Recombinant acid-tolerant yeast with increased lactic acid production capacity

Abstract

This invention provides recombinant acid-tolerant yeast with increased lactic acid production capacity and a method for producing lactic acid using the same. [Solution] A recombinant yeast strain with lactic acid production ability is provided, in which the gene encoding pyruvate decarboxylase is deleted in the acid-resistant yeast YBC strain (KCTC13508BP), and a gene encoding lactate dehydrogenase derived from Staphylococcus epidermidis is introduced at the position of the gene encoding pyruvate decarboxylase. When producing lactic acid using the recombinant acid-resistant yeast according to the present invention, lactic acid fermentation can be performed with lactic acid production ability similar to bacterial fermentation while using significantly less neutralizing agent than existing bacterial fermentation, thereby greatly reducing fermentation costs and also reducing the production capacity of by-products ethanol and glycerol, thus reducing the costs of the subsequent purification process.

Description

Technical Field

[0001] The present invention relates to a recombinant acid-tolerant yeast with increased lactic acid production ability and a method for producing lactic acid using the same. More specifically, it relates to a recombinant acid-tolerant yeast in which a lactate dehydrogenase gene derived from a specific bacterium is introduced at a position where the gene encoding pyruvate decarboxylase is deleted, and a method for producing lactic acid using the same.

Background Art

[0002] PLA (Polylactic Acid) is a biodegradable polymer produced by converting lactic acid into lactide and subjecting the latter to ring-opening polymerization. It is produced by lactic acid fermentation, which is its raw material. PLA can be widely used in disposable food containers and has the strength to be used as various industrial plastics, either alone or in the form of compositions or copolymers, including in the automotive and textile industries. Moreover, recently, it has become a representative polymer used in 3D printing, especially an environmentally friendly polymer that generates less harmful gas and odor during 3D printer use.

[0003] Traditional lactic acid production processes use lactic acid bacteria for production. To prevent strain death or growth arrest due to acid caused by the accumulation of lactic acid produced by lactic acid bacteria, fermentation is carried out while adjusting the pH to 6 - 8 of neutral pH using various forms of neutralizing agents such as Ca salts / Mg salts or ammonia. When fermentation is completed, the microorganisms are separated. However, in the salt form, separation with water and lactide conversion are difficult. Therefore, sulfuric acid is added to convert lactate to lactic acid while removing Ca salts in the form of CaSO4. Such a process results in more...​​​​​​​​​ This process generates CaSO4 as a byproduct, leading to a decrease in process economics.

[0004] PLA produces lactic acid through fermentation, and then the produced lactic acid is purified to form lactide. The process of converting to lactide is common. For lactide conversion, lactic acid is converted to a hydrogenated form (Hy A process is required to convert to the drogenated form, and the process is to convert to the normal neutral fermentation. Since H is 6-7, a large amount of sulfuric acid is used to convert it to an acidic pH. A large amount of This generates neutralized salt, and the investment costs for processes to remove such neutralized salt, as well as the low value of the neutralized salt, This will further reduce economic efficiency.

[0005] On the other hand, lactic acid has two optical isomers: L-type and D-type. There are also about 5-1 lactic acid bacteria that mainly produce L-type. Often, both types D and L are produced at 0%. Strains that primarily produce type D also produce both types D and L. It has many forms, including being produced in a single form and in a form that produces both type D and ethanol. There are microbial communities that do this (Non-patent document 1). On the other hand, Lactobacillus, which produces lactic acid in nature ( Lactobacillus )in the case of To produce lactic acid at a commercial level, large amounts of expensive nutrients are needed. It must be used as a base, and such excess nutrients will cause polymerization in the subsequent process (pol (ymerization) process, or lactide conversion process when lactide is used as an intermediate. To provide significant inhibition and obtain high yield, high purity polymers or their precursors, adsorption is necessary. Furthermore, the costs associated with purification processes such as distillation and ion exchange contribute to high production costs. To address these problems, research using yeast has been proposed. In the case of yeast, it is known that it can grow / ferment smoothly even when using inexpensive nutrients. It is also known to have high resistance to acidity.

[0006] When producing lactic acid using yeast that thrives in acidic conditions (hereinafter referred to as acid-tolerant yeast), during fermentation... Since there is no need to use a neutralizing agent to maintain the culture medium at pH 6-7, the fermentation process becomes simpler, and A subsequent purification process to remove the neutralizing agent is unnecessary. Furthermore, yeast contains many components necessary for metabolism. Because it produces itself, it can be grown even in culture media with relatively low nutrient levels compared to bacteria, especially Lactobacillus. It can be fermented, many subsequent refining processes can be eliminated, and production costs can be significantly reduced. can.

[0007] However, there are prerequisites for lactic acid production technology using yeast, but these are suitable for commercialization. For use, the yield, productivity, and lactic acid concentration, which are indicators of fermentation performance of the lactic acid bacteria, must be similar to the performance of the lactic acid bacteria. This means that the level of similarity needs to be maintained at a high level. Attempts are being made to develop acid-resistant lactic acid technology using yeast, but in reality, a neutralization reaction occurs during fermentation. High performance is only achieved when fermentation is carried out while maintaining a pH of 3.7 or higher, which is above the pKa value of lactic acid. Since fermentation capacity is often obtained, it is practically difficult to call it an acid-resistant technology, and the process involves It is also difficult to achieve any cost-saving effect (Non-Patent Document 2).

[0008] Therefore, acid-tolerant yeast, which can reduce process costs, requires either no neutralizing agent or a minimal amount of neutralizing agent. It is necessary to complete the fermentation in a fermentation liquid with a pH below the pKa value while using it, and the three major indicators of fermentation It only becomes commercially viable if it reaches a level similar to that of lactic acid bacteria.

[0009] Common yeast primarily produces ethanol when fermenting glucose, with glucose as its main byproduct. It is very rare to produce reserol and produce lactic acid. In addition, since the probability of selecting a strain that produces lactic acid from microorganisms with high acid resistance is very low, the inventors selected yeast strains with excellent acid resistance and improved the selected strains by genetic engineering methods, attempting to produce a strain that has the ability to produce lactic acid and suppresses the production ability of ethanol and glycerol. Therefore, the inventors earnestly endeavored to produce a yeast strain whose lactic acid production ability (lactic acid production rate and concentration) is similar to that of bacterial strains, suppresses the production of by-products ethanol and glycerol, and has strong acid resistance. As a result, in acid-resistant yeast, when the lactate dehydrogenase gene derived from is introduced at the position of the pyruvate-converting enzyme gene, it was confirmed that the lactic acid yield is improved due to an increase in lactate dehydrogenase activity, and the present invention was completed.

Prior Art Documents

Non-Patent Documents

Non-Patent Document 1

Non-Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0010] Ellen I.Garvie,Microbiological Reviews,106-139,1980 Michael Sauer et al.,Biotechnology and Genetic Engineering Reviews,27:229-256,2010

[0011] [[ID= for]]The object of the present invention is to provide a recombinant acid-resistant yeast strain having lactic acid-producing ability and having high resistance to high-concentration lactic acid. ​​​​​The objective is to provide recombinant bacterial strains that increase resistance and thereby increase lactic acid production rate and concentration. be.

[0012] Another object of the present invention is to use adaptive evolution methods Furthermore, to provide a method for producing recombinant yeast strains that have increased lactic acid tolerance and lactic acid production ability. be.

[0013] Another object of the present invention is to improve lactic acid production capacity in the high-concentration lactic acid medium produced by the above method. The objective is to provide recombinant yeast strains. [Means for solving the problem]

[0014] To achieve the above objective, the present invention relates to the acid-resistant yeast strain YBC (KCTC13508 In BP, the gene encoding pirubate decarboxylase is deleted, and pirubate Staphylococcus epidermidis at the location of the gene encoding decarboxylase ( Staphylococcus epidermidis ) derived from lactate dehydrogenase This invention provides a recombinant bacterial strain that has lactic acid-producing ability, into which a gene encoding a lactic acid enzyme has been introduced.

[0015] The present invention also relates to dihydro in acid-resistant yeast strain YBC (KCTC13508BP). This is a gene that codes for an enzyme that converts xyacetone phosphate to glycerol-3-phosphate. The GPD1 gene is a gene that codes for an enzyme that converts lactate to pirubate. YB2 gene; ADH gene, which encodes alcohol dehydrogenase; and Furthermore, the PDC gene, which encodes pyrubate decarboxylase, is deleted, The gene encoding lactate dehydrogenase has been introduced, giving it the ability to produce lactate. Recombinant strain, The gene encoding lactate dehydrogenase is the deleted ADH gene; PD It is introduced at the location of the C gene and the GPD1 gene. The gene encoding lactate dehydrogenase introduced at the aforementioned PDC gene site The gene is Staphylococcus epidermidis ( Staphylococcus epi dermidis It is a gene that codes for lactate dehydrogenase derived from ) We provide a recombinant strain that serves as a characteristic feature.

[0016] The present invention also relates to (a) a recombinant yeast strain having lactic acid production ability, from a low-concentration lactic acid medium to a high-concentration lactic acid medium. The recombinant yeast strain is sequentially cultured in lactic acid medium to allow it to adapt and evolve to high lactic acid concentrations. (b) A step of selecting recombinant yeast strains with improved lactic acid production ability in high-concentration lactic acid medium; and, (c) At the position of the PDC gene in the genome of the selected strain, Staphylococcus epide Lumidis Staphylococcus epidermidis ) derived lactate This process involves introducing a gene encoding dehydrogenase, which increases lactic acid tolerance. This invention provides a method for producing recombinant yeast strains that have efficacy.

[0017] The present invention also relates to dihydro in acid-resistant yeast strain YBC (KCTC13508BP). This is a gene that codes for an enzyme that converts xyacetone phosphate to glycerol-3-phosphate. The GPD1 gene is a gene that codes for an enzyme that converts lactate to pirubate. The YB2 gene, the ADH gene which encodes alcohol dehydrogenase, and The PDC gene, which encodes bipirubate decarboxylase, is deleted, A group of individuals with lactate production ability in which the gene encoding lactate dehydrogenase has been introduced. Recombinant strain #26-5 (deposit number: KC) obtained by adapting a replacement strain to high lactic acid concentrations. We offer TC14215BP).

[0018] The present invention also relates to the recombinant strain #26-5 (deposit number: KCTC14215BP) Staphylococcus epidermidis at the location of the PDC gene in the genome ( Staphyl ococcus epidermidis ) encodes lactate dehydrogenase derived from A gene has been introduced into the YBC strain (KCTC13508BP) or the YBC5 strain. In comparison, lactic acid production capacity improved at high concentrations of lactic acid, and the production of ethanol and glycerol increased. This provides a reduced recombinant yeast strain YBC6.

