Polynucleotide constructs encoding DNA polymerases and pores
A mechanism combining a DNA-dependent DNA polymerase and a DNA secretion pore facilitates the spread of polynucleotides between eukaryotic cells, addressing the inefficiencies in delivering DNA to target cells and improving therapeutic and recombinant protein expression.
Patent Information
- Application Number
- JP2025536946
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-22
- Filing Date
- 2023-12-22
- Publication Date
- 2026-01-14
AI Technical Summary
Current technologies face limitations in delivering recombinant DNA molecules to the majority of cells in target tissues or organs, leading to inefficiencies in gene therapy, cancer therapy, DNA vaccination, immunotherapy, and recombinant protein expression due to the inability of DNA to spread effectively between cells.
A technique combining a polynucleotide sequence encoding a DNA-dependent DNA polymerase and a pore that allows for DNA secretion between eukaryotic cells, enabling the spread of polynucleotides to most target cells using a mechanism involving replication and secretion.
Enables the delivery of polynucleotides, such as DNA, to the majority of target cells in a tissue or organ, enhancing the effectiveness of gene therapy, cancer therapy, DNA vaccination, immunotherapy, and in vitro recombinant protein production.
Smart Images

Figure 2026501319000001_ABST
Abstract
Description
[Technical Field]
[0001] FIELD OF THE INVENTION The present invention relates to techniques for replicating polynucleotides within eukaryotic cells and transferring such polynucleotides between eukaryotic cells. The polynucleotides can be used to deliver polynucleotide sequences that provide a desired function, such as a therapeutic effect, or that can complement or directly replace a mutated gene in a eukaryotic cell. Treatment methods involving administration of the polynucleotides are also disclosed.
[0002] Background of the invention: Numerous therapeutic approaches exist that require the introduction of nucleic acid molecules into humans or other animals for subsequent expression of the gene encoded by the nucleic acid molecule. These include gene therapy, cancer therapy, and DNA vaccination. In gene therapy, functional copies of mutated genes are delivered to the host's chromosomes to transiently or permanently correct defective phenotypes through chromosomal integration or gene editing (Anguela & High, 2019). Cancer is frequently caused by mutations in genes involved in DNA repair or regulating cell division, and the introduction of these genes can preventatively correct cancer-predisposing mutations or eliminate tumors (Anguela & High, 2019). DNA vaccination relies on the expression of genes encoding immunogenic proteins derived from pathogens in the host's antigen-presenting cells (Hobernik & Bros, 2018).
[0003] Nucleic acids can be formulated in solution, encapsulated in liposomes, attached to microbeads or other carriers, or packaged in viruses (Ates et al. 202). For gene therapy and cancer therapy, transfected DNA ideally needs to reach the majority of cells in the target organ to exert a beneficial effect. However, the percentage of cells transfected using current technology is very low, which has significantly limited the development of gene therapy and gene cancer therapy. A fundamental problem is that DNA transfection is limited to the cells that it originally transfected. Attempts to transfect more cells require high doses of DNA or virus, which are expensive to produce and have tolerance issues in the host.
[0004] Immunotherapy most commonly involves the ex vivo modification of T cells derived from an individual to target tumor antigens (CAR-T therapy). T cells are extracted, genetically modified to express T cell receptors, and then reintroduced into the patient (Miliotou & Papadopoulou, 2018). This patient-specific approach is expensive, time-consuming, and labor-intensive. T cells are generated by progenitor cells in the bone marrow and mature in the thymus. Modifying T cells at their source would be simpler and more cost-effective, but existing technologies are unable to modify enough progenitor cells.
[0005] Direct treatment of pathogens involves the delivery of antimicrobial agents, including antibacterial, antifungal, and antiviral compounds. Viruses may also be targeted using gene editing techniques such as CRISPR-Cas9 to eliminate the viral genome from infected individuals (Doudna & Charpentier, 2014). However, no technology currently exists that allows DNA-encoded antimicrobial agents to spread throughout infected organs and target invading pathogens.
[0006] Recombinant protein expression involves inserting DNA containing a gene of interest, controlled by a promoter and polyadenylation signal sequence, into a cell culture medium derived from a multicellular eukaryote in vitro. Because the creation and selection of highly expressing clones is a lengthy process, transient transfection can be used to achieve transient gene expression in a much shorter time (Bandaranayake & Almo, 2014). To ensure that as many cells as possible take up the DNA, maximizing the yield of recombinant protein requires high concentrations of DNA, which are currently used to achieve this.
[0007] All of the above fields are limited by the inability of recombinant DNA molecules to reach the majority of cells in the target tissue, organ, or cell culture. Therefore, there is a need to develop technologies that allow cell-to-cell DNA transfer.
[0008] Summary of the Invention The present inventors have developed a technique for the intercellular transfer of polynucleotides, such as DNA. The inventors surprisingly discovered that the combination of a gene expressing a pore that secretes DNA with a gene that confers replication functions enables the spread of polynucleotides between eukaryotic cells, enabling a technique that can deliver polynucleotides, such as DNA, to the majority of target cells in a tissue or organ. Applications of this invention include gene therapy, cancer therapy, DNA vaccination, immunotherapy, antimicrobial treatment, and in vitro production of recombinant proteins.
[0009] Therefore, in a first aspect of the present invention, a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that allows for the secretion of DNA from a eukaryotic cell. A polynucleotide is provided comprising:
[0010] In a further aspect of the present invention, a) origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) i) protelomerase; or ii) Terminal and DNA-binding proteins required for plasmid replication in eukaryotic cells a polynucleotide sequence encoding d) a polynucleotide sequence encoding a pore that allows for the secretion of DNA from a eukaryotic cell. A polynucleotide is provided comprising:
[0011] In a further aspect of the invention, - A circular or linear plasmid comprising a polynucleotide as defined herein is provided.
[0012] In a further aspect of the invention, - There is provided a pharmaceutical composition comprising a polynucleotide as defined herein, or a plasmid as defined herein, and a pharmaceutically acceptable excipient.
[0013] In a further aspect of the invention, - a method of treatment is provided which comprises administering to an individual in need thereof a polynucleotide as defined herein, a plasmid as defined herein, or a pharmaceutical composition as defined herein.
