Oligonucleotide-based modification of C9orf72
A chemically modified dsRNA targeting C9orf72 gene expression addresses the limitations of current ALS treatments by effectively inhibiting the gene, offering significant therapeutic benefits for ALS and frontotemporal dementia.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF MASSACHUSETTS
- Filing Date
- 2026-01-26
- Publication Date
- 2026-06-02
AI Technical Summary
Current treatments for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia, such as riluzole and edaravone, do not halt disease progression and have limited therapeutic effects, while existing delivery methods for siRNA, like Lipofectamine, face challenges in effectively targeting C9orf72 mutations due to narrow effective and non-toxic ranges.
Development of a chemically modified RNA molecule, specifically a double-stranded RNA (dsRNA), designed to target and inhibit the C9orf72 gene expression by being complementary to a portion of its sequence, utilizing hydrophobic modifications and delivery methods like intraventricular or intrathecal injection to enhance brain penetration.
The dsRNA effectively inhibits C9orf72 gene expression by at least 50% to 90%, potentially slowing disease progression and providing therapeutic benefits for ALS and frontotemporal dementia.
Smart Images

Figure 2026090298000066 
Figure 2026090298000067 
Figure 2026090298000068
Abstract
Description
[Technical Field]
[0001] (Cross-reference of related applications) This application claims priority to U.S. Provisional Patent Application 62 / 826,589 filed March 29, 2019, U.S. Provisional Patent Application 62 / 864,789 filed July 21, 2019, and U.S. Provisional Patent Application 62 / 910,842 filed October 4, 2019, the entire contents of each of these applications being incorporated herein by reference.
[0002] (Statement regarding federally funded research or development) This application was filed with government support under licenses No. NS104022, HD086111, OD020012, and GM108803 granted by the National Institutes of Health. The government has certain rights to the invention.
[0003] (Field of this application) This disclosure relates to a novel C9orf72 target sequence, a novel oligonucleotide, and a novel method for treating and preventing neurodegeneration in diseases such as amyotrophic lateral sclerosis and frontotemporal dementia. [Background technology]
[0004] Amyotrophic lateral sclerosis (ALS) is a rapidly progressive and fatal neurodegenerative disease that affects motor neurons in both the brain and spinal cord, resulting in paralysis of voluntary muscles in the later stages of the disease. ALS affects approximately 6 in 100,000 people and generally leads to death within 3 to 5 years after the onset of symptoms, and there is still no cure. The US Food and Drug Administration (FDA) approved riluzole for the treatment of ALS in 1995. However, riluzole neither improves the clinical condition nor halts the progression of the disease, and it only extends ventilation-free survival by 2 to 3 months in patients with the sporadic or genetic (familial) form of the disease. Recently, the FDA approved treatment with edaravone. Unfortunately, edaravone has no therapeutic effect on the majority of ALS patients, and only a specific subset of patients has experienced a slowing of disease progression. Thus, developing therapeutics that clearly meet unmet medical needs is the key not only to the survival of ALS patients but also to changing the quality of life.
[0005] Mutations in SOD1 and C9orf72 account for the majority of the genetic cases of ALS (familial ALS, fALS) and cause death of upper and lower motor neurons by different mechanisms. SOD1 has been established as a historical target, but mutations in this gene are estimated to account for less than 10% of disease cases. On the other hand, the recently identified C9 is associated with more than 40% of fALS patients and patients with frontotemporal dementia (FTD). The expansion of the G4C2 hexanucleotide within intron 1 of the C9 gene not only forms nuclear and cytoplasmic RNA foci but also generates toxic repeat-associated non-ATG (RAN) dipeptides in the cytoplasm. The expression of mutant C9 hexanucleotides occurs in both the sense and antisense directions and is not contained in all C9 mRNA transcript variants. Thus, C9 has emerged as a promising and clear genetic target that can potentially be regulated by therapeutic gene silencing technologies.
[0006] Monogenetic diseases are ideal targets for oligonucleotide therapeutic interventions, such as RNA interference (RNAi). RNAi is a fundamental mechanism involving short double-stranded RNA fragments that can be used to reprogram cellular mechanisms as needed, silence, and degrade target mRNA. This technique has clinically proven effective and has revolutionized the field of human functional genetics. For mRNA knockdown, a variety of techniques have been explored, including virus-based delivery of short hairpin RNA (shRNA), antisense oligonucleotides (ASOs), and naked or slightly modified siRNAs, both as therapeutic and functional research tools.
[0007] Unmodified siRNA ("naked siRNA") has hitherto been difficult to deliver to more sensitive cell lines and tissues in vivo. Transfection reagents such as Lipofectamine can be used, but the effective and non-toxic range is very narrow, and different batches of neurons must be optimized independently to determine the ratio of siRNA to lipid required for equivalent levels of silencing. (Bell, H., Kimber, W. L., Li, M. & Whittle, I. R. Liposomal transfection efficiency and toxicity on glioma cell lines: in vitro and in vivo studies. NeuroReport 9, 793-798 (1998); Dass, C. R. Cytotoxicity issues pertinent to lipoplex-mediated gene therapy in-vivo. Journal of Pharmacy and Pharmacology 1-9 (2010); Masotti, A. et al. Comparison of different commercially available cationic liposome-DNA lipoplexes: Parameters influencing toxicity and transfection efficiency. Colloids and Surfaces B: Biointerfaces 68, 136-144 (2009); Zou, L. L. et al. Liposome-mediated NGF gene transfection following neuronal injury: potential therapeutic applications. Gene Ther 6, 994-1005 (1999)).
[0008] Hydrophobically modified siRNAs are also used as an alternative delivery method to cells and the brain (Sah, Supra; Soutschek, J. et al. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 432, 173-178 (2004); Cheng, K., Ye, Z., Guntaka, RV & Mahato, RI Enhanced hepatic uptake and bioactivity of type alpha1(I) collagen gene promoter-specific triplex-forming oligonucleotides after conjugation with cholesterol. Journal of Pharmacology and Experimental Therapeutics 317, 797-805 (2006); Byrne, M. et al. Novel Hydrophobically Modified Asymmetric RNAi Compounds (sd-rxRNA) Demonstrate Robust Efficacy in the Eye. Journal of Ocular Pharmacology and Therapeutics 29, 855-864). (2013)) Some of these compounds have been put into clinical use. [Overview of the project]
[0009] In one embodiment, the disclosure relates to a first target sequence 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', or 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA The present invention provides an RNA molecule (e.g., 8 to 80 nucleotides long, e.g., 15 to 35 bases long) that contains a complementary region substantially complementary to a portion of which has a length of 10 to 30 consecutive nucleotides at 3', for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides (e.g., a portion of which has a length of 15 to 25 consecutive nucleotides, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides).
[0010] In some embodiments, the RNA molecule is 8 to 80 nucleotides long (for example, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides) (Length, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 51 nucleotides, 52 nucleotides, 53 nucleotides, 54 nucleotides, 55 nucleotides, 56 nucleotides, 57 nucleotides, 58 nucleotides, 59 nucleotides, 60 nucleotides, 61 nucleotides, 62 nucleotides, 63 nucleotides, 64 nucleotides, 65 nucleotides, 66 nucleotides, 67 nucleotides, 68 nucleotides, 69 nucleotides, 70 nucleotides, 71 nucleotides, 72 nucleotides, 73 nucleotides, 74 nucleotides, 75 nucleotides, 76 nucleotides, 77 nucleotides, 78 nucleotides, 79 nucleotides, or 80 nucleotides).
[0011] In some embodiments, the RNA molecule is 10 to 50 nucleotides long (for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long).
[0012] In some embodiments, RNA molecules are 15 to 25 nucleotides long.
[0013] In some embodiments, the RNA molecule is 15 to 25 nucleotides long (for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides long).
[0014]
[0014] In some embodiments, the RNA molecule includes a complementarity region that is substantially complementary to AUAAAGAUUAACCAGAAGAA.
[0015] In some embodiments, the RNA molecule is single-stranded (ss)RNA or double-stranded (ds)RNA.
[0016] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, where the antisense strand includes a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0017] In some embodiments, the complementary region is complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 10 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 11 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 12 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 13 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 14 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 15 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 16 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 17 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 18 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.In some embodiments, the complementary region is complementary to 19 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 20 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 21 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 22 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 23 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 24 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. In some embodiments, the complementary region is complementary to 25 to 35 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0018] In some embodiments, the complementary region contains three or fewer mismatches with 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0019] In some embodiments, the complementary region is perfectly complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0020] In some embodiments, the dsRNA has a blunt end. In some embodiments, the dsRNA contains at least one single-stranded nucleotide overhang.
[0021] In some embodiments, dsRNA contains naturally occurring nucleotides.
[0022] In some embodiments, the dsRNA contains at least one modified nucleotide.
[0023] In some embodiments, the modified nucleotide is selected from the group consisting of 2'-O-methyl modified nucleotides, nucleotides containing a 5'-phosphorothioate group, and terminal nucleotides bonded to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.
[0024] In some embodiments, the modified nucleotide is selected from the group consisting of nucleotides including 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and non-natural bases.
[0025] In some embodiments, the dsRNA comprises at least one 2'-O-methyl-modified nucleotide and at least one nucleotide containing a 5' phosphorothioate group.
[0026] In some embodiments, the dsRNA is chemically modified by at least 80%.
[0027] In some embodiments, the dsRNA is completely chemically modified.
[0028] In some embodiments, the dsRNA includes a cholesterol portion.
[0029] In some embodiments, the RNA molecule comprises a 5' end and a 3' end, which are complementary to the target, where (1) the RNA molecule alternates between 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; and (4) the nucleotides at positions 1-2 and 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.
[0030] In some embodiments, the dsRNA has a 5' end and a 3' end, is complementary to the target, and comprises a first oligonucleotide and a second oligonucleotide, where (1) the first oligonucleotide comprises a sequence substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.
[0031] In some embodiments, the RNA molecule comprises a 5' end and a 3' end, which are complementary to the target, where (1) the RNA molecule comprises a region of three consecutive 2'-fluororibonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; (4) the nucleotides at positions 1-2 to 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds; and (5) the nucleotides at positions 1-2 from the 5' end are linked to each other via phosphorothioate bonds.
[0032] In some embodiments, the dsRNA has a 5' end and a 3' end, is complementary to the target, and comprises a first oligonucleotide and a second oligonucleotide, where (1) the first oligonucleotide comprises a sequence substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises a region of three consecutive 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.
[0033] In some embodiments, the first oligonucleotide is 20 nucleotides long, and the second oligonucleotide is 15 or 16 nucleotides long.
[0034] In some embodiments, the first oligonucleotide is 21 nucleotides long, and the second oligonucleotide is 15 or 16 nucleotides long.
[0035] In some embodiments, the first oligonucleotide is 20 or 21 nucleotides long, and the second oligonucleotide is 15 nucleotides long.
[0036] In some embodiments, the first oligonucleotide is 20 or 21 nucleotides long, and the second oligonucleotide is 16 nucleotides long.
[0037] In some embodiments, the first oligonucleotide is 20 nucleotides long, and the second oligonucleotide is 15 nucleotides long.
[0038] In some embodiments, the first oligonucleotide is 21 nucleotides long, and the second oligonucleotide is 16 nucleotides long.
[0039] In some embodiments, the dsRNA contains at least 80% chemically modified nucleotides (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides). In some embodiments, the dsRNA is completely chemically modified.
[0040] In some embodiments, the dsRNA contains at least 70% 2'-O-methylnucleotide modifications (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% 2'-O-methyl modifications).
[0041] In some embodiments, the dsRNA contains approximately 80% to 90% 2'-O-methyl nucleotide modifications (e.g., approximately 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% 2'-O-methyl nucleotide modifications). In some embodiments, the dsRNA contains approximately 83% to 86% 2'-O-methyl modifications (e.g., approximately 83%, 84%, 85%, or 86% 2'-O-methyl modifications).
[0042] In some embodiments, the dsRNA contains about 70% to about 80% of 2'-O-methyl nucleotide modifications (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, or 80% of 2'-O-methyl nucleotide modifications). In some embodiments, the dsRNA contains about 75% to about 78% of 2'-O-methyl modifications (e.g., about 75%, 76%, 77%, or 78% of 2'-O-methyl modifications).
[0043] In some embodiments, the first oligonucleotide comprises at least 80% chemically modified nucleotides (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides). In some embodiments, the first oligonucleotide is fully chemically modified.
[0044] In some embodiments, the first oligonucleotide comprises at least 70% 2'-O-methylnucleotide modification (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% 2'-O-methyl modification).
[0045] In some embodiments, the first oligonucleotide contains about 70% to 90% 2'-O-methyl nucleotide modifications (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% 2'-O-methyl modifications). In some embodiments, the first oligonucleotide contains about 85% to 90% 2'-O-methyl modifications (e.g., about 85%, 86%, 87%, 88%, 89%, or 90% 2'-O-methyl modifications).
[0046] In some embodiments, the first oligonucleotide contains about 75% to 85% 2'-O-methyl nucleotide modification (e.g., about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, or 85% 2'-O-methyl modification).
[0047] In some embodiments, the second oligonucleotide comprises at least 80% chemically modified nucleotides (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides). In some embodiments, the second oligonucleotide is fully chemically modified.
[0048] In some embodiments, the second oligonucleotide contains at least 65% 2'-O-methylnucleotide modification (e.g., 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% 2'-O-methyl modification). In some embodiments, the second oligonucleotide contains 100% 2'-O-methylnucleotide modification.
[0049] In some embodiments, the second oligonucleotide contains about 70% to about 85% of 2'-O-methylnucleotide modifications (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, or 85% of 2'-O-methylnucleotide modifications).
[0050] In some embodiments, the second oligonucleotide contains about 65% to about 75% of 2'-O-methylnucleotide modifications (e.g., about 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% of 2'-O-methylnucleotide modifications).
[0051] In some embodiments, the second oligonucleotide has a hydrophobic molecule attached to its 3' end.
[0052] In some embodiments, the second oligonucleotide has a hydrophilic molecule attached to its 3' end. Typical examples of hydrophilic moieties include aptamers, carbohydrates, and hydrosoluble vitamins.
[0053] In some embodiments, the bond between the second oligonucleotide and the hydrophobic molecule comprises polyethylene glycol or triethylene glycol.
[0054] In some embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds.
[0055] In some embodiments, the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide, and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide, are linked to adjacent ribonucleotides via phosphorothioate bonds.
[0056] In one embodiment, the present disclosure provides a pharmaceutical composition for inhibiting the expression of the C9ORF72 gene in an organism, comprising the dsRNA and a pharmaceutically acceptable carrier described herein.
[0057] In some embodiments, the dsRNA inhibits the expression of the C9ORF72 gene by at least 50%.
[0058] In some embodiments, the dsRNA inhibits the expression of the C9ORF72 gene by at least 90%.
[0059] In one embodiment, a method for inhibiting the expression of the C9ORF72 gene in cells, (a) Introducing the double-stranded ribonucleic acid (dsRNA) described herein into cells. (b) A method is provided for inhibiting the expression of the C9ORF72 gene in cells, comprising maintaining the cells prepared in step (a) for a sufficient time to obtain degradation of the mRNA transcript of the C9ORF72 gene.
[0060] In one embodiment, the present disclosure provides a method for treating or managing a neurodegenerative disease, comprising administering a therapeutically effective dose of the dsRNA to a patient in need of such treatment or management.
[0061] In some embodiments, dsRNA is administered to the patient's brain.
[0062] In some embodiments, dsRNA is administered by intraventricular (ICV) or intrathecal (IT) injection.
[0063] In some embodiments, administration of dsRNA induces a reduction in C9ORF72 gene mRNA in the brain.
[0064] In some embodiments, administration of dsRNA induces a reduction in C9ORF72 gene mRNA in the spinal cord.
[0065] In some embodiments, the dsRNA inhibits the expression of the C9ORF72 gene by at least 50%.
[0066] In some embodiments, the dsRNA inhibits the expression of the C9ORF72 gene by at least 90%.
[0067] In one embodiment, the present disclosure provides a vector for inhibiting the expression of the C9ORF72 gene in a cell, comprising a regulatory sequence manipulably bound to a nucleotide sequence encoding an RNA molecule substantially complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', wherein the RNA molecule is 10 to 35 nucleotides long, and the RNA molecule, upon contact with a cell expressing the C9ORF72 gene, inhibits the expression of the C9ORF72 gene by at least 50%.
[0068] In some embodiments, the RNA molecule inhibits the expression of the C9ORF72 gene by at least 90%.
[0069] In some embodiments, the RNA molecule is ssRNA or dsRNA.
[0070] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, where the antisense strand includes a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0071] In one embodiment, the present disclosure provides cells containing the above-mentioned vector.
[0072] In one embodiment, the present disclosure provides an RNA molecule of 15 to 35 nucleotides in length, comprising a complementarity region substantially complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', which targets an intron of the C9ORF72 gene mRNA.
[0073] In some embodiments, the RNA molecule is ssRNA or dsRNA.
[0074] In some embodiments, the dsRNA comprises a sense strand and an antisense strand, where the antisense strand includes a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0075] In one embodiment, the present invention provides a dibranched RNA compound comprising two RNA molecules of 15 to 35 nucleotide lengths, each containing a complementarity region substantially complementary to C9ORF72 mRNA, wherein the two RNA molecules are linked to each other by one or more portions independently selected from linkers, spacers, and branching points.
[0076] In some embodiments, the RNA molecule includes a complementarity region that is substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0077] In some embodiments, the RNA molecule includes a complementarity region that is substantially complementary to AUAAAGAUUAACCAGAAGAA.
[0078] In some embodiments, the RNA molecule is ssRNA or dsRNA.
[0079] In some embodiments, the RNA molecule is an antisense molecule or a gapmer molecule.
[0080] In some embodiments, the antisense molecule is an antisense oligonucleotide.
[0081] In some embodiments, the antisense molecule enhances the decomposition of complementary regions.
[0082] In some embodiments, the degradation is nuclease degradation.
[0083] In some embodiments, nuclease degradation is mediated by RNase H.
[0084] In one embodiment, the present disclosure provides an RNA molecule having a length of 15 to 35 nucleotides and containing a complementarity region substantially complementary to the gene region of the C9ORF72 gene described in Table 1, Table 2, Table 3, Table 4, or Table 5.
[0085] In some embodiments, the RNA molecule is single-stranded (ss)RNA or double-stranded (ds)RNA.
[0086] In one embodiment, the disclosure provides a branched oligonucleotide compound comprising two or more nucleic acids, each nucleic acid independently having a length of 15 to 35 nucleotides, each nucleic acid independently comprising a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', and the two or more nucleic acids being linked by one or more portions selected from linkers, spacers, and branching points.
[0087] In some embodiments, each nucleic acid is independently 15 to 25 nucleotides long.
[0088] In some embodiments, at least one complementary region is substantially complementary to 5' AUAAAGAUUAACCAGAAGAA 3'.
[0089] In some embodiments, the nucleic acid is double-stranded (ds)RNA, and each nucleic acid comprises a sense strand and an antisense strand, each antisense strand comprising a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0090] In some embodiments, each complementary region is complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0091] In some embodiments, each complementary region contains three or fewer mismatches with 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0092] In some embodiments, each complementary region is perfectly complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
[0093] In some embodiments, the dsRNA of at least one nucleic acid comprises at least one modified nucleotide. The modified nucleotide is selected from the group consisting of 2'-O-methyl modified nucleotides, nucleotides containing a 5'-phosphorothioate group, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramides, nucleotides containing non-natural bases, and terminal nucleotides bonded to a cholesteryl derivative or a dodecanoate bisdecylamide group.
[0094] In some embodiments, the dsRNA of at least one nucleic acid is chemically modified by at least 80%.
[0095] In some embodiments, the dsRNA of at least one nucleic acid is fully chemically modified.
[0096] In some embodiments, each nucleic acid comprises a 5' end and a 3' end and is complementary to the target, where (1) the nucleic acid alternates between 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; and (4) the nucleotides at positions 1-2 and 1-7 from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.
[0097] In some embodiments, the branched oligonucleotide compound comprises nucleic acids 2, 3, 4, 6, or 8.
[0098] In some embodiments, the nucleic acid of the branched oligonucleotide compound is a double-stranded (ds)RNA, where each ds nucleic acid comprises a sense strand and an antisense strand, and each dsRNA is independently linked to a linker, spacer, or branch point at the 3' or 5' end of the sense strand or antisense strand.
[0099] In some embodiments, each linker of the branched oligonucleotide compound is independently selected from the group consisting of ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof; where any carbon or oxygen atom of the linker may be replaced by a nitrogen atom and have a hydroxyl substituent or an oxo substituent.
[0100] In one embodiment, this disclosure relates to formula (I) [ka] [In formula (I), L is selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof, where formula (I) may further include one or more branching points B and one or more spacers S (where B is independently a polyvalent organic species or a derivative thereof, each time it appears; S is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof, each time it appears); N is a double-stranded nucleic acid of 15-35 nucleotides in length, comprising a sense strand and an antisense strand, where the antisense strand is 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA The present invention provides a compound represented by [containing a complementary region substantially complementary to 3', the sense chain and antisense chain each independently containing one or more chemical modifications, and n is 2, 3, 4, 5, 6, 7, or 8].
[0101] In some embodiments, the compounds represented by formula (I) are formulas (I-1) to (I-9): [Table 1] It has a structure selected from among.
[0102] In some embodiments, the antisense chain of the compound represented by formula (I) is [ka] It contains a 5' terminal group R selected from the group consisting of the following.
[0103] In some embodiments, the compound represented by formula (I) is represented by formula (II): [ka] The formula has the structure [wherein X is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; - indicates a phosphodiester nucleoside bond; = indicates a phosphorothioate nucleoside bond; and --- indicates, each time it appears, alone, a base pairing interaction or mismatch].
[0104] In some embodiments, the compound represented by formula (II) is represented by formula (III): [ka] [In the formula, X X is a nucleotide that independently contains a 2'-deoxy-2'-fluoro modification each time it appears; X is a nucleotide that independently contains a 2'-O-methyl modification each time it appears; Y The structure is such that each instance of Y is independently a nucleotide containing a 2'-deoxy-2'-fluoro modification; and each instance of Y is independently a nucleotide containing a 2'-O-methyl modification.
[0105] In some embodiments, the compound represented by formula (I) is represented by formula (IV): [ka] The formula has the structure [wherein X is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; - indicates a phosphodiester nucleoside bond; = indicates a phosphorothioate nucleoside bond; and --- indicates, each time it appears, alone, a base pairing interaction or mismatch].
[0106] In some embodiments, the compound represented by formula (IV) is represented by formula (V): [ka] [In the formula, X X is a nucleotide that independently contains a 2'-deoxy-2'-fluoro modification each time it appears; X is a nucleotide that independently contains a 2'-O-methyl modification each time it appears; Y The structure is such that each instance of Y is independently a nucleotide containing a 2'-deoxy-2'-fluoro modification; and each instance of Y is independently a nucleotide containing a 2'-O-methyl modification.
[0107] In some embodiments, L is structure L1: [ka] That is the case.
[0108] If L is structure L1, then R can be R3, and n can be 2.
[0109] In some embodiments, L is structure L2: [ka] That is the case.
[0110] If L is structure L2, then R can be R3, and n can be 2.
[0111] In one embodiment, this disclosure is expressed as formula (VI): [ka] [In formula (VI), L is selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof, where formula (VI) may further comprise one or more branching points B and one or more spacers S (where B is independently a polyvalent organic species or a derivative thereof, each instance of which is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof); each cNA is independently a carrier nucleic acid comprising one or more chemical modifications; each cNA independently comprises at least 15 consecutive nucleotides in the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; and n is 2, 3, 4, 5, 6, 7, or 8] to provide a delivery system for therapeutic nucleic acids.
[0112] In one embodiment, the delivery system is given by equations (VI-1) to (VI-9): [Table 2] It has a structure selected from among.
[0113] In some embodiments, each cNA in the delivery system independently consists of a chemically modified nucleotide.
[0114] In a typical embodiment, the delivery system further comprises "n" therapeutic nucleic acids (NAs), where each NA is hybridized to at least one cNA.
[0115] In some embodiments, each NA independently comprises at least 16 consecutive nucleotides.
[0116] In some embodiments, each NA independently contains 16 to 20 consecutive nucleotides.
[0117] In some embodiments, each NA independently comprises at least two unpaired nucleotide protrusions. The nucleotides of the protrusions may be bound via phosphorothioate bonds.
[0118] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagonist miR, miRNA, gapmer, mixmer, or guide RNA. A "gapmer" is a chimeric antisense oligonucleotide containing a central block of deoxynucleotide monomers long enough to induce cleavage by RNase H. A "mixmer" is an oligomer consisting of alternating short stretches of LNA and DNA.
[0119] In one embodiment, the present disclosure provides a pharmaceutical composition for inhibiting the expression of the C9ORF72 gene in a living organism, comprising any of the above-described branched oligonucleotide compounds or any of the above-described delivery systems and a pharmaceutically acceptable carrier.
[0120] In some embodiments, the branched oligonucleotide compound or delivery system of the pharmaceutical composition inhibits the expression of the C9ORF72 gene by at least 50%.
[0121] In some embodiments, the branched oligonucleotide compound or delivery system of the pharmaceutical composition inhibits the expression of the C9ORF72 gene by at least 90%.
[0122] In one embodiment, the present disclosure provides a method for inhibiting the expression of the C9ORF72 gene in a cell, comprising (a) introducing any of the branched oligonucleotide compounds or any of the delivery systems described above into a cell; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the C9ORF72 gene, thereby inhibiting the expression of the C9ORF72 gene in a cell.
[0123] In one embodiment, the present disclosure provides a method for treating or managing a neurodegenerative disease, comprising administering a therapeutically effective amount of any of the branched oligonucleotide compounds or any of the delivery systems described above to a patient in need of such treatment or management.
[0124] In some embodiments, the branched oligonucleotide compound or delivery system is administered to the patient's brain.
[0125] In some embodiments, the branched oligonucleotide compound or delivery system is administered by intraventricular (ICV) or intrathecal (IT) injection.
[0126] In some embodiments, administration of branched oligonucleotide compounds or delivery systems induces a reduction in C9ORF72 gene mRNA in the brain.
[0127] In some embodiments, administration of branched oligonucleotide compounds or delivery systems induces a reduction in C9ORF72 gene mRNA in the spinal cord.
[0128] In some embodiments, the branched oligonucleotide compound or delivery system inhibits the expression of the C9ORF72 gene by at least 50%.
[0129] In some embodiments, the branched oligonucleotide compound or delivery system inhibits the expression of the C9ORF72 gene by at least 90%.
[0130] In one embodiment, the disclosure relates to a branched oligonucleotide compound comprising two nucleic acids, each independently 15 to 35 nucleotides in length, wherein each nucleic acid comprises a complementarity region substantially complementary to C9ORF72 mRNA, and the two nucleic acids are linked to each other by one or more portions independently selected from linkers, spacers, and branching points.
[0131] In some embodiments, each nucleic acid independently comprises a complementarity region substantially complementary to the gene region in the C9ORF72 gene described in Table 1, Table 2, Table 3, Table 4, or Table 5.
[0132] In some embodiments, each nucleic acid is independently single-stranded (ss)RNA or double-stranded (ds)RNA.
[0133] In one embodiment, the disclosure provides a dibranched oligonucleotide compound comprising a first guide chain, a second guide chain, a first passenger chain, a second passenger chain, and a linker. The first and second guide chains each independently contain a complementarity region substantially complementary to 5'GAUUAACCAGAAGAA 3'. The first and second passenger chains are linked via a linker.
[0134] In some embodiments, the first guide chain and the second guide chain each independently contain 5'VP(mU)#(fU)#(mC)(fU)(fU)(fC)(mU)(fG)(mG)(fU)(mU)(fA)(mA)#(fU)#(mC)#(mU)#(mU)#(mU)#(mA)#(fU) 3'. In more embodiments, the first passenger chain and the second passenger chain each contain 5'(mG)#(mA)#(fU)(mU)(fA)(mA)(fC)(mC)(fA)(mG)(mA)(mA)(fG)#(mA)#(mA) 3'.
[0135] The linker may be selected from the group consisting of ethylene glycol chains, alkyl chains, peptides, RNA oligonucleotides, DNA oligonucleotides, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof, where any carbon or oxygen atom of the linker may be replaced by a nitrogen atom, may have a hydroxyl substituent, or may have an oxo substituent. In a non-limiting embodiment, the linker may be glycerol or a glycerol homolog chain of the formula -O-(CH2)o-CH(OH)-(CH2)pO- [wherein o and p are independently integers from 1 to about 6], and the formula -O-(CH2) m -C(O)NH-CH2-CH(OH)-CH2-NHC(O)-(CH2) m The derivatives are selected from the group consisting of derivatives of 1,3-diamino-2-hydroxypropane having -O-[wherein m is an integer from 0 to about 10]. In a more non-limiting embodiment, the 3' end of the first passenger chain is linked to the 3' end of the second passenger chain via a linker.
[0136] In another embodiment, the present disclosure provides a method for treating or managing neurodegenerative diseases. The method of the present invention involves administering to a patient requiring such treatment or management a therapeutically effective amount of a dibranched oligonucleotide compound comprising a first guide chain, a second guide chain, a first passenger chain, a second passenger chain, and a linker as shown in a previous embodiment. In some embodiments, the dibranched oligonucleotide compound is administered to the patient's brain, for example, by intraventricular (ICV) or intrathecal (IT) injection. In a non-limiting embodiment, administration of the dibranched oligonucleotide compound causes a reduction in C9ORF72 disease isoform gene mRNA in the brain. In another non-limiting embodiment, administration of the dibranched oligonucleotide compound or a delivery system causes a reduction in C9ORF72 disease isoform gene mRNA in the spinal cord. In an example embodiment, the dibranched oligonucleotide compound inhibits the expression of the C9ORF72 disease isoform gene by at least 50%. In another example embodiment, the dibranched oligonucleotide compound inhibits the expression of the C9ORF72 disease isoform gene by at least 90%.
[0137] The embodiments outlined above are based on an RNA molecule substantially complementary to the first target sequence 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA'. In another embodiment, the RNA molecule is substantially complementary to the second target sequence 5' UGCUCUCACAGUACUCGCUGAGGGUGAACAAGAAAAGACCUGAUA 3', for example, the RNA molecule includes a complementarity region substantially complementary to 5' CGCUGAGGGUGAACAAGAAA 3'. In yet another embodiment, the RNA molecule is substantially complementary to the third target sequence 5' CGUCAAACAGCGACAAGUUCCGCCCACGUAAAAGAUGACGCUUGG 3', for example, when the RNA molecule includes a complementarity region substantially complementary to 5'AGUUCCGCCCACGUAAAAGA 3'. Embodiments in which the RNA molecule is substantially complementary to 5' GGUCUAGCAAGAGCAGGUGUGGGUUUAGGAGGUGUGUGUUUUGT 3' are also considered, for example, when the RNA molecule contains a complementarity region that is substantially complementary to 5' GGUGUGGGUUUAGGAGGUGU 3'. [Brief explanation of the drawing]
[0138] The above and other features and advantages of this application will be better understood from the following detailed description of exemplary embodiments taken in conjunction with the attached drawings. The patent or application file includes at least one drawing performed in color. A copy of this patent or patent application publication, including the color drawing, will be provided domestically upon request and payment of the required fees.
