Molecular markers, typing primers, and their application for restoring viability to cytoplasmic male sterility in chili peppers

Abstract

This invention provides molecular markers, typing primers and their applications for the restoration of cytoplasmic male sterility in chili pepper. Wild-type and mutant chili pepper materials were used to construct an F2 population, and the chromosomal region closely linked to the cytoplasmic male sterility restoration gene in chili pepper was obtained using the BSA population positioning method. A KASP molecular marker was designed based on a single base mutation, and this marker was used to identify the genotypes of 1290 plants in the F2 population, with a match rate of 100%. This invention is not only useful for the selection and assisted breeding of chili pepper for cytoplasmic male sterility, but also provides a basis for the mapping of the cytoplasmic male sterility restoration gene and the analysis of the molecular mechanism of cytoplasmic male sterility, and has widespread value.

Description

[Technical Field]

[0001] The present invention belongs to the technical field of chili pepper breeding molecular biology, and particularly relates to molecular markers, typing primers and their applications for restoring vegetative cytoplasmic male sterility in chili pepper. [Background technology]

[0002] Male sterility is a common phenomenon in flowering plants. During sexual reproduction, the stamens develop abnormally or fail to produce functional pollen, while the pistils develop normally and function normally. It can generally be divided into nuclear male sterility and cytoplasmic male sterility. Cytoplasmic male sterility, also known as nucleoplasmic interaction sterility, occurs when the nuclear gene (rfrf) and the cytoplasmic gene (S) are co-regulated, resulting in the failure of pollen and sterility. Male sterility can be applied to hybridization of agricultural crops, and utilizing hybridization can significantly improve crop yield and quality and promote the development of agricultural production. Male sterility techniques are used in cross-breeding of important crops, such as rice, wheat, corn, rapeseed, chili peppers, and tomatoes. "Tri-line cross breeding," based on the principle of cytoplasmic male sterility, is the most widely used method for utilizing hybrid superiority in agricultural crops. It includes sterile lines, maintainers, and restorers. The sterile lines contain a cytoplasmic sterility gene (S) and a nuclear gene (rfrf). When crossed with maintainers and restorers as the female line, the maintainers contain the normal viability cytoplasmic gene (N) and the same nuclear gene (rfrf) as the sterile line, allowing normal viability. When crossed with a sterile line as the male line, the sterile line can be grown. Meanwhile, the restorers contain the nuclear restorer gene (RfRf). When crossed with a sterile line, the male viability trait is restored to the offspring, allowing them to be used in the production of commercial hybrid seeds. Using cytoplasmic male sterility technology to select and develop a set of three-line varieties for cross breeding significantly reduces production costs, simplifies breeding procedures, and increases seed purity. The Rf gene has already been successfully cloned in crops such as rice, corn, radish, and sugar beet.

[0003] Chili pepper (Capsicum annuum L.) is an annual or perennial herbaceous plant native to South America. Its fruits are brightly colored, rich in nutrients, have a spicy taste, and are highly resistant to heat. Its cultivated area is wide, making it an important vegetable crop in the world. In recent years, the annual cultivation area of ​​chili pepper in China has reached 1.5 million to 2 million hectares. 2 Currently, chili pepper accounts for 8% to 10% of the total vegetable cultivation area in China, making it one of the vegetable crops with the largest cultivation area. Chili pepper is a heterogamous crop with strong hybrid advantages. Utilizing these advantages in breeding can significantly improve chili pepper yield, resistance, and quality. More than 90% of the popular and applied varieties in China are first-generation hybrids, and "tri-cross breeding" is currently one of the main methods for producing chili pepper hybrids. Genetically locating the vegetative restoration gene for chili pepper cytoplasmic male sterility and elucidating the molecular mechanism of vegetative restoration can accelerate the application of the "tri-cross breeding" method in hybrid seed production. This is of great significance for research into the molecular mechanism of cytoplasmic male sterility formation in chili pepper and also provides important theoretical guidance for chili pepper molecular breeding. Therefore, molecular markers related to the vegetative restoration of chili pepper cytoplasmic male sterility were developed, and these molecular markers were used to select and obtain suitable lines. Summary of the Invention [Problem to be solved by the invention]

[0004] In order to overcome the deficiencies of the prior art, in response to the phenomenon of pollen failure that occurs during the development of chili pepper flowers, the present invention provides molecular markers, typing primers and their applications for restoring the viability of chili pepper cytoplasmic male sterile mutants, thereby providing a new route for the selection and identification of chili pepper cytoplasmic male sterile mutants and directional tri-cross breeding of chili peppers. [Means for solving the problem]

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions.