[0014] Brief Description of Sequence Listing SEQ ID NO: 1 Amino acid sequence of N15repA. SEQ ID NO:2 Cistron of N15repA. SEQ ID NO: 3 Amino acid sequence of N15telN. SEQ ID NO: 4 N15telN cistron. SEQ ID NO: 5 N15telRL. SEQ ID NO: 6 Amino acid sequence of N15sopA. SEQ ID NO: 7 Cistron of N15sopA. SEQ ID NO: 8 Amino acid sequence of N15sopB. SEQ ID NO: 9 Cistron of N15sopB. SEQ ID NO: 10 Amino acid sequence of Phi29 DNA-dependent DNA polymerase (gene 2). SEQ ID NO: 11 Phi29 DNA-dependent DNA polymerase cistron (gene 2). SEQ ID NO: 12 Amino acid sequence of Phi29 terminal protein (gene 3). SEQ ID NO: 13 Phi29 terminal protein cistron (gene 3). SEQ ID NO: 14 Amino acid sequence of Phi29 single-stranded DNA binding protein (gene 5). SEQ ID NO: 15. Phi29 single-stranded DNA binding protein cistron (gene 5). SEQ ID NO: 16 Amino acid sequence of Phi29 double-stranded DNA binding protein (gene 6). SEQ ID NO: 17 Phi29 double-stranded DNA binding protein cistron (gene 6). SEQ ID NO: 18 Amino acid sequence of adenovirus type 5 DNA-dependent DNA polymerase. SEQ ID NO: 19 Adenovirus type 5 DNA-dependent DNA polymerase cistron. SEQ ID NO: 20 Amino acid sequence of the adenovirus type 5 pro-terminal protein (pTP). SEQ ID NO: 21 Adenovirus type 5 pro-terminal protein (pTP) cistron. SEQ ID NO: 22 Amino acid sequence of the adenovirus type 5 DNA binding protein (DBP). SEQ ID NO: 23 Adenovirus type 5 DNA binding protein (DBP) cistron. SEQ ID NO: 24: Amino acid sequence of pSVH1 TraB of Streptomyces venezuelae. SEQ ID NO: 25 Streptomyces venezuelae pSVH1 traB cistron. SEQ ID NO: 26 pSVH1 clt locus of Streptomyces venezuelae. SEQ ID NO: 27 Streptomyces venezuelae pSVH1 clt repeat sequence. SEQ ID NO: 28: Amino acid sequence of TdtA from Thermus thermophilus. SEQ ID NO: 29 Thermus thermophilus tdtA cistron. SEQ ID NO: 30 2A "ribosome skipping" peptide consensus sequence. SEQ ID NO: 31 E2A "ribosome skipping" peptide sequence. SEQ ID NO: 32 P2A "ribosome skipping" peptide sequence. SEQ ID NO: 33 T2A "ribosome skipping" peptide sequence. SEQ ID NO: 34 Nucleotide sequence of pBITREP. SEQ ID NO: 35 Nucleotide sequence of pBITREPA2. SEQ ID NO: 36 pBITREPB2 nucleotide sequence. SEQ ID NO: 37 Nucleotide sequence. SEQ ID NO: 38 Nucleotide sequence. SEQ ID NO: 39 Nucleotide sequence. SEQ ID NO: 40 Nucleotide sequence. SEQ ID NO: 41 Nucleotide sequence. SEQ ID NO: 42 Nucleotide sequence. SEQ ID NO: 43 Nucleotide sequence. SEQ ID NO: 44 Nucleotide sequence. SEQ ID NO: 45 pLUCK nucleotide sequence. SEQ ID NO: 46 pLUCKREP nucleotide sequence. SEQ ID NO: 47 pLUCKB nucleotide sequence. SEQ ID NO: 48 pLUCKCB nucleotide sequence. SEQ ID NO: 49 pLUCKOB nucleotide sequence. SEQ ID NO: 50 pLUCKTB nucleotide sequence. SEQ ID NO: 51 pLUCKRB nucleotide sequence. SEQ ID NO: 52 NoTelNRepA primer. SEQ ID NO: 53 NoTelNR primer. [Brief explanation of the drawings]
[0015] [Figure 1] A) and B) show the intercellular DNA transport mechanism of the present invention, including the DNA replication function and DNA secretion pore of bacteriophage N15. [Figure 2] Figure 2 shows A) processing of telRL sites on circular DNA by the N15 protelomerase TelN to generate covalently closed hairpin ends (resulting in linear DNA), and B) the mechanism of DNA replication by bacteriophage N15 RepA and TelN (adapted from Ravin, 2014). [Figure 3] FIG. 3 shows the intercellular DNA transport mechanism of the present invention, which includes the DNA replication function of Phi29 or adenovirus and the DNA secretion pore (TP: terminal protein; DBP: DNA binding protein). [Figure 4] Figure 4 shows the mechanism of linear DNA replication using a Phi29-based terminal protein. Phi29 polymerase initiates the synthesis of each strand of linear DNA using a terminal protein (covalently attached to each 5' end), and the strands separate as they encounter DNA polymerase and continue replicating, generating two linear DNA molecules (adapted from Choi et al., 2016). [Figure 5] Figure 5 shows the plasmids used in experiments to investigate membrane binding and DNA secretion by the TdtA and TraB pores: A) pBITTdtA and B) pBITTraB2. Experiments were performed to demonstrate that FALG-tagged pore proteins expressed from the plasmids were transfected into HEK293 cells. To detect the pore proteins, cells were stained with wheat germ agglutinin / Alexa Fluor 647 conjugate (membrane), DAPI (DNA), and anti-FALG antibody. C) TdtA expressed from pBITTdtA and D) TraB expressed from pBITTraB2. [Figure 6]Figure 6 shows the results of an experiment in which HEK293 cells were transfected with two plasmids expressing mCherry (the negative control pMCPK and pBITTdtA expressing TdtA) and subsequently with pdClover2-N1 expressing Clover2 (green fluorescent protein). The total percentage of Clover2-expressing cells that were adjacent to A) cells that also expressed Clover2 and mCherry, and B) cells expressing both fluorescent reporter proteins, was recorded. [Figure 7] Figure 7 shows the results of an experiment in which HEK293 cells were transfected with the TraB pore-expressing plasmid pBITTraB2, which was subsequently transfected with pdClover2-N1 and the clt locus-containing plasmid pCMV-Clover2-CLT. A) Cells expressing Clover2 that also expressed mCherry, and B) the total percentage of Clover2-expressing cells adjacent to cells expressing both fluorescent reporter proteins, were recorded. [Figure 8] FIG. 8 shows the plasmids expressing the components of the Gentrafix system: A) pBITREPA2 expressing telN, repA, and tdtA; B) pBITREPB2 expressing telN, repA, and traB. [Figure 9] FIG. 9 shows a Western blot demonstrating the expression of the Gentrafix component proteins TelN, RepA, TdtA and TraB in the human cell line HEK293 cells. [Figure 10] FIG. 10 shows additional plasmids used in experiments to provide evidence for intracellular DNA secretion: A) pBITREP and B) pMCPK. [Figure 11] FIG. 11 shows the plasmids used in experiments to investigate membrane binding and secretion of DNA through the TdtA and TraB pores: A) pdClover2-N1 and B) pCMV-Clover2-CLT. [Figure 12]Figure 12 shows the results of an experiment in which HEK293 cells were transfected with the plasmids pMCPK, pBITREP, or pBITREPA2. Positive (plasmid-containing) cells are red (because both plasmids express mCherry), and a cluster is defined as a group of three or more adjacent red cells: A) number of mCherry-expressing cells per image, B) number of clusters of mCherry-expressing cells per image, C) number of mCherry-expressing cells within clusters per image, D) number of mCherry-expressing cells forming clusters, and E) representative image with red cells indicated by arrows. [Figure 13] Figure 13 shows the results of an experiment in which HEK293 cells were transfected with pBITREP, pBITREPA2, and pBITREPB2, and then cells of a second cell line, HEK293GFP (green fluorescent protein), were added to the culture medium. Red cells are indicated by white arrows, and cells that are both red and green are indicated by hash arrows. [Figure 14] FIG. 14 shows the results of an experiment in which MDCK-GFP cells were transfected with pMCPK and pBITREPB2, and then cells of a second cell line, MDCK, were added to the culture medium. [Figure 15] FIG. 15 shows a plasmid containing the firefly luciferase gene. [Figure 16] FIG. 16 shows the results of an experiment in which HEK293 cells were transfected with a plasmid containing the firefly luciferase gene.
[0016] Detailed Description of the Invention General definition Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0017] It is to be understood that different applications of the disclosed invention may be tailored to meet the particular needs of the art, and that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
[0018] The term "about" or "approximately," when referring to a numerical value, refers to that numerical value, but within a reasonable degree of scientific error. As the case may be, a numerical value is "about x" or "approximately x" when the numerical value is within 10%, within 5%, or within 1% of x.
[0019] Furthermore, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pore" also includes "pores," and the like.
[0020] Generally, the term "comprises" is intended to mean include, but not be limited to. For example, the phrase "a polynucleotide comprising a polynucleotide sequence encoding a pore that allows DNA secretion from a eukaryotic cell, a polynucleotide sequence encoding an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or terminal protein and a DNA-binding protein required for plasmid replication in a eukaryotic cell" should be interpreted as meaning that the polynucleotide comprises at least one pore that allows DNA secretion from a eukaryotic cell, a polynucleotide sequence encoding an origin of replication, a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or terminal protein and a DNA-binding protein required for plasmid replication in a eukaryotic cell, but may also include other polynucleotide sequences.