[0139] [Figure 1]Figures 1A-1D are schematic diagrams quoted from Haeusler et al. (Nature Reviews Neuroscience volume 17, pages 383-395 (2016)), showing the C9orf72 gene and the regions targeted non-selectively or selectively by sense and antisense products. (A) Schematic diagram of the C9ORF72 gene and intron hexanucleotide repeat region. (B) Schematic diagram of the non-pathological sense strand and siRNA target region in exon 2. (C) Schematic diagram of the sense strand containing pathological hexanucleotide repeats, the siRNA non-selective target region in exon 2, and the selective siRNA target region consisting of exon 1a and intron 1. (D) Schematic diagram of the antisense strand containing pathological hexanucleotide repeats, and the selective siRNA target region consisting of exan 1a and intron 1.
[0140] [Figure 2] Figure 2 is a graphical representation of the results of systematic screening of C9orf72 sense-strand target siRNA (1.5 μM) molecules in HeLa cells over 72 hours using the psiCHECK2 system. Candidates for selective target regions spanning exon 1 / intron 1 and non-selective regions of exon 2 were tested. Knockdown was measured in cells by fluorescence detection of a luciferase reporter compared to untreated control cells. Strong knockdown was observed for three candidates in exon 1, one candidate at the junction of exon 1 and intron 1, four candidates in intron 1, and three candidates in exon 2.
[0141] [Figure 3]Figure 3 is a graphical representation of the results of systematic screening of C9orf72 antisense chain-targeted siRNA (1.5 μM) molecules in HeLa cells using the psiCHECK2 system for 72 hours. Candidates for selective target regions spanning exon 1 / intron 1 and non-selective regions of exon 2 were tested. Knockdown was measured in cells by fluorescence detection of a luciferase reporter compared to untreated control cells. Strong knockdown was observed for 3 candidates in exon 1, 9 candidates in intron 1, and 4 candidates in exon 2.
[0142] [Figure 4] Figure 4 is a graphical representation of the results of systematic screening of C9orf72 sense-strand targeting siRNA (1.5 μM) molecules within the non-selective region of exon 2. Knockdown was measured in cells by fluorescence detection of a luciferase reporter compared to untreated control cells.
[0143] [Figure 5] Figure 5 shows the results of luciferase reporter assays for seven candidate non-selective C9orf72 sense-targeting siRNA molecules. Results were obtained using the psiCHECK2 system at various siRNA concentrations in HeLa cells using the DualGlo assay. Knockdown was measured in cells by fluorescence detection of the luciferase reporter compared to untreated control cells.
[0144] [Figure 6] Figure 6 shows the results of luciferase reporter assays for three candidate siRNA molecules to determine IC50 inhibition levels. Results were obtained using the psiCHECK2 system at various siRNA concentrations in HeLa cells using the DualGlo assay. Knockdown was measured by fluorescence detection of the luciferase reporter in cells compared to untreated control cells.
[0145] [Figure 7]Figure 7 shows the results of a systematic screening in U87MG glioblastoma cells using candidate siRNA molecules targeting the exon 2 region of C9orf72. The results were obtained by measuring the level of C9orf72 mRNA by qPCR and comparing its expression to that of untreated control cells.
[0146] [Figure 8] Figure 8 shows the mRNA levels of C9orf72 in U87MG glioblastoma cells treated with candidate siRNA molecules. Results were obtained using qPCR. mRNA levels are shown as a percentage of untreated control cells.
[0147] [Figure 9] Figure 9 shows the mRNA levels of C9orf72 in cultured fibroblasts from two patients. mRNA levels were quantified using qPCR and compared to untreated control levels. Fibroblasts from C9.2 and C9.3 patients showed knockdown of C9orf72 expression in all selected candidates.
[0148] [Figure 10] Figure 10 shows mRNA levels from cultured neurons of a C9ALS mouse model targeting a candidate region of C9orf72 exon 2. mRNA levels were quantified using qPCR and compared to untreated control levels.
[0149] [Figure 11A] Figures 11A-B show the mRNA levels of C9orf72 in a mouse model of amyotrophic lateral sclerosis after treatment with siRNA knockdown molecules, compared to the untreated control. Strong knockdown was observed in several candidate molecules. [Figure 11B] Figures 11A-B show the mRNA levels of C9orf72 in a mouse model of amyotrophic lateral sclerosis after treatment with siRNA knockdown molecules, compared to the untreated control. Strong knockdown was observed in several candidate molecules.
[0150] [Figure 12] Figures 12A-D visually illustrate the reduction of nuclear and cytoplasmic lesions in cultured patient fibroblasts of two representative candidates compared to untreated control cells. (A) is a graph showing that in C9.2 patient fibroblasts, the percentage of cells with intranuclear lesions decreased compared to untreated control cells, and the percentage of cells without intranuclear lesions increased in these cells. (B) is a graph showing that in C9.2 patient fibroblasts treated with the siRNA candidate, the percentage of cells with cytoplasmic lesions decreased compared to untreated patient fibroblasts, and the percentage of cells without cytoplasmic lesions increased. (C) is a graph showing that in C9.3 patient fibroblasts, the percentage of cells with intranuclear lesions decreased compared to untreated control cells, and the percentage of cells without intranuclear lesions increased in these cells. (D) is a graph showing that in C9.3 patient fibroblasts treated with candidate siRNA, the percentage of cells with cytoplasmic lesions decreased and the percentage of cells without cytoplasmic lesions increased compared to untreated patient fibroblasts.
[0151] [Figure 13] Figures 13A-B show representative images of C9.3 patient fibroblasts. (A) is a representative image of untreated C9.3 patient fibroblasts with nuclear staining, where DAPI is stained blue and lesions are stained red. (B) is a representative image of C9.3 patient fibroblasts treated with candidate siRNA, where DAPI is stained blue and RNA lesions are stained red. Scale bar = 10 μm.
[0152] [Figure 14] Figure 14 shows the multiplicative changes in RNA levels of isoforms, including dilated forms, in patient C9.3 fibroblasts treated with candidate siRNA molecules for 24, 48, and 72 hours. RNA levels were measured by qPCR, normalized with hypoxanthine phosphoribosyltransferase, and compared to untreated control cells.
[0153] [Figure 15] Figure 15 shows a dsRNA molecule for sense strand selection, which has alternating 2'O-methyl and 2'-fluoro-ribonucleotide modifications at positions 5 and 18 of the guide strand, and at all positions from the 5' end of the passenger strand except positions 1 and 11, with a cholesterol moiety attached to the terminal nucleotide at the 3' end of the passenger strand.
[0154] [Figure 16] Figure 16 shows the results of a luciferase reporter assay for candidate-selective C9orf72 sense-chain targeting siRNA molecules (1.5 μM) within exon 1a and intron 1 of C9orf72. Knockdown was measured in cells by fluorescence detection of the luciferase reporter compared to untreated control cells.
[0155] [Figure 17] Figure 17 shows the results of a "sense walk" experiment targeting an individual region between nucleotides 238 and 249 of the sense strand of C9orf72. Knockdown was measured in cells by fluorescence detection of a luciferase reporter compared to untreated control cells.
[0156] [Figure 18-1] Figures 18A-C show mRNA expression levels from two C9ALS patient cultured fibroblasts after siRNA treatment. (A) shows the expression level of C9orf72 mRNA measured by qPCR after siRNA treatment in patient C9.2 fibroblasts compared to untreated control cells. (B) shows the expression level of C9orf72 mRNA measured by qPCR after siRNA treatment in C9.3 fibroblasts compared to untreated control cells. (C) shows the average expression of both C9 patient fibroblasts compared to untreated control cells. [Figure 18-2]Figures 18A-C show mRNA expression levels from two C9ALS patient cultured fibroblasts after siRNA treatment. (A) shows the expression level of C9orf72 mRNA measured by qPCR after siRNA treatment in patient C9.2 fibroblasts compared to untreated control cells. (B) shows the expression level of C9orf72 mRNA measured by qPCR after siRNA treatment in C9.3 fibroblasts compared to untreated control cells. (C) shows the average expression of both C9 patient fibroblasts compared to untreated control cells.
[0157] [Figure 19] Figure 19 shows the expression levels of C9orf72 mRNA in cultured neurons treated with siRNA in a select region of the C9orf72 amyotrophic lateral sclerosis (ALS) mouse model. mRNA levels were quantified and compared to untreated control neurons by qPCR.
[0158] [Figure 20] Figure 20 shows a dsRNA molecule for screening antisense strands, which has alternating 2'O-methyl and 2'-fluoro-ribonucleotide modifications at all positions except positions 1 and 15 from the 5' end of the passenger strand, and a cholesterol moiety attached to the nucleotide at the 3' end of the passenger strand.
[0159] [Figure 21] Figure 21 is a graphical representation of the results of systematic screening of C9orf72 sense-strand targeted siRNA (1.5 μM) molecules in HeLa cells using the psiCHECK2 system for 72 hours. Candidates targeting selective target regions spanning exon 1 / intron 1 were tested. Knockdown was measured in cells by fluorescence detection of a luciferase reporter compared to untreated control cells. Potent knockdown was observed for several candidates.
[0160] [Figure 22]Figure 22 shows the common productive silencing region of C9orf72-targeted siRNA in both sense and antisense directions. Results were obtained over 72 hours in HeLa cells using the psiCHECK2 system. Knockdown was measured in cells by fluorescence detection of a luciferase reporter compared to untreated control cells.
[0161] [Figure 23] Figure 23 is a schematic diagram of a disiRNA molecule. Black represents the -2'-O-methyl, gray represents the -2'-fluoro, red represents the dash-phosphorothioate bond, and the linker is a terminal nucleotide bonded at the 3' end of each passenger strand. The alternating nucleotide modification motifs differ at positions 1, 11, and 15 of the sense target strand from the 5' end, and at positions 5, 16, and 18 of the complementary linking strand from the 5' end.
[0162] [Figure 24] Figure 24 shows the structure of di-hsiRNA. The black is -2'-O-methyl, the gray is -2'-fluoro, the red is dash -phosphorothioate bond, and the linker contains a linker derived from triethylene glycol (TEG). Di-hsiRNA consists of two asymmetric siRNAs linked via a linker to the 3' end of a sense strand. Hybridization to a longer antisense strand forms a protruding single-stranded complete phosphorothioate region, which is essential for tissue distribution, cellular uptake, and efficacy. The structures presented herein utilize glycol-based linkers of four monomers. The chemical identity of the linker can be modified without affecting efficacy. This can be adjusted by length, chemical composition (all carbon), saturation, or the addition of a chemically targeted ligand.
[0163] [Figure 25] Figure 25 shows the chemical synthesis, purification, and quality control of dibranched siRNA.
[0164] [Figure 26]Figure 26 shows the HPLC and quality control of the compounds prepared by the method shown in Figure 25. Mass spectrometry identified three major products: a TEG linker, a dibranched oligonucleotide, and a sense chain with a Vit-D (calciferol) conjugate. All products were independently purified by HPLC and tested in vivo. The dibranched oligonucleotide uniquely exhibits unprecedented tissue distribution and efficacy, indicating that the branched structure is essential for tissue retention and distribution.
[0165] [Figure 27] Mass spectrometry is shown to confirm the mass of the dibranched oligonucleotide. The observed mass of 11683 corresponds to the two sense strands linked via a TEG linker at the 3' end.
[0166] [Figure 28-1] Figure 28 shows the synthesis of branched oligonucleotides using an alternative chemical pathway. [Figure 28-2] Figure 28 shows the synthesis of branched oligonucleotides using an alternative chemical pathway.
[0167] [Figure 29] Figure 29 shows an exemplary amidite linker, spacer, and branched portion.
[0168] [Figure 30] Figure 30 shows a branched motif of an oligonucleotide. The double helix represents the oligonucleotide. Various combinations of linkers, spacers, and branching points allow for the generation of a wide variety of branched hsiRNA structures.
[0169] [Figure 31] Figure 31 shows structurally diverse branched oligonucleotides.
[0170] [Figure 32]Figure 32 shows the asymmetric compound of the present invention having four single-chain phosphorothioate regions.
[0171] [Figure 33A] Figure 33 shows a branched oligonucleotide of the present invention formed by annealing three oligonucleotides (A). Longer binding oligonucleotides may include cleavable regions in the form of unmodified RNA, DNA, or UNA (unlocked nucleic acid); (B) asymmetric branched oligonucleotides having 3' and 5' links in the aforementioned linker or space. This can be applied to the 3' and 5' ends of a sense strand or antisense strand, or a combination thereof; (C) branched oligonucleotides consisting of three separate strands. Longer double sense strands can be synthesized with 3' and 5' phosphoramidites that allow for 3'-3' or 5'-5' adjacent ends. [Figure 33B] Figure 33 shows a branched oligonucleotide of the present invention formed by annealing three oligonucleotides (A). Longer binding oligonucleotides may include cleavable regions in the form of unmodified RNA, DNA, or UNA (unlocked nucleic acid); (B) asymmetric branched oligonucleotides having 3' and 5' links in the aforementioned linker or space. This can be applied to the 3' and 5' ends of a sense strand or antisense strand, or a combination thereof; (C) branched oligonucleotides consisting of three separate strands. Longer double sense strands can be synthesized with 3' and 5' phosphoramidites that allow for 3'-3' or 5'-5' adjacent ends. [Figure 33C]Figure 33 shows a branched oligonucleotide of the present invention formed by annealing three oligonucleotides (A). Longer binding oligonucleotides may include cleavable regions in the form of unmodified RNA, DNA, or UNA (unlocked nucleic acid); (B) asymmetric branched oligonucleotides having 3' and 5' links in the aforementioned linker or space. This can be applied to the 3' and 5' ends of a sense strand or antisense strand, or a combination thereof; (C) branched oligonucleotides consisting of three separate strands. Longer double sense strands can be synthesized with 3' and 5' phosphoramidites that allow for 3'-3' or 5'-5' adjacent ends.
[0172] [Figure 34] Figure 34 shows the branched oligonucleotide of the present invention having a conjugated bioactive moiety.
[0173] [Figure 35] Figure 35 shows the relationship between phosphorothioate content and stereoselectivity.
[0174] [Figure 36] Figure 36 shows an exemplary hydrophobic region.
[0175] [Figure 37] Figure 37 shows an exemplary nucleotide bond.
[0176] [Figure 38] Figure 38 shows an exemplary internucleotide skeletal bond.
[0177] [Figure 39] Figure 39 shows an exemplary sugar modification.
[0178] [Figure 40] Figure 40 shows the structures of hsiRNA and fully metabolized (FM)hsiRNA.
[0179] [Figure 41] Figure 41 shows the chemical diversity of single-stranded fully modified oligonucleotides. Single-stranded oligonucleotides can consist of gapmers, mixmers, miRNA inhibitors, SSOs, PMOs, or PNAs.
[0180] [Figure 42] Figure 42 shows the first strategy for incorporating the hydrophobic portion into the branched oligonucleotide structure.
[0181] [Figure 43] Figure 43 shows a second strategy for incorporating the hydrophobic portion into the branched oligonucleotide structure.
[0182] [Figure 44] Figure 44 shows a third strategy for incorporating hydrophobic moieties into branched oligonucleotide structures.
[0183] [Figure 45A] Figure 45 includes plots quantifying total knockdown of C9ORF72 mRNA in mouse tissues from the outer (Figure 45A) and inner (Figure 45B) parts of the central nervous system. [Figure 45B] Figure 45 includes plots quantifying total knockdown of C9ORF72 mRNA in mouse tissues from the outer (Figure 45A) and inner (Figure 45B) parts of the central nervous system.
[0184] [Figure 46A] Figure 46 includes plots quantifying disease isoform-specific knockdown of C9ORF72 mRNA in mouse tissues from the lateral (Figure 46A) and medial (Figure 46B) central nervous system. [Figure 46B] Figure 46 includes plots quantifying disease isoform-specific knockdown of C9ORF72 mRNA in mouse tissues from the lateral (Figure 46A) and medial (Figure 46B) central nervous system.
[0185] [Figure 47A] Figure 47 includes a Western blot of the C9ORF72 protein in the mouse striatum (Figure 47A) and a chart quantifying the knockdown of C9ORF72 protein expression (Figure 47B). [Figure 47B] Figure 47 includes a Western blot of the C9ORF72 protein in the mouse striatum (Figure 47A) and a chart quantifying the knockdown of C9ORF72 protein expression (Figure 47B).
[0186] [Figure 48A] Figure 48 includes a Western blot of the C9ORF72 protein in the mouse thalamus (Figure 48A) and a chart quantifying the knockdown of C9ORF72 protein expression (Figure 48B). [Figure 48B] Figure 48 includes a Western blot of the C9ORF72 protein in the mouse thalamus (Figure 48A) and a chart quantifying the knockdown of C9ORF72 protein expression (Figure 48B).
[0187] [Figure 49A] Figure 49 includes plots quantifying total knockdown of C9ORF72 mRNA in mouse tissues from the outer (Figure 49A) and inner (Figure 49B) parts of the central nervous system. [Figure 49B] Figure 49 includes plots quantifying total knockdown of C9ORF72 mRNA in mouse tissues from the outer (Figure 49A) and inner (Figure 49B) parts of the central nervous system.
[0188] [Figure 50A] Figure 50 includes plots quantifying disease isoform-specific knockdown of C9ORF72 mRNA in mouse tissues from the lateral (Figure 50A) and lateral (Figure 50B) central nervous system. [Figure 50B] Figure 50 includes plots quantifying disease isoform-specific knockdown of C9ORF72 mRNA in mouse tissues from the lateral (Figure 50A) and lateral (Figure 50B) central nervous system.
[0189] [Figure 51A] Figure 51 includes a Western blot of the C9ORF72 protein in the mouse thalamus (Figure 51A) and a chart quantifying the knockdown of C9ORF72 protein expression (Figure 51B). [Figure 51B] Figure 51 includes a Western blot of the C9ORF72 protein in the mouse thalamus (Figure 51A) and a chart quantifying the knockdown of C9ORF72 protein expression (Figure 51B).
[0190] [Figure 52A] Figure 52 includes plots quantifying total knockdown (Figure 52A) and disease-specific knockdown (Figure 52B) of C9ORF72 mRNA expression measured in mice treated by injection into the liver, kidney, or spleen. [Figure 52B] Figure 52 includes plots quantifying total knockdown (Figure 52A) and disease-specific knockdown (Figure 52B) of C9ORF72 mRNA expression measured in mice treated by injection into the liver, kidney, or spleen.
[0191] [Figure 53A] Figure 53 includes plots quantifying total knockdown (Figure 53A) and disease-specific knockdown (Figure 53B) of C9ORF72 mRNA expression measured in mice treated by injection into the cervical, thoracic, or lumbar region of the spine. [Figure 53B] Figure 53 includes plots quantifying total knockdown (Figure 53A) and disease-specific knockdown (Figure 53B) of C9ORF72 mRNA expression measured in mice treated by injection into the cervical, thoracic, or lumbar region of the spine.
[0192] [Figure 54A]Figure 54 includes plots quantifying total knockdown (Figure 54A) and disease-specific knockdown (Figure 54B) of C9ORF72 mRNA expression, measured in mice treated by injection into the prefrontal cortex, motor cortex, cerebellum, or brainstem. [Figure 54B] Figure 54 includes plots quantifying total knockdown (Figure 54A) and disease-specific knockdown (Figure 54B) of C9ORF72 mRNA expression, measured in mice treated by injection into the prefrontal cortex, motor cortex, cerebellum, or brainstem.
[0193] [Figure 55A] Figure 55 includes plots quantifying total knockdown (Figure 55A) and disease-specific knockdown (Figure 55B) of C9ORF72 mRNA expression measured in mice treated by injection into the striatum, thalamus, hippocampus, or somatosensory cortex. [Figure 55B] Figure 55 includes plots quantifying total knockdown (Figure 55A) and disease-specific knockdown (Figure 55B) of C9ORF72 mRNA expression measured in mice treated by injection into the striatum, thalamus, hippocampus, or somatosensory cortex.
[0194] (Detailed description of a specific exemplary embodiment) This specification provides novel C9ORF72 target sequences, including isoform-selective and non-selective target sequences. It also provides novel siRNAs that enable specific and non-specific mRNA variant regulation by targeting selective and non-selective target sequences of C9ORF72 mRNA. Furthermore, methods for treating C9ORF72-related conditions, such as amyotrophic lateral sclerosis (ALS) and frontotemporal degeneration (FTD), are also provided.
[0195] Using a platform of fully modified hydrophobic siRNAs (FM-hsiRNAs) that offer resistance to nuclease degradation and self-delivery capabilities, over 100 sequences targeting C9ORF72 were screened. Approximately 15 hits targeting various regions of interest were identified. Secondary screening was performed in human patient fibroblasts, enabling the identification of intron and exon regions that allow for variant-specific and non-specific regulation of C9ORF72. The identified compounds can also downregulate associated C9ORF72 mRNA variants and reduce RNA lesion formation in the nucleus and cytoplasm. These compounds were also effective in reducing the expression of dipeptides, one of the key determinants of C9ORF72 toxicity.
[0196] RAN dipeptides are expressed from transcripts containing sense and antisense hexanucleotides and should be targeted to reduce C9 neuropathology. Thus, this disclosure introduces for the first time the concept of a dual-target siRNA for C9, which has two guide strands within the same molecule and can simultaneously silence both sense and antisense transcripts.
[0197] Unless otherwise specified, the nomenclature used in relation to cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry, and hybridization described herein is well known and commonly used in the art. Unless otherwise specified, the methods and techniques provided herein are carried out in accordance with conventional methods well known in the art, and as described in the various general and more specific references cited and discussed throughout this specification unless otherwise specified. Enzyme reactions and purification techniques are carried out as commonly achieved in the art or as described herein, according to the manufacturer's specifications. The nomenclature used in relation to analytical chemistry, organic synthesis chemistry, and medicinal chemistry described herein, and their testing methods and techniques, are well known and commonly used in the art. Standard techniques are used in chemical synthesis, chemical analysis, pharmaceuticals, formulations, delivery, and patient treatment.
[0198] Unless otherwise defined herein, scientific and technical terms used herein have the meanings generally understood by those skilled in the art. In any case of any potential ambiguity, the definitions provided herein shall prevail over dictionary or external definitions. Unless otherwise required by context, singular terms shall include plural forms, and plural terms shall include singular forms. The use of "or" shall mean "and / or" unless otherwise stated. The use of the term "including" and other forms such as "includes" and "contains" is not limited.
[0199] To make this application easier to understand, we will first define certain terms.
[0200] "Modification" means a change (increase or decrease) in the expression level of a gene, mRNA, or polypeptide, as detected by standard methods known in the art, such as those described herein. As used herein, increase or decrease includes changes of 10%, 25%, 40%, or 50% or more in the expression level. In certain embodiments, increase or decrease is a change in expression level of about 30% to about 50% or about 30% to about 40%. "Modification" can also refer to a change (increase or decrease) in the biological activity of any of the mRNAs or polypeptides of this application (e.g., C9ORF72 and RAN peptide). Examples of the biological activity of C9ORF72 include one or more clinical manifestations of neurodegenerative diseases, such as ALS and FTD. Herein, increase or decrease includes changes of 10%, 25%, 40%, or 50% or more in the biological activity. In certain preferred embodiments, increase or decrease is a change in expression level of about 30% to about 50%, or about 30% to 40%.
[0201] The specific subject matter of this application is the treatment of ALS or other C9ORF72 diseases. "Treatment of C9ORF72-related disorders" means the use of the oligonucleotides (e.g., siRNA) of this application in pharmaceutical compositions for the treatment of C9ORF72-related disorders. Thus, pharmaceutical compositions containing oligonucleotides are useful for treating diseases, conditions, and disorders that require inhibition of cellular processes such as C9ORF72 expression, RAN peptide formation, and the formation of nuclear or cytoplasmic lesions of C9ORF72.
[0202] Amyotrophic lateral sclerosis (ALS) is a neurological disorder characterized by the degeneration of voluntary muscle control. ALS is characterized by muscle rigidity, muscle spasms, and progressive weakness due to a decrease in muscle size.
[0203] "Therapeutic amount" means an amount sufficient to cause a qualitative or quantitative reduction in the symptoms of ALS or other diseases described herein when administered to a patient suffering from ALS or other diseases. Also, "therapeutic amount" can mean an amount sufficient to cause a decrease in the expression level of one or more C9ORF72 RAN peptides or C9ORF72 transcripts measured by one or more assays described herein when administered to a patient or subject suffering from ALS or other diseases.
[0204] "Subject" means a mammal, including but not limited to humans or non-human mammals such as cows, horses, dogs, sheep, cats, mice, and other non-human primates or other animals.
[0205] The term "nucleoside" means a molecule in which a purine or pyrimidine base is covalently bonded to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine, and thymidine. Further exemplary nucleosides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine (also referred to as "rare" nucleosides). The term "nucleotide" means a nucleoside having one or more phosphates joined to the sugar moiety by an ester bond. Exemplary nucleotides include nucleoside monophosphates, diphosphates, and triphosphates. The terms "polynucleotide" and "nucleic acid molecule" are used interchangeably herein and mean a polymer of nucleotides joined completely by phosphodiester or phosphorothioate bonds between 5' and 3' carbon atoms.
[0206] The term “RNA” or “RNA molecule” or “ribonucleic acid molecule” refers to a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more ribonucleotides). The term “DNA” or “DNA molecule” or “deoxyribonucleic acid molecule” refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized spontaneously (e.g., by DNA replication or DNA transcription, respectively). RNA can be modified after transcription. DNA and RNA can also be synthesized chemically. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). “mRNA” or “messenger RNA” is a single-stranded RNA that identifies the amino acid sequence of one or more polypeptide chains. This information is translated when ribosomes bind to mRNA during protein synthesis.
[0207] As used herein, the term “small interfering RNA” ("siRNA") (also referred to in the art as “short interfering RNA”) means RNA (or RNA analog) containing approximately 10 to 50 nucleotides (or nucleotide analogs) that can direct or mediate RNA interference. Typically, an siRNA contains approximately 15 to 30 nucleotides or nucleotide analogs, or approximately 16 to 25 nucleotides (or nucleotide analogs), or approximately 18 to 23 nucleotides (or nucleotide analogs), or approximately 19 to 22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs). The term “short” siRNA means an siRNA containing approximately 21 nucleotides (or nucleotide analogs), e.g., 19, 20, 21, or 22 nucleotides. The term “long” siRNA means an siRNA containing approximately 24 to 25 nucleotides, e.g., 23, 24, 25, or 26 nucleotides. Short siRNAs may, in some cases, contain fewer than 19 nucleotides, e.g., 16, 17, or 18 nucleotides, but these shorter siRNAs retain their ability to mediate RNAi. Similarly, long siRNAs may, in some cases, contain more than 26 nucleotides, but these longer siRNAs retain their ability to mediate RNAi without further processing (e.g., enzymatic treatment) of the shorter siRNAs.
[0208] The term "nucleotide analog" or "modified nucleotide" or "modified nucleotide" means a non-standard nucleotide, including unnatural ribonucleotides or deoxyribonucleotides. Exemplary nucleotide analogs retain the ability of nucleotide analogs to perform their intended function despite being modified at any position to modify certain chemical properties of the nucleotide. Examples of positions of nucleotides that can be derivatized include the 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine, 5-propynyluridine, 5-propenyluridine, etc.; the 6-position, such as 6-(2-amino)propyluridine; the 8-position of adenosine and / or guanosine, such as 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Also, nucleotide analogs include deazapurines, such as 7-deaza-adenosine; O- and N-modified (e.g., alkylated, such as N6-methyladenosine, or otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.
[0209] Nucleotide analogs can also include modifications to the sugar moiety of the nucleotide. For example, the 2'OH-group may be replaced by a group selected from the group consisting of H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, or COOR, where R is substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications are those described in U.S. Patents 5,858,988 and 6,291,438.
[0210] The phosphate group of a nucleotide can also be modified, for example, by substituting one or more oxygen atoms of the phosphate with sulfur (e.g., a phosphorothioate), or by making other substitutions that enable the nucleotide to perform its intended function, as described, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5):317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and U.S. Patent 5,684,143. The specific modifications described above (e.g., phosphate group modifications) preferably reduce the hydrolysis rate of the polynucleotide containing the analog, for example, in vivo or in vitro.
[0211] The term “oligonucleotide” means a short polymer of nucleotides and / or nucleotide analogs. The term “RNA analog” means a polynucleotide (e.g., a chemically synthesized polynucleotide) that has at least one modified or altered nucleotide compared to the corresponding unmodified or unaltered RNA, but retains the same or similar properties or functions as the corresponding unmodified or unaltered RNA. As described above, oligonucleotides may be linked by a bond that results in a lower hydrolysis rate of the RNA analog compared to RNA molecules with phosphodiester bonds. For example, the nucleotides of the analog may include methylenediol, ethylenediol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phosphoramidate, and / or phosphorothioate bonds. Preferred RNA analogs include sugar- and / or backbone-modified ribonucleotides and / or deoxyribonucleotides. Such alterations or modifications may further include, for example, adding non-nucleotide material (one or more nucleotides of the RNA) to or internally to the ends of the RNA. The RNA analog only needs to be sufficiently similar to native RNA so that it has the ability to mediate RNA interference.
[0212] As used herein, the term “RNA interference” (“RNAi”) means the selective intracellular degradation of RNA. RNAi occurs naturally within cells to remove foreign RNA (e.g., viral RNA). Natural RNAi proceeds via fragments cleaved from free dsRNA that direct degradative mechanisms to other similar RNA sequences. Alternatively, RNAi can be initiated by humans, for example, to silencing the expression of a target gene.
[0213] RNAi agents, such as RNA silencing agents, have a strand that is "sufficiently complementary to the target mRNA sequence to direct target-specific RNA interference (RNAi)," meaning that the strand has a sequence sufficient to induce the destruction of the target mRNA by the RNAi mechanism or process.
[0214] As used herein, the term “isolated RNA” (e.g., “isolated siRNA” or “isolated siRNA precursor”) means an RNA molecule that, when produced by recombinant technology, substantially contains no other cell material or culture medium, and, when chemically synthesized, substantially contains no chemical precursors or other chemical substances.
[0215] As used herein, the term “RNA silencing” refers to a group of sequence-specific regulatory mechanisms mediated by RNA molecules that result in the inhibition or “silencing” of the expression of the corresponding protein-coding gene (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression). RNA silencing has been observed in many organisms, including plants, animals, and fungi.
[0216] As used herein, the term “differential RNA silencing” means, for example, the ability of an RNA molecule to substantially inhibit the expression of a “primary” or “target” polynucleotide sequence, but not substantially inhibit the expression of a “secondary” or “non-target” polynucleotide sequence, when both polynucleotide sequences are present in the same cell. In certain embodiments, the target polynucleotide sequence corresponds to a target gene, while the non-target polynucleotide sequence corresponds to a non-target gene. In other embodiments, the target polynucleotide sequence corresponds to a target allele, while the non-target polynucleotide sequence corresponds to a non-target allele. In certain embodiments, the target polynucleotide sequence is a DNA sequence encoding a regulatory region (e.g., a promoter or enhancer element) of the target gene. In yet another embodiment, the target polynucleotide sequence is a target mRNA encoded by the target gene.
[0217] The term "in vitro" has its technically recognized meaning and includes, for example, purified reagents or extracts, such as cell extracts, and typically ex vivo living cells, such as immortalized cells, primary cells, and cell lines. The term "in vivo" also has its technically recognized meaning and refers to, for example, cells within a living organism.