[0019] The present invention also includes (a) the step of culturing the bacterial strain to produce lactic acid; and (b) the step of The present invention provides a method for producing lactic acid, which includes a step of obtaining the generated lactic acid. [Effects of the Invention]

[0020] When producing lactic acid using recombinant acid-tolerant yeast according to the present invention, existing bacterial fermentation While using significantly less neutralizing agent, it produces lactic acid similar to bacterial fermentation. Because lactic acid fermentation can be performed, fermentation costs can be greatly reduced, and the by-product is ethanol. Furthermore, since the glycerol production capacity is reduced, the costs of the subsequent purification process can also be reduced. [Brief explanation of the drawing]

[0021]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

[0022] Unless otherwise specified, all technical and scientific terms used herein belong to the present invention. It has the same meaning as is usually understood by skilled experts in the field of technology. Generally, The nomenclature used herein is well known and commonly used in the art. .

[0023] Acid-tolerant yeast rapidly consumes sugar even at acidic pH levels and exhibits a high growth rate, and under fermentation conditions Therefore, it has the characteristic of converting consumed sugar into a product. In our prior research, the inventors have shown that As a yeast possessing these characteristics, the acid-resistant yeast YBC strain (KCT) was selected from multiple yeast libraries. C13508BP) was selected, and the acid-resistant yeast YBC strain (KCTC13508BP) was used in milk This strain exhibits high growth and sugar consumption rates even under conditions of acid concentration ranging from 40 g / L to 80 g / L. Yes (Republic of Korea Patent Application No. 10-2018-0044509).

[0024] In our prior application, we described the acid-resistant yeast strain YBC and improved its lactic acid production ability. Furthermore, by regulating the metabolic pathway to reduce ethanol production capacity, the YBC strain can be converted to ethanol. The gene encoding carboxyl dehydrogenase and pyrubete decarboxylase From a strain in which the gene responsible for lactate dehydrogenase is deleted and the lactate dehydrogenase gene is introduced, lactate Recombination by deleting the gene encoding the cytochrome b2 enzyme that converts phosphate to pyrubate. A bacterial strain was created.

[0025] Furthermore, the present inventors have found a way to suppress glycerol production in the recombinant strains created as described above. Therefore, glycerol converts dihydroxyacetone phosphate to glycerol-3-phosphate. Recombinant strains lacking the gene encoding the 3-phosphate dehydrogenase enzyme I have made one before.

[0026] In this invention, in order to restore lactic acid tolerance of the recombinant strain, various concentrations up to ~80 g / L are used. While subculturing the recombinant strains in a culture medium containing a certain lactic acid concentration, strains with high lactic acid tolerance are selected. The foreign lactate dehydrogenase was substituted at the PDC gene position of the selected strain. genes S.epidermidis By replacing the derived lactate dehydrogenase gene A new recombinant strain was created, and this recombinant strain simultaneously possesses high lactic acid tolerance and high lactic acid production ability. Furthermore, it was confirmed that the ability to produce ethanol and glycerol was suppressed.

[0027] Therefore, in one view, the present invention relates to the acid-resistant yeast strain YBC (KCTC13508 In BP, the gene encoding pirubate decarboxylase is deleted, and pirubate Staphylococcus epidermidis at the location of the gene encoding decarboxylase ( Staphylococcus epidermidis ) derived from lactate dehydrogenase This relates to recombinant bacterial strains that have lactic acid-producing ability, into which a gene encoding a lactic acid enzyme has been introduced.

[0028] In the present invention, the lactate dehydrogen derived from Staphylococcus epidermidis The gene encoding the enzyme may be characterized by being represented by Sequence ID No. 1.

[0029] In the present invention, the recombinant bacterial strain is a gene encoding alcohol dehydrogenase. It is characterized by further deficiency or weakening of dihydroxyacetone phosphate and glycerol The gene encoding the enzyme that converts to phosphate-3-phosphate is further deleted or weakened. It may be characterized by the following.

[0030] In the present invention, the recombinant strain encodes an enzyme that converts lactate to pirubate. This may be characterized by further deletion or weakening of the gene responsible.

[0031] In other respects, the present invention relates to the acid-resistant yeast strain YBC (KCTC13508BP). It encodes an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate. The GPD1 gene is a gene that codes for an enzyme that converts lactate to pirubate. The CYB2 gene is a genetic gene, and the AD gene encodes alcohol dehydrogenase. The H gene and the PDC gene, which encodes pyrubate decarboxylase, The gene that is deleted and has been introduced to encode lactate dehydrogenase is lactic acid A recombinant bacterial strain that possesses efficacy, The gene encoding lactate dehydrogenase is the deleted ADH gene, PD It is introduced at the positions of the C gene and the GPD1 gene. The gene encoding lactate dehydrogenase introduced at the aforementioned PDC gene site The gene encodes lactate dehydrogenase derived from Staphylococcus epidermidis. This relates to recombinant bacterial strains characterized by having a gene that performs a specific action.

[0032] In the present invention, the lactate dehydrogen derived from Staphylococcus epidermidis The gene encoding the enzyme is shown in SEQ ID NO: 1, and its protein sequence is shown in SEQ ID NO: 2. This gene is expressed in acid-resistant YBC strains, and the codon usage frequency (Co It can be characterized by adjustments to the usage (of the don't).

[0033] In the present invention, the deleted ADH gene and GPD1 gene are introduced at the location of the deleted ADH gene and GPD1 gene. The gene encoding lactate dehydrogenase is found in Staphylococcus epidermidis. Derived from Lactobacillus plantarum ( Lactobacillus plantarum rum It can be characterized by being of origin.

[0034] Recombinant bacterial strains with lactic acid production ability have high lactic acid yield and lactic acid production ability, but inside the cell Large amounts of lactic acid are produced, and there are significant changes in intracellular carbon flux. Therefore, it affects the redox balance, cell growth, and regulatory mechanisms, thereby affecting cell growth Changes occur in which the rate of stamina and the rate of glucose consumption (in conclusion, the rate of lactate production) are weakened. Genetics The reasons for the reduction in lactic acid tolerance induced by engineering are as follows: Existing wild-type microorganisms are highly concentrated Lactic acid (40-80 g / L) is present outside the cell, and its pH is lower than the pKa (pH2). This strain grew smoothly even in stage 3. This strain became active internally after genetic modification. As the cells begin to produce lactic acid, the lactic acid produced inside the cell and the lactic acid outside the cell, In addition to the effects of lactic acid that has permeated the cell membrane (mass transfer), there are also effects from lactic acid generated internally. This results in dual inhibition by lactic acid, and the increased intracellular lactic acid concentration is due to the cell's p It reduces H, affecting various intracellular activities, including gene replication and protein production within cells. This inhibits lactic acid production, leading to decreased lactic acid tolerance.

[0035] Furthermore, such inhibitory effects occur when the external lactic acid content increases or the external pH becomes more acidic. This becomes even larger when a large proportion of the total lactic acid is present in a hydrated form. To solve the problems induced by bacterial strains, adaptive evolution (ion) / like forced evolution, a bacterial strain is continuously cultured in a target environment, and the bacteria mutate to adapt to the environment. A method is used to improve performance by continuously selecting the body (Zhengming Zhu et al., Applied Microbiology and Biotech nology,102:4615-4627,2018;Eugene Fletche r et al., Metabolic Engineering 39(2017)1 9-28,2017;Christopher P Long,Current opi ion in Chemical Engineering,22:209-215, (2018). When applying such forced evolution methods, the compound that causes the mutation or UV, etc. Physical mutagenesis (Zhengming Zhu et al., Applied Mi crobiology and biotechnology(2018)102:46 15-4627.) can also be used, and in the present invention, in addition to the adaptive evolution described above, other We attempted to apply this as an experiment. However, among the randomly occurring mutations, the target mutation was not met. Along with an increase in performance (for example, acid resistance), other performance aspects (for example, productivity) also increase simultaneously. This is extremely rare, and after individually inspecting approximately 100 strains... Nevertheless, selecting beneficial bacteria was difficult, and attempts to expand the group to be selected were limited. 8 A system that cultivates individuals with colony / ml or more, and uses mutating bacterial populations to develop an automated system. An automated system that can select superior colonies. d High Throughput System) and a legacy capable of detecting superior colonies The need for development of a gene system (for example, a fluorescent reporter proportional to the expression level of LDH). From that perspective, it was difficult to apply.

[0036] Therefore, adaptive evolution is a better approach than utilizing mutants. Using the ion method, recombinant yeast strains are cultured and grown in high concentrations of sugar and lactic acid. If the process was smooth, the lactic acid concentration was increased. Also, in the intermediate stages of cultivation, a solid culture medium containing lactic acid was used. The bacterial cells are smeared onto the solid medium, and colonies with superior growth rate (large size) are selected from the solid medium. The method of selecting and then separately testing the lactic acid production capacity of these colonies in a flask was repeated, and the selected colonies were The strain was directly compared with the parent strain of the culture. Through this iterative process, the target lactic acid was obtained. We were able to select a strain that possessed resistance and increased lactic acid production capacity. Fermentation performance was confirmed by culturing in a fermenter (see Figure 7).

[0037] Therefore, in other respects, the present invention relates to (a) recombinant yeast strain having lactic acid production ability. The recombinant yeast strain is cultured sequentially from low-concentration lactic acid medium to high-concentration lactic acid medium, and the recombinant yeast strain is cultured in high concentration (b) Recombinant yeast with improved lactic acid production ability in high-concentration lactic acid medium (c) the step of selecting the mother strain; and the position of the PDC gene in the genome of the selected strain. Staphylococcus epidermidis ( Staphylococcus epider midis This includes the step of introducing a gene encoding lactate dehydrogenase derived from ) This invention relates to a method for producing recombinant yeast strains that have increased lactic acid tolerance and lactic acid production ability.

[0038] In the present invention, the recombinant yeast strain having the lactic acid production ability in step (a) is an acid-tolerant yeast. In the YBC strain (KCTC13508BP), dihydroxyacetone phosphate is converted to glycerol The GPD1 gene, which codes for an enzyme that converts lactate to phosphate-3-phosphate, The CYB2 gene is a gene that codes for an enzyme that converts alcohol into pirubate. The ADH gene, which encodes a dragenase, and the pirubate decarboxylase The PDC gene, which codes for lactate dehydrogenase, is deleted, and the lactate dehydrogenase is lost. A recombinant bacterial strain having lactic acid production ability into which the encoding gene has been introduced, the lactate The genes encoding toxodehydrogenase include the deleted ADH gene, PDC gene, and This strain can be characterized by being a YBC5 strain with the GPD1 gene introduced at its site.