[0021] In some embodiments of the present invention, the word "comprises" is replaced with the phrase "consisting of." The term "consisting of" is intended to be limiting. For example, the phrase "a polynucleotide consisting of a polynucleotide sequence encoding a pore that allows DNA secretion from a eukaryotic cell, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or terminal protein and a DNA-binding protein required for plasmid replication in a eukaryotic cell" should be interpreted to mean that the polynucleotide contains at least one pore that allows DNA secretion from a eukaryotic cell, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or terminal protein and a DNA-binding protein required for plasmid replication in a eukaryotic cell, but does not contain any other polynucleotide sequences.
[0022] In some embodiments of the present invention, the word "comprises" is replaced with the phrase "essentially consisting of." The term "essentially consisting of" means that additional specific components may be present, i.e., components that do not substantially affect the essential characteristics of the subject matter. For example, the phrase "a polynucleotide consisting essentially of a polynucleotide sequence encoding a pore that enables DNA secretion from eukaryotic cells, a polynucleotide sequence encoding an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells" may also include polynucleotide sequences such as linker sequences between the claimed polynucleotide sequences.
[0023] The terms "nucleic acid molecule," "nucleic acid sequence," "polynucleotide," and "nucleotide sequence" are used synonymously herein and are intended to refer to a polymeric chain of nucleotides of any length, such as deoxyribonucleotides, ribonucleotides, or analogs thereof. For example, the polynucleotide can comprise DNA (deoxyribonucleotides) or RNA (ribonucleotides). The polynucleotide can be composed of DNA. The polynucleotide can be mRNA. The polynucleotide can comprise RNA or DNA, and all references to T (thymine) nucleotides can be replaced with U (uracil).
[0024] It is standard in the art that nucleotide sequences are written from 5' to 3', i.e., the first nucleotide in any given sequence can be considered to be at the 5' end of any given sequence, and the last nucleotide can be considered to be at the 3' end. Thus, a sequence element that is 5' of a second sequence element precedes the second sequence element in the nucleotide sequence. A first sequence element that is 5' of a second sequence element can immediately precede the second sequence element in the nucleotide sequence. Alternatively, a first sequence element that is 5' of a second sequence element can not immediately precede the second sequence element in the nucleotide sequence; i.e., the nucleotide sequence can include an intervening sequence between the first and second sequence elements. Similarly, if the intervening sequence is less than 10 nucleotides in length, the first sequence element is less than 10 nucleotides 5' of the second sequence element.
[0025] A first sequence element that is 3' of a second sequence element follows the second sequence element in the nucleotide sequence. A first sequence element that is 3' of a second sequence element may immediately follow the second sequence element in the nucleotide sequence, i.e., there are no intervening nucleotides between the two sequence elements. Alternatively, a first sequence element that is 3' of a second sequence element may not immediately follow the second sequence element in the nucleotide sequence, i.e., the nucleotide sequence may include an intervening sequence between the first and second sequence elements. Similarly, if the intervening sequence is less than 10 nucleotides in length, the first sequence element is less than 10 nucleotides from 3' of the second sequence element.
[0026] For the purposes of the present invention, to determine the percent identity of two sequences (two polynucleotides or two polynucleotide sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced into the first sequence for optimal alignment with the second sequence). The nucleotides at each position are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the nucleotide is identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity = number of identical positions / total number of positions in the reference sequence × 100).
[0027] Typically, sequence comparison is performed over the length of the reference sequence. For example, if a user wants to determine whether a given ("test") sequence is 95% identical to SEQ ID NO: 1, SEQ ID NO: 1 would be the reference sequence. To assess whether a sequence is at least 95% identical to SEQ ID NO: 1 (an example of a reference sequence), one skilled in the art would perform an alignment over the length of SEQ ID NO: 1 and identify how many positions in the test sequence are identical to positions in SEQ ID NO: 1. If at least 95% of the positions are identical, the test sequence is at least 95% identical to SEQ ID NO: 1. If the test sequence is shorter than SEQ ID NO: 1, gaps or missing positions should be considered non-identical positions.
[0028] Those skilled in the art are aware of various computer programs available for aligning two sequences. For example, alignment between two sequences can be achieved using a mathematical algorithm. In one embodiment, two nucleic acid sequences are aligned using the Needlema and Wunsch (1970) algorithm or the National Center for Biotechnology Information's BLAST2 (Basic Local Alignment Search Tool) algorithm.
[0029] All publications, patents, and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
[0030] Polynucleotide replication by bacteriophage N15 and equivalent components The present inventors have developed a technique for cell-to-cell transfer of polynucleotides such as DNA. In a preferred embodiment of the present invention, the polynucleotide is DNA. In a preferred embodiment of the present invention, the polynucleotide is in the form of a plasmid. In a preferred embodiment of the present invention, the polynucleotide is in the form of a circular plasmid or a linear plasmid.
[0031] The inventors have surprisingly discovered that the combination of a polynucleotide sequence expressing a pore that secretes DNA with a polynucleotide sequence that confers the replication function of a plasmid enables a technique that will allow the polynucleotide to spread between eukaryotic cells and allow the polynucleotide to reach most target cells in a tissue or organ (Figure 1). The present invention is designed to perform a prophylactic or therapeutic function in target cells by expressing proteins and RNA encoded by the polynucleotide.
[0032] The polynucleotides of the present invention comprise several polynucleotide sequences. These polynucleotide sequences may be referred to as sequence elements or components. These components include at least: a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and -contains a polynucleotide sequence encoding a pore that allows the secretion of DNA from a eukaryotic cell.
[0033] In a preferred embodiment, these components include at least: - origin of replication; - a polynucleotide sequence encoding a DNA-dependent DNA polymerase; -i) protelomerase; or ii) Terminal and DNA-binding proteins required for plasmid replication in eukaryotic cells a polynucleotide sequence encoding - a polynucleotide sequence encoding a pore that allows the secretion of DNA from a eukaryotic cell Includes:
[0034] The components can be located in any order, in a 5' to 3' direction, along a polynucleotide of the invention. Other components can be 5' to the above-listed components, 3' to the above-listed components, or 5' to some of the above-listed components but 3' to other of the above-listed components.
[0035] The components can be located in a 5' to 3' direction as follows: a DNA-dependent DNA polymerase; a pore that allows for the secretion of DNA from a eukaryotic cell. The components can be located in a 5' to 3' direction as follows: a pore that allows for the secretion of DNA from a eukaryotic cell; a DNA-dependent DNA polymerase. The components can be located in a 5' to 3' direction as follows: a protelomerase or a terminal protein and a DNA-binding protein; a DNA-dependent DNA polymerase; a pore that allows for the secretion of DNA from a eukaryotic cell. The components can be located in a 5' to 3' direction as follows: a DNA-dependent DNA polymerase; a protelomerase or a terminal protein and a DNA-binding protein; a pore that allows for the secretion of DNA from a eukaryotic cell. The components can be located in a 5' to 3' direction as follows: a protelomerase or a terminal protein and a DNA-binding protein; a pore that allows for the secretion of DNA from a eukaryotic cell; a DNA-dependent DNA polymerase. The components can be located in a 5' to 3' direction as follows: a DNA-dependent DNA polymerase; a pore that allows for secretion of DNA from a eukaryotic cell; a protelomerase or a terminal protein and a DNA-binding protein. The components can be located in a 5' to 3' direction as follows: a pore that allows for secretion of DNA from a eukaryotic cell; a protelomerase or a terminal protein and a DNA-binding protein; a DNA-dependent DNA polymerase. The components can be located in a 5' to 3' direction as follows: a pore that allows for secretion of DNA from a eukaryotic cell; a DNA-dependent DNA polymerase; a protelomerase or a terminal protein and a DNA-binding protein.
[0036] The components can be located in a 5' to 3' direction as follows: an origin of replication; a protelomerase or terminal protein and a DNA-binding protein; a DNA-dependent DNA polymerase; a pore that allows for secretion of DNA from a eukaryotic cell. The components can be located in a 5' to 3' direction as follows: a protelomerase or terminal protein and a DNA-binding protein; an origin of replication; a DNA-dependent DNA polymerase; a pore that allows for secretion of DNA from a eukaryotic cell. The components can be located in a 5' to 3' direction as follows: a protelomerase or terminal protein and a DNA-binding protein; a DNA-dependent DNA polymerase; an origin of replication; a pore that allows for secretion of DNA from a eukaryotic cell.
