Composition for the treatment of exudative age-related macular degeneration

The use of rAAV8.aVEGF for subretinal delivery of anti-VEGF Fab addresses the need for frequent injections in AMD treatment by providing continuous VEGF inhibition and reducing associated risks.

JP2026090364APending Publication Date: 2026-06-02THE TRUSTEES OF THE UNIV OF PENNSYLVANIA +1

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
Filing Date
2026-02-06
Publication Date
2026-06-02

Smart Images

  • Figure 2026090364000054
    Figure 2026090364000054
  • Figure 2026090364000055
    Figure 2026090364000055
  • Figure 2026090364000056
    Figure 2026090364000056
Patent Text Reader

Abstract

This invention provides a suspension, its use, and a method for treating exudative age-related macular degeneration. [Solution] A liquid suspension product is provided containing recombinant adeno-associated virus (rAAV) having an AAV8 capsid suitable for intraretinal injection. A liquid suspension containing these rAAV8.aVEGFs, as well as a method of using them for the treatment of exudative AMD and other ophthalmic conditions, is also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] Age-related macular degeneration (AMD) is a progressively degenerative macular disease that attacks the macula, the area with the highest visual acuity (VA), and is the leading cause of blindness in Americans over 60 years of age (NIH Medline Plus (2008), Leading cause of blindness, NIH Medline Plus 3(2)14-15, www.nlm.nih.gov / medlineplus / magazine / issues / summer08 / articles / summer08pg14-15.html). The "exudative" type of AMD (nAMD or wet AMD) is characterized by choroidal neovascularization, with significant proliferation of blood vessels and cells, including those of the retinal pigment epithelium (RPE) (Carmeliet (2005) Nature 438: 932-936). Ultimately, photoreceptor death and scarring lead to severe loss of central vision, making it impossible to read, write, recognize faces, or drive. Many patients are no longer able to maintain paid employment, perform daily activities, and consequently report a diminished quality of life (Mitchell and Bradley (2006), Health Qual Life Outcomes 4: 97). Preventive treatments have shown little effect, and treatment strategies have primarily focused on treating neovascular lesions.

[0002] Some currently available treatments for exudative AMD include laser photocoagulation, photodynamic therapy with verteporfin, and intravitreal (IVT) injections of vascular endothelial growth factor (VEGF) inhibitors such as pegaptanib, ranibizumab, bevacizumab, or aflibercept (Schmidt-Erfurth, (2014) Guidelines for the management of neovascular age-related Macular degeneration by the European Society of Retina Specialists (EURETINA) Br J Ophthalmol 98:1144-1167). These treatments have some effect on best corrected visual acuity (BCVA), but their effects are limited in terms of visual recovery and duration (Schmidt-Erfurth, cited above, 2014, AAO PPP (2015) Preferred Practice Patterns: Age Related Macular Degeneration. American Academy of Ophthalmology).

[0003] Several drugs used to treat exudative AMD on the market rely on mechanisms that inhibit VEGF and require intravitreal injection. While these treatments have been reported to be successful in preventing disease progression, they require frequent injections of the drug.

[0004] Specifically, ranibizumab, a recombinant humanized monoclonal IgG1 antigen-binding fragment (Fab), is designed to bind to and inhibit all active forms of human VEGF. Ranibizumab is a humanized monoclonal antibody fragment produced in Escherichia coli using recombinant DNA technology. Ranibizumab's binding to VEGF-A blocks the interaction between VEGF-A and its receptors, VEGFR-1 and VEGFR-2, on the surface of endothelial cells. This binding inhibits endothelial cell proliferation, angiogenesis, and vascular leakage, all of which are thought to contribute to the progression of neovascular "exudative" age-related macular degeneration (Wet AMD). The safety and efficacy of ranibizumab (Lucentis®) have been established, and ranibizumab is approved by the US Food and Drug Administration for IVT injection therapy in patients with neovascular AMD and other retinal diseases. These drugs are approved by the Food and Drug Administration (FDA) (first approved by the FDA in 2006). Long-term treatment with either monthly ranibizumab or monthly / 8-weekly aflibercept may slow the progression of vision loss and improve vision, but neither of these treatments prevents the recurrence of angiogenesis (Brown et al (2006) N Engl J Med, 355:1432-44; Rosenfeld et al., (2006) N Engl J Med 355:1419 31; Schmidt-Erfurth, 2014, cited above). Each needs to be re-administered to prevent disease progression. The need for repeated treatment can create additional risks for the patient and is inconvenient for both the patient and the clinician. [Overview of the Initiative] [Means for solving the problem]

[0005] In one embodiment, the present invention provides a recombinant adeno-associated virus (rAVV) having an AAV8 capsid suitable for subretinal and / or intraretinal injection. The AAV8 capsid packages a vector genome that provides the production of a soluble antigen-binding fragment (Fab) of a human monoclonal antibody (MAb) that binds to and inhibits human vascular endothelial growth factor (hVEGF), the expression product of which is often referred herein as “anti-hVEGF Fab” or “aVEGF”.

[0006] In one embodiment, a liquid suspension suitable for subretinal injection in human subjects is provided. The suspension comprises an aqueous liquid and recombinant adeno-associated virus (rAAV) having an AAV8 capsid, the rAAV comprising a vector genome packaged within the capsid, the vector genome comprising: (a) a terminal inversion sequence (ITR) of the AAV; (b) a coding sequence for an anti-human vascular endothelial growth factor (VEGF) antigen-binding antibody fragment (Fab), comprising an exogenous leader sequence, an immunoglobulin heavy chain, a linker, and an immunoglobulin light chain having an exogenous leader sequence, the coding sequence being operably linked to a regulatory factor that induces the expression of the anti-VEGF Fab in the eye; (c) a regulatory factor that induces the expression of the immunoglobulin heavy and light chains of the anti-VEGF Fab and comprises a promoter selected from a tribeta-actin promoter or a ubiquitin C promoter; and (d) the ITR of the AAV, wherein the suspension comprises 6.2 × 10⁻⁶ 11 Genome copies (GC) / mL, or 1 × 10⁶ 12 The suspension contains 6.4 × 10⁻¹⁶ rAAV. In a particular embodiment, the suspension contains 6.4 × 10⁻¹⁶ rAAV. 11 It contains rAAV8.aVEGF in GC / mL. The use of these compositions for treating humans with age-related macular degeneration is also provided. In certain embodiments, the patient is given 1.6 × 10⁻¹⁶ 11 Administer GC rAAV8.aVEGF / treatment eye. In a specific embodiment, the patient receives 1 × 10 11 Administer GC's rAAV8.aVEGF to the treated eye.

[0007] The vector genome packaged in the rAAV8 capsid includes the following: (a) Terminal inversion sequences (ITR(or)) of AAV adjacent to the anti-hVEGF Fab expression construct; (b) Expression construct having regulatory factors including a tri-β-actin promoter or a ubiquitin C promoter that leads to the expression of the transgene encoding anti-hVEGF Fab in the eye; and (c) Transgenes encoding the heavy and light chains of anti-hVEGF Fab, each chain having a heterogeneous leader sequence attached to its amino terminus, where the coding sequences of the heavy and light chains are separated by a "cleavable" peptide linker coding sequence or IRES (intrasequence ribosome entry site) to ensure separate production of heavy and light chain polypeptides, and having a polyadenylation signal. The resulting transgene expression product may contain amino acid residues in addition to those normally found in the Fab heavy chain.

[0008] In certain embodiments, the codon arrangement of the heavy and light chains is optimized for expression in human cells. The columns are used. As shown in the example, these are AAV2 / 8.CB7.CI.aVEGFv1.rBG;AAV2 / 8.CB7.CI.aVEGFv2.rBG;AAV2 / 8.CB7.CI.aVEGFv3.rBG;AAV2 / 8.CB7.CI.aVEGFv4.rBG;AAV2 / 8.CB7.CI.aVEGFv5.rBG;AAV2 / 8.CB7.CI.aVEGFv6.rBG;AAV2 / 8.CB7.CI.aV This may include, but is not limited to, EGFv7.rBG;AAV2 / 8.CB7.CI.aVEGFv8.rBG;AAV2 / 8.CB7.CI.VEGFv9.rBG;AAV2 / 8.CB7.CI.aVEGFv10.rBG;AAV2 / 8.CB7.CI.aVEGFv11.rBG;AAV2 / 8.CB7.CI.aVEGFv12.rBG;AAV2 / 8.CB7.CI.aVEGFv13.rBG.

[0009] As used herein, "AAV2 / 8" and "AAV8" are interchangeable to refer to recombinant AAVs having a vector genome adjacent to the ITR of AAV8 and AAV2.

[0010] In yet another embodiment, any liquid suspension of rAAV8.aVEGF described herein for subretinal and / or intraretinal injection is provided. The composition comprises an aqueous liquid and rAAV8.aVEGF as described herein, as well as optionally one or more vehicles, preservatives, and / or surfactants.

[0011] In a further embodiment, a method is provided for delivering anti-hVEGF Fab to a patient with exudative age-related macular degeneration. The method comprises subretinal injection into the patient's eye of a liquid suspension containing an rAAV8 vector carrying an expression construct of anti-hVEGF Fab (i.e., rAAV8.anti-hVEGF Fab, or rAAV8.aVEGF).

[0012] In some embodiments, the present invention provides rAAV or a liquid suspension as described herein that can be administered subretinally to a patient. In some embodiments, the use of rAAV or a liquid suspension for subretin administration to a patient is provided. The patient may have been previously diagnosed with exudative age-related macular degeneration or other ocular conditions as defined herein.

[0013] In further embodiments, the product includes: (a) a first container containing rAAV8.anti-hVEGF Fab and an aqueous liquid; (b) an optional second container containing a diluent; and (c) a needle for injection. In some embodiments, the product is an injection kit.

[0014] The present invention is demonstrated by the following example, which shows that subretinal administration of the rAAV8.aVEGF vector results in gene transfer throughout the retina and expression of anti-VEGF Fab throughout the retina, as well as in the vitreous and anterior chamber fluid. This result is remarkable, considering prior art gene therapy studies which demonstrate that gene transfer diffuses horizontally outside the original injection bleb but remains confined to their expanded boundaries, failing to achieve gene transfer and transgene expression outside the expanded region of this injection (the “bleb” formed at the injection site in the retina). A single dose of the rAAV8.aVEGF vector offers advantages over standard treatment for neoplastic AMD (nAMD) in that (i) it results in continuous delivery of an effective amount of VEGF inhibitor throughout the retina, which may improve performance compared to repeated IVT administrations of high-dose bolus VEGF inhibitors that dissipate over time, and (ii) it avoids repeated intraocular injections, which present additional risks and inconveniences to the patient. Each aspect may improve treatment outcomes.

[0015] Further embodiments and advantages of the present invention will become apparent from the following detailed description of the invention. [Brief explanation of the drawing]

[0016] [Figure 1]A schematic diagram of the AAV8 vector genome is presented, containing a gene cassette expressing a human anti-vascular endothelial growth factor (anti-VEGF) antigen-binding antibody fragment (Fab), adjacent to the terminal inversion sequence (ITR) of AAV2. Regulatory factors include the CB7 promoter, consisting of a tri-β-actin promoter and a CMV enhancer, and poly A signals for tri-β-actin and rabbit β-globulin. The nucleic acid sequences encoding the heavy and light chains of anti-VEGF Fab are separated by a self-cleaving furin(F) / F2A linker. A furin-recognition site consisting of an arginine-lysine-arginine-arginine amino acid sequence was used. Due to the furin-mediated cleavage mechanism, anti-VEGF Fab expressed in the vector may contain an arginine(R) residue added to the last position of the heavy chain [SEQ ID NO: 1]. Furthermore, each of the light and heavy chains contains a heterogeneous leader peptide that induces the nascent peptide into the appropriate cellular fraction to process and remove the leader peptide from the mature protein by the host cell's mechanisms. These and other synthetic anti-VEGF constructs are referred to herein as AAV.aVEGF. [Figure 2] The levels and dynamics of AAV8.CB7.aVEGFv1 or rAAV8.UbC.aVEGFv1 expression at various time points after administration to the left eye (os) or right eye (od) are presented. AAV8.CB7.aVEGF-Rv1 is represented by the top line with a closed circle. AAV8.UBC.aVEGF-Rv1 is represented by the bottom line with a closed circle. The middle line with an open circle is AAV8.UBC.aVEGF-Rv1. [Figure 3]Panels A-D show the expression of anti-VEGF Fab in the anterior chamber fluid and blood of cynomolgus monkeys in groups 2 and 3, as described in Example 3, where a single dose of AAV2 / 8 vector at 1.00 × 10¹¹ GC / eye was administered subretinally to each eye. Anterior chamber fluid and blood were collected at pre-set time points. Anti-VEGF Fab expression was measured using enzyme-linked immunosorbent assay. Panels A-B and B show the results for group 2 animals. Panels C and D show the results for group 3 animals. In the panel showing serum results, the horizontal line indicates the baseline level. Circles indicate females, and squares indicate males. Samples were analyzed in duplicate. Results are expressed as mean ± standard deviation. Abbreviations: Fab = fragment antigen binding; GC = genome copy; OD = right eye; OS = left eye; VEGF = vascular endothelial growth factor. [Figure 4] A-D show the expression of anti-VEGF Fab in the anterior chamber fluid and blood of cynomolgus monkeys in groups 5 and 6, as described in Example 3, where a single dose of AAV2 / 8 vector at 1.00 × 10¹¹ GC / eye was administered subretinally to each eye. Anterior chamber fluid and blood were collected at pre-set time points. Anti-VEGF Fab expression was measured using enzyme-linked immunosorbent assay. Results for group 5 are shown in A and B, and results for group 6 are shown in C and D. In B and D, the horizontal line in the panel showing serum results indicates the baseline level. Circles indicate females, and squares indicate males. Samples were analyzed in duplicate. Results are expressed as mean ± standard deviation. Abbreviations: Fab = fragment antigen binding; GC = genome copy; OD = right eye; OS = left eye; VEGF = vascular endothelial growth factor. [Figure 5]Panels A-D show mRNA levels for the AAV8.aVEGF test vector in the retina as measured by RT-qPCR. Cynomolgus monkeys were administered a single dose of either the AAV8.aVEGF test vector or FFB-314 at 1.00 × 10¹² GC / eye subretina of the right eye. mRNA levels for the AAV8.aVEGF test vector were quantified by quantitative reverse transcription polymerase chain reaction (RT-qPCR) in different sections of dissected retina. The left panel depicts an overview of the injection site. The middle panel shows the dissected retina. The right panel depicts mRNA levels for the AAV8.aVEGF test vector (GC per 100 ng of RNA) in four sections of the retina. Abbreviations: BV = major vessel; F = fovea; GC = genomic copy; IB = injection bleb; ID = identification; O = optic disc; UD = not detected [Figure 6] Figures A-D present the expression results of anti-VEGF Fab in the anterior chamber fluid, vitreous humor, and retina (Group 2, Example 6). Cynomolgus monkeys were administered a single dose of the AAV2 / 8 vector at 1.00 × 10¹¹ GC / eye subretina. These data represent the results for the AAV8.aVEGF vector, which differs from those shown in Figures 5A-5D. The concentration of anti-VEGF Fab was measured in four different parts of the anterior chamber fluid, vitreous humor, and retina. The eye was dissected as shown in Figures 5A-5D. In A and C, infrared spectral region optical coherence tomography images of the retina are shown along with the injection site boundaries. In B and D, graphs of anti-VEGF Fab concentrations are presented. In this figure, the results for Group 2 animals of Example 6 are presented. Abbreviations: ACF = anterior chamber fluid; BV = major blood vessels; F = fovea; Fab = fragment antigen binding; FOV = intermediate region including the fovea; GC = genome copy; IB = injection bleb; ID = identification; INF = inferior retinal section; O = optic nerve disc; ODI = intermediate region including the optic nerve disc; SUP = superior retinal section; VEGF = vascular endothelial growth factor; VT = vitreous humor. [Figure 7]Figures A-D present the results of anti-VEGF Fab expression in the anterior chamber fluid, vitreous humor, and retina (Group 3, Example 6). Cynomolgus monkeys were administered a single dose of 1.00 × 10¹¹ GC / eye of the AAV2 / 8 vector subretinally. These data represent the results for the AAV8.aVEGF vector, which differ from those shown in Figures 5A-5D. The concentration of anti-VEGF Fab was measured in four different parts of the anterior chamber fluid, vitreous humor, and retina. The eye was dissected as shown in Figures 5A-5D. In A and C, infrared spectral region optical coherence tomography images of the retina are depicted along with the injection site boundaries. In graphs B and D, the concentration of anti-VEGF Fab is presented. In this figure, the results for Group 3 animals in Example 6 are presented. Abbreviations: ACF = anterior chamber fluid; BV = major blood vessels; F = fovea; Fab = fragment antigen binding; FOV = intermediate region including the fovea; GC = genome copy; IB = injection bleb; ID = identification; INF = inferior retinal section; O = optic nerve disc; ODI = intermediate region including the optic nerve disc; SUP = superior retinal section; VEGF = vascular endothelial growth factor; VT = vitreous humor. [Figure 8] Figures A-D present the results of anti-VEGF Fab expression in the anterior chamber fluid, vitreous humor, and retina (Group 5, Example 6). Cynomolgus monkeys were administered a single dose of 1.00 × 10¹¹ GC / eye of the AAV2 / 8 vector subretinally. These data represent the results for the AAV8.aVEGF vector, which differ from those shown in Figures 5A-5D. The concentration of anti-VEGF Fab was measured in four different parts of the anterior chamber fluid, vitreous humor, and retina. The eye was dissected as shown in Figures 5A-5D. In A and C, infrared spectral region optical coherence tomography images of the retina are depicted along with the injection site boundaries. In graphs B and D, the concentration of anti-VEGF Fab is presented. In this figure, the results for Group 5 animals of Example 6 are presented. Abbreviations: ACF = anterior chamber fluid; BV = major blood vessels; F = fovea; Fab = fragment antigen binding; FOV = intermediate region including the fovea; GC = genome copy; IB = injection bleb; ID = identification; INF = inferior retinal section; O = optic nerve disc; ODI = intermediate region including the optic nerve disc; SUP = superior retinal section; VEGF = vascular endothelial growth factor; VT = vitreous humor. [Figure 9] Present a flowchart of the manufacturing process. [Figure 10] Panels A–D show the results of the rcAAV assay for AAV8. wtAAV8 was spiked in AAV vectors with different GC counts, and the cap gene copy number per 1 μg of 293 cells of DNA was measured after three successive passages of cell lysates into new cells. Three different spike levels of wtAAV8 [one level per panel: 1 × 10² GC (Figure 10A), 1 × 10³ GC (Figure 10C), and 1 × 10⁴ GC (Figure 10D)], four different vector amounts [0 GC (rhomboid), 1 × 10⁹ GC (square), 1 × 10¹⁰ GC (triangle), and 1 × 10¹¹ GC (indicated by X)] are shown, and the background level is shown (control, Figure 10B). [Figure 11] Figures A-E provide long-term expression of rAAV8.aVEGF. Cynomolgus monkeys were assigned to four treatment groups, each administered with a different AAV2 / 8 anti-VEGF Fab vector. Animals shown in A-D received a single dose of 1.00 × 10¹¹ GC / eye of the AAV2 / 8 vector in a total volume of 100 μL. The vector was administered subretinically to both eyes. Anterior chamber fluid was collected at pre-determined time points. Anti-VEGF Fab expression was determined by ELISA. Figures A-D show the long-term expression profiles of all four vectors, with D representing rAAV8.aVEGF. Circles indicate females, and squares indicate males. Results are shown as mean (ng / ml) ± standard deviation. In figure E, cynomolgus monkeys were administered a single dose of either 1.00 × 10¹² GC / eye, 1.00 × 10¹¹ GC / eye, or 1.00 × 10¹⁰ GC / eye in a total volume of 100 μL. The vector was administered subretinically. Anterior chamber fluid was collected at pre-determined time points. Anti-VEGFFab expression was determined by ELISA. E shows comparative expression with high, moderate, and low doses of rAAV8.aVEGF. Two high-dose NHP regimens, in which detectable transgene expression was lost, correlated with the development of an antibody response to the human transgene product. [Figure 12]A and B provide retinal function of eyes injected with rAAV8.aVEGF. Retinal function was assessed using whole-field ERG at baseline and 3 months after rAAV8.aVEGF treatment. ERG sessions were performed under dim red light conditions. Whole-field stimulation was generated using a custom-made Ganzfeld stimulator lined with aluminum foil and an LED emitter mounted on its floor. The light source was calibrated using an ILT5000 photometer (International Light Technologies (Peabody, MA)). A Diagnosys LLC (Lowell, MA) Espion workstation controlled the stimulator and obtained signals. ERGs were recorded with bipolar Burian-Allen electrodes (Hansen Labs, Coralwille, IA). B shows no statistically significant change between the control (FFB-314) and the low dose (1.00 × 10¹⁰ GC / eye). However, compared to control and low-dose animals, animals treated with high doses (1.00 × 10¹² GC / eye) of rAAV8.aVEGF showed a statistically significant decrease in retinal function. [Figure 13] Figures A-D show the transduction of retinal layer cells and mRNA distribution in eyes injected with rAAV8.aVEGF. Localization of mRNA encoding anti-VEGF Fab and mRNA expressed after subretinal injection of AAV2 / 8 vector into cynomolgus monkeys (determined by in-situ hybridization) are shown in A and B (cell nuclei contrasting with the expressed mRNA are shown in red, in green). Figure A shows transduction of cells within the retinal layer, including RPE cells, photoreceptor cells, and ganglion cells. Figure B shows the mRNA expression gradient after separation from the injection site. Figure C shows a typical retinal anatomy. The schematic diagram on the left shows a map of the injection bleb, the photograph in the center shows how the retina was dissected, and the schematic diagram on the right lists the segments of the dissected retina (1-upper, 2-foveal region, 3-optic nerve disc region, 4-lower). Figure D provides quantitative distribution of transgene mRNA via RT-qPCR, providing quantitative data to support the qualitative observations in Figure B. Note that in some animals, injections were administered to both the upper and lower retina. [Figure 14] This report provides the protein distribution in eyes injected with rAAV8.aVEGF. The concentration of anti-VEGF Fab was determined in four different sections of anterior chamber fluid, vitreous fluid, and retina. Infrared SD-OCT retinal images show the visible boundaries of the injection sites. Bar graphs show the concentrations of anti-VEGF Fab as measured by VEGF ELISA. Anti-VEGF Fab was injected into animals using an AAV2 / 8 vector expressing 1.00 × 10¹¹ GC / eye. [Figure 15]The images provide retinal structures within the injected area. Frontal view (left panel): Near-infrared (NIR) fundus autofluorescence (FAF) images resulting from the excitation of melanin fluorophores within the retinal pigment epithelium (RPE) show representative post-injection animals. The contours of the retinal vascular system and optic disc are shown as dark images against a normal grayish NIR-FAF background. Arrows indicate the transition zone between the demelanized (dark) area near the center of the injected retina and the retina with a normal or near-normal NIR-FAF appearance. The demelanized retina corresponds to the injection site used to inject the vector into the subretinal space, or the area closest to the retinotomy, and on average occupied about one-third of the entire injected area. Given the relative unpredictability of subretinal fluid migration after subretinal injection, the pre-injection extent shown in the images was extensive but did not extend to the peripheral areas reached by the resulting larger blebs or retinal elevation. Thickness Topography (Mid-Panel): Overlapping raster scan patterns are used to determine the overall retinal thickness topography from the region of interest (ROI) within the injected retina corresponding to the pre-injection site in the same area. Images are registered and rotated or moved so that vascular landmarks overlap. Thickness is mapped to a pseudo-color scale (bottom row). Arrows indicate the transition area between the demelanized retina within the bleb and the normal retina identified by NIR-FAF. Thin green lines and arrows indicate the direction of the SD-OCT cross-section, and the segments overlap in position with the pre- and post-injection images. Cross-sectional Imaging (Right Panel): 1.5 mm SD-OCT cross-section obtained from the injection area after injection, compared with the pre-injection image. Vascular elements (stars) are used to adjust the pre- and post-injection images. Nuclear layers are labeled (GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer). We also label the distal structures of the ONL that are consistently identified in these locations in the central retina (EZ = elliptic zone, RPE = retinal pigment epithelium, BrM = Bruch's membrane). Scale bars are at the bottom and left; T = temporal; N = nasal retina. [Figure 16]This provides SD-OCT quantification. For each set of bars, the bars from left to right represent the results for high dose (black), medium dose (dark gray), low dose (medium gray), injected control (light gray), and uninjected control (white bar). SD-OCT images at ROIs for pre- and post-injected eyes and uninjected controls were segmented using an automated segmentation algorithm built into an OCT system (Heidelberg Engineering GmbH, Heidelberg, Germany) with manual monitoring to ensure proper identification of the retinal border. All injections were directed either upward or downward towards the optic disc, but there was variability between the area covered by the subretinal bleb and the exact retinal region across different experiments. To facilitate comparison, for experiments using pre- and post-injection imaging (high-dose, low-dose, and uninjected control), values ​​are expressed as the ratio of each parameter to the baseline thickness value of each animal, or, for experiments without baseline imaging (medium-dose group), as the ratio of normal thickness at specific locations along the vertical path. Bars represent the mean for each group, and error bars are 2SD. Each NHP measurement is plotted with a separate sign. Inter-visit variability of each OCT parameter in the uninjected control eye helps establish the significance of the change. The 99th percentile of the variability estimate was used to define significant post-injection changes for each parameter (horizontal dashed line). Eyes injected with low dose and control did not show significant differences in total retinal thickness (TRT) compared to the vehicle-injected control, but thinning of TRT within the injection area was observed in the high-dose (9%) and medium-dose (24%) groups. Thinning of the outer nucleus layer (ONL) was observed only in the high-dose (33%) and medium-dose (18%) groups. However, in all dose groups (high-dose = 51%, medium-dose = 20%, low-dose = 17%), the elliptic zone (EZ)-Brook's membrane (BrM) was reduced in the injected area; no significant changes were observed in the injected control compared to the uninjected eye. The thickness of the retina's interior showed significant thinning in one animal in the high-dose group.In some animals in the high-dose and medium-dose groups, non-significant thickening of the retina was observed after injection. Overall retinal thickness was significantly thinner in most animals in the medium-dose group. [Figure 17] Figures A and B provide representative whole-field flash ERGs recorded in cynomolgus monkeys 3 months after LD or HD delivery of AAV8 anti-VEGF Fab, demonstrating that low-dose (LD, 1E+10vg / eye) injection does not alter the ERGs of rod and cone photoreceptor cells. See Example 13 for details. Figure A shows the ERGs of rod and cone photoreceptor cells, primarily rod photoreceptor cells, induced by 3cd s m-2 flash in dark-adapted animals. Figure B shows the ERGs of cone photoreceptor cells induced by 3cd s m-2 flash in light-adapted animals. [Figure 18] A and B provide representative whole-field flash ERGs recorded in cynomolgus monkeys 3 months after LD or HD delivery of AAV8 anti-VEGF Fab, showing that high-dose (HD, 1E+12vg / eye) injection suppresses both rod photoreceptor cells, and cone photoreceptor ERGs at 1E+12vg / eye show toxicity of the active ingredient. See Example 13 for details. A shows rod-cone photoreceptor ERGs, mainly rod photoreceptor ERGs, induced by 3cd s m-2 flash in dark-adapted animals. B shows cone photoreceptor ERGs induced by 3cd s m-2 flash in light-adapted animals. [Figure 19] A and B provide quantitative data on the effect of subretinal delivery of AAV8 anti-VEGF Fab at a low dose (1E+10vg / eye) on the magnitude of whole-field flash ERG induced at the "standard" (3cd s m-2) in cynomolgus monkeys. Columns and error bars represent the mean and standard error, respectively. A provides the results for wave a, mainly photoreceptor signaling. B provides the results for wave b, mainly bipolar cell signaling. Statistical significance was determined by performing Student's paired I test between ERG magnitudes recorded from the left eye (non-injected) and the right eye (injected). *: p<0.1; **: p<0.05. See Example 13 for details. [Figure 20]A and B provide quantitative data on the effect of subretinal delivery of high-dose (1E+12vg / eye) AAV8 anti-VEGF Fab on the magnitude of whole-field flash ERG induced at the "standard" (3cd s m-2) in cynomolgus monkeys. Columns and error bars represent the mean and standard error, respectively. A provides the results for wave a, mainly photoreceptor signaling. B provides the results for wave b, mainly bipolar cell signaling. Statistical significance was determined by performing Student's paired I test between ERG magnitudes recorded from the left eye (non-injected) and the right eye (injected). *: p<0.1; **: p<0.05. See Example 13 for details. [Figure 21] This image shows a representative SD-OCT cross-section of the non-injected retina (white arrow indicated by the solid line on the left) of an eye injected with the vehicle. A comparison was made between a segment within the injected retina where no significant decrease in NIR autofluorescence for NIR-FAF was observed (white arrow indicated by the dashed line in the center) and a segment within the injected retina where the decrease was observed (arrow indicated by the dotted line on the right). The colored segments superimposed on the NIR-FAF image indicate the positional segments shown in the SD-OCT cross-section (data not shown). The animal shown here is the vehicle control. For details, please refer to Example 14. [Figure 22] The image provides the longitudinal reflectance profile (LRP) of a segment within an SD-OCT cross-section of a normal IZ signal (waveform on the left, segment indicated by the dashed arrow), compared to a section of low autofluorescence retina showing attenuation or loss of the IZ signal. See Example 14 for details. [Modes for carrying out the invention]

[0017] Recombinant replication-deficient adeno-associated virus (rAAV) vectors having an AAV8 capsid and compositions comprising the same are suitable for subretinal injection for delivery of anti-VEGF antibody-conjugated fragments (Fab). Compositions comprising the same, and in particular a liquid aqueous suspension, are also provided. In certain embodiments, the suspension is 6.2 × 10⁻⁶ 11Contains rAAV8.aVEGF at genomic copies (GC) / mL. In certain embodiments, the suspension is, or, 1×10 12 Contains rAAV8.aVEGF at GC / mL. In certain embodiments, the suspension is 6.4×10 11 Contains rAAV8.aVEGF at GC / mL. Use of those compositions is also provided. In certain embodiments, a patient receives administration of 1.6×10 11 GC of rAAV8.aVEGF / treated eye. In certain embodiments, a patient receives administration of 1×10 11 GC of rAAV8.aVEGF / treated eye.