[0218] As used herein, the term “transgene” means any nucleic acid molecule that is tricked into being inserted into a cell and becomes part of the genome of an organism that grows from that cell. Such a transgene may contain genes that are partly or entirely heterologous (i.e., exotic) to the transgenic organism, or it may represent genes homologous to the organism’s endogenous genes. The term “transgene” also means a nucleic acid molecule containing one or more nucleic acid sequences, e.g., selected from DNA, that encode one or more manipulated RNA precursors for expression in a transgenic organism, e.g., an animal, which are partly or entirely heterologous (i.e., exotic) to the transgenic animal, or homologous to the transgenic animal’s endogenous genes, but designed to be inserted into the animal’s genome at a different location than the native genes. A transgene may contain one or more promoters and other DNA, such as introns, necessary for the expression of the selected nucleic acid sequence, all of which are manipulably bound to the selected sequence, and may contain enhancer sequences.
[0219] Genes “involved” in a disease or disorder include genes whose normal or abnormal expression or function results in or causes the disease or disorder or at least one symptom of the disease or disorder.
[0220] As used herein, the term “gain-of-function mutation” means any mutation in a gene that causes a protein encoded by that gene (i.e., a mutant protein) to acquire a function that is not normally associated with that protein (i.e., a wild-type protein) that causes or is involved in a disease or disorder. A gain-of-function mutation may be a deletion, addition, or substitution of a nucleotide in a gene that alters the function of the encoded protein. In one embodiment, a gain-of-function mutation alters the function of the mutant protein or causes an interaction with another protein. In another embodiment, a gain-of-function mutation causes, for example, a reduction or elimination of the normal wild-type protein through interaction between the modified mutant protein and the normal wild-type protein.
[0221] A “target allele” is an allele whose expression is selectively inhibited or “silenced” (e.g., an SNP allele). This silencing can be achieved by RNA silencing, for example, by cleaving the target gene or the mRNA of the target allele with siRNA. The term “non-target allele” is an allele whose expression is not substantially silenced. In certain embodiments, the target allele and the non-target allele may correspond to the same target gene. In other embodiments, the target allele may correspond to or be related to the target gene, and the non-target allele may correspond to or be related to the non-target gene. In one embodiment, the polynucleotide sequences of the target allele and the non-target allele may differ by one or more nucleotides. In another embodiment, the target allele and the non-target allele may differ by one or more allelemic polymorphisms (e.g., one or more SNPs). In another embodiment, the target allele and the non-target allele may share less than 100% sequence identity.
[0222] As used herein, the term “polymorphism” means a variation in a gene sequence (e.g., one or more deletions, insertions, or substitutions) that is identified or detected when comparing the same gene sequence from different sources or subjects (but from the same organism). For example, polymorphisms may be identified when comparing the same gene sequence from different subjects. Identification of such polymorphisms is routine in the art, and the methods are similar to those used, for example, to detect point mutations in breast cancer. Identification can be performed, for example, by using DNA extracted from control lymphocytes and then amplifying the polymorphic region using primers specific to the polymorphic region. Alternatively, polymorphisms may be identified when comparing two alleles of the same gene. In certain embodiments, the polymorphism is a single nucleotide polymorphism (SNP).
[0223] In this specification, the variation in the sequence between two alleles of the same gene in an organism is referred to as "allelic polymorphism." In certain embodiments, allelic polymorphisms correspond to SNP alleles. For example, allelic polymorphisms can include single nucleotide variations between two alleles of an SNP. Polymorphisms can be located in nucleotides within the coding region, but due to the degeneracy of the genetic code, changes in the amino acid sequence are not coded. Alternatively, polymorphic sequences can code for different amino acids at specific positions, but this change in amino acid does not affect the function of the protein. Polymorphic regions can also be found in the non-coding regions of a gene. In exemplary embodiments, polymorphisms are found in the coding region of a gene or in the uncoding region of a gene (e.g., the 5'UTR or 3'UTR).
[0224] As used herein, the term “allele frequency” is a measure (e.g., a proportion or percentage) of the relative frequency of an allele (e.g., a SNP allele) at a single locus in a population. For example, if a population has n loci of a particular chromosomal locus (and the gene occupying that locus) in each of its somatic cells, the allele frequency of an allele is the proportion or percentage of loci that the allele occupies in that population. In certain embodiments, the allele frequency of an allele (e.g., a SNP allele) is at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40%, or more) in the sample population.
[0225] As used herein, the term “sample population” means a group of individuals that includes a statistically significant number of individuals. For example, a sample population may include 50, 75, 100, 200, 500, 1000 or more individuals. In certain embodiments, a sample population may include individuals that share at least a common disease phenotype (e.g., gain-of-function disorder) or mutation (e.g., gain-of-function mutation).
[0226] As used herein, the term “heterozygous” means the proportion of individuals in a group that are heterozygous (e.g., have two or more different alleles) at a particular locus (e.g., a SNP). Heterozygous can be calculated for a sample population using methods well known to those skilled in the art.
[0227] As used herein, the term "polyglutamine domain" means a protein segment or domain consisting of consecutive glutamine residues linked by peptide bonds. In one embodiment, the consecutive region includes at least five glutamine residues.
[0228] As used herein, the term "elongated polyglutamine domain" or "elongated polyglutamine segment" means a segment or domain of a protein that contains at least 35 contiguous glutamine residues joined by peptide bonds. Such an elongated segment is seen in subjects suffering from the polyglutamine disorders described herein, regardless of whether the subject exhibits overt symptoms.
[0229] As used herein, the term "trinucleotide repeat" or "trinucleotide repeat region" means a segment of a nucleic acid sequence consisting of contiguous repeats of a specific trinucleotide sequence. In one embodiment, the trinucleotide repeat contains at least 5 contiguous trinucleotide sequences. Exemplary trinucleotide sequences include, but are not limited to, CAG, CGG, GCC, GAA, CTG, and / or CGG.
[0230] As used herein, the term “trinucleotide repeat disease” means any disease or disorder characterized by an elongated trinucleotide repeat region located within a gene, the elongated trinucleotide repeat region being the causative agent of the disease or disorder. Examples of trinucleotide repeat diseases include, but are not limited to, spinocerebellar ataxia type 12, spinocerebellar ataxia type 8, fragile X syndrome, fragile XE intellectual disability, Friedreich ataxia, and myotonic dystrophy. Exemplary trinucleotide repeat diseases for treatment according to the present invention are characterized by, or caused by, an elongated trinucleotide repeat region at the 5' end of the coding region of a gene, the gene encoding a mutated protein that causes or is responsible for the disease or disorder. Certain trinucleotide diseases in which the mutation is not related to the coding region, such as fragile X syndrome, may not be suitable for treatment by the methodology of the present invention because there is no suitable mRNA to target by RNAi. In contrast, diseases such as Friedreich's ataxia are considered suitable for treatment by the methodology of the present invention because, although the causative mutation is not within the coding region (i.e., within an intron), the mutation may be, for example, within the mRNA precursor (e.g., a press-plicated mRNA precursor).
[0231] The phrase "to consider the function of genes in cells or organisms" means to consider or study the resulting expression, activity, function, or phenotype.
[0232] As used herein, the term “RNA silencing agent” means RNA capable of inhibiting or “silencing” the expression of a target gene. In certain embodiments, RNA silencing agents can prevent the complete processing of mRNA molecules (e.g., complete translation and / or expression) via a post-transcriptional silencing mechanism. RNA silencing agents include small (<50 b.p.), non-coding RNA molecules, such as RNA double helixes containing paired strands, and precursor RNAs from which such small non-coding RNAs can be produced. Exemplary RNA silencing agents include siRNA, miRNA, siRNA-like double helixes, shRNA, antisense oligonucleotides, gapmer molecules, and dual-function oligonucleotides, as well as their precursors. In one embodiment, RNA silencing agents can induce RNA interference. In another embodiment, RNA silencing agents can mediate translational repression.
[0233] As used herein, the term “rare nucleotide” means a naturally occurring nucleotide that occurs rarely, including naturally occurring deoxyribonucleotides or ribonucleotides that occur rarely, such as guanosine, adenosine, cytosine, or uridine. Examples of rare nucleotides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2 N-methylguanosine and 2,2 This includes, but is not limited to, N,N-dimethylguanosine.
[0234] In the term "engineered" in the context of engineered RNA precursors or engineered nucleic acid molecules, the term "engineered" indicates that the precursor or molecule does not exist in nature, and that all or part of its nucleic acid sequence has been created or selected by humans. Once created or selected, the sequence is replicated, translated, transcribed, or otherwise manipulated by intracellular mechanisms. Thus, the RNA precursor produced intracellularly from a transgene containing an engineered nucleic acid molecule is an engineered RNA precursor.
[0235] As used herein, the term “microRNA” (“miRNA”) also referred to in the art as “small RNA” (“stRNA”) means a small (10 to 50 nucleotides) RNA that is genetically encoded (e.g., by the genome of a virus, mammal, or plant) and can direct or mediate RNA silencing. “miRNA disorder” means a disease or disorder characterized by abnormal expression or activity of miRNA.
[0236] As used herein, the term “dual-function oligonucleotide” means an RNA silencing agent represented by the formula TL-μ [wherein T is the mRNA targeting moiety, L is the binding moiety, and μ is the miRNA mobilization moiety]. As used herein, the terms “mRNA targeting moiety,” “targeting moiety,” “mRNA targeting portion,” or “targeting portion” mean a domain, part, or region of a dual-function oligonucleotide that is sufficiently sized and sufficiently complementary to a part or region of mRNA selected or targeted for silencing (i.e., that the part has a sequence sufficient to capture the target mRNA). As used herein, the term “linking moiety” or “linking portion” means a domain, part, or region of an RNA silencing agent that covalently joins or binds to mRNA.
[0237] As used herein, the term “antisense strand” of an RNA silencing agent, e.g., siRNA or RNA silencing agent, means a strand substantially complementary to a section of approximately 10–50 nucleotides, e.g., approximately 15–25, 15–30, 16–25, 18–23, or 19–22 nucleotides, of the mRNA of the gene targeted for silencing. The antisense strand or first strand has a sequence that is sufficiently complementary to the desired target mRNA sequence for direct target-specific silencing, e.g., a sequence that is sufficiently complementary to induce disruption of the desired target mRNA by RNAi machinery or manipulation (RNAi interference), or a sequence that is sufficiently complementary to induce translational repression of the desired target mRNA.
[0238] The terms “sense strand” or “second strand” of an RNA silencing agent, such as siRNA, refer to a strand complementary to the antisense strand or first strand. The antisense strand and sense strand are also referred to as the first strand or second strand, respectively, where the first or second strand is complementary to the target sequence, and the second or first strand is complementary to the first or second strand, respectively. A miRNA double-stranded intermediate or siRNA-like double-stranded intermediate includes a miRNA strand that is sufficiently complementary to a section of approximately 10 to 50 nucleotides of mRNA of the gene targeted for silencing, and a miRNA strand that is sufficiently complementary to form a double-stranded structure with the miRNA strand.
[0239] As used herein, the term “guide strand” means a strand of RNA silencing agent that enters the RISC complex and directs the cleavage of the target mRNA, such as an siRNA double helix or an antisense strand of an siRNA sequence.
[0240] As used herein, the term "asymmetric" in the asymmetry of the bilayer region of an RNA silencing agent (e.g., the stem of shRNA) means an imbalance in the binding strength or base pairing strength between the ends of the RNA silencing agent (e.g., between the terminal nucleotide of the first strand or stem portion and the terminal nucleotide of the opposing second strand or stem portion), such that the 5' end of one strand of the bilayer is more frequently in a transient unpaired state, such as a single-stranded state, than the 5' end of the complementary strand. This structural difference determines that one strand of the bilayer is preferentially incorporated into the RISC complex. The strand whose 5' end is not tightly paired with the complementary strand is preferentially incorporated into RISC and mediates RNAi.
[0241] As used herein, the terms “bond strength” or “base pair strength” mean the strength of the interaction between pairs of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide double helix (e.g., an siRNA double helix), primarily due to H bonds between said nucleotides (or nucleotide analogs), van der Waals interactions, and the like.
[0242] As used herein, the "5' end" at the 5' end of an antisense strand means the 5' terminal nucleotide, for example, a region of 1 to approximately 5 nucleotides at the 5' end of the antisense strand. As used herein, the "3' end" at the 3' end of a sense strand means the region complementary to the 5' terminal nucleotide of the complementary antisense strand, for example, a region of 1 to approximately 5 nucleotides.
[0243] As used herein, the term “destabilized nucleotide” means a first nucleotide or nucleotide analog that can form a base pair with a second nucleotide or nucleotide analog such that the base pair has a lower binding strength than a conventional base pair (i.e., a Watson-Crick base pair). In certain embodiments, the destabilized nucleotide can form a mismatch base pair with the second nucleotide. In other embodiments, the destabilized nucleotide can form a fluctuation base pair with the second nucleotide. In yet another embodiment, the destabilized nucleotide can form an ambiguous base pair with the second nucleotide.
[0244] As used herein, the term “base pair” means the interaction between pairs of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide double helix (e.g., a double helix formed by the strands of an RNA silencing agent and a target mRNA sequence), primarily due to H bonds between the nucleotides (or nucleotide analogs), van der Waals interactions, etc. As used herein, the terms “bond strength” or “base pair strength” mean the strength of the base pair.
[0245] As used herein, the term “mismatched base pair” means a base pair consisting of a non-complementary or non-Watson-Crick base pair, such as a base pair that is not a normal complementary G:C, A:T, or A:U base pair. As used herein, the term “ambiguous base pair” (also known as a non-discriminatory base pair) means a base pair formed by a universal nucleotide.
[0246] As used herein, the term “universal nucleotide” (also known as “neutral nucleotide”) includes nucleotides (e.g., certain destabilized nucleotides) that have a base (“universal base” or “neutral base”) that does not significantly discriminate between complementary polynucleotide bases when forming base pairs. Universal nucleotides are primarily hydrophobic molecules that can be efficiently packed into antiparallel duplex nucleic acids (e.g., double-stranded DNA or RNA) due to stacking interactions. The base portion of a universal nucleotide typically contains a nitrogen-containing aromatic heterocyclic moiety.
[0247] As used herein, the terms “sufficient complementarity” or “sufficient degree of complementarity” mean that the RNA silencing agent has a sequence (e.g., in the antisense strand, mRNA target region, or miRNA recruitment region) that is sufficient to bind to the desired target RNA and induce RNA silencing of the target mRNA.
[0248] As used herein, the term “translational repression” means the selective inhibition of mRNA translation. Spontaneous translational repression proceeds via miRNA cleaved from shRNA precursors. Both RNAi and translational repression are mediated by RISC. Both RNAi and translational repression occur naturally or can be initiated by humans to silence, for example, the expression of a target gene.
[0249] Various methodologies of the present invention include a step of comparing values, levels, features, characteristics, properties, etc., with a “suitable control,” which is interchangeably referred to herein as “appropriate control.” A “suitable control” or “appropriate control” is a control or standard familiar to those skilled in the art that is useful for comparison purposes. In one embodiment, a “suitable control” or “appropriate control” is a value, level, feature, characteristic, etc., determined before performing the RNAi methodology, as described herein. For example, before introducing the RNA silencing agent of the present invention into cells or organisms, the transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristics and properties, genotype, phenotype, etc., can be determined. In another embodiment, a “suitable control” or “appropriate control” is a value, level, feature, characteristic, property, etc., determined in cells or organisms, e.g., a control exhibiting normal traits or normal cells or organisms. In yet another embodiment, a “suitable control” or “appropriate control” is a predefined value, level, feature, characteristic, property, etc.
[0250] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by an ordinary person skilled in the art to which the invention pertains. Methods and materials similar to or equivalent to those described herein may be used in carrying out or testing the invention, but suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by citation in their entirety. In the event of any inconsistency, this specification shall prevail, including definitions. Furthermore, materials, methods, and examples are illustrative and not intended to be limiting.
[0251] Various aspects of this application are described in further detail in the following subsections. I. C9ORF72 target sequence
[0252] In some embodiments, the RNA silencing agents of this application are designed to target selective and non-selective regions in the C9ORF72 mRNA molecule. Certain C9ORF72 mRNAs may encode RAN peptides.
[0253] This application targets one or more regions within C9ORF72 mRNA and their corresponding proteins. One strand of double-stranded RNA (siRNA) is complementary to the target sequence within C9ORF72 mRNA. Upon introduction of siRNA into a subject or cell, the siRNA is partially unwound and binds site-specifically to the target region within C9ORF72 mRNA, activating an mRNA nuclease. This nuclease cleaves the C9ORF72 mRNA, thereby halting the translation of the C9ORF72 protein or RAN peptide. The cell blocks translation by removing the partially digested mRNA, or the cell digests the partially translated protein. In certain embodiments, C9ORF72 protein or RAN peptide expression is reduced by approximately 30%–50%, or approximately 30%–40%, in the subject or cell.
[0254] In embodiments of this application, the RNA silencing agent of this application can target transcripts of one or more target sequences of gene regions listed in Tables 1 to 5 below. In certain exemplary embodiments, the RNA silencing agent of this application can target transcripts of one or more target sequences listed in gene locations selected from the group consisting of 018, 028, 031, 048, 052, 056, 127, 129, 136, 143, 148, 149, 150, 180, 182, 187, 191, 202, 211, 214, 215, 219, 226, 237, 241, 244, 250, 251, 272, 275, 282, 288, 291, 294, 305, and 306 of the human C9ORF72 gene. Particularly exemplary target sequences in the human C9ORF72 gene may be found at positions 214 (5' TGCTCTCACAGTACTCGCTGAGGGTGAACAAGAAAAGACCTGATA 3') and 243 (5' AAGAAAAGACCTGATAAAGATTAACCAGAAGAAAACAAGGAGGGA 3'). Genomic sequences for each target sequence can be found, for example, in publicly available databases maintained by NCBI.
[0255] Various aspects of this application are described in more detail in the following subsections.
[0256] II. Ava Design In some embodiments, the siRNA is designed as follows: First, a portion of the target gene (e.g., the C9ORF72 gene), for example, one or more of the target sequences listed in Tables 1-5, is selected. Cleavage of the mRNA at these sites should eliminate translation of the corresponding C9ORF72 protein or RAN peptide. The sense strand is designed based on the target sequence (see Tables 1-5). Typically, this portion (and the corresponding sense or antisense strand) contains about 15-25 nucleotides. In some embodiments, this portion (and the corresponding sense strand) contains 21, 22, or 23 nucleotides. However, those skilled in the art will understand that siRNAs with nucleotide lengths less than 19 or greater than 25 can also function to mediate RNAi. Thus, siRNAs of such lengths are also within the scope of the present invention, as long as they retain the function of mediating RNAi. Longer RNAi agents have been demonstrated to induce interferon or PKR responses in certain mammalian cells, which may be undesirable. Typically, the RNAi agents of this application do not induce PKR responses (i.e., are sufficiently short in length). However, longer RNAi substances may be useful in situations such as cell types that cannot undergo the PKR reaction, or where the PKR reaction is downregulated or weakened by alternative means.
[0257] When the target gene is in the sense direction, the sense strand sequence is designed so that the target sequence is essentially in the center of the strand. Moving the target sequence to an off-center position may, in some cases, reduce the efficiency of siRNA cleavage. Such compositions, i.e., less efficient compositions, may be preferable to use when off-silencing of wild-type mRNA is detected.
[0258] The antisense strand routinely has the same length as the sense strand and contains complementary nucleotides. In one embodiment, the strand is perfectly complementary, i.e., it has blunt ends when aligned or annealed. In another embodiment, the strand includes alignment or annealing such that a 1-, 2-, 3-, 4-, 5-, 6-, or 7-nucleotide overhang is generated, for example, the 3' end of the sense strand extends 1, 2, 3, 4, 5, 6, or 7 nucleotides beyond the 5' end of the antisense strand, and / or the 3' end of the antisense strand extends 1, 2, 3, 4, 5, 6, or 7 nucleotides beyond the 5' end of the sense strand. The overhang may contain, or may consist of, nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhang may contain, or may consist of, deoxyribonucleotides, e.g., dTs, or nucleotide analogs, or other suitable non-nucleotide material.
[0259] To facilitate the entry of the antisense strand into RISC (to increase or improve the efficiency of targeted cleavage and silencing), the base pair strength between the 5' end of the sense strand and the 3' end of the antisense strand may be varied, for example, to mitigate or reduce the effect as described in detail in U.S. Patents 7,459,547, 7,772,203 and 7,732,593, titled “Methods and Compositions for Controlling Efficacy of RNA Silencing” (filed June 2, 2003), and U.S. Patents 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705, titled “Methods and Compositions for Enhancing the Efficacy and Specificity of RNAi” (filed June 2, 2003), which are incorporated herein by reference. In one embodiment of these aspects of the present application, the base pair strength is low because there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the second or sense strand than there are G:C base pairs between the 3' end of the first or antisense strand and the 5' end of the second or sense strand. In another embodiment, the base pair strength is low because there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. In certain exemplary embodiments, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, the base pair strength is low because there is at least one fluctuation base pair, e.g., G:U, between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. In another embodiment, the base pair strength is low because at least one base pair contains a rare nucleotide, e.g., inosine(I). In certain exemplary embodiments, the base pairs are selected from the group consisting of I:A, I:U, and I:C. In yet another embodiment, the base pair strength is reduced because at least one base pair contains a modified nucleotide.In certain exemplary embodiments, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.
[0260] The design of siRNAs suitable for targeting the C9ORF72 target sequences shown in Tables 1-5 is described in detail below. siRNAs can be designed for any other target sequences found in the C9ORF72 gene according to the exemplary teachings above. Furthermore, this technique is also applicable to targeting any other target sequences, such as non-disease-causing target sequences.
[0261] To verify the effectiveness of siRNA in disrupting mRNA (e.g., C9ORF72 mRNA), siRNA can be incubated with cDNA (e.g., C9ORF72 cDNA) in a Drosophila-based in vitro mRNA expression system. 32 Newly synthesized mRNA (e.g., C9ORF72 mRNA) radiolabeled with 3P is detected by autoradiography on an agarose gel. The presence of cleaved mRNA indicates mRNA nuclease activity. A suitable control includes the omission of siRNA. Alternatively, the control siRNA is selected to have the same nucleotide composition as the selected siRNA but lack significant sequence complementarity to the appropriate target gene. Such negative controls can be designed by randomly scrambling the nucleotide sequence of the selected siRNA, and a homology search can be performed to confirm that the negative control lacks homology to any other gene in the appropriate genome. Furthermore, negative control siRNAs can be designed by introducing one or more base mismatches into the sequence.
[0262] III. RNAi agents This application includes, for example, an siRNA molecule designed as described above. The siRNA molecule of this application can be chemically synthesized, transcribed in vitro from a DNA template, or transcribed in vivo from, for example, shRNA, or obtained by cleaving a transcribed dsRNA template in vitro using recombinant human DICER enzyme to form, for example, a pool of RNAi-mediated 20-, 21-, or 23-bp double-stranded RNAs. The siRNA molecule can be designed using any method known in the art.
[0263] In one embodiment, instead of the RNAi substance being an interfering ribonucleic acid, such as the siRNA or shRNA described above, the RNAi agent may encode an interfering ribonucleic acid, such as shRNA, as described above. In other words, the RNAi agent can be a transcription template for an interfering ribonucleic acid. Therefore, the RNAi agent of the present invention may also include small hairpin RNA (shRNA) and expression constructs engineered to express shRNA. The transcription of shRNA is thought to be initiated by the polymerase III (pol III) promoter and terminated at position 2 of the 4-5-thymine transcription termination site. When expressed, shRNAs are thought to fold into a stem-loop structure with a 3'UU overhang, and then the ends of these shRNAs are processed to convert them into siRNA-like molecules of approximately 21-23 nucleotides (Brummelkamp et al., 2002; Lee et al., 2002, Supra; Miyagishi et al., 2002; Paddison et al., 2002, Supra; Paul et al., 2002, Supra; Sui et al., 2002, Supra; Yu et al., 2002, Supra). Further details on the design and use of shRNAs can be found on the internet at the following addresses: katandin.cshl.org:9331 / RNAi / docs / BseRI-BamHI_Strategy.pdf and katandin.cshl.org:9331 / RNAi / docs / Web_version_of_PCR_strategy1.pdf).
[0264] The expression constructs of this application include any construct suitable for use in a suitable expression system, and include, but are not limited to, retroviral vectors, linear expression cassettes, plasmids, and viruses or virus-derived vectors known in the art. Such expression constructs may include one or more inducible promoters, RNA Pol III promoter systems, e.g., the U6 snRNA promoter or the H1 RNA polymerase III promoter, or other promoters known in the art. The construct may include one or both strands of siRNA. Expression constructs expressing both strands may also include a loop structure that joins both strands, or each strand may be transcribed separately from separate promoters within the same construct. Alternatively, each strand may be transcribed from separate expression constructs (Tuschl, T., 2002, Supra).
[0265] Synthetic siRNA can be delivered into cells by methods known in the art, including cation liposome transfection and electroporation. To obtain longer-term repression of a target gene (e.g., the C9ORF72 gene) and to facilitate delivery under specific circumstances, one or more siRNAs can be expressed intracellularly from a recombinant DNA construct. Such methods, which enable the expression of siRNA double-stranded molecules from a recombinant DNA construct and allow for longer-term repression of the target gene intracellularly, include mammalian Pol III promoter systems capable of expressing functional double-stranded siRNA (e.g., H1 or U6 / snRNA promoter systems (Tuschl, T. 2002, supra); (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002, supra; Sui et al., 2002, supra)). Transcription termination by T-III occurs through the execution of four consecutive T residues in the DNA template, providing a mechanism for terminating siRNA transcripts at specific sequences. siRNAs are complementary to the target gene sequence in 5'-3' and 3'-5' orientations, and the two strands of siRNA can be expressed in the same construct or in separate constructs. Hairpin siRNAs, driven by H1 or U6 snRNA promoters and expressed intracellularly, can inhibit the expression of target genes (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002), supra; Sui et al., 2002, supra).Furthermore, constructs containing siRNA sequences under the control of the T7 promoter can produce functional siRNA when co-transfected with a vector expressing T7 RNA polymerase in cells (Jacque et al., 2002, supra). A single construct can contain multiple sequences encoding siRNAs targeting the same gene or multiple genes, for example, multiple sequences encoding C9ORF72, and can be driven by separate PolIII promoter sites. [Table 3] [Table 4] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14] [Table 15] [Table 16] Table 17 Table 18 Table 19 Table 20 Table 21 Table 22 Table 23 Table 24 Table 25 Table 26 Table 27 Table 28 Table 29 Table 30 Table 31 Table 32 Table 33
[0266] Animal cells express a series of non-coding RNAs called microRNAs (miRNAs), each consisting of approximately 22 nucleotides, which can regulate gene expression at the post-transcriptional or post-translational level during animal development. One common characteristic of miRNAs is that the entire stem-loop of the precursor RNA, consisting of approximately 70 nucleotides, is cleaved, likely by the RNase III enzyme Dicer or its homolog. By substituting the stem sequence of the miRNA precursor with a sequence complementary to the target mRNA, a vector construct expressing the manipulated precursor can be used to produce siRNAs that initiate RNAi against specific mRNA targets in mammalian cells (Zeng et al., 2002, supra). When expressed by a DNA vector containing a polymerase III promoter, hairpins designed with microRNAs can silence gene expression (McManus et al., 2002, supra). MicroRNAs targeting polymorphisms are also useful for blocking the translation of mutant proteins in the absence of siRNA-mediated gene silencing. Such applications are useful, for example, in situations where a designed siRNA induces off-target silencing of wild-type proteins.
[0267] Viral delivery mechanisms can also be used to induce specific silencing of target genes via siRNA expression, for example, by generating recombinant adenoviruses containing siRNA under the transcriptional control of the RNA Pol II promoter (Xia et al., 2002, supra). Infection of HeLa cells with these recombinant adenoviruses can reduce the expression of endogenous target genes. Injecting recombinant adenovirus vectors into transgenic mice expressing the siRNA target gene results in in vivo reduction of target gene expression. Id. (Id.) In animal models, synthetic siRNA can be efficiently delivered to post-implantation mouse embryos by whole-embryo electroporation (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be achieved by a “high pressure” delivery technique, which involves rapid injection (within 5 seconds) of a large volume of siRNA-containing solution into the animal via the tail vein (Liu et al., 1999, supra; McCaffrey et al., 2002, supra; Lewis et al., 2002). Nanoparticles and liposomes can also be used to deliver siRNA to animals. In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and their associated vectors can be used to deliver one or more siRNAs to cells, e.g., nerve cells (e.g., brain cells) (U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766).
[0268] The nucleic acid composition of this application comprises both unmodified siRNA and modified siRNA known in the art, such as cross-linked siRNA derivatives, or derivatives having non-nucleotide moieties attached to their 3' or 5' ends. By modifying siRNA derivatives in this manner, it is possible to improve the cellular uptake of the resulting siRNA derivative or enhance the cellular targeting activity of the resulting siRNA derivative compared to the corresponding siRNA, and to be useful for tracking the siRNA derivative in cells or to improve the stability of the siRNA derivative compared to the corresponding siRNA.
[0269] As described herein, engineered RNA precursors introduced into cells or an entire organism lead to the creation of desired siRNA molecules. Such siRNA molecules bind to endogenous protein components of the RNAi pathway, targeting specific mRNA sequences for cleavage and disruption. This depletes the mRNA targeted by the siRNA produced from the engineered RNA precursor from the cell or organism, thereby reducing the concentration of the protein encoded by that mRNA in the cell or organism. RNA precursors are typically nucleic acid molecules that encode either one strand of dsRNA or the entire nucleotide sequence of the RNA hairpin loop structure.
[0270] The nucleic acid composition of the present invention does not need to be conjugated, or it may be conjugated to other parts such as nanoparticles to enhance the properties of the composition, such as pharmacokinetic parameters such as absorption, efficacy, bioavailability, and / or half-life. Conjugation can be achieved by methods known in this field, for example, using Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (described nucleic acids packed into polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3):137-43 (1998) (described nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (described nucleic acids bound to inserts, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (described nucleic acids bound to nanoparticles).
[0271] The nucleic acid molecules of this application may also be labeled using any method known in the art. For example, the nucleic acid composition may be labeled with a fluorophore, such as Cy3, fluorescein, or rhodamine. The labeling may be done using a kit, such as SILENCER TM This can be carried out using an siRNA labeling kit (Ambion). Furthermore, siRNA can be, for example, 3 H, 32 It can be radiolabeled with P or other suitable isotopes.
[0272] Furthermore, since RNAi is thought to proceed via at least one single-stranded RNA intermediate, those skilled in the art will understand that ss-siRNA (e.g., the antisense strand of ds-siRNA) can also be designed (e.g., for chemosynthesis), generated (e.g., enzymatically generated), or expressed (e.g., from a vector or plasmid) as described herein and can be utilized according to the claimed methodology. Moreover, in invertebrates, RNAi can be effectively induced by long dsRNAs (e.g., approximately 100–1000 nucleotides long, e.g., approximately 200–500 nucleotides long, e.g., dsRNAs of approximately 250, 300, 350, 400 or 450 nucleotides long) acting as effectors of RNAi (Brondani et al., Proc Natl Acad Sci USA. 2001 Dec. 4; 98(25):14428-33. Epub 2001 Nov. 27.).