[0039] Furthermore, from another perspective, the present invention relates to the acid-resistant yeast strain YBC (KCTC13508BP In ) an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is used. The GPD1 gene, which codes for the enzyme that converts lactate to pirubate, The CYB2 gene is a gene that encodes alcohol dehydrogenase. The ADH gene and the PDC gene, which encodes pyrubate decarboxylase. Milk in which the gene is deleted and the gene encoding the lactate dehydrogenase has been introduced. Recombinant strain #26 obtained by adapting a recombinant strain with acid-producing ability to high lactic acid concentrations. Regarding -5 (Deposit number: KCTC13508BP).

[0040] In another respect, the present invention relates to recombinant strain #26-5 (deposit number: KCTC). Staphylococcus epidermidis ( ) at the PDC gene position of the genome of 14215 S taphylococcus epidermidis ) derived lactate dehydrogenate The gene encoding ze has been introduced, and the YBC strain (KCTC13508BP) or Y Compared to the BC5 strain, lactic acid production ability is improved at high concentrations of lactic acid, and ethanol and glycerol Regarding recombinant yeast strain YBC6 with reduced iodine production.

[0041] Adaptive evolution is a very powerful tool, but This also results in a reaction. Among the adaptive evolutionary processes, the one adopted in this invention is high concentration lactic acid This involves selecting strains that are adapted to promote healthy growth. The selected microorganisms are those that can grow even in conditions with high concentrations of free lactic acid, and that exhibit high lactic acid production ability during the selection process. Because the strains are selected, a defense mechanism against lactic acid concentration is well-developed, and sugars can survive even in the presence of lactic acid. A strain is selected in which the metabolism of the selected strain is promoted. Even in situations where lactic acid accumulates in the reactor, it is possible to increase the concentration of microorganisms in the reactor. As a result, such high microbial concentrations increase the overall lactic acid production rate. In particular, this adaptation process The chemical transformation process is characterized by the properties of the parent strain used in this invention before genetic manipulation, resulting in a high concentration. Because this strain grows at a very rapid rate using lactic acid and has a high sugar consumption rate, genetic engineering This process changes the carbon flux from ethanol to lactic acid. This decreased lactic acid tolerance and reduced growth rate in the presence of lactic acid were reversed through adaptive evolution. It is a process of restoration. However, if we consider this adaptive evolutionary process from the perspective of microorganisms, There is a direction that a few microorganisms must choose. From the perspective of microorganisms, a lower acidity pKa is preferable. In the H state, when the lactic acid concentration in the outside becomes high, the hydrated lactic acid in its non-ionized state... It has the effect of transmitting signals into the cell and lowering the intracellular pH, thus affecting lactic acid. While DNA replication and protein production are carried out under conditions of significant influence, the growth substrate When selecting a fermentation product (carbon flow) that can convert sugar and produce ATP and NADH, external By enhancing lactic acid production performance (for example, production rate), which is affected in the same way as stress, The evolutionary direction that promotes growth and accelerates glucose metabolism cannot be considered a natural selection. Rather than producing lactic acid, we choose a method that produces fermentation products that have less impact on current stress factors. This is natural. Furthermore, in the parent strain used in this invention, the lactic acid production pathway is introduced from an external source. This is a pathway, and wild-type microorganisms are microorganisms that grow by producing ethanol as their main product. Therefore, the carbon pathway was naturally strengthened to promote growth along with increased lactic acid tolerance. The carbon pathway is ethanol, and therefore it is a byproduct of the lactic acid production process. We confirmed that the amount of ethanol increases.

[0042] The increase in by-products induced by adaptive evolution and the genetic factors that promoted increased lactate tolerance To analyze this, qPCR analysis was performed on microorganisms before and after the progression of adaptive evolution (T Ranscriptome analysis). In addition to qPCR analysis, for the whole gene... It is also possible to analyze the differences by performing such analyses, but the genetic material is altered by mutations within the gene. Although there are a great many genes, the phenotype actually develops through protein expression and its regulatory mechanisms. Since the factors that appeared as phenotypes are only a part of the whole, the increase in resistance and growth rate are not significant. To identify the genetic factors that manifest as such phenotypes, we determined that qPCR analysis is more appropriate. Ta.

[0043] In transcriptome analysis, we identify genes that show differences in expression. To do this, the expression rate and adaptive evolution of the RNA sequences analyzed in the wild-type strain were examined. The difference in expression rate (fold change) between the strain and the actual expression rate decreases / increases by more than 2 times. After separating the added genes, the genes are separated by annotation. We analyzed it (see Table 6).

[0044] Among the gene pools with reduced expression, the specific gene is lactate dehydro This is the LDH gene that encodes genase. As mentioned earlier, this increases lactate concentration. Therefore, the growth rate and lactic acid production rate are the fastest (in some cases, the lactic acid produced is the highest). High-quality microorganisms were selected, but oxidative stress caused by lactic acid (oxidative press) was present. (ure) or an inhibitory pH, the preferred solution from a microbial perspective is internal Since this should reduce the amount of lactic acid produced, this decrease in expression is an adaptive evolution. It is accumulated within the microorganisms during the process. Of course, the selected strains also have superior lactic acid production. This is mainly due to the effect of the rapid increase in microbial concentration caused by the fast growth rate, and the consumption of sugar or This effect is thought to occur while the intracellular transport rate of sugars increases, and may result in a decrease in the expression type shown above. Therefore, it is judged that the cellular glycolactic acid production capacity has decreased.

[0045] Analysis of the gene pool with increased expression revealed that several genes performing the same role... Increased expression was observed in both gene groups. Categorizing these, they are as follows: be.

[0046] Category A is related to fermentation products, including the lactate dehydrogenate mentioned above. In addition to the decrease in the expression of -ase, the carbon flux required to achieve the growth rate This is a gene associated with the production of ethanol generated for the purpose of fortification. In particular, existing PDCs (P (The gene encoding rubetodecarboxylase) and ADH (alcohol dehydrogenase) - When confirming enzyme activity, it was tested as a candidate, but the predicted activity was different. It was confirmed that genes whose sex could not be identified were strengthened through this adaptive evolution. Category E is hexose transporter These are the initial external C6 sugars, i.e., glucose, mannose, etc. This is a group of genes associated with proteins that act on sugars and transport them into cells. Category B is a group of zinc finger proteins. Oxidative stress induced by this affects functional groups associated with zinc finger proteins. Alternatively, zinc finger protein-related enhancement can mitigate the effects of reactive oxygen species (ROS). There are studies suggesting that it acts on (Derek A. Abbott et al., Ap plied and Environmental Microbiology,232 (0-2325, 2009), Association between lactate-containing oxidative stress and zinc finger proteins The probability is very high (Xixi Zhou et al, The journal of biological chemistry,290:18361-18369,201 5;B Gao et al.,Cell Death and Disease,5: e1334,2014;Ananda S.Prasad and Bin Bao,A (ntioxidants8:164,2019), some of the acid resistance of the selected strains is this It is presumed to be associated with zinc finger proteins. Category D is sulfate This is a gene related to sulfites, and in particular, sulfates / An increase in sulfite reductase expression was observed, which is due to oxidative stress caused by lactic acid. Then, a mechanism to alleviate oxidative stress caused by these sulfates / sulfites is activated, leading to increased expression. It is presumed that this has happened. In addition, it supports the gene structure and cellular structure against external stress. The expression of genes that attempt to maintain their function was confirmed, and these were collectively referred to as Category D stress responses. .

[0047] The aforementioned transcription analysis confirmed various characteristics of the strain of the present invention, and in the future, reverse engineering Further research, including reverse engineering, has revealed that each gene By studying its characteristics, we can create additional performance development strategies.

[0048] The aforementioned transcription analysis did not reveal any increase in gene expression related to glycerol production. However, in the phenotypes confirmed by fermentation culture, the strains selected through adaptive evolution showed glycerin. We were able to confirm that the roll-forming ability also increased compared to the parent strain.

[0049] Therefore, this increased glycerol is due to a weakening of LDH rather than the expression of related genes. This is because the NADH regeneration capacity is insufficient, and NADH is regenerated and produced through the glycerol production pathway. This was the case, and it was judged that it would decrease again when LDH was strengthened.

[0050] In conclusion, increased lactic acid tolerance allows for the acquisition of more microorganisms in the fermenter in the same amount of time. The rate of sugar metabolism increased, and the rate of fermentation increased, but at the same time, the milk due to increased lactic acid tolerance An increase in by-products from the acid process was also observed, which is due to a decrease in LDH expression associated with increased resistance and this This phenomenon was caused by increased glycerol and the expression of genes related to ethanol production. As a strategy to achieve this, consider strengthening LDH and removing the gene that induces ethanol. In this invention, additional LDH expression is performed to increase the production rate in each cell, thereby improving overall performance. (overall) While further increasing the production rate, the reduction of the coenzyme NADH By performing the procedure with LDH, the NADH reduction that was handled by the glycerol pathway was reduced, and in conclusion, It also reduces the increase in lyserol, and uses bibric acid as the precursor node in the metabolic pathway to ethanol. We first tried a method to reduce ethanol production by enhancing lactic acid production capacity, which directly competes with production. Subsequently, if necessary, a method to remove the additionally expressed ethanol-producing gene will also be implemented. It is possible.

[0051] In one embodiment of the present invention, the strain that has undergone adaptive evolution is the YBC5 strain, and this strain These are g4423 (ADH), g3002-1 (PDC), and g2947 (CYB2) in the genome. Lactobacillus plantarum ( L.plantarum ) LDH gene It has been replaced, and in addition to the characteristics of YBC bacteria being diploid, there are a total of 6 copies ( This is a strain in which the gene (copy) is inserted. In many cases, the same gene is inserted. As a result, the expression of the same gene is suppressed by the inhibition of cellular feedback, and the copy number is the same. It fails to produce the desired effect, and the presence of the same gene may also affect genome stability. For these reasons, the present invention has found a new method for enhancing LDH. The inventor's prior patent applications (Republic of Korea Patent Application 2018-0044509 and Republic of Korea Patent Application) As described in application 2019-0124701, YBC5 strain g4423(ADH) LDH inserted at the position showed very high activity, and inserted at the g2947 (CYB2) position The LDH that was produced also showed sustained activity in the later stages of fermentation due to the influence of the g2947 promoter. However, LDH inserted at the g3002-1(PDC) position has a relatively low phenotypic effect. The degree to which it increases lactic acid production capacity is not significant, and in particular, the PDC contained in YBC is in the g3 The high expression rate is observed with the highly active promoter 002-1(PDC) using qPCR. We had previously confirmed this and conducted further research on related phenomena.