[0018] The rAAV8 vector is designed to express an anti-VEGF antibody binding fragment (Fab) in mammals, and more particularly in human cells. These anti-VEGF Fabs are particularly well-suited for the treatment of age-related macular degeneration (AMD). For convenience, these vectors are referred to as rAAV8.AMD. As described herein, a series of novel AAV8.aVEGF constructs have been developed that demonstrate high yields, expression levels, and / or activities.

[0019] The present invention is demonstrated by the following example, which shows that subretinal administration of the rAAV8.aVEGF vector results in gene transfer throughout the retina and expression of anti-VEGF Fab throughout the retina, as well as in the vitreous and anterior chamber fluid. This result is remarkable, considering prior art gene therapy studies which demonstrate that gene transfer diffuses horizontally outside the original injection bleb but remains confined to their expanded boundaries, failing to achieve gene transfer and transgene expression outside the expanded region of this injection (the “bleb” formed at the injection site in the retina). A single dose of the rAAV8.aVEGF vector offers advantages over standard treatment for nAMD in that (i) it results in continuous delivery of an effective amount of VEGF inhibitor throughout the retina, which may improve performance compared to repeated IVT administrations of high-dose bolus VEGF inhibitors that dissipate over time, and (ii) it avoids repeated intraocular injections, which present additional risks and inconveniences to the patient. Each aspect may improve treatment outcomes.

[0020] The present invention provides a construct encoding a novel anti-VEGF Fab having at least the heavy chain amino acid sequence of SEQ ID NO: 1 and the light chain amino acid sequence of SEQ ID NO: 2, each modified to have an exogenous leader sequence for the heavy chain and the light chain, respectively. In one construct shown herein, the leader sequence is derived from a human IL2 leader. Furthermore, in one construct shown in the examples, the heavy chain and light chain are separated by a furin / F2a linker, which may result in one or more additional amino acids being added to the heavy chain [SEQ ID NO: 1]. In one embodiment, a single arginine [R] is added to the heavy chain. However, in one embodiment, a different linker is selected, and / or a different system may result in no additional amino acids at all, or in any case in any of the cases [e.g., R, Lys(K), RK, RKR, RKRR]. In a previous provisional application, the resulting construct was named aVEGF-R in the specification. However, for clarity, these constructs encoding anti-VEGF Fab transgene products described herein are referred to as anti-VEGF Fab, aVEGF, anti-hVEGF, anti-human VEGF, or anti-VEGF This is called a Fab transgene product. In the construct encoding this transgene product, the number following the term aVEGF, for example aVEGFv1, aVEGFv2, aVEGFv3 through aVEGFv13, refers to a different nucleic acid that encodes the sequence for the open reading frame of the immunoglobulin heavy and light chains.

[0021] In one embodiment, the amino acid sequence of anti-VEGF Fab has 513 amino acids, and anti-VEGF includes a heavy chain and a light chain separated by additional amino acids as a result of a linker. For example, each of the following expression cassettes encodes the same anti-VEGF heavy chain and light chain, but in one embodiment there may be one amino acid added to the last position of the heavy chain. In yet another embodiment there may be two, three, four or more additional amino acids that bind to the heavy chain. For example, in one embodiment the nucleic acid sequences encoding the heavy chain and light chain of anti-VEGF Fab are separated by a self-cleaving furin(F) / F2A linker. A furin recognition site consisting of an arginine-lysine-arginine-arginine amino acid sequence may be used. Due to the mechanism of furin-mediated cleavage, the anti-VEGF Fab expressed by the vector may include an additional arginine(R) residue added to the last position of the heavy chain [SEQ ID NO: 1]. In other embodiments, the anti-VEGF Fab expressed by the vector may contain a dipeptide, arginine-lysine, a tripeptide, arginine-lysine-arginine, or a polypeptide, arginine-lysine-arginine-arginine at the end of the heavy chain. In some embodiments, the anti-VEGF Fab expressed by the vector is a heterogeneous mixture of two or more of these Fab products. Other furin cleavage sites (arginine-XX-arginine, or arginine-X-lysine, or arginine-arginine) can also be used, which may also result in C-terminal heterogeneity. In other words, other vectors The anti-VEGF Fab expressed by the ter may be a heterogeneous collection of Fabs, where the heavy chain has 0, 1, 2, 3, or 4 amino acids at its C-terminus as a result of linker treatment. Furthermore, each of the light and heavy chains contains a heterogeneous leader peptide that induces the nascent peptide into a suitable cellular fraction that processes and removes the leader peptide from the mature protein by the host cell's mechanisms. In other embodiments, there may be 2, 3, 4, or more additional amino acids. In some embodiments, the anti-VEGF Fab does not contain any HC or LC leader sequences at all. See, for example, SEQ ID NO: 33.

[0022] In one embodiment, the heavy chain of anti-VEGF Fab has the amino acid sequence of residues 21-252 of SEQ ID NO: 33 together with the leader sequence. In another embodiment, the light chain of anti-VEGF Fab has the amino acid sequence of residues 300-513 of SEQ ID NO: 33 together with the leader sequence. For example, the leader sequence may be about 15-25 amino acids, preferably about 20 amino acids. In one embodiment, the leader has the amino acid sequence of amino acids 1-20 of SEQ ID NO: 33.

[0023] In one embodiment, the coding sequences of the heavy and light chains of anti-VEGFv1 are presented in SEQ ID NO: 24. More specifically, referring to SEQ ID NO: 24, the open reading frame (ORF) of the heavy chain variable region is presented at nucleotides (nt) 1843-2211, and the ORF of the heavy chain constant region (CH1) is presented at nt 2212-2532. Thus, the heavy chain of aVEGFv1 without a leader has the nucleic acid sequence nt 1843-2532. The ORF of the light chain variable region (VL) is presented at nt 2680-3000 in SEQ ID NO: 24, and the light chain constant region (CL) is presented at nt 3001-3321 in SEQ ID NO: 24. Thus, the light chain of aVEGFv2 without a leader has the nucleic acid sequence nt 2680-3321 in SEQ ID NO: 24.

[0024] In another embodiment, the coding sequences of the heavy and light chains of anti-VEGFv2 are presented in SEQ ID NO: 3. More specifically, the ORF of VH is presented at nt2059-2427 of SEQ ID NO: 3, CH1 is presented at nt2428-2748 of SEQ ID NO: 3, and the leaderless heavy chain has the nucleic acid sequence at nt2059-2748 of SEQ ID NO: 3. The ORF of VL is presented at nt2896-3216 of SEQ ID NO: 3, CL is presented at nt3217-3536 of SEQ ID NO: 3, and the leaderless light chain has the nucleic acid sequence at nt2896-3536 of SEQ ID NO: 3.

[0025] In yet another embodiment, the coding sequences of the heavy and light chains of aVEGFv3 are presented in SEQ ID NO: 19. The ORF of VH is presented at nt1842-2210 of SEQ ID NO: 19, CH1 is presented at nt2211-2531 of SEQ ID NO: 19, and the leaderless heavy chain has the nucleic acid sequence at nt1842-2531 of SEQ ID NO: 19. The ORF of VL is presented at nt2679-2999 of SEQ ID NO: 19, CL is presented at nt3000-3320 of SEQ ID NO: 19, and the leaderless light chain has the nucleic acid sequence at nt2670-3320 of SEQ ID NO: 19.

[0026] In a further embodiment, the coding sequences for the heavy and light chains of aVEGFv4 are presented in SEQ ID NO: 35. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 35, the ORF for VH is located in nt2053-2421 of SEQ ID NO: 35, and CH1 is located in nt2422-2742 of SEQ ID NO: 35. As in other constructs described herein, sequences coding for additional amino acids may remain on the VH chain as a result of the placement of the F2A cleavage site. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 35, the ORF for VL is presented in nt2890-3210 of SEQ ID NO: 35, and the ORF for CL is located in nt3211-3531 of SEQ ID NO: 35.

[0027] In further embodiments, the coding sequences for the heavy and light chains of aVEGFv5 are presented in SEQ ID NO: 36. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 36, the VH ORF is coded in nt2053-2421 of SEQ ID NO: 36, and CH1 is coded in nt2422-2742 of SEQ ID NO: 36. As in other constructs described herein, sequences coding for additional amino acids may remain on the VH chain as a result of the placement of the F2A cleavage site. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 36, the VL ORF is presented in nt2890-3210 of SEQ ID NO: 36, and the CL ORF is located in nt3211-3531 of SEQ ID NO: 36.

[0028] In further embodiments, the coding sequences for the heavy and light chains of aVEGFv6 are presented in SEQ ID NO: 37. The heavy chain leader sequence is coded in nt1993-2051 of SEQ ID NO: 37, the VH ORF is coded in nt2053-2421 of SEQ ID NO: 37, and CH1 is coded in nt2422-2742 of SEQ ID NO: 37. As in other constructs described herein, sequences coding for additional amino acids may remain on the VH chain as a result of the placement of the F2A cleavage site. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 37, the VL ORF is presented in nt2890-3210 of SEQ ID NO: 37, and the CL ORF is located in nt3211-3531 of SEQ ID NO: 37.

[0029] In a further embodiment, the coding sequences for the heavy and light chains of aVEGFv7 are presented in SEQ ID NO: 38. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 38, the VH ORF is coded in nt2053-2421 of SEQ ID NO: 38, and CH1 is coded in nt2422-2742 of SEQ ID NO: 38. As in other constructs described herein, additional Arg codons remain on the VH chain as a result of the placement of the F2A cleavage site. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 38, the VL ORF is presented in nt2890-3210 of SEQ ID NO: 38, and the CL ORF is located in nt3211-3531 of SEQ ID NO: 38.

[0030] In a further embodiment, the coding sequences for the heavy and light chains of aVEGFv8 are presented in SEQ ID NO: 39. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 39, the VH ORF is coded in nt205-2421 of SEQ ID NO: 39, and CH1 is coded in nt2422-2742 of SEQ ID NO: 39. As in other constructs described herein, additional Arg codons remain on the VH chain as a result of the placement of the F2A cleavage site. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 39, the VL ORF is presented in nt2890-3210 of SEQ ID NO: 39, and the CL ORF is located in nt3211-3531 of SEQ ID NO: 39.

[0031] In a further embodiment, the coding sequences for the heavy and light chains of aVEGFv9 are presented in SEQ ID NO: 40. The heavy chain leader sequence is coded in nt1999-2058 of SEQ ID NO: 40, the VH ORF is coded in nt2059-2427 of SEQ ID NO: 40, and CH1 is coded in nt2428-2748 of SEQ ID NO: 40. As in other constructs described herein, additional Arg codons remain on the VH chain as a result of the placement of the F2A cleavage site. The light chain leader sequence is coded in nt2836-2895 of SEQ ID NO: 40, the VL ORF is presented in nt2896-3216 of SEQ ID NO: 40, and the CL ORF is located in nt3217-3637 of SEQ ID NO: 40.

[0032] In a further embodiment, the coding sequences of the heavy and light chains of aVEGFv10 are presented in SEQ ID NO: 41. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 41, the ORF of VH is coded in nt2053-2421 of SEQ ID NO: 41, and CH1 is coded in nt2422-2742 of SEQ ID NO: 41. As in other constructs described herein, additional Arg codons are obtained as a result of the arrangement of the F2A cleavage site. It remains in the VH strand. The light strand leader sequence is encoded in nt2830~2889 of SEQ ID NO: 41, the VL ORF is presented in nt2890~3210 of SEQ ID NO: 41, and the CL ORF is located in nt3211~3231 of SEQ ID NO: 41.

[0033] In a further embodiment, the coding sequences of the heavy and light chains of aVEGFv11 are presented in SEQ ID NO: 42. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 42, the ORF of VH is coded in nt2053-2421 of SEQ ID NO: 42, and CH1 is coded in nt2422-2742 of SEQ ID NO: 42. As in other constructs described herein, the F2A cleavage site is located between the end of the heavy chain and the beginning of the light chain. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 42, the ORF of VL is presented in nt2890-3210 of SEQ ID NO: 42, and the ORF of CL is located in nt3211-3531 of SEQ ID NO: 42.

[0034] In a further embodiment, the coding sequences of the heavy and light chains of aVEGFv12 are presented in SEQ ID NO: 43. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 43, the ORF of VH is coded in nt2053-2421 of SEQ ID NO: 43, and CH1 is coded in nt2422-2742 of SEQ ID NO: 43. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 43, the ORF of VL is presented in nt2890-3210 of SEQ ID NO: 43, and the ORF of CL is located in nt3211-3531 of SEQ ID NO: 43.

[0035] In a further embodiment, the coding sequences of the heavy and light chains of aVEGFv13 are presented in SEQ ID NO: 44. The heavy chain leader sequence is coded in nt1993-2052 of SEQ ID NO: 44, the ORF of VH is coded in nt2053-2421 of SEQ ID NO: 44, and CH1 is coded in nt2422-2742 of SEQ ID NO: 44. The light chain leader sequence is coded in nt2830-2889 of SEQ ID NO: 44, the ORF of VL is in nt2890-3210 of SEQ ID NO: 44, and the ORF of CL is located in nt3211-3531 of SEQ ID NO: 44.

[0036] Ranibizumab, described herein as a positive control, is currently marketed under the trade name Lucentis®. It is described as the Fab portion of the high-affinity version of the recombinant humanized monoclonal antibody rhuMAb vascular endothelial growth factor (VEGF). It consists of a 214-residue light chain linked by a disulfide bond at its C-terminus to the N-terminus of a 231-residue heavy chain. The predicted amino acid sequences of the heavy and light chains are presented in SEQ ID NOs: 1 and 2. CAS number 347396-82-1.

[0037] As used herein, “immunoglobulin domain” refers to a domain of the heavy or light chain of an antibody, as defined with reference to a typical full-length antibody. More specifically, a full-length antibody comprises a heavy (H) chain polypeptide containing four domains: one N-terminal variable (VH) region and three C-terminal constant (CH1, CH2, and CH3) regions, and a light (L) chain polypeptide containing two domains: one N-terminal variable (VL) region and one C-terminal constant (CL) region. The Fc region may contain two domains (CH2-CH3). The Fab region contains one constant domain and one variable domain for the heavy chain and light chain, respectively.

[0038] In one embodiment, the rAAV.aVEGF vector comprises an AAV8 capsid and a vector genome packaged therein that contains at least one element heterogeneous with respect to AAV8. In one embodiment, the vector genome has, from 5' to 3', (a) the 5' ITR of AAV, (b) an enhancer, (c) a promoter, (d) an intron, (e) a leader sequence and an anti-VEGF heavy chain coding sequence, (f) a fluyn-F2a linker, and (g) a leader - Includes the sequence and anti-VEGF light chain coding sequence, (h) poly(A) signal, and (i) the 3'ITR of AAV.

[0039] In one embodiment, the processing of the heavy and light chains of anti-VEGF Fab is induced by a leader peptide derived from the human IL2 protein. In one embodiment, the leader sequence is the interleukin (IL) IL-2 leader sequence, which may be wild-type human IL2MYRMQLLSCIALSLALVTNS[SEQ ID NO: 29] or a mutated leader such as MYRMQLLLLIALSLALVTNS[SEQ ID NO: 30] or MRMQLLLLIALSLALVTNS[SEQ ID NO: 31]. In another embodiment, the secretion signal of human serpine F1 may be used as the leader peptide. Other leader sequences, or other leaders that are exogenous to the heavy and light chains, may be used.

[0040] When used in the following descriptions of vector genomes, unless otherwise specified as light or heavy chain, references to coding sequences (e.g., aVEGFv2) encompass the heavy chain of anti-VEGF - furin / F2a linker - light chain of anti-VEGF. In some embodiments, a nucleic acid sequence encoding the furin recognition site, arginine-lysine-arginine-arginine, is selected. In some embodiments, a nucleic acid encoding the F2A linker, which is a 24-amino acid peptide derived from FMDV (GenBank number CAA2436.1), is selected. However, if desired, an IRES sequence such as that derived from encephalomyocarditis virus (EMCV): Sequence ID 32: [TATGCTAGTACGTCTCTCAAGGATAAGTAAGTAATATTAAGGTACGGGAGGTATTGGACAGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTGGCCTAACTGGCCGGTACCTGAGCTCTAGTTTCACTTTCCCTAGTTTCACTTTCCCTAGTTTCACTTTCCCTAGTTTCACTTTCCCTAGTTTCACTTTCCCCTCGAGGATATCAAGATCTGGCCTCGGCGGCCAG], cMyc [Nanbru C, et al (1997). J. Biol. Chem. 272, 32061-32066; Stoneley M, [et al., (1998). Oncogene 16, 423-428.] or those derived from foot-and-mouth disease (FMD) may be selected.

[0041] A terminal inversion sequence (ITR) derived from AAV2 may be selected. A vector having an ITR derived from a different source than its capsid is called a "falsetype". In some embodiments, an ITR derived from a different source than AAV2 may be selected for this construct to produce a different falsetype AAV. Alternatively, an ITR derived from the same source as the capsid may be selected. In some embodiments, an ITR may be selected to produce a self-complementary AAV as defined below.

[0042] In one embodiment, the promoter is CB7, i.e., a hybrid of the cytomegalovirus (CMV) initial enhancer (C4) and the tri-β-actin promoter. In another embodiment, the promoter is the ubiquitin C (UbC) promoter. See, for example, WO2001 / 091800. See, for example, GenBank® accession numbers AF232305 (rat) and D63791 (human), respectively. Further other promoters and / or enhancers may be selected. See, for example, the cytomegalovirus (CMV) initial enhancer (260 bp, C4, GenBank number K03104.1) and the tri-β-actin promoter (281 bp, CB, GenBank number X00182.1). Further embodiments may include multiple enhancers and / or promoters.

[0043] In some embodiments, an intron is included. One preferred intron is the tri-β-actin intron. In some embodiments, the intron is 875 bp (GenBank number X00182.1). In other embodiments, a chimeric intron available from Promega is used. However, other preferred introns may also be selected.

[0044] The vector genomes described herein include a polyadenylation signal (polyA). Various suitable polyA sequences are known. In one example, the polyA is rabbit β-globin, such as the 127 bp rabbit β-globin polyadenylation signal (GenBank number V00882.1). In other embodiments, the SV40 polyA signal is selected. Further suitable polyA sequences may also be selected. Optionally, other suitable vector factors may be selected, for example, including UTR sequences or Kozak sequences.

[0045] In one embodiment, the vector genome includes ITR-CB7-CI-aVEGFv2-rBG-ITR [SEQ ID NO: 3]. In another embodiment, the vector genome includes ITR-UbC-CI-aVEGFv2-SV40-ITR [SEQ ID NO: 9]. In one embodiment, the vector genome includes ITR-CB7-CI-aVEGFv3-rBG-ITR [SEQ ID NO: 14]. In another embodiment, the vector genome includes ITR-UbC-PI-aVEGFv3-SV40-ITR [SEQ ID NO: 19]. In yet another embodiment, the vector genome includes ITR-UbC-PI-aVEGFv1-SV40-ITR [SEQ ID NO: 24]. In a further embodiment, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv4.rBG-AAV2 ITR [SEQ ID NO: 35]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv5.rBG-AAV2 ITR [SEQ ID NO: 36]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv6.rBG-AAV2 ITR [SEQ ID NO: 37]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv7.rBG-AAV2 ITR [SEQ ID NO: 38]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv8.rBG-AAV2 ITR [SEQ ID NO: 39]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv9.rBG-AAV2 ITR [SEQ ID NO: 40]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv10.rBG-AAV2 ITR [SEQ ID NO: 41]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv11.rBG-AAV2 ITR [SEQ ID NO: 42]. In further embodiments, the vector genome includes AAV2-ITR-CB7.CI.aVEGFv12.rBG-AAV2 ITR [SEQ ID NO: 43]. In further embodiments, the vector genome includes AAV2 ITR-CB7.CI.aVEGFv13.rBG-AAV2 ITR [see SEQ ID NO: 44].In a further embodiment, the vector genome includes AAV2 ITR-CMV.PI.aVEGFv7.eCMVIres.aVEGF.SV40-AAV2 ITR [SEQ ID NO: 45]. In another embodiment, the vector genome includes AAV2 ITR.CMV.PI.aVEGF.FMDV1IRES.SV40-ITR [SEQ ID NO: 46]. In yet another embodiment, the vector genome includes AAV2 ITR.CMV.PI.aVEGF.cMycIRES.Fab.SV40-ITR [SEQ ID NO: 47].

[0046] For use in the preparation of AAV virus vectors (e.g., recombinant(r)AAV), the expression cassette can be immobilized on any suitable vector, such as a plasmid, to be delivered to a packaging host cell. Plasmids useful in the present invention can be modified to be suitable for replication and packaging in prokaryotic cells, mammalian cells, or both. Suitable transfection techniques and packaging host cells are known to those skilled in the art and / or can be readily designed by those skilled in the art.

[0047] Methods for generating and isolating AAVs suitable for use as vectors are known in the art. Generally, see, for example, Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem.Engin / Biotechnol.99:119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J.Gene Med.10:717-733; and the references cited below, each incorporated in its entirety as forming part of this specification. For packaging the transgene into a virion, the ITR is the only AAV component required in cis form in the same construct as the nucleic acid molecule containing the expression cassette. The cap gene and rep gene can be supplied in trans form.

[0048] In some embodiments, the expression cassette described herein is manipulated to contain a genetic element (e.g., a shuttle plasmid) that introduces an immunoglobulin construct sequence to be carried thereon for viral vector production into packaging host cells. In some embodiments, the selected genetic element may be delivered to AAV packaging cells by any preferred method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA coated pellets, viral infection, and protoplast fusion. Stable AAV packaging cells can also be produced. Alternatively, the expression cassette may be used to produce viral vectors other than AAV, or to produce antibody mixtures in vitro. Methods used to produce such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombination techniques, and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0049] As used herein, “AAV8 capsid” refers to an AAV8 capsid having the amino acid sequence of GenBank accession number: YP_077180 (SEQ ID NO: 48) encoded by the nucleic acid sequence of NCBI reference sequence: NC_006261.1 (SEQ ID NO: 49), both of which are incorporated herein by reference. Some mutations of this encoded sequence are encompassed by the present invention and may include sequences having approximately 99% identity with the reference amino acid sequence in GenBank accession: YP_077180, U.S. Patents 7,282,199, 7,790,449, 8,319,480, 8,962,330, and US 8,962,332 (i.e., less than 1% mutation from the reference sequence). In another embodiment, the AAV8 capsid may have the VP1 sequence of an AAV8 variant described in WO2014 / 124282, which is incorporated herein by reference. Capsids, methods for generating coding sequences, and therefore methods for constructing rAAV viral vectors have been described previously. See, for example, Gao, et al, Proc. Natl. Acad. Sci. USA100(10), 6081-6086(2003), US2013 / 0045186A1, and WO2014 / 124282. In one embodiment, an AAV8 variant exhibiting directivity to a desired target cell, such as a photoreceptor, RPE, or other ophthalmocellular cell, is selected. For example, the AAV8 capsid may have the VP1 sequence of an AAV8 variant described in Kay et al, Targeting Photoreceptors, which is incorporated herein by reference. via Intravitreal Delivery Using Novel,Capsid-Mutated AAV Vectors,PLoS One.2013;8(4):e62097.Published online 2013 Apr 26 The AAV capsid may have the Y447F, Y733F, and T494V mutations (also known as "AAV8(C&G+T494V)" and "rep2-cap8(Y447F+733F+T494V)") as described herein. See, for example, Mowat et al, Tyrosine capsid-mutant AAV vectors for gene delivery to the canine retina from a subretinal or intravitreal approach, Gene Therapy 21, 96-105 (January 2014), incorporated herein by reference. In another embodiment, the AAV capsid is the AAV8 capsid, which preferentially targets bipolar cells. See, for example, WO2014 / 024282, incorporated herein by reference.

[0050] As used herein, the term “NAb titer” measures how much neutralizing antibody (e.g., anti-AAV Nab) is produced that neutralizes the physiological effects of its target epitope (e.g., AAV). Anti-AAV NAb titer can be measured, for example, as described in Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009. 199(3): pp. 381-390, which is incorporated herein by reference.

[0051] In the context of amino acid sequences, the terms “percent (%) identity,” “sequence identity,” “percent sequence identity,” or “percent identity” refer to residues in two sequences that are identical when aligned for matching. Percent identity can be readily determined for proteins, polypeptides, full-length sequences of approximately 32 amino acids or 330 amino acids, or their peptide fragments, or the corresponding nucleic acid sequences encoding those sequences. Suitable amino acid fragments can be at least 8 amino acids long and up to approximately 700 amino acids. Generally, when referring to “identity,” “homology,” or “similarity” between two different sequences, “identity,” “homology,” or “similarity” is determined by reference to an aligned sequence. An “aligned” sequence or “alignment” refers to a multiplexed nucleic acid sequence or protein (amino acid) sequence that often contains missing or additional bases or amino acid modifications compared to a reference sequence. Alignment is performed using any of the various publicly or commercially available multiplexed sequence alignment programs. For example, sequence alignment programs such as "Clustal Omega," "Clustal X," "MAP," "PIMA," "MSA," "BLOCKMAKER," "MEME," and "Match-Box" are available for amino acid sequences. Generally, all of these programs are used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art may use another algorithm or computer program that provides at least the level of identity or alignment provided by the referenced algorithm and program. See, for example, JDThomson et al, Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments," 27(13):2682-2690 (1999). As used herein, the term "operably linked" refers to both the gene of interest and the adjacent regulatory sequence, and the regulatory sequence that acts to control the gene of interest trans or distally.

[0052] A "replication-deficient virus" or "viral vector" is a synthetic or artificial viral particle in which an expression cassette containing the target gene is packaged in a viral capsid or envelope, where similarly packaged in a viral capsid or envelope. This refers to any viral genome sequence being replicated that is a replication defect, meaning it cannot produce progeny virions but retains the ability to infect target cells. In some embodiments, the genome of the viral vector does not contain genes encoding enzymes necessary for replication (the genome may be modified to be a "weak" one containing only the target transgene adjacent to the signals necessary for amplification and packaging of the artificial genome), but these genes can be supplied during construction. Therefore, replication and infection by progeny virions do not occur except in the presence of the viral enzymes necessary for replication, and it is considered safe for use in gene therapy.

[0053] The abbreviation "sc" refers to self-complementary. "Self-complementary AAV" refers to a plasmid or vector having an expression cassette in which the coding region supported by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary halves of scAAV associate to form a single double-stranded DNA (dsDNA) until ready for direct replication and transcription. See, for example, DM McCarty et al, “Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis”, Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference.

[0054] When used in reference to proteins or nucleic acids, the term “heterogeneity” indicates that a protein or nucleic acid contains two or more sequences or subsequences that, in nature, are not identical to one another. For example, nucleic acids having two or more sequences from unrelated genes arranged to produce a nucleic acid with a novel function are typically produced by recombinant DNA. For example, in one embodiment, a nucleic acid has a promoter from one gene arranged to induce the expression of a coding sequence from another gene. Thus, with respect to the coding sequence, the promoter is heterogeneous.

[0055] When used in reference to a protein or nucleic acid sequence, the term “exogenous” refers to two or more sequences or subsequences derived from different sources, such as AAV and human proteins.

[0056] Note that the terms "a" or "an" can refer to one or more. In such cases, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0057] The words “comprise,” “comprises,” and “comprising” should be interpreted inclusively, not exclusively. The words “consist,” “consisting,” and their variations should be interpreted inclusively, not exclusively. Various embodiments herein are presented using the word “comprising” in other contexts, but the relevant embodiments are also interpreted and described using the words “consisting of” or “consisting essentially of.”

[0058] As used herein, the term "about" means a 10% variability from a given standard unless otherwise specified.

[0059] Unless otherwise specified herein, the technical and scientific terms used herein have the same meaning as they would normally be understood by those skilled in the art and by referring to published literature that provides a general explanation of many of the terms used herein.

[0060] rAAV8.aVEGF preparation The rAAV8.aVEGF formulation is a suspension containing an effective amount of the rAAV8.aVEGF vector suspended in an aqueous solution. In some embodiments, the suspension optionally includes a buffered saline solution, along with a surfactant and / or other vehicle. The buffered saline solution typically contains a physiologically compatible salt or mixture of salts, such as phosphate-buffered saline, sodium chloride, or a mixture thereof.

[0061] In one embodiment, the formulation is, for example, M.Lock, which is incorporated herein by reference. As described in et al, Hu Gene Therapy Methods, Hu Gene Ther Methods 2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14, when measured by oqPCR or digital droplet PCR (ddPCR), for example, approximately 1 × 10⁻¹⁴ 8 GC / eye ~ approx. 7×10 12 GC / eye, or approximately 5 x 10 9 GC / eye ~ approx. 1×10 11 GC / eye, or about 10 10 May include GC / eye or approximately.