[0037] The components can be located in a 5' to 3' direction as follows: RepA;TdtA. The components can be located in a 5' to 3' direction as follows: RepA;TraB. The components can be located in a 5' to 3' direction as follows: TelN;RepA;TdtA. The components can be located in a 5' to 3' direction as follows: TelN;RepA;TraB.
[0038] The polynucleotides of the present invention may be referred to herein as the Gentrafix system, the Gentrafix cassette, or similar names.
[0039] A first aspect of the present invention relates to mechanisms for replicating polynucleotides in eukaryotic cells.
[0040] The polynucleotide of the present invention present in a eukaryotic cell may be in the form of a linear or circular plasmid. Replication of the polynucleotide of the present invention is enabled by a DNA-dependent DNA polymerase, optionally in combination with one or more additional proteins essential for replication. These components may be of bacteriophage, bacterial, archaeal, viral, or eukaryotic origin.
[0041] The enzyme for replication of the plasmid is preferably DNA polymerase RepA from bacteriophages, including PY54 of Yersinia enterocolitica, Siphovirus ψKO2 of Klebsiella oxytoca, and coliphage N15.
[0042] The repA gene sequence of coliphage N15 contains the origin of replication (ori), on which it acts to initiate replication. N15RepA alone is sufficient for bidirectional theta-mode circular DNA replication because it possesses primase, helicase, and origin-binding activities (Ravin, 2014). Therefore, a plasmid containing only RepA will replicate as a covalently closed circular double-stranded DNA molecule.
[0043] Thus, in the polynucleotide of the present invention, the polynucleotide comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase. In a preferred embodiment of the present invention, the DNA-dependent DNA polymerase is encoded by the repA gene.
[0044] In a preferred embodiment of the invention, the DNA-dependent DNA polymerase expressed by the polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, or at least 1300 amino acids of SEQ ID NO:1; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:1; or (iii) SEQ ID NO: 1 Includes:
[0045] In a preferred embodiment of the present invention, the polynucleotide sequence of the DNA-dependent DNA polymerase is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 2000, at least 2500, at least 3000, at least 3500, at least 3700, at least 3800, or at least 3900 nucleotides of SEQ ID NO:2; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:2; or (iii) SEQ ID NO: 2 Includes:
[0046] The sequence variants retain the ability to function as DNA-dependent DNA polymerases when expressed. Suitable assays for determining DNA-dependent DNA polymerase activity are known to those skilled in the art and include quantitative PCR assays using primers and probes that bind to the DNA sequence replicated by the DNA polymerase.
[0047] In one embodiment of the invention, a polynucleotide of the invention is a linear, double-stranded DNA molecule with covalently closed ends that form a so-called "hairpin loop," preventing the DNA ends from being exposed to exonucleases and thereby increasing its stability. In this embodiment, the polynucleotide may further comprise a polynucleotide sequence containing a protelomerase-encoding polynucleotide sequence containing telN and one copy of its target site, telRL (a 56-bp inverted repeat), from a bacteriophage, including bacteriophage N15.
[0048] In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding the protelomerase TelN from bacteriophage N15.
[0049] In a preferred embodiment of the invention, the protelomerase expressed by the polynucleotide sequence: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 400, at least 450, at least 500, at least 550, or at least 600 amino acids of SEQ ID NO:3; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:3; or (iii) SEQ ID NO: 3 Includes:
[0050] In a preferred embodiment of the invention, the TelN polynucleotide sequence is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1500, at least 1600, at least 1700, or at least 1800 nucleotides of SEQ ID NO:4; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:4; or (iii) SEQ ID NO: 4 Includes:
[0051] The sequence variants retain the ability to function as protelomerases when expressed. Suitable assays for determining protelomerase activity are known to those of skill in the art and include agarose gel electrophoresis of plasmid DNA containing the TelRL sequence, since treatment with TelN results in a linear form that migrates at its correct size relative to the circular plasmid DNA, which can be determined using "size markers" containing DNA fragments of known length. Furthermore, restriction endonuclease digestion using an enzyme that cuts once within the plasmid will convert the circular plasmid into a linear form, where the linear plasmid will be cut into two fragments.
[0052] In a preferred embodiment of the invention, a polynucleotide of the invention comprises a telRL site. In one embodiment, the polynucleotide sequence of the telRL site comprises SEQ ID NO: 5 or a variant of SEQ ID NO: 5 that differs by 1, 2, 3, 4 or 5 nucleotides.
[0053] The sequence variants retain the ability to function as telRL sites. Suitable assays for determining the functionality of telRL sites are known to those of skill in the art and include agarose gel electrophoresis of plasmid DNA containing TelRL sequences, since treatment with TelN results in a linear form that migrates at its correct size relative to the circular plasmid DNA, which can be determined using "size markers" containing DNA fragments of known length. Furthermore, restriction endonuclease digestion using an enzyme that cuts once within the plasmid will convert the circular plasmid into a single linear form, whereas the linear plasmid will be cut into two fragments.
[0054] The replication mechanism of linear plasmids is as follows: the protelomerase TelN cleaves a single telRL site on the plasmid with a staggered nick, generating a 6-bp extension that folds back and is connected to the complementary DNA strand by a phosphodiester bond, creating terminal hairpin loops on the linear, double-stranded DNA molecule. These loops are called telL and telR. This linear plasmid is replicated by RepA. When telL converts from single-stranded to double-stranded in the replication bubble, the resulting site, telLL, is cleaved and self-annealed by TelN to generate a Y-shaped molecule or a circular plasmid dimer replication intermediate. When telR converts from single-stranded to double-stranded in the replication bubble, the resulting site, telRR, is also cleaved and self-annealed by TelN to generate a linear plasmid with opposite telL and telR hairpin ends (Ravin, 2014). The newly generated linear plasmid is then replicated by RepA and processed by TelN to produce further copies. The mechanism of plasmid replication by RepA and TelN of bacteriophage N15 is shown in Figure 2.
[0055] It is well known in the art that therapeutic plasmid DNA can be produced in and purified from prokaryotic cells (e.g., Escherichia coli) prior to introduction into eukaryotic (e.g., Homo sapiens) target cells. In one embodiment of the invention, the repA and telN polynucleotide sequences are expressed from standard hybrid or dual promoters that allow transcription in both prokaryotic and eukaryotic cells.
[0056] In another embodiment of the invention, the repA and telN polynucleotide sequences are expressed from a promoter functional only in eukaryotic cells, and additional repA and telN polynucleotide sequences are expressed in trans from a promoter functional in prokaryotic cells. Additionally, the sopA and sopB genes from bacteriophage N15 may be present in trans to stabilize the linear form of the polynucleotides of the invention in prokaryotic cells. When polynucleotide sequences comprising one or more of repA, telN, sopA, and sopB are present in trans, they may be present on a second plasmid or integrated into the chromosome, and their expression is regulated by a prokaryotic promoter or promoters, which may be constitutive or inducible.
[0057] In a preferred embodiment of the present invention, a host cell is provided comprising a polynucleotide of the present invention. In a preferred embodiment, the host cell is an Escherichia coli cell. In a preferred embodiment, the Escherichia coli cell expresses the telN and repA genes from bacteriophage N15. In a preferred embodiment, the Escherichia coli cell expresses the sopA and sopB genes from bacteriophage N15. In a preferred embodiment, the Escherichia coli cell comprises a polynucleotide comprising a polynucleotide sequence encoding sopA and sopB.