[0052] First, remove g3002-1 from the wild-type YBC strain. L.plantarum Origin Lactic acid production ability was confirmed by introducing LDH. The strain showed good phenotypic changes after PDC removal. Although observed, it was confirmed that very little lactic acid was produced. (by g4423) L.p lantarum When considering the strong expression of the derived LDH, different genes within the same strain may be present. Extreme differences in the expression levels of the same gene at different locations within the body were not a common phenomenon. 1. If the LDH is expressed in RNA, the translation step into protein will proceed smoothly. It is inferred that, in conclusion, the same gene was not transcribed at that PDC site. It is determined. In order to resolve this phenomenon, the inventors have put forward various hypotheses, but No hypothesis was found to resolve this. Therefore, the inventors considered the location of the gene and L.p lantarum It is assumed that the smooth expression of the derived LDH is suppressed due to a genetic structural problem. Therefore, in order to resolve this, LDH derived from other strains is introduced to change the genetic structure, and LDH The aim was to promote its expression.

[0053] The target LDH to be introduced should be acidic and optimized to match the characteristics of the acid-resistant bacterial strain as much as possible. We attempted to select genes that possess pH and are highly expressed in yeast. Searching for such genes through screening alone from a large number of genes requires lysotherapy. From the outset, it is nearly impossible, and genome mining is performed with many assumptions. This is a task that requires experimental confirmation. The inventors of this invention have developed such genome mining Rather than using a 3002 gene, we selected genes with similar characteristics from the literature and identified the g3002 gene of the acid-resistant strain in question. We first attempted to check the activity by placing it at position -1. Based on literature research, we found similar conditions To search for already identified genes, we looked at the target literature (Jae Won Lee et al, J. Among the genes tested in Biotechnology 241, 2017, those that showed an effect LDH derived from Staphylococcus epidermidis and Bos taurus The study targeted the LDH gene derived from the US.

[0054] The three target genes were compared to the g3002- of the wild-type YBC strain (KCTC13508BP). After introducing the substance at position 1, a comparison of lactic acid production capacity revealed some very interesting facts. 3 The differences in gene activity among the species were very large, but among them, S.epidermidis The originating LDH (SeLDH) gene is L.plantarum Derived from LDH (LpLDH) In comparison, a 39-fold increase in activity was observed based on lactate yield, resulting in the SeLDH gene A yield of 0.39 g / g was achieved at position g3002-1 alone. This is compared to the existing g4423 It exhibits activity comparable to LpLDH at the position, and as a result, high activity is also observed at the g3002-1 position. We also secured a plan to restore the LDH activity of the adaptively evolved strains while maintaining their activity.

[0055] however, S.epidermidis The LDH gene is a coenzyme among various LDHs. FDP-activated LDH (E) requests FDP .I Garvie,Bacterial Lactate Dehydrogenas (es, Microbiological Reviews, 1980) This is the form, FDP is an intermediate product of glycolysis. Therefore, the activity of the LpLDH gene is related to the ability of FDP to function. It is highly likely that its properties will be affected, and common glucose, fructose, sucrose, etc. When using a different sugar as a substrate, the activity may be affected compared to when using a sugar as a substrate. The possibility exists. However, the substrates mainly used in commercial processes are glucose and fructose. Corn starch, whose main components are sugars and sucrose, and These include saccharified products, sugarcane juice, and its by-products. Therefore, these constraints will be minimized.

[0056] In one embodiment of the present invention, the SeLDH gene is inserted into a bacterial strain selected using adaptive evolution. As expected, the strain produced significantly fewer by-products while also showing an increased rate of growth. I got it.

[0057] In culturing the bacterial strains secured by this invention, existing literature (Antonius Java n Maris et al.,Appl.Environ.Microbiol.,7 As described in 0;2898,2004), the ATP requirements for fermentation of acid-resistant bacterial strains, In other words, as the lactic acid concentration outside the cell increases, energy is needed to transport the internal lactic acid to the outside. Ghee is necessary, and therefore, ATP supply is required during fermentation by consuming ATP. It has been confirmed that this is because general fermentation involves the production strain producing lactic acid while blocking oxygen. By forcing production, we can secure 2 ATP / glucose, and further, acid-resistant lactic acid can be produced. This results in ATP depletion, which is why, under anaerobic conditions of general fermentation, the cell fibers This will result in a lack of energy needed for sustained activity. Oxygen supply is necessary to compensate for this. This oxygen then completely oxidizes the substrate in the TCA cycle, supplying ATP, which is energy. However, at the same time, some substrates are converted to CO2 instead of lactic acid, leading to a decrease in lactic acid yield. Therefore, the optimal approach is to minimize the loss of lactate yield while maintaining cell activity. Setting aeration conditions is necessary.

[0058] Furthermore, since the strain of the present invention is a yeast and a Gram-positive strain, this has been taken into consideration. The fermentation method must be established. As is well known, Gram-positive bacterial strains ferment in the presence of high concentrations of sugar. Furthermore, even under aerobic conditions, anaerobic fermentation reactions such as ethanol fermentation and lactic acid fermentation occur in addition to TCA. In contrast, Gram-negative bacterial strains may have their fermentation product production suppressed under aerobic conditions. Only the bacterial cells increase, and the bacterial growth phase and the fermentation product production phase can be separated and executed. These Gram-negative bacterial strains undergo cell growth under aerobic conditions and achieve high cell concentrations in fermenters. While this can be achieved, many substrates that are consumed under aerobic conditions are converted to CO2 as the cells grow. Because they are converted, it is not possible to increase the number of cells indefinitely to increase the fermentation rate (and moreover, It is also a fact that cell concentrations are limited by the nutrients and limiting substrates in the culture medium. In contrast, Gram-positive bacterial strains undergo cell growth under aerobic conditions and also produce fermentation products. Therefore, if the fermentation product is lactic acid, the lactic acid-producing enzyme LDH is consumed by NADH. The supply of NAD necessary for glycolysis continues, and relatively speaking, in Gram-negative strains, respiration is mediated by TCA. Therefore, compared to NAD, which supplies (oxidizes) the substrate while converting it to CO2, the carbon in CO2 Since it can increase lactic acid while minimizing losses, it may be advantageous for lactic acid yield. However, The rapid accumulation of fermentation products in the reactor leads to a relatively quicker arrival of lactic acid concentrations that cause growth inhibition. This can sometimes limit the cell proliferation to the desired concentration. To overcome this, the optimal seed concentration and initial fermentation growth rate are needed. Optimal oxygen supply that maximizes oxygen levels while preventing excessive conversion of the substrate to CO2 due to excess oxygen. The rate needs to be adjusted. Also, as soon as the lactic acid concentration that stops growth is reached, the oxygen supply rate should be adjusted immediately. By lowering the temperature, as mentioned earlier, ATP, which is the energy source that can expel lactic acid from the cell, is supplied. While maintaining a microaerobic state without excessive CO2 loss, It is necessary to adjust the oxygen supply rate so that this fermentation is neutralized. The addition of compounds and a high mixing rate in the fermenter to mix them (high mixin It is not necessary to maintain the g rate, but while reducing CO2 loss due to excess oxygen, In the early stages of fermentation, sufficient cell growth occurs, and in the later stages of fermentation, the smallest amount of cells that can generate sufficient ATP supply is required. It is necessary to adjust the oxygen supply rate, which is an important scale-up factor (S This is the cale-up factor. Optimizing the oxygen supply rate in this way is important in many practical applications. From the experiment, we were able to find the appropriate aeration rate and mixing rate, and also OUR and We use factors (parameters) known in the field, such as OTR, to find the optimal value. It can also be released.

[0059] In one embodiment of the present invention, the strain selected by adaptive evolution is the parent strain YBC. YBC1, YBC2 / Y are mutant strains derived from the parent strain (KCTC13508BP) or the parent strain. Compared to the BC3 / YBC4 / YBC5 strains, resistance to lactic acid is increased, and high cell concentrations are achieved. This allows for a rapid lactic acid production rate. In another aspect of the present invention, selection by the adaptive evolution described above is possible. In the separated strains, LDH was enhanced, and a reduction in ethanol and glycerol production was achieved. Ta.

[0060] In yet another aspect of the present invention, the PDC(g3002) of the genome of the parent strain YBC is used. -1) Location of the gene L.plantarum Lactic acid production appears when the derived LDH gene is introduced. Compared to Seino, S.epidermidis By introducing the derived LDH gene We confirmed that the lactic acid production capacity was enhanced by more than 30 times in terms of yield.

[0061] In the present invention, the gene encoding the lactate dehydrogenase introduced is L.helveticus Derived LDH gene, R.oryzae Derived LDH gene, L. plantarum Derived LDH gene, B.taurus Derived LDH gene, or S.e pidermidis It is preferably derived from LDH, and more preferably, L.plan tarum The derived LDH gene is introduced at position g4423(ADH),S.epider midis The derived LDH gene is preferably introduced at the g3002-1(PDC) position. stomach.

[0062] In one embodiment of the present invention, YBC5 strain (Δg4423::ldh / Δg3002-1:: LDH / ΔG2947 (::LDH / ΔG1544) shows remarkable lactic acid tolerance through adaptive evolution. The increased #26-5 strain yielded faster lactic acid production and higher lactic acid concentration, improving the economics of the process. It can be seen that the sex of this #26-5 strain is greatly increased. LDH S.epidermidis YBC6 strain (Δg442) with LDH substitution 3::LpLDH / Δg3002-1::SeLDH / Δg2947::LpLDH / Δ g1544) shows increased production rate and concentration compared to YBC5 and #26-5. We confirmed that the production of ethanol and glycerol was suppressed, and the yield also increased. The fermentation properties of eel YBC6 indicate that, as an acid-resistant strain, its yield, production rate, and production concentration are commercially viable. It can be confirmed that they have reached that level.

[0063] Therefore, in other respects, the present invention relates to (a) culturing the recombinant strain to produce lactic acid (b) a step of producing lactic acid; and (b) a step of obtaining the lactic acid produced. do.

[0064] This invention significantly increases lactate productivity, production concentration, and production yield, making it commercially viable. Upon reaching the Bell, ethanol production decreased significantly, and glycerol byproducts also decreased considerably. This allows us to secure superior acid-resistant strains of bacteria.

[0065] In the present invention, 'acid-resistant yeast' refers to yeast that, at a pH lower than the pKa value of an organic acid, is used in a culture medium. Compared to when organic acids are not present, the culture medium contains organic acids (especially lactic acid) at a concentration of 1M or higher. If so, the biomass consumption rate must be at least 10% (e.g., sugar consumption rate) or at least 10 It is defined as yeast that can maintain a non-growth rate of %. More specifically, in this invention, 'acid-tolerant yeast' 'Mother' refers to a biomass that is at least 10% higher at pH 2-4 compared to when the pH is 5 or higher. It is defined as yeast that can maintain a low sugar consumption rate (such as a low sugar consumption rate) or a non-growth rate of at least 10%. .

[0066] The recombinant yeast according to the present invention is obtained by conventional methods to transfer the gene to the chromosome (ch) of the host yeast. The gene may be inserted into a romosome, or a vector containing the gene may be introduced into the host yeast. It can be manufactured by importing it.

