Method for producing 3-hydroxypropionic acid-containing polyester using recombinant bacterial strains

Abstract

The objective is to produce poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid) (P(3HB-co-3HP)) copolymer using inexpensive biomass as the basic carbon source. [Solution] According to the present invention, a method is provided for producing a P(3HB-co-3HP) copolymer having a high 3HP fraction by blocking the 3HP degradation pathway in a C. necator H16 strain into which a gene encoding a malonyl-CoA reductase mutant has been introduced by homologous recombination.

Description

Technical Field

[0001] The present invention relates to a method for improving the fraction of 3-hydroxypropionic acid in a copolymer by using a saccharide as a single carbon source in the production of poly(3-hydroxybutyric acid-co-3-hydroxypropionic acid), which is one of the biodegradable and biocompatible copolyesters with biomass such as sugar and vegetable oil as the basic raw materials, by microorganisms.

Background Art

[0002] Plastics are indispensable materials in modern society because they can achieve versatile physical properties according to their structures and are inexpensive. However, most plastics are synthesized from petroleum and have been developed and produced for long-term stability. As a result, many petroleum synthetic plastics are not decomposed in the natural environment after being discarded, so the management and disposal of unnecessary plastic waste have become a major problem in countries around the world. In addition, the depletion of fossil resources represented by petroleum is also an urgent problem. Even if the recoverable years of fossil resources have been extended due to the progress of mining technology, these are still limited resources, and it is predicted that the consumption of fossil resources will continue to increase in the future due to the expansion of demand caused by the economic growth of the world. In addition, the increase in the concentration of carbon dioxide in the atmosphere due to the consumption of fossil resources has also become a major environmental problem. Therefore, it is necessary to suppress the consumption of fossil resources and build a social system that does not depend on fossil resources.

[0003] Against this backdrop, the development and practical application of bioplastics, which are environmentally friendly plastic materials, are highly desired. Bioplastics are a general term encompassing two types: "biodegradable plastics" and "biomass plastics." Biodegradable plastics are plastics that are broken down by microorganisms in the environment, eliminating the waste disposal problems associated with petroleum-based synthetic plastics. Biomass plastics, on the other hand, are plastics made from renewable biomass resources derived from plants and animals. The carbon dioxide produced by their combustion is originally carbon dioxide fixed in the atmosphere through plant photosynthesis (carbon neutral), making them a material that can contribute to the creation of a future circular economy from the perspective of fossil resource depletion and greenhouse gas emissions.

[0004] Polyhydroxyalkanoates (PHAs) produced by microorganisms are environmentally friendly, biodegradable plastics that can be produced using biomass as a raw material. However, poly(3-hydroxybutanoic acid) [P(3HB)], a representative PHA, is difficult to commercialize due to its hard and brittle properties. On the other hand, by devising a carbon source to supply to P(3HB)-producing bacteria, copolymer polyesters with a second monomer unit can be synthesized. Generally, copolymer polyesters change their physical properties depending on the structure and composition of the second monomer, so microbial synthesis of copolymer polyesters that can be used as practical biodegradable plastics is attracting attention. For example, poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid) [P(3HB-co-3HP)] can be synthesized by supplying P(3HB)-producing bacteria with a mixed carbon source containing 3-hydroxypropionic acid (3HP) or 1,3-propanediol. This copolymer is a superior plastic material with a lower melting point and higher flexibility compared to P(3HB) (Non-Patent Literature 1). However, since 3HP and 1,3-propanediol are expensive, using them as a carbon source is not practical from an operational standpoint.

[0005] The present inventors have previously demonstrated microbial synthesis of P(3HB-co-3HP) using fructose as a carbon source by modifying the P(3HB)-producing bacterium Cupriavidus necator (Ralstonia eutropha), but the 3HP fraction in the resulting copolymer was low, at a maximum of 0.7 mol% (Patent Document 1, Non-Patent Document 2). [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] Patent No. 5103619 [Non-patent literature]

[0007] [Non-Patent Document 1] “Microbial synthesis and characterization of poly(3-hydroxybutyrate-co-3-hydroxypropionate)”, E. Shimamura et al., Macromolecules, volume 27, 4429-4435 (1994) [Non-Patent Document 2] “Microbial synthesis of poly((R)-3-hydroxybutyrate-co-3-hydroxypropionate) from unrelated carbon sources by engineered Cupriavidus necator”, T. Fukui et al., Biomacromolecules, vol 10, 700-706 (2009), DOI https: / / doi.org / 10.1021 / bm801391j [Non-Patent Document 3] “Malonyl-coenzyme A reductase from Chloroflexus aurantiacus, a key enzyme of the 3-hydroxypropionate cycle for autotrophic CO2 fixation”, M. Hugler et al., J Bacteriol, vol 184, 2404-2410 (2002), DOI https: / / doi.org / 10.1128 / jb.184.9.2404-2410.2002 [Non-Patent Document 4] “The genetic basis of 3-hydroxypropanoate metabolism in Cupriavidus necator H16”, C. Arenas-Lopez et al., Biotechnology for Biofuels, volume 12, Article number: 150 (2019), DOI https: / / doi.org / 10.1186 / s13068-019-1489-5 [Non-Patent Document 5] “The methylcitric acid pathway in Ralstonia eutropha: new genes identified involved in propionate metabolism”, C. O. Bramer and A. Steinbuchel., Microbiol, vol 147, 2203-2214 (2001), DOI https: / / doi.org / 10.1099 / 00221287-147-8-2203 [Non-Patent Document 6] “Two NADH-dependent (S)-3-hydroxyacyl-CoA dehydrogenases from polyhydroxyalkanoate-producing Ralstonia eutropha”, M. Segawa et al., J Biosci Bioeng, vol 127, 294-300 (2019), DOI https: / / doi.org / 10.1016 / j.jbiosc.2018.08.009 [Non-Patent Document 7] “Functional balance between enzymes in malonyl-CoA pathway for 3-hydroxypropionate biosynthesis”, C. Liu et al., Metab Eng, vol 34, 104-111 (2016), DOI https: / / doi.org / 10.1016 / j.ymben.2016.01.001 [Overview of the project] [Problems that the invention aims to solve]

[0008] In previous research by the inventors, the 3HP fraction in the P(3HB-co-3HP) copolymer produced by a single-stage culture using fructose as a carbon source, using a modified P(3HB)-producing bacterium C. necator (Ralstonia eutropha), was as low as a maximum of 1.0 mol%. Therefore, the aim is to improve the 3HP fraction. [Means for solving the problem]

[0009] The inventors focused on the H16 strain, the most well-studied strain of C. necator, and discovered that by identifying and blocking the 3HP degradation pathway in this strain, copolymers with a high 3HP fraction can be produced using carbohydrates as a single carbon source, thus completing the present invention.

[0010] In other words, the present invention is as follows: [1] A method for producing poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid), comprising growing a recombinant microbial strain obtained by deleting one or more of the following genes in a culture medium containing carbohydrates as the sole carbon source: a wild-type microbial strain having the ability to produce 3-hydroxypropionic acid (3HP) and the ability to biosynthesize polyhydroxyalkanoic acid (PHA), or a microbial strain conferring the ability to produce 3HP and the ability to biosynthesize PHA, in a culture medium containing carbohydrates as the sole carbon source. [2] The method described in [1], which involves deleting the prpR gene. [3] The method according to [1] or [2], which involves deleting the prpR gene, the yhdH gene, and the crt2 gene. [4] The method according to any one of [1] to [3], wherein the wild-type microbial strain having 3HP production ability and PHA biosynthesis ability, and the microbial strain conferring 3HP production ability and PHA biosynthesis ability, are derived from the Cupriavidus necator strain. [5] The method according to [4], wherein the C. necator strain is the H16 strain (DSM428). [6] The method according to any one of [1] to [5], wherein the microbial strain conferring the 3HP production ability and PHA biosynthesis ability is a microbial strain obtained by transforming the wild-type microbial strain by homologous recombination of a gene encoding malonyl-CoA reductase (e.g., Mcr) or a gene of a mutant thereof, or by introducing an autonomous replication vector into which the gene is incorporated into the strain. [7] In the recombinant microbial strain, the following genes: (a) Methylmalonate semialdehyde dehydrogenase A1 gene (e.g., mmsA1 gene); (b) Methylmalonate semialdehyde dehydrogenase A2 gene (e.g., mmsA2 gene); (c) 3-hydroxypropionic acid dehydrogenase gene (e.g., hpdH gene); (d) 3-hydroxyisobutanoate dehydrogenase gene (e.g., hbdH gene); and (e) malonyl-CoA decarboxylase gene (e.g., mcd gene) The method according to any one of [1] to [6], further comprising deleting one or more of the above.

Advantages of the Invention

[0011] In the production of poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid) [P(3HB-co-3HP)] in recombinant Cupriavidus necator strain, by performing genetic manipulation to limit the metabolic pathway, a method for significantly improving the 3HP fraction can be provided.