[0273] IV. Anti-C9ORF72 RNA silencing agents In one embodiment, the application provides novel anti-C9ORF72 RNA silencing agents (e.g., siRNA and shRNA), methods for producing the RNA silencing agents, and methods (e.g., research and / or therapeutic methods) for using the improved RNA silencing agents (or parts thereof) for RNA silencing of the C9ORF72 protein. The RNA silencing agents comprise an antisense strand (or part thereof) that mediates an RNA-mediated silencing mechanism (e.g., RNAi) by being sufficiently complementary to a heterozygous single nucleotide polymorphism. A second type of RNA silencing agent (or part thereof) for silencing C9ORF72 antisense transcripts is also provided. The second type of RNA silencing agent comprises a sense strand (or part thereof) which is sufficiently complementary to an antisense transcript that mediates an RNA-mediated silencing mechanism.
[0274] In certain embodiments, siRNA compounds having one or a combination of the following properties are provided: (1) completely chemically stabilized (i.e., no unmodified 2'-OH residues); (2) asymmetric; (3) 11-16 base pair double helix; (4) alternating pattern of chemically modified nucleotides (e.g., 2'-fluoro and 2'-methoxy modifications); and (5) a 5-8 base single strand with a completely phosphorothioate tail. The number of phosphorothioate modifications varies from 6 to 17 in total in various embodiments.
[0275] In certain embodiments, the siRNA compounds described herein can be conjugated to a variety of targeting agents, including but not limited to cholesterol, DHA, phenyltropane, cortisol, vitamin A, vitamin D, GalNac, and gangliosides. The cholesterol-modified version showed a 5- to 10-fold improvement in in vitro efficacy across a wide range of cell types (e.g., HeLa, nerve cells, hepatocytes, trophoblasts) compared to previously used chemical stabilization patterns (e.g., all purines are modified, but pyrimidine is not).
[0276] The specific compounds of this application having the structural properties described above and herein may be referred to as “hsiRNA-ASP” (hydrophobic modified small interfering RNA characterized by a highly stabilizing pattern). Furthermore, this hsiRNA-ASP pattern exhibits a dramatic improvement in delivery to the liver, placenta, kidneys, spleen, and several other tissues through the brain and spinal cord, making it available for therapeutic intervention. .
[0277] In the liver, hsiRNA-ASP is specifically delivered to endothelial and Kupffer cells, but not to hepatocytes. This chemical modification pattern makes it a complementary, rather than competitive, technology to GalNac conjugates.
[0278] The compounds of this application can be described in the following aspects and embodiments.
[0279] In a first embodiment, the Specified provides an oligonucleotide having a 5' end and a 3' end and being complementary to a target, comprising at least 16 consecutive nucleotides, wherein (1) the oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (2) the nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxy-ribonucleotides; (3) the nucleotides are linked via phosphodiester or phosphorothioate bonds; and (4) the nucleotides at positions 1-6 from the 3' end, or at positions 1-7 from the 3' end, are linked to adjacent nucleotides via phosphorothioate bonds.
[0280] In a second embodiment, the Specified provides a double-stranded chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide is an oligonucleotide described herein (for example, including one of the target sequences in Tables 1-5); (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) the second oligonucleotide comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) the nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.
[0281] In a third aspect, the structure is as follows: XA(-LBLA)j(-SBSA)r(-SB)t-OR Oligonucleotides are provided having [where X is a 5' phosphate group; A is independently a 2'-methoxy-ribonucleotide in each occurrence; B is independently a 2'-fluoro-ribonucleotide in each occurrence; L is independently a phosphodiester or phosphorothioate linker in each occurrence; S is a phosphorothioate linker; and R is selected from hydrogen and a capping group (e.g., acyl such as acetyl); j is 4, 5, 6 or 7; r is 2 or 3; and t is 0 or 1].
[0282] In a fourth embodiment, the Specified Provisions relating to a double-stranded chemically modified nucleic acid comprising a first oligonucleotide and a second oligonucleotide, wherein (1) the first oligonucleotide is selected from the oligonucleotides of the third embodiment; (2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and (3) the second oligonucleotide has the structure: CLB(-SASB)m'(-PAPB)n'(-PASB)q'(-SA)r'(-SB)t'-OR A double-stranded chemically modified nucleic acid is provided having [where C is a hydrophobic molecule; A is independently a 2'-methoxy-ribonucleotide each time it appears; B is independently a 2'-fluoro-ribonucleotide each time it appears; L is a linker comprising one or more parts selected from the group consisting of 0-4 repeating units of ethylene glycol, phosphodiesters, and phosphorothioates; S is a phosphorothioate linker; P is a phosphodiester linker; R is selected from hydrogen and a capping group (e.g., acyl such as acetyl); m' is 0 or 1; n' is 4, 5, or 6; q' is 0 or 1; r' is 0 or 1; and t' is 0 or 1].
[0283] a) Design of an anti-C9ORF72 siRNA molecule In exemplary embodiments, the siRNA molecule of this application is a double heddle comprising a sense strand and a complementary antisense strand, wherein the antisense strand is sufficiently complementary to the RNAi-mediated C9ORF72 mRNA. Furthermore, an siRNA molecule is provided in which the sense strand is sufficiently complementary to the RNAi-mediated C9ORF72 antisense strand. Typically, an siRNA molecule has a nucleotide length of about 10 to 50 or more nucleotides, i.e., each strand contains 10 to 50 nucleotides (or nucleotide analogs). In some embodiments, the siRNA molecule has a nucleotide length of about 15 to 30 nucleotides in each strand, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, where one strand is sufficiently complementary to the target region. Typically, the chains are aligned such that when annealed, a protrusion of one, two, or three residues is generated at one or both ends of the double helix, with at least one, two, or three bases at the end of the unaligned chain (i.e., there are no bases complementary to the opposing chain). Typically, siRNA molecules have a nucleotide length of about 10 to 50 or more, i.e., each chain contains 10 to 50 nucleotides (or nucleotide analogs). In some embodiments, the siRNA molecule has a nucleotide length of about 15 to 30 in each chain, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, where one chain is substantially complementary to the target sequence and the other chain is identical or substantially identical to the first chain.
[0284] Typically, siRNA can be designed using any method known in the art, for example, using the following protocol.
[0285] 1. The siRNA should be specific to the target sequence, e.g., the target sequences shown in Tables 1-5. In one embodiment, the target sequence is found in the wild-type C9ORF72 allele. In another embodiment, the target sequence is found in both the C9ORF72 mutant allele and the wild-type C9ORF72 allele. In yet another embodiment, the target sequence is found in the wild-type C9ORF72 allele. The first strand should be complementary to the target sequence, and the other strand should be substantially complementary to the first strand. (See Tables 1-5 for exemplary sense and antisense strands). Sense sequences for exemplary targets are selected from the 5' untranslated region (5'-UTR) of the target gene. Cleavage of mRNA at these sites should eliminate translation of the corresponding C9ORF72 protein. Target sequences from other regions of the C9ORF72 gene, including several antisense sequences, are also suitable targets. The sense strand is designed based on the target sequence. Furthermore, siRNAs with a low G / C content (35-55%) may be more active than those with a G / C content higher than 55%. Therefore, in one embodiment, this application includes nucleic acid molecules having a G / C content of 35-55%.
[0286] 2. In embodiments where the target sequence is sense-oriented, the sense strand of the siRNA is designed based on the sequence of the selected target site. Typically, the sense strand contains about 19–25 nucleotides, e.g., 19, 20, 21, 22, 23, 24, or 25 nucleotides. Typically, the sense strand contains 21, 22, or 23 nucleotides. However, those skilled in the art will understand that siRNAs having a nucleotide length of less than 19 or a nucleotide length of more than 25 can also function to mediate RNAi. Thus, siRNAs of such lengths are also within the scope of this application, provided they retain the function of mediating RNAi. Longer RNA silencing agents have been shown to induce interferon or protein kinase R (PKR) reactions in certain mammalian cells that may be undesirable. Typically, the RNA silencing agents of this application do not induce PKR reactions (i.e., are sufficiently short in length). However, longer RNA silencing agents may be useful in situations such as cell types that cannot undergo PKR reactions, or where PKR reactions are downregulated or attenuated by alternative means.
[0287] The siRNA molecules of this application have sufficient complementarity to the target sequence so that the siRNA can mediate RNAi. Generally, siRNA containing a nucleotide sequence sufficiently identical to the target sequence portion of the target gene is preferred in order to result in RISC-mediated cleavage of the target gene. Therefore, in a preferred embodiment, the sense strand of the siRNA is designed to have a sequence sufficiently identical to a portion of the target. For example, the sense strand may be 100% identical to the target site. However, 100% identity is not required. It is preferable to have more than 80% identity between the sense strand and the target RNA sequence, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% identity. This application has the advantage of allowing for certain sequence diversity to improve the efficiency and specificity of RNAi. In one embodiment, the sense strand has four, three, two, one, or zero mismatched nucleotides in a target region where at least one base pair differs between the wild-type and mutant alleles, such as a target region containing a gain-of-function mutation, while the other strand is identical or substantially identical to the first strand. Furthermore, siRNA sequences with small insertions or deletions of one or two nucleotides are also effective in mediating RNAi. Alternatively, siRNA sequences with substitutions or insertions of nucleotide analogs may also be effective in inhibition.
[0288] Sequence identity can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for the purpose of optimal comparison (for example, gaps can be introduced in the first or second sequence for optimal alignment). Then, the nucleotides (or amino acid residues) at the corresponding nucleotide (or amino acid) positions are compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = number of identical positions / total number of positions x 100), and optionally, a penalty is imposed on the score for the number and / or length of introduced gaps.
[0289] Sequence comparison and percentage identity determination between two sequences can be performed using mathematical algorithms. In one embodiment, alignment is generated over specific portions of aligned sequences that have sufficient identity, but not over portions with a low degree of identity (i.e., local alignment). A preferred non-restrictive example of a local alignment algorithm used for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, which has been modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such algorithms are incorporated into the BLAST program (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
[0290] In another embodiment, alignment is optimized by introducing appropriate gaps, and percentage identity is determined over the length of the aligned sequences (i.e., gapped alignment). To obtain gapped alignment for comparison purposes, Gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, alignment is optimized by introducing appropriate gaps, and percentage identity is determined over the entire length of the aligned sequences (i.e., inclusive alignment). A non-restrictive example of a preferred mathematical algorithm for use in inclusive sequence comparison is the algorithm of Myers and Miller, CABIOS (1989). Such algorithms are incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program for amino acid sequence comparison, the PAM120 overweight residue table, gap length penalty 12, and gap penalty 4 may be used.
[0291] 3. The antisense or guide strand of an siRNA is routinely the same length as the sense strand and contains complementary nucleotides. In one embodiment, the guide and sense strands are perfectly complementary, i.e., the strands are blunt-ended when aligned or annealed. In another embodiment, the siRNA strands can be paired in such a way that they have 1 to 7 (e.g., 2, 3, 4, 5, 6, or 7) or 1 to 4, e.g., 2, 3, or 4 nucleotide 3' overhangs. The overhangs may (or may consist of) nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhangs may (or may consist of) deoxyribonucleotides, e.g., dT, or nucleotide analogs, or other suitable non-nucleotide material. Thus, in another embodiment, the nucleic acid molecule may have a 2-nucleotide 3' overhang, e.g., TT. The overhang nucleotides may be either RNA or DNA. As described above, it is desirable to select a target region where the mutant:wild-type mismatch is a purine:purine mismatch.
[0292] 4. Using any method known in the art, compare potential targets with appropriate genome databases (human, mouse, rat, etc.) and exclude target sequences that have significant homology to other coding sequences. One such sequence homology search method is known as BLAST, which is available on the National Center for Biotechnology Information website.
[0293] 5. Selection of one or more sequences that meet the evaluation criteria.
[0294] Further general information on the design and use of siRNA can be found in "The siRNA User Guide," available on the website of The Max-Plank-Institut fur Biophysikalische Chemie.
[0295] Alternatively, siRNA can be functionally defined as a nucleotide sequence (or oligonucleotide sequence) that can hybridize with a target sequence (e.g., hybridization at 50°C or 70°C for 12 - 16 hours in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA; subsequent washing). Further preferred hybridization conditions include hybridization at 70°C in 1xSSC or at 50°C in 1xSSC, 50% formamide, followed by washing at 70°C in 0.3xSSC or at 70°C in 4xSSC or at 50°C in 4xSSC, 50% formamide, followed by washing at 67°C in 1xSSC. The hybridization temperature of a hybrid predicted to be shorter than 50 base pairs in length is 5 - 10°C lower than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following formula. For hybrids shorter than 18 base pairs in length, Tm (°C) = 2 (number of A + T bases) + 4 (number of G + C bases). For hybrids 18 - 49 base pairs in length, Tm (°C) = 81.5 + 16.6 (log 10 [Na + ) + 0.41 (%G + C) - (600 / N), where N is the number of bases of the hybrid and [Na + is the sodium ion concentration in the hybridization buffer (for 1xSSC, [Na + = 0.165 M). Further examples of stringency conditions for polynucleotide hybridization are provided in Sambrook, J., E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F. M. Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3 - 6.4, which are incorporated herein by reference.
[0296] Negative control siRNAs should have the same nucleotide composition as the selected siRNA but lack significant sequence complementarity to the appropriate genome. Such negative controls can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. Homology searches can be performed to confirm that the negative control lacks homology to any other gene in the appropriate genome. Alternatively, negative control siRNAs can be designed by introducing one or more base mismatches into the sequence.
[0297] 6. To verify the effectiveness of siRNA in disrupting target mRNA (e.g., wild-type or mutant C9ORF72 mRNA), siRNA may be incubated with target cDNA (e.g., C9ORF72 cDNA) in a Drosophila-based in vitro mRNA expression system. 32 A newly synthesized target mRNA (e.g., C9ORF72 mRNA) radiolabeled with 3P is detected by autoradiography on an agarose gel. The presence of cleaved target mRNA indicates mRNA nuclease activity. Suitable controls include the omission of siRNA and the use of non-target cDNA. Alternatively, the control siRNA may be selected to have the same nucleotide composition as the selected siRNA but lack significant sequence complementarity to the appropriate target gene. Such negative controls can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. Homology searches can be performed to confirm that the negative control lacks homology to any other gene in the appropriate genome. Furthermore, negative control siRNAs can be designed by introducing one or more base mismatches into their sequence.
[0298] Anti-C9ORF72 siRNA can be designed to target any of the target sequences described above. The siRNA comprises an antisense strand that is well complementary to the target sequence and mediates the silencing of the target sequence. In certain embodiments, the RNA silencing agent is siRNA.
[0299] In a particular embodiment, the siRNA comprises a sense strand containing the sequence shown in Figure 3A, and an antisense strand containing the sequence shown in Figure 3A.
[0300] The complementary site of siRNA-mRNA is selected to provide optimal mRNA specificity and maximum mRNA cleavage.
[0301] b) siRNA-like molecules The siRNA-like molecule of this application has a sequence that is "sufficiently complementary" to the target sequence of C9ORF72 mRNA (i.e., has a sequence-containing strand) and directs gene silencing by either RNAi or translational repression. The siRNA-like molecule is designed in the same manner as an siRNA molecule, but the degree of sequence identity between the sense strand and the target RNA approximates that observed between miRNA and its target. Generally, as the degree of sequence identity between the miRNA sequence and the corresponding target gene sequence decreases, the tendency to mediate post-transcriptional gene silencing by translational repression rather than RNAi increases. Therefore, in an alternative embodiment where post-transcriptional gene silencing by translational repression of the target gene is desired, the miRNA sequence has partial complementarity with the target gene sequence. In certain embodiments, the miRNA sequence has partial complementarity with one or more short sequences (complementary sites) dispersed within the target mRNA (e.g., within the 3'-UTR of the target mRNA) (Hutvagner and Zamore, Science, 2002; Zeng et al., Mol. Cell, 2002; Zeng et al., RNA, 2003; Doench et al., Genes & Dev., 2003). Because the translational repression mechanism is cooperative, in certain embodiments, multiple complementary sites (e.g., 2, 3, 4, 5, or 6) can be targeted.
[0302] The function of siRNA-like double helixes mediating RNAi or translational repression can be predicted by the distribution of non-identical nucleotides between the target gene sequence and the silencing agent nucleotide sequence at complementary sites. In one embodiment where gene silencing by translational repression is desired, at least one non-identical nucleotide is present in the central part of the complementary site, so that the double helix formed by the miRNA guide strand and target mRNA contains a central "bulge" (Doench JG et al., Genes & Dev., 2003). In another embodiment, two, three, four, five, or six consecutive or discontinuous non-identical nucleotides are introduced. The non-identical nucleotides can be selected to form fluctuating base pairs (e.g., G:U) or mismatch base pairs (G:A, C:A, C:U, G:G, A:A, C:C, U:U). In a more preferred embodiment, the "bulge" is centered on the nucleotides at positions 12 and 13 from the 5' end of the miRNA molecule.
[0303] c) Short hairpin RNA (shRNA) molecules In certain characteristic embodiments, this application provides shRNA capable of mediating RNA silencing of the C9ORF72 target sequence with improved selectivity. In contrast to siRNA, shRNA mimics the natural precursor of microRNA (miRNA) and occupies a higher position in the gene silencing pathway. For this reason, shRNA is thought to mediate gene silencing more efficiently by being supplied throughout the entire natural gene silencing pathway.
[0304] miRNAs are non-coding RNAs of approximately 22 nucleotides that can regulate gene expression at the post-transcriptional or post-translational level during plant and animal development. One common characteristic of miRNAs is that they are all cleaved from a precursor RNA stem-loop of approximately 70 nucleotides, referred to as pre-miRNA, by Dicer or its homolog, presumably by the enzyme Dicer, a type III RNase. Naturally occurring miRNA precursors (pre-miRNAs) generally have a single strand that forms a double-stranded stem containing two complementary parts, and a loop that connects the two parts of the stem. In a typical pre-miRNA, the stem contains one or more bulges, e.g., an extra nucleotide that creates a single-nucleotide "loop" in one part of the stem, and / or one or more unpaired nucleotides that create a gap in the hybridization of the two parts of the stem. The short hairpin RNAs or engineered RNA precursors of this application are artificial constructs based on these naturally occurring pre-miRNAs but engineered to deliver a desired RNA silencing agent (e.g., siRNA of this application). shRNA is formed by substituting the pre-miRNA stem sequence with a sequence complementary to the target mRNA. Because shRNA is processed throughout the cell's gene silencing pathway, it efficiently mediates RNAi.
[0305] The necessary elements of an shRNA molecule include a first and second portion, which are sufficiently complementary to anneal or hybridize to form a double-stranded or twin-stranded stem portion. These two portions do not need to be completely or perfectly complementary. The first and second “stem” portions are joined by a portion having a sequence that is not sufficiently sequence-complementary to anneal or hybridize to the other portion of the shRNA. This latter portion is referred to as the “loop” portion in the shRNA molecule. This shRNA molecule is processed to produce siRNA. The shRNA can also contain one or more bulges, i.e., extra nucleotides that make up small nucleotide “loops” in part of the stem, e.g., 1, 2, or 3 nucleotide loops. The stem portions may be of the same length, and one portion may contain, for example, a protrusion of 1 to 5 nucleotides. The protrusion nucleotides can include, for example, uracil (U), e.g., all U. Such U is encoded by thymidine (T) in the DNA encoding the shRNA, which indicates the termination of transcription.
[0306] In the shRNA (or engineered precursor RNA) of this application, one portion of the double-stranded stem is a nucleic acid sequence complementary (or antisense) to the C9ORF72 target sequence. Typically, one strand of the shRNA stem portion is sufficiently complementary (e.g., antisense) to the sequence of the target RNA (e.g., mRNA) and mediates the degradation or cleavage of the target RNA via RNA interference (RNAi). Thus, the engineered RNA precursor includes a double-stranded stem having two portions and a loop connecting the two stem portions. The antisense portion may be at the 5' or 3' end of the stem. In exemplary embodiments, the stem portion of the shRNA is about 15 to about 50 nucleotides long. For example, the two stem portions may be about 18 or 19 to about 21, 22, 23, 24, 25, 30, 35, 37, 38, 39, or 40 or more nucleotides long. In preferred embodiments, the length of the stem portion should be 21 nucleotides or more. When used in mammalian cells, the stem portion should be less than approximately 30 nucleotides in length to avoid inducing nonspecific responses such as the interferon pathway. In non-mammalian cells, the stem may be longer than 30 nucleotides. In fact, the stem can contain much larger sections complementary to the target mRNA (up to the entire mRNA, and including the entire mRNA).
[0307] The two parts of a double-stranded stem should be sufficiently complementary to hybridize to form a double-stranded stem. Therefore, the two parts may, but do not necessarily, be completely or perfectly complementary. Furthermore, the two stem parts may have the same length, and one part may contain a protrusion of 1, 2, 3, or 4 nucleotides. The protrusion nucleotides may include, for example, uracil (U), or all U. Loops in shRNA or engineered RNA precursors differ from the native pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Therefore, loops in shRNA or engineered RNA precursors may have 2, 3, 4, 5, 6, 7, 8, 9, or more nucleotide lengths, for example, 15 or 20, or more.
[0308] Loops in shRNA or engineered RNA precursors differ from those in native pre-miRNA sequences by modifying the loop sequence to increase or decrease the number of nucleotide pairs, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Therefore, the loop portion in shRNA can be about 2 to about 20 nucleotides long, i.e., about 2, 3, 4, 5, 6, 7, 8, 9, or more, for example, 15 or 20, or more nucleotides. Preferred loops consist of or include a “tetraloop” sequence. Exemplary tetraloop sequences include, but are not limited to, the sequences GNRA [where N is any nucleotide and R is a purine nucleotide], GGGG, and UUU.
[0309] In certain embodiments, the shRNAs of this application include the sequence of the desired siRNA molecule described above. In other embodiments, the sequence of the antisense portion of the shRNA can be designed essentially as described above, or more generally, by selecting a sequence of 18, 19, 20, 21, or more nucleotides from a region of 100-200 or 300 nucleotides upstream or downstream of the translation initiation within the target RNA (e.g., C9ORF72 mRNA). Generally, the sequence can be selected from any portion of the target RNA (e.g., mRNA) that includes the 5'UTR (untranslated region), coding sequence, or 3'UTR. This sequence can optionally follow immediately after a region of the target gene containing two adjacent AA nucleotides. The last two nucleotides of the nucleotide sequence can be selected to be UU. This sequence of about 21 nucleotides is used to make up a portion of the double-stranded stem in the shRNA. This sequence can, for example, enzymatically replace the stem portion of the wild-type pre-miRNA sequence or be included in the complete sequence to be synthesized. For example, DNA oligonucleotides encoding the entire stem-loop manipulated RNA precursor, or DNA oligonucleotides encoding only the portion inserted into the double stem of the precursor, can be synthesized, and the manipulated RNA precursor construct can be constructed from, for example, wild-type pre-miRNA using restriction enzymes.
[0310] The engineered RNA precursor contains a double-stranded stem with approximately 21-22 nucleotide sequences of siRNA or siRNA-like double helix that is desired to be generated in vivo. Thus, the stem portion of the engineered RNA precursor contains at least 18 or 19 nucleotide pairs corresponding to the sequence of the exon portion of the gene whose expression is reduced or inhibited. Two 3' nucleotides flanking this region of the stem are selected to maximize siRNA generation from the engineered RNA precursor and to maximize the effectiveness of the resulting siRNA when targeting the corresponding mRNA for RNAi-mediated translational repression or disruption in vivo and in vitro.
[0311] In certain embodiments, the shRNA of this application includes a miRNA sequence, optionally a terminally modified miRNA sequence, to enhance entry into RISC. The miRNA sequence can be similar to or identical to any naturally occurring miRNA (see, for example, The miRNA Registry; Griffiths-Jones S, Nuc. Acids Res., 2004). More than 1,000 naturally occurring miRNAs have been identified to date, and these together are thought to represent about 1% of all genes predicted in the genome. Many naturally occurring miRNAs are clustered in the introns of pre-mRNA and can be identified in silico using homology-based searches (Pasquinelli et al., 2000; Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001) or computer algorithms that predict the function of candidate miRNA genes forming stem-loop structures of pri-mRNA (Grad et al., Mol. Cell., 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003; Lai EC et al., Genome Bio., 2003) (e.g., MiRScan, MiRSeeker). Online registries provide searchable databases of all publicly available miRNA sequences (The miRNA Registry at the Sanger Institute website; Griffiths-Jones S, Nuc. Acids Res., 2004).Exemplary natural miRNAs include lin-4, let-7, miR-10, mirR-15, miR-16, miR-168, miR-175, miR-196 and their homologs, as well as other natural miRNAs from specific model organisms, including humans and those described in International PCT Publication WO 03 / 029459, such as Drosophila melanogaster, Caenorhabditis elegans, zebrafish, Arabidopsis thalania, Mus musculus, and Rattus norvegicus.
[0312] Naturally occurring miRNAs are expressed in vivo by endogenous genes and processed from hairpin or stem-loop precursors (pre-miRNA or pri-miRNA) by Dicer or other RNAse (Lagos-Quintana et al., Science, 2001; Lau et al., Science, 2001; Lee and Ambros, Science, 2001; Lagos-Quintana et al., Curr. Biol., 2002; Mourelatos et al., Genes Dev., 2002; Reinhart et al., Science, 2002; Ambros et al., Curr. Biol., 2003; Brennecke et al., 2003; Lagos-Quintana et al., RNA, 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003). miRNAs exist as temporary double-stranded double helixes in vivo, but only single strands are incorporated into the RISC complex, directing gene silencing. Certain miRNAs, such as plant miRNAs, have perfect or near-perfect complementarity with their target mRNAs and therefore directly cleave those target mRNAs. Other miRNAs have incomplete complementarity with their target mRNAs and therefore directly repress the translation of those target mRNAs. The degree of complementarity between a miRNA and its target mRNA is thought to determine the mechanism of action. For example, perfect or near-perfect complementarity between a miRNA and its target mRNA predicts a cleavage mechanism (Yekta et al., Science, 2004), while incomplete complementarity predicts a translation repression mechanism. In certain embodiments, the miRNA sequence is a naturally occurring miRNA sequence, and its abnormal expression or activity correlates with miRNA dysfunction.
[0313] d) Dual-function oligonucleotide tether In other embodiments, the RNA silencing agents of this application include dual-function oligonucleotide tethers useful for intercellular recruitment of miRNAs. Animal cells express a set of miRNAs, which are non-coding RNAs of about 22 nucleotides that can regulate gene expression at the post-transcriptional or post-translational level. By binding miRNAs bound to RISC and recruiting them to target mRNA, dual-function oligonucleotide tethers can suppress the expression of genes involved in the process of atherosclerosis, for example. The use of oligonucleotide tethers offers several advantages compared to existing techniques for suppressing the expression of specific genes. First, the methods described herein allow endogenous molecules (often abundant) such as miRNAs to mediate RNA silencing. Thus, the methods described herein eliminate the need to introduce exogenous molecules (e.g., siRNA) to mediate RNA silencing. Second, the RNA silencing agents and, in particular, the binding moieties (e.g., oligonucleotides such as 2'-O-methyl oligonucleotides) can be made stable and resistant to nuclease activity. As a result, the tether of this application can be designed for direct delivery, eliminating the need to indirectly deliver precursor molecules or plasmids designed to produce the desired drug within the cell. Thirdly, the tether and its respective portions can be designed to fit specific mRNA sites and specific miRNAs. This design allows for specialization to cells and gene products. Fourthly, the methods disclosed herein leave the mRNA intact, allowing those skilled in the art to block protein synthesis with short pulses using the cell's own machinery. As a result, these RNA silencing methods are highly controllable.
[0314] The dual-function oligonucleotide tethers ("tethers") of this application are designed to recruit miRNAs (e.g., endogenous cellular miRNAs) to target mRNAs in order to induce regulation of a gene of interest. In preferred embodiments, the tether has the formula TL-μ [wherein T is the mRNA targeting portion, L is the binding portion, and μ is the miRNA recruiting portion]. One or more of these portions may be double-stranded. In exemplary embodiments, each portion is single-stranded.
[0315] The portion within the tether may be sequenced or bound (5' to 3' direction) as shown in formula TL-μ (i.e., the 3' end of the target portion is bound to the 5' end of the binding portion, and the 3' end of the binding portion is bound to the 5' end of the miRNA mobilization portion). Alternatively, this portion may be sequenced or bound within the tether as follows: μ-TL (i.e., the 3' end of the miRNA mobilization portion is bound to the 5' end of the binding portion, and the 3' end of the binding portion is bound to the 5' end of the target portion).
[0316] The mRNA targeting region described above can capture a specific target mRNA. According to this application, expression of the target mRNA is undesirable, and translational repression of the mRNA is desired. The mRNA targeting region should be large enough to effectively bind to the target mRNA. The length of the targeting region will vary considerably, in part, depending on the length of the target mRNA and the degree of complementarity between the target mRNA and the targeting region. In various embodiments, the targeting region is about 200, 100, 50, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or less than 5 nucleotides in length. In certain embodiments, the targeting region is about 15 to about 25 nucleotides in length.
[0317] The miRNA recruitment site described above can associate with a miRNA. According to this application, the miRNA may be any miRNA capable of repressing a target mRNA. More than 250 types of endogenous miRNAs have been reported in mammals (Lagos-Quintana et al. (2002) Current Biol. 12:735-739; Lagos-Quintana et al. (2001) Science 294:858-862; and Lim et al. (2003) Science 299:1540). In various embodiments, the miRNA may be any miRNA recognized in the art.
[0318] The binding site is one of the drugs capable of binding to the target site in such a way that the activity of the target site is maintained. An example binding site includes an oligonucleotide site containing a sufficient number of nucleotides so that the target drug can adequately interact with its respective target. The binding site has little to no sequence homology to the mRNA or miRNA sequence in the cell. An example binding site includes one or more 2'-O-methylnucleotides, such as 2'-β-methyladenosine, 2'-O-methylthymidine, 2'-O-methylguanosine, or 2'-O-methyluridine.
[0319] e) Gene silencing oligonucleotides In certain exemplary embodiments, gene expression (i.e., C9ORF72 gene expression) can be effectively inhibited or reduced by using oligonucleotide-based compounds containing two or more single-stranded antisense oligonucleotides linked via their 5' ends, allowing for the presence of two or more accessible 3' ends. Such linked oligonucleotides are also known as gene silencing oligonucleotides (GSOs). (See, for example, U.S. Patent No. 8,431,544, assigned to Idera Pharmaceuticals, Inc., which is incorporated herein by reference in its entirety for all purposes.)
[0320] The binding at the 5' end of GSO is independent of other oligonucleotide bindings and can be carried out directly via the 5', 3', or 2' hydroxyl group, or indirectly via a non-nucleotide linker or nucleoside, utilizing either the 2' or 3' hydroxyl position of the nucleotide. The binding can utilize the functionalized sugar or nucleic acid base of the 5' terminal nucleotide.
[0321] GSOs can contain two identical or different sequences conjugated at their 5'-5' ends via phosphodiesters, phosphorothioates, or non-nucleoside linkers. Such compounds may contain 15-27 nucleotides complementary to a specific portion of the mRNA target of interest for antisense downregulation of the gene product. GSOs containing identical sequences can bind to a specific mRNA via Watson-Crick hydrogen bond interactions and inhibit protein expression. GSOs containing different sequences can bind to two or more different regions of one or more mRNA targets and inhibit protein expression. Such compounds consist of heteronucleotide sequences complementary to the target mRNA and form a stable double-strand structure via Watson-Crick hydrogen bonds. Under certain conditions, GSOs containing two free 3' ends (5'-5' conjugated antisense) may be more potent gene expression inhibitors than those containing a single free 3' end or those without a free 3' end.