[0062] For example, when provided herein, the suspension may contain both NaCl and KCl. The pH may be in the range of 6.5 to 8 or 7.2 to 7.6. The pH can be determined by any preferred method, e.g., USP <791> [American Pharmacopeia, Reference Standards] can be used for evaluation. Suitable surfactants, or combinations of surfactants, are poloxamers, i.e., nonionic triblock copolymers consisting of two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)) flanked by a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)), such as SOLUTOL HS. The surfactant can be selected from 15 (macrogol-15 hydroxysteart), LABRASOL (polyoxycaprylic acid glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In some embodiments, the formulation contains poloxamer. These copolymers are generally named by the letter "P" (for poloxamer) followed by a three-digit number, where the first two digits × 100 give the approximate molecular weight of the polyoxypropylene core, and the last digit × 10 gives the percentage of polyoxyethylene content. In some embodiments, poloxamer 188 is selected. The surfactant may be present in an amount of about 0.0005% to about 0.001% of the suspension. In some embodiments, the rAAV8.aVEGF formulation is, for example, based on M. Lock et al, Hu Gene Therapy Methods, Hu Gene Therapy Methods, which are incorporated herein by reference. As described in Methods 2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14, when measured by oqPCR or digital droplet PCR (ddPCR), at least 1 × 10⁻¹⁶ 11 Or more genome copies (GC) / mL, for example, about 1 × 10⁶ 13This is a suspension containing GC / mL. In one embodiment, the vector is suspended in an aqueous solution at pH 7.3 containing 180 mM sodium chloride, 10 mM sodium phosphate, and 0.001% polyoxame 188. The formulation is suitable for use in human subjects and is administered subretinally.

[0063] To ensure that empty capsids are removed from the dose of AAV8.aVEGF administered to the patient, empty capsids are separated from the vector particles during the vector purification process. In one embodiment, the vector particles containing the packaged genome are incorporated herein by reference in International Patent Application No. PCT / filed December 9, 2016. Purification is performed from empty capsids using the process described in US16 / 65976, and its priority documents, US Patent Application No. 62 / 322,098 filed on April 13, 2016, and US Patent Application No. 62 / 266,341 filed on December 11, 2015, entitled "Scalable Purification Method for AAV8". Briefly, a two-step purification scheme is described for clarifying rAAV-producing cell cultures and selectively capturing and isolating genome-containing rAAV vector particles from the concentrated supernatant. The process uses an affinity capture method performed at high salt concentrations, followed by an anion exchange resin method performed at high pH, ​​to yield rAAV vector particles substantially free of rAAV intermediates.

[0064] In one embodiment, the pH used is 10–10.4 (approximately 10.2), and the rAAV particles are purified by at least approximately 50%–90% from the AAV8 intermediates, or the pH is 10.2, and approximately 90%–99% from the AAV8 intermediates. In one embodiment, this is measured by genome copying. A stock or formulation of rAAV8 particles (packaged genome) is "substantially free" of empty AAV capsids (and other intermediates) when the rAAV8 particles in the stock are at least approximately 75%–100%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least 95%, or at least 99% of the rAAV8 in the stock, and the "empty capsids" are less than approximately 1%, less than approximately 5%, less than approximately 10%, or less than approximately 15% of the rAAV8 in the stock or formulation. In one embodiment, the formulation features an rAAV stock having an empty-to-perfect ratio of less than 1, preferably less than 0.75, more preferably less than 0.5, and more preferably less than 0.3.

[0065] In further embodiments, the average yield of rAAV particles is at least about 70%. This can be calculated by measuring the titer (genomic copy) in the mixture packed into the column and the amount present in the final eluent. Furthermore, these can be measured based on q-PCR analysis and / or SDS-PAGE techniques, such as those described herein or have been described in the art.

[0066] For example, to calculate the content of empty and complete particles, the volume of the VP3 band for a selected sample (e.g., iodixanol gradient purified preparation, where the number of GCs = the number of particles) is plotted against the packed GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the volume of the peak band for the test sample. The number of particles (pt) per 20 μL of packed material is then multiplied by 50 to obtain particles (pt) / mL. Dividing pt / mL by GC / mL gives the ratio of particles to genome copies (pt / GC). pt / mL - GC / mL gives the empty pt / mL. Dividing empty pt / mL by pt / mL and multiplying by 100 gives the percentage of empty particles.

[0067] Generally, methods for analyzing AAV vector particles having empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec.Ther. (2003) 7:122-128. To test for denatured capsids, the method comprises subjecting a treated AAV stock to SDS-polyacrylamide gel electrophoresis on any gel capable of separating three capsid proteins, for example, a gradient gel containing 3-8% tris acetate in buffer; then electrophoresis of the gel until the sample material is separated; and blotting the gel onto a nylon or nitrocellulose membrane, preferably nylon. Next, an anti-AAV capsid antibody that binds to the denatured capsid protein, preferably an anti-AAV capsid monoclonal antibody, most preferably a B1 anti-AAV-2 monoclonal antibody, is used as the primary antibody (Wobus et al., J. Viral. (2000) 74:9281- 9293). Next, a secondary antibody is used that binds to a primary antibody and includes means for detecting binding to the primary antibody, more preferably an anti-IgG antibody including a detection molecule covalently bound thereto, most preferably a goat anti-rabbit IgG antibody covalently bound to horseradish peroxidase. The method for detecting binding is used to semi-quantitatively measure the binding between the primary and secondary antibodies, and is preferably a detection method capable of detecting radioactive isotope emission, electromagnetic radiation, or colorimetric change, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, a sample can be taken from the column fraction and heated in an SDS-PAGE loading buffer containing a reducing agent (e.g., DTT), and the capsid protein is analyzed on a precast gradient polyacrylamide gel (e.g., Novex). Silver staining using SilverXpress (Invitrogen, CA) may be performed according to the manufacturer's instructions. In one embodiment, the concentration of the AAV vector genome (vg) in the column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and cleaved with DNase I (or another suitable nuclease) to remove exogenous DNA. After nuclease inactivation, the sample is further diluted and amplified using a TaqMan® fluorescence-generating probe specific to the DNA sequence between the primers. The number of cycles required to reach a predetermined level of fluorescence (threshold cycles, Ct) is measured for each sample using an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing the same sequence as that present in the AAV vector is used to create a standard curve in the Q-PCR reaction. The cycle threshold (Ct) value obtained from the sample is used to measure the titer of the vector genome by standardizing it against the Ct value of the plasmid standard curve. Digital PCR-based evaluation assays are also available.

[0068] In one embodiment, an optimized q-PCR method using a broad-spectrum serine protease, such as proteinase K (commercially available from Qiagen), is provided herein. More specifically, the optimized qPCR genome titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with proteinase K buffer and treated with proteinase K, followed by thermal inactivation. A suitable sample is diluted with an amount of proteinase K buffer equal to the sample size. The proteinase K buffer may be concentrated more than 2-fold. Typically, the proteinase K treatment is about 0.2 mg / mL, and can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55°C for 15 minutes, but may be carried out at lower temperatures (e.g., about 37°C to about 50°C) for longer periods (e.g., about 20 minutes to about 30 minutes), or at higher temperatures (e.g., up to about 60°C) for shorter periods (e.g., about 5 to 10 minutes). Similarly, thermal inactivation is generally performed at approximately 95°C for about 15 minutes, but the temperature may be lower (e.g., approximately 70-90°C) and the duration extended (e.g., approximately 20-30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in the standard assay.

[0069] Furthermore, or alternatively, droplet digital PCR (ddPCR) can be used. For example, methods for measuring single-stranded and self-complementary AAV vector genome titers by ddPCR have been previously described. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hu Gene Ther Methods. 2014. See Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131.Epub 2014 Feb 14.

[0070] manufacturing The rAAV8.aVEGF vector can be prepared as shown in the flowchart in Figure 9. Briefly, cells (e.g., HEK293 cells) can be grown in a suitable cell culture system. The cells are propagated and transfected for vector production. The rAAV8.aVEGF vector can then be harvested, concentrated, purified, and prepared as a bulk vector, which is then filled and completed in downstream processes. The methods for producing gene therapy vectors described herein include methods well known in the art, such as generating plasmid DNA used in the production of gene therapy vectors, generating vectors, and purifying vectors. In some embodiments, the gene therapy vector is an AAV vector, and the vector produced is an AAV cis plasmid encoding the AAV genome and the gene of interest, an AAV transplasmid containing the rep and cap genes of AAV, and an adenovirus helper plasmid. The vector production process may include method steps such as initiating cell culture, subculturing cells, seeding cells, transfecting cells with plasmid DNA, changing the medium to serum-free medium after transfection, and harvesting vector-containing cells and medium. The harvested vector-containing cells and medium are referred to herein as crude cell harvests.

[0071] Subsequently, the crude cell sample can be subjected to steps such as concentration of the vector sample, dialysiefiltration of the vector sample, microsolution preparation of the vector sample, nuclease digestion of the vector sample, filtration of the microsolution intermediate, purification by chromatography, purification by ultracentrifugation, buffer exchange by tangent flow filtration, and formulation and filtration for bulk vector preparation.

[0072] In certain embodiments, the method used to produce gene therapy vectors is described in the examples herein.

[0073] Patient group Patients who are candidates for treatment include those with neovascular age-related macular degeneration, macular edema after retinal vein occlusion (RVO), diabetic macular edema (DME), diabetic retinopathy (nonproliferative diabetic retinopathy (NPDR), proliferative diabetic retinopathy (PDR) in patients with DME, and diabetic retinopathy in patients with diabetic macular edema). These patients are particularly well suited to subretinal treatment with AAV8.aVEGF compositions as described herein.

[0074] Patients who are candidates for intraocular administration of AAV8.aVEGF as described herein, including subretinal and / or intravitreal administration, include those with macular degeneration, neovascular / exudative / exudative age-related macular degeneration, macular edema after retinal vein occlusion (RVO) (including central retinal vein occlusion (CRVO) and branch retinal vein occlusion (BRVO)), central retinal vein / hemiretinal vein / branch retinal vein occlusion, retinal artery occlusion, retinal neovascularization, diabetic macular edema (DME), and diabetic retinopathy (non- Proliferative diabetic retinopathy (NPDR), proliferative diabetic retinopathy (PDR) in patients with DME, diabetic retinopathy without macular edema (including pretreatment before vitrectomy for proliferative diabetic retinopathy), highly active photocoagulated diabetic retinopathy, choroidal neovascularization, rare causes of choroidal neovascularization (striae pigmentosa, choroiditis [including choroiditis secondary to histoplasmosis of the eye], idiopathic degenerative myopia, retinal dystrophy, iris neovascularization, and trauma), idiopathic Choroiditis, corneal neovascularization, retinopathy of prematurity, optic nerve disc perfusion, posterior lens fiber formation, retinal degeneration, vitreomacular traction syndrome, retinal detachment, diabetic tractional retinal detachment, submacular neovascular pigment epithelial detachment, Vogt-Koyanagi-Harada syndrome, pigment epithelial detachment, pigment epithelial rupture, proliferative vitreoretinopathy, vitreoretinal surgery in diabetic tractional retinal detachment, polypoid choroidal vasculopathy, punctate choroidal endothelial lamina (PIC), multifocal choroiditis, central serous chorioretinopathy (CSC), creeping Choroiditis, vitreous hemorrhage, transciliary vitrectomy for vitreous hemorrhage, preretinal hemorrhage with highly active vascular connective tissue proliferation, choroidal hemorrhagic amblyopia, myopia, myopic choroidal neovascularization, subfoveal / parafoveal neovascularization in high myopia, choroidal malignant melanoma, ocular histoplasmic syndrome, refractory inflammatory neovascularization (neovascularization, tuberculosis, multifocal creeping choroiditis, Harada toxoplasmosis), pseudoxanthoma elasticum, hereditary eye diseases, corneal endothelial cell loss, Pho Kuto-Koyanagi-Harada syndrome, anterior ischemic optic neuropathy, cystoid macular edema, cystic macular edema, idiopathic cystic macular edema, idiopathic macular telangiectasia, Coats' disease (also known as exudative retinitis or retinal telangiectasia), glaucoma, neovascular glaucoma, steroid-induced glaucoma, ocular hypertension, glaucoma surgery, wound healing control, uveal melanoma, uveitis, radiation macular damage, pattern dystrophy, radiation retinopathy, radiation necrosis, Hippel's disease, von Hippel-Lindau syndrome This includes individuals with endophthalmitis, neuromyelitis optica spectrum disorder, pterygium, primary pterygium (including adjunctive treatment for primary pterygium surgery), recurrent pterygium, retinal drusen, ocular tumors, intraocular melanoma, cataracts, corneal transplant failure, trabeculectomy, fatty keratopathy, full-thickness corneal transplant, herpes zoster keratopathy, rosacea, retinal hemangioma, renovascular disease, visual impairment, proliferative vitreoretinopathy, iris neovascularization (NV), corneal NV, pannus, ciliary body squamous cellulitis sarcoid, or Eels disease.

[0075] Patients who are candidates for treatment with AAV8.aVEGF (anti-VEGF transgene product) are candidates for treatment in regimens including, but not limited to, combinations with 24 GyE protons, 16 GyE, lidocaine, propalacaine hydrochloride, Tetravisc, Acuvail, Zimura, triamcinolone acetonide, ranibizumab, or Ozurdex. Examples of suitable indications include those listed in the preceding paragraph. For example, combination regimens containing AAV8.aVEGF with one or more of the previously listed drugs may be used to treat exudative age-related macular degeneration, central retinal vein occlusion, idiopathic polypoidal choroidal vasculopathy, and / or diabetic macular edema.

[0076] The AAV8.aVEGF compositions described herein are also useful for inhibiting angiogenesis in many cancers, neoplasms, and other VEGF-related diseases. Such compositions can be administered by any preferred route, including, for example, intravenous, intrafocal, or direct delivery to tumors or organs. Such patients include those with acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenocortical carcinoma, adrenocortical carcinoma, AIDS-related cancers, Kaposi's sarcoma, AIDS-related lymphoma, primary CNS lymphoma, anal cancer, appendiceal cancer, astrocytoma, atypical teratomatoid / rhabdomyosarcoma-like tumors, basal cell carcinoma of the skin, bladder cancer, bone cancers (including Ewing's sarcoma and osteosarcoma and malignant fibrous histiocytoma), brain tumors, breast cancer, bronchial tumors, Burkitt lymphoma, non-Hodgkin lymphoma, Carcinoid tumors, cancer of unknown primary origin, cardiac tumors, atypical teratomas / rhabdomyosarcomas of the central nervous system, germ cell tumors, primary CNS lymphoma, cervical cancer, rare cancers in children, cholangiocarcinoma, cholangiocarcinoma, chordoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), chronic myeloproliferative neoplasms, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, ductal carcinoma in situ (DCIS), germ cell tumors of the central nervous system, endometrial cancer, ependymoma, esophageal cancer, sensory neuroblastoma Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, intraocular melanoma, retinoblastoma, fallopian tube cancer, fibrous histiocytoma of bone, malignant osteosarcoma, gallbladder cancer, stomach cancer, pediatric stomach cancer, gastrointestinal stromal tumor (GIST), germ cell tumor, pediatric central nervous system germ cell tumor, pediatric extracranial germ cell tumor, extragonadal germ cell tumor, ovarian germ cell tumor, testicular cancer, gestational trophoblastic disease, hairy cell leukemia, head and neck cancer, cardiac tumor, hepatocellular carcinoma, histiocytosis, Langerhans cells, Hodgkin's Parkinson's disease, hypopharyngeal cancer, intraocular melanoma, pancreatic islet tumors, pancreatic endocrine tumors, Kaposi's sarcoma, renal cancer, Langerhans cell histiocytosis, laryngeal cancer, pediatric laryngeal cancer and papillomas, leukemia, lip and oral cancer, liver cancer, lung cancer (non-small cell and small cell), pediatric lung cancer, lymphoma, male breast cancer, malignant fibrous histiocytoma and osteosarcoma of bone, melanoma, intraocular melanoma, Merkel cell carcinoma, malignant mesothelioma, metastatic cancer, metastatic squamous cell carcinoma of unknown primary origin, midline cancer involving the NUT gene, oral cancer (MouthCancer), multiple endocrine neoplasia syndrome, multiple myeloma / plasmacytic neoplasm, mycosis fungoides, myelodysplastic syndrome, myelodysplasia, myeloproliferative neoplasm, myeloid leukemia, chronic myeloid leukemia (CML), acute myeloid leukemia (AML), chronic myeloproliferative neoplasm, paranasal sinus cancer and nasal cavity cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, oral cancer, oral cavity cancer and oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian cancer, pancreatic cancer, pancreatic endocrine neoplasm, papilloma, paraganglioma, paranasal sinus cancer and nasal cavity cancer, para Salivary gland carcinoma, penile cancer, pharyngeal cancer, pheochromocytoma, plasma cell tumor / multiple myeloma, pleuropulmonary blastoma, pregnancy and breast cancer, primary central nervous system (CNS) lymphoma, primary peritoneal cancer, prostate cancer, rectal cancer, recurrent cancer, renal cell carcinoma, retinoblastoma, salivary gland carcinoma, sarcoma, pediatric rhabdomyosarcoma, pediatric angiomoma, Ewing's sarcoma, osteosarcoma, uterine sarcoma, Sézary syndrome, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma of the skin Squamous cervical cancer of unknown primary origin, metastatic cancer, gastric cancer, cutaneous T-cell lymphoma, testicular cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter (renal (renal cell) carcinoma), cancer of unknown primary origin, cancer of unknown primary origin in children, rare cancers in children, cancer of the ureter and renal pelvis, urethral cancer, endometrial uterine cancer, uterine sarcoma, uterine leiomyosarcoma, vaginal cancer, hemangioma, vulvar cancer, Wilms' tumor and others. Pediatric renal tumors, abdominal tumors (adenocarcinoma, hepatocyte, papillary serous Müller's disease, lapatinib, colon, ovarian, fallopian tube, peritoneal cancer / neoplasm / carcinoma / tumor), lymphoproliferative disorders, small bowel cancer, acoustic neuromas (e.g., vestibular schwannoma, neurofibromatosis type 2), acute myeloid leukemia, acute respiratory distress syndrome (ARDS), head and neck cancer, squamous cell carcinoma, multiple myeloma, non-Hodgkin lymphoma, B-cell lymphoma, sarcoma, neuroblastoma, Some patients have advanced cancer, malignant neoplasms of the female genitalia, metastatic or unresectable solid tumors, malignant astrocytoma, colon cancer, metastatic melanoma, malignant ascites, renal cell carcinoma, glioblastoma, gliosarcoma, liver metastases from colorectal cancer, advanced malignant tumors, myeloma, pregnancy trophoblastic tumor, choriocarcinoma, placental trophoblastic tumor, epithelioid trophoblastic tumor, biliary tract cancer, malignant glioma, cervical cancer, uterine cancer, or mesothelioma.The candidates are, by the composition alone, or, for example, paclitaxel, carboplatin, oxaliplatin, radiation, capecitabine, irinotecan, fluorouracil, doxorubicin hydrochloride liposomes, erlotinib hydrochloride, irinotecan hydrochloride, irinotecan hydrochloride hydrate (CPT-11), gemcitabine hydrochloride, pazopanib hydrochloride, topotecan hydrochloride, trifluridine / tipiracil hydrochloride, pegylated liposome-encapsulated doxorubicin hydrochloride, enzastaurin hydrochloride, mitoxantrone hydrochloride, epirubicin hydrochloride, docetaxel, gemcitabine, erlotinib, cisplatin, chemotherapy, cetuximab, FOLFIRI-cetuximab, 5-fluorouracil (5 -FU), LV5FU2, cyclophosphamide, temozolomide, pemetrexed, levofolinate calcium (1-LV), leucovorin calcium, FOLFOX, FOLFOX6, mFOLFOX, FOLFOXIRI, FOLFIRI, doxorubicin, liposomal doxorubicin, liposomal doxorubicin hydrochloride, sorafenib tosylate, sorafenib, triamcinolone, triamcinolone acetonide, trastuzumab, everolimus, sunitinib, dexamethasone, conventional surgery, Xeloda, radiotherapy, temsirolimus, pazopanib, leucovorin (LV), 1-LV, anitumumab, epirubicin, verteporfin, AMG 655, Amgen 386, AMG. 479, AMG 706, AMG 951, AMG 102, folinic acid, levofolinic acid, etoposide, BAY 43-9006, atezolizumab, interferon alpha-2b, interferon alpha-2a, interferon alpha, gamma-interferon-1b, photodynamic therapy, vinorelbine tartrate, vinorelbine, topotecan, tarceva, pemetrexed disodium, estramustine phosphate sodium, imetelstat sodium, XELOX, RAD001, pegfilgrastim, paclitaxel albumin stabilized small particle preparation, ipilimumab, stereotactic radiosurgery (SRS), stereotactic radiology, ozaldex, letrozole, AG-013736 (axitinib), filgrastim, crizotinib, cediranib maleate, cediranib, bortezomib, Abraxane, vorinostat, vincristine, TRC1 05, Rituximab, Regorafenib, Pembrolizumab, Methotrexate, Imatinib, Herceptin, Tecentriq, Oxaliplatin (OXA), Lomustine, Ixabepirone, CPT-11, CGC-11047, Vinorelbine Tartrate, Tartrate, Prednisone, Nivolumab, Fulvestrant, Enzastaurin, Doxil, AZD2014, AZD228 1. AZD2171, AZD4547, AZD5363, AZD8931, Vitamin B12, Vitamin C, Vitamin D, Valproic acid, Mitomycin C, Cedilanib maleate, Lenalidomide, Lapatinib, HAI Abraxane, HAI Irinotecan, GDC-0941, GDC-0449, GDC-0980, Bicalutamide, XELIRI, Vandetanib, Thalidomide These include, but are not limited to, iodine, rapamycin, olaparib, NovoTTF100A, navelbine, MetMAb, imatinib mesylate (Gleevec), ifosfamide, hydroxychloroquine, and GM-CSF, and are used in combination with other anticancer therapies.

[0077] Further suitable conditions for treatment may include, for example, hemophilia, synovitis, hypertension, keloids, inflammation, radiation necrosis, and neoplastic meningitis. These and the aforementioned conditions can be delivered by any suitable route unless a different type of administration for subretinal or ocular administration is specified.

[0078] In certain embodiments, the patient receives a single dose of rAAV8.aVEGF administered subretinally. For example, this is particularly well suited in the treatment of neovascular age-related macular degeneration, macular edema after retinal vein occlusion (RVO), diabetic macular edema (DME), diabetic retinopathy (non-proliferative diabetic retinopathy (NPDR), proliferative diabetic retinopathy (PDR) in patients with DME, and diabetic retinopathy in patients with diabetic macular edema).

[0079] The dose of rAAV8.aVEGF administered to the patient should be at least 1 × 10⁶ (as measured by oqPCR or ddPCR). 9 GC / eye~1×10 13 GC / eye, or at least 1 × 10 10 GC / eye~7.5×10 12 GC / ocular. However, other doses may be selected. For example, a therapeutically effective subretinal dose of rAAV8.aVEGF for a patient is approximately 0.1 mL to approximately 0.5 mL, preferably 0.25 mL (250 μl), or approximately 3 × 10 in injection volumes ranging from 0.1 to 0.15 mL (100 to 150 μl). 9 GC / eye ~ approx. 6.6×10 11 It may be within the range of GC / eye, more preferably 6.6 × 10⁻⁶. 10 In another embodiment, the therapeutically effective concentration is approximately 1 × 10⁻⁶. 5 It is acceptable for the concentration to be 1 × 10⁻⁶. 5 GC / μL ~ 1 × 10 9 The concentration can be GC / μL, and the injection volume for any GC concentration within that range can be 10 μL to 300 μL. In one embodiment, the dose of rAAV8.aVEGF administered to the patient is approximately 3 × 10⁻⁶ 9 GC / eye, approx. 1×10 10 GC / eye, approx. 6×1010 GC / eye, approx. 1.6×10 11 GC / eye, or approximately 2.5 × 10 11 GC / eye.

[0080] In one embodiment, the patient may receive rAAV8.aVEGF by subretinal administration by a retinal surgeon under local anesthesia. The procedure may include a standard three-port transciliary vitrectomy with central vitrectomy, followed by subretinal delivery into the subretinal space via a subretinal cannula (36-41 gauge). In certain embodiments, 100-150 milliliters of rAAV8.aVEGF are delivered.

[0081] In some embodiments, rAAV8.aVEGF is administered in combination with one or more therapies for the treatment of exudative AMD or another selected disorder. In some embodiments, rAAV8.aVEGF is administered in combination with laser coagulation, photodynamic therapy with verteporfin, and intravitreal anti-VEGF agents such as, but not limited to, pegaptanib, ranibizumab, aflibercept, or bevacizumab.

[0082] In one embodiment, patients for rAAV8.aVEGF therapy may include those who have previously responded to conventional anti-VEGF antibody (Fab) therapy.

[0083] The objective of the gene therapy treatment of the present invention is to slow or halt the progression of retinal degeneration and to slow or halt vision loss with minimal intervention / invasive treatment. In some embodiments, the efficacy of the gene therapy treatment may be demonstrated by the elimination or reduction of salvage treatment using standard therapies, such as intravitreal injections of anti-VEGF agents, including but not limited to pegaptanib, ranibizumab, aflibercept, or bevacizumab.

[0084] In certain embodiments, effectiveness may be measured by one or more of the following: visual changes, best corrected visual acuity as measured by the (BCVA) score, Snellen chart or early treatment diabetic retinopathy (ETDRS) visual acuity score, percentage loss or gain by the subject as measured by ETDRS, best corrected distance visual acuity, best corrected reading visual acuity, change in the NEI Visual Function Questionnaire-25 (VFQ-25) score, visual quality questionnaire, visual acuity including contrast sensitivity as measured by the Perry-Robson chart, low contrast visual acuity in an electronic visual acuity meter, peripheral visual field as measured by the Goldmann visual field, corneal-iris distance and trabecular-iris distance as measured by Heidelberg slit-lamp optical coherence tomography, central and paracentral metamorphopsia, preferential hyperacuity perimeter for age-related macular degeneration (AMD) by analyzing retinal sensitivity (mfERG, Nidek MP-1 microperimeter). Perimeter (PHP) test, visual analog scale (VAS), macular mapping test, electroretinography (ERG), pattern electroretinography (PERG) and full-field (or flash) electroretinography (ffERG), multifocal electroretinography (mfERG), electrophysiological changes including central ring amplitude density in mfERG, mean retinal sensitivity (dB) in three concentric rings (4°, 8°, and 12°), visual evoked potentials (VEP): ECG parameters include PR interval, QRS interval, and corrected QT interval (QTcF) using Fridericia's formula. Anatomical changes including NVE (retinal neovascularization), CNVM (choroidal neovascular membrane) regression, macular volume, macular thickness, thickness of the central macular subregion, retinal volume (internal and external retinal volume), retinal thickness, central retinal thickness, retinal subregion thickness (CSRT), subfoveal retinal thickness (SRT), foveal thickness, maximum diameter of foveal avascular zone, retinal layer integrity, external limiting membrane (ELM) integrity, ellipsoidal line / band integrity, lens condition, lens opacity, changes measured using optical coherence tomography (OCT), neovascular membrane regression percentage measured by optical coherence tomography angiography (OCTA), and degree of photoreceptor integrity of the internal / external segment layers in a 1 mm area centered on the fovea.Optionally, during the trial, AMD injury size and leakage may be determined by fluorescein angiography, and may include total injury size and CNV (choroidal neovascularization) size as determined by fluorescein angiography (FA) and indocyanine green angiography (ICG), active CNV leakage which may include subretinal fluid or hemorrhage, area of ​​leakage, area of ​​macular leakage, change in percentage of injury and hemorrhage, change in drusen size, amount of fluid, volume of intraretinal cystic changes (IRCs), vascular density, presence of intraretinal / subretinal fluid, height and diameter of subretinal fluid (SRF), volume of intraretinal fluid, anterior chamber reaction, chorioretinal perfusion (ICG), progression of geographic atrophy (GA) as detected by fundus photography (FP) and / or fundus autofluorescence (AF), presence and dilation of capillary occlusion, peripheral retinal ischemia, macular sensitivity using microvisual field measurement, iris neovascularization, horn neovascularization, and diabetic retinopathy.

[0085] In certain embodiments, subretinal and / or intraretinal injection of AAV8.aVEGF results in plasma and serum levels that do not contain aVEGF.

[0086] In certain embodiments, efficacy may be monitored by measuring BCVA (e.g., best corrected visual acuity using an Early Treatment Diabetic Retinopathy Study (ETDRS) chart), intraocular pressure (IOP), slit-lamp biomicroscopy, dilated fundus endoscopy, indirect ophthalmoscopic examination, SD-OCT (SD-Optical Coherence Tomography, e.g., using Heidelberg Spectralis), fundus autofluorescence (FAF), color fundus photographs, and / or fluorescein angiography (FA). Signs of other safety-related phenomena, including visual acuity loss, infection, inflammation, and retinal detachment, may also be monitored.

[0087] SD-OCT is a useful non-invasive in vivo cross-sectional retinal microscopy technique. Suitable instruments are commercially available. For example, see Spectralis OCT, Heidelberg Engineering, Carlsbad, CA. In short, this technique involves the pupil... This can be performed by dilation. Using a scanning laser ophthalmoscope of this imaging system, frontal retinal imaging can be performed by near-infrared (NIR) reflectance (REF) and / or NIR fundus autofluorescence (FAF). Spectral-region optical coherence tomography scans can be performed by superimposing horizontal and vertical sections 9 mm long passing through the fovea, as well as a 30 × 25 mm raster scan extending to a nearly intermediate area. Parameters may be changed as needed, or may be other suitable parameters determined to be equivalent.