[0006] In a first aspect, the present invention provides a molecular marker for restoring viability of cytoplasmic male sterility in chili pepper, the molecular marker being a nucleotide sequence of the chili pepper genome, which is significantly related to the property of restoring viability of cytoplasmic male sterility in chili pepper, the nucleotide sequence being based on the chili pepper genome and including a base sequence located in the 246736279-248221876 bp interval of chromosome 6, and being a C to T mutation occurring at position 247327150 of chromosome 6.

[0007] In an optional embodiment, the present invention provides a molecular marker, wherein the molecular marker is obtained from a selected phenotypically stable male sterile mutant after mutation by EMS.

[0008] As a general technical idea, in a second aspect, the present invention provides a KASP typing primer for the above molecular markers used for identification, selection or application, and the KASP typing primer primer sequence is: Forward primer 6X, CAACAGTGGGGCAACCAATAC (SEQ ID NO. 1); Forward primer 6Y, CAACAGTGGGGCAACCAATAT (SEQ ID NO. 2); The reverse primer appears to be 6C, GTTTGAGTTGGAGGCCATTT (SEQ ID NO. 3).

[0009] In an optional embodiment, in the KASP typing primer provided by the present invention, the forward primers 6X and 6Y are each linked to different fluorescent linker sequences, and the fluorescent linker sequences are any of FAM, HEX, FITC, RED, TET, JOE, and R110.

[0010] In an optional embodiment, in the KASP typing primer provided by the present invention, the forward primers 6X and 6Y are linked to fluorescent linker sequences FAM and HEX, respectively, and the specific sequences are: Forward primer PEPER-CMS-6X, GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC(SEQ ID NO.4), Forward primer PEPER-CMS-6Y, It appears to be GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT (SEQ ID NO. 5).

[0011] The fluorescent linker sequences selected in this application are FAM and HEX, with the forward primer PEPER-CMS-6X linked to FAM and the forward primer PEPER-CMS-6Y linked to HEX.

[0012] As a general technical idea, in a third aspect, the present invention provides an application of the above-mentioned molecular marker or KASP typing primer, and the application includes at least: 1. To assess the growth of chili peppers and assist in their selection; 2. Identification, selection, or breeding of chili pepper cytoplasmic male sterile mutants Including one with.

[0013] In an optional embodiment, the application provided by the present invention involves detection using a PCR reaction.

[0014] In an optional embodiment, the present invention provides an application for identification or screening by PCR detection. Specifically, the genomic DNA of the sample to be detected is used as a template, and amplification primers for the molecular markers are used for amplification. The amplification primers are then subjected to fluorescent detection. The amplification system is as follows: 50-100 ng of template DNA, 0.15 μL of each primer, 5 μL of 2X PARMS master mix, and ddH2O supplemented to 10 μL.

[0015] In an optional embodiment, in the application provided by the present invention, when the amplified product is subjected to fluorescent detection, if a fluorescent signal corresponding to the primer PEPER-CMS-6X is detected, it is determined that the detection site is the C:C genotype and the strain is a chili pepper pollen viable phenotype; if a fluorescent signal corresponding to the primer PEPER-CMS-6Y is detected, it is determined that the detection site is the T:T genotype and the strain is a chili pepper pollen sterile phenotype; and if two types of fluorescent signals are detected simultaneously, it is determined that the detection site is the T:C genotype and the strain is a chili pepper pollen viable phenotype.