[0322] In some embodiments, the non-nucleotide linker is glycerol, or formula -O-(CH2) o -CH(OH)-(CH2) p -O-[wherein o and p are independently integers 1 to about 6, 1 to about 4, or 1 to about 3] is a glycerol homolog. In some other embodiments, the non-nucleotide linker is a derivative of 1,3-diamino-2-hydroxypropane. Some such derivatives are of the formula -O-(CH2) m -C(O)NH-CH2-CH(OH)-CH2-NHC(O)-(CH2) m -O-[wherein m is an integer between 0 and approximately 10, 0 and approximately 6, 2 and approximately 6, or 2 and approximately 4].
[0323] Some non-nucleotide linkers allow for the binding of more than two GSO components. For example, the non-nucleotide linker glycerol has three hydroxyl groups to which the GSO component can be covalently bonded. Thus, some oligonucleotide-based compounds of this application contain two or more oligonucleotides bound to a nucleotide or non-nucleotide linker. Such oligonucleotides according to this application are referred to as "branched".
[0324] In certain embodiments, the GSO is at least 14 nucleotides long. In certain exemplary embodiments, the GSO is 15–40 nucleotides long or 20–30 nucleotides long. Thus, the oligonucleotide components of the GSO can independently be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides long.
[0325] These oligonucleotides can be prepared by methods recognized in the art, such as phosphoramidate or H-phosphonate chemistry, which can be carried out manually or by automated synthesizers. These oligonucleotides can also be modified in several ways without impairing their ability to hybridize to mRNA. Such modifications may include at least one internucleotide bond of the oligonucleotide which is an alkylphosphonate, phosphorothioate, phosphorodithioate, methylphosphonate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate hydroxyl, acetamidate or carboxymethyl ester or a combination thereof, and other internucleotide bonds between the 5' end of one nucleotide and the 3' end of another nucleotide, in which the 5' nucleotide phosphodiester bond is replaced by various chemical groups.
[0326] IV. Modified anti-C9ORF72 RNA silencing agents In certain embodiments of this application, the RNA silencing agent of this application (or any part thereof) described above may be modified to further improve the activity of the agent. For example, the RNA silencing agent described in Section II above may be modified with any of the modifications described below. These modifications may, in part, help to further improve target recognition, improve drug stability (e.g., prevent degradation), promote cell uptake, improve target efficiency, improve efficacy in binding to (e.g., targets), improve patient tolerance to the drug, and / or reduce toxicity.
[0327] 1) Modifications to improve target recognition In certain embodiments, the RNA silencing agents of this application may be substituted with destabilized nucleotides to improve single-nucleotide target recognition (see U.S. application Ser. No. 11 / 698,689 filed January 25, 2007, and U.S. Provisional Application No. 60 / 762,225 filed January 25, 2006, both of which are incorporated herein by reference). Such modifications may be sufficient to disrupt the specificity of the RNA silencing agent to non-target mRNA (e.g., wild-type mRNA) without affecting the specificity of the RNA silencing agent to target mRNA (e.g., gain-of-function mutant mRNA) to a senseable extent.
[0328] In a preferred embodiment, the RNA silencing agent of this application is modified by introducing at least one common nucleotide into its antisense strand. The common nucleotide comprises a base moiety that can indiscriminately base-pair with any of the four bases of a conventional nucleotide (e.g., A, G, C, U). Common nucleotides are preferred because they have a relatively small effect on the stability of the RNA double helix, or the double helix formed by the guide strand of the RNA silencing agent and the target mRNA. Exemplary common nucleotides include those having an inosine base moiety or an inosine analog base moiety selected from the group consisting of deoxynosine (e.g., 2'-deoxynosine), 7-deaza-2'-deoxynosine, 2'-aza-2'-deoxynosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In a particularly preferred embodiment, the common nucleotide is an inosine residue or a naturally occurring analog thereof.
[0329] In certain embodiments, the RNA silencing agent of this application is modified by introducing at least one destabilizing nucleotide within 5 nucleotides of a specificity-determining nucleotide (i.e., a nucleotide that recognizes a disease-associated polymorphism). For example, the destabilizing nucleotide can be introduced at a position within 5, 4, 3, 2, or 1 nucleotide from the specificity-determining nucleotide. In an exemplary embodiment, the destabilizing nucleotide is introduced at a position 3 nucleotides from the specificity-determining nucleotide (i.e., so that there are two stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In RNA silencing agents having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide can be introduced into the strand or strand portion that does not contain the specificity-determining nucleotide. In a preferred embodiment, the destabilizing nucleotide is introduced into the same strand or strand portion that contains the specificity-determining nucleotide.
[0330] 2) Modifications to improve efficacy and specificity In certain embodiments, the RNA silencing agents of this application may be modified to facilitate improved efficacy and specificity in the mediation of RNAi by asymmetric design rules (see U.S. Patents 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705). Such modifications facilitate the entry of the antisense strand of siRNA (e.g., siRNA designed using the method of this application or siRNA made from shRNA) into RISC for the sense strand, thereby increasing or improving the efficiency of targeted cleavage and silencing by preferentially leading the antisense strand to cleave or repress the translation of the target mRNA. The asymmetry of the RNA silencing agent is enhanced by reducing the base pair strength between the 5' end of the antisense strand (AS 5') and the 3' end of the sense strand (S 3') of the RNA silencing agent compared to the binding strength or base pair strength between the 3' end of the antisense strand (AS 3') and the 5' end of the sense strand (S'5) of the RNA silencing agent.
[0331] In one embodiment, the asymmetry of the RNA silencing agent of the present application may be enhanced such that the number of G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the sense strand portion is less than the number of G:C base pairs between the 3' end of the first or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present application may be enhanced such that there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In an exemplary embodiment, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, the asymmetry of the RNA silencing agent of the present application may be enhanced such that there is at least one fluctuation base pair, for example, G:U, between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present application may be enhanced such that there is at least one base pair containing a rare nucleotide, for example, inosine(I). In a typical embodiment, the base pair is selected from the group consisting of I:A, I:U, and I:C. In yet another embodiment, the asymmetry of the RNA silencing agent of this application may be enhanced so that there is at least one base pair containing a modified nucleotide. In a preferred embodiment, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.
[0332] 3) RNA silencing agent with improved stability The RNA silencing agent of the present invention can be modified to improve its stability in serum or growth medium for cell culture. To improve stability, the 3'-residue may be stabilized against degradation and may be selected to consist of, for example, purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides with modification analogs, such as uridine being replaced with 2'-deoxythymidine, is acceptable and does not affect the efficiency of RNA interference.
[0333] In one embodiment, the present application features an RNA silencing agent comprising first and second strands, the second and / or first strands being modified by substituting an internal nucleotide with a modified nucleotide, thereby improving in vivo stability compared to the corresponding unmodified RNA silencing agent. As defined herein, an “internal” nucleotide is a nucleotide that occurs at any position other than the 5' or 3' end of a nucleic acid molecule, polynucleotide, or oligonucleotide. Internal nucleotides can be within a single-stranded molecule or within a double-stranded or double-stranded molecule. In one embodiment, the sense strand and / or antisense strand are modified by the substitution of at least one internal nucleotide. In another embodiment, the sense strand and / or antisense strand are modified by the substitution of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more internal nucleotides. In another embodiment, the sense strand and / or antisense strand are modified by substitutions of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more internal nucleotides. In yet another embodiment, the sense strand and / or antisense strand are modified by substitutions of all internal nucleotides.
[0334] In one embodiment, the present application features an RNA silencing agent in which at least 80% are chemically modified. In a preferred embodiment of the present application, the RNA silencing agent is completely chemically modified, i.e., 100% of the nucleotides are chemically modified.
[0335] In preferred embodiments of this application, the RNA silencing agent may comprise at least one modified nucleotide analog. The nucleotide analog may be located at a site where target-specific silencing activity, such as RNAi-mediated activity or translational repression activity, is substantially unaffected, for example, in the 5' and / or 3' terminal regions of the siRNA molecule. In particular, the terminals may be stabilized by incorporating the modified nucleotide analog.
[0336] Exemplary nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., modifications to the phosphate-sugar backbone). For example, the phosphodiester bond of native RNA may be modified to include at least one nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides, a phosphoester group attached to an adjacent ribonucleotide is replaced by a modifying group, such as a phosphothioate group. In exemplary sugar-modified ribonucleotides, the 2'OH- group is replaced by a group selected from the group consisting of H, OR, R, halo, SH, SR, NH2, NHR, NR2, or ON, where R is a C1-C6 alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I.
[0337] In certain embodiments, the modifications are 2'-fluoro, 2'-amino, and / or 2'-thio modifications. Certain preferred modifications include 2'-fluorocytidine, 2'-fluorouridine, 2'-fluoroadenosine, 2'-fluoroguanosine, 2'-aminocytidine, 2'-aminouridine, 2'-aminoadenosine, 2'-aminoguanosine, 2,6-diaminopurine, 4-thiouridine, and / or 5-aminoallyluridine. In certain embodiments, the 2'-fluororibonucleotide is any uridine and cytidine. Additional exemplary modifications include 5-bromouridine, 5-iodouridine, 5-methylcytidine, ribothymidine, 2-aminopurine, 2'-aminobutyrylpyreneuridine, 5-fluorocytidine, and 5-fluorouridine. 2'-deoxynucleotides and 2'-Omenucleotides can also be used within the modified RNA silencing agent moiety of this application. Additional modification residues include deoxy debases, inosine, N3-methyluridine, N6,N6-dimethyladenosine, pseudouridine, purine ribonucleosides, and ribavirin. In a particularly preferred embodiment, the 2' portion is a methyl group such that the binding portion is a 2'-O-methyl oligonucleotide.
[0338] In exemplary embodiments, the RNA silencing agent of this application comprises locked nucleic acids (LNAs). LNAs are resistant to nuclease activity (highly stable) and contain sugar-modified nucleotides with single-nucleotide recognition of mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42:7967-7975, Petersen et al. (2003) Trends Biotechnol 21:74-81). These molecules have 2'-O,4'-C-ethylene-bridged nucleic acids and are capable of modifications such as 2'-deoxy-2''-fluorouridine. Furthermore, LNAs increase the specificity of oligonucleotides by binding the sugar moiety to the 3'-terminal structure, thereby pre-organizing the nucleotides for base pairing and raising the melting temperature of oligonucleotides by as much as 10°C per base.
[0339] In another exemplary embodiment, the RNA silencing agent of this application comprises peptide nucleic acids (PNAs). The PNAs comprise modified nucleotides in which the sugar-phosphate moiety of the nucleotide is replaced with a neutral 2-aminoethylglycine moiety that can form a polyamide skeleton that is highly resistant to nuclease digestion and confers improved binding specificity to the molecule (Nielsen, et al., Science, (2001), 254: 1497-1500).
[0340] Furthermore, ribonucleotides with modified nucleic acid bases, i.e., ribonucleotides containing at least one non-natural nucleic acid base instead of a naturally occurring nucleic acid base, are also preferred. The bases can be modified to block the activity of adenosine deaminase. Suitable, but not limited to, modified nucleic acid bases include uridine and / or cytidine modified at position 5, e.g., 5-(2-amino)propyluridine, 5-bromouridine; adenosine and / or guanosine modified at position 8, e.g., 8-bromoguanosine; deazanucleotides, e.g., 7-deazadenosine; and O- and N-alkylated nucleotides, e.g., N6-methyladenosine. The above modifications may be combined.
[0341] In other embodiments, crosslinking can be used to modify the pharmacokinetics of RNA silencing agents, for example, to increase their half-life in the body. Therefore, this application includes RNA silencing agents having two complementary strands of nucleic acid, wherein the two strands are crosslinked. This application also includes RNA silencing agents that are conjugated to another portion (e.g., a non-nucleic acid portion such as a peptide, an organic compound (e.g., a dye), etc.) or unconjugated (e.g., at their 3' end). By modifying siRNA derivatives in this way, it is possible to improve the cellular uptake of the resulting siRNA derivative compared to the corresponding siRNA, enhance the intracellular targeting of the resulting siRNA derivative, be useful for tracking the siRNA derivative in cells, or improve the stability of the siRNA derivative compared to the corresponding siRNA.
[0342] Other exemplary modifications include: (a) 2' modifications, e.g., providing a 2'OMe portion to the sense or antisense chain, particularly U on the sense chain, or providing a 2'OMe portion to the 3' protrusion, e.g., the 3' end (wherein the 3' end means the 3' atom of the molecule, or the furthest 3' end, e.g., the furthest 3'P or 2' position, as indicated by the context); (b) modifications of the skeleton, e.g., replacing 0 with S in the phosphate skeleton, e.g., providing phosphorothioate modifications to U or A or both, e.g., replacing 0 with S; (c) replacing U with a C5 aminolinker; (d) replacing A with G (preferably the sequence variation is located on the sense chain rather than the antisense chain); and (d) modifications at the 2', 6', 7', or 8' positions. Exemplary embodiments include those in which one or more of these modifications are present on the sense chain but not on the antisense chain, or embodiments in which the antisense chain has fewer such modifications. Further exemplary modifications include the use of a 3' protrusion, e.g., methylated P at the 3' terminus; combinations of 2' modifications, e.g., providing a 2'OMe moiety and modifying the skeleton (e.g., replacing O with S), e.g., providing a phosphorothioate modification; or the use of a 3' protrusion, e.g., methylated P at the 3' terminus; modification with a 3' alkyl group; modification with a 3' protrusion, e.g., debasic pyrrolidone at the 3' terminus; modification with naproxen, ibuprofen, or other moieties that inhibit degradation at the 3' terminus.
[0343] 4) Modifications to improve cell uptake In other embodiments, the RNA silencing agent may be modified with a chemical moiety, for example, to improve cellular uptake by target cells (e.g., nerve cells). Accordingly, this application includes RNA silencing agents that are conjugated to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), or are not conjugated (e.g., at their 3' end). Conjugation can be achieved by methods known in the art, for example, using the methods described in Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (which describes nucleic acids loaded onto polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3):137-43 (1998) (which describes nucleic acids conjugated to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (which describes nucleic acids conjugated to inserts, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (which describes nucleic acids conjugated to nanoparticles).
[0344] In certain embodiments, the RNA silencing agent of this application is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand containing a cationic group. In another embodiment, the lipophilic moiety is conjugated to one or both of the siRNAs. In an exemplary embodiment, the lipophilic moiety is conjugated to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is conjugated to the 3' end of the sense strand. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic portions include cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.
[0345] 5) Tether Ligand Other entities may be tethered to the RNA silencing agent of this application. For example, ligands tethered to the RNA silencing agent that improve stability, hybridization thermodynamics with target nucleic acids, targeting specific tissues or cell types, or, for example, cell permeability by endocytosis-dependent or independent mechanisms. Ligands and associated modifications can also increase sequence specificity and consequently reduce off-site targets. The tethered ligand may contain one or more modified bases or sugars that can function as intervenes. These are preferably located in internal regions such as the bulge of the RNA silencing agent / target double helix. The intervenes may be aromatic, e.g., polycyclic aromatic or heterocyclic aromatic compounds. Polycyclic intervenes may have stacking capabilities and may include systems having two, three, or four fused rings. The common bases described herein may be included on the ligand. In one embodiment, the ligand may contain cleavage groups that contribute to the inhibition of the target gene by cleaving the target nucleic acid. The cleavage group may be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group may include, for example, a Lu(III) or EU(III) macrocyclic complex, a Zn(II) 2,9-dimethylphenanthroline derivative, Cu(II) terpyridine, or acridine, and can promote the selective cleavage of target RNA at the bulge site by a free metal ion such as Lu(III). In some embodiments, the peptide ligand can be tethered to an RNA silencing agent to promote the cleavage of target RNA, for example, in the bulge region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (Cycram) can be conjugated to peptides (e.g., by amino acid derivatives) to facilitate the cleavage of target RNA.A tethered ligand can be an aminoglycoside ligand that can enable an RNA silencing agent to have improved hybridization properties or improved sequence specificity. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, e.g., neo-N-acridine, neo-S-acridine, neo-C-acridine, tobra-N-acridine, and KanaA-N-acridine. Sequence specificity can be increased by using acridine analogs. For example, neomycin B has high affinity for RNA compared to DNA, but low sequence specificity. The acridine analog neo-5-acridine has increased affinity for the HIV Rev-response element (RRE). In some embodiments, guanidine analogs (guanidinoglycosides) of aminoglycoside ligands are tethered to RNA silencing agents. In guanidinoglycosides, the amine group of an amino acid is replaced with a guanidine group. Binding of a guanidine analog can improve the cell permeability of RNA silencing agents. The tether ligand can be a polyarginine peptide, peptoid, or peptide mimetic that can improve the cell uptake of oligonucleotide agents.
[0346] Exemplary ligands typically bind to ligand-conjugate carriers covalently, either directly or indirectly via intervening tethers. In exemplary embodiments, the ligand is bound to the carrier via an intervening tether. In exemplary embodiments, the ligand alters the distribution, targeting, or lifespan of the RNA silencing agent it incorporates. In exemplary embodiments, the ligand enhances affinity for selected targets, such as molecules, cells or cell types, compartments, such as compartments of cells or organs in the body, tissues, organs, or regions, compared to species in which such ligands are absent.
[0347] Exemplary ligands can improve transport, hybridization, and specificity properties, and may also improve the nuclease resistance of polymer molecules, including the resulting natural or modified RNA silencing agents or any combination of monomers and / or natural or modified ribonucleotides described herein. Ligands may include, for example, therapeutic modifiers to improve uptake; for example, diagnostic compounds or reporter groups for monitoring distribution; crosslinking agents; nuclease resistance-constituting moieties; and natural or rare nucleic acid bases. Common examples include lipophilic substances, lipids, steroids (e.g., ubaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friederin, epifriederanol-deranolic acid-derived lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binders, integrin target molecules, polycations, peptides, polyamines, and peptidomimetic compounds. Ligands may include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); amino acids, or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic acid anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphatidine polyamino acids.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha-helical peptides.
[0348] The ligand may also include a target group, such as a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein that binds to a specific cell type, such as kidney cells, such as an antibody. The target group may be thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyhydric lactose, polyhydric galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyhydric mannose, polyhydric fucose, glycosylated polyamino acids, polyhydric galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, or RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, inserts (e.g., acridine and substituted acridines), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphylline, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptides, aminoglycosides, guanidium aminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol and its thioanalogs), cholic acid, lithocholic acid, adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters, e.g., C) 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19, or C 20 fatty acids) and their ethers, for example, C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , or C 20 Alkyl groups (e.g., 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octadecyl)glycerol), geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapene) Diapeptides (Tat peptides), alkylating agents, phosphates, amino acids, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption facilitators (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraaza macrocyclic ring Eu 3+ Examples include complexes, dinitrophenyl, HRP, or AP.
[0349] Ligands can be proteins, such as glycoproteins, or peptides, such as coligands, or antibodies, such as molecules that have specific affinity for antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or osteocytes. Ligands may also include hormones and hormone receptors. They may also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose. Ligands may also be, for example, lipopolysaccharides, activators of p38MAP kinase, or activators of NF-κB.
[0350] A ligand can be a substance, such as a drug, that can increase the uptake of RNA silencing agents into cells, for example, by disrupting the cytoskeleton, such as by disrupting the cellular microtubules, microfilaments, and / or intermediate filaments. Drugs may include, for example, taxone, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latruncrine A, phalloidin, swinholide A, indanosine, or myoserbine. Ligands can also increase the uptake of RNA silencing agents into cells, for example, by activating an inflammatory response. Exemplary ligands that may have such effects include tumor necrosis factor α (TNFα), interleukin-1β, or γ-interferon. In one embodiment, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can bind to serum proteins, such as human serum albumin (HSA). HSA-binding ligands enable the distribution of conjugates to target tissues of the body, such as non-renal target tissues. For example, the target tissue may be the liver, including the parenchymal cells of the liver. Molecules that can bind to HSA may also be used as ligands. For example, neproxin or aspirin may be used. Lipids or lipid-based ligands can (a) increase resistance to the degradation of the conjugate, (b) increase targeting or transport to target cells or cell membranes, and / or (c) be used to modulate binding to serum proteins, e.g., HSA. Lipid-based ligands can be used to modulate, for example, control the binding of the conjugate to the target tissue. For example, lipids or lipid-based ligands that bind more strongly to HSA are less likely to be targeted to the kidney and therefore less likely to be removed from the body. Lipids or lipid-based ligands that bind more weakly to HSA can be used to target the conjugate to the kidney. In a preferred embodiment, the lipid-based ligand binds to HSA. The lipid-based ligand can bind to HSA with sufficient affinity such that the conjugate is preferably distributed to non-renal tissue.However, the affinity is preferably not so strong that the HSA-ligand binding cannot be reversed. In another preferred embodiment, the lipid-based ligand binds weakly to HSA or does not bind at all, so that the conjugate is preferably distributed to the kidney. Other parts targeting kidney cells may also be used instead of or in addition to the lipid-based ligand.
[0351] In another embodiment, the ligand is a portion taken up by target cells, e.g., proliferating cells, e.g., a vitamin. These are particularly useful for treating, for example, undesirable cell proliferation of malignant or non-malignant forms, disorders characterized by, for example, cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include vitamin B, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. HSA and low-density lipoprotein (LDL) are also included.
[0352] In another embodiment, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In exemplary embodiments, this agent is amphiphilic. Exemplary agents are peptides such as tat or antennopedia. If this agent is a peptide, it may be modified by including the use of peptidylmimetic, inverted isomers, non-peptide or pseudo-peptide bonds, and D-amino acids. The helical agent is an α-helical agent that may contain lipophilic and oleophobic phases.
[0353] The ligand may be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule that can fold into a distinct three-dimensional structure similar to that of a natural peptide. The binding of peptides and peptidomimetics to oligonucleotides may affect the pharmacokinetic distribution of RNA silencing agents, for example, by improving cell recognition and absorption. The peptide or peptidomimetic moiety may be about 5 to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. The peptide or peptidomimetic may be, for example, a cell-permeable peptide, a cationic peptide, an amphiphilic peptide, or a hydrophobic peptide (e.g., mainly consisting of Tyr, Trp, or Phe). The peptide moiety may be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. The peptide moiety may be an L-peptide or a D-peptide. In another alternative example, the peptide moiety may include a hydrophobic membrane translocation sequence (MTS). Peptides or peptidomimetics can be encoded by random sequences of DNA, such as peptides identified from phage display libraries or one-bead-one-compound (OBOC) combination libraries (Lam et al., Nature 354:82-84, 1991). In exemplary embodiments, the peptide or peptidomimetic tethered to an RNA silencing agent via incorporated monomer units is a cell-targeting peptide such as an arginine-glycine-aspartate (RGD)-peptide or RGD mimetic. The peptide moiety may range in length from about 5 to about 40 amino acids. The peptide moiety may have structural modifications, such as to increase stability or direct conformational properties. Any of the structural modifications described below may be used.
[0354] V. Branched oligonucleotides Two or more of the above-mentioned anti-C9ORF72 RNA silencing agents, such as oligonucleotide constructs including siRNA, can be linked together by one or more parts independently selected from linkers, spacers, and branching points to form a branched oligonucleotide containing two or more RNA silencing agents. Figure 70 shows an example of a di-siRNA scaffold for delivering two siRNAs. In a typical embodiment, each nucleic acid in the branched oligonucleotide comprises an antisense strand (or portion thereof), where the antisense strand is sufficiently complementary to heterojunctional mononucleotide polymorphism to mediate an RNA-mediated silencing mechanism (e.g., RNAi). In another embodiment, a second type of branched oligonucleotide is provided, characterized by a nucleic acid comprising a sense strand (or portion thereof) for silencing a C9ORF72 antisense transcript, wherein the sense strand is sufficiently complementary to the antisense transcript to mediate an RNA-mediated silencing mechanism. In a further embodiment, a third type of branched oligonucleotide is provided, comprising both types of nucleic acids, namely, an antisense strand (or portion thereof) and an oligonucleotide comprising a sense strand (or portion thereof).
[0355] In exemplary embodiments, a branched oligonucleotide may have 2 to 8 RNA silencing agents linked via a linker. The linker may be hydrophobic. In certain embodiments, the branched oligonucleotide of this application comprises 2 to 3 oligonucleotides. In one embodiment, the oligonucleotides independently have substantial chemical stability (e.g., at least 40% of the constituent bases are chemically modified). In certain embodiments, the oligonucleotides have complete chemical stability (i.e., all of the constituent bases are chemically modified). In some embodiments, the branched oligonucleotides have one or more single-stranded phosphorothioate tails, each independently having 2 to 20 nucleotides. In certain embodiments, each single-stranded tail has 8 to 10 nucleotides.
[0356] In certain embodiments, branched oligonucleotides are characterized by three properties: (1) a branched structure, (2) complete metabolic stabilization, and (3) the presence of a single-stranded tail containing a phosphorothioate linker. In certain embodiments, branched oligonucleotides have two or three branches. It is thought that an increase in the overall size of the branched structure promotes increased uptake. Also, without being constrained by a specific activity theory, it is thought that multiple adjacent branches (e.g., two or three) allow each branch to work in coordination, thus dramatically improving the rates of internalization, trafficking, and release.
[0357] Branched oligonucleotides are provided in a variety of structurally diverse embodiments. As shown in Figure 30, for example, in some embodiments, the nucleic acid linked at the branching point is single-stranded and consists of a miRNA inhibitor, gapmer, mixmer, splice-switching nucleic acid (SSO), phosphorodiamidate morpholino oligonucleotide (PMO), or peptide nucleic acid (PNA). These single strands may be linked at their 3' or 5' ends. Combinations of siRNA and single-stranded oligonucleotides can also be used for dual function. In another embodiment, short nucleic acids complementary to gapmers, mixmers, miRNA inhibitors, SSO, PMO, and PNA can be used to carry active single-stranded nucleic acids and improve their distribution and intracellular integration. Short double-stranded regions have a low melting temperature (T m It has a temperature range of ~37°C, and once its branched structure is internalized within the cell, it degrades rapidly.
[0358] As shown in Figure 34, di-siRNA branched oligonucleotides can contain a variety of chemically diverse conjugates. Conjugated bioactive ligands can be used to enhance cell specificity and promote membrane binding, internalization, and serum protein binding. Examples of bioactive moieties used for conjugation include DHAg2, DHA, GalNAc, and cholesterol. These moieties can be conjugated to the di-siRNA via a binding linker or spacer, or added via an additional linker or spacer bound to another free siRNA end.
[0359] The presence of branched structures enhances tissue retention levels in the brain by more than 100 times compared to non-branched compounds of the same chemical composition, indicating a novel mechanism of cell retention and distribution. Branched oligonucleotides are unexpectedly uniformly distributed throughout the spinal cord and brain. Furthermore, branched oligonucleotides exhibit unexpectedly efficient systemic delivery to various tissues and very high levels of tissue accumulation.
[0360] Branched oligonucleotides include a variety of therapeutic nucleic acids, including ASOs, miRNAs, miRNA inhibitors, splice switching, PMOs, and PNAs. In some embodiments, the branched oligonucleotides further include a conjugated hydrophobic moiety, exhibiting unprecedented silencing and efficacy in vitro and in vivo.
[0361] Non-limiting embodiments of branched oligonucleotide shapes are disclosed in Figures 24, 30-32, and 33-35. Non-limiting examples of linkers, spacers, and branching points are disclosed in Figure 34.
[0362] Linker In embodiments of branched oligonucleotides, each linker is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof; where any carbon or oxygen atom of the linker may be replaced by a nitrogen atom, and has a hydroxyl substituent or an oxo substituent. In one embodiment, each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In another embodiment, each linker is a peptide. In another embodiment, each linker is RNA. In another embodiment, each linker is DNA. In another embodiment, each linker is a phosphate. In another embodiment, each linker is a phosphonate. In another embodiment, each linker is a phosphoramide. In another embodiment, each linker is an ester. In another embodiment, each linker is an amide. In another embodiment, each linker is a triazole. In another embodiment, each linker is a structure selected from the formulas in Figure 30.
[0363] VI. Compounds represented by formula (I) In another embodiment, in this specification, formula (I): [ka] [In formula (I), L is selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof, where formula (I) may further include one or more branching points B and one or more spacers S (where B is independently a polyvalent organic species or a derivative thereof, each time it appears; S is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof, each time it appears); N is RNA comprising a sense strand and an antisense strand, where the antisense strand is 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA A compound is provided that includes a complementary region substantially complementary to 3', and the sense chain and antisense chain each independently contain one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8.
[0364] In some embodiments, the compound represented by formula (I) has a structure selected from formulas (I-1) to (I-9) in Table 6. [Table 34]
[0365] In one embodiment, the compound represented by formula (I) is formula (I-1). In another embodiment, the compound represented by formula (I) is formula (I-2). In another embodiment, the compound represented by formula (I) is formula (I-3). In another embodiment, the compound represented by formula (I) is formula (I-4). In another embodiment, the compound represented by formula (I) is formula (I-5). In another embodiment, the compound represented by formula (I) is formula (I-6). In another embodiment, the compound represented by formula (I) is formula (I-7). In another embodiment, the compound represented by formula (I) is formula (I-8). In another embodiment, the compound represented by formula (I) is formula (I-9).
[0366] In embodiments of the compound represented by formula (I), each linker is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof; where any carbon or oxygen atom of the linker may be replaced by a nitrogen atom, and having a hydroxyl substituent or an oxo substituent. In one embodiment of the compound represented by formula (I), each linker is an ethylene glycol chain. In another embodiment, each linker is an alkyl chain. In yet another embodiment of the compound represented by formula (I), each linker is a peptide. In yet another embodiment of the compound represented by formula (I), each linker is RNA. In yet another embodiment of the compound represented by formula (I), each linker is DNA. In yet another embodiment of the compound represented by formula (I), each linker is a phosphate. In yet another embodiment, each linker is a phosphonate. In yet another embodiment of the compound represented by formula (I), each linker is a phosphoramide. In another embodiment of the compound represented by formula (I), each linker is an ester. In another embodiment of the compound represented by formula (I), each linker is an amide. In another embodiment of the compound represented by formula (I), each linker is a triazole. In another embodiment of the compound represented by formula (I), each linker is a structure selected from Figure 30.
[0367] In one embodiment of the compound represented by formula (I), B is a polyvalent organic species. In another embodiment of the compound represented by formula (I), B is a derivative of a polyvalent organic species. In one embodiment of the compound represented by formula (I), B is a triol or tetrol derivative. In another embodiment, B is a tri- or tetra-carboxylic acid derivative. In another embodiment, B is an amine derivative. In another embodiment, B is a tri- or tetra-amine derivative. In another embodiment, B is an amino acid derivative. In another embodiment of the compound represented by formula (I), B is selected from the formulas in Figure 29.
[0368] A polyvalent organic species is a moiety containing carbon and three or more valencies (i.e., bond points with moieties such as S, L, or N as defined above). Non-limiting examples of polyvalent organic species include triols (e.g., glycerol, phloroglucinol, etc.), tetrols (e.g., ribose, pentaerythritol, 1,2,3,5-tetrahydroxybenzene, etc.), tricarboxylic acids (e.g., citric acid, 1,3,5-cyclohexanetricarboxylic acid, trimesic acid, etc.), tetracarboxylic acids (e.g., ethylenediaminetetraacetic acid, pyromellitic acid, etc.), tertiary amines (e.g., tripropargylamine, triethanolamine, etc.), triamines (e.g., diethylenetriamine, etc.), tetramines, and species containing combinations of hydroxyl, thiol, amino, and / or carboxyl moieties (e.g., amino acids such as lysine, serine, and cysteine).