[0088] In another embodiment, retinal function can be assessed by whole-field electroretinography (ERG). ERG is the collective potential generated by the retina in response to light stimulation. It is typically recorded by electrodes in contact with the corneal surface. Electroretinography can be performed according to the recommendations set forth by the International Society for Clinical Electrophysiology of Visual Vision (ISCEV; McCulloch, Doc Ophthalmol. 2015 Feb;130(1):1-12.2015). In summary, electroretinography (ERG) is typically generated when all retinal cells actively respond to flash stimulation (in dark-adapted animals, moderate to intense flashes). Its two components are: * Wave α: The first corneal negative signal after a flash. Origin: Photoreceptor photocurrent, the most direct characteristic of photoreceptor function. * Wave b: A corneal positive signal following wave a, mostly generated by ON-type bipolar cells (secondary neurons downstream of photoreceptors). In the examples described below, standards and additional protocols in accordance with the International Society for Clinical Electrophysiology of Vision (ISCEV) were used. However, these parameters may be adjusted as needed or requested. ERG of dark-adapted rod photoreceptor cells: Stimulation intensity: 0.01~0.02cd sm -2 Response: b-wave only, a-wave absent. Source: Rod "on-type" bipolar cells (secondary neurons driven by input from rod photoreceptor cells). Meaning: Measurement of rod photoreceptor function. Dark adaptation standard flash ERG: Stimulus intensity: 3cd sm -2Response: A mixture of A-waves and B-waves from rod and cone photoreceptor cells; 60%-70% of the signal is generated by the rod photoreceptor-driven pathway. Source: Photoreceptors, both rod and cone photoreceptor cells (A-wave); higher-order neurons driven by both rod and cone photoreceptor cells. Meaning: A measure of the function of most rod photoreceptor cells, with low sensitivity to the dark adaptation state and lower variability than the "dim flash" response. Dark adaptation bright flash ERG: Stimulus intensity: 10 cd sm -2 Response and meaning: The response is the same as for the "standard flash," but the response to a brighter flash may be larger in scale and less variable. Light-adjusted standard flash cone photoreceptor cell ERG: Stimulation intensity: 30 cd / m² after 5 minutes of light adaptation. -2 3cd SM delivered in the presence of background light -2 Response: Waves a and b generated by the cone photoreceptor drive pathway. Meaning: In the presence of background light that makes cone photoreceptor cells completely non-photosensitive, the ERG is exclusively produced by cone photoreceptor cells and cone photoreceptor-driven secondary retinal neurons, and measures the function of cone photoreceptor cells. Light-adapted bright flash cone ERG (additional to ISCEV standard) Stimulus intensity: 30 cd / m² after 5 minutes of light adaptation -2 10 cd sm delivered in the presence of background light -2 Response and meaning: The cone cell-driven ERG was similar to that of a "standard cone cell ERG," but on a larger scale and potentially with less variability. ERG measurements (a-wave amplitude, a-wave latency, b-wave amplitude, b-wave latency) were summarized using mean and standard deviation (SD) for the treated eye and control eye.

[0089] Another measure of effectiveness may include loss of retinal thickness.

[0090] As shown in the following example, 1 × 10 10 Administration of the GC / ocular AAV8.aVEFG vector does not cause any impairment of retinal function. This dose is not a limitation on the therapeutically effective dose that can be administered.

[0091] Measurement for therapeutic purposes The safety of the gene therapy vector after administration is evaluated at multiple time points up to 36 months after vector administration, including the number of adverse events, changes observed on physical examination, and / or clinical This can be evaluated by floor examination parameters. Physiological effects can be observed as early as about 1 day to 1 week, but in some embodiments, steady-state levels of expression can be reached by about 12 weeks.

[0092] The improvement / efficacy resulting from rAAV.aVEGF administration can be evaluated as a predetermined mean change in visual acuity from baseline at approximately 12 weeks, 12 months, 24 months, 36 months, or other desired time points. Other improvements / efficacy can be evaluated at 12, 24, and 36 months as a mean change from baseline in central retinal thickness as measured by spectral-region optical coherence tomography (SD-OCT).

[0093] In some embodiments, treatment with rAAV.aVEGF results in an increase of 5%, 10%, 15%, 20%, 30%, 40%, 50%, or more from baseline in visual acuity. In some embodiments, treatment with rAAV.aVEGF results in a decrease of approximately 5%, 10%, 15%, 20%, 30%, 40%, 50%, or more in central retinal thickness, for example. In other embodiments, central retinal thickness is stable, i.e., there is no increase in central retinal thickness at all. In some embodiments, the measure of effectiveness includes stabilization of retinal thickness and / or stabilization / reduction of exudate and / or drusen.

[0094] In some embodiments, the onset may be observed as early as approximately 8 to 24 hours after administration. One or more of the desired clinical effects described above may be observed within a few days to a few weeks after administration.

[0095] The present invention is demonstrated by the following example, which shows that subretinal administration of the rAAV8.aVEGF vector results in gene transfer throughout the retina and expression of anti-VEGF Fab throughout the retina, as well as in the vitreous humor and anterior chamber fluid. This result is remarkable from the perspective of prior art gene therapy studies, which have shown that gene transfer diffuses horizontally outside the original injection bleb but remains confined to their expanded boundaries, failing to achieve gene transfer and transgene expression outside the expanded region of this injection (the “bleb” formed at the injection site in the retina). A single dose of the rAAV8.aVEGF vector offers advantages over standard treatment for nAMD in that (i) it results in continuous delivery of an effective amount of VEGF inhibitor throughout the retina, which may improve performance compared to repeated IVT administrations of high-dose bolus VEGF inhibitors that dissipate over time, and (ii) it avoids repeated intraocular injections, which present additional risks and inconveniences to the patient. Each aspect may improve treatment outcomes. [Examples]

[0096] The following abbreviations are used herein: AAV refers to adeno-associated virus. ACF refers to anterior chamber fluid. Ad5 refers to adenovirus type 5. AE refers to adverse events. AMD refers to age-related macular degeneration. BCA refers to bicinchoninic acid. BCVA refers to best corrected visual acuity. BH refers to bulk samples. BI refers to bulk active pharmaceutical ingredient intermediates. BP refers to base pairs. CB refers to tri-beta-actin promoter. CB7 refers to a hybrid of CMV enhancer (C4) and tri-beta-actin promoter. CBC refers to complete blood count. CI refers to tri-beta-actin intron. CMC refers to chemistry, manufacturing, and quality control. CMO refers to a contract manufacturing organization for pharmaceuticals. CMV refers to cytomegalovirus. CNV refers to choroidal angiogenesis. CS-10 refers to Corning 10-layer CellSTACKs® plate. ddPCR refers to droplet digital polymerase chain reaction. DLS refers to dynamic light scattering. DMEM refers to Dulbecco's modified Eagle medium. DNA refers to deoxyribonucleic acid. DP refers to a drug formulation. ELISA refers to enzyme-linked immunosorbent assay. ERG refers to electroretinography. ELISPOT refers to enzyme-linked spot immunoassay. Fab refers to antigen-binding fragment. FBS refers to fetal bovine serum. GC refers to genome copy. g refers to gram. GLP refers to drug safety testing standards. GMP refers to pharmaceutical manufacturing management and quality control standards. This refers to quality control standards. HEK293 refers to human embryonic kidney cells. HCP refers to host cell proteins. HS-36 refers to Corning 36-layer HYPERStacks®. ICH refers to the International Conference on Harmonisation of Clinical Trials (ICH). IND refers to investigational drug. IP refers to in-process. ITR refers to terminal inversion sequence. IU refers to infectious unit. IV refers to intravenous. IVT refers to intravitreous. KDa refers to kilodalton. Kg refers to kilogram. LOQ refers to limit of quantification. Lucentis® is the brand name for ranibizumab. MCB refers to master cell bank. MED refers to minimum effective dose. μl refers to microliter. mL refers to milliliter. Mm refers to millimeter. mRNA refers to messenger RNA. MS refers to mass spectrometry. Ng refers to nanogram. NHP refers to non-human primates. OCT refers to optical coherence tomography. oqPCR refers to optimized quantitative polymerase chain reaction. PCR refers to polymerase chain reaction. PD refers to pharmacokinetics. popPK refers to population pharmacokinetics. PEI refers to polyethyleneimine. PK refers to pharmacokinetics. POC refers to proof of concept. PRN refers to pro re nata (if necessary). QA refers to quality assurance. qPCR refers to quantitative polymerase chain reaction. rAAV refers to recombinant adeno-associated virus. RBG refers to rabbit beta-globin. PRE refers to retinal pigment epithelium. S-36 refers to HYPERstack® 36 layers. SEND refers to standards for non-clinical trial data exchange. SOC refers to standard treatment. SOP refers to standard operating procedure. TCID50 refers to 50% tissue culture infectious titer. TTF refers to tangent flow filtration. μL ​​refers to microliter. VA refers to visual acuity. VEGF refers to vascular endothelial growth factor. WAMD refers to exudative age-related macular degeneration. YAG refers to yttrium aluminum garnet. [Examples]

[0097] Treating human subjects This example relates to gene therapy treatment for patients with neovascular (exudative) age-related macular degeneration (nAMD). In this example, the gene therapy vector, rAAV8.aVEGF, which is a replication-deficient adeno-associated virus vector 8 (AAV8) carrying the coding sequence of a soluble anti-VEGF Fab protein, is administered to patients with nAMD. The objective of the gene therapy treatment is to slow or halt the progression of retinal degeneration and to slow or halt vision loss with minimal intervention / invasive treatment.

[0098] A. Gene therapy vectors The generation of several rAAV8.aVEGF gene therapy vectors is described herein in Example 2. Furthermore, a schematic diagram of the rAAV8.aVEGF vector genome is shown in Figure 1. rAAV8.aVEGF is a non-replicating recombinant AAV8 virus vector containing a transgene resulting in the production of a human anti-vascular endothelial growth factor (anti-VEGF) antigen-binding antibody fragment (Fab). The gene cassette is facilitated with the AAV2 terminal inversion sequence (ITR). Expression from the cassette is driven by the CB7 promoter, a hybrid of the cytomegalovirus early enhancer and the tri-β-actin promoter. Transcription from this promoter is enhanced by the presence of tri-β-actin introns. The polyadenylation signal for the expression cassette is derived from the rabbit β-globin gene. The nucleic acid sequences encoding the heavy and light chains of anti-VEGF Fab are separated by a self-cleaving furin(F) / F2A linker. Incorporation of the furin-F2A linker ensures the expression of approximately equal amounts of heavy and light chain polypeptides.

[0099] The final product is supplied as a frozen solution of the AAV vector active ingredient in a formulation buffer within a Crystarl Zenith® vial, which is sealed with a latex-free rubber stopper and an aluminum flip-off seal. The vial is stored at -60°C or below.

[0100] B. Medication and Route of Administration A single dose of 250 μL of rAAV8.aVEGF is administered intraretinally to the eyes of patients in need of treatment. The subjects are 3 × 10⁶ 9 GC / eye, 1×10 10 GC / eye, or 6×10 10 The prescribed dosage for GC / ophthalmic use will be administered.

[0101] rAAV8.aVEGF is administered to subjects by a single subretinal delivery by a retinal surgeon under local anesthesia. The procedure involves a standard three-port transciliary vitrectomy with central vitrectomy, followed by subretinal delivery of rAAV8.aVEGF into the subretinal space via a subretinal cannula (38 gauge). The delivery is automated by a vitrectomy device, delivering 250 μL into the subretinal space.

[0102] rAAV8.aVEGF can be administered in combination with one or more therapies for the treatment of exudative AMD. For example, rAAV8.aVEGF is administered in combination with laser coagulation, photodynamic therapy with verteporfin, and intravitreal anti-VEGF agents such as, but not limited to, pegaptanib, ranibizumab, aflibercept, or bevacizumab.

[0103] Starting approximately four weeks after administration of rAAV8.aVEGF, patients may receive intravitreal ranibizumab salvage therapy in the affected eye.

[0104] C. Patient subgroups Suitable patients may include the following: Those diagnosed with nAMD; Responsive to anti-VEGF therapy; Those requiring frequent injections of anti-VEGF therapy; Men or women aged 50 or older; Those with a BCVA of 20 / 100 or less and 20 / 400 or more in the affected eye (65 or less and 35 or more ETDRS characters); Those with a BCVA between 20 / 63 and 20 / 400 (with 75 or fewer ETDRS characters and 35 or more); Patients with a confirmed diagnosis of subfoveal CNV secondary to AMD in the affected eye; The following are examples of damage sizes less than 10 disk spaces (typical disk space is 2.54 mm²). 2 ), with less than 50% blood in the size of the injury, and / or injury characteristics of CNV such as scarring; Prior to treatment, at least four intravitreal injections of an anti-VEGF agent for the treatment of nAMD have been administered to the affected eye for 8 months (or less) and the patient has an anatomical response confirmed on SD-OCT; and / or The presence of subretinal or intraretinal fluid in the affected eye, as demonstrated by SD-OCT. Before treatment, patients are screened, and one or more of the following criteria may indicate that this treatment is unsuitable for them: ● CNV or macular edema in the affected eye secondary to any factor other than AMD; ● In the affected eye, blood accounts for 50% or more of the AMD damage, or blood is present in 1.0 mm 2 It is located beyond the fovea; ● Any condition that prevents improvement of VA in the affected eye, such as fibrosis, atrophy, or retinal epithelial tear at the center of the fovea; ● A history of highly active retinal detachment or retinal detachment in the affected eye; ● Advanced glaucoma in the affected eye; ● The treatment may increase the risk to the affected eye, or may require either medical or surgical intervention to prevent or treat vision loss. or any medical condition that may interfere with the evaluation test; ● History of intraocular surgery in an affected eye within 12 weeks prior to screening (yttrium aluminum garnet capsulotomy may be acceptable if performed more than 10 weeks prior to the screening visit); ● History of intravitreal therapy in the affected eye within the 6 months prior to screening, such as intravitreal steroid injections or investigational drug use other than anti-VEGF therapy; ● Presence of implants in the affected eye at the time of screening (excluding intraocular lenses) ● A history of malignant tumors requiring chemotherapy and / or radiation within the five years prior to screening (localized basal cell carcinoma may be acceptable); ● Treatments known to cause retinal toxicity, or combination therapy with any drug that may affect vision or has known retinal toxicity, such as a history of chloroquine or hydroxychloroquine; ● Infections of the eye or periocular area that may interfere with surgical procedures in the affected eye; ● Myocardial infarction, cerebrovascular event, or transient ischemic attack during treatment over the past six months; ● Uncontrolled hypertension despite maximum treatment (systolic blood pressure [BP] above 180 mmHg, diastolic blood pressure above 100 mmHg); ● Eye surgery or any accompanying treatments that may interfere with the healing process; ● Known hypersensitivity to ranibizumab or any of its components, or past hypersensitivity to rAAV8.aVEGF-like agents; ● Any serious or unstable medical or psychological condition in the opinion of the researchers that would impair the safety of the subject or their successful participation in the study; ● Aspartate aminotransferase (AST) / alanine aminotransferase (ALT) levels exceeding 2.5 times the upper limit of normal (ULN); ●Total bilirubin exceeding 1.5 times the ULN, and fractionated bilirubin showing that bound bilirubin is less than 35% of total bilirubin, unless the subject has a previously known history of Gilbert's syndrome; ● Prothrombin time (PT) exceeding 1.5 times that of ULN; ●Hemoglobin levels below 10 g / dL for male subjects and below 9 g / dL for female subjects; ●100×10 3 Platelets less than / μL; ●30mL / min / 1.73m 2 Estimated glomerular filtration rate (GFR) less than 1. If one or more of the following rescue criteria are met regarding disease activity, the patient may receive intravitreal ranibizumab rescue therapy in the affected eye, starting approximately 4 weeks after administration of rAAV8.aVEGF: ● Visual acuity loss of 5 letters or more (per best corrected visual acuity [BCVA]) associated with retinal fluid accumulation on spectral-region optical coherence tomography (SD-OCT); ● Novel or persistent elevation of subretinal or intraretinal fluid on SD-OCT, associated with choroidal neovascularization (CNV); ● New eye hemorrhage; If any of the following set of findings occurs, the researcher may, at their discretion, postpone further rescue injections: ●When evaluated by SD-OCT, visual acuity is 20 / 20 or better, and central retinal thickness is "normal", or ●Visual acuity and SD-OCT are stable after two consecutive injections. ● If injections are postponed, they will be resumed if vision or SD-OCT worsens according to the above criteria.

[0105] D. Measurement for therapeutic purposes The main treatment goals are to slow or stop the progression of retinal degeneration and to delay vision loss. This includes reducing or preventing retinal detachment. The therapeutic objective is indicated by the elimination and reduction of rescue treatments using standard treatments, such as intravitreal injections of anti-VEGF agents, including but not limited to pegaptanib, ranibizumab, aflibercept, or bevacizumab. The therapeutic objective is also indicated by the reduction or prevention of vision loss and / or the reduction or prevention of retinal detachment.

[0106] The treatment objective is determined by measuring BCVA (best corrected visual acuity), intraocular pressure, slit-lamp biomicroscopy, indirect ophthalmoscopic examination, and / or SD-OCT (semi-dispersive optical coherence tomography). In particular, the treatment objective is determined by measuring the mean change in BCVA over time from baseline, measuring the gain or loss of 15 letters or more compared to baseline based on BCVA, measuring the mean change in CRT over time as measured by SD-OCT, measuring the mean number of ranibizumab rescue injections over time, measuring the time to the first rescue ranibizumab injection, measuring the mean change in CNV over time and damage size and leakage area based on FA, measuring the mean change in aqueous aVEGF protein over time from baseline, performing serum and urine vector depletion analysis, and / or measuring the immunogenicity of rAAV.aVEGF, i.e., measuring Nab against AAV, measuring binding antibodies against AAV, measuring antibodies against aVEGF, and / or performing ELISpot.

[0107] The treatment objectives are also determined by measuring the mean change in the area of ​​geographic atrophy over time from baseline based on fundus autofluorescence (FAF), measuring the occurrence of new areas of geographic atrophy by FAF (in subjects with no geographic atrophy at baseline), measuring the percentage of subjects who gained or lost 5 or more letters and 10 or more letters compared to baseline by BCVA, measuring the percentage of subjects with a 50% reduction in rescue injections compared to the previous year, and measuring the percentage of subjects without fluid on SD-OCT.

[0108] The improvement / efficacy resulting from rAAV.aVEGF administration can be evaluated as a predetermined mean change in visual acuity from baseline at approximately 4 weeks, 12 weeks, 6 months, 12 months, 24 months, 36 months, or other desired time points. Treatment with rAAV.aVEGF may result in an increase of 5%, 10%, 15%, 20%, 30%, 40%, 50%, or more from baseline in visual acuity. Improvement / efficacy can be evaluated as a mean change from baseline in central retinal thickness (CRT) as measured by spectral-region optical coherence tomography (SD-OCT) at 4 weeks, 12 weeks, 6 months, 12 months, 24 months, and 36 months. Treatment with rAAV.aVEGF may result in an increase of 5%, 10%, 15%, 20%, 30%, 40%, 50%, or more from baseline in central retinal thickness. [Examples]

[0109] Generation of AAV8.CMV.aVEGF Each of the avEGF vectors described herein comprises an expression cassette containing a promoter that drives the expression of anti-VEGF Fab heavy and light chains, each having an IL2 reader sequence. The Fab coding sequences in the vector genomes supported on rAAV in the test composition (suspension) were designed to be identical. The expression cassette is flanked by the 5' ITR of AAV2 and the 3' ITR of AAV2. Each of the vector genomes tested is identical anti-VEGF Includes coding sequence variants of Fab (formerly called aVEGF-Arg or aVEGF-R). In some embodiments, the expressed aVEGF Fab is a homogeneous population. In some embodiments, the expressed aVEGF Fab has heterogeneity at the carboxyl terminus of the heavy chain. The open reading frames of the heavy chain and light chain of IL2-aVEGF are separated by a furin cleavage site / F2A linker encoded to promote equimolar expression of both the heavy and light chains. This can optionally be 0, 1, 2, 3 or This results in the expression of an aVEGF heavy chain containing four amino acids at its carboxyl terminus: arginine, arginine-lysine, arginine-lysine-arginine, or arginine-lysine-arginine-arginine.

[0110] Various coding sequences are referred to as aVEGFv1, v2, etc. These vector genomes are presented in the sequence listings referenced herein as part of this specification.

[0111] The following elements of the transgene cassette in the AAV2 / 8 vector were evaluated for the expression of anti-VEGF Fab in mice. ●Seven different promoters (98 male C57BL / 6 mice, Jackson Laboratories) were evaluated using a conventional antibody (F16) expressed from AA2 / 8. F16mAb expression was measured by ELISA against hemagglutinin (HA) protein. ●Two different leader peptides were used (28 male C57BL / 6 mice, Jackson Laboratories). Expression of anti-VEGF Fab was measured by ELISA against VEGF. ●Three different light-heavy chain segregators (42 male C57BL / 6 mice, Jackson Laboratories) were evaluated using the following vectors.

[0112] [Table 1]

[0113] The expression of anti-VEGF Fab was measured by ELISA against VEGF. ● 13 different code sequences (182 male C57BL / 6 mice, Jackson) (Laboratories). Anti-VEGF Fab expression was measured by ELISA against VEGF.

[0114] The vector was delivered to the subretinal space of the mouse eye. Reporter gene expression was measured by enzyme-linked immunosorbent assay (ELISA).

[0115] Seven different promoters were evaluated in separate tests: three viruses (cytom Promoters for gallovirus [CMV], thymidine kinase [TK], Simian virus [SV40]), three nonviral (phosphoglycerate kinase [PGK], human elongation factor-1α [EF1a], ubiquitin C [UbC]), and one hybrid (chicken β-actin [CB7]).

[0116] Two different leader peptides were also evaluated using the rAAV8 vector, which has the same vector factors and the same coding sequence, i.e., v3, except for the leader sequence (interleukin vs. serpin leader). AAV2 / 8 = adeno-associated virus (AAV) capsid type 8 with an AAV terminal inversion sequence adjacent to the transgene; amd201Lead = anti-VEGF Fab with IL2 leader sequence and furin F2A as light-heavy chain segregator; amd201altLead = anti-VEGF Fab with SF1 leader sequence and furin F2A as light-heavy chain segregator; CB7 = tri-β-actin promoter; CI = chimeric intron; rBG = rabbit β-globin polyadenylated sequence.

[0117] Three different intrasequence ribosome entry sites (IRES) sequences that separate the heavy and light chains of anti-VEGF Fab were evaluated in a separate study. These IRES sequences were derived from encephalomyocarditis virus (EMCV), cMyc, and foot-and-mouth disease virus 1 (FMDV1). In this study, the vectors were identical except for the light and heavy chain segregators (EMC, FMDV1, and cMyc). AAV2 / 8 = adeno-associated virus (AAV) capsid type 8 with an AAV terminal inversion sequence adjacent to the transgene; amd201 = codon variant of anti-VEGF Fab with an IL2 reader sequence; CMV = cytomegalovirus promoter; EMCV = encephalomyocarditis virus; Fab = fragment antigen-binding region; FMDV1 = foot-and-mouth disease virus 1; IRES = intrasequence ribosome entry site; PI = Promega intron; SV40 = Simian virus polyadenylated sequence.

[0118] In another study, 13 different coding sequences for anti-VEGF Fab were evaluated. The variance of the overall coding sequences was between approximately 20% and 30%. The vectors are listed in the table below.

[0119] Vectors with different coding sequences were used. The sequence numbers of the expression cassettes are shown in the table below.

[0120] [Table 2] In all tests, the vector was diluted with Dulbecco's phosphate-buffered saline (DPBS).

[0121] The animals were assigned to treatment groups, and a 1.00 × 10⁶ sample was taken into the right eye. 9 or 5.00 × 10 9 The AAV2 / 8 vector was administered via genome copy (GC) / eye. The left eye was used as an untreated control. The vector was administered subretally in a total volume of 1 μL.

[0122] A. Subretinal injection Subretinal injection was performed using sterile techniques and sterile dissection instruments. The animals were anesthetized with ketamine / xylazine or 3-5% isoflurane and administered meloxicam. The animals were placed under a dissection microscope with the eye to be injected in the field of view (using 15x magnification). The temporal conjunctiva was grasped with jeweler's forceps and carefully cut down to the sclera using the tip of Vanus iridotomy scissors. Pericornectomy of the conjunctiva was performed by introducing the lower edge of the scissors through the incision and extending it circumferentially both above and below the conjunctiva. All conjunctival fragments were carefully removed from the surface of the sclera. The conjunctiva adjacent to the cornea was grasped with forceps and traction was applied to rotate the eyeball to allow for optimal surgical exposure. A small incision of sufficient size for the blunt-tipped needle to pass through was made using a 30 1 / 2 gauge needle.

[0123] The tip of a 33-gauge blunt-tipped needle, mounted on a Hamilton autoinjector syringe, was introduced into the incision tangentially to the surface of the eyeball. The tip was advanced approximately 1 mm, and the needle was passed along the inner surface of the sclera. The 33-gauge needle passed through the sclera and choroid, and then terminated in the subretinal space. Up to 1 μL of the vector was delivered. After the procedure was complete, an antibiotic ophthalmic ointment was applied to the eye.

[0124] B. Assay Method The collected eyes were homogenized by placing the entire eyeball into a conical tube containing stainless steel beads and a cocktail of 200 μL of protein lysis and extraction buffer (RIPA), cOmplete®, and Mini Protease Inhibitor Cocktail tablets (1 tablet / 10 mL of RIPA buffer). The eyes were homogenized in a TissueLyser (Qiagen, USA) for at least 2 minutes, or until completely homogenized. The homogenates were centrifuged at 12,000 RPM for 20 minutes at 4°C in a cold room. The supernatant was transferred to a new tube and used in analytical assays.

[0125] Measurement of protein concentration in ocular homogenates Protein concentrations in eye homogenates were measured using the Pierce® BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Equal amounts of protein from all samples were used in ELISA.

[0126] Enzyme-linked immunosorbent assay A 96-well round-bottom plate was coated overnight at 4°C with 2 μg / mL HA A-Beijing or 1 μg / mL VEGF. After coating, the plate was washed five times with phosphate-buffered saline (PBS) (PBS-T) containing 200 μL of 0.05% Tween-20 using a 405 TS Washer (BioTek Instruments, Winooski, VT). The plate was blocked at room temperature (RT) for 1 hour with 200 μL / well of 1% bovine serum albumin (BSA). After washing (as described), 100 μL / well of sample was packed into the double wells and incubated at 37°C for 1 hour. After incubation, the plate was washed (as described) and then blocked at RT for 1 hour with 1% BSA. After washing (as described), 100 μL / well of primary antibody was added and incubated at RT for 1 hour. Next, the wells were washed (as described) and incubated with 100 μL / well of secondary antibody in RT for 1 hour. Following a final wash (as described), 150 μL / well of the detection substrate, 3,3',5,5'-tetramethylbenzide, was added and incubated in RT for 30 minutes in the dark. The reaction was stopped with 50 μL / well of 2N H2SO4. The plate was then read using a SpectraMax® M3 spectrophotometer (Molecular Devices, Sunnyvale, CA) at 450 nm / 540 nm excitation / emission.

[0127] The following primary antibodies were used: 1.0 mg / mL of pre-adsorbed 1.0 mg / mL goat anti-human IgG H&L (biotin) (Abcam, 0.5 mg / mL) diluted 1:10000 in PBS; and 0.5 mg / mL of pre-adsorbed 0.5 mg / mL goat anti-human IgG H&L (biotin) (Abcam, 1 mg / mL) diluted 1:5000 in PBS. The following secondary antibody was used: 1 mg / mL streptavidin (HRP) diluted 1:30000 in PBS.

[0128] Statistical analysis: The mean and standard deviation values ​​of reporter gene concentrations for ELISA were calculated using Microsoft Office Excel 2010.

[0129] C. Results AAV2 / 8 vectors with seven different promoters were evaluated for FI6 mAb expression. When using promoter EF 1-α, FI6 mAb expression was not observed in any of the animals. Promoters SV40.PI and PGK.P were used. When using I and TK.PI, FI6 mAb expression was low. Promoters CMV.PI, CB7.CI, and UbC.PI demonstrated the highest expression of FI6 mAb. In all animals, no expression was observed in the untreated left eye (data is available in the file). AAV2 / 8 vectors with two different leader peptides were evaluated for anti-VEGF Fab expression. When using the leader peptide aVEGFv7 with the SF2 leader, anti-VEGF Fab expression was higher at low doses compared to aVEGFv7 with the IL2 leader. At high doses, anti-VEGF Fab expression was similar for both leader peptides. In all animals, no expression was observed in the untreated left eye (data is available in the file). AAV2 / 8 vectors with three different light-heavy chain segregators were evaluated for anti-VEGF Fab expression. When the cMyc light-heavy chain segregator was used, anti-VEGF Fab expression was not observed in any animals. Anti-VEGF Fab was expressed at low levels when EMCV and FMDV1 light-heavy chain segregators were present. In all animals, expression was not observed in the untreated left eye (data is available in the file).

[0130] AAV2 / 8 vectors with 13 different coding sequences were evaluated for the expression of the anti-VEGF Fab transgene product. Anti-VEGF Fab expression was low when coding sequences aVEGFv4, aVEGFv5, aVEGFv6, aVEGFv7, aVEGFv8, and aVEGFv9 were used. Expression was higher when coding sequences aVEGFv13, aVEGFv10, aVEGFv11, and aVEGFv12 were used. Anti-VEGF Fab expression was highest when coding sequences aVEGFv1, aVEGFv2, and aVEGFv3 were used. No expression was observed in the untreated left eye of any of the animals (data is available in the file).

[0131] Each vector encodes the same anti-VEGF transgene product. Partially based on these results, a single replication-deficient recombinant AAV8.aVEGF was selected for further development. This vector has a vector genome flanked by the AAV8 capsid, as well as the AAV2 ITR, the CB7 promoter, introns, an anti-VEGF coding sequence selected from the coding sequences described above, and the rBG polyA sequence. This will be referred to as the test vector (or alternatively, the AAV2 / 8.aVEGF test vector or the AAV8.aVEGF test vector) in the following examples, unless otherwise specifically identified. [Examples]

[0132] Pharmacokinetic (PK) studies in non-human primates Macacas were used in this study because they are the species most closely related to humans in terms of studying retinal diseases. Cryomolgus monkeys and humans have similar anatomical structures of the eye, including the fovea. The dimensions of the eye are comparable, making it possible to determine human doses based on the relative retinal area.