Brief Description of the Drawings

[0012] [Figure 1] A schematic diagram of the metabolic pathway of P(3HB-co-3HP) in C. necator H16 strain is shown. [Figure 2] An expression vector ("pBBad-mcr3m") incorporating a gene encoding a malonyl-CoA reductase (Mcr) mutant used to generate a recombinant C. necator strain is shown.

Modes for Carrying Out the Invention

[0013] The present invention relates to a method for producing a P(3HB-co-3HP) copolymer with an increased 3HP fraction in a microorganism using a carbohydrate as a single carbon source. Hereinafter, for the purpose of explaining the present invention, the strategy leading to the present invention and preferred embodiments of the present invention will be described in detail.

[0014] A. Strategy (1) Construction of P(3HP) production strain Figure 1 shows the biosynthetic pathway of poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid) (hereinafter sometimes referred to as "P(3HB-co-3HP)") introduced by modifying the C. necator H16 strain. In previous research by the present inventors, it was shown that a modified strain obtained by introducing malonyl-CoA reductase (Mcr) (Non-Patent Literature 3) and 3HP-CoA synthase Acs from the green sulfur bacterium Chloroflexus aurantiacus, which produces 3HP from malonyl-CoA via malonate semialdehyde, into the Priavidus necator JMP134 strain resulted in the biosynthesis of a P(3HB-co-3HP) copolymer containing a small amount (approximately 1 mol%) of 3HP (Patent Literature 1).

[0015] One pathway for the degradation of 3HP in microorganisms is the conversion of malonyl-CoA to acetyl-CoA via oxidative decarboxylation of malonyl-CoA, which is produced by the oxidation of 3HP. In the C. necator H16 strain, there are three types of (methyl)malonyl-CoA dehydrogenases, MmsA1, MmsA2, and MmsA3, that catalyze this oxidative decarboxylation, and it has been reported that two of these, MmsA1 and MmsA2, contribute to the degradation of 3HP (Non-Patent Literature 4). In addition, the involvement of two types of 3HP / isobutanoic acid dehydrogenases, HpdH and HbdH, has been shown as enzymes that oxidize 3HP to malonyl-CoA (Non-Patent Literature 4). Furthermore, the H16 strain possesses Mcd, which is presumed to be a malonyl-CoA decarboxylase that converts malonyl-CoA to acetyl-CoA via decarboxylation. Since these enzymes degrade 3HP and its biosynthetic / degradation intermediate metabolites, malonate semialdehyde and malonyl-CoA, we created the "H16_4ΔM strain" by deleting these five genes by homologous recombination, as will be detailed in Example 1 below.

[0016] In C. necator H16 strain, there is no knowledge of 3HP degradation pathways other than the oxidative degradation pathway carried out by MmsA1 and MmsA2. On the other hand, this strain has the methylcitric acid cycle as a degradation pathway for propionic acid, which is also a C3 organic acid (Non-Patent Literature 5). It was hypothesized that 3HP is converted to 3HP-CoA by CoA conversion, and then the double bond of the acryloyl-CoA produced by the dehydration reaction is reduced to produce propionyl-CoA, which can be metabolized in the methylcitric acid cycle (Figure 1). A homologous gene of prpR, which has been reported as a transcription activator of the methylcitric acid cycle in E. coli, is also present in strain H16. If this PrpR homolog is a similar transcription activator, it was thought that the methylcitric acid cycle could be suppressed by its inactivation. As will be detailed in Example 2 below, prpR was deleted by homologous recombination to create "H16" strain. We created the "4ΔMP strain".

[0017] On the other hand, the C. necator H16 strain contains YhdH, which is presumed to be an acryloyl-CoA reductase based on amino acid sequence homology. In addition, the inventors have previously identified Crotonase Crt2, which dehydrates (S)-3-hydroxybutanoic acid, a C4 with one carbon chain longer (Non-Patent Literature 6). Considering the possibility of conversion from 3HP to propionyl-CoA by YhdH and Crt2, as detailed in Example 3 below, yhdH and crt2 were further deleted by homologous recombination to create "H16 We created the "4ΔMPΔyhdHΔcrt2 strain".

[0018] The Mcr gene used in previous research by the present inventors is a bifunctional enzyme that catalyzes a two-step reduction reaction (Non-Patent Literature 3). It has been reported that the activity of reducing malonate semialdehyde in the second step is lower than that of the first step malonyl-CoA reduction reaction, and that a triple mutation (N940V-K1106W-S1114R) that improves this activity has been reported (Non-Patent Literature 7). The mcr gene into which this triple mutation was introduced was linked to the broad-host-range vector pBBad, which has a BAD promoter that can be expressed with arabinose, to create "pBBad-mcr3m" (Figure 2). Transformants were obtained by introducing the created expression vector pBBad-mcr3m into various C. necator H16 strains via conjugate transfer.

[0019] B. Preferred Embodiment Unless otherwise defined, all technical terms, notations, and other scientific or technical terms used herein are intended to have meanings that are generally understood by those skilled in the art to which this disclosure relates. Where applicable, terms that have generally understood meanings are defined herein for clarity and / or for immediate reference, and the inclusion of such definitions herein should not necessarily be interpreted as representing a substantial difference from the generally understood meaning in the art. Furthermore, terms as defined in commonly used dictionaries should be interpreted as having meanings consistent with their meanings in the context of the relevant art and / or as meanings otherwise defined herein.

[0020] The terms used herein are for illustrative purposes only and are not intended to limit the use of any particular embodiment.

[0021] In the metabolic pathways of microorganisms, a pathway is known to convert propionyl-CoA to pyruvate for processing. The present inventors succeeded in maintaining 3HP-CoA within cells and thereby improving the 3HP fraction in P(3HB-co-3HP) by deleting the genes that possess catalytic activity involved in the conversion of 3HP-CoA to propionyl-CoA via acryloyl-CoA, and further in the metabolism of propionyl-CoA to pyruvate, thereby completing the present invention. In other words, the present invention provides a method for producing poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid), which typically involves growing a recombinant microbial strain obtained by deleting one or more of the acryloyl-CoA reductase gene (yhdH gene), the crotonase gene (crt2 gene), and the methylcitric acid cycle transcription activator gene (prpR gene) in a wild-type microbial strain having the ability to produce 3-hydroxypropionic acid (3HP) and the ability to biosynthesize polyhydroxyalkanoic acid (PHA), or a microbial strain conferring the ability to produce 3HP and the ability to biosynthesize PHA, in a culture medium containing carbohydrates as the sole carbon source.

[0022] (1) Host (microorganisms) The host used in the production method of the present invention may be a wild-type microbial strain having the ability to produce 3-hydroxypropionic acid (3HP) and polyhydroxyalkanoic acid (PHA) biosynthesize, or a microbial strain conferring the ability to produce 3HP and PHA biosynthesize. Examples of such microbial strains include, but are not limited to, Escherichia coli, bacteria of the genera Corynebacterium, Cupriavidus, Ralstonia, Alcaligenes, Hydrogenomonas, Wautersia, Pseudomonas, Bacillus, Saccharomyces yeast, and Aspergillus fungi. Preferably, the microbial strain is derived from the Cupriavidus necator strain. In particular, the C. necator strain used in the production method of the present invention is not limited to, but the H16 strain (DSM428) is preferred. According to the present invention, as the C. necator strain, a recombinant C. necator strain can be used that has been transformed by homologous recombination with a gene encoding a malonyl-CoA reductase (Mcr) mutant (mcr3m gene), or by introducing an autonomous replication vector into which the gene has been incorporated into the strain.

[0023] As used herein, "malonyl-CoA reductase" (also referred to as "Mcr") refers to a protein that has catalytic activity to produce malonyl-CoA semialdehyde from malonyl-CoA. The gene encoding this enzyme is referred to as "mcr". As will be understood by those skilled in the art, in some microbial species, it may be a bifunctional enzyme that catalyzes a two-step reaction: the reduction of malonyl-CoA and the subsequent reduction of malonyl-CoA semialdehyde. The wild-type amino acid sequence (SEQ ID NO: 4) and nucleotide sequence (SEQ ID NO: 5) of "Mcr" are known. According to the present invention, it is preferable to use a mutant malonyl-CoA reductase obtained from a sequence in which a mutation has been made in part of the amino acid sequence or nucleotide sequence of the enzyme as the malonyl-CoA reductase.