[0067] The aforementioned host yeast has high DNA introduction efficiency and high host cell expression efficiency of the introduced DNA. While cysts are commonly used, and one embodiment of the present invention uses acid-resistant yeast, the invention is not limited thereto. Any type of yeast is acceptable as long as it sufficiently expresses the target DNA.

[0068] The recombinant yeast is produced by any transformation method. It can be created. "Transformation" is the process of introducing DNA into a host, so that the DNA can be used as a chromosomal factor or Chromosome integration completes the process of making replication possible, and it allows for the introduction of external DNA into cells. This refers to the phenomenon of intentionally causing genetic changes, and common transformation methods include electroporation (ele Examples include ctroporation and lithium acetate-PEG.

[0069] Furthermore, the method for inserting a gene onto the chromosome of a host microorganism in this invention is not commonly known. Any gene manipulation method can be used, for example, retroviral vectors, adeno Viral vectors, adeno-related virus vectors, herpes simplex virus vectors TA, poxvirus vectors, lentivirus vectors, nonviral vectors, etc. One method is to use a "vector" that can express DNA in a suitable host. This refers to a DNA product containing DNA sequences operably ligated to a segmental sequence. This can be a plasmid, a phage particle, or simply a potential genomic insertion. A suitable host When transformed, the vector may replicate and function independently of the host genome, or In some cases, it may be integrated into the genome itself. Currently, plasmids are the most common vector. This is the form used, and linearized DNA is also used in yeast. This is the form commonly used for genome integration.

[0070] A typical plasmid vector contains (a) a plasmid vector per host cell. (b) Replication initiation site to enable efficient replication of sea urchins, and plasma transmutation using a plasmid vector. Antibiotic resistance genes or nutritional requirement marker genes (au) that enable selection of replaced host cells (c) xotrophic marker gene, and (c) insertable foreign DNA section. It has a structure that includes restriction enzyme cleavage sites. , synthetic oligonucleotide adapters (oligonucleotid) by conventional methods Using an adaptor or linker, the vector and foreign DNA can be connected. It can be easily ligated (Gibson assembly (mbly), and if necessary, methods that synthesize and use the entire desired sequence are also commonly used. It is being done.

[0071] Furthermore, the aforementioned gene is "operably linked" when it is arranged in a functional relationship with other nucleic acid sequences. This is done by "operably linked" the appropriate molecule (e.g., transcriptional activation). Genes linked in a way that enables gene expression when a protein binds to a regulatory sequence. It may be a child or regulatory sequence. For example, a pre-sequence or secretory sequence. The DNA for the leader is a precursor protein that participates in polypeptide secretion. When expressed, it is operably ligated to the DNA for the polypeptide; promoter or Enhancers are operably linked to coding sequences when they affect sequence transcription. The ribosome binding site may affect the transcription of the coding sequence. Operablely linked to; or the ribosome binding site is positioned to facilitate translation It is operably concatenated to the coding array when applicable.

[0072] Generally, "operably linked" means that the linked DNA sequences are in contact with and secreteable In the case of a da, it means that it is in contact and present within the reading frame. However, enhancement The enhancers do not need to be in contact. The concatenation of these sequences is a convenient limitation. This is carried out by ligation (linking) at the enzyme site. If not, use the usual method to synthesize oligonucleotide adapters (oligonucleo Use a tide adaptor or linker.

[0073] Of course, all vectors function equally well in expressing the DNA sequence of the present invention. Furthermore, it is not the case that all hosts function identically to the same expression system. No. However, a person skilled in the art would be able to deviate from the scope of the present invention without an excessive experimental burden. In this state, various other vectors, expression regulatory sequences, and hosts can be appropriately selected and applied. This is possible. For example, when selecting a vector, the host must be considered. This is because the vector needs to be replicated within its host, and the number of vector replications , the ability to regulate the number of copies, and other proteins encoded by the vector, e.g. For example, the expression of antibiotic markers should also be considered.

[0074] In this invention, the carbon source is glucose, xylose, arabinose, sucrose, f Composed of luctose, cellulose, galactose, glucose oligomer, and glycerol. It may be characterized by being one or more selected from the group, but is not limited to this.

[0075] In this invention, the culture is performed in such a way that microorganisms, such as E. coli, do not continue to function any further. For example, the culture may be carried out under conditions that make metabolite production impossible. For example, the culture may be performed at pH 1.0~ 6.5, preferably pH 1.0 to 6.0, more preferably pH 2.6 to 4.0. It may be characterized by, but is not limited to, these features. [Examples]

[0076] The present invention will be described in more detail below with reference to examples. These examples are merely illustrative of the present invention. These examples are for illustrative purposes only, and it should be interpreted that the scope of the present invention is limited by these embodiments. It would be obvious to anyone with common knowledge in this industry that this will not happen.

[0077] Example 1: Adaptive evolution of acid-resistant yeast strain YBC )#1 The inventors of this invention have found through tests on various yeast strains in prior research that the present inventors possess acid resistance. Select a suitable strain, and add lactic acid to the culture medium in the early stages of cultivation to promote microbial growth and sugar consumption. While monitoring the rate of wear, the YBC strain, which has the best acid resistance, was selected by Korea Bio-Technology Corporation. It was previously deposited with the Bioresource Center of the Graduate School of Science and Technology as KCTC13508BP. From phylogenetic analysis, the YBC strain (KCTC13508BP) is S.cerevisiae to Similar strains, possessing diploid genes (Diploid), and exhibiting crabtree-positive characteristics. I confirmed that it exists.

[0078] The YBC5 strain, which is a genetically engineered variant of the YBC strain, minimizes ethanol production. While obtaining this, lactic acid consumption is suppressed, glycerol production is suppressed, and a commercially viable yield is achieved. Achieved (Republic of Korea Patent Application No. 10-2020-0046779).

[0079] The aforementioned YBC5 strain is derived from the YBC strain by ADH (alcohol dehydrogen In the YBC1 strain, which had the LDH gene introduced while removing the ase gene, g300 was further added. A strain in which LDH is expressed while the 2-1 gene (PDC gene) is removed, and ethano The YBC2 strain, which produces lactic acid with high efficiency while its lactate production ability is blocked, consumes lactate. The g2947 gene, which is responsible for this process, is removed while the LDH gene is introduced, thereby eliminating the ability to expend lactate. A YBC4 strain was created, and the GPD1(g1544) gene was removed from the YBC4 strain. (Allele 1 and Allele 2 are diploid strains) (Removed) and then prepared.

[0080] The method for preparing the aforementioned strain is as follows: The aforementioned YBC1 strain had the g4423 gene, which is the main ADH gene of the YBC strain, removed. The LDH gene of Sequence ID No. 3, derived from Lactobacillus plantarum, is introduced at the aforementioned g4423 position. The introduced strains, based on g4423 and their UTR information, the ORFs of each gene were The removed gene cassette containing the 5' and 3' UTRs is prepared to create donor DNA (Dono It was used as r DNA. For each allele of g4423, the corresponding 5'UTR is indicated by SEQ ID NOs. 4 and 5, and 3'UTR is indicated by SEQ ID NOs. 6 and 5. As shown in 7, the donor DNA was prepared using restriction enzyme cloning, as previously mentioned. Methods and Gibson assembly and gene synthesis were used. The following method was used: The LDH of sequence number 3 was synthesized and then introduced at the ORF position of g4423. We prepared donor DNA and introduced it into YBC to create recombinant strain YBC1.

[0081] The g3002-1 gene was obtained through genome sequencing of the YBC strain (Secen). It is a gene located at scaffold position 72 in (ing) and is produced as a PDC gene. It is a movable gene. The g3002-1 gene of the YBC1 strain (located at scaffold 72) Recombinant strain YB in which the LDH gene of sequence number 3 was introduced while removing the gene that was present. C2 was fabricated.

[0082] Cassettes for replacing the g3002 gene like this are available. The UTR was used as the recombination position during the manufacturing process. Similar to the method of introducing LDH at the g4423 gene (ADH) position in YBC1, g30 It was constructed using the UTR of 02-1. However, for the substitution of the gene in question, the process was simplified. Therefore, without considering allele variation, a single allele is used. While donor cassettes were created using a single target group, it is also possible to create them separately for each allele. The primers used for gene substitution are also the same primers used to create the deletion strains mentioned above. In addition, a separate primer pair that can confirm both the UTR and LDH of g3002-1 is used. By using it individually, the accuracy of gene substitution confirmation was improved.

[0083] g3002-1UTR-LDH-fwd:GCAGGATATCAGTTGTTTG( Sequence ID 8) g3002-1UTR-LDH-rev:AATACCTTGTTGAGCCATAG (Sequence ID 9)

[0084] Furthermore, the YBC4 strain has the g2947 gene, which is the CYB2 gene of the YBC2 strain, removed. Furthermore, at position g2947, the LDH gene of Sequence ID No. 3, derived from Lactobacillus plantarum, is present. This is a strain into which the g2947 gene was introduced in the genome sequencing of the YBC strain. It is a gene located at scaffold position 41. Information on g2947 and its UTR Based on this, the ORF of each gene is removed, and a gene cassette containing the 5' and 3' UTRs is created. This was then used as donor DNA. For each allele of g2947, the corresponding 5'UTR was used. This is shown in SEQ ID NOs. 10 and 11, and 3'UTR is shown in SEQ ID NOs. 12 and 13. As shown above, the donor DNA was prepared using a restriction enzyme cloning method. Methods using Gibson assembly and gene synthesis were employed.

[0085] However, in the case of the gene substitution in question, for the sake of simplifying the process, allele changes are not considered. We created a donor cassette targeting one allele, but it is also possible to create one for each allele. be.

[0086] The aforementioned YBC5 strain was created by removing the g1544 gene, which is the GPD1 gene of the YBC4 strain. This strain is characterized by the g1544 gene, which was found in the genome sequence analysis of the YBC strain. It is a gene located at position 19. Based on the information of g1544 and their UTRs, each gene The offspring ORF is removed, and a gene cassette containing the 5' and 3' UTR and antibiotic marker is obtained. The DNA was prepared and used as donor DNA. For each allele of g1544, the corresponding 5'UT was used. R is shown in SEQ ID NOs. 14 and 15, and 3'UTR is shown in SEQ ID NOs. 16 and 17. As shown above, the donor DNA was prepared using a restriction enzyme cloning method. Methods using the Gibson Assembly method and gene synthesis were employed.

[0087] However, in the substitution of the gene in question, for the sake of simplifying the process, allele changes are not considered and only one is used. We created donor cassettes targeting the same allele, but it is also possible to create them for each individual allele. Furthermore, antibiotic markers can also be developed using currently commercially available genetic engineering technology (CRISPR). In such cases, it is also possible to manufacture and apply the product in a form that does not use it.