[0133] This study was conducted to select the AAV2 / 8 vector for clinical development and to evaluate the toxicity and immunogenicity of the AAV2 / 8 vector and anti-VEGF Fab in cynomolgus monkeys. The study is ongoing. The results presented are based on data collected at 10 months. The evaluation of the toxicity of the AAV2 / 8 vector and anti-VEGF Fab is described. Animals received subretinal administration of the AAV2 / 8 vector. Toxicity was evaluated based on clinical observation, body weight, indirect fundus examination, spectral optical coherence tomography, hematology, coagulation, clinical chemistry, and gross pathological findings. The only adverse finding associated with the AAV2 / 8 vector or anti-VEGF Fab was 1.00 × 10⁻⁶. 11 In some eyes of animals administered the GC / ocular AAV2 / 8 vector, some thinning of the outer granular layer localized at the injection site was observed by spectral-region optical coherence tomography.

[0134] The animals were assigned to four treatment groups. 11 A single dose of AAV2 / 8 vector (100 μL total) per eye was administered to each eye. The vector was administered subretinally to both eyes (confirmed to the naked eye by the appearance of a dome-shaped retinal detachment / retinal bleb under a microscope). The following table lists the test vectors.

[0135] [Table 3]

[0136] subretinal injection For subretinal injection, the needle was inserted through a sheath needle introduced by a dural incision at the 2 o'clock or 10 o'clock position. The needle was advanced through the vitreous humor and penetrated the retina at the posterior pole. Under microscopic control, 100 μL of the test sample was injected into the subretinal space. This was confirmed by the appearance of a dome-shaped retinal detachment / retinal bleb. If the initial injection attempt did not result in retinal detachment, the cannula was moved to another site in the retina. The injection site may result in a temporary blind spot. The injected solution was reabsorbed by the retina within a few hours. Retinal detachment occurred in the peripheral retina and did not result in permanent blindness. The dural incision site was sutured with absorbable sutures, and the eye was treated with PredG ointment or equivalent. Subconjunctival Kenalog or equivalent was administered. Animals were observed daily, and analgesics were administered parenterally as needed. If vitreous inflammation occurred, the animals were treated with topical atropine and PredG ointment or equivalent until the symptoms resolved.

[0137] Collection of anterior chamber fluid The animals were anesthetized and their heads were fixed. Betadine 5% disinfectant and propalacaine or equivalent were applied to each eye. A retractor was positioned to allow access to the anterior chamber. The procedure was performed using a tuberculin syringe fitted with a 27-30 gauge subcutaneous needle. The eye was held stably with forceps or a cotton swab over the nasal conjunctiva. The needle was inserted obliquely upward through the marginal cornea anterior to the iris. Once in the eye, the sampler slowly withdrew the plunger of the syringe to aspirate aqueous humor. A maximum of 100 μL of anterior chamber fluid was collected. After the anterior chamber fluid was removed, the needle was withdrawn from the eye. The anterior chamber fluid was placed on moist ice until use or storage. After the procedure, topical flurbiprofen, PredG ointment, and an antibiotic infusion were applied to each eye. Anterior chamber fluid was collected on the following test days (occasionally adjusted due to weekends, holidays, or scheduling issues). ● 0, 15, 29, 43, 57, 71, 85, 120, 149, 183, 212, 2 47, 274, and 302.

[0138] Spectral optical coherence tomography The structure of the retina (with micron-level resolution) was evaluated in vivo using non-invasive cross-sectional retinal microscopy with SD-OCT (Spectralis OCT, Heidelberg Engineering, Carlsbad, CA). Pupils were dilated with phenylephrine 2.5% and tropicamide 1%. Frontal retinal imaging was performed using a scanning laser ophthalmoscope of this imaging system, by near-infrared (NIR) reflectance (REF) and, in a subset of animals, NIR fundus autofluorescence (FAF). Spectral-region optical coherence tomography scans were performed by superimposing 9 mm long horizontal and vertical sections passing through the fovea, as well as a 30 × 25 mm raster scan extending to approximately the intermediate region. See Aleman, Invest Ophthalmol Vis Sci. 2007 Oct;48(10):4759-65.

[0139] Enzyme-linked immunosorbent assay (ELISA) The ELISA was performed essentially as described in the mouse study described above. For the expression of anti-VEGF Fab, a 96-well round-bottom plate was coated with 1 μg / mL of VEGF. The plate was coated overnight at 4°C. After coating, the plate was washed five times with phosphate-buffered saline (PBS) (PBS-T) containing 200 μL of 0.05% Tween-20 using a 405 TS Washer (BioTek Instruments, Winooski, VT). The plate was blocked at room temperature (RT) for 1 hour with 200 μL / well of 1% bovine serum albumin (BSA). After washing (as described), 100 μL / well of sample was packed into the double wells and incubated at 37°C for 1 hour. After incubation, the plate was washed (as described) and then blocked at RT for 1 hour with 1% BSA. After washing (as described), 100 μL / well of primary antibody was added and incubated in RT for 1 hour. Next, the wells were washed (as described) and incubated with 100 μL / well of secondary antibody in RT for 1 hour. Following a final wash (as described), 150 μL / well of the detection substrate, 3,3',5,5'-tetramethylbenzide, was added and incubated in RT for 30 minutes in the dark. The reaction was stopped with 50 μL / well of 2N H2SO4. The plate was then read using a SpectraMax® M3 spectrophotometer (Molecular Devices, Sunnyvale, CA) at 450 nm / 540 nm excitation / emission. The following primary antibody was used: 1.0 mg / mL goat anti-human IgG, pre-adsorbed and diluted 1:10000 in PBS. H&L (biotin): 0.5 mg / mL goat anti-human IgG H&L (biotin) pre-adsorbed at a 1:5000 dilution in PBS. The following secondary antibody was used: 1 mg / mL streptavidin (HRP) at a 1:30000 dilution in PBS.

[0140] The mean and standard deviation values ​​of anti-VEGF Fab concentrations in anterior chamber fluid and blood were calculated using Microsoft Office Excel 2010.

[0141] A. Pharmacological results In this example, four AAV vectors having different promoters and coding sequences were evaluated as described above. The vectors were administered subretinally. Anti-VEGF Fab expression was measured by enzyme-linked immunosorbent assay.

[0142] Anti-VEGF Fab expression in anterior chamber fluid Similar expression dynamics were observed in the anterior chamber fluid of all animal groups (Figures 3A-3D, 4A-4D). The onset of anti-VEGF Fab expression was rapid, generally within 7 days. Steady-state expression levels were achieved within 1 month. Two animals were used up to the last evaluation point. All other cells continued to express anti-VEGF Fab at a steady-state level.

[0143] One animal in group 2 (Figure 3B) and one animal in group 5 (Figure 4A) lost the expression of anti-VEGF Fab. This loss of expression coincided with the appearance of antibodies against anti-VEGF Fab. No differences in anti-VEGF Fab expression were observed between males and females, or between the right and left eyes.

[0144] In general, vectors regulated by the CB7.CI promoter (Figures 4A-4D) expressed anti-VEGF Fab at higher levels than vectors regulated by the UbC.PI promoter (Figure 3). Vector AAV2 / 8.CB7.CI.aVEGFv3aVEGFv3.rBG was selected as the most important vector for clinical development. This selection was based on the transgene expression level, the better transferability of the relative expression levels of the aVEGFv3 coding sequence from mouse to cynomolgus monkeys, and the superior levels experienced by the CB7.CI promoter.

[0145] Expression of anti-VEGF Fab in the blood Ranibizumab was observed in serum in some patients who received a single IVT injection of Lucentis (Xu, 2013). To determine whether subretinal administration of the AAV2 / 8 vector resulted in systemic exposure to anti-VEGF Fab, its serum concentration was measured.

[0146] Anti-VEGF Fab expression was near baseline levels in the blood of all animals (Figures 3A-3D, 4A-4D).

[0147] B. Toxicology The toxicity assessment of the AAV2 / 8 vector and anti-VEGF Fab is described in subpart B of this document. Animals were administered the AAV2 / 8 vector subretinally. Toxicity was assessed based on clinical observation, body weight, indirect fundus examination, spectral-region optical coherence tomography (SD-OCT), hematology, coagulation, clinical chemistry, and gross pathology findings.

[0148] For each variable in each treatment group, the measurement at each time point was compared to the corresponding baseline value using the Wilcoxon rank-sum test. The Wilcoxon rank-sum test is a non-parametric alternative to the two-sample t-test, which is based solely on the ranks of the observations from the two samples. It is a preferred test for datasets with small sample sizes. Statistical significance was declared at the 0.05 level without adjustment for multiple tests. The analysis was performed using the R program (version 3.3.1; cran.r-project.org / ) with the "wilcox.test" function.

[0149] The trial is ongoing. The results presented are based on data collected up to 10 months. There were no deaths in this trial. No adverse clinical observations related to the AAV2 / 8 vector or anti-VEGF Fab were observed in any of the animals. No clinically significant changes in body weight were observed in any of the animals during the trial. No adverse findings related to the AAV2 / 8 vector or anti-VEGF Fab were observed in any of the animals during indirect fundus examination.

[0150] Spectral optical coherence tomography A total of four animals (eight eyes) in group 6 were imaged using SD OCT. Intermediate dose level AAV8.aVEGF test vector (1.00 × 10⁻¹⁴) 11 The injected area of ​​the eye that received GC / ocular administration was 1.00 × 10⁻⁶ as described in Example 7 (particularly subpart B). 10 and 1.00 × 10 12 Intermediate results were shown compared to the dose level. Two animals (Animal C7) Some thinning of the ONL was observed in animal C65936 (data available in file). In addition, minimal changes were observed in two animals (animals C74422 and C74414) (data available in file). No clinically significant changes in hematological, coagulation, or clinical chemistry parameters were observed in any of the animals.

[0151] No findings associated with the AAV2 / 8 vector or anti-VEGF Fab were observed in the two animals sacrificed at 10 months. In animal C65936, liver heaviness was observed, which was microscopically localized chronic grade 3 inflammation. In animal C74414, bilateral grade 3 lymphoid tissue hyperplasia was observed. These findings were not associated with the AAV2 / 8 vector or anti-VEGF Fab. 1.00 × 10 11 At GC / ocular AAV2 / 8 vector dose levels, the only finding associated with the AAV2 / 8 vector or anti-VEGF Fab was minimal vacuolation of the lens in the right eye of animal C65926. In animal C74414, minimal perivascular mononuclear cell infiltration around the vascular structure of the right optic nerve was observed. In the same animal, minimal subconjunctival infiltration of mononuclear cells was noted in the left eye, and minimal perivascular extraocular mononuclear cell infiltration was noted in the right eye.

[0152] The only adverse finding associated with the AAV2 / 8 vector or anti-VEGF Fab was 1.00 × 10⁻⁶. 11Some thinning of the ONL localized at the injection site was observed by SD-OCT in some eyes of animals administered the GC / ocular AAV2 / 8 vector.

[0153] C. Immunology This section describes the evaluation of the immunogenicity of the AAV2 / 8 vector and anti-VEGF Fab. The vector was administered subretinally as described above in this example. Immunogenicity was evaluated by the presence of IgM and IgG antibodies against anti-VEGF Fab, neutralizing antibodies against the AAV8 capsid, and cellular immune responses against the AAV2 / 8 vector and anti-VEGF Fab.

[0154] In summary, one animal in each of groups 2 and 5 exhibited antibodies against anti-VEGF Fab, high levels of Nab against AAV8 capsid, and a T-cell response. Both animals had lost anti-VEGF Fab expression. Animals with pre-existing Nab against AAV8 capsid generally showed an increased response after administration of the AAV2 / 8 vector compared to animals without pre-existing Nab. In some animals sacrificed at approximately 300 days of the study, Nab against AAV8 capsid was observed in the vitreous fluid. Antibodies against anti-VEGF Fab and a T-cell response were not observed at all in animals in group 6. In animals in group 6, only a slight change in Nab levels was observed after administration of the AAV2 / 8 vector.

[0155] Anti-VEGF Fab was expressed in all animals administered with the AAV2 / 8 vector (Part A of this example). Two animals (animal C74440 and animal C68127) lost the expression of anti-VEGF Fab. The loss of expression coincided with the appearance of antibodies against anti-VEGF Fab.

[0156] Overall, IgM and IgG levels against anti-VEGF Fab were below baseline levels in anterior chamber fluid and serum. In some animals, increases above baseline levels were observed at certain time points. In one animal each in group 2 (animal C74440) and group 5 (animal C68127), the level of IgG against anti-VEGF Fab in anterior chamber fluid increased above baseline levels for approximately 6 months. Subsequently, the levels were Generally, levels increased. In both animal groups, IgG against anti-VEGF Fab increased above serum baseline levels. These increases in IgG were consistent with the loss of anti-VEGF Fab expression. Importantly, in group 6 animals, IgM and IgG against anti-VEGF Fab were undetectable or below baseline levels throughout the study period.

[0157] In short, the animal immune system tolerated the continued local expression of the anti-VEGF transgene product, despite the fact that the transgene product was a human antibody.

[0158] Presence of neutralizing antibodies against AAV8 capsid Baseline levels of NAb against the AAV8 capsid were measured in serum derived from blood samples collected on day 0 of the study. The limit of detection was 1:5 dilution, and titers less than 5 were considered undetectable. In two of the 16 animals (animals C63116 and C66122), no pre-existing NAb was observed in the serum. Following administration of the AAV2 / 8 vector, NAb levels in these two animals remained below the limit of detection or were low. Pre-existing NAb was observed in 14 of the 16 animals. In 11 of these animals, NAb levels fluctuated throughout the study. In one animal each from group 2 (animal C74440) and group 5 (animal C68127), following administration of the AAV2 / 8 vector, NAb levels increased to 256 and 128, respectively, at 2-fold dilution at 2 months. These increases in NAb were consistent with the loss of anti-VEGF Fab expression. The presence of NAb in the vitreous fluid was evaluated in six sacrificial animals from groups 2, 3, and 5. In two animals (animals C63116 and C66122) where serum NAb was undetectable at the time of sacrifice, NAb was not present in the vitreous fluid at the time of sacrifice. In the remaining animals, the level of NAb at the time of sacrifice did not correlate with the level in the serum at the time of sacrifice. Pre-existing NAb was observed in all animals in group 6. The levels of NAb in these animals changed slowly throughout the experiment.

[0159] T cell response to AAV2 / 8 vector and anti-VEGF Fab In one animal from group 2 (animal C74440), an elevated T cell response was observed at a single time point. This animal also showed antibodies against anti-VEGF Fab and neutralizing antibodies against the AAV8 capsid. This animal had lost the expression of anti-VEGF Fab. In one animal from group 5 (animal C65873), a sustained T cell response presented to the pool B peptide of the AAV8 capsid was observed, including in a pre-injected baseline sample. This same animal had the highest level of NAb after administration of the AAV2 / 8 vector. Another animal from the same group (animal C68127) produced T cells against the entire peptide pool of the AAV8 capsid, but these were not sustained over time. This animal had antibodies against anti-VEGF Fab and the second highest level of NAb. This animal had lost the expression of anti-VEGF Fab.

[0160] No sustained T cell response was observed to these other transgene products. In group 6 animals, no sustained T cell response was observed at all. [Examples]

[0161] A useful animal model for evaluating AAV2 / 8.aVEGF and anti-VEGF transgene products. VEGF transgenic mice were used as animal models for exudative AMD. Two such models include the Rho / VEGF mouse model and the Tet / opsin / VEGF model.

[0162] A.Rho / VEGF Mouse Model Rho / VEGF mice are transgenic mice in which the rhodopsin promoter drives the expression of human vascular endothelial growth factor (VEGF165) at photoreceptors, causing new blood vessels to sprout from the deep capillary bed of the retina and grow toward the subretinal space from day 10 postnatally. VEGF production is sustained, and therefore the new blood vessels continue to grow and dilate, forming a large network in the subretinal space similar to that seen in humans with age-related macular degeneration. (Tobe, Takao, et al. "Evolution of neovascularization in mice with overexpression of See "Vascular endothelial growth factor in photoreceptors." Investigative Ophthalmology & Visual Science 39.1(1998):180-188.

[0163] Enzyme-linked immunosorbent assay (ELISA) can be performed as follows: Briefly coat the plate with 1 μg / mL VEGF overnight at 4°C. Use 1% BSA as blocking buffer and incubate at room temperature for 1 hour at 200 μL per well. Double-pack the sample with 100 μL per well and incubate at 37°C for 1 hour, followed by incubation with secondary blocking buffer. The primary antibody is biotin-conjugated goat anti-human IgG H&L, and is left to incubate at room temperature for 1 hour at 100 μL per well. The secondary antibody is streptavidin diluted 1:30,000, and is packed with 100 μL per well and incubated at room temperature for 1 hour. Use TMB solution as the detection substrate (0.1 M NaOAc citrate buffer (pH 6.0), hydrogen peroxide, 100× TMB stock), pack with 150 μL per well, and incubate at room temperature for 30 minutes in the dark. 50 μL of stop solution (2N H2SO4) was added to each well, and then each plate was read at 450 nm–540 nm.

[0164] In one test conducted using this model and the AAV8.aVEGF test described in the preceding examples, the ELISA results were as follows:

[0165] [Table 4]

[0166] [Table 5] Anti-VEGF Fab levels are indicated in ng / eye.

[0167] B.Tet / Opsin / VEGF Mouse Model Tet / opsin / VEGF mice are transgenic mice that are normal until administered doxycycline in their drinking water. Doxycycline induces very high expression of vascular endothelial growth factor (VEGF) at photoreceptors, leading to extensive vascular leakage, and within 4 days of induction, 80-90% of mice develop total exudative retinal detachment. (Ohno-Matsui, Kyoko, et al. "Inducible expression of vascular endothelial growth factor") See "In adult mice causes severe proliferative retinopathy and retinal detachment." The American Journal of Pathology 160.2(2002):711-719.

[0168] The ELISA can be performed as described in Part A of this example. In one test performed using this model and the AAV8.aVEGF test as described in the preceding example, the ELISA results were as follows: The results are shown in the table below as mean ± standard deviation (Std).

[0169] [Table 6]

[0170] [Table 7]

[0171] C. Other animal models Other animal models of exudative AMD were used. In laser trauma models, high-power, focused laser energy is used to induce damage in Bruch's membrane. Subretinal injection of Matrigel, VEGF, macrophages, lipid hydroperoxides, and / or polyethylene glycol induces choroidal neovascularization (CNV), a pathological condition of exudative AMD. Pennesi, Mark E., Martha Neuringer, and R See Obert J. Courtney, "Animal models of age-related macular degeneration," Molecular aspects of medicine 33.4(2012):487-509.

[0172] An optimized rAAV.aVEGF vector was generated, diluted, and delivered to the subretinal space of the eyes of transgenic mice at the doses described in the preceding examples. The expression of the reporter gene, VEGF, and anti-VEGF antibody in the eyes and / or plasma was measured by PCR, qPCR, ddPCR, oqPCR, Western blotting, and ELISA, as described in the preceding examples. Electron microscopy and immunohistochemical analysis were also performed to assess retinal neovascularization. The number of lesions per retina, the area per lesion, the neovascular area per retina, and the histopathological evaluation of the retina in tractional retinal detachment were quantified. [Examples]

[0173] Evaluation of anti-VEGF Fab (transgene product) expression in cynomolgus monkeys This study was conducted to evaluate the expression of anti-VEGF Fab (transgene product) in cynomolgus monkeys following administration, and to assess the toxicity, immunogenicity, and in vivo distribution of the AAV8 vector expressing anti-VEGF Fab. This report describes the expression of the transgene product and the immunogenicity of the vector. Animals were administered subretinally with either the AAV2 / 8.aVEGF vector or FFB-314 (control sample) as described in these examples. The expression of the transgene product in the anterior chamber fluid and blood was measured by enzyme-linked immunosorbent assay (ELISA). Immunogenicity was assessed by the presence of neutralizing antibodies (NAb) against the AAV8 capsid before and after administration. The transgene product was expressed in the anterior chamber fluid of all animals administered the vector. The transgene product was not expressed in the blood. An increase in NAb levels was observed in one animal administered AAV8.aVEGF (C73723), which had pre-existing NAb levels.

[0174] The animals in this study were 1.00 × 10 12 A single dose of AAV8.CB7.CI.aVEGFv3.rBG or formulation buffer, FFB-314, was administered to each eye via genome copy (GC).

[0175] AAV8.CB7.CI.aVEGFv3.RBG and FFB-314 were administered subretinally in the right eye in a total volume of 100 μL (visually confirmed by the appearance of a dome-shaped retinal detachment / retinal bleb under a microscope).

[0176] Animals were randomized using www.jamestease.co.uk / team-generator. Using www.randomizer.org / , one of four animals was randomly selected and assigned to group 2. The remaining three animals were assigned to group 1. The group design and dose levels for this study are presented in the table below.

[0177] [Table 8]

[0178] The animals were euthanized on the 7th day of the test. Anterior chamber fluid and blood samples were collected to determine the expression of the anti-VEGF Fab transgene product and / or the presence of NAb against the AAV8 capsid.

[0179] Subretinal injection was performed as described in the previous examples. Anterior chamber fluid collection was performed as described in the previous examples. For ELISA, 96-well round-bottom plates were coated with 1 μg / mL of VEGF for the expression of the anti-VEGF Fab transgene product, or with 0.5 μg / mL of commercially available anti-VEGF Fab for the expression of IgM and IgG in response to the anti-VEGF Fab transgene product. The ELISA method was as described in the previous examples.

[0180] The following primary antibodies were used: 1.0 mg / mL goat anti-human IgG H&L (biotin) pre-adsorbed at a 1:10000 dilution in PBS; and 0.5 mg / mL goat anti-human IgG H&L (biotin) pre-adsorbed at a 1:5000 dilution in PBS. The following secondary antibody was used: 1 mg / mL streptavidin (HRP) at a 1:30000 dilution in PBS.

[0181] Neutralizing antibody assay Neutralizing antibodies in response to AAV8 capsids were analyzed as follows: Poly-D lysine-coated 96-well black-walled / clear-bottom plates were analyzed in 1 × 10⁶ wells. 5 Human embryonic kidney 293 (HEK293) cells were seeded in cells / well (referred to as cell plates), and the plates were incubated overnight at 37°C. The following day, serum samples were heat-inactivated at 56°C for 30 minutes. The heat-inactivated samples and recombinant vector (1 × 10⁶) were then used. 9For the serum-vector plates, AAV8.CMV.LacZ provided by the Penn Vector Core at the University of Pennsylvania was used. The recombinant vector was diluted in serum-free Dulbecco's Modified Eagle Medium (DMEM) and incubated at 37°C for 1 hour with heat-inactivated samples in a two-fold serial dilution (starting at 1:5). Before combining the serum-vector plates and the cell plates, HEK293 cells (here 2×10 5 cells / well) were infected with wild-type HAdV5 (90 particles / cell) and incubated at 37°C for 2 hours. After incubation, the serum-vector plates and the cell plates were combined and incubated at 37°C for 1 hour. After incubation, equal volumes of 20% fetal bovine serum (FBS) and DMEM were added to each well, and the combined plates were cultured at 37°C for an additional 18 - 22 hours. The next day, the combined plates were washed with PBS, the HEK293 cells were lysed, and the lysates were developed using a mammalian β-galactosidase bioluminescence assay kit according to the manufacturer's instructions. As a control, mouse serum was used instead of the serum samples. The resulting luminescence was measured using a SpectraMax® M3 microplate luminometer. The resulting NAb titer was reported as the serum dilution that inhibited transduction of at least 50% of the vectors compared to mouse serum.

[0182] Statistical analysis The mean and standard deviation values of the concentrations of the anti-VEGF Fab transgene product in the aqueous humor and blood were calculated using Microsoft Office Excel 2010.

[0183] Results Expression of the anti-VEGF Fab transgene product in the aqueous humor The anti-VEGF Fab transgene product was not expressed in the aqueous humor of animals administered FFB-314. The anti-VEGF Fab transgene product was expressed in the aqueous humor collected from the right eyes of all animals administered the AAV8.aVEGF test vector. No expression was observed in the left eye. No difference in the expression of the anti-VEGF Fab transgene product was observed between male and female.

[0184] Expression of the anti-VEGF Fab transgene product in blood Ranibizumab was observed in the serum of some patients administered a single intravitreal injection of Lucentis (Xu, Invest Ophthalmol Vis Sci, 54:1616 - 24 (2013)). To determine whether subretinal administration of the AAV8.aVEGF test vector resulted in systemic exposure of the anti-VEGF Fab transgene product, its concentration in the serum was measured.

[0185] Expression of the anti-VEGF Fab transgene product in the blood of animals administered FFB-314 and all animals administered the AAV8.aVEGF vector was below the non-specific background level compared to the corresponding pre-injection levels.

[0186] Presence of neutralizing antibodies against the AAV8 capsid The baseline level of NAbs against the AAV8 capsid was measured in serum from blood samples collected on day 0 of the study day. The detection limit was a 1:5 dilution, and titers less than 5 were considered non-detectable.

[0187]

Table 9

[0188] Animals administered FFB-314 had pre-existing NAbs against the AAV8 capsid (see previous table). One animal (C74431) administered the AAV8.aVEGF test vector did not have detectable NAbs against the AAV8 capsid. Two animals (C73723, C65027) administered the AAV8.aVEGF test vector had pre-existing NAbs against the AAV8 capsid that were observed and persisted on day 7 (see previous table).

[0189] Toxicity was assessed based on clinical observations, body weight, indirect fundus examination, hematology, coagulation, clinical chemistry, and gross pathological findings. There were no deaths or unplanned casualties in this study. No adverse clinical observations related to the AAV8.aVEGF test vector or the anti-VEGF Fab transgene product were observed in any of the animals. Some animals exhibited intermittent, transient diarrhea without affecting animal activity due to stable body weight. No clinically significant changes in body weight were observed in any of the animals during the study. No adverse findings related to the AAV8.aVEGF test vector or the anti-VEGF Fab transgene product were observed in any of the animals during indirect fundus examination. No clinically significant changes were observed in hematological, coagulation, or clinicochemical parameters in any of the animals. All clinicopathological parameters were within the normal range in all animals. No macroscopic findings were present in animals C64956 and C74431. The surface of the right and left kidneys of C73723 was pale. Focal lesions were present in the liver of C65027. In conclusion, no major toxicological findings were present.

[0190] The test vector used in Examples 6-11 is rAAV8.CB7.CI.aVEGFrv3.rBG. [Examples]

[0191] Expression of AAV2 / 8.aVEGF vector in cynomolgus monkeys This study was conducted in cynomolgus monkeys to evaluate the expression of anti-VEGF transgene products and to assess the effects of loss of AAV2 / 8.aVEGF, anti-VEGF transgene products, and AAV8.aVEGF on toxicity, immunogenicity, and normal retinal function. The study is ongoing.

[0192] In this study, the AAV2 / 8.aVEGF described above in the examples was used. The vector was diluted in Dulbecco's phosphate-buffered saline (DPBS) containing 0.001% Pluronic F-68. FFB-314 (DPBS containing 0.001% Pluronic F-68) was used as the control sample. The study is ongoing. The results presented are based on data collected at 3 months.

[0193] Macaques were used because they are the closest species to humans in terms of studying retinal diseases. These monkeys and humans have similar anatomical structures of the eye, including the fovea. The dimensions of the eye are comparable, making it possible to determine human doses based on the relative retinal area.

[0194] The animal in Example 7 was 1.00 × 10 10 Genome copy (GC) / single dose of AAV8.aVEGF, or 1.00 × 10⁻¹⁶ 12 The patient received either GC / ocular AAV8.aVEGF or FFB-314. Both AAV8.aVEGF and FFB-314 were administered subretinally in the right eye in a total volume of 100 μL (visually confirmed by a dome-shaped retinal detachment / retinal bleb under a microscope).

[0195] The animals were randomly assigned to six sets of four animals each using www.jamestease.co.uk / team-generator. After assignment to sets, one animal from each of the six sets was randomly selected using www.randomizer.org / and assigned to the group receiving FFB-314 on each given administration day (groups 2, 4, 6, 8, 10, and 12). The remaining three animals were then divided into 1 × 10⁻¹⁶ animals. 12 GC / eye or 1×10 10 Participants were assigned to receive GC / ocular AAV8.aVEGF (groups 1, 3, 5, 7, 9, and 11). The group designations and dose levels for Examples 6 and 7 are presented below.

[0196]

Table 10

[0197] A. Pharmacology The results presented are based on data collected at the 3-month time point. In this report, the expression of the anti-VEGF Fab transgene product is described.

[0198] 1. Methods Animals were administered the AAV8.aVEGF test vector or FFB-314 (control sample) subretinally. The expression of the anti-VEGF transgene product in aqueous humor and blood was measured by enzyme-linked immunosorbent assay (ELISA), which was performed as described in the previous examples.

[0199] 2. Pharmacological Results (a) Expression of the transgene product in aqueous humor The transgene product was not expressed in the aqueous humor of any of the animals administered FFB-314. The transgene product was expressed in the aqueous humor of all animals administered the AAV8.aVEGF test vector. The onset of expression was rapid, generally within 7 days. Steady-state expression levels were achieved within 1 month. All animals continued to express the transgene product at steady-state levels until the last time point evaluated. However, the overall expression level of the anti-transgene product was higher in animals administered the AAV8.aVEGF test vector at 1.00 × 10 GC / eye. No difference in the expression of the transgene product was observed between males and females. 12 GC / eye. No difference in the expression of the transgene product was observed between males and females.

[0200] (b) Expression of the transgene product in blood Ranibizumab was observed in serum in some patients who received a single IVT injection of Lucentis (Xu, Invest Ophthalmol Vis Sci. 2013 Mar 5, 54(3):1616-24). To determine whether subretinal administration of the AAV2 / 8.aVEGF test vector described in these examples resulted in systemic exposure to the anti-VEGF Fab transgene product, its serum concentration was measured. Expression of the anti-VEGF Fab transgene product was below nonspecific background levels in the blood of all animals administered the AAV8.aVEGF test vector, compared to the corresponding pre-injection levels.