[0369] In embodiments of the compound represented by formula (I), each nucleic acid contains one or more chemically modified nucleotides. In embodiments of the compound represented by formula (I), each nucleic acid consists of chemically modified nucleotides. In specific embodiments of the compound represented by formula (I), >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of each nucleic acid contains chemically modified nucleotides.
[0370] In some embodiments, each antisense chain independently contains a 5' terminal group R selected from the group in Table 7. [Table 35]
[0371] In one embodiment, R is R1. In another embodiment, R is R2. In another embodiment, R is R3. In another embodiment, R is R4. In another embodiment, R is R5. In another embodiment, R is R6. In another embodiment, R is R7. In another embodiment, R is R8.
[0372] Structure of equation (II) In some embodiments, the compound represented by formula (I) is represented by formula (II): [ka] The formula has the structure [wherein X is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; - indicates a phosphodiester nucleoside bond; = indicates a phosphorothioate nucleoside bond; and --- indicates, each time it appears, alone, a base pairing interaction or mismatch].
[0373] In certain embodiments, the structure of formula (II) does not contain mismatches. In one embodiment, the structure of formula (II) contains one mismatch. In another embodiment, the compound represented by formula (II) contains two mismatches. In another embodiment, the compound represented by formula (II) contains three mismatches. In yet another embodiment, the compound represented by formula (II) contains four mismatches. In some embodiments, each nucleic acid consists of chemically modified nucleotides.
[0374] In a particular embodiment, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of X' in the structure of formula (II) are chemically modified nucleotides. In another embodiment, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of X' in the structure of formula (II) are chemically modified nucleotides.
[0375] Structure of equation (III) In some embodiments, the compound represented by formula (I) is represented by formula (III): [ka] [In the formula, X X is a nucleotide that independently contains a 2'-deoxy-2'-fluoro modification each time it appears; X is a nucleotide that independently contains a 2'-O-methyl modification each time it appears; Y The structure is such that each instance of Y is independently a nucleotide containing a 2'-deoxy-2'-fluoro modification; and each instance of Y is independently a nucleotide containing a 2'-O-methyl modification.
[0376] In some embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro-modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl-modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro-modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl-modified adenosine, guanosine, uridine, or cytidine.
[0377] In a particular embodiment, the structure of formula (III) does not contain any mismatches. In one embodiment, the structure of formula (III) contains one mismatch. In another embodiment, the compound represented by formula (III) contains two mismatches. In another embodiment, the compound represented by formula (III) contains three mismatches. In yet another embodiment, the compound represented by formula (III) contains four mismatches.
[0378] Structure of equation (IV) In some embodiments, the compound represented by formula (I) is represented by formula (IV): [ka] The formula has the structure [wherein X is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; - indicates a phosphodiester nucleoside bond; = indicates a phosphorothioate nucleoside bond; and --- indicates, each time it appears, alone, a base pairing interaction or mismatch].
[0379] In certain embodiments, the structure of formula (IV) does not contain mismatches. In one embodiment, the structure of formula (IV) contains one mismatch. In another embodiment, the compound represented by formula (IV) contains two mismatches. In another embodiment, the compound represented by formula (IV) contains three mismatches. In yet another embodiment, the compound represented by formula (IV) contains four mismatches. In some embodiments, each nucleic acid consists of chemically modified nucleotides.
[0380] In a particular embodiment, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of X' in the structure of formula (II) are chemically modified nucleotides. In another embodiment, >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% of X' in the structure of formula (II) are chemically modified nucleotides.
[0381] Structure of equation (V) In some embodiments, the compound represented by formula (I) is represented by formula (V): [ka] [In the formula, X X is a nucleotide that independently contains a 2'-deoxy-2'-fluoro modification each time it appears; X is a nucleotide that independently contains a 2'-O-methyl modification each time it appears; Y The structure is such that each instance of Y is independently a nucleotide containing a 2'-deoxy-2'-fluoro modification; and each instance of Y is independently a nucleotide containing a 2'-O-methyl modification.
[0382] In certain embodiments, X is selected from the group consisting of 2'-deoxy-2'-fluoro-modified adenosine, guanosine, uridine, or cytidine. In some embodiments, X is selected from the group consisting of 2'-O-methyl-modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-deoxy-2'-fluoro-modified adenosine, guanosine, uridine, or cytidine. In some embodiments, Y is selected from the group consisting of 2'-O-methyl-modified adenosine, guanosine, uridine, or cytidine.
[0383] In certain embodiments, the structure of formula (V) does not contain mismatches. In one embodiment, the structure of formula (V) contains one mismatch. In another embodiment, the compound represented by formula (V) contains two mismatches. In another embodiment, the compound represented by formula (V) contains three mismatches. In another embodiment, the compound represented by formula (V) contains four mismatches.
[0384] Variable linker In embodiments of the compound represented by formula (I), L is L1: [ka] It has the structure of [the object]. In the L1 embodiment, R is R 3 Therefore, n is 2.
[0385] In the structural embodiment of formula (II), L has the structure of L1. In the structural embodiment of formula (III), L has the structure of L1. In the structural embodiment of formula (IV), L has the structure of L1. In the structural embodiment of formula (V), L has the structure of L1. In the structural embodiment of formula (VI), L has the structure of L1. In the structural embodiment of formula (VI), L has the structure of L1.
[0386] In embodiments of the compound represented by formula (I), L is L2: [ka] It has the structure of [the object]. On Tuesday, L2, R is R 3And n is 2. In the embodiment of the structure of formula (II), L has the structure of L2. In the embodiment of the structure of formula (III), L has the structure of L2. In the embodiment of the structure of formula (IV), L has the structure of L2. In the embodiment of the structure of formula (V), L has the structure of L2. In the embodiment of the structure of formula (VI), L has the structure of L2. In the embodiment of the structure of formula (VI), L has the structure of L2.
[0387] Delivery system In a third embodiment, as used herein, formula (VI): [ka] A delivery system for therapeutic nucleic acids is provided having the structure [in formula (VI), where L is selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof, where formula (VI) may further include one or more branching points B and one or more spacers S (where B is independently a polyvalent organic species or a derivative thereof, each time it appears; S is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof); each cNA is independently a carrier nucleic acid comprising one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7, or 8].
[0388] In one embodiment of the delivery system, L is an ethylene glycol chain. In another embodiment of the delivery system, L is an alkyl chain. In another embodiment of the delivery system, L is a peptide. In another embodiment of the delivery system, L is RNA. In another embodiment of the delivery system, L is DNA. In another embodiment of the delivery system, L is a phosphate. In another embodiment of the delivery system, L is a phosphonate. In another embodiment of the delivery system, L is a phosphoramidate. In another embodiment of the delivery system, L is an ester. In another embodiment of the delivery system, L is an amide. In another embodiment of the delivery system, L is a triazole.
[0389] In one embodiment of the delivery system, S is an ethylene glycol chain. In another embodiment, S is an alkyl chain. In yet another embodiment of the delivery system, S is a peptide. In yet another embodiment, S is RNA. In yet another embodiment of the delivery system, S is DNA. In yet another embodiment of the delivery system, S is a phosphate. In yet another embodiment of the delivery system, S is a phosphonate. In yet another embodiment of the delivery system, S is a phosphoramide. In yet another embodiment of the delivery system, S is an ester. In yet another embodiment, S is an amide. In yet another embodiment, S is a triazole.
[0390] In one embodiment of the delivery system, n is 2. In another embodiment of the delivery system, n is 3. In yet another embodiment of the delivery system, n is 4. In yet another embodiment of the delivery system, n is 5. In yet another embodiment of the delivery system, n is 6. In yet another embodiment of the delivery system, n is 7. In yet another embodiment of the delivery system, n is 8.
[0391] In a particular embodiment, each cNA contains >95%, >90%, >85%, >80%, >75%, >70%, >65%, >60%, >55%, or >50% chemically modified nucleotides.
[0392] In some embodiments, the compound represented by formula (VI) is shown in Table 7: [Table 36] It has a structure selected from equations (VI-1) to (VI-9).
[0393] In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-1). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-2). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-3). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-4). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-5). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-6). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-7). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-8). In some embodiments, the compound represented by formula (VI) has the structure of formula (VI-9).
[0394] In some embodiments, the compound represented by formula (VI) (for example, including formulas (VI-1)-(VI-9)) contains each cNA independently comprising at least 15 consecutive nucleotides. In some embodiments, each cNA independently consists of chemically modified nucleotides.
[0395] In some embodiments, the delivery system further comprises n therapeutic nucleic acids (NAs), where each NA includes a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'. Each NA is also hybridized to at least one cNA. In one embodiment, the delivery system consists of 2 NAs. In another embodiment, the delivery system consists of 3 NAs. In yet another embodiment, the delivery system consists of 4 NAs. In yet another embodiment, the delivery system consists of 5 NAs. In yet another embodiment, the delivery system consists of 6 NAs. In yet another embodiment, the delivery system consists of 7 NAs. In yet another embodiment, the delivery system consists of 8 NAs.
[0396] In some embodiments, each NA independently contains at least 16 consecutive nucleotides. In some embodiments, each NA independently contains 16 to 20 consecutive nucleotides. In some embodiments, each NA independently contains 16 consecutive nucleotides. In another embodiment, each NA independently contains 17 consecutive nucleotides. In another embodiment, each NA independently contains 18 consecutive nucleotides. In another embodiment, each NA independently contains 19 consecutive nucleotides. In another embodiment, each NA independently contains 20 consecutive nucleotides.
[0397] In some embodiments, each NA contains at least two unpaired nucleotide protrusions. In another embodiment, each NA contains at least three unpaired nucleotide protrusions. In yet another embodiment, each NA contains at least four unpaired nucleotide protrusions. In yet another embodiment, each NA contains at least five unpaired nucleotide protrusions. In yet another embodiment, each NA contains at least six unpaired nucleotide protrusions. In some embodiments, the nucleotides of the protrusions are linked via phosphorothioate bonds.
[0398] In some embodiments, each NA is independently selected from the group consisting of DNA, siRNA, antagonist miR, miRNAs, gapmers, mixed mers, or guide RNA. In one embodiment, each NA is independently DNA. In another embodiment, each NA is independently siRNA. In another embodiment, each NA is independently an antagonist miR. In another embodiment, each NA is independently a miRNA. In another embodiment, each NA is independently a gapmer. In another embodiment, each NA is independently a mixed mer. In another embodiment, each NA is independently a guide RNA. In some embodiments, each NA is the same. In some embodiments, each NA is different.
[0399] In some embodiments, a delivery system further comprising n therapeutic nucleic acids (NAs) has a structure selected from formulas (I), (II), (III), (IV), (V), (VI), and their embodiments described herein. In one embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising 2 therapeutic nucleic acids (NAs). In another embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising 3 therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI), and their embodiments described herein, further comprising 4 therapeutic nucleic acids (NAs). In one embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI) and their embodiments described herein, further comprising five therapeutic nucleic acids (NA). In one embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI) and their embodiments described herein, further comprising six therapeutic nucleic acids (NA). In one embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI) and their embodiments described herein, further comprising seven therapeutic nucleic acids (NA). In one embodiment, the delivery system has a structure selected from formulas (I), (II), (III), (IV), (V), (VI) and their embodiments described herein, further comprising eight therapeutic nucleic acids (NA).
[0400] In one embodiment, the delivery system is structure L1 or L2 [where R is R 3 The structure is selected from formulas (I), (II), (III), (IV), (V), (VI) which further include a linker of [where R is 2]. In another embodiment, the delivery system has a structure L1 [where R is R 3The structure is selected from formulas (I), (II), (III), (IV), (V), (VI) which further include a linker of [where R is 2]. In another embodiment, the delivery system has a structure L2 [where R is R 3 The structure is selected from formulas (I), (II), (III), (IV), (V), (VI), which further include a linker of [where n is 2].
[0401] In embodiments of the delivery system, the delivery target is selected from the group consisting of the brain, liver, skin, kidneys, spleen, pancreas, colon, fat, lungs, muscle, and thymus. In one embodiment, the delivery target is the brain. In another embodiment, the delivery target is the striatum of the brain. In another embodiment, the delivery target is the cerebral cortex. In another embodiment, the delivery target is the striatum of the brain. In one embodiment, the delivery target is the liver. In one embodiment, the delivery target is the skin. In one embodiment, the delivery target is the kidney. In one embodiment, the delivery target is the spleen. In one embodiment, the delivery target is the pancreas. In one embodiment, the delivery target is the colon. In one embodiment, the delivery target is fat. In one embodiment, the delivery target is the lungs. In one embodiment, the delivery target is muscle. In one embodiment, the delivery target is the thymus. In one embodiment, the delivery target is the spinal cord.
[0402] The methods described herein are not limited to the specific methods and experimental conditions disclosed herein, and it should be understood that such methods and conditions may vary. Furthermore, the terms used herein are for illustrative purposes only and are not intended to limit any particular mode of practice.
[0403] Furthermore, unless otherwise specified, the experiments described herein utilize conventional molecular, cell biological, and immunological techniques within the scope of those skilled in the art. Such techniques are well known to those skilled in the art and are well described in the literature. See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY (1987–2008), including all supplements, Molecular Cloning: A Laboratory Manual (Fourth Edition) by MR Green and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2013, 2nd edition).
[0404] In certain embodiments, the compounds of the present application are characterized by the following properties: (1) two or more branched oligonucleotides, e.g., with an equal number of 3' and 5' ends; (2) substantially chemically stabilized, with more than 40%, and optimally 100%, of the oligonucleotides being chemically modified (e.g., without RNA and optionally without DNA); and (3) a single phosphorothionate-modified oligonucleotide containing at least three, and optimally 5 to 20, phosphorothioate bonds.
[0405] V. Methods for introducing nucleic acids, vectors, and host cells The RNA silencing agent of this application may be introduced directly into cells (e.g., nerve cells) (i.e., intracellularly), extracellularly into cavities, interstitial spaces, or the circulation of organisms, orally, or by immersing cells or organisms in a nucleic acid-containing solution. Blood vessels or extravascular circulation, the blood or lymphatic system, and cerebrospinal fluid are sites into which nucleic acids may be introduced.
[0406] The RNA silencing agent of this application can be introduced using nucleic acid delivery methods known in the art, including injection of a nucleic acid-containing solution, bombardment with nucleic acid-coated particles, immersion of cells or organisms in a nucleic acid solution, or electroporation of cell membranes in the presence of nucleic acids. Other methods known in the art for introducing nucleic acids into cells, such as lipid-mediated transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate, can be used. The nucleic acid may be introduced together with other components that perform one or more activities, such as enhancing nucleic acid uptake by cells or increasing inhibition of target genes.
[0407] Physical methods for introducing nucleic acids include injection of RNA-containing solutions, impact with RNA-coated particles, immersion of cells or organisms in RNA solutions, or electroporation of cell membranes in the presence of RNA. Viral constructs packaged in viral particles can achieve both the efficient introduction of expression constructs into cells and the transcription of RNA encoded by these expression constructs. Other methods known in the art for introducing nucleic acids into cells, such as lipid-mediated transport and chemical-mediated transport such as calcium phosphate, can be used. Thus, RNA can be introduced with components that perform one or more activities such as improving RNA uptake by cells, inhibiting single-strand annealing, stabilizing single strands, or increasing inhibition of target genes.
[0408] RNA can be introduced into cells (i.e., intracellularly), into extracellular spaces, cavities, interstitial spaces, or the circulation of organisms, or orally, or by immersing cells or organisms in a solution containing RNA. Blood vessels or extravascular circulation, the blood or lymphatic system, and cerebrospinal fluid are sites into which RNA can be introduced.
[0409] Cells possessing the target gene may originate from germline or somatic cells, totipotent or pluripotent cells, dividing or non-dividing cells, parenchymal or epithelial cells, immortalized or transformed cells, etc. The cells may be stem cells or differentiated cells. Differentiated cell types include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelial cells, neurons, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinizing cells, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of endocrine or exocrine glands.
[0410] Depending on the specific target gene and the dose of double-stranded RNA material delivered, this process can provide partial or complete loss of function of the target gene. Exemplary reductions or losses include at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more of the targeted cells. Inhibition of gene expression means the absence (or observable reduction) of levels of protein and / or mRNA products from the target gene. Specificity means the ability to inhibit the target gene without affecting other genes in the cell. The results of inhibition can be confirmed by testing the external properties of the cell or organism (as shown in the examples below) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring in microarrays, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescent cell sequencing (FACS).
[0411] In the case of RNA-mediated inhibition in cell lines or whole organisms, gene expression can be conveniently assayed using reporter genes or drug resistance genes whose protein products are readily assayable. Such reporter genes include acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), β-galactosidase (LacZ), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopalin synthase (NOS), octopine synthase (OCS), and their derivatives. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinotricin, puromycin, and tetracycline. Depending on the assay, quantifying gene expression levels allows for the determination of inhibition levels exceeding 10%, 33%, 50%, 90%, 95%, or 99% compared to cells not treated with this application. Lower doses of injected material and longer time intervals after RNAi agent administration may result in inhibition in smaller fractions of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of target cells). Quantifying gene expression in cells may reveal similar levels of inhibition at the level of target mRNA accumulation or target protein translation. As an example, the efficiency of inhibition can be determined by evaluating the amount of gene products in cells, where mRNA can be detected with a hybridization probe having the nucleotide sequence outside the region used for inhibitory double-stranded RNA, or translated polypeptides can be detected with an elevated antibody against the polypeptide sequence in that region.
[0412] RNA can be introduced in amounts that allow for delivery of at least one copy per cell. Higher doses of the material (e.g., at least 5, 10, 100, 500, or 1000 copies per cell) may result in more effective inhibition, while lower doses may also be useful for specific applications.
[0413] In exemplary embodiments, the efficacy of the RNAi agent of this application (e.g., siRNA targeting the C9ORF72 target sequence) is tested for its ability to specifically degrade mutant mRNA (e.g., production of C9ORF72 mRNA and / or C9ORF72 protein) in cells, particularly neurons (e.g., clonal lines of striatal or cortical neurons and / or primary neurons). Other readily transfectable cells, such as HeLa cells or COS cells, are also suitable for cell-based validation assays. Cells are transfected with human wild-type or mutant cDNA (e.g., human wild-type or mutant C9ORF72 cDNA). Standard siRNA, modified siRNA, or vectors capable of generating siRNA from U-loop mRNA are co-transfected. Selective reduction of the target mRNA (e.g., C9ORF72 mRNA) and / or target protein (e.g., C9ORF72 protein) is measured. The reduction of target mRNA or protein can be compared to the level of the target mRNA or protein in the absence of the RNAi agent or in the presence of an RNAi agent that does not target C9ORF72 mRNA. Exogenously introduced mRNA or protein (or endogenous mRNA or protein) can be assayed for comparison. When using neurons that are known to be somewhat resistant to standard transfection techniques, it may be desirable to introduce RNAi agents (e.g., siRNA) by passive uptake.
[0414] Recombinant adeno-associated viruses and vectors In certain exemplary embodiments, recombinant adeno-associated virus (rAAV) and its associated vectors can be used to deliver one or more siRNAs to cells, such as nerve cells (e.g., brain cells). AAV can infect a variety of cell types, but the efficiency of infection varies depending on the serotype, which is determined by the sequence of the capsid protein. Several native AAV serotypes have been identified, with serotypes 1–9 being the most commonly used for recombinant AAV. AAV-2 is the most well-studied and published serotype. The AAV-DJ system includes serotypes AAV-DJ and AAV-DJ / 8. These serotypes are created by DNA shuffling of multiple AAV serotypes to produce AAVs with hybrid capsids that exhibit improved transduction efficiency in vitro (AAV-DJ) and in vivo (AAV-DJ / 8) in various cells and tissues.
[0415] In certain embodiments, broad central nervous system (CNS) delivery can be achieved by intravascular delivery of recombinant adeno-associated virus 7 (RAAV7), RAAV9, and rAAV10, or other suitable rAAVs (Zhang et al. (2011) Mol. Ther. 19(8):1440-8. doi: 10.1038 / mt.2011.98. Epub 2011 May 24). rAAVs and their associated vectors are well known in the art and are described in U.S. Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766, each of which is incorporated herein by reference in its entirety for all purposes.
[0416] rAAV can be delivered to a subject in a composition by any suitable method known in the art. rAAV can be suspended in a physiologically compatible carrier (i.e., a composition) and administered to a host animal, namely humans, mice, rats, cats, dogs, sheep, rabbits, horses, cattle, goats, pigs, guinea pigs, hamsters, chickens, turkeys, and non-human primates (e.g., macaques). In certain embodiments, the host animal is a non-human host animal.
[0417] The delivery of one or more rAAVs to a mammalian subject may be carried out, for example, by intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream is obtained by injection into a vein, artery, or any other vascular conduit. In certain embodiments, one or more rAAVs are administered into the bloodstream by a method of isolated limb perfusion, a technique well known in the surgical field, which essentially allows a technician to isolate one limb from the systemic circulation before administration of the rAAV virions. A variation of the isolated limb perfusion technique described in U.S. Patent 6,177,403 may also be used by those skilled in the art to deliver virions into the vascular structure of an isolated limb to potentially enhance transduction into muscle cells or tissues. Furthermore, in certain circumstances, it may be desirable to deliver virions into the central nervous system (CNS) of the subject. "CNS" means all cells and tissues of the brain and spinal cord of vertebrates. Therefore, this term includes, but is not limited to, nerve cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial space, bone, cartilage, etc. Recombinant AAV can be delivered directly to the CNS or brain by injection using a needle, catheter or related device, using neurosurgical techniques known in this field, such as stereotactic injection, into the ventricular region, as well as the striatum (e.g., the caudate nucleus or putamen of the striatum), the spinal cord and neuromuscular junction, or the cerebellar lobule (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).
[0418] The compositions of this application may include rAAV alone or in combination with one or more other viruses (e.g., coded secondary rAAV having one or more different transgenes). In certain embodiments, the compositions include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different rAAVs, each having one or more different transgenes.
[0419] An effective dose of rAAV is sufficient for targeted infection of an animal targeting the desired tissue. In some embodiments, an effective dose of rAAV is sufficient to produce a stable somatic cell transgenic animal model. The effective dose can vary between animals and tissues, depending primarily on factors such as the target species, age, body weight, health status, and the tissue being targeted. For example, an effective dose of one or more rAAVs is generally about 10 9 ~10 16 This ranges from approximately 1 ml to approximately 100 ml of solution containing genome copies. In some cases, approximately 10 11 ~10 12 The dose of rAAV genome copies is appropriate. In a particular embodiment, 10 12 rAAV genome copies are effective for targeting heart, liver, and pancreatic tissues. In some cases, stable transgenic animals are produced by multiple doses of rAAV.
[0420] In some embodiments, the rAAV composition is particularly characterized by a high concentration of rAAV (e.g., about 10%). 13 When present at genome copies / mL or higher, the formulation is designed to reduce the aggregation of AAV particles in the composition. Methods for reducing rAAV aggregation are well known in the art and include, for example, the addition of surfactants, pH adjustment, and salt concentration adjustment. (See, for example, Wright et al. (2005) Molecular Therapy 12:171-178, the content of which is incorporated herein by reference.)
[0421] A recombinant AAV (rAAV) vector comprises, at a minimum, the transgene and its regulatory sequences, as well as 5' and 3' AAV inverted end sequences (ITRs). This recombinant AAV vector is packaged in a capsid protein and delivered to selected target cells. In some embodiments, the transgene is a vector sequence and a heterogeneous nucleic acid sequence that encodes the polypeptide, protein, functional RNA molecule (e.g., siRNA) or other gene product of interest. The nucleic acid coding sequence is manipulably bound to the regulatory components in a manner that enables transcription, translation, and / or expression of the transgene in cells of the target tissue.
[0422] The AAV sequence of a vector typically contains cis-acting 5' and 3' inverted end (ITR) sequences (see, e.g., BJ Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequence is usually about 145 base pairs long. In certain embodiments, substantially the entire sequence encoding the ITR is used in the molecule, although some minor modifications to these sequences are permissible. The ability to modify these ITR sequences is within the scope of the art (see, e.g., Sambrook et al., "Molecular Cloning. A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520-532 (1996)). An example of such a molecule used in this application is a “cis-acting” plasmid containing a transgene, in which the selective transgene sequence and associated regulatory elements are flanked by the 5' and 3' AAV ITR sequences. The AAV ITR sequences can be obtained from any known AAV, including the mammalian AAV types further described herein.
[0423] VI. Treatment Methods This application provides preventive and therapeutic methods for treating subjects at risk of (or susceptible to) a disease or disorder caused entirely or partially by abnormalities in the C9ORF72 gene. In one embodiment, such abnormalities have been found to predict the progression of neurodegeneration in the brain and spinal cord. In another embodiment, the disease or disorder is a polyglutamine disorder. In a preferred embodiment, the disease or disorder is one in which reduction of C9ORF72 in the CNS reduces the clinical symptoms seen in neurodegenerative diseases such as AD and ALS.
[0424] As used herein, “treatment” or “to treat” is defined as the application or administration of a therapeutic agent (e.g., an RNA agent or a vector or transgene encoding it) to a patient, or the application or administration of a therapeutic agent to isolated tissues or cell lines from a patient who has a disease or disorder, symptoms of a disease or disorder, or a predisposition to a disease or disorder, for the purpose of curing, resolving, mitigating, altering, treating, ameliorating, improving or influencing a disease or disorder, symptoms of a disease or disorder, or a predisposition to a disease.
[0425] In one embodiment, the present application provides a method for preventing the aforementioned disease or disorder in a subject by administering a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding it) to the subject. Subjects at risk of the disease may be identified, for example, by one or a combination of the diagnostic or predictive assays described herein. The administration of the prophylactic agent is performed before the manifestation of the characteristic symptoms of the disease or disorder, thereby preventing the disease or disorder or slowing its progression.
[0426] Another aspect of this application relates to methods for therapeutically treating patients, that is, altering the onset of symptoms of a disease or disorder. In exemplary embodiments, the modification methods of this application involve contacting CNS cells expressing C9ORF72 with a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding it) that is specific to a target sequence in the gene, such that sequence-specific interference with the gene is achieved. These methods can be carried out in vitro (e.g., by culturing cells with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject).
[0427] With respect to both preventive and therapeutic methods of treatment, such treatments may be specifically tailored or modified based on knowledge derived from the field of pharmacogenomics. As used herein, “pharmacogenomics” means the application of genomic techniques such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and commercially available drugs. More specifically, the term means studying how a patient’s genes determine their response to a drug (e.g., a patient’s “drug response phenotype” or “drug response genotype”). Accordingly, another aspect of this application provides a method for tailoring preventive or therapeutic treatments to an individual according to that individual’s drug response genotype using the target gene molecule or target gene modulator of this application. Pharmacogenomics allows clinicians or physicians to target patients who would benefit most from a treatment with preventive or therapeutic treatments and to avoid treatments for patients who would experience toxic drug-related side effects.
[0428] Therapeutic agents can be tested in appropriate animal models. For example, the efficacy, toxicity, or side effects of treatment with the RNAi agent (or the expression vector or transgene encoding it) described herein can be determined using an animal model. Alternatively, the mechanism of action of such a therapeutic agent can be determined using an animal model. For example, the efficacy, toxicity, or side effects of treatment with the agent can be determined using an animal model. Alternatively, the mechanism of action of the agent can be determined using an animal model.
[0429] The pharmaceutical composition comprising the RNA silencing agent of this application can be administered to patients diagnosed with or at risk of developing a neurodegenerative disease. In one embodiment, the patient is diagnosed with a neurological disease, and the patient's other general health is good. For example, the patient is not in a terminal state, and the patient is likely to survive for at least two, three, five years, or more after diagnosis. The patient may be treated immediately after diagnosis, or treatment may be delayed until the patient experiences more debilitating symptoms, such as motor fluctuations or abnormal movements in patients with Parkinson's disease. In another embodiment, the patient has not reached a progressive stage of the disease.
[0430] RNA silencing agents modified to improve uptake into nerve cells are available in doses of less than approximately 1.4 mg / kg body weight or less than 10 mg, 5 mg, 2 mg, 1 mg, 0.5 mg, 0.1 mg, 0.05 mg, 0.01 mg, 0.005 mg, 0.0005 mg, 0.0001 mg, 0.00005 mg, or 0.00001 mg / kg body weight and RNA agents with a molecular weight of 200 nmole (e.g., approximately 4.4 × 10⁻⁶). 16RNA silencing agents can be administered in unit doses of less than 1500 nmole / kg body weight or less than 1500 nmole, 750 nmole, 300 nmole, 150 nmole, 75 nmole, 15 nmole, 7.5 nmole, 1.5 nmole, 0.75 nmole, 0.15 nmole, 0.075 nmole, 0.015 nmole, 0.0075 nmole, 0.00075 nmole, and 0.00015 nmole / kg body weight. The unit dose can be administered, for example, by injection (e.g., directly intravenously or intramuscularly, intrathecally or intracerebrally), inhalation, or topical application. Particularly preferred doses are less than 2 mg, 1 mg, or 0.1 mg / kg body weight.
[0431] Direct delivery of RNA silencing agents to organs (e.g., directly to the brain) may be in doses of approximately 0.00001 mg to 3 mg / organ, or approximately 0.0001 to 0.001 mg / organ, approximately 0.03 to 3.0 mg / organ, approximately 0.1 to 3.0 mg / eye, or approximately 0.3 to 3.0 mg / organ. These doses may be effective for the treatment or prevention of neurodegenerative diseases or disorders, such as AD or ALS. In one embodiment, the unit dose is often administered less than once a day, for example, less than every 2, 4, 8, or 30 days. In another embodiment, the unit dose is not administered at a constant frequency (e.g., not at regular intervals). For example, the unit dose may be administered all at once. In one embodiment, an effective dose is administered in conjunction with other traditional therapeutic modalities.
[0432] In one embodiment, the subject is administered an initial dose and one or more maintenance doses of an RNA silencing agent. The maintenance dose is generally less than the initial dose, for example, half the initial dose. The maintenance regimen may include treatment of the subject with one or more doses ranging from 0.01 g to 1.4 mg / kg body weight / day, for example, 10 mg, 1 mg, 0.1 mg, 0.01 mg, 0.001 mg, or 0.00001 mg / kg body weight / day. In an exemplary embodiment, the maintenance dose is administered at a frequency of no more than once every 5, 10, or 30 days. Furthermore, the treatment regimen may be continued for a period of time that varies depending on the nature of the specific disease, its severity, and the patient's overall condition. In a preferred embodiment, the dose may be delivered not more than once a day, for example, not more than once every 24, 36, 48 hours, or more, for example, not more than once every 5 or 8 days. After treatment, the patient may be monitored for changes in condition and relief of symptoms of the disease state. The dosage of the compound may be increased if the patient does not respond significantly to the current dosage level, or it may be decreased if relief of symptoms of the disease state is observed, the disease state is eliminated, or undesirable side effects are observed.