[0016] In an optional embodiment, the application provided by the present invention employs Touchdown PCR, and the Touchdown PCR amplification program includes 10 cycles of 94°C for 15 minutes; 95°C for 20 seconds; and 65°C-56°C for 60 seconds, with the annealing / extension temperature decreasing by 0.8°C per cycle; and 30 cycles of 94°C for 20 seconds; and 57°C for 60 seconds. [Effects of the Invention]

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] 1. The present invention uses the BSA location method to locate a new gene that controls cytoplasmic male sterility in chili pepper, and based on the mutation site of the gene, develops a KASP molecular marker associated with the gene that restores cytoplasmic male sterility (CMS) in chili pepper. This marker can be directly used to identify the viability of chili pepper pollen and its corresponding genotype. Furthermore, by relying on this molecular marker for assisted breeding, it can effectively solve problems such as the long breeding cycle and susceptibility to environmental influences. Early use of this molecular marker allows for the rapid selection of desirable plants, effectively reducing the cultivation scale and the workload of later identification, and improving the efficiency and accuracy of selection.

[0019] 2. By developing a molecular marker linked to the growth restoration gene for cytoplasmic male sterility in chili peppers, this patent can shorten the transplantation period for the restorer line, and use techniques such as hybridization and backcrossing to quickly introduce the gene that controls the growth restoration of chili peppers and other genes with excellent characteristics into plants, providing genetic resources for the selection and breeding of high-quality new varieties. The development of a molecular marker linked to the growth restoration gene for cytoplasmic male sterility is advantageous for directional breeding of chili pepper cytoplasmic male sterility lines, and also lays the foundation for cloning the growth restoration gene in chili peppers and research into the molecular mechanism of cytoplasmic male sterility in chili peppers, which is of great significance to research into the molecular mechanism behind cytoplasmic male sterility in chili peppers. [Brief explanation of the drawings]

[0020] [Figure 1] FIG. 1 shows phenotype diagrams of the whole plant, stem, and inflorescence of two parent plants measured by BSA in the first embodiment. [Figure 2] FIG. 2 is a graph showing some of the results of genotyping performed on the F2 population constructed from the wild type (WT) and mutant (MT) in Example 3. [Figure 3] FIG. 3 is a diagram showing the chromosomal region results of precise gene location for the growth restoration gene of cytoplasmic male sterility in pepper in embodiment 1. DETAILED DESCRIPTION OF THE INVENTION

[0021] In order to facilitate understanding of the present invention, the present invention will be described more generally and in detail below based on the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0022] Unless otherwise defined, all technical terms used below have the same meaning as commonly understood by those skilled in the art. The technical terms used in this specification are intended to describe the purpose of specific embodiments and do not limit the scope of protection of the present invention.

[0023] In embodiment 1, a molecular marker linked to the vegetative restoration gene of cytoplasmic male sterility (CMS) in pepper is obtained using bulked segregation analysis (BSA) detection method.

[0024] Step 1: Building a population Using the stem chili pepper parent "ST-8" developed through multiple generations of self-pollination and the cytoplasmic male-sterile material "CMS20A," as shown in Figure 1, A is "ST-8" and B is "CMS20A." The male-sterile phenotype of "CMS20A" is genetically stable, unaffected by the environment, and completely sterile. The viable parent "ST-8" was crossed with the sterile parent "CMS20A" to obtain the F1 generation, which was then self-pollinated to obtain the F2 population.

[0025] Step 2: Identifying pollen viability Once the F2 population is in full bloom, the presence or absence of pollen grains in the mature anthocyanins is observed and identified to determine the viability of each plant in the population.

[0026] Step 3: Initial location of the viability restorer gene for cytoplasmic male sterility From the ST-8 x CMS20A F2 population, 25 viable and 25 sterile leaves were selected and mixed in equal amounts to create a viable / sterile DNA mixed pool. Furthermore, leaves from the CMS20A plant were selected to create a parental mixed pool. Total DNA was extracted from the three mixed pools using the cetyltrimethylammonium bromide (CTAB) method. DNA libraries were constructed for the three mixed pools using the TruSeq DNA LT Sample Prep Kit (Illumina). Genome sequencing was performed on the Illumina Novaseq PE150 platform. After rigorous quality control, the reads were matched to the pepper reference genome using bwa software, and whole-genome SNP detection was performed using SAMtools software. Analysis revealed that the sequencing depths for the viable and sterile plants were 18.48x and 20.99x, respectively, covering over 99% of the whole genome. After selection based on the following criteria: base mass ≥ 30, mapping mass ≥ 30, and base depth ≥ 2, ≤ 80 in two F2 mixed pools, and simultaneously ≥ 2, ≤ 40 in two parental lines, we finally obtained 634,273 differential SNPs. We calculated the maximum allele frequency (SNP index) of the sterile pool and its corresponding ΔSNP-index value, and created a graph with a 2 Mb window and 200 kb step size. Because SNPs associated with the target trait are inherited linked to surrounding SNPs on the chromosome, the candidate interval ΔSNP-index was ≥ 0.5 or close to 1. However, in genomic regions unrelated to the trait, the ΔSNP-index was randomly distributed around 0.5. Observing the distribution of ΔSNP-index values, we found a clear peak region across the genome, with a ΔSNP-index value ≥ 0.5 and close to 1. This region was located between 240.1 and 253.0 M on chromosome 6, indicating that the viability restorer gene controlling cytoplasmic male sterility is located within this region.