[0201] 3. Conclusion ● The anti-VEGF Fab transgene product was expressed in the anterior chamber fluid of all animals administered the AAV8.aVEGF test vector.

[0202] ● The anti-VEGF Fab transgene product was not expressed in the blood of any animals administered the AAV8.aVEGF test vector.

[0203] B. Toxicology This report describes the toxicity evaluation of the AAV2 / 8.aVEGF test vector. Animals were administered either the AAV8.aVEGF test vector or FFB-314 (control sample) subretinally. Toxicity was evaluated based on clinical observation, body weight, intraocular pressure, indirect fundus examination, spectral optical coherence tomography, hematology, coagulation, clinical chemistry, and gross and histopathological findings.

[0204] Intraocular pressure (IOP) was assessed via rebound tonometry (TonoVet). This method is easy to use and does not require local anesthesia. Rebound tonometry estimates OP by using an induction coil to magnetize a small plastic-tipped metal probe that is fired against the cornea. As the probe rebounds back to the device, it generates an induced current, from which OP is calculated. Up to two data readings were performed, from which the average OP was determined to demonstrate the accuracy of the results. The device was applied according to the manufacturer's instructions.

[0205] The structure of the retina (with micron-level resolution) was evaluated using in vivo, non-invasive cross-sectional retinal microscopy with SD-OCT (Spectralis OCT, Heidelberg Engineering, Carlsbad, CA). The pupils were dilated with phenylephrine 2.5% and tropicamide 1%. Frontal retinal imaging was performed using near-infrared (NIR) reflectance (REF) and, in a subset of animals, NIR fundus autofluorescence (FAF) with a scanning laser ophthalmoscope of this imaging system. Spectral-region optical coherence tomography scans were performed by superimposing horizontal and vertical sections 9 mm long passing through the fovea, as well as a 30 × 25 mm raster scan extending to approximately the intermediate region.

[0206] The only adverse finding associated with the AAV8.aVEGF test vector was 1.00 × 10⁻⁶. 12 The observed effects were significant retinal thinning and photoreceptor loss, as seen by spectral-region optical coherence tomography in animals administered the GC / ocular test vector.

[0207] C. Electroretinography (ERG) This subpart describes the evaluation of the effects of the AAV8.aVEGF test vector and anti-VEGF Fab transgene product on normal retinal function. Animals were administered either the AAV8.aVEGF test vector or FFB-314 (control sample) subretinally. Retinal function was assessed by full-field electroretinography (ERG). Full-field ERG is a widely used electrophysiological test of retinal function. Electroretinography is the collective potential generated by the retina in response to light stimulation. It is typically recorded by electrodes in contact with the corneal surface. Electroretinography in this study was performed according to the recommendations set forth by the International Society for Clinical Electrophysiology of Visual Vision (ISCEV; McCulloch, Doc Ophthalmol. 2015 Feb;130(1):1-12. 2015). The results presented are based on data collected at 3 months. This report describes the evaluation of the effects of the AAV8.aVEGF test vector and anti-VEGF Fab transgene product on normal retinal function. Animals were administered either the AAV8.aVEGF test vector or FFB-314 (control sample) subretinally. Retinal function was assessed by full-field electroretinography. In summary, 1.00 × 10⁻¹⁰ 10 Administration of the genome copy (GC) / ocular AAV8.aVEGF test vector does not impair retinal function. In contrast, 1.00 × 10⁻⁶ 12 Administration of the AAV8.aVEGF test vector to GC / ocular retinal cells impairs retinal function.

[0208] 1. Electroretinogram (ERG) parameters An electroretinogram (ERG) is typically generated when all retinal cells are in an active response to a flash of light (in dark-adapted animals, a moderate to intense flash). It consists of the following two components: ● Wave α: The first corneal negative signal after a flash. Origin: Photoreceptor photocurrent, the most direct characteristic of photoreceptor function. ● wave b: A corneal positive signal that follows wave a, mostly generated by ON-type bipolar cells (secondary neurons downstream of photoreceptors). In this study, standards and additional protocols in accordance with the International Society for Clinical Electrophysiology of Vision (ISCEV) were used: ●ERG of dark-adapted rods: Stimulation intensity: 0.01~0.02cd sm -2 Response: b-wave only, a-wave absent. Source: Rod "on-type" bipolar cells (secondary neurons driven by input from rods). Meaning: Measurement of rod photoreceptor cell function. Notation in datasheet: "Dim flash" ●Dark adaptation Standard flash ERG: Stimulus intensity: 3cd sm -2 Response: A mixture of A-waves and B-waves from rod and cone photoreceptor cells; 60%-70% of the signal is generated by the rod photoreceptor-driven pathway. Source: Photoreceptors, both rod and cone photoreceptor cells (A-wave); higher-order neurons driven by both rod and cone photoreceptor cells. Meaning: A measure of the function of most rod photoreceptor cells, with low sensitivity to the state of dark adaptation and lower variability than the "dim flash" response. Notation in datasheets: "Standard flash". ●Dark adaptation to bright flash ERG: Stimulation intensity: 10cd sm -2 Response and meaning: The response is the same as for a "standard flash," but the response to a bright flash may be larger in scale and less variable. Notation in the datasheet: "Bright flash" ●Light adaptation Standard flashing cone photoreceptor cell ERG: Stimulation intensity: 30 cd / m² after 5 minutes of light adaptation -2 3cd SM delivered in the presence of background light -2 Response: Waves a and b generated by the cone photoreceptor cell driving pathway. Meaning: In the presence of background light that makes the cone photoreceptor cells completely non-photosensitive, the ERG is exclusively generated by cone photoreceptor cells and cone photoreceptor cell-driven secondary retinal neurons, and measures cone function. Notation in datasheet: "Standard cone ERG" ● Light adaptation: Bright flashing cone ERG (additional to ISCEV standard) Stimulation intensity: 30 cd / m² after 5 minutes of light adaptation. -2 10 cd / s delivered in the presence of background light m -2 Response and meaning: The cone cell-driven ERG was similar to the case of a "standard cone cell ERG," but larger in scale and potentially less variability.

[0209] Each treatment (FFB-314 (vehicle) group, AAV8.aVEGF test vector 1.00 × 10) 10 GC / eye group, AAV8.aVEGF test vector 1.00×10 12 For the GC / eye group, ERG measurements (a-wave amplitude, a-wave latency, b-wave amplitude, b-wave latency) were summarized using the mean and standard deviation (SD) for both treated and control eyes. Paired t-tests were used to compare ERG measurements between the AAV8.aVEGF test vector (treated) eye and the FFB-314 (control eye), and to compare post-injection versus pre-injection measurements. AAV8.aVEGF test vector 1.00 × 10⁶ 10 GC / eye group vs. FFB-314 (vehicle) group, AAV8.aVEGF test vector 1.00 × 10 12 GC / eye group vs. FFB-314 (vehicle) group, and AAV8.aVEGF test vector 1.00 × 10 12 GC / eye group vs. AAV8.aVEGF trial vector 1.00×10 10A two-sample t-test was used to compare ERG measurements for GC / eye groups. The t-test is appropriate when the sample size is small [Winter JCF. Using the Student's t-test with extremely small sample sizes. Practical Assessment, Research and Evaluation. 2013;18(10). Available online: pareonline.net / -getvn.asp?v=18&n=10] or when the data are not normally distributed. See Shuster JJ. Diagnostic for assumptions in moderate to large simple clinical trials: do they really help? Statist.Med. 2005;24:2431-2438; and Ganju JD's comment on “Diagnostic for assumptions in moderate to large simple clinical trials: do they really help?” Statist.Med. 2006;25:1798-1800. All statistical analyses were performed using SAS v9.4 (SAS Institute Inc., Cary, NC), and a two-tailed p-value of 0.05 or less is considered statistically significant.

[0210] 2.Results The anti-VEGF Fab transgene product was expressed in all animals administered the AAV8.aVEGF test vector (see pharmacological results in Part A of this example). Retinal function (post-injection) at 3 months following administration of the AAV8.aVEGF test vector or FFB-314 was compared to pre-injection retinal function in both treated and untreated eyes. Animals in group 8 were excluded from data analysis due to unobtainable ERGs after FFB-314 administration.

[0211] [Table 11]

[0212] a. Comparison of retinal function between treatment groups Regarding the treated eyes, post-injection retinal function was (1.00 × 10) in the low-dose group. 10 The GC / ocular AAV8.aVEGF test vector and the FFB-314 group were equivalent in animals (see the table above). For treated eyes, the high-dose group (1.00 × 10) 12 In animals treated with GC / ocular AAV8.aVEGF test vector, post-injection retinal function was significantly reduced compared to animals in the FFB-314 group (see the table above). In treated eyes, post-injection retinal function in the high-dose group was significantly reduced compared to animals in the low-dose group (see the table above). In untreated eyes, post-injection retinal function was equivalent to pre-injection in all groups.

[0213] b. Comparison of retinal function within the treatment group In treated eyes, post-injection retinal function was equivalent to the corresponding pre-injection baseline in the low-dose and FFB-314 groups. In treated eyes, post-injection retinal function was reduced compared to the corresponding pre-injection baseline in the high-dose group. In untreated eyes, post-injection retinal function was equivalent to the corresponding pre-injection baseline.

[0214] E. Virus shedding Depletion of the AAV8.aVEGF test vector was measured by quantitative PCR analysis targeting the transgene-specific sequence in tear, nasal secretion, serum, saliva, urine, and fecal samples. Samples were collected before and after administration of the AAV8.aVEGF test vector or FFB-314. The AAV8.aVEGF test vector DNA was identified as the AAV8.aVEGF test vector It was readily detectable in many samples taken from animals administered with the drug. The presence of AAV8.aVEGF DNA was dose-dependent, transient, and decreased over time.

[0215] F. Immunogenicity This study describes the immunogenicity of the AAV8.aVEGF test vector and the anti-VEGF Fab transgene product. Immunogenicity was assessed as follows: ● Presence of IgM and IgG antibodies against anti-VEGF Fab transgene products using enzyme-linked immunosorbent assay (ELISA); ● Presence of neutralizing antibodies (NAbs) against AAV8 capsid using NAb assays; ●T cell response to AAV8.aVEGF test vector and anti-VEGF Fab transgene product using enzyme-linked immunosorbent spot (ELISPOT) assay.

[0216] In this example, as described above, animals were administered either the AAV8.aVEGF test vector or FFB-314 (control sample) subretinally. No sustained IgM, IgG, or T cell response to the anti-VEGF Fab transgene product was observed in any of the animals. 1.00 × 10 12 Animals administered the GC / ocular AAV8.aVEGF test vector showed a 1.00 × 10⁻¹⁰ 10 The GC / ocular AAV8.aVEGF test vector was administered to animals that produced higher levels of neutralizing antibodies (NAb) in response to the AAV8 capsid than to animals that were administered the AAV8.aVEGF test vector. The NAb response was higher in animals that already had pre-existing NAb levels. 1.00 × 10 12 In two of the six animals administered the GC / ocular test vector, a slightly increased T-cell response to the AAV8 capsid was observed.

[0217] result The anti-VEGF Fab transgene product was expressed in all animals administered the AAV8.aVEGF test vector (Example 6). IgM levels against the anti-VEGF Fab transgene product were not significantly present in the serum or anterior chamber fluid of animals administered FFB-314. IgG levels against the anti-VEGF Fab transgene product exceeding baseline levels were not observed in animals administered FFB-314.

[0218] IgM against the anti-VEGF Fab transgene product exceeded the baseline level in the aqueous humor of one animal administered the AAV8.aVEGF test vector in the GC / eye. However, there was no corresponding increase in serum, and thus this observation was not clinically significant. IgG against the anti-VEGF Fab transgene product above the baseline level was not observed in this treatment group. 10 IgM against the anti-VEGF Fab transgene product above the baseline level was observed in the aqueous humor of one animal administered the AAV8.aVEGF test vector in the GC / eye. However, there was no corresponding increase in serum, and this observation was not clinically significant. IgG against the anti-VEGF Fab transgene product above the baseline level was observed in serum and aqueous humor from separate animals and in the aqueous humor only of a third animal in this treatment group. However, since no detectable IgM preceded these, these observations were not clinically significant. The presence of IgG in these animals was not associated with loss of expression of the anti-VEGF Fab transgene product.

[0219] IgM against the anti-VEGF Fab transgene product exceeded the baseline level by 1.00×10 12 GC / eye. However, there was no corresponding increase in serum, and this observation was not clinically significant. IgG against the anti-VEGF Fab transgene product above the baseline level was observed in serum and aqueous humor from separate animals and in the aqueous humor only of a third animal in this treatment group. However, since no detectable IgM preceded these, these observations were not clinically significant. The presence of IgG in these animals was not associated with loss of expression of the anti-VEGF Fab transgene product.

[0220] The baseline level of NAb against the AAV8 capsid was measured in serum from blood samples collected on Day 0 of the study. The limit of detection was a 1:5 dilution, and titers less than 5 were considered non-detectable.

[0221] Pre-existing NAb was not observed in 4 of 6 animals administered FFB-314. Two animals followed through Day 90 of the study did not develop NAb. Pre-existing NAb was observed in 2 animals administered FFB-314. The levels of NAb in these 2 animals fluctuated below 2 in a 2-fold dilution series during the study. Pre-existing NAb was not observed in 4 of 6 animals administered FFB-314. Two animals followed through Day 90 of the study did not develop NAb. Pre-existing NAb was observed in 2 animals administered FFB-314. The levels of NAb in these 2 animals fluctuated below 2 in a 2-fold dilution series during the study.

[0222] IgM against the anti-VEGF Fab transgene product exceeded the baseline level by 1.00×10 10In two of the nine animals administered the GC / ocular AAV8.aVEGF test vector, no pre-existing NAbs were observed. In one animal followed up to the 90-day test date, no NAbs were observed following administration of the AAV8.aVEGF test vector. In animals with pre-existing NAbs, their levels increased to less than 4 in the 2-fold dilution series following administration of the AAV8.aVEGF test vector.

[0223] 1.00 × 10 12 In four of the nine animals administered the GC / ocular AAV8.aVEGF test vector, no pre-existing NAb was observed. Despite the pre-existing NAb status, an increase in the NAb response up to 9 in a 2-fold dilution series was observed in many animals following AAV8.aVEGF administration. This response persisted throughout the 90-day study period.

[0224] A T-cell response to the AAV8.aVEGF test vector was observed at a single time point in one animal administered FFB-314. A nonspecific T-cell response was observed at all time points in one animal.

[0225] The sustained T cell response to the AAV8.aVEGF test vector was 1.00 × 10⁻⁶. 10 This was not observed in animals administered with the GC / ocular test vector.

[0226] 1.00 × 10 12 In four of the six animals administered the GC / ocular AAV8.aVEGF test vector, a low level of immune response to the AAV8.aVEGF test vector was observed. Of the four animals with a low level of immune response, a sustained response (more than two consecutive time points) was observed in two of them. No sustained T-cell response to the anti-VEGF Fab transgene product was observed in any of the animals.

[0227] No sustained IgM, IgG, or T cell responses to the anti-VEGF Fab transgene product were observed in any of the animals.

[0228] 1.00×10 12 Animals administered the AAV8.aVEGF test vector to the GC / eye had a NAb response to the AAV8.aVEGF test vector that was higher than that of animals administered the same test vector to the GC / eye. The NAb response was higher in animals with pre-existing NAb. 1.00×10 10 Animals administered the AAV8.aVEGF test vector to the GC / eye had a NAb response to the AAV8.aVEGF test vector that was higher than that of animals administered the same test vector to the GC / eye. The NAb response was higher in animals with pre-existing NAb. 1.00×10 12 A slightly increased T cell response to this AAV8.aVEGF test vector was observed in 2 out of 6 animals administered the AAV8.aVEGF test vector to the GC / eye.

Example

[0229] Evaluation of the distribution of AAV2 / 8 vector mRNA and anti-VEGF fragment antigen binding following subretinal administration of the AAV2 / 8 vector in cynomolgus monkeys This study was performed to evaluate the retinal distribution of AAV2 / 8 vector mRNA and the distribution of anti-VEGF Fab throughout the eye using tissues from Examples 3, 5, and 6 following subretinal administration of the AAV2 / 8 vector. The mRNA levels in different parts of the retina were evaluated by quantitative reverse transcription-polymerase chain reaction and in situ hybridization. The concentration of anti-VEGF Fab was measured by enzyme-linked immunosorbent assay in retinal sections, aqueous humor, and vitreous humor.

[0230] The mRNA of the AAV2 / 8 vector distributes throughout the retina following subretinal administration. Similarly, anti-VEGF Fab distributes throughout the retina and is detected in both the vitreous and aqueous humor.

[0231]

Table 12

[0232] The subretinal injection site is indicated by retinal bleb, which can be visualized by SD-OCT. Retinal bleb is visible in all SD-OCT images.

[0233] Levels of AAV2 / 8.aVEGF test vector mRNA in the retina as measured by RT-qPCR mRNA for the AAV8.aVEGF test vector was not detected in the retinas of animals administered FFB-314. mRNA for the AAV8.aVEGF test vector was detected in the retinas of all animals administered the AAV8.aVEGF test vector. The highest mRNA levels were detected in retinal sections including the subretinal injection site. However, mRNA for the AAV8.aVEGF test vector was also detected in sections outside the injection bleb. mRNA levels in these sections were lower than those in the bleb. Levels were as low as 4log in the most peripheral sections relative to the injection bleb. In sections immediately adjacent to the injection bleb, mRNA levels were intermediate.

[0234] AAV2 / 8 vector mRNA expression in the retina determined by in-situ hybridization (ISH) mRNA expression of the AAV2 / 8 vector, as determined by ISH, was elevated at the injection site. Transduced cells in the retinal layer included RPE cells, photoreceptors, and ganglion cells. As the cells moved away from the injection site, mRNA expression was low and almost completely absent in the region most distal to the injection site.

[0235] Concentrations of anti-VEGF Fab in anterior chamber fluid, vitreous humor, and retina Anti-VEGF Fab was expressed in the retina, vitreous humor, and vitreous humor of the eyes of all animals administered the AAV2 / 8 vector (Figures 6-8). Expression in the vitreous humor was 3-9 times higher than in the anterior chamber fluid. In group 5 (Figure 8), with the exception of one animal (C65873), the maximum expression in the retina was 1.2-3.6 times higher than in the vitreous humor. This concentration gradient likely reflects the mechanism of anti-VEGF Fab distribution. Anti-VEGF Fab is secreted into the vitreous humor by the transduced retina and then dispersed from the vitreous humor into the anterior chamber fluid. Notably, the expression of anti-VEGF Fab throughout the retina is more uniform than mRNA expression.

[0236] Overall, the functional AAV2 / 8 vector, surprisingly, is distributed throughout the retina following subretinal administration, as evidenced by the expression of vector mRNA by transduced cells, rather than being limited to injectable blebs. The anti-VEGF Fab is also surprisingly distributed throughout the retina, including the peripheral retinal portions compared to injectable blebs, and is detected in both the vitreous and anterior chamber fluid.

[0237] The evaluation of in vivo distribution revealed the presence of some vectors in tears, nasal lavage fluid, saliva, serum, urine, and feces obtained up to 7 days after injection. These vectors were not considered pathogenic or a cause of health damage, and their elimination within a short period may not be clinically relevant. [Examples]

[0238] Measurement of the binding affinity of anti-VEGF transgene products to recombinant human VEGF. This study was conducted to measure the binding affinity of anti-VEGF Fab heavy and light chain products to recombinant human VEGF. Binding affinity was measured using a Biacore 3000 system based on surface plasmon resonance (SPR) technology. This technology is based on plane-polarized light striking the sensor chip under conditions of total internal reflection. The interaction between the immobilized ligand (e.g., VEGF) on the sensor chip and the interacting molecule (e.g., anti-VEGF Fab transgene product) causes a change in the reflectivity of the plane-polarized light. This change is immediately detected as a response unit by the sensorgram in real time (Daghestani, Theory and applications of surface plasmon resonance, resonance mirror, resonance waveguide grating, and dual polarization interferometry biosensors. Sensors (Basel). 2010;10(11): 9630-46). The equilibrium binding affinity constant for the binding of the anti-VEGF transgene product is consistent with the published range for ranibizumab. [Examples]

[0239] Tissue cross-reactivity test The objective of this study was to evaluate the potential cross-reactivity of sponsor-provided antibody Fab fragment aVEGF transgene product using immunohistochemistry techniques with histologically prepared frozen sections derived from a selected panel of human tissues.

[0240] The anti-VEGF Fab transgene product (1 mg / mL) ("Test Product") and ranibizumab (0.97 mg / mL) were used in this study. Natural human IgG Fab fragment protein ("Control Sample") was provided at a protein concentration of 14.64 mg / mL. To facilitate immunohistochemical detection of the test gene product, natural human IgG Fab fragment protein and ranibizumab were conjugated with biotin. The respective protein concentrations were 2.79 mg / mL, 2.88 mg / mL, and 2.89 mg / mL. Frozen sections were prepared from control material and human tissue for the study. Tissue viability assessment showed that the panel of human tissues was viable. Following slide evaluation of control dose setting, the following three concentrations of test transgene product-biotin: 5, 2.5, and 1.25 μg / mL, and the following concentration of ranibizumab-biotin: 2.5 μg / mL were selected for use in tissue dose setting. In tissue dose setting, no specific positive staining was observed in any of the tissues tested for anti-VEGF transgene product-biotin or ranibizumab-biotin. All other observed staining was variable and considered nonspecific.

[0241] Under the conditions of this study, antigen-specific binding of the test-transduced gene product-biotin and ranibizumab-biotin was observed in positive control material (human glioblastoma and VEGF protein). This was demonstrated in a pot. At the concentrations tested in tissue dose settings, no similar staining was observed in natural human IgG Fab fragment protein-biotin or antibody dilutions. [Examples]

[0242] Clinical trials The rAAV8.aVEGF vector, offering the advantages of a single subretinal administration and thereby reducing the burden of repeated injections, was selected for further testing. Preclinical studies have demonstrated the expression of anti-VEGF Fab in NHP lasting more than 6 months and reduced angiogenesis in animal models of WAND treated with the rAAV8.aVEGF vector, allowing for evaluation of the safety of subretinal injection in non-human primates. The initial clinical trial will evaluate the safety and transgene expression after a single subretinal injection of the rAAV8.aVEGF test vector as described above. Upon subretinal injection, these vectors express anti-VEGF Fab. It is expected that the Fab gene product will continue to release, blocking angiogenesis signals and thereby protecting the retina from further damage.

[0243] Each dose cohort includes five subjects. Main purpose: The safety and tolerability of the AAV8.aVEGF test vector will be evaluated over 25 weeks (24 weeks after a single subretinal delivery to subjects with nAMD). Secondary purpose: ● Evaluate the long-term safety and tolerability of the AAV8.aVEGF test vector; ● Evaluate the concentration of aVEGF protein levels in aqueous solutions. ● Evaluate the effects of AAV8.aVEGF on BCVA ● Evaluate the effect of AAV8.aVEGF on central retinal thickness (CRT) measured by SD-OCT. ● Assess the need for emergency medical treatment. ● Evaluate the effect of the AAV8.aVEGF test vector on the growth and leakage of CNV lesions measured by fluorescein angiography (FA).

[0244] Primary evaluation criteria: Safety up to 26 weeks (24 weeks after administration of the rAAV8.aVEGF test vector): Incidence of ocular and non-ocular adverse events (AEs) and serious adverse events (SAEs). Ocular and non-ocular safety evaluation at 6 weeks, 24 weeks, 6 months, and 12 months post-treatment.

[0245] Secondary evaluation criteria: ●Eye and non-eye safety beyond 106 weeks ● Mean change in aqueous rAAV8.aVEGF protein over time from baseline ● Mean change in BCVA over time from baseline ●Percentage of subjects who gained or lost 15 or more letters compared to baseline using BCVA at 26, 54, and 106 weeks. ● Mean change from baseline over time when measured by SD-OCT ●Average number of ranibizumab rescue injections over time ● Time until the first rescue ranibizumab injection ● Mean change from baseline in the leakage area based on CNV and damage size and FA over time. ● Immunogenicity measurement (NAb against AAV8, binding antibody against AAV8, antibody against aVEGF protein, and enzyme-linked immunosorbent spot [ELISpot]). ● Vector elimination analysis in serum and urine

[0246] Exploratory evaluation criteria: ● Mean change from baseline over time in areas of geographic atrophy as measured by fundus autofluorescence (FAF), and the development of new areas of geographic atrophy as measured by FAF (in subjects with no geographic atrophy at baseline). ●Percentage of subjects who gained or lost 10 or more characters compared to the baseline using BCVA. ● Percentage of subjects experiencing a 50% reduction in emergency vaccinations compared to the previous year ●Percentage of objects that do not contain any liquid in SD-OCT

[0247] For this trial, patients must have a diagnosis of neovascular age-related macular degeneration (exudative AMD) and meet the following criteria.

[0248] Recruitment criteria: To be eligible to participate in this study, participants must meet all of the following criteria. It should be understood that one or more of these criteria may not be required for further trials and treatment of other populations. 1. Males or females over 50 years of age and under 89 years of age; 2. The sentinel subject in each dose cohort must have a BCVA of ≤20 / 63 and ≥20 / 400 in the eye being tested (≤63 and ≥19 ETDRS characters); following the evaluation of the sentinel subject, the remaining subjects in the dose cohort must have a BCVA of ≤20 / 40 and ≥20 / 400 (≤73 and ≥19 ETDRS characters). 3. If both eyes are eligible, the eye to be tested should be the weaker eye of the subject, if the researcher decides otherwise. 4. The eye being tested must have a definitive diagnosis of subfoveal CNV secondary to AMD. CNV injury characteristics: Injury size must be less than 10 disc regions (typical disc region is 2.54 mm). 2 ), and blood less than 50% of the size of the injury. Approximately eight months prior to day 5.1, the eye being tested must have received at least four intravitreal injections of an anti-VEGF agent for the treatment of nAMD and have an anatomical response confirmed by SD-OCT. 6. If a subject has not undergone rescreening, they must have subretinal or intraretinal fluid presence demonstrated by SD-OCT in the eye being tested on day 1. Subjects who previously met all inclusion criteria, including the week 1 response criteria for OCT, but do not have anti-VEGF Fab within the window, may be rescreened, and there is no need to provide hydration at the time of participation or to consult with or obtain approval from the sponsoring medical monitor regarding the need for the subject to meet the week 1 response criteria again. 7. The eye being tested must be pseudo-cataract (post-cataract surgery condition). 8. The candidate must be able to voluntarily accept and be able to comply with all examination procedures throughout the examination period. 9. Women who may be pregnant should have a negative urine pregnancy test at the time of their screening visit, have a negative serum result by day 8, and be willing to undergo additional pregnancy tests during the trial. 10. Sexually active individuals (both women and men) should be willing to use medically acceptable barrier contraception (e.g., condoms, diaphragms, or abstinence) from the screening visit until 24 weeks after vector administration. Any discontinuation of contraception beyond this point should be discussed with the attending physician. 11. They should have the willingness and ability to provide informed consent in writing.

[0249] Exclusion criteria: Individuals meeting any of the following exclusion criteria are ineligible to participate in the study. It should be understood that some or all of these criteria may not be included in further studies and treatment of other patient populations. 1. CNV or macular edema in the eye being examined, secondary to any factor other than AMD. 2. In the eye being tested, blood accounts for 50% or more of the AMD damage, or blood is present in 1.0 mm 2 It is located beyond the fovea and below it. 3. Any condition that prevents improvement of VA in the eye being tested, such as fibrosis, atrophy, or retinal epithelial tear at the center of the fovea. 4. Active retinal detachment or a history of retinal detachment in the eye being tested. 5. Advanced glaucoma in the eye being tested. 6. Any medical condition that, in the opinion of the researchers, could increase the risk to the subject in the eye being tested, require any medical or surgical intervention to prevent or treat vision loss during the study period, or could interfere with the study of treatment or evaluation. 7. History of intraocular surgery in the eye being tested within 12 weeks prior to the screening visit. Yttrium-aluminum-garnet capsulotomy is acceptable if performed more than 10 weeks prior to the screening visit. 8. History of intravitreal therapies in the eye to be tested within the six months prior to screening, such as intravitreal steroid injections or investigational drugs other than anti-VEGF therapy. 9. The presence of implants in the eye being screened (excluding intraocular lenses). 10. A history of malignant tumors requiring chemotherapy and / or radiation within the five years prior to screening. Localized basal cell carcinoma is acceptable. 11. The patient will be administered one of the investigational drugs within 30 days of registration or within five times the half-life of the investigational drug, whichever is longer. 12. Participation in any other gene therapy trial. 13. A history of treatments known to cause retinotoxicity, or combination therapy with any drug that may affect vision or has known retinotoxicity, such as chloroquine or hydroxychloroquine. 14. Infections of the eye or periophthalmos that may interfere with surgical procedures in the eye being examined; 15. Myocardial infarction, cerebrovascular event, or transient ischemic attack in the past six months. 16. Uncontrolled hypertension despite maximum treatment (systolic blood pressure [BP] above 180 mmHg, diastolic blood pressure above 100 mmHg). 17. Any incidental treatment that, in the opinion of researchers, may interfere with eye surgery or the healing process. 18. Known hypersensitivity to ranibizumab or any component thereof, or past hypersensitivity (in the researcher's opinion) to agents similar to the rAAV8.aVEFG test vector. 19. Any serious chronic or unstable medical or psychological condition that, in the opinion of the researcher, could impair the subject's ability to complete all assessments and follow-ups in the study or to ensure the subject's safety.