[0088] The genotypes of the recombinant strains prepared are as follows: YBC2: Δg4423::ldh / Δg3002-1::ldh YBC4: Δg4423::ldh / Δg3002-1::ldh / Δg2947:: ldh YBC5: Δg4423::ldh / Δg3002-1::ldh / Δg2947:: ldh / Δg1544

[0089] However, in order to ensure economic viability during commercialization, the recombinant strain must achieve a production rate of 2.5 g / L / hr or more and a lactic acid concentration of 120 g / L or more at a pH of 3.7 or less. Therefore, in the following examples, in order to increase the lactic acid production rate of the YBC5 strain, a treatment was performed to enhance the resistance to lactic acid.

[0090] The YBC5 strain was subcultured while sequentially increasing the lactic acid concentration from 10 g / L to 80 g / L as shown in Table 1. During subculture, mutants were generated in the cells by natural mutation, and among them, strains with high adaptability to high-concentration lactic acid grew relatively faster and gradually became dominant in the whole bacterial population. This process was repeated while increasing the lactic acid concentration, and the growth rate of the whole bacterial population was confirmed. Also, at an appropriate time point, colonies generated by smearing the bacterial population on an agar plate containing lactic acid were isolated. At this time, the colony selection criterion was to select the colony that became the largest due to fast growth on a solid medium containing lactic acid. Through such a process, 42 colonies were selected from bacterial populations that grew at liquid concentrations of 40, 50, 60, 70, and 80 g / L.

[0091] [[ID=4']]

[0092] ​​The changes in lactic acid concentration produced by the microbial community in each lactic acid-containing culture medium during this process are shown in Table 2. This will be shown.

[0093] [Table 2]

[0094] The 42 selected colonies were inoculated into 5 ml conical tubes. Small-scale culture Therefore, the inoculated OD should be taken as uniformly as possible from the colony and inoculated directly, and the culture medium used is m-YP medium (5g / L peptone, 4g / L yeast extract, 5g / L KH2PO4, 2g / L MgSO4·7H2O, 0.15g / L uracil) with 6% glucose (primary) or 1 The sample was used with 2% (secondary) added and incubated at 30°C and 150 rpm for 96 hours. The results of the 5 ml culture are shown in Table 3. In this culture, the lactate production concentration, cell concentration, or milk Fifteen colonies with high acid production yields were selected, and the following flask culture evaluation was performed.

[0095] The selected colonies are as follows: 3, 5, 6, 8, 10, 22, 24, 26, 27, 31, 32, 35, 37, 38, 41

[0096] [Table 3-1]

[0097] [Table 3-2]

[0098] Flask culture evaluation was performed on the selected colonies, and the culture conditions were as follows: m-YP medium (5g / L peptone, 4g / L yeast extract, 5g / L KH2PO4, 2g / L MgSO4·7H2O, 0.15 g / L uracil), 10% glucose (primary) was added to make the total volume 50 ml. After preparation, microorganisms were inoculated and cultured at 30 °C and 150 rpm for 72 hours. Also, after 1 day of culture, a CaCO3 solution was added so that 20% of the sugar injection concentration was injected. The analysis results for flask culture are shown in Table 4. Regarding the results of flask culture, a comprehensive judgment is necessary, and an evaluation logic was introduced. First, for each item of production rate, lactic acid yield, growth rate, ethanol concentration (in ascending order), glycerol concentration (in ascending order), the top 5 colonies were selected respectively. For the selected colonies, score points and weighted values were given according to the performance order of each item and then added up. The weighted value was given the highest priority to the lactic acid production rate for the purpose of adaptive evolution.

[0099] Colonies with a high growth rate but impaired lactic acid production ability were excluded. The evaluation process and results are shown in Table 5. As shown in Table 5, colony No. 26 (hereinafter referred to as "#26 strain") was selected. The main reason was that it was a colony in which the increase in by-products was minimized compared to the increase in lactic acid production ability. If the increase in by-products is excluded and only lactic acid production ability and yield are considered, colony No. 3 showed relatively excellent results. However, in the first round, overall performance was considered.

[0100]

[0100]

Table 4

[0101]

Table 5

[0102] As shown in Table 5, colony No. 26 (hereinafter referred to as "# twenty-six strains") was selected, but The main reason was that it was a colony in which the increase in by-products was minimized compared to the increase in lactic acid production ability. If the increase in by-products is excluded and only lactic acid production ability and yield are considered, colony No. 3 showed relatively excellent results. However, in the first round, overall performance was considered. In response to this increasing trend of by-products, subsequent adaptive evolution has taken place. This was also confirmed in e evolution.

[0103] Example 2: Adaptive evolution of acid-resistant yeast strain YBC #2 Selected in the first round of adaptive evolution in Example 1 Strain #26 showed improved performance compared to YBC5 (see Table 4 for comparison results with YBC5). (Refer to [source]), but the performance did not meet commercialization standards, so further improvement work was carried out.

[0104] Strain #26 showed increased tolerance to lactic acid concentrations, so we started with high concentrations of lactic acid and then proceeded to... The approach was to increase the number of subculturing cycles by adjusting the concentration, and to culture without adding CaCO3 as a neutralizing agent. We attempted to enhance growth potential under extreme conditions through cultivation.

[0105] The lactic acid used was produced in the culture medium during actual fermentation, with impurities removed using a 0.2 μm filter. Afterward, the solution is concentrated to produce a 40-50% solution, and then grown in a YP culture medium according to the desired lactic acid concentration. Mix with soil (20g / L peptone, 10g / L yeast extract), adjust sugar concentration to 10%, and subculture The culture medium was inoculated with 10% of the total volume of new medium and cultured.

[0106] Figure 1(a) shows the subculturing results of strain #26. Smooth subculturing was achieved even under a lactic acid concentration of 60 g / L. After confirming the growth of the fungal colony, the colony was diluted and cultured on YP medium on day 23, and 12 colonies were produced. — was separated. The colonies were selected based on size.

[0107] The selected colonies were cultured in a flask under the same conditions as in Example 1. The standard performance was based on the performance of strain #26. Following a selection process similar to that of Example 1, strain #5 was selected. Knee was selected, and in order to distinguish her from the results of the 1st Round, #2 We named it strain 6-5. The culture results for #26-5 are shown in Figure 2.

[0108] The third round of adaptive evolution was conducted with the goal of further increasing resistance compared to strain #26-5. The target strains used were strain #26-5 and the existing bacterial community cultured from the second round. Comparing the growth in both flasks at the beginning of the first round, we found that continuous cultivation from the second round onwards was successful. The growth of the resulting fungal community was relatively superior, and this was due to strain #26-5 selected from that community. Since there is a higher probability of the existence of more resistant mutants, strain #26-5 is adapted to be used as the initial culture. Evolution was interrupted. The results of the third round are shown in Figure 1(b). Lactic acid concentration was 80 g / The concentration was increased to L, and bacterial growth was observed, but relatively speaking, the growth rate was large compared to 60g / L. Since we confirmed that the growth rate decreased, we lowered the lactic acid content to 70g / L, which is suitable for smooth growth, and continued subculturing. Culturing was performed. After the third round, the bacterial community was smeared onto an agar plate and the colonies were observed. They were sorted. At this time, a YPDU agar plate containing 45 g / L of lactic acid and the lactic acid concentration were selected. Plates containing 50 g / L and 60 g / L of lactic acid were also prepared and smeared on both plates, and the lactic acid contained in them... Colonies were also formed on the agar plate.

[0109] However, the colonies generated in the additional third round were more lactic acid resistant than #26-5. The increased fermentation production increased the ability to grow in high concentrations of lactic acid, but compared to #26-5, The proportion of lactic acid in the product is lower, and ethanol and glycerol are by-products. Product production increased further. Here, we will compare the strain #26-5 and the strain isolated in the third round. The choice of which of these strains to target for additional development for commercialization is a matter of selection, and in the medium to long term... Further development will be carried out using strains with high lactic acid tolerance (research on restoring lactic acid production ability and reducing high levels of by-products). Alternatively, it may have a relatively low lactic acid tolerance, but still possesses good lactic acid tolerance. A decision was needed regarding whether to proceed with project #26-5, which also produces few by-products. In this invention, additional research was conducted on #26-5, which was expected to have a short development period.

[0110] Example 3: Comparison of gene expression before and after adaptive evolution In this example, YBC5 and #26-5 were subjected to qPCR-based adaptive evolution of genes. Changes in expression rates were confirmed. Each sample was cultured in YPDU medium at 30°C and 200 rpm for 24 hours. After extracting the total RNA from the sample, the RNA is analyzed by NGS to determine the presence of the same gene. The changes in the actual quantities were analyzed and are shown in Table 6.

[0111] [Table 6-1]

[0112] [Table 6-2]

[0113] [Table 6-3]

[0114] In selected colony strains, various genes undergo adaptive evolution. Expression levels increased or decreased due to (evolution), but the most notable difference was lactate production. This is the weakened portion of LpLDH (Lactobacillus plantarum-derived LDH) responsible for this function, and is separate This clearly indicates the need for LDH enhancement research. Despite the weakening, the inventor selected only the strains that produced lactic acid quickly, resulting in #2 In strains 6-5, numerous transporters (transp) transport sugars into the cell from the outside. It was found that the expression of the (orter) gene was enhanced, and this may also be related to the weakening of LpLDH. This is considered to be the main reason why it continued to exhibit rapid lactic acid production.

[0115] The acid-resistant recombinant strain #26-5 was deposited with KCTC on June 15, 2020. (Number KCTC14215).

[0116] Example 4: Fermentation operation using selected adaptively evolved bacterial strains In this example, the #26-5 strain selected by adaptive evolution in Example 3 was targeted for biotechnology. The lactic acid fermentation performance was confirmed by culturing in a reactor.