[0024] Wild-type malonyl-CoA reductase (amino acid sequence) Met Ser Gly Thr Gly Arg Leu Ala Gly Lys Ile Ala Leu Ile Thr Gly Gly Ala Gly Asn Ile Gly Ser Glu Leu Thr Arg Arg Phe Leu Ala Glu Gly Ala Thr Val Ile Ile Ser Gly Arg Asn Arg Ala Lys Leu Thr Ala Leu Ala Glu Arg Met Gln Ala Glu Ala Gly Val Pro Ala Lys Arg Ile Asp Leu Glu Val Met Asp Gly Ser Asp Pro Val Ala Val Arg Ala Gly Ile Glu Ala Ile Val Ala Arg His Gly Gln Ile Asp Ile Leu Val Asn Asn Ala Gly Ser Ala Gly Ala Gln Arg Arg Leu Ala Glu Ile Pro Leu Thr Glu Ala Glu Leu Gly Pro Gly Ala Glu Glu Thr Leu His Ala Ser Ile Ala Asn Leu Leu Gly Met Gly Trp His Leu Met Arg Ile Ala Ala Pro His Met Pro Val Gly Ser Ala Val Ile Asn Val Ser Thr Ile Phe Ser Arg Ala Glu Tyr Tyr Gly Arg Ile Pro Tyr Val Thr Pro Lys Ala Ala Leu Asn Ala Leu Ser Gln Leu Ala Ala Arg Glu Leu Gly Ala Arg Gly Ile Arg Val Asn Thr Ile Phe Pro Gly Pro Ile Glu Ser Asp Arg Ile Arg Thr Val Phe Gln Arg Met Asp Gln Leu Lys Gly Arg Pro Glu Gly Asp Thr Ala His His Phe Leu Asn Thr Met Arg Leu Cys Arg Ala Asn Asp Gln Gly Ala Leu Glu Arg Arg Phe Pro Ser Val Gly Asp Val Ala Asp Ala Ala Val Phe Leu Ala Ser Ala Glu Ser Ala Ala Leu Ser Gly Glu Thr Ile Glu Val Thr His Gly Met Glu Leu Pro Ala Cys Ser Glu Thr Ser Leu Leu Ala Arg Thr Asp Leu Arg Thr Ile Asp Ala Ser Gly Arg Thr Thr Leu Ile Cys Ala Gly Asp Gln Ile Glu Glu Val Met Ala Leu Thr Gly Met Leu Arg Thr Cys Gly Ser Glu Val Ile Ile Gly Phe Arg Ser Ala Ala Ala Leu Ala Gln Phe Glu Gln Ala Val Asn Glu Ser Arg Arg Leu Ala Gly Ala Asp Phe Thr Pro Pro Ile Ala Leu Pro Leu Asp Pro Arg Asp Pro Ala Thr Ile Asp Ala Val Phe Asp Trp Ala Gly Glu Asn Thr Gly Gly Ile His Ala Ala Val Ile Leu Pro Ala Thr Ser His Glu Pro Ala Pro Cys Val Ile Glu Val Asp Asp Glu Arg Val Leu Asn Phe Leu Ala Asp Glu Ile Thr Gly Thr Ile Val Ile Ala Ser Arg Leu Ala Arg Tyr Trp Gln Ser Gln Arg Leu Thr Pro Gly Ala Arg Ala Arg Gly Pro Arg Val Ile Phe Leu Ser Asn Gly Ala Asp Gln Asn Gly Asn Val Tyr Gly Arg Ile Gln Ser Ala Ala Ile Gly Gln Leu Ile Arg Val Trp Arg His Glu Ala Glu Leu Asp Tyr Gln Arg Ala Ser Ala Ala Gly Asp His Val Leu Pro Pro Val Trp Ala Asn Gln Ile Val Arg Phe Ala Asn Arg Ser Leu Glu Gly Leu Glu Phe Ala Cys Ala Trp Thr Ala Gln Leu Leu His Ser Gln Arg His Ile Asn Glu Ile Thr Leu Asn Ile Pro Ala Asn Ile Ser Ala Thr Thr Gly Ala Arg Ser Ala Ser Val Gly Trp Ala Glu Ser Leu Ile Gly Leu His Leu Gly Lys Val Ala Leu Ile Thr Gly Gly Ser Ala Gly Ile Gly Gly Gln Ile Gly Arg Leu Leu Ala Leu Ser Gly Ala Arg Val Met Leu Ala Ala Arg Asp Arg His Lys Leu Glu Gln Met Gln Ala Met Ile Gln Ser Glu Leu Ala Glu Val Gly Tyr Thr Asp Val Glu Asp Arg Val His Ile Ala Pro Gly Cys Asp Val Ser Ser Glu Ala Gln Leu Ala Asp Leu Val Glu Arg Thr Leu Ser Ala Phe Gly Thr Val Asp Tyr Leu Ile Asn Asn Ala Gly Ile Ala Gly Val Glu Glu Met Val Ile Asp Met Pro Val Glu Gly Trp Arg His Thr Leu Phe Ala Asn Leu Ile Ser Asn Tyr Ser Leu Met Arg Lys Leu Ala Pro Leu Met Lys Lys Gln Gly Ser Gly Tyr Ile Leu Asn Val Ser Ser Tyr Phe Gly Gly Glu Lys Asp Ala Ala Ile Pro Tyr Pro Asn Arg Ala Asp Tyr Ala Val Ser Lys Ala Gly Gln Arg Ala Met Ala Glu Val Phe Ala Arg Phe Leu Gly Pro Glu Ile Gln Ile Asn Ala Ile Ala Pro Gly Pro Val Glu Gly Asp Arg Leu Arg Gly Thr Gly Glu Arg Pro Gly Leu Phe Ala Arg Arg Ala Arg Leu Ile Leu Glu Asn Lys Arg Leu Asn Glu Leu His Ala Ala Leu Ile Ala Ala Ala Arg Thr Asp Glu Arg Ser Met His Glu Leu Val Glu Leu Leu Leu Pro Asn Asp Val Ala Ala Leu Glu Gln Asn Pro Ala Ala Pro Thr Ala Leu Arg Glu Leu Ala Arg Arg Phe Arg Ser Glu Gly Asp Pro Ala Ala Ser Ser Ser Ser Ala Leu Leu Asn Arg Ser Ile Ala Ala Lys Leu Leu Ala Arg Leu His Asn Gly Gly Tyr Val Leu Pro Ala Asp Ile Phe Ala Asn Leu Pro Asn Pro Pro Asp Pro Phe Phe Thr Arg Ala Gln Ile Asp Arg Glu Ala Arg Lys Val Arg Asp Gly Ile Met Gly Met Leu Tyr Leu Gln Arg Met Pro Thr Glu Phe Asp Val Ala Met Ala Thr Val Tyr Tyr Leu Ala Asp Arg Asn Val Ser Gly Glu Thr Phe His Pro Ser Gly Gly Leu Arg Tyr Glu Arg Thr Pro Thr Gly Gly Glu Leu Phe Gly Leu Pro Ser Pro Glu Arg Leu Ala Glu Leu Val Gly Ser Thr Val Tyr Leu Ile Gly Glu His Leu Thr Glu His Leu Asn Leu Leu Ala Arg Ala Tyr Leu Glu Arg Tyr Gly Ala Arg Gln Val Val Met Ile Val Glu Thr Glu Thr Gly Ala Glu Thr Met Arg Arg Leu Leu His Asp His Val Glu Ala Gly Arg Leu Met Thr Ile Val Ala Gly Asp Gln Ile Glu Ala Ala Ile Asp Gln Ala Ile Thr Arg Tyr Gly Arg Pro Gly Pro Val Val Cys Thr Pro Phe Arg Pro Leu Pro Thr Val Pro Leu Val Gly Arg Lys Asp Ser Asp Trp Ser Thr Val Leu Ser Glu Ala Glu Phe Ala Glu Leu Cys Glu His Gln Leu Thr His His Phe Arg Val Ala Arg Lys Ile Ala Leu Ser Asp Gly Ala Ser Leu Ala Leu Val Thr Pro Glu Thr Thr Ala Thr Ser Thr Thr Glu Gln Phe Ala Leu Ala Asn Phe Ile Lys Thr Thr Leu His Ala Phe Thr Ala Thr Ile Gly Val Glu Ser Glu Arg Thr Ala Gln Arg Ile Leu Ile Asn Gln Val Asp Leu Thr Arg Arg Ala Arg Ala Glu Glu Pro Arg Asp Pro His Glu Arg Gln Gln Glu Leu Glu Arg Phe Ile Glu Ala Val Leu Leu Val Thr Ala Pro Leu Pro Pro Glu Ala Asp Thr Arg Tyr Ala Gly Arg Ile His Arg Gly Arg Ala Ile Thr Val(SEQ ID NO:4)

[0025] Nucleic acid (nucleotide sequence) encoding wild-type malonyl-CoA reductase

[0026] Furthermore, for the creation of mcr genes with mutations in a portion of their base sequence, refer to Patent Document 1 and Non-Patent Document 2, which disclose expression vectors incorporating the wild-type mcr gene (SEQ ID NO: 5). The vectors usable in the present invention are not particularly limited, but pBBad-mcr, which is linked to a broad-host-range vector (pBBad) having a BAD promoter that can be expressed with arabinose, can be used. Regarding the pBBad-mcr vector, in Patent Document 1, "pBBad" is described as "pBBR-BAD" and "pBBad-mcr" as "pBBR-BAD-mcr", and in Non-Patent Document 2, "pBBad-mcr" is described as "pBBREX37". Expression vectors for genes with mutations in a portion of the base sequence of the wild-type mcr gene can be obtained by using such vectors and inducing mutations using general genetic engineering techniques.