[0433] The effective dose may be administered in a single dose or two or more doses as desired or appropriate under specific circumstances. If it is desired to facilitate repeated or frequent infusions, a delivery device, such as a pump, a semi-permanent stent (e.g., intravenous, intraperitoneal, intracapsular, or intraarticular), or the implantation of a reservoir is preferable. In one embodiment, the pharmaceutical composition comprises multiple RNA silencing species. In another embodiment, the RNA silencing species have non-contiguous sequences that do not overlap with other species with respect to naturally occurring target sequences. In another embodiment, the multiple RNA silencing species are specific to different naturally occurring target genes. In another embodiment, the RNA silencing agent is allele-specific. In another embodiment, the multiple RNA silencing species target two or more target sequences (e.g., 2, 3, 4, 5, 6, or more target sequences).
[0434] After successful treatment, it may be desirable for patients to receive maintenance therapy to prevent recurrence of the disease state, in which case the compound of this application is administered in a maintenance dose ranging from 0.01 g to 100 g / kg of body weight (see U.S. Patent No. 6,107,094).
[0435] The concentration of the RNA silencing agent composition is sufficient to be effective in treating or preventing a disorder or controlling a physiological condition in humans. The concentration or amount of RNA silencing agent administered depends on parameters determined by the drug and method of administration, e.g., nasal, buccal, or pulmonary. For example, nasal formulations tend to require much lower concentrations of certain components to avoid nasal irritation or injury. Diluting oral formulations up to 10 to 100 times may be desirable to provide a suitable nasal formulation.
[0436] Certain factors, including but not limited to the severity of the disease or disorder, prior treatment, general health, and / or the subject's age and other pre-existing conditions, may influence the dose required to effectively treat the subject. Furthermore, treatment of the subject with a therapeutically effective dose of the RNA silencing agent may consist of a single treatment or a series of treatments. It is also recognized that the effective dose of the RNA silencing agent for treatment may increase or decrease during the course of a particular treatment. Changes in dosage may result from and become apparent from the results of diagnostic assays described herein. For example, the subject may be monitored after administration of the RNA silencing agent composition. Based on the monitored information, additional amounts of the RNA silencing agent composition may be administered.
[0437] Administration depends on the severity and responsiveness of the disease condition being treated, and the course of treatment continues for several days to several months or until a cure is achieved or a reduction in the disease condition is achieved. The optimal dosing schedule can be calculated by measuring drug accumulation in the patient's body. Those skilled in the art can easily determine the optimal dose, method of administration, and number of repetitions. The optimal dose may vary depending on the relative potency of the individual compounds and is generally based on EC models that have proven effective in in vitro and in vivo animal models. 50 This can be estimated based on the following. In some embodiments, the animal model includes a transgenic animal that expresses a human gene, for example, a gene that produces the target RNA, for example, RNA expressed in nerve cells. The transgenic animal may lack the corresponding endogenous RNA. In another embodiment, the test composition includes an RNA silencing agent that is sequence-complementary, at least in its internal region, to the target RNA in the animal model and to the target RNA in humans.
[0438] VII. Pharmaceutical Compositions and Methods of Administration The present invention relates to the use of the above-mentioned agents for preventive and / or therapeutic treatment, as described below. Accordingly, the modulators of this application (e.g., RNA silencing agents) can be incorporated into a pharmaceutical composition suitable for administration. Such compositions generally include nucleic acid molecules, proteins, antibodies or modifying compounds and pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarders, etc., that are suitable for pharmaceutical administration. Such media and agents for pharmaceutically active substances are well known in the art. The use of conventional media or agents in a composition is considered unless they are incompatible with the active compound. Auxiliary active compounds can also be incorporated into a composition.
[0439] The pharmaceutical compositions of this application are formulated to be compatible with their intended route of administration. Examples of routes of administration include non-enteral, e.g., intravenous, intradermal, subcutaneous, intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal administration. In certain exemplary embodiments, the pharmaceutical compositions of this application are delivered to the cerebrospinal fluid (CSF) by routes of administration including, but not limited to, intrastriatal (IS), intraventricular (ICV), and intrathecal (IT) administration (e.g., via pump, infusion). Solutions or suspensions for non-enteral, intradermal, or subcutaneous application may contain the following components: sterile diluents, e.g., water for injection, saline solution, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents, e.g., benzyl alcohol or methylparaben; antioxidants, e.g., ascorbic acid or sodium bisulfite; chelating agents, e.g., ethylenediaminetetraacetic acid; buffers, e.g., acetate, citrate, or phosphate; and tonicity modifiers, e.g., sodium chloride or dextrose. pH may be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. Non-enteral preparations may be sealed in glass or plastic ampoules, disposable syringes, or multi-use vials.
[0440] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (when water-soluble) or dispersants and sterile powders for the immediate preparation of sterile injection solutions or dispersants. For intravenous, IS, ICV and / or IT administration, suitable carriers are physiological saline, bacteriostatic water, and Cremophor EL. TM The composition may contain (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid enough to allow easy passage through a syringe needle. It must be stable under manufacturing and storage conditions and protected against microbial contamination such as bacteria and fungi. The carrier may be a solvent or dispersion medium, for example, containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) and suitable mixtures thereof. Adequate fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of a dispersant, and by the use of a surfactant. Inhibition of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. Often, it is preferable to include isotonic agents in the composition, such as sugars, polyalcohols, such as mannitol, sorbitol, and sodium chloride. Long-term absorption of injectable compositions can be achieved by encapsulating the composition in an absorption-delaying agent, such as aluminum monostearate and gelatin.
[0441] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound, along with one or a combination of the above components as needed, into a suitable solvent, and then sterilizing by filtration. Generally, dispersants can be prepared by incorporating the active compound into a sterile medium containing a basic dispersion medium and other necessary components from the above. In the case of sterile powders for preparing sterile injectable solutions, preferred preparation methods are vacuum drying and freeze-drying, which produce a powder of the active component and any further desired components from a pre-sterile filtered solution.
[0442] Oral compositions generally contain inert diluents or food carriers. They may be encapsulated in gelatin capsules or compressed into tablets. For oral therapeutic administration, active compounds are incorporated with additives and used in the form of tablets, lozenges, or capsules. Oral compositions may also be prepared using fluid carriers as mouthwashes, where the compounds in the fluid carrier are applied orally, rinsed, spat out, or swallowed. Pharmaceutically compatible binders and / or adjuvant materials may be incorporated as part of the composition. Tablets, pills, capsules, lozenges, etc., may contain the following ingredients or compounds of similar properties: binders, e.g., microcrystalline cellulose, tragacanth gum, or gelatin; excipients, e.g., starch, or lactose; disintegrants, e.g., alginic acid, Primogel, or corn starch; lubricants, e.g., magnesium stearate, or sterol; flow enhancers, e.g., colloidal silicon dioxide; sweeteners, e.g., sucrose, or saccharin; or flavoring agents, e.g., peppermint, methyl salicylate, or orange flavoring agents.
[0443] For administration by inhalation, the compound is delivered in the form of an aerosol spray or nebulizer from a pressurized container or dispenser containing a suitable propellant, such as a gas like carbon dioxide.
[0444] Systemic administration can also be obtained by transmucosal or transdermal means. For transmucosal or transdermal administration, a permeabilizing agent suitable for the barrier to be permeated is used in the formulation. Such permeabilizing agents are generally known in the art and include, for example, surfactants, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be achieved via the use of nasal sprays or suppositories. For transdermal administration, the active compound is formulated into ointments, plasters, gels, or creams, as is generally known in the art.
[0445] The compound can also be formulated in the form of suppositories for rectal delivery (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or as a retained enema.
[0446] RNA silencing agents may also be administered by transfection or infection using methods including, but not limited to, those described in McCaffrey et al. (2002), Nature, 418(6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol., 20(10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm. 53(2), 151-160, erratum at Am. J. Health Syst. Pharm. 53(3), 325 (1996).
[0447] RNA silencing agents can also be administered by any method suitable for administering nucleic acid agents such as DNA vaccines. These methods include gene guns, bio-injectors and skin patches, as well as needle-free methods such as percutaneous needle-free mammalian vaccination of particulate DNA vaccine technology disclosed in U.S. Patent 6,194,389 and powder form vaccines disclosed in U.S. Patent 6,168,587. Furthermore, intranasal delivery is possible, as described, among other things, in Hamajima et al. (1998), Clin. Immunol. Immunopathol., 88(2), 205-10. Liposomes (e.g., described in U.S. Patent 6,472,375) and microencapsulation may also be used. Biodegradable targetable particulate delivery systems may also be used (e.g., described in U.S. Patent 6,471,996).
[0448] In one embodiment, the active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation including implants and microencapsulation delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid are used. Methods for preparing such formulations are obvious to those skilled in the art. The materials are also available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspensions (containing liposomes targeted to infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared by methods known to those skilled in the art, for example, as described in U.S. Patent 4,522,811.
[0449] For ease of administration and uniformity of dosage, it is particularly advantageous to formulate oral or enteral compositions into dosage units. As used herein, dosage unit forms mean physically divided units suitable as unit doses for the subject of treatment; each unit contains a calculated predetermined amount of the active compound, along with the necessary pharmaceutical carrier, to produce the desired therapeutic effect. The details of the dosage unit forms in this application are supported and directly depend on the specific characteristics of the active compound, the specific therapeutic effect to be achieved, and the limitations inherent in the field of producing such active compounds for the treatment of individuals.
[0450] The toxicity and therapeutic efficacy of such compounds are, for example, LD 50 (A lethal dose in 50% of the population) and ED 50 The dose (therapeutically effective in 50% of the population) can be determined by a standard pharmaceutical process in cell culture or experimental animals. The dose-to-toxicity ratio is the therapeutic index, or ratio LD50. 50 / ED 50This can be expressed as follows. Compounds exhibiting a large therapeutic index are preferred. Compounds exhibiting toxic side effects may also be used, but care should be taken in designing delivery systems that target such compounds to the site of the affected tissue in order to minimize the possibility of damage to non-infected cells and thereby reduce side effects.
[0451] Data obtained from cell culture assays and animal studies can be used to calculate a range of dosages for human use. Doses of such compounds are minimally or non-toxic and ED-positive. 50 It may fall within the range of circulating concentrations, including [specific compound]. The dose may vary within this range depending on the dose used and the route of administration utilized. For any compound used in the method of this application, the therapeutically effective dose can be estimated from the initial cell culture assay. A constant dose is formulated in an animal model, and the EC determined in cell culture... 50 A circulating plasma concentration range can be achieved that includes (i.e., the concentration of the test compound that achieves half of the maximum response). This information can be used to more accurately determine a useful dose in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.
[0452] The pharmaceutical composition may be contained in a container, pack, or dispenser, along with instructions for administration.
[0453] The therapeutically effective dose (i.e., effective dose) of an RNA silencing agent as defined herein depends on the RNA silencing agent selected. For example, if a plasmid encoding shRNA is selected, a single dose ranging from approximately 1 μg to 1000 mg is administered; in some embodiments, 10 μg, 30 μg, 100 μg, or 1000 μg may be administered. In some embodiments, 1 to 5 g of the composition may be administered. The composition may be administered once daily or more, or once weekly or more; including once every other day. Those skilled in the art will recognize that certain factors, including but not limited to the severity of the disease or disorder, prior treatment, overall health status, and / or the age of the subject and other pre-existing diseases, may influence the dose and timing required for effective treatment of the subject. Furthermore, treatment of the subject with a therapeutically effective dose of protein, polypeptide, or antibody may consist of a single treatment or a series of treatments.
[0454] The nucleic acid molecules of this application may be introduced into expression constructs, such as viral vectors, retroviral vectors, expression cassettes, or plasmid viral vectors, using methods known in the art, including but not limited to those described in, for example, Xia et al., (2002), Supra. The expression constructs may be delivered to a target, for example, by inhalation, oral administration, intravenous injection, topical administration (see U.S. Patent 5,328,470), or stereotactic injection (see, for example, Chen et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 3054-3057). The pharmaceutical product of a delivery vector may contain the vector in an acceptable diluent or contain a sustained-release matrix in which the delivery medium is embedded. Alternatively, if the complete delivery vector can be produced intact from recombinant cells, such as a retroviral vector, the pharmaceutical product may contain one or more cells that produce a gene delivery system.
[0455] The nucleic acid molecules of this application also include small hairpin RNA (shRNA) and expression constructs engineered to express shRNA. Transcription of shRNA is initiated at the polymerase III (pol III) promoter and terminates at position 2 of the 4-5-thymine transcription termination site. Upon expression, shRNA is thought to fold into a stem-loop structure with a 3'UU overhang; subsequently, the ends of these shRNAs are processed to convert them into siRNA-like molecules of approximately 21 nucleotides. (References: Brummelkamp et al. (2002), Science, 296, 550-553; Lee et al, (2002), supra; Miyagishi and Taira (2002), Nature Biotechnol., 20, 497-500; Paddison et al. (2002), supra; Paul (2002), supra; Sui (2002), supra; Yu et al. (2002), supra.)
[0456] An expression construct can be any construct suitable for use in an appropriate expression system, and includes, but is not limited to, retroviral vectors, linear expression cassettes, plasmids, and viruses or virus-derived vectors, as known in the art. Such an expression construct may include one or more inducible promoters, RNA Pol III promoter systems such as the U6 snRNA promoter or H1 RNA polymerase III promoter, or other promoters known in the art. The construct may include one or both strands of siRNA. An expression construct expressing both strands may also include a loop structure that joins the two strands, or each strand may be transcribed separately from another promoter within the same construct. Each strand may also be transcribed from another expression construct, Tuschl (2002), Supra.
[0457] In certain exemplary embodiments, compositions comprising the RNA silencing agent of this application can be delivered to the target nervous system via a variety of routes. Examples of routes include intrathecal, parenchymal (e.g., of the brain), nasal, and ocular delivery. The compositions can also be delivered systemically, for example, by intravenous, subcutaneous, or intramuscular injection, which is particularly useful for delivering RNA silencing agents to peripheral nerve cells. Preferred delivery routes are direct to the brain, for example, the ventricles or hypothalamus of the brain, or to lateral or dorsal regions of the brain. RNA silencing agents for nerve cell delivery can be incorporated into pharmaceutical compositions suitable for administration.
[0458] For example, a composition may comprise one or more RNA silencing agents and a pharmaceutically acceptable carrier. The pharmaceutical compositions of this application may be administered in a number of ways, depending on whether topical or systemic treatment is desired and the treatment area. Administration may be topical (including ocular, intranasal, and transdermal), oral, or non-enteral. Non-enteral administration includes intravenous infusion, subcutaneous, intraperitoneal, or intramuscular injection, intrathecal, or intraventricular (e.g., intraventricular) administration. In certain exemplary embodiments, the RNA silencing agents of this application are delivered across the blood-brain barrier (BBB) using a variety of suitable compositions and methods described herein.
[0459] The delivery route depends on the patient's condition. For example, the anti-C9ORF72 RNA silencing agent of this application may be administered directly to the brain (e.g., the globus pallidus or striatum and near medium spiny neurons in the striatum) in subjects diagnosed with neurodegenerative diseases. In addition to the RNA silencing agent of this application, the patient may be given a second treatment, such as symptomatic treatment and / or disease-specific treatment. The second treatment may be, for example, symptomatic (e.g., to alleviate symptoms), neuroprotective (e.g., to slow or halt disease progression), or regenerative (e.g., to reverse the disease process). Other treatments may include psychotherapy, physiotherapy, speech therapy, communication and memory aids, social support services, and dietary advice.
[0460] RNA silencing agents can be delivered to nerve cells in the brain. Delivery methods can be used that do not require the composition to cross the blood-brain barrier. For example, a pharmaceutical composition containing an RNA silencing agent can be delivered to a patient by direct injection into a region containing diseased cells. For example, a pharmaceutical composition can be delivered by direct injection into the brain. The injection is obtained by stereotactic injection into a specific region of the brain (e.g., the substantia nigra, cortex, hippocampus, striatum, or globus pallidus). RNA silencing agents can be delivered to multiple regions of the central nervous system (e.g., multiple regions of the brain and / or the spinal cord). RNA silencing agents can be delivered to generalized regions of the brain (e.g., generalized delivery to the cerebral cortex).
[0461] In one embodiment, the RNA silencing agent may be delivered by the use of a cannula or other delivery device, one end of which is implanted in a tissue, such as the brain, such as the substantia nigra, cortex, hippocampus, striatum, or globus pallidus. The cannula may be connected to a reservoir of the RNA silencing agent. Flow or delivery may be mediated by a pump, such as an osmotic pump or minipump, such as an Alzet pump (Durect, Cupertino, CA). In one embodiment, the pump and reservoir are implanted in a region distal to the tissue, such as the abdomen, and delivery is carried out by a conduit from the pump or reservoir to the release site. Devices for delivery to the brain are described, for example, in U.S. Patents 6,093,180 and 5,814,014.
[0462] The RNA silencing agent of this application may be further modified to allow it to cross the blood-brain barrier. For example, the RNA silencing agent may be conjugated with a molecule that enables the drug to cross the barrier. Such a modified RNA silencing agent may be administered by any desired method, such as intraventricular or intramuscular injection or pulmonary delivery.
[0463] In certain embodiments, exosomes are used for the delivery of the RNA silence of this application. Exosomes can pass through the BBB, delivering siRNA, antisense oligonucleotides, chemotherapeutic agents, and proteins to nerve cells, particularly after systemic injection (Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. (2011). Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat Biotechnol. 2011 Apr;29(4):341-5. doi: 10.1038 / nbt.1807; El-Andaloussi S, Lee Y, Lakhal-Littleton S, Li J, Seow Y, Gardiner C, Alvarez-Erviti L, Sargent IL, Wood MJ.(2011). Exosome-mediated delivery of siRNA in vitro and in vivo. Nat Protoc. 2012 Dec;7(12):2112-26. doi: 10.1038 / nprot.2012.131; EL Andaloussi S, Mager I, Breakefield XO, Wood MJ. (2013). Extracellular vesicles: biology and emerging therapeutic opportunities. Nat Rev Drug Discov. 2013 May;12(5):347-57. doi: 10.1038 / nrd3978; El Andaloussi S, Lakhal S, Mager I, Wood MJ. (2013). Exosomes for targeted siRNA delivery across biological barriers. Adv Drug Deliv Rev. 2013 Mar;65(3):391-7. doi: 10.1016 / j.addr.2012.08.008).
[0464] In certain embodiments, one or more lipophilic molecules are used to enable the delivery of the RNA silencing agent of this application across the blood-brain barrier (Alvarez-Ervit (2011)). The RNA silencing agent is then activated, for example, by enzymatic degradation of the lipophilic disguise compound to release the drug in its active form.
[0465] In certain embodiments, one or more receptors mediating the permeation of compounds may be used to increase blood-brain barrier (BBB) permeability, thereby enabling delivery of the RNA silencing agents of this application. These drugs increase BBB permeability by loosening tight junctions between endothelial cells, thereby temporarily increasing the osmotic pressure in the blood ((El-Andaloussi (2012)). By loosening tight junctions, the RNA silencing agents can be administered by conventional intravenous injection.
[0466] In certain embodiments, a nanoparticle-based delivery system is used to deliver the RNA silencing agent of this application across the blood-brain barrier (BBB). As used herein, “nanoparticles” means polymerized nanoparticles, generally solid, biodegradable, and colloidal systems, which are widely studied as drug or gene carriers (SP Egusquiaguirre, M. Igartua, RM Hernandez, and JL Pedraz, “Nanoparticle delivery systems for cancer therapy: advances in clinical and preclinical research,” Clinical and Translational Oncology, vol. 14, no. 2, pp. 83-93, 2012). Polymerized nanoparticles are classified into two major categories: natural polymers and synthetic polymers. Natural polymers for siRNA delivery include, but are not limited to, cyclodextrins, chitosan, and atelocollagen (Y. Wang, Z. Li, Y. Han, LH Liang, and A. Ji, “Nanoparticle-based delivery system for application of siRNA in vivo,” Current Drug Metabolism, vol. 11, no. 2, pp. 182-196, 2010).Synthetic polymers include, but are not limited to, polyethyleneimine (PEI), poly(dl-lactide-coglycolide) (PLGA), and dendrimers, which have been extensively studied (X. Yuan, S. Naguib, and Z. Wu, “Recent advances of siRNA delivery by nanoparticles,” Expert Opinion on Drug Delivery, vol. 8, no. 4, pp. 521-536, 2011). For a review of nanoparticles and other suitable delivery systems, see Jong-Min Lee, Tae-Jong Yoon, and Young-Seok Cho, “Recent Developments in Nanoparticle-Based siRNA Delivery for Cancer Therapy,” BioMed Research International, vol. 2013, Article ID 782041, 10 pages, 2013. doi:10.1155 / 2013 / 782041 (included as a whole by citation)).
[0467] The RNA silencing agent of this application may be administered orally for the treatment of retinal disorders, such as retinopathy. For example, the pharmaceutical composition may be applied to the ocular surface or adjacent tissue, such as within the eyelid. It may be applied topically, for example, as a spray, eye drops, eye wash, or ointment. The ointment or droppable liquid may be delivered by an ocular delivery system known in the art, such as an applicator or eye dropper. Such a composition may contain mucomimetics, such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose, or poly(vinyl alcohol), preservatives, such as sorbic acid, EDTA, or benzylcuronium chloride, and a normal amount of diluent and / or carrier. The pharmaceutical composition may also be administered intraocularly and may be introduced by a needle or other delivery device that can be introduced into a selected region or structure. Compositions containing the RNA silencing agent may also be administered via an ocular patch.
[0468] In general, the RNA silencing agents of this application may be administered by any suitable method. As used herein, topical delivery means the direct application of the RNA silencing agent to any surface of the body, including the eyes, mucous membranes, body cavity surfaces, or any internal surface. Topical formulations may include transdermal patches, ointments, lotions, creams, gels, droplets, sprays, and liquids. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, and thickeners may be required or desirable. Topical delivery may also be used as a means of selectively delivering the RNA silencing agent to the target epidermis or dermis or a specific layer or lining tissue.
[0469] Compositions for intrathecal or intracerebroventricular (e.g., intracerebroventricular) administration may include a sterile aqueous solution that may also contain a buffer, diluent, and other suitable additives. In some embodiments, the intrathecal or intracerebroventricular administration composition does not contain additional lipophilic moieties other than those bound to the transfection reagent or, for example, the RNA silencing agent.
[0470] Non-enteral formulations include sterile aqueous solutions that may also contain buffers, diluents, and other appropriate additives. Intracerebroventricular injection can be facilitated, for example, by an intracerebroventricular catheter connected to a reservoir. For intravenous use, the total concentration of the solute should be controlled to make the preparation isotonic.
[0471] The RNA silencing agent of this application may be administered to a subject by pulmonary delivery. The pulmonary delivery composition may be delivered by inhalation of a dispersant such that the composition in the dispersant reaches the lungs, where it can be readily absorbed directly into the bloodstream via the alveolar region. Pulmonary delivery may be effective for both systemic delivery and localized delivery for the treatment of lung diseases. In one embodiment, the RNA silencing agent administered by pulmonary delivery is modified to cross the blood-brain barrier.
[0472] Lung delivery can be achieved by various approaches, including spraying, aerosolization, micelles, and dry powder-based formulations. Delivery can be achieved with liquid nebulizers, aerosol-based inhalers, and dry powder dispersion devices. Measuring devices are preferred. One advantage of using atomizers or inhalers is that the possibility of contamination is minimized because the devices are self-sufficient. Dry powder dispersion devices deliver drugs that can be readily formulated as dry powders, for example. RNA silencing agent compositions can be stored stably as lyophilized or spray-dried powders, either on their own or in combination with a suitable powder carrier. Delivery of inhalation compositions may involve an administration time-delay element, which may include a timer, dose counter, time measuring device, or time indicator, enabling dose tracking, compliance monitoring, and / or triggering of patient administration during aerosol drug administration when taken up by the device.
[0473] Useful types of pharmaceutical excipients as carriers include stabilizers, such as human serum albumin (HSA); fillers, such as carbohydrates, amino acids, and polypeptides; pH modifiers or buffers; and salts, such as sodium chloride. These carriers may be in crystalline or amorphous form, or a mixture of the two.
[0474] Particularly valuable fillers include suitable carbohydrates, polypeptides, amino acids, or combinations thereof. Suitable carbohydrates include monosaccharides, e.g., galactose, D-mannose, sorbose; disaccharides, e.g., lactose, trehalose; cyclodextrins, e.g., 2-hydroxypropyl-beta-cyclodextrin; and polysaccharides, e.g., raffinose, maltodextrin, dextran; and algitols, e.g., mannitol, xylitol. Preferred carbohydrate groups include lactose, trehalose, raffinose, maltodextrin, and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred.
[0475] A suitable pH adjusting factor or buffer solution includes organic salts prepared from organic acids and bases, such as sodium citrate and sodium ascorbate; sodium citrate is preferred.
[0476] The RNA silencing agents of this application can be administered orally and nasally. For example, drugs administered via these membranes have a rapid onset of action, provide therapeutic plasma levels, avoid the first-pass effect of hepatic metabolism, and avoid exposure of the drug to an unfavorable gastrointestinal (GI) environment. Further advantages include ease of access to membrane sites so that the drug can be easily applied, localized, and removed. In one embodiment, the RNA silencing agent administered orally or nasally is modified to cross the blood-brain barrier.
[0477] In one embodiment, a unit dose or quantitative composition containing an RNA silencing agent is dispensed by an implantable device. The device may include sensors that monitor parameters within the subject. For example, the device may include a pump, such as an osmotic pump, and optionally associated electronic equipment.
[0478] RNA silencing agents may be packaged in viral natural capsids or chemically or enzymatically produced artificial capsids or structures derived therefrom.
[0479] VIII. Kit In certain other embodiments, the application provides a kit comprising a suitable container for a pharmaceutical formulation of an RNA silencing agent, e.g., a double-stranded RNA silencing agent or an sRNA agent (e.g., a large RNA silencing agent that can be processed into a precursor, e.g., an sRNA agent, or an RNA silencing agent, e.g., DNA encoding a double-stranded RNA silencing agent or an sRNA agent or its precursor). In certain embodiments, the individual components of the pharmaceutical formulation may be provided in one container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation in two or more containers, for example, one container for the RNA silencing agent formulation and at least one other container for the carrier compound. The kit may be packaged in a number of various arrangements, such as one or more containers in one box. The various components may be combined, for example, by instructions for use provided with the kit. The components may be combined, for example, by the methods described herein for preparing and administering a pharmaceutical composition. The kit may also include a delivery device.
[0480] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made using appropriate equivalents without departing from the scope of the embodiments disclosed herein. Although some embodiments are described in detail, they will be understood more clearly by referring to the following embodiments, and they are not intended to be limited to or encompass all for illustrative purposes only. [Examples]
[0481] Example 1 Systematic screening to identify functional siRNAs targeting C9orf72 in non-selective regions Candidate C9orf72 functional siRNAs were screened as follows: The C9orf72 reporter plasmid was inserted into the psiCHECK2 system in HeLa cells. The siRNA was applied at a concentration of 1.5 μM. After 72 hours, the samples were analyzed by DualGlo assay for reporter expression knockdown. Candidates were identified in the exon 1, exon 1 / intron 1 junction, intron 1, and exon 2 regions, as shown in Figure 3.
[0482] Next, candidate siRNA molecules were tested with increasing doses of siRNA in a luciferase reporter assay. Dose-response curves were constructed and functional candidates were identified, as shown in Figure 4. The IC50 values of the three candidate molecules were calculated, as shown in Figure 5. Candidate 6686 showed an IC50 of approximately 5 nM, candidate 6974 showed an IC50 of approximately 4 nM, and candidate 7028 showed an IC50 of approximately 62 nM.
[0483] To determine the in vivo effects of candidate siRNA molecules, U87MG glioblastoma cells were exposed to different siRNA molecules, and mRNA levels were evaluated by qPCR. As shown in Figure 6, C9orf72 mRNA levels were compared to untreated control cells. Potential mRNA knockdown was observed with candidates 7005 and 7032.
[0484] Four candidate siRNA molecules were tested for efficacy in C9 ALS patient fibroblasts from two patients. mRNA levels in fibroblasts from C9.2 and C9.3 patients after siRNA treatment were assessed by qPCR and compared to untreated controls. As shown in Figure 7, potent knockdown of C9orf72 mRNA was observed in fibroblast cell lines from both patients with all four candidate molecules.
[0485] Next, five candidate molecules were tested in a mouse model of C9 ALS. ALS mice were treated with siRNA and sacrificed, and RNA was extracted from spinal cord tissue. Then, as shown in Figure 8, C9orf72 mRNA levels were evaluated by qPCR and compared to untreated controls. In multiple experiments, potent knockdown of the C9orf72 transcript was consistently observed with three of the candidate molecules.
[0486] Example 2 A systematic screening process to identify functional siRNAs targeting C9orf72 in a selected region. C9orf72 functional siRNA candidates were screened as follows: The C9orf72 reporter plasmid was inserted into the psiCHECK2 system in HeLa cells. siRNA was applied at 1.5 μM. After 72 hours, samples were analyzed by DualGlo assay for reporter expression knockdown. As shown in Figure 9, candidates were identified in a region spanning exon 1 and intron 1. Knockdown was observed to be most potent against candidate 244.
[0487] A "sensewalk" experiment was performed to determine the knockdown of additional candidate molecules within a selected region adjacent to candidate 244. Reporter expression was analyzed as described above. Candidate molecules were developed targeting nucleotide regions. Regions starting at nucleotides 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, or 249 and ending 20 nucleotides downstream were measured, and the results are shown in Figure 17. Compared to the expression of the untreated control reporter, potent knockdown was observed for all candidates.
[0488] Selective target candidate molecules were tested in C9 ALS patient fibroblast cell lines C9.2 (Figure 11A) and C9.3 (Figure 11B). C9 patient fibroblasts were treated with eight candidate siRNA molecules. RNA was extracted, and mRNA levels for C9 or C92 were evaluated by qPCR. The results from both patient lines are summarized in Figure 11C. Significant reductions in mRNA were observed for several candidate molecules, including 52s, 56s, 143s, 214s, 226s, and 241.
[0489] Selective target candidates were tested in primary cultured neurons from C9 ALS mice (Figure 10). Cultured neurons were treated with 19 different siRNA candidates. RNA was extracted, and mRNA levels of C9orf72 were evaluated by qPCR. Strong knockdown was observed for 12 candidate molecules compared to untreated control neurons.
[0490] The identified compounds were also able to downregulate associated C9 mRNA variants and reduce RNA lesion formation in the nucleus and cytoplasm. The compounds also had the effect of reducing the expression of dipeptides, one of the major determinants of C9 toxicity.
[0491] Example 3 Chemical synthesis of di-siRNAs and vitamin D conjugate hsiRNAs DisiRNA, used for in vitro and in vivo efficacy evaluation, was synthesized as follows. As shown in Figure 25, triethylene glycol was reacted with acrylonitrile to introduce protected amine functionality. Next, the branching point was added as a tosylated sol-ketal, followed by reduction of the nitrile to obtain a primary amine, which was then conjugated to vitamin D (calciferol) via a carbamate linker. Next, the ketal was hydrolyzed to release a cis-diol selectively protected with a dimethoxytrityl (DMTr) protecting group at a primary hydroxyl group, followed by succinylation with succinic anhydride. After the resulting moiety was bound to a solid support, solid-phase oligonucleotide synthesis and deprotection were performed to obtain three products: VitD, a capped linker, and disiRNA. The synthetic products were then analyzed as described in Example 6.