[0117] #26-5 strain in mYP medium (10g / L peptone, 5g / L yeast extract, 5g / L Primary seed culture in KH2PO4 (2g / L), MgSO4·7H2O (0.3g / L), and uracil. After culturing 40 ml of culture solution and 380 ml of secondary seed culture solution at 30°C and 200 rpm for 2 days, All cells were harvested and inoculated into 1.18 L of mYP medium and cultured at 30°C. However, m The concentration of the YP medium is determined in a 1.7L volume in which all of the additional sugar solution and CaCO3 solution are added. The concentration of the aforementioned components was adjusted. Culturing was started with an inoculation OD of 1.73, resulting in a 62.5% concentration. Add 100 ml of 42.33% CaCO3 to 450 ml of sugar solution in a separate feeding bottle. Mix in a (feeding bottle), and stir the bottle with a magnetic stirrer (s Mix continuously at 400 rpm with a tiller to maintain uniformity of CaCO3 in the solution. A mixture of sugar and CaCO3 was injected into the bioreactor. The method of CaCO3 injection was as follows: In addition to the method of mixing it with sea urchin sugar and injecting it, in some fermentations a certain amount (5-10%) is injected separately from the sugar solution. We also used a method of injecting (ml) once every two hours, but we tried to inject small amounts as evenly as possible. This approach minimizes the effect of CaCO3 input on increasing CO2 concentration, which is advantageous for improving fermentation performance. It was determined that it was mixed with sugar solution and injected. In commercial fermentation, CaCO3 is injected directly without mixing it with water. Direct injection is also possible, which does not result in dilution of the lactic acid concentration by additional water, but in the laboratory In the scale, sterile CaCO3 was injected as a solution phase using a method that allows for such injection. In the aforementioned ratio of sugar to CaCO3 mixture, CaCO3 may be injected evenly throughout the entire fermentation process. In some cases, the initial strain growth is most active within 24 hours after inoculation, when the amount of CaCO3 increases. Another method involves adding a portion of the fermentation solution, followed by injecting only the sugar solution (Fermentation ID 6). (0 standard). The injection rate of the sugar and CaCO3 mixture and the aeration rate are set for each batch. Although it varied for each ch, according to the fermentation ID F60 standard in Table 7, the injection rate of the mixed liquid was initially During the first two hours, the mixed solution was administered at a rate of 13.5 ml / hr, and thereafter at 15.3 ml / hr. F According to the 60 standard, the aeration rate during the cell growth phase is 0.7 lpm with stirring at 700 rpm. The culture was performed at a stirring rate, and after 8 PM, it was 600 rpm, 0 The culture was gradually converted to 0.35 lpm.

[0118] The fermentation culture results using strain #26-5 are shown in Figure 3.

[0119] Fermentation of strain #26-5 resulted in a lactic acid production rate of 2.54 g / L / hr and a yield of 0.6 The results showed 7g / g and a lactic acid concentration of 123g / L, which is excellent in terms of rate and concentration, but YBC It can be seen that the yield has decreased significantly compared to 5. This is because in this fermentation, ethanol and This problem arises from the generation of 7 g / L of glycerol each, and in adaptive evolution, lactic acid In exchange for the resulting resistance to and increased fermentation rate, the following counter-benefits occurred. This is due to the weakening of LDH and the expression of ethanol-producing genes, and is not something that can be counteracted. The proposal may involve enhancing LDH and removing the ethanol-producing gene, but of these, LDH enhancement methods were performed in Examples 5-7. The sugar concentrations shown in Figure 3 represent sugar and CaCO3. The sugar concentration in the reactor is displayed during the process of injecting mixture 3 in a fed batch. This is the result of commercial fermentation, where CaCO3 is injected separately while all the sugar is injected in the initial stages. It can also be operated in batches, and similarly, some sugars are produced in fed-batch or appropriately combined batches. Operation and optimization are also possible for semi-fed batches added during the fermentation process. It is possible.

[0120] The results of comparing only the lactic acid concentration in fermentation using strains #26-5 and YBC5. This is shown in Figure 4. Strain #26-5 showed a fermentation rate and lactic acid production concentration compared to strain YBC5. There is an increase on the lateral side, which is judged to be due to the effect of increased lactic acid tolerance. However, as mentioned above... For example, while the lactic acid yield of the YBC5 strain is at the level of 0.81-0.83 g / g, The lactic acid yield of strain #26-5 remained at 0.63-0.72 g / g, particularly near pH 3. The rate was 0.67–0.68 g / g (see F59 and F60 in Table 6).

[0121] The role and importance of aeration in acid-resistant fermentation have already been explained. Aeration must be maximized as much as possible during the 24-hour cell growth phase. After that, it must be maintained at a minimum value. However, excessive aeration during the cell growth phase is also necessary. In the experiment, a decrease in lactic acid yield was observed (see F57 fermentation in Table 7), and the activity of cells after 24 hours was observed. Because the aeration value for maintaining sex and its effect on yield are very sensitive, 2L culture is necessary. When reducing the lactic acid production rate from the optimal standard of 0.35 lpm to below 0.3 lpm, the lactic acid production rate will We have confirmed that it slows down significantly, and in severe cases, lactic acid production can stop completely, and that it can be below 0.4 lpm. It was also confirmed that the yield decreases inversely when proceeding as described above. Aeration rate This may be expressed as oxygen transport rate or cell oxygen inflow rate, but the reactor structure and stirrer Both the shape of the stirrer and the air discharge configuration of the sparger Because it is affected, if the above matters change, optimization will be required again, and this is due to microorganisms. For a company with comprehensive knowledge of cell culture, this process should not be particularly difficult.

[0122] The fermentation results under various conditions are shown in Table 7 below.

[0123] [Table 7]

[0124] Example 5: Comparison of the effect of LDH introduced at the g3002-1 position of the YBC strain. The PDC(g3002-1) position of the YBC strain L.plantarum Origin: LpLDH (Sequence ID 3), Bos taurus Derived from LDH (BtLDH) (Sequence ID 58), S .epidermidisCopy each of the originating LDH(SeLDH)(sequence number 1) twice. They were introduced one by one.

[0125] The method for preparing the aforementioned strain is as follows: The g3002-1 gene, which is the main PDC gene of the YBC strain, is removed, and the aforementioned g3002- LDH of Lactobacillus plantarum-derived yeast codon-optimized at position 1 of SEQ ID NO: 3 These are strains into which genes have been introduced, and each gene is based on the information of g3002-1 and their UTRs. As the gene's ORF is removed, LpLDH is introduced in its place, and the 5' of g3002-1 A gene cassette containing the 3'UTR was also constructed and used as donor DNA (Figure 5 Genetics). (See example of a child cassette). Note that the g3002-1 gene is from the genome sequence of the YBC strain. In Sing, it is a gene located at scaffold 72 and functions as a PDC gene. This is the gene that performs the action. In the substitution of this gene, for the sake of simplifying the process, an allele change (all Without considering allele variation, a donor cassette is used for a single allele. Although one sample was prepared, it is also possible to prepare samples for each allele of g3002-1. The corresponding 5'UTR is shown in SEQ ID NOs. 59 and 60, and the 3'UTR is shown in SEQ ID NO. 6 As shown in 1 and Sequence ID 62, restriction enzymes were used to prepare the donor DNA, as previously mentioned. A cloning method and a method using Gibson assembly may be used, but the said The entire gene sequence may be synthesized and used. This recombinant strain is named YBClp. Ta.

[0126] To confirm that the gene manipulation was performed correctly, the following primers were used to perform the transplantation. Identify the transformant and, if necessary, sequence the relevant gene portion. We identified the correct transformant through SING.

[0127] Similarly, strains into which the BtLDH gene was introduced were YBCbt, and strains into which the SeLDH gene was introduced were also introduced. The strain was named YBCse, and the primers used to identify the gene were as follows: It is.

[0128] 3002-1ORF verification forward:GCAGGATATCAGTTGTTTG (Sequence No. 63) 3002-1ORF confirmation reverse:ATAGAGAAGCTGGAACAG( (Sequence code 64) 3002-1UTR verification forward:GCAGGATATCAGTTGTTTG (Sequence ID 65) 3002-1UTR verification reverse: CAGAATCTTAGAAAGGAGG (Sequence ID 66) Forward to confirm LpLDH, BtLDH, and SeLDH implementation: GCAGGATAT CAGTTGTTTG (Sequence ID 67) LpLDH installation confirmation reverse:AATACCTTGTTGAGCCATAG( (Sequence code 68) BtLDH installation confirmation reverse: ACCTTCTTGTTGTCTAGC (distribution Column number 69) SeLDH installation confirmation reverse:ATAACTCTTTCAGCTGGC(array) Number 70)

[0129] For the converted strain whose genotype was confirmed, the inoculation OD was 0.1, and the culture medium was used. This uses YP medium (20 g / L peptone, 10 g / L yeast extract) with 6% glucose. Then, add 150 mg / L of uracil and culture in a 50 ml flask at 30°C and 150 rpm. The experiment was conducted under the specified conditions.

[0130] The results are shown in Table 8.

[0131] [Table 8]

[0132] As shown in Table 8, significant differences in lactate production were observed due to changes in LDH within the same genetic material. In particular, in LpLDH, when the g4423 gene position of YBC is substituted, It showed very strong expression at a rate of 0.5 g / g or higher, but almost no expression at the g3002-1 position. To show a special phenomenon that does not manifest, and to change the origin of this LDH to SeLDH, g3002- The acquisition of LDH activity at position 1 that is comparable to that at position g4423 is unprecedented. This is a new phenomenon that has never existed before.

[0133] Example 6: Effect of SeLDH substituted at the g3002-1 position in YBC1 and YBC5 strains In order to confirm the high activity of SeLDH at position g3002-1 as confirmed in the above example, The same genetic manipulation was performed on strains YBC1 and #26-5 (from YBC5). .

[0134] The genotypes of the target YBC1 and YBC5 are as follows: YBC1:Δg4423::LpLDH #26-5(from YBC5):Δg4423::LpLDH,Δg3002-7 2::LpLDH, Δg2947::LpLDH, Δg1544

[0135] The cassette and method used are similar to those in Example 5, but in the case of YBC5, the target position The LpLDH in this location must be replaced with SeLDH, but there is a similarity between the two LDH sequences. The low-quality parts are amplified to confirm the correct transformant. To confirm this, the primer was modified as follows:

[0136] Forward to confirm the presence of LpLDH:GCAGGATATCAGTTG TTTG (Sequence ID 71) reverse:TTTCAAACCAGTACC to confirm the existence of LpLDH ACCA (Sequence ID 72) forward1:GCAGGATATCAGTT to verify the substitution of SeLDH GTTTG (Sequence ID 73) reverse1:GAAGAAGAATACAA to verify the substitution of SeLDH AGCACC (Sequence ID 74) forward2:GCAGGATATCAGTT to verify the substitution of SeLDH GTTTG (Sequence ID 75) reverse2:CACCAGCTTTAACA to verify the substitution of SeLDH GTAAC (Sequence ID 76)

[0137] The strain in which SeLDH is introduced at the g3002 position of the YBC1 strain was named YBC2se. Furthermore, the strain in which SeLDH was introduced at the g3002 position of the YBC5 strain was named YBC6. Their genotypes are as follows:

[0138] YBC2se:Δg4423::LpLDH, Δg3002-72::SeLDH YBC6;Δg4423::LpLDH, Δg3002-72::SeLDH, Δg2 947::LpLDH, Δg1544

[0139] For the converted plants whose genotype was confirmed, the inoculation OD was 0.1, and the culture medium was YP medium (20g). (L peptone, 10g / L yeast extract) contains glucose, while YBC2 and YBC2se contain 5 For %, 10% was used for YBC5 and YBC6, and 150 mg / L of uracil was added, 50 The experiment was conducted using ml flask cultures under conditions of 30°C and 150 rpm.