[0250] Criteria for continuing the trial after receiving ranibizumab In week 1, subjects (excluding those who meet this criterion for rescreening in this part) are evaluated for their initial anti-VEGF response to ranibizumab. Subjects undergo both SD-OCT and BCVA, which are compared by the researcher to the values ​​on day 1. 1. Responsiveness (the subject will continue testing): Responsiveness is defined by a reduction in CRT of more than 50 microns by SD-OCT, or an improvement of more than 30% in liquids. 2. Non-responsiveness (the subject is withdrawn from the trial early): Non-responsiveness meets the above criteria. It is defined as not being performed. In each cohort, up to 6 additional subjects are enrolled and administered a single dose of the rAAV8.aVEFG test vector. At the time of this visit, the results from the central laboratory will be reviewed. All subjects with the following values ​​will be withdrawn: 3. Aspartate aminotransferase (AST) / alanine aminotransferase (ALT) levels exceeding 2.5 times the upper limit of normal (ULN). 4. Total bilirubin exceeding 1.5 times the ULN, and fractionated bilirubin showing that bound bilirubin is less than 35% of total bilirubin, unless the subject has a previously known history of Gilbert's syndrome. 5. Prothrombin time (PT) more than 1.5 times that of ULN 6. Hemoglobin levels below 10 g / dL for male subjects and below 9 g / dL for female subjects. 7.100 × 10 3 platelets less than / μL 8.30mL / min / 1.73m 2 Estimated glomerular filtration rate (GFR) less than Prohibited drugs and procedures The target is: ● Unable to receive salvage treatment for the research eye, or treatment for one eye with bevacizumab (Avastin®, Genentech) ● You cannot receive experimental drug therapy or treatment within 4 weeks of screening, or within 5 half-lives of the investigational drug, or at any point during the study period. ●In the opinion of clinicians, patients should not receive any concomitant treatments that may interfere with surgical procedures on the eye or the healing process.

[0251] In the initial trial, ranibizumab (LUCENTIS, Genentech) 0.5 mg will be administered intravitreally on day 1, 14 days prior to subretinal delivery of the rAAV8.aVEGF test vector. rAAV8.aVEGF will be administered as a single dose subretinally by a retinal surgeon under local anesthesia. The procedure will include a standard 3-port transciliary vitrectomy with central vitrectomy, followed by a single subretinal administration into the subretinal space via a subretinal cannula (36-41 gauge, e.g., 38 gauge). This delivery will be automated via vitrectomy equipment, delivering 250 microliters of rAAV8.aVEGF in blebs into the subretinal space. Additional subjects may be enrolled if the 250 μl dose is not fully administered to the subretinal space. Patients will receive one of five dose levels. The five dose levels are as follows: 3 x 10 9 Genome copy (GC) / eye (1.2 × 10⁻⁶) 10 GC / mL), 1 × 10 10 GC / Eye(4×10 10 GC / mL), 6 × 10 10 GC / eye (2.4×10 11 GC / mL), 1.6 × 10 11 GC / eye(6.2×10 11 GC / mL), and 2.5 × 10 11 GC / eye (1×10 12 GC / mL).

[0252] Based on the examples, 1 × 10 11 GC / eye (1×10 12 The dose of GC / mL is the MTD in NHP. In a study using the rAAV8.aVEGF test vector delivered subretinally to NHP eyes, 1 × 10 10 , 1 x 10 11 , or 1 × 10 12 The amount of GC is injected in a volume of 100 μl, and each is 1 × 10⁶ 11 , 1 x 10 12, and 1 × 10 13 This corresponds to the concentration in GC / mL. The amount injected in human studies, i.e., the total GC dose, is adjusted to correspond to the large size of the human eye. The target is the concentration of the vector (1 × 10⁻¹⁰) which has been shown to be non-toxic in NHP. 12 The goal is to expose a region or retina to a dose of GC / mL or less (MTD) that exceeds the MED determined in dose-response studies in a mouse model of choroidal angiogenesis, while maintaining the expected safety and clinical benefit profile. Human doses are scaled to 250 μL, taking into account procedural differences and generally considering physiological differences. The proposed starting dose tested in humans was 1.2 times the MED administered based on concentration, and also 2 log of the MTD; the maximum dose was the MTD.

[0253] In addition to reducing the risk of toxicity by using doses below the MTD, further risks are mitigated by the administration site. Subretinal delivery targets the area above the fovea within the vascular arcade, avoiding the macula. Finally, it is important to note that no changes in normal vascular structure were observed in non-clinical studies, which can occur with excessive VEGF inhibition.

[0254] If one or more of the following rescue criteria are met regarding disease activity, the patient may receive intravitreal ranibizumab rescue treatment in the eye being tested, starting 4 weeks after administration of the rAAV8.aVEGF test vector, at the clinician's discretion: loss of visual acuity of 5 letters or more (per best-corrected visual acuity [BCVA]) associated with retinal fluid accumulation on spectral-regional optical coherence tomography (SD-OCT); new or persistent elevation of subretinal or intraretinal fluid associated with choroidal neovascularization (CNV) on SD-OCT; and new ocular hemorrhage.

[0255] If any of the following sets of findings occur, the clinician may, at their discretion, postpone further salvage injections: visual acuity is 20 / 20 or better as assessed by SD-OCT, and central retinal thickness (CRT) is "normal"; or visual acuity and SD-OCT are stable after two consecutive injections. If injections are postponed, they should be resumed if visual acuity or SD-OCT deteriorates according to the above criteria. The clinician may change ocular salvage therapy from ranibizumab to aflibercept. [Examples]

[0256] Dose-gradual increase study This Phase I, open-label, multi-cohort, dose-increasing trial is designed to evaluate the safety and tolerability of rAAV8.aVEGF gene therapy in subjects with pre-treated neovascular AMD (nAMD). These doses will be tested in five doses across approximately 30 subjects. Subjects meeting the inclusion / exclusion criteria and demonstrating an anatomical response to the initial anti-VEGF injection will be administered a single dose of rAAV8.aVEGF via subretinal delivery. rAAV8.aVEGF utilizes an AAV8 vector containing a gene encoding a monoclonal antibody fragment that binds to VEGF and neutralizes VEGF activity. Safety will be the initial focus during the first 24 weeks (initial study period) after rAAV8.aVEGF administration. In specific embodiments, the study will involve administration of an anti-VEGF antibody, e.g., ranibizumab, and response will be measured at week 1 by SD-OCT. Patients who respond to anti-VEGF antibody administration can receive rAAV8.aVEGF at week 2, and safety will then be evaluated over 26 weeks (24 weeks after rAAV8.aVEGF administration). Following completion of the initial study period, subjects will continue to be evaluated up to 104 weeks after administration of rAAV8.aVEGF.

[0257] Participants meeting the selection / exclusion criteria will be enrolled and receive an intravitreal injection of 0.5 mg of ranibizumab in the eye to be tested (Day 1). At Week 1 (7 days after ranibizumab injection), participants will be evaluated by SD-OCT to confirm their anatomical response to the initial anti-VEGF activity associated with the ranibizumab injection, compared to their baseline assessments. Participants without an anatomical response will be withdrawn from the study. Of the withdrawn participants, all those with an AE associated with the ranibizumab injection on Day 1 will be followed until the AE resolves (up to 30 days post-injection). At Week 2 (Day 15), participants will be administered a single dose of the rAAV8.aVEGF test vector via subretinal delivery in the operating room.

[0258] The first sentinel target in each cohort has a visual acuity of 20 / 63 or less and 20 / 400 or more (63 or less and 19 or more ETDRS characters). After administration of rAAV8.aVEGF Fab to the sentinel target, a minimum observation period of one week is required for safety. Yes. If there are no safety concerns, up to 5 additional subjects (with an extended visual acuity criterion of ≤20 / 40 and ≥20 / 400 [≤73 and ≥19 ETDRS letters]) may be treated in parallel with the rAAV8.aVEGF trial vector, for at least one consecutive calendar day between each treatment. It is recommended to discontinue the study, proceed to the next dosing cohort, or proceed with a lower dose (up to semi-logarithmic). If no safety review triggers (SRTs) are observed, the last subject will receive the dose after 4 weeks. The subjects will be rAAV8.aVEGF Patients will visit the clinic three times within the first four weeks after treatment with the Fab test vector. Intravitreal ranibizumab salvage therapy may be initiated four weeks after administration of the rAAV8.aVEGF Fab test vector, at the clinician's discretion, if the subjects meet the pre-defined salvage injection criteria. Immunogenicity to the rAAV8.aVEGF test vector and the transgene will be evaluated throughout the study period.

[0259] Participants will visit the clinic three times during the first four weeks after treatment with the rAAV8.aVEGF test vector. Starting four weeks after administration of the rAAV8.aVEGF test vector, participants may be eligible for intravitreal ranibizumab salvage treatment. Throughout the study, the immunogenicity of the rAAV8.aVEGF test vector and its transgene will be evaluated.

[0260] Safety will be the initial focus during the first 24 weeks following rAAV8.aVEGF administration (the initial study period). Following completion of the initial study period, subjects will continue to be evaluated up to 104 weeks (106 weeks) following administration of rAAV8.aVEGF. At the end of the study, subjects will be asked to participate in a long-term follow-up study. The safety and tolerability of rAAV8.aVEGF will be evaluated in subjects at each dose and observed through assessment of ocular and non-ocular AEs and SAEs, chemistry, hematology, coagulation, urinalysis, immunogenicity, ocular examinations and imaging (BCVA, intraocular pressure, slit-lamp biomicroscopy, indirect fundus examination, and SD-OCT), and vital signs.

[0261] Effectiveness analysis Observed values ​​and changes over time from baseline (where applicable) are summarized for explanatory purposes, and 95% confidence intervals are provided for the dose cohort and the overall study for the efficacy endpoint (as defined by SAP). The significance level is 5%, and no adjustments for multiple comparisons are performed.

[0262] Medical and medication history Collect relevant medical and surgical history (e.g., information on co-existing conditions and drug therapies in the subject, complete ophthalmic history, and previous anti-VEGF therapy and ophthalmic history over the past 12 months, as well as other major treatments for nAMD such as anti-VEGF therapy).

[0263] Ophthalmic evaluation The following ophthalmological evaluations may be performed. If applicable, the evaluations should be performed in the order listed. 1. Complete ophthalmological examination - slit-lamp biomicroscopy, IOP, and extended fundus endoscopy Use ETDRS at 2.4 meters on the BCVA, repeat at 1 meter if necessary (on both sides). 3. SD-OCT (bilateral) using Heidelberg Spectralis 4. FAF (Test Eye) 5. Color fundus photograph (test eye) 6. FA (Test Eye)

[0264] Adverse events An AE is defined as an adverse medical event related to drug use in humans, regardless of whether it is considered drug-related or not. Therefore, an AE is defined regardless of whether it is related to the drug (investigational drug). Regardless of the circumstances, this may include any undesirable or unintended signs (such as abnormal laboratory findings), symptoms, or diseases temporarily associated with the use of a drug (investigational drug).

[0265] A suspected side effect refers to an adverse event (AE) that is reasonably likely to occur due to the drug. For rapid reporting purposes, "reasonable possibility" means there is evidence suggesting a causal relationship between the drug and the AE. A suspected side effect refers to an AE caused by a drug, where the certainty regarding the causal relationship is less than that of a side effect.

[0266] The following are examples of events that satisfy the definition of AE: ● Worsening of a chronic or intermittent pre-existing condition, such as an increase in the frequency and / or severity of the condition. ● New medical conditions detected or diagnosed after administration of the investigational drug, even if they may have existed before the start of the study. ●Suggested signs, symptoms, or clinical sequelae of an interaction ● Signs, symptoms, or clinical sequelae of suspected overdose of the investigational drug or concomitant medication (overdose itself is considered an AE / SAE) ● Abnormal laboratory findings

[0267] The following are examples of events that do not satisfy the definition of AE: ● Medical or surgical procedures (e.g., endoscopy, appendectomy); the pathological conditions leading to these procedures are adverse events (AEs). ● Circumstances in which no adverse medical events occurred (e.g., social and / or convenient hospitalization) ● Predicted daily fluctuations of pre-existing, non-worsening diseases or conditions (multiple) that were present or detected at the start of the study. ● Unless the patient's condition is more severe than expected, the disease / disorder being studied, or the expected progression, signs, or symptoms of the disease / disorder being studied.

[0268] From a clinician's perspective, an AE is considered a SAE if it leads to any of the following outcomes: ●Death ● Life-threatening AE Note: A life-threatening adverse event (AE) or suspected life-threatening adverse event is defined as an AE or suspected adverse event that, from the perspective of any clinician, presents an immediate risk of death to the patient. This does not include AEs or suspected adverse events that could lead to death if they occur in a more severe form. ● Treatment of hospitalized patients, or extension of hospitalization Note: Generally, hospitalization means keeping a patient in a hospital or emergency room for observation and / or treatment (usually including a stay of at least one night), as a clinic or outpatient setting is not appropriate. Complications that occur during hospitalization are AEs. An event is serious if the complication prolongs hospitalization or otherwise meets any serious criteria. An AE is considered serious if it leads to hospitalization, or if there are doubts about the necessity of hospitalization. ● Permanent or serious disability / physical impairment Note: The term "physical disability" means a substantial disruption to a person's ability to perform normal daily living activities. This definition is not intended to include relatively minor medically significant experiences that may interfere with or impede daily living activities but do not constitute a substantial disruption, such as uncomplicated headaches, nausea, vomiting, diarrhea, influenza, and accidental injuries (e.g., ankle sprains). ●Congenital abnormalities / congenital defects ●All events that may be drug-induced liver injury accompanied by hyperbilirubinemia and include the following three elements are referred to as "Hy's Law" events. 1. ALT ≥ 3 × ULN, or AST ≥ 3 × ULN 2. Total bilirubin ≥ 2 × ULN 3. No other reason can be found to explain the changes acknowledged in #1 and #2 above.

[0269] A significant medical event that does not result in death, is not immediately life-threatening, or requires hospitalization is considered serious, based on appropriate medical judgment, if it endangers the subject and may require medical or surgical intervention to prevent one of the outcomes described in this definition. An example of such an event is eye inflammation causing severe vision loss (>6 rows on the ETDRS chart).

[0270] Pregnancy test Women who have a positive urine or serum pregnancy test prior to administration of the rAAV8.aVEGF test vector (week 2) and are of childbearing potential will be enrolled in the study, even though they do not meet the eligibility criteria for enrollment. Women considered unlikely to be of childbearing potential include those who have undergone a total hysterectomy, have been menopausal for at least two years, or have had a tubal ligation at least one year prior to screening.

[0271] Further urine pregnancy tests are performed during visits where the pregnancy status is a concern. Serum pregnancy tests are performed if the urine pregnancy test result is positive or inconclusive.

[0272] Clinical Tests The following clinical tests and antibody tests will be evaluated. ●Chemistry: Glucose, blood urea nitrogen, creatinine, sodium, potassium, chloride, carbon dioxide, calcium, total protein, albumin, total bilirubin, direct bilirubin, alkaline phosphatase, ALT, AST, and creatine kinase. ●Hematology: Hematocrit, hemoglobin, and complete blood count using white blood cell percentage and platelet count, including counting of red blood cells, white blood cells, platelets, neutrophils, lymphocytes, monocytes, eosinophils, and basophils, as well as mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration. ● Coagulation: PT and partial thromboplastin time ●Urine test: glucose, ketones, protein, and blood dipsticks (microscopic evaluation to be completed if necessary) ● aVEGF protein concentration in serum and aqueous solution ●Immunogenicity measurement: ○NAb to AAV8 ○ Antibody binding to AAV8 ○Antibodies against aVEGF protein ○ELISpot ● Vector loss analysis in serum and urine

[0273] Vital signs Acquire / perform an assessment of vital signs (BP and heart rate).

[0274] A. Group and intervention [Table 13]

[0275] B. Evaluation Items Primary outcome measures: 1. Safety: Occurrence of ocular adverse events (AEs) and non-ocular serious adverse events (SAEs) beyond 26 weeks.

[0276] Secondary outcome measure: 2. Safety: No occurrence of AEs and SAEs in the eyes or non-eyes beyond 106 weeks. 3. Changes in best corrected visual acuity (BCVA) over 106 weeks. 4. Changes in central retinal thickness (CRT) measured by SD-OCT over 106 weeks. 5. Rescue injections: The average number of rescue injections given after 106 weeks of age. 6. Changes in choroidal angiogenesis, injury size, and leakage area CNV when measured by FA for more than 6 weeks.

[0277] Criteria: Recruitment criteria: 1. Secondary AMD in eyes undergoing testing that have previously received intravitreal anti-VEGF therapy. Patients aged over 50 and under 89 years with a diagnosis of subfoveal CNV. The selected patient population is gender-neutral (includes both males and females). 2. For the first patient in each cohort, BCVA between ≤63 and ≥20 / 400 (Early Treatment Studies [ETDRS] letters ≤63 and ≥19), followed by BCVA between ≤40 and ≥20 / 400 (ETDRS letters ≤73 and ≥19). 3. History of the necessity and response to anti-VEGF therapy. 4. Responsiveness to anti-VEGF at trial registration (evaluated by SD-OCT in week 1) 5. The test eye must be pseudo-cataract (post-cataract surgery condition). 6. Aspartate aminotransferase (AST) / alanine aminotransferase (ALT) less than 2.5 times the upper limit of normal (ULN); total bilirubin (TB) less than 1.5 times the ULN; prothrombin time (PT) less than 1.5 times the ULN; hemoglobin (Hb) greater than 10 g / dL (male), hemoglobin greater than 9 g / dL (female); 100 × 10 3 Platelets exceeding / μL; 30 mL / min / 1.73 m 2 Estimated glomerular filtration rate (eGFR) exceeding 7. They should have the willingness and ability to provide informed consent in writing with signatures.

[0278] Exclusion criteria: 1. CNV or macular edema in the test eye secondary to any factor other than AMD. 2. Any pathological condition that prevents improvement of visual acuity in the eye being tested, such as fibrosis, atrophy, or retinal epithelial tear at the center of the fovea. 3. Highly active retinal detachment or a history of retinal detachment in the test eye. 4. Advanced glaucoma in the test eye. 5. History of intravitreal therapy in the test eye within 6 months prior to screening, such as intravitreal steroid injections or investigational drug use other than anti-VEGF therapy. 6. Presence of implants in the test eye during screening (excluding intraocular lenses) 7. Myocardial infarction, cerebrovascular event, or transient ischemic attack in the past six months. 8. Uncontrolled hypertension despite maximum treatment (systolic blood pressure [BP] above 180 mmHg, diastolic blood pressure above 100 mmHg). [Examples]

[0279] Vector creation and manufacturing A. Description of the manufacturing process Cell seeding: The standard human embryonic kidney 293 cell line is used in the preparation process. Cell culture used for vector preparation starts from a single thawed MCB vial and expands according to the Masterbatch Record (MBR) document. Cells are seeded 5 × 10⁶ times using Corning T-flasks and CS-10. 9 ~5×10 10 The cells are expanded to a certain size, which provides a sufficient cell volume to generate seedings into HS-36 up to 50 for vector production per BDS lot. The cells are cultured in a medium consisting of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% gamma-irradiated, US-origin, fetal bovine serum (FBS). The cells are scaffold-dependent, and cell dissociation is achieved using TrypLE® Select, a cell dissociation reagent free of animal-derived components. Cell seeding is achieved using sterile, single-use, disposable bioprocess bags and tube sets. The cells are maintained at 37°C (±2°C) in 5% (±0.5%) CO2 air.

[0280] Transient transfection: Following approximately 3 days of growth (DMEM medium + 10% FBS), the HS-36 cell culture medium is replaced with fresh serum-free DMEM medium, and the cells are transfected with three prepared plasmids using an optimized PEI-based transfection method. All plasmids used in the manufacturing process are prepared in accordance with a CMO quality system and infrastructure that utilizes traceability, documentation, and controls to ensure material isolation.

[0281] Sufficient DNA plasmid transfection complexes to transfect 50 HS-36 cells (per BDS batch) are prepared in BSC. First, a DNA / PEI mixture is prepared containing 7.5 mg of the relevant vector genome plasmid, 150 mg of pAdDeltaF6(Kan), 75 mg of pAAV2 / 8Kan AAV helper plasmid, and GMP-grade PEI (PEIPro, PolyPlus Transfection SA). The plasmid ratios are determined to be optimized for AAV production in small-scale optimization tests. After thorough mixing, the solution is left at room temperature for 25 minutes, then added to serum-free medium to stop the reaction, and then added to the HS-36 cells. The transfection mixture is homogenized across all 36 layers of HS-36 cells, and the cells are incubated at 37°C (±2°C) in 5% (±0.5%) CO2 air for 5 days.

[0282] Cell medium collection: Transfected cells and medium are collected from each HS-36 by aseptically draining the medium from the unit using a disposable bioprocess bag. Following medium collection, approximately 200 liters are replenished with MgCl2 to a final concentration of 2 mM (a cofactor for benzonase), and benzonase nuclease (Cat#: 1.016797.0001, Merck Group) is added to a final concentration of 25 units / mL. The product (in the disposable bioprocess bag) is incubated in an incubator at 37°C for 2 hours to allow sufficient time for enzymatic digestion of any residual cell and plasmid DNA present in the collection as a result of the transfection process. This step is performed to minimize the amount of DNA remaining in the final vector DP. After the incubation period, NaCl is added to a final concentration of 500 nM to aid in the recovery of the product during filtration and downstream tangential flow filtration.

[0283] Purification: Cells and cellular debris are removed from the product using depth filter capsules (1.2 / 0.22 μm) connected in a series of sterile, closed tubes and bags driven by a peristaltic pump. Purification ensures that downstream filters and chromatography columns are protected from contamination, and bioburden reduction filtration ensures that all bioburden potentially introduced during the upstream preparation process is removed at the end of the filter chain before downstream purification. The collected material is passed through Sartorius Sartoguard PES capsule filters (1.2 / 0.22 μm) (Sartorius Stedim Biotech Inc.).

[0284] Large-scale tangent flow filtration: Volume reduction (10x) of the purified product is achieved by tangent flow filtration (TFF) using a custom-sterilized, closed bioprocess tube, bag, and membrane set. The principle of TFF is to flow a solution through a membrane of suitable porosity (100 kDa) under parallel pressure. The pressure difference drives smaller molecules through the membrane and effectively moves them to the waste stream, while retaining molecules larger than the membrane pores. By recirculating the solution, the parallel flow sweeps the membrane surface, preventing contamination of the membrane pores. By selecting the appropriate membrane pore size and surface area, the liquid sample can be rapidly reduced in volume while retaining and concentrating the desired molecules. Dialysis filtration in TFF applications involves adding fresh buffer to the recirculated sample at the same rate as the liquid moves through the membrane to the waste stream. Smaller molecules, which increase in volume with increasing volume of dialysis filtration, are removed from the recirculated sample. This results in moderate purification of the purification product, while also achieving buffer exchange compatible with the subsequent affinity column chromatography step. Therefore, a 100kDa PES membrane is used for concentration, followed by 20mM Tris pH 7.5 and 400mM Diafiltration is performed with a buffer solution consisting of NaCl at a minimum dialysis volume of 4. The diafiltration product is stored overnight at 4°C and then purified using a 1.2 / 0.22 μm depth filter capsule to remove all precipitated material.

[0285] Affinity chromatography: The dialyzed product is applied to Poros® Capture Select® AAV8 affinity resin (Life Technologies), which effectively captures the AAV8 cell type. Under these ionic conditions, a significant proportion of residual cellular DNA and proteins pass through the column, while AAV particles are effectively captured. Following application, the column is washed to remove additional feed impurities and subsequently subjected to a low-pH step elution (400 mM NaCl, 20 mM sodium citrate; pH 2.5), which is immediately neutralized by recovery in 1 / 10 volume neutralizing buffer (Bis Tris propane, 200 mM, pH 10.2).

[0286] Anion exchange chromatography: To achieve further reduction of in-process impurities, including empty AAV particles, the Poros-AAV8 elution pool is diluted 50-fold (20 mM Bis Tris propane, 0.001% Pluronic F68; pH 10.2) to reduce ionic strength and enable binding to the CIMultus® QA monolithic matrix (BIA Separations). Following low-salt washing, the vector product is eluted using a 60 CV NaCl linear salt gradient (10–180 mM NaCl). This shallow salt gradient effectively separates capsid particles from particles containing the vector genome (complete particles) without containing the vector genome (empty particles), resulting in a concentrated preparation of complete capsids. 0.1% Pluronic F68 in 1 / 100 volume and 0.1% Bis Tris in 1 / 27 volume, respectively, minimize nonspecific binding to the tube and minimize exposure time to high pH. The fraction is collected in a tube containing pH 6.3. The appropriate peak fraction is collected, the peak area is evaluated, and compared with previous data for determining the appropriate vector yield.

[0287] Bioburden reduction filtration to obtain the final formulation and BDS: TFF with a 100kDa membrane is used to obtain the final formulation from the pooled AEX fraction. This is achieved by diafiltration of the formulation buffer (PBS containing NaCl and 0.001% Pluronic or PBS containing 0.001% Pluronic, selected following the completion of stability testing) and concentrated to obtain the BDS intermediate at the desired target. The sample is collected for BDS intermediate testing (described in the following section). The BDS intermediate is stored in sterile polypropylene tubing and frozen in an isolated location below -60°C until release for final filling. Stability testing is ongoing to evaluate stability following storage below -60°C.

[0288] Final Filling: Frozen BDS is thawed, pooled, and adjusted to the desired concentration (dilution or concentration step with TFF) using the final formulation buffer (PBS containing NaCl and 0.001% Pluronic or PBS containing 0.001% Pluronic, selected following the completion of stability testing). The product is then subjected to final filtration through a 0.22 μm filter and filled to a filling volume of 0.1 mL to 0.5 mL per vial using either West Pharmaceutical's “Ready-to-Use” (pre-sterilized) glass vials or Crystal Zenith (polymer) vials (vial type awaits comparative test results) with a crimp-sealed stopper. Vials are individually labeled according to the following specifications. Labeled vials are stored below -60°C. All doses require dilution in formulation buffer before administration. Dilution is performed by the pharmacy at the time of administration.

[0289] B. Assay Method Sterility and bacteriostatic / fungal: This procedure involves the sample matrix causing inhibition of the assay. To ensure that no cross-sections occur, the United States Pharmacopeia (USP) <71> It is performed once according to the regulations. The test includes a conformity test.

[0290] Particle Aggregation: The aggregation of formulation particles was evaluated using a dynamic light scattering (DLS) assay. DLS is used to measure variations in scattered light intensity due to dispersed particles and to analyze the sizes of various particles in a sample. DLS instrument software typically shows particle populations of different diameters. If the system is monodisperse, only one population can be detected, and the average effective diameter of the particles can be determined. In polydisperse systems, such as in the case of aggregation, multiple particle populations can be detected and sized using CONTIN analysis.

[0291] Residual plasmid DNA: Detection of plasmid DNA sequences is achieved using qPCR and primer-probe sets specific to the kanamycin gene, which is present in the plasmid backbone but not in the vector genome. Assays are performed both in the presence and absence of DNase digestion to determine the amount of free plasmid and the amount packaged in vector particles.

[0292] E1 DNA: Adenovirus E1 DNA is a contaminant in host cells and is detected by gene-specific qPCR. Assays are performed both in the presence and absence of DNase digestion to quantify both free and packaged E1 DNA.

[0293] Residual host cell DNA: The level of residual host cell DNA (HCDNA) is quantified using qPCR against the human 18s rDNA gene, which is a high-copy-number DNA sequence and therefore provides sensitivity. In addition to the total residual HCDNA level, the amount of DNA in various size ranges is also measured.

[0294] Residual host cell proteins: The 293 residual host cell proteins (HCPs) can be detected using commercially available ELISA kits, such as those sold by Cygnus Technologies.

[0295] Poros-AAV8 leaching ligand: An enzyme-linked immunosorbent assay (ELISA) kit, supplied by Life Technologies, the manufacturer of the Poros-AAV8 resin, is used to detect camel antibodies leached into the formulation.

[0296] Mycoplasma detection: Mycoplasma testing is USP <63> It will be implemented according to the following.

[0297] Bioburden trial: This trial is a USP <61> It will be implemented according to the following.

[0298] Endotoxin test: This test is USP <85> It will be implemented according to the following.

[0299] In vitro assay for exogenous active ingredients: The purpose of the in vitro assay for viral contaminants is to detect exogenous viruses that may be introduced during AAV8.AMD vector preparation, and is based on CBER's 1993 Points to Consider and ICH Q5A. The in vitro assay uses three indicator cell lines: human diploid lung (MRC-5) cells, African green monkey kidney (Vero) cells, and human prepectomy fibroblast (Hs68) cells. The assay endpoints are observation of cytopathic effects (CPE) and hemocyte adsorption over a period of at least 28 days at the end of the assay period, which facilitate the detection of a wide range of viruses.

[0300] Vector genome identification: DNA sequencing: Viral vector genome DNA is isolated. The sequences are then determined using primer walking for 2x sequence coverage. Sequence alignment is performed and compared to the expected sequences.

[0301] Vector capsid identification: AAV capsid mass spectrometry of VP1: Confirmation of the AAV2 / 8 serotype of the formulation is achieved by assays based on the analysis of the AAV capsid protein peptide.

[0302] Genome Copy (GC) Titer: A droplet digital PCR (ddPCR)-based technique for measuring the genome copy (GC) titer of AAV vectors is described in Lock et al. Human Gene Therapy Methods 25:115-125. The assay used involves digestion with DNase I, followed by digital PCR analysis to measure the encapsulated vector genome copy. DNA detection is achieved using sequence-specific primers targeting the polyA region of RBG, combined with a fluorescently labeled probe that hybridizes to the same region. A number of standards, evaluation samples, and controls (for background and DNA contamination) are introduced into the assay.