[0027] Step 4: Accurately locating the viability restoration gene In step 3, the chromosomal region controlling the restoration of vegetative cytoplasmic male sterility in chili peppers was identified. To further narrow down the candidate region for the gene controlling vegetative restoration, DNA sequences within the region were analyzed and KASP (competitive allele-specific PCR) markers were developed. The KASP markers were then used to genotype the F2 population and identify the replacement line. As shown in Figure 3, based on the phenotypic data of plant vegetative phenotypes and the genotypes of the identified replacement line, the vegetative restoration gene was located in the 246736279-248221876 bp interval on chromosome 6. Finally, sequencing identified the C-to-T mutation at position 247327150 on chromosome 6 of the chili pepper genome.

[0028] In embodiment 2, primers are designed based on the molecular markers in embodiment 1, and the primers include two forward primers and one reverse primer, and the two forward primers are linked to fluorescent linker sequences, FAM and HEX, respectively, and the specific sequences are: Forward primer PEPER-CMS-6X, GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC(SEQ ID NO.4), Forward primer PEPER-CMS-6Y, GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT(SEQ ID NO.5), reverse primer PEPER-CMS-6C, It appears to be GTTTGAGTTGGAGGCCATTT (SEQ ID NO. 3).

[0029] Touchdown PCR was performed using the above primers, and the reaction system is as shown in Table 1 below.

[0030] Table 1. PCR reaction system

[0031] [Table 1]

[0032] The amplification program was 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, with 10 cycles, with the annealing-extension temperature decreasing by 0.8°C per cycle; 94°C for 20 s; 57°C for 60 s, with 30 cycles.

[0033] When performing fluorescence detection on the amplified products, If only the fluorescent signal (FAM) corresponding to the primer PEPER-CMS-6X is detected from the sample PCR product, the detection site is determined to be the C:C genotype and the strain is determined to have a chili pepper pollen viability phenotype; if only the fluorescent signal (HEX) corresponding to the primer PEPER-CMS-6Y is detected from the sample PCR product, the detection site is determined to be the T:T genotype and the strain is determined to have a chili pepper pollen viability phenotype; and if two types of fluorescent signals are detected simultaneously, the detection site is determined to be the T:C genotype and the strain is determined to have a chili pepper pollen viability phenotype.

[0034] In embodiment 3, the molecular marker (a C to T mutation occurring at position 247327150 on chromosome 6 of the chili pepper genome) is referred to as PEPER-CMS-6. Genotyping verification was performed using PEPER-CMS-6 on leaves of 1,290 plants selected from an F2 population constructed using ST-8 and CMS20A. Three types of fluorescent signals were detected: 323 C:C fluorescent signals, 662 C:T fluorescent signals, and 305 T:T fluorescent signals. Phenotyping data showed a high degree of agreement between the genotype and the plant's growth phenotype, with a match rate of 100%. The growth type and genotype test results for some plants in the F2 population are shown in Table 2 below. These results fully demonstrate the versatility and accuracy of the PEPER-CMS-6 marker, and its application in predicting, identifying, and selecting chili pepper plant growth phenotypes.