[0027] As an example, in the present invention, a Mcr mutation enzyme expression vector (e.g., pBBad-mcr3m) can be used, which is created by introducing a base substitution corresponding to an amino acid mutation in the amino acid sequence (SEQ ID NO: 4) of Mcr, a bifunctional enzyme derived from green non-sulfur bacteria, in which asparagine at position 940 is replaced with valine (N940V), lysine at position 1,106 is replaced with tryptophan (K1106W), and serine at position 1,114 is replaced with arginine (S1114R) into the mcr region of an expression vector (e.g., pBBad-mcr) via site-directed mutagenesis (see Example 4).

[0028] Generally, methods for incorporating genes into vectors such as plasmids include, for example, the method described in Sambrook, J. et al., Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, 1.1 (2001). For a simpler method, commercially available ligation kits (e.g., those manufactured by Takara Bio) can also be used.

[0029] Vectors can be easily prepared by conventionally ligating the desired gene to a recombinant vector readily available in the industry (e.g., plasmid DNA). Specific examples of vectors used include, but are not limited to, the broad-host-range vectors pBBR1-MCS2 (GenBank Accession No. U23751), pJRD215 (M16198) (see Davision, J. et al., (1987) Gene, 51, 275-80), pJB861 (U82000), and pHRP311 (see Parales, RE and Harwood, CS (1993) Gene, 133, 23-30). Additionally, plasmids such as pBAD24 (GenBank Accession No. X81837), pDONR201, pBluescript, pUC118, pUC119, pUC18, pUC19, and pBR322 can be used for E. coli.

[0030] Those skilled in the art can appropriately select restriction ends to suit the expression vector. Furthermore, those skilled in the art can appropriately select an expression vector suitable for the host cell in order to express the desired protein. Thus, it is preferable that the vector is constructed or constructed so that the nucleic acid is appropriately expressed by appropriately sequencing or introducing regions involved in gene expression (promoter, enhancer, operator, splicing signal, poly(A) addition signal, selection marker (such as kanamycin resistance gene), ribosome binding sequence (SD sequence) as needed) so that the gene used in the present invention can be expressed in the target host cell. As an example, the desired expression vector (pBBad) can be constructed by excising DNA fragments containing the transcription factor araC, BAD promoter region, multicloning site, and rrnB terminator region from plasmid pBAD24 (mentioned above), which has a BAD promoter whose expression can be induced by the addition of arabinose in E. coli, and ligating these DNA fragments and mcr to the broad-host-range vector pBBR-MCS2. In addition, existing vectors can be used in the manufacturing method of the present invention, and their type is not particularly limited as long as they have the function of expressing a desired gene and producing a desired protein in various host cells of prokaryotic cells and / or eukaryotic cells.

[0031] Generally, transformants can be produced by incorporating a recombinant vector into a host cell. In this case, the host cell can be either a prokaryotic cell (e.g., Escherichia coli (S17-1 strain, etc.), Bacillus subtilis) or a eukaryotic cell (mammalian cell, yeast, insect cell, etc.). The introduction of the recombinant vector into the host cell (transformation) can be carried out using known methods. For example, in the case of bacteria (E. coli, Bacillus subtilis, etc.), methods such as the method of Cohen et al. (Proc. Natl. Acad. Sci. USA, 69:2110 (1972)), the protoplast method (Mol. Gen. Genet., 168:111 (1979)), the competent method (J. Mol. Biol., 56:209 (1971)), the calcium chloride method, and the electroporation method can be used. Furthermore, the conjugation method can be used to introduce expression vectors into bacterial cells belonging to genera such as Ralstonia, Alcaligenes, and Pseudomonas (J. Bacteriol., 147:198 (1981)).

[0032] This conjugation transfer method, simply put, utilizes the cellular property of transferring chromosomal genomes or plasmids from one cell to another through contact between cells. For example, it is a means of enabling gene transfer through a series of steps, starting with the conjugation of a donor bacterium into which a self-transferring plasmid carrying the target DNA has been introduced, and a recipient bacterium that does not possess the plasmid, followed by the formation of a bridge between the two bacterial cells, replication and transfer of the plasmid, and the separation of the bacterial cells upon completion of DNA synthesis.

[0033] Furthermore, the gene encoding the mutant malonyl-CoA reductase may also contain, or consist of, a nucleic acid that hybridizes under stringent conditions with a nucleic acid containing the base sequence represented by Sequence ID No. 5, and which encodes a protein having catalytic activity to produce malonyl-CoA from malonyl-CoA.

[0034] In this specification, “under stringent conditions” means hybridizing under moderate or highly stringent conditions. Specifically, moderate stringent conditions can be easily determined by a person skilled in the art with general skill, for example, based on the length of the DNA. Basic conditions are described in Sambrook, J. et al., Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, 7.42-7.45 (2001), but for nitrocellulose filters, this includes the use of a pre-washing solution of 5×SSC, 0.5% SDS, and 1.0 mM EDTA (pH 8.0), hybridization conditions of approximately 40-50°C, approximately 50% formamide, 2×SSC-6×SSC (or other similar hybridization solutions such as Stark's solution in approximately 50% formamide at approximately 42°C), and washing conditions of approximately 60°C, 0.5×SSC, and 0.1% SDS. High stringent conditions can also be easily determined by those skilled in the art, for example, based on the length of the DNA. Generally, these conditions include hybridization and / or washing at higher temperatures and / or lower salt concentrations than moderately stringent conditions, and are defined, for example, as hybridization conditions as described above, and washing with approximately 68°C, 0.2 × SSC, and 0.1% SDS. Those skilled in the art will recognize that the temperature and washing solution salt concentration can be adjusted as needed, depending on factors such as probe length.

[0035] Homologous nucleic acids cloned using nucleic acid amplification reactions or hybridization as described above have at least 30%, preferably 50%, more preferably 70%, even more preferably 90%, even more preferably 95%, and most preferably 98% or more identity with respect to the base sequences described herein. The identity percentage can be determined by visual inspection and mathematical calculation. Alternatively, the identity percentage of two nucleic acid sequences can be determined by comparing sequence information using a sequence homology search program such as the Basic Local Alignment Search Tool (BLAST), which is described and published at https: / / pubmed.ncbi.nlm.nih.gov / 2231712 / and is now available on public servers worldwide.

[0036] (2) Genetic deletion strain In one embodiment, in the method for producing P(3HB-co-3HP) according to the present invention, a wild-type microbial strain having 3HP production ability and PHA biosynthesis ability, or a recombinant microbial strain obtained by deleting one or more genes on the chromosome of a microbial strain conferring 3HP production ability and PHA biosynthesis ability, can be used. The genes to be deleted are not limited to, but at least one (or at least one species) can be selected from the acryloyl-CoA reductase gene (yhdH gene), the crotonase gene (crt2 gene), and the methylcitric acid cycle transcription activator gene (prpR gene). In further embodiments, the gene to be deleted may be selected from the three genes described above, as well as at least one (or at least one species) from the group consisting of the methylmalonate semialdehyde dehydrogenase A1 gene (mmsA1 gene), methylmalonate semialdehyde dehydrogenase A2 gene (mmsA2 gene), 3-hydroxypropionic acid dehydrogenase gene (hpdH gene), 3-hydroxyisobutanoic acid dehydrogenase gene (hbdH gene), and malonyl-CoA decarboxylase gene (mcd gene). Furthermore, if at least two of the above eight genes are selected, the combination is not limited. In this specification, "deletion" refers to a state in which part or all of the target gene is absent due to genetic manipulation, and as a result, part or all of the activity of the protein encoded by the gene is lost. Generally, deletion mutations can be induced using known site mutagenesis methods (Current Protocols in Molecular Biology, Vol. 1, p. 8.1.1, 1994) or commercially available kits (Takara's LA PCR in vitro Mutagenesis series kits).

[0037] (2-1) Methylcitric acid cycle activator gene ("prpR gene") As used herein, the term “methylcitric acid cycle activator gene” refers to a gene that encodes a protein presumed to function as a methylcitric acid cycle activator. In the H16 strain, the “prpR gene” is H16 It has been identified as A1904 (chromosome 1, numbers 2067440-2069479 (sequence number 1)).

[0038] (2-2) Acryloyl-CoA reductase gene ("yhdH gene") As used herein, the term “acryloyl-CoA reductase gene” refers to a gene encoding an enzyme that is presumed to have catalytic activity in producing propionyl-CoA from acryloyl-CoA. In the H16 strain, the “yhdH gene” is H16 It has been identified as A3330 (chromosome 1, 3605624-3604620 (Sequence ID 2)).