[0058] In a preferred embodiment of the invention, the SopA expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, at least 350, or at least 375 amino acids of SEQ ID NO:6; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:6; or (iii) SEQ ID NO: 6 Includes:
[0059] In a preferred embodiment of the invention, the sopA polynucleotide sequence is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 1100 nucleotides of SEQ ID NO: 7; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:7; or (iii) SEQ ID NO: 7 Includes:
[0060] The sequence variants retain the ability to function as SopA proteins when expressed. Suitable assays for determining SopA protein activity are known to those skilled in the art and involve culturing a plasmid-replicating E. coli strain for multiple generations by inoculating a flask of nutrient broth at a low density, growing to high density, and repeating the process over several days. Comparison of daily plasmid preparations from the strains by agarose gel electrophoresis or quantitative PCR will allow detection of any loss of plasmid.
[0061] In a preferred embodiment of the invention, the SopB expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, or at least 340 amino acids of SEQ ID NO:8; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:8; or (iii) SEQ ID NO: 8 Includes:
[0062] In a preferred embodiment of the invention, the sopB polynucleotide sequence is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides of SEQ ID NO:9; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:9; or (iii) SEQ ID NO: 9 Includes:
[0063] The sequence variants retain the ability to function as SopB proteins when expressed. Suitable assays for determining SopB protein activity are known to those skilled in the art and involve culturing a plasmid-replicating E. coli strain for multiple generations by inoculating a flask of nutrient broth at a low density, growing to high density, and repeating the process over several days. Comparison of daily plasmid preparations from the strains by agarose gel electrophoresis or quantitative PCR will allow detection of any loss of plasmid.
[0064] An alternative method for producing the polynucleotides of the invention involves a cell-free system whereby TelN and Phi29 polymerases are used to replicate linear DNA containing TelR and TelL hairpin ends in vitro.
[0065] Terminal protein-mediated replication of linear DNA In one embodiment of the present invention, the polynucleotides of the present invention are linear, double-stranded DNA molecules protected at each end by covalent attachment of the 5' phosphate to terminal proteins (TPs) that contain inverted repeat sequences at the DNA termini and act as replication origins. These systems further require a DNA polymerase (DNA replication is initiated from the terminal protein) and one or more DNA-binding proteins essential for DNA replication. In bacteria, the plasmid is circular, and replication is initiated at a bacterial origin of replication, which in Escherichia coli can be N15 repA, pMB1, ColEI, p15A, or pSC101. The circular plasmid is linearized using restriction endonucleases to generate a linear plasmid containing the terminal inverted repeat sequences for transfection into target eukaryotic cells. The linear plasmid can also be ligated to the terminal proteins in vitro prior to transfection.
[0066] In a further embodiment of the present invention, the linear replication system included as part of the polynucleotide of the present invention is derived from Bacillus subtilis bacteriophages of the Phi29 (ψ29) group, including ψ29, PZA, ψ15, BS32, B103, Nf, M2Y, and GA-1 (Meijer et al., 2001). The replication machinery includes a DNA-dependent DNA polymerase (gene 2), TP (gene 3), single-stranded DNA-binding protein p5 (gene 5), and double-stranded DNA-binding protein 6 (gene 6); the DNA-binding protein is essential for DNA amplification (Salas et al., 2016).
[0067] In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase derived from bacteriophage Phi29. In a preferred embodiment of the invention, the DNA-dependent DNA polymerase is encoded by gene 2.
[0068] In a preferred embodiment of the invention, the DNA-dependent DNA polymerase expressed by the polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 350, at least 400, at least 450, at least 500, or at least 550 amino acids of SEQ ID NO: 10; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 10; or (iii) SEQ ID NO: 10 Includes:
[0069] In a preferred embodiment of the invention, the polynucleotide sequence of the DNA-dependent DNA polymerase is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, at least 1600, or at least 1700 nucleotides of SEQ ID NO: 11; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 11; or (iii) SEQ ID NO: 11 Includes:
[0070] The sequence variants retain the ability to function as DNA-dependent DNA polymerases when expressed. Suitable assays for determining DNA-dependent DNA polymerase activity are known to those skilled in the art and include expressing the DNA-dependent DNA polymerase in an E. coli strain together with a plasmid containing its corresponding origin of replication. An increase in the total yield of DNA, as measured by UV spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicates that a functional DNA-dependent DNA polymerase is replicating the plasmid.
[0071] In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding the terminal protein TP and the DNA binding proteins p5 and p6 from a bacteriophage of the Phi29 group of Bacillus subtilis.
[0072] In a preferred embodiment of the invention, the terminal protein expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, or at least 260 amino acids of SEQ ID NO: 12; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 12; or (iii) SEQ ID NO: 12 Includes:
[0073] In a preferred embodiment of the present invention, the polynucleotide sequence of the terminal protein is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 400, at least 500, at least 600, at least 700, at least 750, or at least 800 nucleotides of SEQ ID NO: 13; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 13; or (iii) SEQ ID NO: 13 Includes:
[0074] The sequence variants retain the ability to function as terminal proteins when expressed. Suitable assays for determining terminal protein activity are known to those skilled in the art and include an increase in the overall yield of linear DNA as measured by ultraviolet spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicating that functional terminal proteins contribute to plasmid replication. Additionally, electrophoretic mobility shift assays can be used to detect DNA-bound terminal proteins.
[0075] In a preferred embodiment of the invention, the DNA binding protein p5 expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, or at least 120 amino acids of SEQ ID NO: 14; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14; or (iii) SEQ ID NO: 14 Includes:
[0076] In a preferred embodiment of the present invention, the polynucleotide sequence of the DNA binding protein p5 is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 300, at least 350, at least 360, or at least 370 nucleotides of SEQ ID NO: 15; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15; or (iii) SEQ ID NO: 15 Includes:
[0077] The sequence variants retain the ability to function as DNA-binding protein p5 when expressed. Suitable assays for determining the activity of DNA-binding protein p5 are known to those skilled in the art and include an increase in the total yield of linear DNA as measured by ultraviolet spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicating that functional p5 contributes to plasmid replication. Additionally, electrophoretic mobility shift assays can be used to detect terminal protein bound to DNA.
[0078] In a preferred embodiment of the invention, the DNA binding protein p6 expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, or at least 100 amino acids of SEQ ID NO: 16; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 16; or (iii) SEQ ID NO: 16 Includes:
[0079] In a preferred embodiment of the present invention, the polynucleotide sequence of the DNA binding protein p6 is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 260, at least 270, at least 280, at least 290, at least 300, or at least 310 nucleotides of SEQ ID NO: 17; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 17; or (iii) SEQ ID NO: 17 Includes:
[0080] The sequence variants retain the ability to function as DNA-binding protein p6 when expressed. Suitable assays for determining the activity of DNA-binding protein p6 are known to those skilled in the art and include an increase in the total yield of linear DNA as measured by ultraviolet spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicating that functional p6 contributes to plasmid replication. Additionally, electrophoretic mobility shift assays can be used to detect terminal protein bound to DNA.
[0081] The first step of DNA replication involves the formation of a heterodimer between the terminal protein and DNA polymerase, which recognizes and binds to the replication origin sequences located at either end of the linear plasmid. DNA is unwound by the binding of p6 to the intact plasmid, and DNA replication is initiated by DNA polymerase, forming a phosphodiester bond between the hydroxyl group of Ser232 of the terminal protein and dAMP. Initiation occurs at the second nucleotide of the template, beginning with the T-repeat sequence (TTT). Thus, once the first dAMP is added to the new DNA strand, the TP-A complex returns to the initiation site, ensuring that no information is lost. DNA polymerase dissociates from the terminal protein after inserting at the tenth nucleotide and continues DNA elongation in the single-stranded region of the replication bubble bound by p5. When the replication forks from each end meet, the linear plasmid separates into two, and replication of each ends when the DNA polymerase reaches the template and dissociates (Salas et al., 2016). This creates two linearized plasmids, each with a terminal protein ligated to each end, which can initiate subsequent rounds of replication.
[0082] In a further embodiment of the invention, the linear replication system included as part of the polynucleotide of the invention is derived from adenovirus (AdV), which infects vertebrate cells. Adenoviruses use the pro-terminal protein (pTP) to initiate DNA replication by their DNA polymerase, adenoviral polymerase (both expressed from the same gene: E2B); the plasmid will additionally require the adenoviral DNA-binding protein (DBP), which is encoded by E2A.