[0035] Table 2. Growth types and genotypes of some strains in the F2 population

[0036] [Table 2]

[0037] The above results, as shown in Figure 2, show that molecular markers can be used for identification and selection in breeding. By retaining material that detects the C fluorescent signal corresponding to primer PEPER-CMS-6, cytoplasmically sterile pepper material can be selected. By retaining material that detects the A fluorescent signal corresponding to primer PEPER-CMS-6, viable homozygous material can be selected. By retaining material that detects the B fluorescent signal (including the fluorescent signals corresponding to the previous two primers), viable hybrid material can be selected. Early selection using molecular markers can reduce the workload of later selection and identification, accelerating the breeding process.

[0038] The above content has described the present invention in more detail with reference to specific preferred embodiments, and the specific embodiments of the present invention are not considered to be limited to these descriptions. A person skilled in the art to which the present invention pertains may make some simple inferences or substitutions without departing from the concept of the present invention, but they should all be considered to fall within the protection scope of the present invention.

Claims

1. A molecular marker for restoring growth to cytoplasmic male sterility in chili peppers, characterized in that the molecular marker is a nucleotide sequence of the chili pepper genome and is significantly related to the property of restoring growth to cytoplasmic male sterility in chili peppers, the nucleotide sequence being based on the chili pepper genome and including a base sequence located in the 246736279-248221876 bp section of chromosome 6, and is a C to T mutation occurring at position 247327150 of chromosome 6.

2. A molecular marker for restoring growth to cytoplasmic male sterility in chili peppers as described in claim 1, characterized in that the molecular marker is obtained from a male sterile mutant whose selected phenotype after mutation by EMS is stable.

3. A KASP typing primer for the molecular marker according to claim 1 or 2, which is used for identification, selection or application, and the primer sequence of the KASP typing primer is: Forward primer 6X, CAACAGTGGGGCAACCAATAC (SEQ ID NO. 1); Forward primer 6Y, CAACAGTGGGGCAACCAATAT (SEQ ID NO. 2); reverse primer 6C, GTTTGAGTTGGAGGCCATTT (SEQ ID NO. 3); A KASP typing primer for the molecular marker described in claim 1 or 2, which is used for identification, selection or application, characterized by:

4. The KASP typing primer described in claim 3, characterized in that the forward primers 6X and 6Y are each linked to a different fluorescent linker sequence, and the fluorescent linker sequence is any of FAM, HEX, FITC, RED, TET, JOE, and R110.

5. The forward primers 6X and 6Y are linked to fluorescent linker sequences FAM and HEX, respectively, and the specific sequences are: Forward primer PEPER-CMS-6X, GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC (SEQ ID NO.4), Forward primer PEPER-CMS-6Y, GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT (SEQ ID NO. 5), The KASP typing primer according to claim 3, characterized in that:

6. An application of the molecular marker described in claim 1 or 2 or the KASP typing primer described in any of claims 3 to 5, characterized in that the application includes identifying and auxiliary selection of growth potential in chili peppers, or identifying, selecting or breeding chili pepper cytoplasmic male sterile mutants.

7. Identification or selection is performed through PCR detection. Specifically, the genomic DNA of the sample to be detected is used as a template, and amplification primers for the molecular markers are used for amplification. The amplification primers are then subjected to fluorescent detection. The amplification system is as follows: 50-100ng of template DNA, 0.15ul of each primer, 5ul of 2X PARMS master mix, and ddH2SO4 supplemented to 10ul. 2 7. The application of claim 6, wherein the .alpha.-.alpha.

8. The application of claim 7, characterized in that when performing fluorescent detection on the amplified product, if a fluorescent signal corresponding to the primer PEPER-CMS-6X is detected, the detection site is determined to be a C:C genotype and the strain is a chili pepper pollen viable phenotype; if a fluorescent signal corresponding to the primer PEPER-CMS-6Y is detected, the detection site is determined to be a T:T genotype and the strain is a chili pepper pollen sterile phenotype; and if two types of fluorescent signals are detected simultaneously, the detection site is determined to be a T:C genotype and the strain is a chili pepper pollen viable phenotype.

9. The application of claim 7, characterized in that touchdown PCR is adopted, and the touchdown PCR amplification program is 10 cycles of 94°C for 15 minutes; 95°C for 20 seconds; 65°C-56°C for 60 seconds, with the annealing / extension temperature decreasing by 0.8°C per cycle; 94°C for 20 seconds; 57°C for 60 seconds, for 30 cycles.

Images