[0039] (2-3) Crotonase gene ("crt2 gene") As used herein, the term “crotonase gene” refers to a gene that encodes a protein having catalytic activity to produce acryloyl-CoA from 3-hydroxypropionic acid (3HP). In the H16 strain, the “crt2 gene” is H16 It has been identified as A3307 (chromosome 1, 3581726-3580950 (Sequence ID 3)).

[0040] (2-4) Methylmalonate semialdehyde dehydrogenase A gene ("mmsA1 gene" and "mmsA2 gene") The term "methylmalonate semialdehyde dehydrogenase A gene" refers to the gene that encodes an enzyme with catalytic activity that oxidatively decarboxylates malonate semialdehyde to produce acetyl-CoA. It is known that at least two variations of this gene exist on the chromosomes of microorganisms, and in the H16 strain, "mmsA1" and "mmsA2" have been identified as H16 A0273 (chromosome 1, 284579-286114 (SEQ ID NO: 6)) and H16 A3664 (chromosome 1, 3945851-3947377 (SEQ ID NO: 7)), respectively.

[0041] (2-5) 3-hydroxypropionic acid dehydrogenase gene ("hpdH gene") The term "3-hydroxypropionic acid dehydrogenase gene" refers to the gene that encodes an enzyme that has catalytic activity to oxidize 3HP to malonic acid semialdehyde. In the H16 strain, the "hpdH gene" is H16 It has been identified as A3663 (3945823-3944156 on chromosome 1 (NC_008313 (Sequence ID 8))).

[0042] (2-6) 3-hydroxyisobutanoate dehydrogenase gene ("hbdH gene") The term "3-hydroxypropionic acid dehydrogenase gene" refers to a gene that encodes an enzyme that has catalytic activity to oxidize 3HP to malonic acid semialdehyde, similar to the hpdH gene mentioned above. In the H16 strain, the "hbdH gene" is H16 It has been identified as B1190 (1344917-1344012 (Sequence ID 9) of chromosome 2 (NC_008314)).

[0043] (2-7) Malonyl-CoA decarboxylase gene ("mcd gene") As used herein, the term “malonyl-CoA decarboxylase gene” refers to the gene encoding an enzyme that has catalytic activity for decarboxylating malonyl-CoA to acetyl-CoA. In the H16 strain, the “mcd gene” is “H16 It has been identified as A2981 (chromosome 1, 3225600-3227057 (sequence number 10)).

[0044] The genes described in (2-1) to (2-7) above include single-stranded or double-stranded DNA, and their RNA complements. DNA includes, for example, naturally occurring DNA, recombinant DNA, chemically synthesized DNA, PCR-amplified DNA, and combinations thereof. DNA is preferred as the nucleic acid used in the present invention. As is well known, codons are degenerate, and some amino acids have multiple base sequences that code for a single amino acid. However, any nucleic acid having any base sequence that codes for a protein that functions as an enzyme or transcription factor with various catalytic activities is included in the scope of the present invention.

[0045] Furthermore, the isolation and identification of the above genes can be carried out by conventional molecular biological methods as needed. These genes can be amplified using genomic DNA as a template by designing synthetic nucleotides as primers based on known base sequences. Since unique DNA fragments are obtained as PCR products, nucleic acids can be isolated by conventional methods such as separating DNA fragments by molecular weight using methods such as agarose gel electrophoresis and excising specific bands.

[0046] Here, methods for amplifying nucleic acids include, for example, polymerase chain reaction (PCR) (Saiki, RK, et al., Science, 230:1350-1354 (1985)), ligase chain reaction (LCR) (Wu, DY, et al., Genomics, 4:560-569 (1989)), and transcription-based amplification (Kwoh, DY, et al., Proc. Natl. Acad. Sci. USA, 86:1173-1177 (1989)), as well as chain substitution reactions (SDA) (Walker, GT, et al., Proc. Natl. Acad. Sci. USA, 89:392-396 (1992); Walker, GT, et al., Nuc. Acids While isothermal reactions such as Res., 20:1691-1696 (1992), self-retaining sequence replication (3SR) (Guatelli, JC, et al., Proc. Natl. Acad. Sci. USA, 87:1874-1878 (1990)), and the Qβ replicase system (Lizardi, PM, et al., BioTechnology, 6:1197-1202 (1988)) can be used, the invention is not limited to these. In the production method of the present invention, the PCR method is preferably used.

[0047] (3) Synthesis of P(3HB-co-3HP) copolymer According to the present invention, the synthesis of P(3HB-co-3HP) copolymer is typically carried out by transforming a C. necator strain (preferably the H16 strain) with a gene encoding a malonyl-CoA reductase (Mcr) mutant (hereinafter also referred to as "mutant malonyl-CoA reductase") (e.g., the mcr3m gene), deleting at least one of the mmsA1, mmsA2, hpdH, hbdH, mcd, prpR, yhdH, and crt2 genes, thereby generating and accumulating P(3HB-co-3HP) copolymer in the resulting recombinant C. necator strain or culture (e.g., culture medium), and then harvesting the target copolymer from the recombinant strain or culture. As will be understood by those skilled in the art, it is preferable to place the recombinant strain under appropriate culture conditions in order to synthesize the copolymer. Such culture of the recombinant strain may follow the culture conditions of the parental strain before genetic recombination. Furthermore, in a specific embodiment of the present invention, recombinant strains may be grown in a culture medium containing carbohydrates as a carbon source.

[0048] An example of a culture medium when using recombinant C. necator strain as a host is a medium to which carbohydrates that the recombinant strain can assimilate are added, and which restricts either the nitrogen source, inorganic salts, or other organic nutrients. Typically, the copolymer can be produced by culturing aerobically for 1 to 10 days at a medium temperature in the range of 25°C to 37°C, generating and accumulating copolymers within the bacterial cells, and then recovering and purifying them. When using carbohydrates as a carbon source, commercially available carbohydrates can be used, and the source is not particularly limited. "Carbohydrates" refers to polyhydric alcohols having an aldehyde group or a ketone group, and means monosaccharides, oligosaccharides, polysaccharides, and sugar derivatives. Specifically, monosaccharides include glucose, galactose, mannose, glucosamine, N-acetylglucosamine, and fructose. Disaccharides include maltose, isomaltose, lactose, lactosamine, N-acetyllactosamine, cellobiose, and melibiose. Oligosaccharides include homooligomers composed of glucose, galactose, mannose, glucosamine, N-acetylglucosamine, fructose, etc., or heterooligomers composed of two or more components such as glucose, galactose, mannose, glucosamine, N-acetylglucosamine, fructose, sialic acid, etc. Examples include maltooligosaccharides, isomaltoligosaccharides, lactoligosaccharides, lactosamine oligosaccharides, N-acetyllactosamine oligosaccharides, cellooligosaccharides, and melibiooligosaccharides. Polysaccharides include those found in a wide range of organisms such as animals, plants (including seaweed), insects, and microorganisms, examples of which include N-linked glycans, O-linked glycans, glycosaminoglycans, starch, amylose, amylopectin, cellulose, chitin, glycogen, agarose, alginic acid, hyaluronic acid, inulin, and glucomannan. As a sugar derivative, deoxyribose (C5H 10 Examples include O4, sulfated polysaccharides, etc. The concentration of carbohydrates in the culture medium is preferably 0.1-5%, but this can be adjusted as appropriate by those skilled in the art.

[0049] Furthermore, if necessary, nitrogen sources or inorganic substances may be added to the culture medium. Examples of nitrogen sources include ammonia, ammonium chloride, ammonium sulfate, ammonium phosphate and other ammonium salts, as well as peptone, meat extract, yeast extract, and corn steep liquor. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, and sodium chloride.

[0050] Culturing is usually performed using shaking culture under aerobic conditions at 25°C to 37°C for at least one day after gene expression induction. Antibiotics such as kanamycin and ampicillin may be added to the culture medium. If necessary, arabinose, indoleacrylic acid (IAA), isopropyl-β-D-thiogalactopyranoside (IPTG), etc. can be used as gene expression inducers. Those skilled in the art can appropriately select the culture conditions and gene expression induction conditions that are possible for the desired gene expression.

[0051] (4) Purification and structural analysis of P(3HB-co-3HP) In the present invention, the copolymer can be purified as follows: The transformants are recovered from the culture medium by centrifugation, washed with distilled water, and then dried or freeze-dried. The dried transformants are then suspended in chloroform and stirred at room temperature for a predetermined time to extract the copolymer. Heating may be used during the extraction stage if necessary. The residue is removed by filtration, methanol is added to the supernatant to precipitate the copolymer, the supernatant is removed by filtration or centrifugation, and the copolymer is dried to obtain a purified copolymer. Subsequently, the monomer unit composition ratio of the obtained copolymer can be confirmed using NMR (nuclear magnetic resonance) or gas chromatography, although this is not limited to the copolymer.