[0140] The results are shown in Tables 9 and 10 below.

[0141] [Table 9]

[0142] [Table 10]

[0143] As shown in Tables 9 and 10, YBC2s located at the PDC gene position of the YBC1 strain. e yields significantly higher yields under similar conditions compared to YBC2 in which LpLDH is substituted at the same position. This shows that, in addition to PDC blockade, strong additional LDH expression by SeLDH is also occurring. Compared to ethanol production capacity, lactic acid production capacity is greatly enhanced, allowing lactic acid to be released outside the cell under acid-tolerant conditions. Taking into account the yield reduction associated with the ATP production required for transport, It shows a value that is almost identical to the theoretical yield. Also, existing adaptive evolution In strain #26-5, productivity was enhanced by (olution), but the yield was weakened. Also, under the same conditions, it showed a significant increase in yield, and the LDH that had been weakened by adaptive evolution was converted to g3002 The strong expression of SeLDH at position -1 significantly increased LDH activity, thus complementing it. This has been confirmed.

[0144] Example 7: Fermentation operation using YBC6 strain In this example, the lactic acid fermentation performance of YBC6 was confirmed by culturing it in a bioreactor. did.

[0145] YBC6 strain in mYP medium (10g / L peptone, 5g / L yeast extract, 5g / L K Primary seed culture 4 in H2PO4 (2g / L), MgSO4·7H2O (0.3g / L), and uracil. 0 ml, 380 ml of secondary seed culture, culture at 30°C and 200 rpm for 2 days, then all The cells were harvested and inoculated into 1.18 L of mYP medium and cultured at 30°C. However, mYP The concentration of the P medium is determined by the amount of 1.7 L of the medium into which all of the additional sugar solution and CaCO3 solution are added. The concentration was adjusted to [amount]. The inoculated OD was 1.74, and culture was started with a 64.4% glucose solution. Mix 450 ml of liquid with 100 ml of 42.33% CaCO3 in a separate feeding bottle. Combine the ingredients and continue stirring with a magnetic stirrer at 400 rpm to add CaCO3 to the solution. The CaCO3 was injected while maintaining uniformity. The method of CaCO3 injection is to inject it evenly. Minimizing the effect of CO2 concentration increase due to input (interference with oxygen transport) is advantageous for improving fermentation performance. It was determined that it was necessary, and it was injected after being mixed with sugar solution. In commercial fermentation, CaCO3 is not mixed with water. Direct injection is possible, but at the laboratory scale, a method that allows for the injection of sterile CaCO3 is preferred. Considering this, it was injected as a solution phase. Also, in the ratio of the sugar and CaCO3 mixture, C While aCO3 can be injected evenly throughout the entire fermentation process, in this fermentation, the initial strain growth was more active. Within 24 hours of inoculation, most of the CaCO3 is administered, and only the sugar solution is then injected. The following method was used: The infusion rate of the sugar and CaCO3 mixture was 4.5 ml / The injection rate was increased from hr to 18 ml / hr, and then to 22.5 ml / hr. Aeration The culture rate is 0.5 lpm at a stirring speed of 600 rpm during the cell growth phase, and after 12 hours... Then, gradually switch to 0.35 lpm and 600 rpm for culturing, and after 33 hours, reduce to 0.4 lpm The cells were cultured at 600 rpm in m.

[0146] The fermentation culture results using the YBC6 strain are shown in Figure 6. The sugar concentration shown in Figure 6 is due to the reaction during the process of injecting the sugar and CaCO3 mixture in a fed-add batch. This shows the sugar concentration inside the container; during commercial fermentation, CaCO3 is injected separately while the sugar is being added. It can be operated with batches where everything is injected initially, and similarly with sequential injections or a suitable combination thereof. Additionally, some sugars can be added during the fermentation process in a semi-flow batch manner, allowing for operation and optimization.

[0147] The culture results showed a lactate yield of 0.75 g / g and 2.56 g / L / h at pH 3.16. The yeast showed a high fermentation rate and a lactic acid concentration of 130 g / L, which is the performance of acid-tolerant strains published to date. This is the best result among them. Cargill's acid-resistant strain culture patent (US registered patent No. In (No. 7,232,664), the standard for the commercialization performance of acid-resistant lactic acid bacteria strains is 0.75g / The yield was 2.5 g, the fermentation rate was 2.5 g product / L / h, and the lactic acid concentration was 120 g / L. Although it is being considered, the results of this embodiment have achieved the aforementioned criteria in all indicators. In the example of registered Japanese Patent No. 7,232,664, the total yield was 0.67 g / g and 0.8 g lactic acid / g. - The average fermentation rate of cells / h and the concentration of 114 g / L are specified, but in this example... The fermentation results showed performance exceeding the yield and concentration limits.

[0148] The figure shows the results of comparing only the lactic acid production capacity of YBC strain 5, strain #26-5, and strain YBC6. As shown in 7, adaptive evolution and the PDC of the genome The superior lactate production of YBC6 can be confirmed through the combined effect of LDH enhancement at the position.

[0149] Depository name: Korea Institute of Biotechnology Accession number: KCTC14215BP Date of acceptance: 20200615

[0150] The above describes in detail specific parts of the present invention, and assumes common knowledge in the industry. For those who possess such a specific description, such a description is merely a preferred embodiment, and by this, It should be clear that the scope of the present invention is not limited by this. Therefore, the substantial scope of the present invention is It can be said that this is defined by the attached claims and their equivalents.

Claims

1. In acid-resistant yeast strain YBC (KCTC13508BP), pirubate decarboxyla The gene encoding the enzyme is deleted, and the gene encoding pyrubate decarboxylase is deleted. Staphylococcus epidermidis (Staphylococcus epidermidis) A gene encoding lactate dehydrogenase derived from *Ermidis* has been introduced. Recombinant strains that possess lactic acid-producing ability.

2. The aforementioned Staphylococcus epidermidis The gene encoding lactate dehydrogenase derived from ermidis is shown in Sequence ID No.

1. The recombinant strain according to claim 1, characterized by being displayed.

3. Further deletions or weakening of the gene encoding alcohol dehydrogenase The recombinant strain described in claim 1 is characterized by the following:

4. This code encodes an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate. The recombinant strain according to claim 1, characterized in that the gene is further deleted or weakened.

5. The gene encoding the enzyme that converts lactate to pirubate is further deleted or weakened. The recombinant strain according to claim 1, characterized by being present.

6. In acid-resistant yeast strain YBC (KCTC13508BP), dihydroxyacetonephosphate The GPD1 gene is a gene that codes for an enzyme that converts acid to glycerol-3-phosphate. , the CYB2 gene, which codes for the enzyme that converts lactate to pirubate, The ADH gene, which encodes glycerol dehydrogenase, and Pilbate Decal The PDC gene, which encodes boxylase, is deleted, and the lactate dehydro A recombinant bacterial strain having lactic acid production ability, into which a gene encoding genase has been introduced, The gene encoding the aforementioned lactate dehydrogenase is the deleted ADH gene, PD It is introduced at the positions of the C gene and the GPD1 gene. The gene encoding lactate dehydrogenase introduced at the location of the aforementioned PDC gene The gene is Staphylococcus epidermidis. It is a gene that codes for lactate dehydrogenase derived from Dermidis. A recombinant strain that is characteristic of the species.

7. The aforementioned Staphylococcus epidermidis The gene encoding lactate dehydrogenase derived from ermidis is shown in Sequence ID No.

1. The recombinant strain according to claim 6, characterized by being displayed.

8. Lactate hydroxypropyl alcohol is introduced at the location of the deleted ADH and GPD1 genes. The gene encoding the enzyme for drogenase is Staphylococcus epidermidis (Staph (derived from Ylococcus epidermidis) or Lactobacillus plantarum ( The claim is characterized by being derived from Lactobacillus plantarum. Recombinant strains as described in item 6.

9. A method for producing recombinant yeast strains with increased lactic acid tolerance and lactic acid production ability, including the following steps: (a) Recombinant yeast strains with lactic acid production ability are gradually introduced from low-concentration lactic acid medium to high-concentration lactic acid medium. Next, culture the recombinant yeast strain to allow it to adapt and evolve to high lactic acid concentrations; (b) A step of selecting recombinant yeast strains in which lactic acid production ability has been improved in high-concentration lactic acid medium; and (c) At the position of the PDC gene in the genome of the selected strain, Staphylococcus epi Lacte derived from Dermidis (Staphylococcus epidermidis) This is the stage where the gene encoding todehydrogenase is introduced.

10. The recombinant yeast strain having lactic acid production ability in step (a) above is the acid-resistant yeast YBC strain (KC In TC13508BP), dihydroxyacetone phosphate is replaced with glycerol-3-phosphate. The GPD1 gene, which codes for the enzyme that converts lactate to pirubate, The CYB2 gene, which codes for the enzyme that converts alcohol dehydrogenase, The ADH gene, which is a gene that codes for pirubate decarboxylase, and the gene that codes for pirubate decarboxylase The gene PDC is deleted, and the gene encoding the lactate dehydrogenase is deleted. A recombinant bacterial strain having lactic acid production ability, The gene encoding the aforementioned lactate dehydrogenase is the deleted ADH gene, PD This strain is characterized by being a YBC5 strain with the C gene and GPD1 gene introduced into their respective positions. The method according to claim 9.

11. In acid-resistant yeast strain YBC (KCTC13508BP), dihydroxyacetonephosphate The GPD1 gene is a gene that codes for an enzyme that converts acid to glycerol-3-phosphate. , the CYB2 gene, which codes for the enzyme that converts lactate to pirubate, The ADH gene, which encodes glycerol dehydrogenase, and pirbetodeca The PDC gene, which encodes luboxylase, is deleted, and the lactate dehydr A recombinant bacterial strain with lactic acid production ability, into which a gene encoding rogenase has been introduced, is used at high concentrations. Recombinant strain #26-5 (KCTC14215BP) obtained by adapting to lactic acid concentration.

12. In the genome of recombinant strain #26-5 (KCTC14215BP), at the position of the PDC gene, Staphylococcus epidermidis The gene encoding lactate dehydrogenase derived from idis has been introduced, and YB Compared to strain C (KCTC13508BP) or strain YBC5, lactic acid at high concentrations A recombinant yeast strain YBC6 with improved production capacity and reduced production of ethanol and glycerol.

13. A method for producing lactic acid, including the following steps; (a) Culturing the strain according to any one of claims 1 to 6, claim 11 and claim 12. The step of generating lactic acid; and (b) A step of obtaining the lactic acid produced.

Images