[0083] In a preferred embodiment of the present invention, the polynucleotide of the present invention comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase derived from an adenovirus, in a preferred embodiment of the present invention, the DNA-dependent DNA polymerase is encoded by the gene E2B.
[0084] In a preferred embodiment of the invention, the DNA-dependent DNA polymerase expressed by the polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 700, at least 800, at least 900, at least 950, at least 1000, at least 1050, at least 1100, or at least 1150 amino acids of SEQ ID NO: 18; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 18; or (iii) SEQ ID NO: 18 Includes:
[0085] In a preferred embodiment of the invention, the polynucleotide sequence of the DNA-dependent DNA polymerase is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to at least 2600, at least 2700, at least 2800, at least 2900, at least 3000, at least 3100, at least 3200, at least 3300, at least 3400, or at least 3500 nucleotides of SEQ ID NO: 19; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 19; or (iii) SEQ ID NO: 19 Includes:
[0086] The sequence variants retain the ability to function as DNA-dependent DNA polymerases when expressed. Suitable assays for determining DNA-dependent DNA polymerase activity are known to those skilled in the art and include expressing the DNA-dependent DNA polymerase in an E. coli strain together with a plasmid containing its corresponding origin of replication. An increase in the total yield of DNA, as measured by UV spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicates that a functional DNA-dependent DNA polymerase is replicating the plasmid.
[0087] In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding the terminal protein pTP and the DNA binding protein E2A from adenovirus.
[0088] In a preferred embodiment of the invention, the terminal protein expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, or at least 650 amino acids of SEQ ID NO: 20; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 20; or (iii) SEQ ID NO: 20 Includes:
[0089] In a preferred embodiment of the present invention, the polynucleotide sequence of the terminal protein is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1500, at least 1600, at least 1700, at least 1800, at least 1900, or at least 2000 nucleotides of SEQ ID NO: 21; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 21; or (iii) SEQ ID NO: 21 Includes:
[0090] The sequence variants retain the ability to function as terminal proteins when expressed. Suitable assays for determining terminal protein activity are known to those skilled in the art and include an increase in the overall yield of linear DNA as measured by ultraviolet spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicating that functional terminal proteins contribute to plasmid replication. Additionally, electrophoretic mobility shift assays can be used to detect DNA-bound terminal proteins.
[0091] In a preferred embodiment of the invention, the DNA binding protein expressed by the polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, or at least 520 amino acids of SEQ ID NO: 22; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 22; or (iii) SEQ ID NO: 22 Includes:
[0092] In a preferred embodiment of the present invention, the polynucleotide sequence of the DNA binding protein is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, or at least 1500 nucleotides of SEQ ID NO: 23; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 23; or (iii) SEQ ID NO: 23 Includes:
[0093] The sequence variants retain the ability to function as DNA-binding proteins when expressed. Suitable assays for determining DNA-binding protein activity are known to those skilled in the art and include an increase in the total yield of linear DNA, as measured by ultraviolet spectrophotometry, agarose gel electrophoresis, or quantitative PCR, indicating that functional E2A contributes to plasmid replication. Additionally, electrophoretic mobility shift assays can be used to detect terminal proteins bound to DNA.
[0094] Two host transcription factors (NFI and Oct-1) are involved in enhancing the initiation of DNA replication (Hoeben & Uil, 2013), but are not required on plasmids. The inverted terminal repeats, which contain the origin of replication, are included. The DNA replication mechanism is similar to that of Phi29-group bacteriophages. DNA-binding proteins bind to double-stranded DNA and unwind it by multimerization. pTP is covalently linked to the 5' phosphate, and adenovirus polymerase initiates DNA replication by adding dCMP (deoxycytidine monophosphate) to the hydroxyl group of Ser580 of pTP (except for chicken adenovirus A, which incorporates dGMP). Initiation most frequently occurs at the fourth nucleotide of the template, which begins with a trinucleotide repeat (GTAGTA). Therefore, once the third nucleotide is added to the new DNA strand, the pTP-CAT complex jumps back to the initiation site, ensuring that no information is lost. Adenoviral polymerase and DNA-binding proteins then act to replicate the sequence, creating two linear plasmids (each with a pTP ligated to each end) that can initiate subsequent rounds of replication (Hoeben & Uil, 2013).
[0095] In further embodiments of the present invention, the linear replication system included as part of the polynucleotide of the present invention is derived from linear plasmids, genomes or other replicons (e.g., E. coli phage PRD1, Streptococcus pneumoniae bacteriophage Cp-1), linear plasmids of Streptomyces, viruses, archaea, bacteria, fungi, and plants, transposable elements, and mitochondrial DNA (Salas et al., 2016). The replication mechanism of a plasmid using a linear DNA replication system featuring a terminal protein is shown in Figure 3.
[0096] DNA secretion pore A second aspect of the present invention relates to a pore capable of secreting DNA from one eukaryotic cell into an adjacent eukaryotic cell.
[0097] The term "DNA secretion pore" refers to a structure composed of one or more protein subunits that crosses a membrane between two cellular regions or between two cells and can translocate a DNA molecule across a membrane junction.
[0098] Preferably, the polynucleotide sequence of a DNA secretion pore included as part of the polynucleotide of the present invention is TraB from the plasmid pSVH1 of Streptomyces (including S. lividans) and S. venezuelae.
[0099] In a preferred embodiment of the invention, the pore expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, or at least 750 amino acids of SEQ ID NO: 24; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 24; or (ii) SEQ ID NO: 24 Includes:
[0100] In a preferred embodiment of the invention, the polynucleotide sequence of the pore is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1700, at least 1800, at least 1900, at least 2000, at least 2100, at least 2200, or at least 2300 nucleotides of SEQ ID NO: 25; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 25; or (iii) SEQ ID NO: 25 Includes:
[0101] The sequence variants retain the ability to function as DNA secretion pores when expressed. Suitable assays for determining DNA secretion pore activity are known to those skilled in the art and include the introduction of a plasmid encoding a fluorescent marker gene from the donor into the recipient cell line.
[0102] TraB contains a single subunit that assembles as a hexameric pore-forming ATPase, which, similar to the chromosome segregation protein FtsK, translocates DNA by recognizing a specific 8-bp clt repeat sequence (GACCCGGA, SEQ ID NO: 27) present in the plasmid clt locus (Thoma & Muth, 2012).
[0103] In a preferred embodiment of the present invention, the polynucleotide of the present invention comprises a polynucleotide sequence of the clt locus. In a preferred embodiment of the present invention, the polynucleotide sequence of the clt locus comprises SEQ ID NO: 26, or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4, or 5 nucleotides. The sequence variant retains the ability to function as the clt locus. Suitable assays for determining the functionality of the clt locus are known to those skilled in the art, and include electrophoretic mobility shift assays (EMSAs) using DNA sequences with and without the clt locus (only the former are retarded by TraB) (Amado et al. 2019).
[0104] TraB transfers plasmid DNA by conjugation between the tips of Streptomyces hyphae, and proteins encoded by genes of the spd family are involved in the subsequent transmission through the septal septum, but the initial transfer from donor to recipient requires only TraB (Thoma & Muth, 2015 ).
[0105] In one embodiment of the present invention, the DNA-secreting pore is a single-protein DNA transferase, TdtA, from the Thermus genus, including Thermus thermophilus, which actively extrudes DNA from donor cells without the use of specific sequences (Blesa et al. 2017). TdtA does not require specific DNA sequences, such as clt repeats, for secretion.
[0106] In one embodiment of the present invention, the DNA-secreting pore is a single-protein DNA transferase of bacterial or archaeal origin belonging to the FtsK-HerA superfamily, which includes FtsK and SpoIIIE, which recognize 8-bp KOPS and SRS motifs, respectively (Amado et al. 2019).