[0052] The 3HP fraction of the P(3HB-co-3HP) copolymer obtained by the manufacturing method of the present invention is preferably 0.1 to 20 mol%, more preferably 0.1 to 50 mol%, and even more preferably 0.1 to 99 mol%. In this specification, the term "mol%" refers to the amount obtained by dividing the number of moles of a particular component by the sum of the moles of each component in a multicomponent system. For methods of calculating the fraction (mol%) of each component in the copolymer and the average molecular weight of the copolymer (e.g., weight-average molecular weight and number-average molecular weight), please refer to, for example, Patent Document 1. [Examples]

[0053] The present invention will be described in more detail below with reference to examples. However, the present invention is not limited to the following examples and can be implemented in any form without departing from the spirit of the invention.

[0054] Example 1: Preparation of Cupriavidus necatol H16 4ΔM strain We created a quintuple deletion strain, H16_4ΔM, by deleting the 3-hydroxypropionic acid dehydrogenase gene hpdH and the 3-hydroxyisobutanoic acid dehydrogenase gene hbdH, which oxidize 3HP to malonic acid semialdehyde; the methylmalonic acid semialdehyde dehydrogenase genes mmsA1 and mmsA2, which oxidatively decarboxylate malonic acid semialdehyde to produce acetyl-CoA; and the malonyl-CoA decarboxylase gene mcd, which decarboxylates malonyl-CoA to acetyl-CoA.

[0055] hpdH and hbdH are H16 A3663 (chromosome 1 (NC_008313) 3945823-3944156 and H16) As B1190 (chromosome 2 (NC_008314) 1344917-1344012), mmsA1 and mmsA2 are H16 respectively. A0273 (chromosome 1, 284579-286114), H16 As A3664 (chromosome 1, 3945851-3947377), mcd is H16 It has been identified as A2981 (chromosome 1, 3225600-3227057).

[0056] H16_A3663 (chromosome 1, NC_008313, 3945823-3944156 (complementary strand))

[0057] H16_B1190 (chromosome 2, NC_008314, 1344917-1344012 (complementary strand)) ATGCATATCGCCTTCATCGGCCTCGGCAACATGGGCGCGCCCATGGCGCGCAACCTGCTCAAGGCCGGCCATACGCTGACCGTATTCGACCTGAACGCCGCGGCGGTGGCGTCGCTGTGCGCCGAGGGCGCCGCCACCGCGGATTCCGCCCGAAAGGCCGTGGCCGAAGCAGACTTTGTCATCACCATGCTGCCCGCCGCTGCCCATGTGCGCAGCGCCTACCTGGGCCCGGAAGGCGTGCTGGCCGGCGTGCGCCCGGGCGTGCCGCTGGTGGATTCCAGCACCATCGACCCCGCCACCGTGCGCGAACTGGCCGCTGCCGCCGAGGCGCACGGCAATGCGCTGGCCGATGCACCGGTCTCCGGCGGCACCGTTGGCGCCCAGGCCGGCACGCTGACCTTCATGGTCGGCGCCACCGAAGCACTGTTCGCCCAGGTGCGCCCGGTGCTGGCCGGCATGGGGCGCAACCTGGTCCACTGCGGCGGCACCGGCACCGGCCAGGTCGCCAAGATCTGCAACAACCTGATCCTCGGCATCTCCATGATCGGCGTATCCGAGGCGATGGCGCTGGGCGTCAAGCTGGGCATCGACGCCAATGTGCTGGCCGGCATCGTCAATACCTCCACCGGCCGCTGCTGGGCCTCGGATACCTGCAACCCCTGGCCCGGCGTGATCGAGGCCGCACCGGCCGGGCGCGGCTACACCGGCGGCTTTGGCGCCGACCTGATGCTCAAGGACCTGGGCCTGGCCAACGACGCCGCGCGCAGCGTGAAGCAGCCGCTGTTCCTGGGCGCGCTGGCGCAGCAGGTCTACCAGGCCGTGAGCCATGCCGGCGACGGCCAGCTCGACTTCTCCGGCGTGATCCGCCAGTACCTGTCCGCCGCCGACAAGGAGGGCAAGCAATGA (SEQ ID NO: 9)

[0058] H16_A0273(chromosome 1, NC_008313, 284579-286114)

[0059] H16_A3664(chromosome 1, NC_008313, 3945851-3947377

[0060] H16_A2981 (chromosome 1, NC_008313, 3225600-3227057)

[0061] 1-1 Construction of mmsA1 gene disruption vector Using the genomic DNA of the Cupriavidus nekator H16 strain as a template, the mmsA1 region and the region containing approximately 1 kbp upstream and downstream of it were amplified by PCR using oligonucleotides of sequences 1 and 2 below as primers. PCR was performed using a KOD Plus (Toyo Bo Co., Ltd.), with one cycle consisting of 20 seconds at 98°C, 15 seconds at 65°C, and 3 minutes at 68°C, and this was repeated 30 times. The amplified fragments were purified using a DNA purification kit (Promega Corporation). Array 1: GCTCAT GAAACCTGATGCCGGGCACCGACCAC (Underlined indicates XbaI restriction enzyme site) (Sequence ID 11) Array 2: GCTCTA GACTCGGTCATCGAGAACCGGGTCTTC (Underlined indicates XbaI restriction enzyme site) (SEQ ID NO: 12)

[0062] The obtained fragments were treated with the restriction enzyme XbaI and purified by isopropanol precipitation. pK18mobsacB, a widely used homologous recombination vector, was treated with XbaI, its 5' end was dephosphorylated by alkaline phosphatase (Toyobo Co., Ltd.), and purified by isopropanol precipitation. The XbaI-treated amplified fragment and the vector fragment were ligated using Ligation High (Toyobo Co., Ltd.) to obtain a plasmid in which the target gene and its upstream and downstream regions were inserted into pK18mobsacB. Using the obtained plasmid as a template, DNA fragments consisting of homologous regions other than the target gene and the plasmid sequence were amplified by inverse PCR using oligonucleotides of sequences 3 and 4 below as primers. The 5' end of this amplified fragment was phosphorylated with T4 kinase (Toyobo Co., Ltd.), and the mmsA1 disruption vector pK18ms-ΔmmsA1 was obtained by self-ligation using Ligation High. Sequence 3: ATGAAGGTCAACCGGATCGTTGCCAACA (Sequence ID 13) Array 4: TTGGGATTTCCTTCGATAGCCGCGGCACGCA (Sequence ID 14)

[0063] 1-2 Construction of mmsA2-hpdH gene disruption vectors In the Cupriavidus necatol H16 strain, mmsA2 and hpdH are H16 A3664-H16 Since A3663 is located adjacent to another gene on chromosome 1, these two gene regions were deleted together. The same procedure as in section 1-1 was performed on mmsA2-hpdH to obtain the mmsA2-hpdH disruption vector pK18ms-ΔmmsA2-hpdH. The primers used are shown below. Amplification of the region including mmsA1-hpdH and its upstream and downstream regions, approximately 1 kbp. Array 5: GCTCTA ATCGAAGCCTCCTGGTCGACATGC (Underlined indicates XbaI restriction enzyme site) (Sequence ID 15) Array 6: GCTCTA ACCACGCTCATGTTGTGTTCCACC (Underlined indicates XbaI restriction enzyme site) (Sequence ID 16) • Amplification of DNA fragments consisting of homologous regions other than the target gene and plasmid sequences. Sequence 7: TTCCGCTCCTGAATGCTGGGTCGCT (Sequence ID 17) Sequence 8:CATGAGCGCGCCACGGGTCGC (Sequence ID 18)

[0064] 1-3 Construction of hbdH gene disruption vectors The same procedure as in section 1-1 was performed on the hpdH region to obtain the hbdH disruption vector pK18ms-ΔhbdH. The primers used are listed below. • Amplification of the region including hbdH and its upstream and downstream areas, approximately 1 kbp. Array 9: GCTCTA GATCGTGTGCGGCAATACCTTTG (Underlined indicates XbaI restriction enzyme site) (SEQ ID NO: 19) Array 10: GCTCTA ACCTGGAACAGCACCTCCG (Underlined indicates XbaI restriction enzyme site) (Sequence ID 20) • Amplification of DNA fragments consisting of homologous regions other than the target gene and plasmid sequences. Array 11: GGGGTCTCCTTCCGTGTCGTTCTTG (Sequence ID 21) Sequence 12:TCGAGTTCGCCCTGCACGGCC (Sequence ID 22)

[0065] 1-4 Construction of mcd gene knockout vectors The same procedure as in section 1-1 was performed on the mcd gene to obtain the disruption vector pK18ms-Δmcd. The primers used are listed below. • Amplification of the region including mcd and approximately 1kbp upstream and downstream of it. Array 13: GCTCTA AGTCCCGCTGGCACGTAAAT (underlined indicates XbaI restriction enzyme site) (SEQ ID NO: 23) Array 14: GCTCTA GCGTCTCGGAACCGTTGTTA (underlined indicates XbaI restriction enzyme site) (SEQ ID NO: 24) • Amplification of DNA fragments consisting of homologous regions other than the target gene and plasmid sequences. Array 15: GCGGTACCTGCCTTGATGCATCGATC (Sequence ID 25) Array 16: CCCTGGTCCGGTCACGCGGGTC (Sequence ID 26)