[0303] Empty-to-Perfect Particle Ratio: The total particle content of the formulation is measured by SDS-PAGE analysis. A reference vector formulation purified in an iodixanol gradient is analyzed by various methods (analytical ultracentrifugation, electron microscopy, and absorbance at 260 / 280 nm) to establish the percentage of perfect particles in the formulation. This reference substance is serially diluted to known genome copy numbers (and therefore, by extension, particle numbers), and each dilution is electrophoresed on an SDS-PAGE gel along with formulations of similar dilution series. The volume of the peak region of the VP3 protein bands in the reference substance and formulation is measured by densitometry, and the volume of the reference substance is plotted against the particle number. The total particle concentration of the formulation is measured by extrapolation from this curve, and the genome copy (GC) titer is subtracted to obtain the titer of empty particles. The empty-to-perfect particle ratio is the ratio of the titer of empty particles to the titer of GC.

[0304] Infectivity Titer: The Infectious Units (IU) assay is used to measure the productive uptake and replication of the AAV8.AMD vector in RC32 cells (rep2-expressing HeLa cells). As previously published, a 96-well endpoint type is used. Briefly, RC32 cells are co-infected with serial dilutions of AAV8.AMD.BDS and unified dilutions of Ad5, with 12 overlaps for each dilution of rAAV. Cells are lysed 72 hours after infection, and qPCR is performed to detect rAAV vector amplification exceeding the input. Endpoint Dilution Tissue Culture Infectious Dose 50% (TCID50) calculation (Spearman-Karber) is performed to determine the replication titer, expressed as IU / mL. Since the "infection" value depends on the particles that come into contact with the cells, receptor binding, internalization, nuclear translocation, and genomic replication, they are affected by the geometric configuration of the assay and the presence of appropriate receptors and post-binding pathways in the cell line used. Since receptors and post-binding pathways are typically not maintained in immortalized cell lines, infectivity assay titers are not an absolute measure of the number of “infectious” particles present. However, the ratio of capsidized GC to “infectious units” (expressed as the GC / IU ratio) can be used as a measure of lot-to-lot product consistency.

[0305] Host cell DNA: A qPCR assay is used to detect residual human 293 DNA. After spiking with "irrelevant DNA," total DNA (irrelevant vector and residual genome) is extracted from approximately 1 mL of product. Host cell DNA is quantified using qPCR targeting the 18S rDNA gene. The amount of DNA detected is normalized based on the recovery of the spiked irrelevant DNA.

[0306] Host cell proteins: ELISA is used to assess the level of contamination from host HEK293 cell proteins. This is performed to measure the following: The Cygnus Technologies HEK293 Host Cell Proteins 2 nd The Generation ELISA kit is used according to the instructions.

[0307] Reproducible AAV (rcAAV) assay: Samples are analyzed for the presence of reproducible AAV2 / 8 (rcAAV) that may arise during the preparation process.

[0308] An example of this type of assay is shown (Figures 10A-10D), in which wtAAV8 is spiked into AAV8 vectors with different GC numbers, and the number of cap gene copies per 293 cells of DNA per 1 μg of cell lysates is measured after three successive passages of cell lysates into new cells. Details of the assay development are included in the CTA submission. These results indicate that the minimum detectable amount of wtAAV8 using this assay is 10 4 This indicates that it is a garbage collector (GC). This number is 1TCID. 50 The result is nearly equivalent to IU, reflecting the infectivity deletion of AAV8 against 293 cells, as evidenced by the high GC:IU ratio obtained compared to AAV2. Low sensitivity is unavoidable in the current assay system, but may be overcome in the future by creating cell lines with AAV cell receptors or other proteins important in the post-entry pathway that have not yet been discovered. 11 The spikes in the AAV8 vector at concentrations up to GC had little effect on detection, indicating no interference of the vector to wtAAV8 replication at this vector level. While wild-type AAV has been overused in the past as a substitute for rcAAV2 and as a substitute for AAV8 in our own efforts to develop rcAAV assays, the best substitutes are the AAV8 capsid containing the ITR of AAV2, the rep gene of AAV2, and the cap gene of AAV8.

[0309] [Table 14-1] [Table 14-2]

[0310] A clinically suitable surfactant, Pluronic F68, is added to the final formulation buffer of AAV8.AMD to minimize this type of loss. Interactions between the formulation and the storage vial and clinical delivery device were investigated to determine the amount of vector loss through surface binding. GC titer (oqPCR) of the engineered run formulation is measured before and after vialing and storage at -60°C or below. Regarding the delivery device, the DP is thawed, diluted to the correct dose concentration with an appropriate clinical diluent, and passed through the device. GC titer determination is performed on the DP immediately after thawing, after dilution, and after passing through the device, with an appropriate number of overlaps. This method was included to ensure statistical significance. Comparison of GC titers in this method allows for the assessment of DP loss during storage and administration to patients. Parallel studies were also performed in a similar manner to assess the activity of the formulation after passing through the delivery device. For this purpose, an in vitro lanivizumab expression-based efficacy test was used. [Examples]

[0311] Safety of subretinal delivery of AAV8-anti-VEGF Fab in non-non-human primates, as evaluated by whole-field ERG. Experiments were conducted to evaluate the preclinical dose-dependent toxicity of AAV8-anti-VEGF Fab delivered subretinically in non-human primates.

[0312] This study used 20 adult male and female camouflage mice (CMs). Each animal / eye underwent a complete ophthalmic examination and retinal imaging using optical coherence tomography to confirm the absence of any abnormalities that could affect retinal function. The ERG sessions were conducted under dim lighting conditions. Full-field stimulation was generated using a custom-made Ganzfeld stimulator lined with aluminum foil and an LED emitter mounted on the floor. The light source was calibrated using an ILT5000 photometer (International Light Technologies (Peabody, MA)). An Espion workstation from Diagnosys LLC (Lowell, MA) controlled the stimulator and obtained the signal. ERGs were recorded using bipolar Briand-Allene electrodes (Hansen Labs, Coralwhille, IA). The intensity of the flash stimuli used (cd sm) is recorded. -2 The procedure followed ISCEV standards and is shown in the table below. All stimuli were 5 ms flashes provided by an LED light source. ERGs were recorded before active substance delivery and at 3, 6, 9, and 12 months. The active substance was delivered to the right eye at 1E10 (low dose, LD) or 1E12 (high dose, HD) vg / eye; and the left eye was used as a control. ERGs were recorded before active substance delivery and at 3, 6, 9, and 12 months.

[0313] Stimulus parameters used in the current work [Table 15]

[0314] The animals were sedated with 8 mg / kg ketamine and 0.025 mg / kg dexmeditomidine, their pupils were dilated with phenylephrine (2.5%) and tropicamide (1%), and propalacaine (0.5%) was used for local anesthesia. If necessary, 4 mg / kg ketamine and 0.0125 mg / kg dexmeditomidine were administered as needed. Heart rate, SpO2, respiratory rate, and body temperature were monitored. The monkeys were placed on a custom-designed stage equipped with a bite bar and ear clamps in a "sphinx" position (prone position with the head excessively extended), with their heads and eyes facing forward.

[0315] Two recording bipolar Briandallene electrodes, moistened with GONAK methylcellulose solution (AKORN, Inc., Lake Forest, IL), were placed in the animal's eye, and a ground electrode (GRASS gold electrode, Astro-Med, West Warwick, RI) was taped to the shaved skin between the crown and inion. One drop of ELECTRO-GEL (Electro-Cap International, Eston, OH) was applied to the skin beneath the ground electrode to provide good electrical contact. The stage in which the animal was located was moved to a Ganzfeld enclosure so that the entire head of the animal was inside the Ganzfeld during the recording session.

[0316] As demonstrated in Figures 19 and 20, AAV8-anti-VEGF Fab injected subretinically at 1E10 vg / eye did not affect ERG size and therefore did not show toxicity at this dose. At higher doses of 1E12 vg / eye, toxicity was evident. After application, ERG size decreased by approximately 50%. This decrease occurred similarly across all ERG components, indicating that the active ingredient does not target specific cell types but rather exhibits general toxicity at very high concentrations. The toxic effect fully manifested within the first three months after injection, and statistical significance was limited only to the 3-month mark (n=6), after which it remained dormant. ERG size recorded at 6, 9, and 12 months after administration of the active ingredient was similar to that at 3 months, but the animal population of 2-3 animals / group was insufficient for statistical analysis.

[0317] These results suggest the following: (1) Subretinal delivery of AAV8 anti-VEGF Fab in 1E10 vg / monkey eyes does not cause any retinal dysfunction detectable by whole-field electroretinography. (2) Statistically significant impairment of retinal function, as revealed by a decrease in the amplitude of the whole-field ERG, is observed with high-dose vector use (1E12 vg / eye). (3) The full manifestation of retinal dysfunction is achieved three months after injection; at the time of injection of 1E12 vg / eye of the active ingredient, retinal function remains at a reduced level. (4) AAV8 anti-VEGF Fab does not selectively impair the function of specific cell types, but rather exhibits general toxicity at high concentrations. [Examples]

[0318] Safety of subretinal delivery of AAV8-anti-VEGF Fab in NHP: Retinal structure after one year Age-related macular degeneration (AMD) is a progressive, irreversible, and severe degenerative retinal disease that causes significant central visual field loss. The neovascular ("exudative") form of AMD (nAMD) is characterized by abnormal vascular development within and beneath the neuroretina. This abnormal vascular growth leads to rapid leakage, causing typical hemorrhage, deformation, and destruction of normal retinal structures. Anti-VEGF Fab (fragment antigen binding) is a recombinant humanized monoclonal IgG1 isotype kappa fragment approved for the treatment of nAMD. Anti-VEGF Fab binds to all isoforms of human vascular endothelial growth factor (VEGF)-A and inhibits its biological activity. This inhibits endothelial cell proliferation, abnormal vascular growth, and vascular leakage. It suppresses angiogenesis. However, repeated administration of anti-VEGF Fab is necessary to prevent recurrence of angiogenesis. Repeated administration of anti-VEGF Fab can be avoided with gene therapy. A single subretinal dose of the vector allowed for the delivery of a sufficient number of copies of the target gene to provide continuous therapeutic levels of anti-VEGF agents.

[0319] AAV8 anti-VEGF Fab is being developed for gene therapy of nAMD. AAV8 anti-VEGF Fab is a non-replicating recombinant adeno-associated virus (AAV) vector consisting of serotype 8 capsids, containing a gene cassette adjacent to an AAV2 inverted terminal repeat (AAV2 / 8 vector). The gene cassette of AAV8 anti-VEGF Fab encodes anti-VEGF Fab.

[0320] To evaluate long-term (1 year) safety and define the upper limit of the subretinal dose of AAV8 anti-VEGF Fab for the treatment of exudative AMD in non-human primates (NHPs), we conducted experiments.

[0321] method: Cynomolgus macaques were randomly assigned to various treatment groups. Each treatment group received either a specific dose of an AAV2 / 8 vector expressing anti-VEGF Fab, or a final formulation buffer control (FFB-314). Animals received a single 100 μL dose of either 1.00e12 GC / eye, 1.00e11 GC / eye (Aleman et al., 2017, Trctiakova et al., 2017), or 1.00e10 GC / eye of AAV2 / 8 vector. The vector was administered subretally to the designated eye (high and low doses to the right eye (OD) only, and a medium dose to both the left eye (OS) and the right eye). Experiments were conducted at baseline and 3 months. Subsets of animals were followed up to 6 months (n=7) and 12 months (n=6) after injection into the low-dose, high-dose, and control groups. The anterior chamber fluid was collected at a pre-specified time.

[0322] ELISA: The concentration of anti-VEGF Fab was determined by VEGF enzyme immunosorbent assay (ELISA) of anterior chamber fluid, vitreous fluid, and tissue homogenates prepared from various segments of the injected and uninjected retina.

[0323] Retinal imaging: Retinal structures were evaluated using spectral-regional optical coherence tomography (SD-OCT) (Spectralis OCT, Heidelberg Engineering GmbH, Heidelberg, Germany). Frontal retinal imaging was performed in a darkroom equipped with near-infrared reflectivity (NIR-REF) (to maintain adaptability to ERG experiments), and near-infrared fundus autofluorescence (NIR-FAF) was performed in a subset of animals using a scanning laser ophthalmoscope of this imaging system. SD-OCT scans were performed by superimposing 30°x25°mm raster scans in horizontal and vertical sections 9 mm long passing through the fovea. Retinal layers were quantified using the Spectralis system's built-in automated segmentation and monitored to ensure accurate identification of boundaries between different layers. A thickness topography map of the entire retina was generated and used in combination with frontal imaging to visualize the treatment area as a region of interest (ROI) for further focused segmentation analysis. The segmentation parameters investigated within the ROI were: 1- Total retinal thickness, defined as the distance between the internal limiting membrane (ILM) and the basal side of the retinal pigment epithelial signaling (RPE); 2- Inner retinal thickness, defined as the distance between the ILM and the outer plexiform layer (OPL); 3- Outer nuclear layer (ONL) thickness, defined as the distance between the OPL and the outer limiting membrane (ELM); 4- Elliptic zone (EZ) to Bruch's membrane (BrM), and SD - One definition is the distance between these two bands on OCT (Aleman et al., 2017). Comparisons were made between parameters before and after treatment, and with similar areas in the opposite, uninjected eye. An injected area of ​​the eye was compared using a normative database constructed from data along the vertical meridian from the uninjected eye, without using imaging of the uninjected baseline (1.00E+11 GC / eye, n=4) at the ROI.

[0324] Long-term expression of AAV8 anti-VEGF Fab Anti-VEGF Fab expression was determined by ELISA. Expression was compared between high-dose, medium-dose, and low-dose groups. One high-dose animal that lost transgene expression showed an antibody response to the human transgene product (data not shown).

[0325] These results indicate robust and sustained expression of anti-VEGF Fab in all treatment groups.

[0326] Frontal retinal imaging Near-infrared reflection (NIR-REF): NIR-REF images were obtained from six animals that completed follow-up 12 months after injection (data not shown). Dark convex lines correspond to the contours of subretinal blebs. In high-dose animals, a clear change in the NIR-REF signal was observed in the injected retina, but the signal was normal, and no significant difference was observed between the injected retina and the surrounding retina of low-dose animals that did not receive the injection.

[0327] Near-infrared fundus autofluorescence (NIR-FAF): NIR-FAF at 3 months post-injection compared to 12 months post-injection (data not shown). Dark areas of demelaninization are observed within the injected retina of all animals. These lesions appear denser and more widespread in higher-dose animals. HyperFAF at 68587 in the center of the injected retina corresponds to localized chronic serous detachment. Depigmented retinas are evident in retinas that appear normal with respect to NIR-REF, suggesting RPE and / or choroidal demelaninization, in contrast to NIR light absorption due to RPE surface structures that result in altered NIR-REF signaling. These lesions appear to stabilize over time after the earliest point in time, with the exception of 76562, which showed slight movement of depigmented borders in the perinasal and peripapillary retina.

[0328] Demelaninization by normal structure Representative images are shown in Figures 21 and 22. The appearance of the retina on SD-OCT in the cross-section of the low autofluorescence region (dotted arrow on the left, Figure 21) is very similar to that without NIR-FAF changes (dashed arrow in the center, Figure 21). The boundary of the bleb indicates localized destruction of the apical retinal epiphysis (RPE) at the outer edge of the retina (data not shown). The interdigital signal (white arrow, Figure 21) appears attenuated (gray arrow, Figure 21) within the injection area near the low autofluorescence region.

[0329] Cross-sectional retinal imaging Front view image: Near-infrared fundus autofluorescence (NIR-FAF) image caused by excitation of melanin fluorescein. Image obtained 12 months after injection. The retinal vascular system and optic nerve head appear as dark images against a normal grayish NIR-FAF background. Focused chronic serous retinal detachment was confirmed (data not shown).

[0330] There is a transition zone between the demelaninized (dark) area near the center of the injected retina and the retina with a normal or nearly normal NIR-FAF appearance (data not shown).

[0331] Thickness Topography: Using 9mm long SD-OCT raster scans, we determined the overall retinal thickness topography from regions of interest (ROIs) in the post-injection retina 12 months after injection, corresponding to the pre-injection site in the same region. Images were co-registered. The scan direction and overlapping segments before and after injection were recorded.

[0332] In animals, especially those receiving high doses, there is a transitional area between the demelanized, thin retina within the bleb and the adjacent, normally melanized, normal-thickness retina (data not shown).

[0333] Cross-sectional imaging: 1.5 mm SD-OCT section of the injection site 12 months after injection, compared with pre-injection image. Pre- and post-injection images were adjusted using vascular elements. Nuclear layers were labeled (GCL = ganglion cell layer; INL = inner nuclear layer; ONL = outer nuclear layer). Distal structures of the ONL that were consistently identified in these locations in the central retina were also labeled (EZ = elliptic zone, RPE = retinal pigment epithelium, BrM = Bruch's membrane). T = temporal; N = nasal retina.

[0334] At the highest vector dose, the retina thins overall and the tissue becomes disordered. At the lowest vector dose, the retina appears normal, or abnormalities are limited to the lateral segment of photoreceptors with RPE between the digital processes.

[0335] Vertical changes in structural parameters: Comparison of SD-OCT parameters expressed as relative change (percentage of baseline) and plotted as a function of time after a single injection of AAV2 / 8-anti-VEGF Fab into the monocular subretina compared to the vehicle-injected eye (data not shown). The limits of inter-visit variability of parameters estimated in the vehicle-injected control (99th percentile limit of change: TRT=14%, IRT=31%, ONL=18%; EZ-RPE10%; n=4) were recorded in comparison with parameters measured in animals injected with the vector. The dashed line for the vehicle-injected eye is plotted to represent the limits estimated from the uninjected eye (99th percentile limit of change: TRT=7%, IRT=16%, ONL=22%; EZ-RPE19%; n=16). The distance from EZ to BrM / RPE is a surrogate measure of the length of the outer segment (POS) of the photoreceptor.

[0336] 1e12 GC / Eye: At 3 months, the overall retinal thickness in the injected area was significantly thinner than baseline in one animal (C76562). Two animals in this group that were followed longitudinally (C61636 for 6 months and C71849 for 12 months) ultimately showed overall retinal thinning. The inner retina was generally thicker than normal, but this was not significant. The overall reduction in retinal thickness occurred in conjunction with a deficiency or reduction of the posterior superioris (POS) associated with thinning of the onset retina (ONL). Significant thinning of both ONL and POS was observed in 4 / 6 animals 3 months after injection. One animal (C71849) that showed no change in ONL thickness at 3 months ultimately showed ONL thinning at follow-up. All animals in this group showed a reduction in the distance from EZ to RPE / BrM, which represents a deficiency or reduction of POS at all time points.

[0337] 1e10 GC / eye: During the observation period, the thickness of the entire retina, the interior of the retina, and the outer retina did not change significantly. In the 3-month study, 5 out of 6 animals had a range of POS deficiency (9-30%), which was significantly different from the control group without injection, but not as severe as that observed in the high-dose group. At follow-up, animals that showed thinning from EZ to RPE / BrM recovered to normal levels (C73946;C75760). The increase in thickness was due to persistent localized serous It was related to delamination (C68587).

[0338] Controlling eye: From the initial stages, there was a tendency for the thickness of the inner retinal layer and the distance from the EZ to the RPE / BrM to increase (similar to the trend observed in the low-dose group), but there was no significant change in thickness for any of the parameters at 12 months.

[0339] conclusion AAV8-anti-VEGF Fab induces long-term dose-dependent expression of anti-VEGF Fab. Subretinal injection of AAV8-anti-VEGF Fab in NHP eyes demonstrated long-term safety in the low-dose group, without significant changes in SD-OCT structural parameters up to 12 months after injection, while high-dose groups were associated with significant structural changes within the injection area, including overall retinal thinning. NIR-FAF imaging revealed low autofluorescence within the injection area in NHP eyes that underwent both experimental and vehicle injections, suggesting RPE demelaninization.

[0340] [Table 16] [Sequence Listing Free Text]

[0341] The following information is an identification number <223> Provided for the array containing the free text below. [Table 17-1] [Table 17-2] [Table 17-3] [Table 17-4] [Table 17-5] [Table 17-6] [Table 17-7] [Table 17-8] [Table 17-9] Table 17-10 Table 17-11 Table 17-12 Table 17-13 Table 17-14 Table 17-15 Table 17-16 Table 17-17 Table 17-18 Table 17-19 Table 17-20 Table 17-21 Table 17-22 Table 17-23 Table 17-24 Table 17-25 Table 17-26 [Table 17-27] [Table 17-28] [Table 17-29] [Table 17-30] [Table 17-31] [Table 17-32] [Table 17-33] [Table 17-34] [Table 17-35] [Table 17-36]

[0342] All publications cited herein are incorporated in their entirety as constituting part of this specification, including U.S. Provisional Patent Application No. 62 / 663,532 filed April 27, 2018, and U.S. Provisional Patent Application No. 62 / 632,775 filed February 20, 2018. Similarly, sequence numbers described herein and found in the attached sequence listings are incorporated as constituting part of this specification. While the present invention has been described with reference to specific embodiments, it will be understood that modifications may be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the attached claims.

Claims

1. A liquid suspension suitable for subretinal injection in human subjects, wherein the suspension comprises an aqueous liquid and recombinant adeno-associated virus (rAAV) having an AAV8 capsid, the rAAV comprising a vector genome packaged within the capsid, and the vector genome is: (a) Terminal inversion (ITR) of AAV; (b) A coding sequence for an anti-human vascular endothelial growth factor (VEGF) antigen-binding antibody fragment (Fab), comprising an exogenous leader sequence, an immunoglobulin heavy chain, a linker, and an immunoglobulin light chain having an exogenous leader sequence, wherein the coding sequence is operably linked to a regulatory factor that induces the expression of the anti-VEGF Fab in the eye; (c) A regulatory factor that induces the expression of the immunoglobulin heavy chain and light chain of the anti-VEGF Fab and comprises a promoter selected from the tribeta-actin promoter or the ubiquitin C promoter; and (d) The liquid suspension comprising the ITR of AAV.

2. The suspension according to claim 1, wherein the linker is an F2A linker.

3. The suspension according to claim 1 or claim 2, wherein the heterogeneous leader sequence is an IL2 leader.

4. The suspension according to any one of claims 1 to 3, wherein the regulatory factor further comprises a UTR sequence.

5. The suspension according to any one of claims 1 to 4, wherein the control factor further comprises an enhancer and an intron.

6. The suspension according to claim 5, wherein the regulatory factor comprises a cytomegalovirus early enhancer, a CB7 promoter, and a tri B actin intron.

7. The coding sequence of the variable regions of the anti-VEGF Fab heavy chain and light chain is (a) aVEGFv3 (SEQ ID NO: 24); (b) aVEGFv2 (SEQ ID NO: 3); or (c) aVEGFv1 (SEQ ID NO: 19); (d) aVEGFv4 (SEQ ID NO: 35); (e) aVEGFv5 (SEQ ID NO: 36); (f) aVEGFv6 (SEQ ID NO: 37); (g) aVEGFv7 (SEQ ID NO: 38); (h) aVEGFv8 (SEQ ID NO: 39); (i) aVEGFv9 (SEQ ID NO: 40); (j) aVEGFv10 (SEQ ID NO: 41); (k) aVEGFv11 (SEQ ID NO: 42); (l) aVEGFv12 (SEQ ID NO: 43); or (m) A suspension according to any one of claims 1 to 6, selected from the group consisting of aVEGFv13 (SEQ ID NO: 44).

8. The aforementioned vector genome, (a) ITR-CB7-CI-aVEGFv3-rBG-ITR (Sequence ID 14); (b) ITR-CB7-CI-aVEGFv2-rBG-ITR (Sequence ID 3); (c) ITR-UbC-CI-aVEGFv2-SV40-ITR (Sequence ID 9): (d) ITR-UbC-PI-aVEGFv3-SV40-ITR (Sequence ID 19); (e) ITR-UbC-PI-aVEGFv1-SV40-ITR (Sequence ID 24); (f) ITR-CB7.CI. aVEGFv4.rBG-ITR (Sequence ID 35); (g) ITR-CB7.CI. aVEGFv5.rBG-ITR (Sequence ID 36); (h) ITR-CB7.CI. aVEGFv6.rBG-ITR (Sequence ID 37); (i) ITR-CB7.CI.aVEGFv7.rBG-ITR (Sequence ID 38); (j) ITR-CB7.CI. aVEGFv8.rBG-ITR (Sequence ID 39); (k) ITR-CB7.CI. aVEGFv9.rBG-ITR (Sequence ID 40); (l) ITR-CB7.CI. aVEGFv10.rBG-ITR (Sequence ID 41); (m) ITR-CB7.CI. aVEGFv11.rBG-ITR (Sequence ID 42); (n) ITR-CB7.CI. aVEGFv13.rBG-ITR (Sequence ID 43); (o) ITR-CB7.CI. aVEGFv14.rBG-ITR (Sequence ID 44); (p) Sequence ID 45; (q) Sequence ID 46; or (r) Sequence ID 47 A suspension according to any one of claims 1 to 7, selected from the group consisting of the following.

9. The suspension according to any one of claims 1 to 8, wherein the patient has exudative age-related macular degeneration.

10. Use of the liquid suspension according to any one of claims 1 to 9 in the preparation of a pharmaceutical product for subretinal administration to a patient.

11. The use according to claim 10, wherein the patient has exudative age-related macular degeneration.

12. A method for administering an anti-VEGF Fab to a human subject having exudative age-related macular degeneration, the method comprising injecting a liquid suspension suitable for subretinal injection into the retina of the human subject, the suspension comprising an aqueous liquid and recombinant adeno-associated virus (rAAV) having an AAV8 capsid, the rAAV comprising a vector genome packaged within the capsid, the vector genome being: (a) Terminal inversion (ITR) of AAV; (b) A coding sequence for an anti-human vascular endothelial growth factor (VEGF) antigen-binding antibody fragment (Fab), comprising an exogenous leader sequence, an immunoglobulin heavy chain, a linker, and an immunoglobulin light chain having an exogenous leader sequence, wherein the coding sequence is operably linked to a regulatory factor that induces the expression of the anti-VEGF Fab in the eye. The aforementioned code sequence; (c) A regulatory factor that induces the expression of the immunoglobulin heavy chain and light chain of the anti-VEGF Fab and comprises a promoter selected from the tribeta-actin promoter or the ubiquitin C promoter; and (d) Including the ITR of AAV, The suspension is divided into 1.6 × 10 11 GC / eye (6.2×10 11 GC / mL), or 2.5 × 10 11 GC / eye (1×10 12 The method described above, injecting at a dose of GC / mL.

13. The method according to claim 12, wherein the linker is an F2A linker.

14. The method according to claim 12 or claim 13, wherein the heterogeneous leader sequence is an IL2 leader.

15. The method according to any one of claims 12 to 14, wherein the regulatory factor further comprises a UTR sequence.

16. The method according to any one of claims 12 to 15, wherein the regulatory factor comprises a cytomegalovirus early enhancer, a CB7 promoter, and a tri B actin intron.

17. The coding sequence of the variable regions of the anti-VEGF Fab heavy chain and light chain is (a) aVEGFv3 (SEQ ID NO: 24); (b) aVEGFv2 (SEQ ID NO: 3); or (c) aVEGFv1 (SEQ ID NO: 19); (d) aVEGFv4 (SEQ ID NO: 35); (e) aVEGFv5 (SEQ ID NO: 36); (f) aVEGFv6 (SEQ ID NO: 37); (g) aVEGFv7 (SEQ ID NO: 38); (h) aVEGFv8 (SEQ ID NO: 39); (i) aVEGFv9 (SEQ ID NO: 40); (j) aVEGFv10 (SEQ ID NO: 41); (k) aVEGFv11 (SEQ ID NO: 42); (l) aVEGFv12 (SEQ ID NO: 43); or (m) The method according to any one of claims 12 to 16, selected from the group consisting of aVEGFv13 (SEQ ID NO: 44).

18. The aforementioned vector genome, (a) ITR-CB7-CI-aVEGFv3-rBG-ITR (Sequence ID 14); (b) ITR-CB7-CI-aVEGFv2-rBG-ITR (Sequence ID 3); (c) ITR-UbC-CI-aVEGFv2-SV40-ITR (Sequence ID 9): (d) ITR-UbC-PI-aVEGFv3-SV40-ITR (Sequence ID 19); (e) ITR-UbC-PI-aVEGFv1-SV40-ITR (Sequence ID 24); (f) ITR-CB7.CI. aVEGFv4.rBG-ITR (Sequence ID 35); (g) ITR-CB7.CI. aVEGFv5.rBG-ITR (Sequence ID 36); (h) ITR-CB7.CI. aVEGFv6.rBG-ITR (Sequence ID 37) ; (i) ITR-CB7.CI.aVEGFv7.rBG-ITR (Sequence ID 38); (j) ITR-CB7.CI. aVEGFv8.rBG-ITR (Sequence ID 39); (k) ITR-CB7.CI. aVEGFv9.rBG-ITR (Sequence ID 40); (l) ITR-CB7.CI. aVEGFv10.rBG-ITR (Sequence ID 41); (m) ITR-CB7.CI. aVEGFv11.rBG-ITR (Sequence ID 42); (n) ITR-CB7.CI. aVEGFv13.rBG-ITR (Sequence ID 43); (o) ITR-CB7.CI. aVEGFv14.rBG-ITR (Sequence ID 44); (p) Sequence ID 45; (q) Sequence ID 46; or (r) Sequence ID 47 A method according to any one of claims 12 to 17, selected from the group consisting of the following.

19. The suspension according to any one of claims 1 to 11, or the method according to any one of claims 12 to 18, wherein the rAAV is delivered in a suspension volume of about 75 μL to about 150 μL.

20. The suspension according to any one of claims 1 to 11, or the method according to claim 12, wherein the rAAV is delivered in a suspension volume of about 100 μL.

21. A product comprising (a) a first container containing the suspension according to any one of claims 1 to 11, (b) an optional second container containing a diluent, and (c) a needle for injection.