[0107] In a preferred embodiment of the invention, the pore expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, or at least 560 amino acids of SEQ ID NO: 28; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 28; or (iii) SEQ ID NO: 28 Includes:
[0108] In a preferred embodiment of the invention, the polynucleotide sequence of the pore is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1300, at least 1400, at least 1450, at least 1500, at least 1550, at least 1600, at least 1650, or at least 1700 nucleotides of SEQ ID NO: 29; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 29; or (iii) SEQ ID NO: 29 Includes:
[0109] In one embodiment, the DNA-secreting pore is a type VI secretion system (T4SS) from bacterial genera including Agrobacterium, Bartonella, Brucella, Escherichia, Legionella, Helicobacter, Rickettsia, Salmonella, and Shigella, the Neisseria DNA export system, the Helicobacter pylori ComB system, or the Bordetella pertussis pertussis toxin excretion (Pt1) system (Christie et al., 2014). These multicomponent protein pores do not require specific DNA sequences for secretion.
[0110] Regulation of gene expression in vivo A third aspect of the present invention relates to promoters and other sequences involved in the expression of a polynucleotide sequence contained in a polynucleotide of the present invention in eukaryotic cells. Promoters are binding sites for RNA polymerase and transcription factors and are required for the initiation of mRNA synthesis. It is understood in the art that promoters may be used in their entire wild-type sequence or as truncated derivatives.
[0111] In a preferred embodiment of the invention, the polynucleotide of the invention comprises a promoter sequence that functions in most cells of the target organism: in mammals, these include promoters from human cytomegalovirus (major immediate early promoter human CMV-MIE), Rous sarcoma virus (RSV), simian virus 40 (SV40), long terminal repeat of Moloney murine leukemia virus, elongation factor 1 alpha (EF-1 alpha), cytokeratins 18 and 19 (K18 and K19), amylase (AMY), and rat aquaporin-5 (rAQP5) (Zheng & Baum, 2005).
[0112] Preferably, the promoter sequence contained in the polynucleotide of the present invention will restrict gene expression to a specific organ or tissue, limiting the spread of the polynucleotide of the present invention and restricting its activity to regions where it will be therapeutically beneficial. These tissue-specific promoters regulate genes including human muscle creatine kinase (MCK) (Wang et al., 2008), mammary gland-specific mouse whey acidic protein (WAP) (Ozturk-Winder et al., 2002), or the small breast epithelial mucin gene promoter (SBEM) (Hube et al., 2006), the ciliated cell-specific gene FOXJ1 (hepatocyte nuclear factor-3 / forkhead homolog 4) for the lung (Ostrowski et al., 2003), and the WASp (Wiskott-Aldrich syndrome) proximal promoter for hematopoietic cells (Martin et al., 2005).
[0113] Internal ribosome entry site (IRES) sequences allow translation initiation within a single mRNA transcript, thereby allowing two or more cistrons to be regulated by the same promoter and allowing shorter expression cassettes to be generated. In one embodiment of the present invention, IRES sequences, including those from encephalomyocarditis virus (EMCV) (Al-Allaf et al., 2019) and poliovirus (PV) (Malnouet et al., 2002), may be incorporated into the polynucleotides of the present invention.
[0114] An alternative approach to expressing two or more cistrons from the same promoter is the use of 2A "ribosomal skipping" peptides, including F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2A), and T2A (thosea asigna virus 2A) (Liu et al., 2017). These require the addition of the highly conserved sequence GDVEXNPGP (SEQ ID NO: 30) to the C-terminus of the protein encoded by the upstream gene. After translation, this sequence is retained on the C-terminus of the "upstream" protein, but the final proline is removed, making this the first amino acid of the "downstream" protein. The 2A peptide can be separated from the upstream protein by a short linker sequence, such as GSG, to increase skipping frequency (Szymczak-Workman et al., 2012). In one embodiment of the invention, the polynucleotides of the invention include one or more polynucleotides encoding a 2A "ribosome skipping" peptide.
[0115] It is known in the art that the incorporation of a polyadenylation signal (poly(A)) sequence containing the central sequence motif AAUAAA increases the steady-state level of mRNA expressed from a gene in eukaryotic cells (Proudfoot, 2011), thus increasing the expression level of recombinant proteins. The poly(A) sequence is located downstream of the cistron and can include sequences derived from late simian virus 40 (SV40), human or bovine growth hormone gene (hGH or bGH), and human or rabbit b-globin gene. In one embodiment of the present invention, a polynucleotide of the present invention comprises one or more polyadenylation signal (poly(A)) sequences.
[0116] Selectable marker gene A fourth aspect of the present invention relates to the presence of a selectable marker gene in the polynucleotide of the present invention and a mechanism for the subsequent removal of the selectable marker gene, if this is required.
[0117] It is well established in the art that plasmids require a selectable marker gene for initial selection in bacterial (typically E. coli) host cells and to ensure that cells that have lost the plasmid do not grow in culture to the detriment of plasmid-containing cells. Most commonly, these genes are antibiotic resistance genes, including genes that confer resistance to β-lactam antibiotics (β-lactamase: bla); aminoglycoside antibiotics such as kanamycin or neomycin (kanamycin phosphotransferase: kan, neomycin phosphotransferase: neo); chloramphenicol (chloramphenicol acetyltransferase: cat); and tetracycline (tetracycline efflux pump: tetA). Preferably, the antibiotic resistance gene on the plasmid is kan.
[0118] Alternatives to antibiotic resistance genes are antibiotic-free plasmid selection systems. These include complementation of bacterial host auxotrophy by the presence of functional genes (e.g., dapD) or suppressor tRNAs, toxin-antitoxin systems (e.g., hok / sok and ccdB / ccdA), operator-repressor titration (ORT), and various RNA-based selection systems (Vandermeulen et al., 2011). In one embodiment of the present invention, the polynucleotide of the present invention comprises one or more selectable marker genes as discussed above.
[0119] Preferably, an antibiotic resistance gene is used during plasmid construction and removed after transformation into the final E. coli production strain. This can be achieved using the native XerCD multimer resolution system by flanking the antibiotic resistance gene with XerC and XerD recognition sequences (cer, psi, or dif) and allowing the XerCD recombinase to excise the intervening gene by site-specific recombination. An "X-mark" technique is used on a circular plasmid, whereby the antibiotic resistance gene is flanked by cer or psi sites and adjacent binding sites for the accessory proteins PepA and ArgR / ArcA; when cultured in pepA mutant E. coli, the antibiotic resistance gene is retained but is excised when transformed into any E. coli strain containing a functional pepA (Cranenburgh & Leckenby, 2010). The "Xer-cise" technique is used on a circular plasmid containing telRL, which will be converted to a linear plasmid by the action of TelN, whereby the antibiotic resistance gene is flanked by dif sites and the Xer recombination event that excises the antibiotic resistance gene occurs only when the plasmid achieves a linear conformation (Bloor & Cranenburgh, 2006). In one embodiment of the invention, a polynucleotide of the invention comprises one or more antibiotic resistance genes as discussed above.
[0120] Control of protein function duration and intracellular DNA movement A fifth aspect of the present invention relates to a mechanism for limiting the duration of replication and gene expression to enhance the biological safety of the polynucleotides of the present invention and potentially to remove terminal proteins if they block DNA secretion through intermembrane pores.
[0121] To limit the intracellular residence time of proteins expressed from polynucleotides of the present invention, the half-life of components such as RepA, TelN, TdtA, or TraB can be shortened to allow only a limited number of replication cycles, thereby achieving therapeutic effects and allowing the polynucleotides of the present invention to be transferred to neighboring cells. To limit the half-life of a component protein, the protein can be fused to a peptide sequence that targets it for degradation. These include a proteolysis regulatory region and a destabilization domain (DD). The proteolysis regulatory region binds directly to ubiquitin ligase or the proteasome, targeting the fusion protein to the ubiquitin-proteasome system (UPS) (Wu et al., 2020). The destabilization domain can be an N- or C-terminal fusion, and when expressed in mammalian cells, it can rapidly degrade the fusion protein through an unidentified quality control pathway unless a ligand that prevents degradation is shared. One example of a destabilization domain sequence is derived from rapamycin-binding protein (FKBP12), which has a ligand including Shld1 (Wu et al., 2020). In one embodiment of the invention, the polynucleotides of the invention comprise one or more polynucleotide sequences that, when expressed, act to limit the half-life of a protein such as RepA, TelN, TdtA, or TraB.