[0066] 1-5 Transformation of Cupriavidus necatol H16 strain The obtained pK18ms-ΔmmsA1 (mmsA1 disruption vector) was used to transform the Cupriavidus nekator H16 strain by conjugation. First, the prepared vector was introduced into Escherichia coli S17-1 strain using the calcium chloride method. Next, this recombinant Escherichia coli was cultured overnight at 37°C in 3.0 ml of LB medium (1 wt% tryptone, 1 wt% sodium chloride, 0.5 wt% yeast extract, pH 7.2). In parallel, the recombinant Cupriavidus nekator strain was cultured overnight at 30°C in 3.0 ml of NR medium (1 wt% fish extract, 1 wt% polypeptone, 0.2 wt% yeast extract). Subsequently, 0.1 ml of culture solution of the recombinant Cupriavidus nekator strain was mixed with 0.2 ml of culture solution of Escherichia coli and cultured at 30°C for 6 hours. This bacterial cell mixture was spread onto Simmons Citrate agar (DIFCO) supplemented with 0.2 mg / ml kanamycin and cultured at 30°C for 3 days. Recombinant E. coli vectors were transmitted to Cupriavidus nekator cells, and the cells incorporated into the chromosome by homologous recombination showed resistance to kanamycin. On the other hand, recombinant E. coli could not grow on Simmons Citrate agar. Therefore, the colonies that grew on the above medium were Cupriavidus nekator transformants (pop-in strains) in which pK18ms-ΔmmsA1 was incorporated into the chromosome from recombinant E. coli. Furthermore, the pop-in strains were cultured overnight at 30°C in NR medium, then spread onto NR medium supplemented with 10% sucrose and cultured at 30°C for 3 days. Levansulacase, encoded by sacB on pK18mobsacB, uses sucrose as a substrate to accumulate toxic polysaccharides in the cell. Therefore, in a medium supplemented with 10% sucrose, only strains with the plasmid region removed (pop-out strains) could grow. From these colonies, clones with a deletion of the mmsA1 gene on the chromosome were selected by PCR.

[0067] The obtained H16 Using a ΔmmsA1 knockout strain as the host and pK18ms-ΔmmsA2-hpdH as the conjugation vector, the same procedure as in sections 1-5 was performed to produce the triple deletion strain H16. We acquired the ΔmmsA1ΔmmsA2-hpdH strain.

[0068] H16 Using the ΔmmsA1ΔmmsA2-hpdH strain as the host and pK18ms-ΔhbdH as the conjugation vector, the same procedure as in sections 1-5 was performed to produce the quadruple deletion strain H16. We acquired the ΔmmsA1ΔmmsA2-hpdHΔhbdH strain.

[0069] H16 Using the ΔmmsA1ΔmmsA2-hpdHΔhbdH strain as the host and pK18ms-Δmcd as the conjugate vector, the same procedure as in sections 1-5 was performed to produce the quintuple deletion strain H16. We acquired the ΔmmsA1ΔmmsA2-hpdHΔhbdHΔmcd strain. The strain was designated as 4ΔM.

[0070] Example 2: Preparation of Cupriavidus necatol H16 4ΔMP strain A gene knockout strain was created in which prpR, a gene presumed to be a transcription activator gene for the methylcitric acid cycle, was deleted from the Cupriavidus nekator H16 strain as follows. It has been identified as A1904 (chromosome 1, 2067440-2069479).

[0071] H16_A3663(chromosome 1, NC_008313, 2067440-2069479)

[0072] 2-1 Construction of prpR gene disruption vector The same procedure as in section 1-1 was performed on the prpR region to obtain the disruption vector pK18ms-ΔprpR. The primers used are listed below. However, restriction enzymes HindIII and BamHI were used to cleave the amplified fragment and vector. • Amplification of the region including prpR and its upstream and downstream areas, approximately 1 kbp. Array 17:CCGC AAGCTT GTTTTCCGCCGCCTTGTTC (Underlined indicates HindIII restriction enzyme site) (Sequence ID 27) Array 18: AGTG GGATCC GGAAGTCAGGGATGGATTTGC (Underlined indicates BamHI restriction enzyme site) (Sequence ID 28) • Amplification of DNA fragments consisting of homologous regions other than the target gene and plasmid sequences. Sequence 19:ACCGCGCTGGCATTTACCCGGCTG (Sequence ID 29) Array 20: TGTCCGTCACGCAGCCCGGGATTTC (Sequence ID 30)

[0073] 2-2 Transformation of Cupriavidus necatol H16 4ΔM strain H16 Using the 4ΔM strain as the host and pK18ms-ΔprpR as the conjugate vector, the same procedure as in section 12-5 was performed, resulting in H16 with further deletion of the prpR region. I acquired 4ΔMP shares.

[0074] Example 3: Preparation of Cupriavidus necatol H16_4ΔMPΔyhdHΔcrt2 strain Gene knockout strains were created as follows, by deleting yhdH, which is presumed to be the acryloyl-CoA reductase gene, and the crotonase gene Crt2. yhdH is H16 A3330 (chromosome 1, 3605624-3604620), crt2 is H16 It has been identified as A3307 (chromosome 1, 3581726-3580950).

[0075] H16_A3330 (chromosome 1, NC_008313, 3605624-3604620 (complementary strand))

[0076] H16_A3307 (chromosome 1, NC_008313, 3581726-3580950 (complementary strand)) (Sequence ID 3)

[0077] 3-1 Construction of a yhdH gene disruption vector The same procedure as in section 1-1 was performed on the yhdH region to obtain the fracture vector pK18ms-ΔyhdH. The primers used are listed below. Amplification of the region including yhdH and its upstream and downstream areas, approximately 1kbp. Array 21:GC TCTAGA CGATTTGCTTGCGCTGACCGCGGCCAC (Underlined indicates XbaI restriction enzyme site) (Sequence ID 31) Array 22:GC TCTAGA TACGGCACGAACGCGGCCGGCTTGA (Underlined indicates XbaI restriction enzyme site) (Sequence ID 32) • Amplification of DNA fragments consisting of homologous regions other than the target gene and plasmid sequences. Array 23: GGTGTCTCCTTTGTCGCCTGCCGGCGAT (Sequence ID 33) Sequence 24:TCGCGCACCGTCGCCCTGATGCACC (Sequence ID 34)

[0078] 3-2 Construction of a crt2 gene disruption vector The same procedure as in section 1-1 was performed on the crt2 region to obtain the disruption vector pK18ms-Δcrt2. The primers used are listed below. However, restriction enzymes XbaI and HindIII were used to cleave the amplified fragment and vector. • Amplification of the region including CRT2 and its upstream and downstream areas, approximately 1 kbp. Array 25:GC TCTAGA AATCTTGAAAAACGCTATGCCAA (Underlined indicates XbaI restriction enzyme site) (SEQ ID NO: 35) Array 26: CCC AAGCTT ATTGTCCAAAATTCCCCACTGCT (Underlined indicates HindIII restriction enzyme site) (Sequence ID 36) • Amplification of DNA fragments consisting of homologous regions other than the target gene and plasmid sequences. Sequence 27: GGCCCGGATCAGGGAATACCCGA (Sequence ID 37) Array 28:GTCTTCTCCTATGTATTTGCAGGCG (Sequence ID 38)

[0079] 3-3 Transformation of Cupriavidus necatol H16_4ΔMP strain H16 Using the 4ΔMP strain as the host and pK18ms-ΔyhdH as the conjugate vector, the same procedure as in sections 1-5 was performed to obtain H16 with a further deletion of the yhdH region. I acquired 4ΔMPΔyhdH shares.

[0080] H16 Using the 4ΔMPΔyhdH strain as the host and pK18ms-Δcrt2 as the conjugate vector, the same procedure as in sections 1-5 was performed to obtain H16 with further deletion of the crt2 region. We acquired 4ΔMPΔyhdHΔcrt2 shares.

[0081] Example 4: Preparation of a Cupriavidus necatolmalonyl-CoA reductase mutant expression strain 4-1 Construction of the Mcr mutant enzyme expression vector pBBad-mcr3m pBBad-mcr is a vector in which the malonyl-CoA reductase gene (mcr) derived from the green sulfur bacterium Chloroflexus aurantiacus is inserted into the expression vector pBBad, which autologously replicates in a wide range of Gram-negative bacteria. The Cupriavidus nekator strain, which carries this vector, expresses Mcr upon the addition of arabinose (see Patent Document 1 [in the document, pBBad is referred to as "pBBR-BAD" and pBBad-mcr as "pBBR-BAD-mcr"], and Non-Patent Document 2 [in the document, pBBad-mcr is referred to as "pBBREX37"]).