[0492] Example 4 Alternative synthesis route 1 As shown in Figure 28, the monophosphoamide linker approach involves the following steps: monoazide tetraethylene glycol has a branching point to which it is added as a tosylated sol ketal. The ketal is then removed to release a cis-diol selectively protected with a dimethoxytrityl (DMTr) protecting group at a primary hydroxyl group, followed by reduction of the azide to a primary amine with triphenylphosphine, which is immediately protected with a monomethoxytrityl (MMTr) protecting group. The remaining hydroxyl is succinylated with succinic anhydride and bound to a solid support (LCAA CPG). Synthesis and deprotection of the oligonucleotide yielded one major product: di-siRNA with phosphate and phosphoamide linkages. This example illustrates an alternative direct synthetic route that produces only phosphate and phosphoamide linkers.
[0493] Example 5 Alternative synthesis route 2 To produce the diphosphate-containing moiety, a second alternative synthetic approach was developed. As shown in Figure 28, the diphosphonate linker approach involves the following steps: Starting from a sol-ketal-modified teraethylene glycol, the ketal is removed and two primary hydroxyls are selectively protected with dimethoxytrityl (DMTr). The remaining hydroxyl is lengthened with silyl-protected 1-bromoethanol. TBDMS is removed, succinylation is performed, and the molecule is bound to a solid support. Subsequently, solid-phase oligonucleotide synthesis and deprotection are performed to produce a disiRNA with a diphosphate-containing linker.
[0494] Example 6 Quality control of the chemical synthesis of disiRNA and vitamin D-conjugate hsiRNA. HPLC To evaluate the quality of the chemical synthesis of disiRNA and vitamin D-conjugated hsiRNA, the synthesized products were identified and quantified using analytical HPLC. Three major products were identified: triethylene glycol (TEG) linker-capped siRNA sense strand, disiRNA, and vitamin D-conjugated siRNA sense strand (Figure 3). Each product was isolated by HPLC and used in subsequent experiments. The chemical structures of the three major synthesized products are shown in Figure 26. The HPLC conditions included: 5-80% B for 15 minutes, buffer A (0.1M TEAA + 5% ACN), buffer B (100% ACN).
[0495] Mass Spectrometry Furthermore, quality control was performed by mass spectrometry to confirm the identity of the di-siRNA complex. The product was observed to have a mass of 11683 m / z, which corresponds to the two sense strands of the siRNA bound to the 3' end via a TEG linker (Figure 27). In this particular example, the sense strands of the siRNA were designed to target the huntingtin gene (Htt). The desired product of the di-branched siRNA complex targeting the huntingtin gene was successfully produced by the chemical synthesis method summarized in Example 5. The LC-MS conditions included: 0-100% B for 7 minutes, 0.6 mL / min. Buffer A (25 mM HFIP, 15 mM DBA, 20% MeOH), Buffer B (MeOH and 20% Buffer A).
[0496] Example 7 Incorporation of hydrophobic moieties in branched oligonucleotide structures: Strategy 1 In one example, a short hydrophobic alkylene or alkane (Hy) having an unprotected hydroxyl group (or amine) that can be phosphilated with 2-cyanoethoxy-bis(N,N-diisopropylamino)phosphine (or other suitable phosphating reagent) is used to generate the corresponding lipophilic phosphoramidite. These lipophilic phosphoramidites can then be added to the terminal position of a branched oligonucleotide using conventional oligonucleotide synthesis conditions. This strategy is shown in Figure 42.
[0497] Example 8 Incorporation of hydrophobic moieties in branched oligonucleotide structures: Strategy 2 In another example, a short / small aromatic planar molecule (Hy) having a positively charged or unprotected hydroxyl group (or amine) that can be phophytylated with 2-cyanoethoxy-bis(N,N-diisopropylamino)phosphine (or other suitable phophytylation reagent) is used to generate the corresponding aromatic hydrophobic phosphoramidite. The aromatic moiety can be positively charged. These lipophilic phosphoramidites can be added to the terminal position of branched oligonucleotides using conventional oligonucleotide synthesis conditions. This strategy is shown in Figure 43.
[0498] Example 9 Incorporation of hydrophobic moieties in branched oligonucleotide structures: Strategy 3 To introduce biologically important hydrophobic moieties, short lipophilic peptides are prepared by sequential peptide synthesis on a solid support or in solution (the latter being described herein). Short (1-10) amino acid chains can contain positively charged or polar amino acid moieties, as a positive charge reduces the overall net charge of the oligonucleotide and thus increases hydrophobicity. Once peptides of the appropriate length are prepared, they should be capped with acetic anhydride or another short fatty acid to increase hydrophobicity and mask free amines. Subsequently, the carbonyl protecting group is removed to attach 3-aminopropan-1-ol and phosphytylate the free hydroxyl (or amine). This amino acid phosphoramidite can then be added to the terminal 5' position of a branched oligonucleotide using conventional oligonucleotide synthesis conditions. This strategy is shown in Figure 44.
[0499] Example 10 RNAi-based therapies in the C9ALS research model C9ALS transgenic mice, also known as "Baloh mice" (strain name: C57BL / 6J-Tg(C9orf72_i3)112Lutzy / J), express a disease-associated repeat G4C2 hexanucleotide expansion within intron 1 of the C9 gene and can be used as a research model in the study of ALS and FTD. Heterozygous C9ALS mice are viable, fertile, and born according to Mendel's laws. They develop core pathological features observed in C9orf72 expansion carriers, including RNA lesions in the nervous system. By 3 months of age, 40–80% of cells throughout the brain show sense and antisense lesions.
[0500] Table 8 lists modified oligonucleotides targeting the disease isoform sequences C9ORF72 AS241 and C9ORF72 S241. [Table 37] As shown, it was synthesized with the modification pattern defined as "P3" in this specification.
[0501] This synthesis yielded a first antisense-modified oligonucleotide and a second sense-modified oligonucleotide. The first oligonucleotide, labeled herein as "C9ORF72_241", has the following formula: C9ORF72_241: Characterized by VP(mU)#(fU)#(mC)(fU)(fU)(fC)(mU)(fG)(mG)(fU)(mU)(fA)(mA)#(fU)#(mC)#(mU)#(mU)#(mU)#(mA)#(fU).
[0502] The second sense nucleotide is dimerized by covalently bonding its 3' end to the linker in Figure 27, and labeled with the cyanine-3 dye moiety, as shown in the following formula: C9_S_DIO_Cy3_241: We obtained the "Dioligo" of CyMN3-(mG)#(mA)#(fU)(mU)(fA)(mA)(fC)(mC)(fA)(mG)(mA)(mA)(fG)#(mA)#(mA)-DIO.
[0503] C9_AS_241 and C9_S_DIO_Cy3_241 were annealed and labeled "c9-241" as shown in Figures 1C and 1D to form disiRNAs targeting disease isoform variants of the C9ORF72 gene. A second disiRNA, labeled "c9-7005" as shown in schematic diagrams in Figures 1A and 1B, was also synthesized, designed to non-selectively and globally target the transcript of C9ORF72.
[0504] Ninety-day-old Baloh mice, reared to be heterozygous, were injected with either c9-241 or c9-7005. Control mice were injected with PBS solution or a template-less control (NTC). Six weeks after injection, the mice were sacrificed and processed for quantification of C9ORF72 mRNA and protein. The table in Figure 45 shows plots quantifying the total knockdown of C9ORF72 mRNA expression measured in c9-7005-treated mice in external (Figure 45A) and internal (Figure 45B) tissues of the central nervous system. The table in Figure 46 plots the levels of C9ORF72 disease isoform-specific mRNA knockdown measured in c9-241-treated mice in external (Figure 46A) and internal (Figure 46B) tissues of the central nervous system. Figure 47A is a Western blot of C9ORF72 protein in the mouse striatum, and Figure 47B is a graph quantifying the knockdown of C9ORF72 protein expression in PBS-injected control mice. Figure 48A is a Western blot of C9ORF72 protein in the mouse thalamus, and Figure 48B is a graph quantifying the knockdown of C9ORF72 protein expression in PBS-injected control mice.
[0505] Next, the experiment was repeated with heterozygous Baloh mice aged 140–146 days. Four weeks after injection, the mice were sacrificed and processed for quantification of C9ORF72 mRNA and protein. The table in Figure 49 is a plot quantifying the total knockdown of C9ORF72 mRNA expression measured in mice treated with c9-7005 in the outer (Figure 49A) and inner (Figure 49B) tissues of the central nervous system. The table in Figure 50 plots the levels of knockdown of C9ORF72 disease isoform-specific mRNA measured in mice treated with c9-241 in the outer (Figure 50A) and inner (Figure 50B) tissues of the central nervous system. Figure 51A is a Western blot of C9ORF72 protein in the mouse striatum, and Figure 51B is a table quantifying the knockdown of C9ORF72 protein expression compared to PBS-injected control mice.
[0506] Example 11 RNAi-based add-on therapy in the C9ALS study model The experiment reported in Example 10 was carried out to synthesize two additional sets of modified oligonucleotides having the "P3" modification pattern described above. The first set comprises a first antisense modified oligonucleotide labeled herein as "C9ORF72_052", with the following formula: C9ORF72_052: Characterized by VP(mU)#(fC)#(mU)(fU)(fU)(fU)(mA)(fC)(mG)(fU)(mG)(fG)(mG)#(fC)#(mG)#(fG)#(mA)#(mA)#(mC)#(fU).
[0507] The second sense nucleotide of the first set is dimerized by covalently bonding its 3' end to the linker in Figure 27, and labeled with the cyanine-3 dye moiety, as shown in the following formula: C9_S_DIO_Cy3_52: We obtained the "Dioligo" of CyMN3-(mC)#(mG)#(fC)(mC)(fC)(mA)(fC)(mG)(fU)(mA)(mA)(mA)(fA)#(mG)#(mA)-DIO.
[0508] The second set comprises the first antisense-modified oligonucleotide, labeled herein as "C9ORF72_143," which has the following formula: C9ORF72_143: Characterized by VP(mU)#(fC)#(mA)(fC)(fC)(fU)(mC)(fC)(mU)(fA)(mA)(fA)(mC)#(fC)#(mC)#(fA)#(mC)#(mA)#(mC)#(fC).
[0509] The second sense nucleotide of the second set is also dimerized by covalently bonding its 3' end to the linker in Figure 27, and labeled with the cyanine-3 dye moiety, resulting in the following for...
Claims
1. (i) 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', or (ii) 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', containing a complementarity region substantially complementary to a portion thereof having a length of 10 to 30 consecutive nucleotides, and a complementarity region.
2. The RNA molecule according to claim 1, comprising a complementarity region substantially complementary to AUAAAGAUUAACCAGAAGAA.
3. The RNA molecule according to claim 1, which is single-stranded (ss) RNA or double-stranded (ds) RNA.
4. A dsRNA according to claim 3, comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
5. An RNA molecule according to claim 1, having a length of 15 to 25 base pairs.
6. The dsRNA according to claim 3, wherein the complementary region is complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
7. The dsRNA according to claim 3, wherein the complementary region contains three or fewer mismatches with 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
8. The dsRNA according to claim 3, wherein the complementary region is completely complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
9. The dsRNA according to claim 3, which has a blunt end.
10. The dsRNA according to claim 3, comprising at least one single-stranded nucleotide overhang.
11. The dsRNA according to claim 3, comprising naturally occurring nucleotides.
12. The dsRNA according to claim 3, comprising at least one modified nucleotide.
13. The dsRNA according to claim 12, wherein the modified nucleotide is selected from the group consisting of a 2'-O-methyl modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, and a terminal nucleotide bonded to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.
14. The dsRNA according to claim 12, wherein the modified nucleotide is selected from the group consisting of nucleotides comprising 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, and non-natural bases.
15. The dsRNA according to claim 3, comprising at least one 2'-O-methyl modified nucleotide and at least one nucleotide containing a 5' phosphorothioate group.
16. The dsRNA according to claim 3, wherein at least 80% is chemically modified.
17. The dsRNA according to claim 3, which is completely chemically modified.
18. The dsRNA according to claim 3, comprising a cholesterol portion.
19. An RNA molecule according to claim 1, comprising a 5' end and a 3' end, and having complementarity with respect to a target, (1) RNA molecules consist of alternating 2'-methoxyribonucleotides and 2'-fluororibonucleotides; (2) The nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) Nucleotides are linked via phosphodiester or phosphorothioate bonds; and (4) The RNA molecule wherein the nucleotides from the 1-2 position to the 1-7 position from the 3' end are bound to adjacent nucleotides via phosphorothioate bonds.
20. A dsRNA according to claim 3, having a 5' end and a 3' end, being complementary to a target, and comprising a first oligonucleotide and a second oligonucleotide, (1) The first oligonucleotide contains a sequence substantially complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; (2) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) The second oligonucleotide consists of alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (4) The nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The dsRNA wherein the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.
21. An RNA molecule according to claim 1, comprising a 5' end and a 3' end, and having complementarity with respect to a target, (1) An RNA molecule contains a region of three consecutive 2'-fluororibonucleotides; (2) The nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) Nucleotides are linked via phosphodiester or phosphorothioate bonds; (4) Nucleotides from the 3' end at positions 1-2 to 1-7 are bound to adjacent nucleotides via phosphorothioate bonds; and, (5) The RNA molecule in which the nucleotides at positions 1-2 from the 5' end are linked to each other via phosphorothioate bonds.
22. A dsRNA according to claim 3, having a 5' end and a 3' end, being complementary to a target, and comprising a first oligonucleotide and a second oligonucleotide, (1) The first oligonucleotide contains a sequence substantially complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; (2) A portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; (3) The second oligonucleotide comprises a region of three consecutive 2'-methoxy-ribonucleotides; (4) The nucleotides at positions 2 and 14 from the 3' end of the second oligonucleotide are 2'-methoxy-ribonucleotides; and (5) The dsRNA wherein the nucleotides of the second oligonucleotide are linked via phosphodiester or phosphorothioate bonds.
23. The nucleic acid according to claim 20 or 21, wherein a hydrophobic molecule is bound to the 3' end of the second oligonucleotide.
24. The nucleic acid according to claim 23, wherein the bond between the second oligonucleotide and the hydrophobic molecule comprises polyethylene glycol or triethylene glycol.
25. The nucleic acid according to claim 20 or 21, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide are linked to adjacent nucleotides via phosphorothioate bonds.
26. The nucleic acid according to claim 20 or 21, wherein the nucleotides at positions 1 and 2 from the 3' end of the second oligonucleotide, and the nucleotides at positions 1 and 2 from the 5' end of the second oligonucleotide are linked to adjacent ribonucleotides via phosphorothioate bonds.
27. A pharmaceutical composition for inhibiting the expression of the C9ORF72 gene in a living organism, comprising the dsRNA described in claim 3 and a pharmaceutically acceptable carrier.
28. The pharmaceutical composition according to claim 27, wherein the dsRNA inhibits the expression of the C9ORF72 gene by at least 50%.
29. The pharmaceutical composition according to claim 27, wherein the dsRNA inhibits the expression of the C9ORF72 gene by at least 90%.
30. A method for inhibiting the expression of the C9ORF72 gene within cells, (a) introducing the double-stranded ribonucleic acid (dsRNA) described in claim 3 into cells; and (b) A method for inhibiting the expression of the C9ORF72 gene in cells, comprising maintaining the cells prepared in step (a) for a sufficient amount of time to obtain degradation of the mRNA transcript of the C9ORF72 gene.
31. A method for treating or managing a neurodegenerative disease, comprising administering a therapeutically effective amount of the dsRNA described in claim 3 to a patient in need of such treatment or management.
32. The method according to claim 31, wherein the dsRNA is administered to the brain of a patient.
33. The method according to claim 31, wherein the dsRNA is administered by intraventricular (ICV) or intrathecal (IT) injection.
34. The method according to claim 31, wherein administration of dsRNA causes a reduction in the C9ORF72 gene in the brain.
35. The method according to claim 31, wherein administration of dsRNA causes a reduction in the C9ORF72 gene in the spinal cord.
36. The method according to claim 31, wherein the dsRNA inhibits the expression of the C9ORF72 gene by at least 50%.
37. The method according to claim 31, wherein the dsRNA inhibits the expression of the C9ORF72 gene by at least 90%.
38. A vector for inhibiting the expression of the C9ORF72 gene in a cell, comprising a regulatory sequence manipulably bound to a nucleotide sequence encoding an RNA molecule substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', wherein the RNA molecule is 10 to 35 nucleotides long, and the RNA molecule, upon contact with a cell expressing the C9ORF72 gene, inhibits the expression of the C9ORF72 gene by at least 50%.
39. The vector according to claim 38, wherein the RNA molecule inhibits the expression of the C9ORF72 gene by at least 90%.
40. The vector according to claim 38, wherein the RNA molecule is ssRNA or dsRNA.
41. The vector according to claim 40, wherein the dsRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
42. A cell comprising the vector according to claim 38.
43. An RNA molecule having a length of 15 to 35 nucleotides, which includes a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', and which targets an intron of the C9ORF72 gene mRNA.
44. The RNA molecule according to claim 43, wherein the RNA molecule is ssRNA or dsRNA.
45. The dsRNA according to claim 44, comprising a sense strand and an antisense strand, wherein the antisense strand comprises a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
46. A dibranched RNA compound comprising two RNA molecules of 15 to 35 nucleotide lengths, each containing a complementarity region substantially complementary to C9ORF72 mRNA, wherein the two RNA molecules are linked to each other by one or more portions independently selected from linkers, spacers, and branching points.
47. The RNA molecule according to claim 46, comprising a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
48. The RNA molecule according to claim 46, comprising a complementarity region substantially complementary to AUAAAGAUUAACCAGAAGAA.
49. The RNA molecule according to claim 46, which is ssRNA or dsRNA.
50. The RNA molecule according to claim 46, which is an antisense molecule or a gapmer molecule.
51. The RNA molecule according to claim 50, wherein the antisense molecule is an antisense oligonucleotide.
52. The RNA molecule according to claim 51, wherein the antisense molecule enhances the degradation of the complementary region.
53. The RNA molecule according to claim 52, wherein the degradation is nuclease degradation.
54. The RNA molecule according to claim 53, wherein the nuclease degradation is mediated by RNase H.
55. An RNA molecule of 15–35 nucleotides in length containing a complementary region substantially complementary to the gene region of the C9ORF72 gene as described in Table 1, Table 2, Table 3, Table 4, or Table 5.
56. The RNA molecule according to claim 55, which is single-stranded (ss) RNA or double-stranded (ds) RNA.
57. A branched oligonucleotide compound comprising two or more nucleic acids, Each nucleic acid is independently 15 to 35 base pairs long. Each nucleic acid independently contains a complementarity region that is substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3', and, The branched oligonucleotide compound is characterized in that the two or more nucleic acids are linked to each other by one or more parts selected from linkers, spacers, and branching points.
58. The branched oligonucleotide compound according to claim 57, wherein each nucleic acid is independently 15 to 25 base pairs long.
59. The branched oligonucleotide compound according to claim 57, wherein at least one complementary region is substantially complementary to 5' AUAAAGAUUAACCAGAAGAA 3'.
60. The branched oligonucleotide compound according to claim 57, wherein the nucleic acid is a double-stranded (ds)RNA, and each nucleic acid comprises a sense strand and an antisense strand, and each antisense strand comprises a complementarity region substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
61. The branched oligonucleotide compound according to claim 60, wherein each complementary region is complementary to at least 10, 11, 12, or 13 consecutive nucleotides of 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
62. The branched oligonucleotide compound according to claim 60, wherein each complementary region contains three or fewer mismatches with the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
63. The branched oligonucleotide compound according to claim 60, wherein each complementary region is completely complementary to 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'.
64. The branched oligonucleotide compound according to claim 60, wherein the dsRNA of at least one nucleic acid comprises at least one modified nucleotide.
65. The branched oligonucleotide compound according to claim 64, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl modified nucleotides, nucleotides containing a 5'-phosphorothioate group, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, debasalized nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramides, nucleotides containing unnatural bases, and terminal nucleotides bonded to cholesteryl derivatives or bisdecylamide dodecanoate groups.
66. The branched oligonucleotide compound according to claim 60, wherein at least 80% of the dsRNA of at least one nucleic acid is chemically modified.
67. The branched oligonucleotide compound according to claim 60, wherein at least one nucleic acid dsRNA is completely chemically modified.
68. A branched oligonucleotide compound according to claim 60, wherein each nucleic acid comprises a 5' end and a 3' end and is complementary to the target, (1) Nucleic acids consist of alternating 2'-methoxyribonucleotides and 2'-fluororibonucleotides; (2) The nucleotides at positions 2 and 14 from the 5' end are not 2'-methoxyribonucleotides; (3) Nucleotides are linked via phosphodiester or phosphorothioate bonds; and, (4) A branched oligonucleotide compound in which nucleotides from the 1-2 position to the 1-7 position from the 3' end are linked to adjacent nucleotides via phosphorothioate bonds.
69. A branched oligonucleotide compound according to claim 57, comprising nucleic acids 2, 3, 4, 6, or 8.
70. The branched oligonucleotide compound according to claim 57, wherein the nucleic acid is a double-stranded (ds)RNA, each nucleic acid comprises a sense strand and an antisense strand, and each dsRNA is independently bound to a linker, spacer, or branch point at the 3' or 5' end of the sense strand or antisense strand.
71. Each linker is independently selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof; where any carbon or oxygen atom of the linker may be replaced by a nitrogen atom and have a hydroxyl substituent or an oxo substituent, the branched oligonucleotide compound according to claim 57.
72. Equation (I): 【Chemistry 1】 [In formula (I), L is selected from ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof, where formula (I) may further comprise one or more branching points B and one or more spacers S (where, Each instance of B is independently a polyvalent organic species or a derivative thereof; Each instance of S is independently selected from the group consisting of ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof. N is a double-stranded nucleic acid with a length of 15–35 nucleotides, including a sense strand and an antisense strand, where, The antisense strand contains a complementarity region that is substantially complementary to the 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; The sense chain and antisense chain each independently contain one or more chemical modifications; and, n is 2, 3, 4, 5, 6, 7, or 8. The compound shown by [this symbol].
73. Equations (I-1) to (I-9): Table 1 The compound according to claim 72, having a structure selected from the above.
74. The antisense chain, 【Chemistry 2】 The compound according to claim 72, comprising a 5' terminal group R selected from the group consisting of the following.
75. Formula (II): 【Transformation 3】 [In the formula, X is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives each time it appears; - indicates a phosphodiester nucleoside bond; = indicates a phosphorothioate nucleoside bond; and, --- indicates a base pairing interaction or mismatch each time it appears. The compound according to claim 72, having the structure.
76. Formula (III): 【Chemistry 4】 [In the formula, Each instance of X is an independent nucleotide containing a 2'-deoxy-2'-fluoro modification; Each instance of X is independently a nucleotide containing a 2'-O-methyl modification; Y is a nucleotide that independently contains a 2'-deoxy-2'-fluoro modification each time it appears; and, Y is a nucleotide that, each time it appears, independently contains a 2'-O-methyl modification. The compound according to claim 75, having the structure.
77. Formula (IV): 【Transformation 5】 [In the formula, X is independently selected each time it appears from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives; Y is independently selected from adenosine, guanosine, uridine, cytidine, and their chemically modified derivatives each time it appears; - indicates a phosphodiester nucleoside bond; = indicates a phosphorothioate nucleoside bond; and, --- indicates a base pairing interaction or mismatch each time it appears. The compound according to claim 72, having the structure.
78. Formula (V): 【Transformation 6】 [In the formula, Each instance of X is an independent nucleotide containing a 2'-deoxy-2'-fluoro modification; Each instance of X is independently a nucleotide containing a 2'-O-methyl modification; Y is a nucleotide that independently contains a 2'-deoxy-2'-fluoro modification each time it appears; and, Y is a nucleotide that, each time it appears, independently contains a 2'-O-methyl modification. The compound according to claim 77, having the structure.
79. L is structure L1: 【Transformation 7】 The compound according to any one of claims 72 to 78.
80. R is R 3 The compound according to claim 79, wherein n is 2.
81. L is structure L2: 【Transformation 8】 The compound according to any one of claims 72 to 78.
82. R is R 3 The compound according to claim 81, wherein n is 2.
83. Equation (VI): 【Chemistry 9】 [In formula (VI), L is selected from the group consisting of ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof, where formula (VI) may further include one or more branching points B and one or more spacers S (where, Each instance of B is independently a polyvalent organic species or a derivative thereof; Each instance of S is independently selected from the group consisting of ethylene glycol chains, alkyl chains, peptides, RNA, DNA, phosphates, phosphonates, phosphoramides, esters, amides, triazoles, and combinations thereof. Each cNA is a carrier nucleic acid containing one or more chemical modifications; Each cNA independently contains at least 15 consecutive nucleotides in the order 5' AAGAAAAGACCUGAUAAAGAUUAACCAGAAGAAAACAAGGAGGGA 3'; and, n is 2, 3, 4, 5, 6, 7, or 8. A delivery system for therapeutic nucleic acids having the following structure.
84. Equations (VI-1) to (VI-9): Table 2 A delivery system according to claim 83, having a structure selected from the following.
85. The delivery system according to claim 83, wherein each cNA independently comprises a chemically modified nucleotide.
86. The delivery system according to claim 83, further comprising n therapeutic nucleic acids (NAs), wherein each NA is hybridized to at least one cNA.
87. The delivery system according to claim 86, wherein each NA independently comprises at least 16 consecutive nucleotides.
88. The delivery system according to claim 87, wherein each NA independently comprises 16 to 20 consecutive nucleotides.
89. The delivery system according to claim 87, wherein each NA includes at least two unpaired nucleotide protrusions.
90. The delivery system according to claim 89, wherein the nucleotides of the protruding portion are bound via phosphorothioate bonds.
91. The delivery system according to claim 86, wherein each NA is independently selected from the group consisting of DNA, siRNA, antagonist miR, miRNA, gapmer, mixed mer, or guide RNA.
92. A pharmaceutical composition that inhibits the expression of the C9ORF72 gene in a living organism, comprising a branched oligonucleotide compound according to any one of claims 55 to 80 or a delivery system and a pharmaceutically acceptable carrier according to any one of claims 83 to 91.
93. The pharmaceutical composition according to claim 92, wherein the branched oligonucleotide compound or delivery system inhibits the expression of the C9ORF72 gene by at least 50%.
94. The pharmaceutical composition according to claim 92, wherein the branched oligonucleotide compound or delivery system inhibits the expression of the C9ORF72 gene by at least 90%.
95. A method for inhibiting the expression of the C9ORF72 gene within cells, (a) introducing a branched oligonucleotide compound according to any one of claims 57 to 82 or a delivery system according to any one of claims 83 to 91 into a cell; and (b) A method for inhibiting the expression of the C9ORF72 gene in cells, comprising maintaining the cells prepared in step (a) for a time sufficient to obtain the mRNA transcript of the C9ORF72 gene.
96. A method for treating or managing a neurodegenerative disease, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of a branched oligonucleotide compound according to any one of claims 57 to 82 or a delivery system according to any one of claims 83 to 91.
97. The method according to claim 96, wherein a branched oligonucleotide compound or delivery system is administered to the patient's brain.
98. The method according to claim 97, wherein the branched oligonucleotide compound or delivery system is administered by intraventricular (ICV) or intrathecal (IT) injection.
99. The method according to claim 96, wherein administration of a branched oligonucleotide compound or a delivery system causes a reduction in C9ORF72 gene mRNA in the brain.
100. The method according to claim 96, wherein administration of a branched oligonucleotide compound or a delivery system causes a reduction in C9ORF72 gene mRNA in the spinal cord.
101. The method according to claim 96, wherein the branched oligonucleotide compound or delivery system inhibits the expression of the C9ORF72 gene by at least 50%.
102. The method according to claim 96, wherein the branched oligonucleotide compound or delivery system inhibits the expression of the C9ORF72 gene by at least 90%.
103. A branched oligonucleotide compound comprising two nucleic acids, each independently having a length of 15 to 35 base pairs, wherein each nucleic acid comprises a complementarity region substantially complementary to C9ORF72 mRNA, and the two nucleic acids are linked to each other by one or more parts independently selected from the group consisting of linkers, spacers, and branching points.
104. The branched oligonucleotide compound according to claim 103, wherein each nucleic acid independently comprises a complementarity region substantially complementary to the gene region in the C9ORF72 gene described in Table 1, Table 2, Table 3, Table 4, or Table 5.
105. The branched oligonucleotide compound according to claim 103, wherein each nucleic acid is independently single-stranded (ss)RNA or double-stranded (ds)RNA.
106. A dibranched oligonucleotide compound comprising a first guide chain, a second guide chain, a first passenger chain, a second passenger chain, and a linker, The first guide chain and the second guide chain each independently contain a complementarity region substantially complementary to 5' GAUUAACCAGAAGAA 3'; and, The dibranched oligonucleotide compound, wherein the first passenger chain and the second passenger chain are linked to each other via a linker.
107. The dibranched oligonucleotide compound according to claim 106, wherein the first guide chain and the second guide chain each independently contain 5' VP(mU)#(fU)#(mC)(fU)(fU)(fC)(mU)(fG)(mG)(fU)(mU)(fA)(mA)#(fU)#(mC)#(mU)#(mU)#(mU)#(mA)#(fU) 3'.
108. The dibranched oligonucleotide compound according to claim 106, wherein the first passenger chain and the second passenger chain each contain 5' (mG)#(mA)#(fU)(mU)(fA)(mA)(fC)(mC)(fA)(mG)(mA)(mA)(fG)#(mA)#(mA)3'.
109. The linker is selected from the group consisting of ethylene glycol chains, alkyl chains, peptides, RNA oligonucleotides, DNA oligonucleotides, phosphates, phosphonates, phosphoramidates, esters, amides, triazoles, and combinations thereof; The dibranched oligonucleotide compound according to claim 106, wherein any carbon or oxygen atom of the linker may be replaced by a nitrogen atom, may have a hydroxyl substituent, or may have an oxo substituent.
110. The linker is glycerol or formula -O-(CH 2 ) o -CH(OH)-(CH 2 ) p -O-[wherein o and p are integers independently from 1 to about 6] glycerol homolog chains; and -O-(CH 2 ) m -C(O)NH-CH 2 -CH(OH)-CH 2 -NHC(O)-(CH 2 ) m -O-[where m is an integer from 0 to about 10], the dibranched oligonucleotide compound according to claim 106, which is selected from the group consisting of derivatives of 1,3-diamino-2-hydroxypropane.
111. The dibranched oligonucleotide according to claim 106, wherein the 3' end of a first passenger chain is linked to the 3' end of a second passenger chain via a linker.
112. A method for treating or managing a neurodegenerative disease, comprising administering to a patient in need of such treatment or management a therapeutically effective amount of a dibranched oligonucleotide compound according to any one of claims 106 to 111.
113. The method according to claim 112, wherein a dibranched oligonucleotide compound is administered to the patient's brain.
114. The method according to claim 112, wherein the dibranched oligonucleotide compound is administered by intraventricular (ICV) or intrathecal injection.
115. The method according to claim 112, wherein administration of a dibranched oligonucleotide compound causes a reduction in C9ORF72 disease isoform gene mRNA in the brain.
116. The method according to claim 112, wherein administration of a dibranched oligonucleotide compound causes a reduction in C9ORF72 disease isoform gene mRNA in the spinal cord.
117. The method according to claim 112, wherein the dibranched oligonucleotide compound inhibits the expression of the C9ORF72 disease isoform gene by at least 50%.
118. The method according to claim 112, wherein the dibranched oligonucleotide compound inhibits the expression of the C9ORF72 disease isoform gene by at least 90%.