA contained in a sample obtained from a subject before step (1) above.

3. The typing method according to claim 1, wherein the probe set in step (2) is biotin-added, and the concentration in step (3) is carried out by adding streptavidin-immobilized beads.

4. The typing method according to claim 1, wherein the transplant-related gene is an HLA gene, and the probe set used in step (2) is a probe set comprising oligonucleotides having the base sequences shown in SEQ ID NOs: 1544 to 1991.

5. The typing method according to claim 1, wherein the transplant-related gene is a KIR gene, and the probe set used in step (2) is a probe set containing oligonucleotides, each having a base sequence as shown in SEQ ID NOs: 1 to 1543.

Citation Information

Patent Citations

  • Nanopore Sequencer

    JP2020524271A

  • Nanopore structure, and base sequence analyzer including the nanopore structure

    JP7237388B2