[0082] For Mcr, which consists of 1,219 amino acids, base substitutions corresponding to amino acid mutations—replacing asparagine at position 940 with valine (N940V), lysine at position 1,106 with tryptophan (K1106W), and serine at position 1,114 with arginine (S1114R)—were introduced into the mcr region of pBBad-mcr by site-directed mutagenesis using the following procedure.

[0083] PCR was performed using pBBad-mcr as a template and a primer set designed so that the mutation site would be approximately in the center, introducing a base mutation into the extended chain and amplifying it. PCR was performed using KOD Plus (Toyo Bo Co., Ltd.), with 30 cycles consisting of a reaction at 98°C for 20 seconds, 65°C for 15 seconds, and 68°C for 3 minutes. The template plasmid was digested by treating the reaction product with the restriction enzyme DpnI, and the amplified DNA was purified using a DNA purification kit (Promega). Since the complementary amplified DNA strand takes on a circular structure with a gap, this circular DNA solution was diluted as appropriate and used to transform E. coli. Plasmid clones with correctly introduced site-directed mutations were selected from the obtained transformants. By sequentially repeating this procedure with primer pairs corresponding to N940V, K1106W, and S1114R, pBBad-mcr3m expressing a Mcr mutant enzyme with three amino acid substitutions was obtained. The sequences of the primer pairs used are shown below. • N940V mutation (underlined indicates mutated base) Array 29: CCTTGCCGACCGC GT TGTCAGTGGTGAG (Sequence ID 39) Sequence 30: CTCACCACTGACA AC GCGGTCGGCAAGG (Sequence ID 40) • K1106W mutation (underlined indicates the mutated base) Array 31: CCGGGTAGCGCGC TG GATTGCCCTGAGTG (Sequence No. 41) Sequence 32: CACTCAGGGCAATC CA GCGCGCTACCCGG (Sequence ID 42) • S1114R mutation (underlined is the mutated base) Array 33:CTGAGTGATGGTGCC C GTCTCGCGCTGGTC (Sequence ID 43) Array 34: GACCAGCGCGAGAC G GGCACCATCACTCAG (Sequence ID 44)

[0084] 4-2 Transformation of Cupriavidus necatol strain using Mcr mutant expression vector The prepared pBBad-mcr3m was introduced into *E. coli* strain S17-1 by calcium chloride method, and then introduced into *Cupriavidus nekator* strain by conjugation, as described in sections 1-5. Transformants exhibiting kanamycin resistance upon vector transfer were selected on Simmons Citrate agar medium supplemented with kanamycin. H16 4ΔM shares, H16 4ΔMP shares, H16 Conjugation was performed using the 4ΔMPΔyhdHΔcrt2 strain as the recipient strain, and pBBad-mcr3m-introduced strains were obtained for each strain.

[0085] Example 5. Copolymer polyester synthesis using modified Cupriavidus necatol strain. Recombinant Cupriavidus nekator strains, pre-cultured in NR medium (as described above), were inoculated into 100 ml of MB medium (0.9 wt% disodium hydrogen phosphate dodecahydrate, 0.15 wt% potassium dihydrogen phosphate, 0.05 wt% ammonium chloride, 0.02 wt% magnesium sulfate, 1 vol% trace metal solution) and cultured in a Sakaguchi flask at 30°C for 72 hours with shaking. 1 wt% fructose was used as the carbon source. At the start of the culture, 0.1 mg / ml of kanamycin was added to the medium to maintain the expression vector, and 0.1 wt% of arabinose, a gene expression inducer, was added. After the culture was completed, the cells were collected by centrifugation and washed with distilled water. The obtained cells were freeze-dried, and the dry cell weight was measured.

[0086] 10-30 mg of dried bacterial cells were mixed with 2 ml of sulfuric acid-methanol (15:85) and 2 ml of chloroform. The mixture was sealed and heated at 100°C for 140 minutes to obtain methyl esters of intracellular polyester degradation products. 1 ml of distilled water was added and the mixture was vigorously stirred. After standing to separate into two layers, the lower organic layer was removed. 0.5 ml of the organic layer was analyzed by capillary glass chromatography. A Shimadzu GC-2014 gas chromatograph and a GL Sciences InertCap-1 capillary column (column length 25 m, column inner diameter 0.25 mm, liquid film thickness 0.4 μm) were used. The temperature was increased from an initial temperature of 100°C at a rate of 8°C / min. The results are shown in Table 1 below.

[0087] [Table 1]

[0088] By deleting HpdH and HbdH, which oxidize 3HP, and MmsA1 and MmsA2, which oxidize malonic acid semialdehyde, 3HP degradation is suppressed. Furthermore, the H16 quintuple gene knockout strain was created by deleting Mcd, which degrades malonyl-CoA, a precursor of 3HP biosynthesis. In strains into which the malonyl-CoA reductase mutant vector pBBad-mcr3m was introduced into 4ΔM, the accumulated PHA was a P(3HB) homopolymer, and no 3HP units were detected. This indicates that in host strains to which Mcr has been introduced to confer 3HP-producing ability, blocking or suppressing the oxidative 3HP degradation pathway alone is insufficient for the biosynthesis of P(3HB-co-3HP).

[0089] On the other hand, in a strain further lacking PrpR, which is presumed to be a transcription activator of the methylcitric acid cycle, the copolymer contained 0.9 mol% of 3HP units along with trace amounts of 3-hydroxypentanoic acid (3HV) units, strongly suggesting that the methylcitric acid cycle is involved in the degradation of 3HP. There was no significant change in polyester production.

[0090] Since the starting material for the methylcitric acid cycle is propionyl-CoA, we hypothesize that 3HP-CoA is converted to propionyl-CoA in Cupriavidus nekatoll cells. We then double-delete H16, which contains putative acryloyl-CoA reductase YhdH and crotonase Crt2, as enzymes potentially involved in this conversion. In 4ΔMPΔyhdHΔcrt2, although polyester production decreased, copolymer polyester was biosynthesized with a significantly increased 3HP fraction of 6.1 mol%. This 3HP composition was significantly higher than the 0.7 mol% 3HP in similar fructose cultures using known recombinant strains (Patent Document 1). This indicates that blocking or suppressing the reductive 3HP degradation pathway, in addition to the oxidative 3HP degradation pathway, is important for the microbial production of P(3HB-co-3HP). The present invention makes it possible to produce copolymer polyester with improved flexibility from renewable raw materials such as carbohydrates without the need for precursor addition. [Industrial applicability]

[0091] The manufacturing method of the present invention makes it possible to produce poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid) (P(3HB-co-3HP)) using inexpensive biomass as the basic carbon source, and furthermore, it is possible to obtain copolymers with a higher 3HP fraction compared to conventional methods. Such copolymer polyesters are useful because they have excellent thermal stability and moldability, and are biodegradable plastics with superior impact resistance compared to P(3HB).

[0092] All publications and patent documents referenced herein are incorporated herein by reference in their entirety. While specific embodiments of the present invention have been described herein for illustrative purposes, it will be readily apparent to those skilled in the art that various modifications may be made without departing from the spirit and scope of the invention.

Claims

1. A method for producing poly(3-hydroxybutanoic acid-co-3-hydroxypropionic acid), comprising growing a recombinant microbial strain obtained by deleting one or more of the following genes in a culture medium containing carbohydrates as the sole carbon source: a wild-type microbial strain having the ability to produce 3-hydroxypropionic acid (3HP) and the ability to biosynthesize polyhydroxyalkanoic acid (PHA), or a microbial strain conferring the ability to produce 3HP and the ability to biosynthesize PHA, in a culture medium containing carbohydrates as the sole carbon source.

2. The method according to claim 1, wherein the gene for methylcitric acid cycle transcription activator is deleted.

3. The method according to claim 1 or 2, wherein the methylcitric acid cycle activator gene, the acryloyl-CoA reductase gene, and the crotonase gene are deleted.

4. The method according to claim 1 or 2, wherein the wild-type microbial strain having 3HP production ability and PHA biosynthesis ability, and the microbial strain conferring 3HP production ability and PHA biosynthesis ability, are derived from the Cupriavidus necator strain.

5. The method according to claim 4, wherein the C. necator strain is strain H16 (DSM428).

6. The method according to claim 1 or 2, wherein the microbial strain conferring the 3HP production ability and PHA biosynthesis ability is a microbial strain obtained by transforming the wild-type microbial strain by homologous recombination of the gene encoding malonyl-CoA reductase or the gene of a mutant thereof, or by introducing an autonomous replication vector into which the gene is incorporated into the strain.

7. In the aforementioned recombinant microbial strain, the following genes: (a) Methylmalonate semialdehyde dehydrogenase A1 gene; (b) Methylmalonate semialdehyde dehydrogenase A2 gene; (c) 3-hydroxypropionate dehydrogenase gene; (d) 3-hydroxyisobutanoate dehydrogenase gene; and (e) Malonyl-CoA decarboxylase gene The method according to claim 1 or 2, further comprising deleting one or more of the following.

Images