[0122] In applications where CRISPR-Cas9 technology is used for gene editing (see below), the polynucleotides of the invention are self-limiting, as the Cas9 RNA-guided nuclease cleaves and thus inactivates the polynucleotides of the invention within the nucleus; in applications not featuring gene editing, a polynucleotide sequence encoding a plasmid-targeted Cas9 may be included within the polynucleotides of the invention as an additional safety feature.
[0123] The polynucleotides of the present invention may contain a transgene sequence, also known as a payload sequence. The payload sequence may be a therapeutic gene, a polynucleotide sequence that exerts a therapeutic effect on a eukaryotic cell, or a sequence encoding a protein that exerts a therapeutic effect on a eukaryotic cell. Examples of payload sequences are provided in the following aspects of the present invention. For example, the payload sequence may be a therapeutic gene, a CRISPR RNA-guided nuclease (optionally including CRISPR donor DNA), a zinc finger nuclease or TALEN, an antigen gene, a gene encoding an immunogenic protein or a protein derived from a pathogen or tumor, an antibacterial, antifungal, or antiviral compound, an antibody, a chimeric antigen receptor, a T cell receptor, or a B cell receptor.
[0124] Gene editing A sixth aspect of the invention relates to gene editing to replace a mutated copy of a chromosomal gene that causes a genetic disease, indicates an elevated risk of cancer, or is involved in cancer, with a correctly functioning copy of that gene; alternatively, a chromosomal gene is mutated or excised where inactivation of the chromosomal gene will have the desired effect.
[0125] Gene editing involves cutting specific gene sequences within the genome to inactivate the gene or allow for the insertion of foreign genes, and the break is repaired by homology-directed repair (HDR) or non-homologous end joining (NHEJ). Synthetic nucleases, including restriction enzymes such as FokI fused to modular DNA recognition protein subunits, such as zinc fingers (to create zinc finger nucleases: ZFNs), transcription activator-like effector proteins (TALEs) from Xanthomonas (to create TAL nucleases: TALENS) (Adli, 2018), or members of the Obligate Mobile Element Guided Activity (OMEGA) RNA-guided nuclease family, e.g., TnpB (Nety et al., 2023), or Fanzor (Fz) proteins encoded by eukaryotic transposons (Saito et al., 2023), or artificial peptide genome editing tools (ApGet) (GB Patent No. 2114453.0), can be used for gene editing in the polynucleotides of the invention. Preferably, gene editing is performed using components of the CRISPR (clustered regularly interspaced short palindromic repeats) bacterial immune system, which uses an RNA-guided nuclease such as Cas9 (SpCas9) from Streptococcus pyogenes to introduce specific double-stranded breaks in the target host genome. In one embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding a gene-editing protein or proteins, for example an RNA-guided nuclease such as Cas9.
[0126] CRISPR-associated RNA-guided nucleases, such as Cas9 or a functional equivalent of Cas9, e.g., Cas13 or CPf1, or a variant thereof, can be derived from prokaryotic cells, including bacteria of the genera Acidaminococcus, Campylobacter, Francisella, Lachnospiraceae, Neisseria, Staphylococcus, and Streptococcus (Adli, 2018). In one embodiment of the present invention, the nuclease used is MAD7 nuclease, a type V CRISPR nuclease isolated from Eubacterium rectale. In gene editing applications, wild-type CRISPR nucleases, such as Cas9, can introduce undesired mutations at off-target sites that share homology with the desired target sequence.
[0127] Preferably, Cas9 with an altered amino acid sequence, such as SpCas9-HF1 (Kleinstiver et al., 2016) or eSpCas9 (Slaymaker et al., 2016), will be used to reduce or eliminate off-target effects. Inclusion of a nuclear localization signal (NLS) at the N- or C-terminus, such as the SV40 large T antigen nuclear localization signal (NLS), can enhance gene editing efficiency (Hu et al., 2018).
[0128] Cas9 requires a CRISPR RNA (crRNA) that recognizes a complementary DNA target sequence flanked by a protospacer adjacent motif (PAM, consensus sequence: NGG) and a transactivating CRISPR RNA (tracrRNA) that binds to Cas9, which are combined as a single guide RNA (sgRNA) for gene editing applications (Jinek et al., 2013). The sgRNA sequence can be expressed from a mammalian promoter that initiates transcription from RNA polymerase III, including the U6, H1, and 7SK promoters (Yin et al., 2020). In one embodiment of the present invention, the polynucleotide comprises a polynucleotide sequence encoding an RNA-guided nuclease, such as SpCas9-HF1 or eSpCas9. In one embodiment of the present invention, the polynucleotide of the present invention comprises one or more polynucleotide sequences encoding sgRNAs.
[0129] The polynucleotides of the present invention can be used to replace mutated genes by gene editing in gene therapy and cancer therapy applications in humans and other animals, including embryos. The wild-type or cDNA cistron of a defective gene is contained on the polynucleotide of the present invention, flanked on each side by approximately 1 kb of homologous targeting sequences, which in turn are flanked by complementary sites for a pair of sgRNAs that also flank the target site in the chromosome. The target site may be a defective gene, the removal of which may be particularly beneficial, or an intergenic region. When the polynucleotide of the present invention enters a cell, it is first transported across the nuclear membrane into the nucleus, where it undergoes transcription of the gene, and the resulting mRNA is then exported back across the nuclear membrane into the cytoplasm for translation. The Cas9 protein then enters the nucleus, binds to the sgRNA, and cleaves the polynucleotide and the chromosome, releasing the donor DNA and the defective gene, respectively. The donor DNA is incorporated into the chromosomal break by homologous recombination repair or possibly non-homologous end joining.
[0130] In vivo gene expression The seventh aspect of the present invention relates to the expression of therapeutic genes without the need for chromosomal gene editing. In this application, therapeutic genes are expressed in target cells, resulting in the sustained production of therapeutic proteins. This can be achieved by using a single polynucleotide or plasmid of the present invention, or by carrying functional genes encoding DNA replication proteins and pores on a first polynucleotide of the present invention, which is degraded after a certain period of time, for example by Cas9 or another endonuclease, leaving a second polynucleotide that expresses the therapeutic gene but cannot move to other cells in the absence of the first plasmid. Thus, the polynucleotides of the present invention can be used to treat genetic diseases and cancers. In one embodiment of the present invention, the polynucleotides of the present invention can be used to treat genetic diseases and cancers caused by inactivating coding mutations or as DNA vaccines.
[0131] Genetic mutations that cause genetic diseases Candidate genetic disease targets (and mutated genes) include color vision disorders (genes encoding components of the cone phototransduction cascade: CNGA3, CNGB3, GNAT2, PDE6C, PDE6H; activating transcription factor 6: ATF6); alpha-1-antitrypsin deficiency (serine protein inhibitor A1: SERPINA1); Angelman syndrome (ubiquitin ligase; UBE3A); aromatic L-amino acid decarboxylase (AADC) deficiency (dopa decarboxylase: DDC); Batten disease (neuronal ceroid lipofuscinosis) (PPT1, TPP1, CLN3, D Genes including NAJC5, CLN5, CLN6, MFSD8, CLN8, CTSD, GRN, ATP13A2, CTSF, and KCTD7; beta-thalassemia (beta-globin: HBB); Charcot-Marie-Tooth disease type 1A (peripheral myelin protein 22: PMP22); total choroidal atrophy (Rab escort protein 1: CHM); Crigler-Najjar syndrome (UDP-glucuronosyltransferase: UGT1A1); cystic fibrosis (cystic fibrosis transmembrane conductance regulator: CFTR); diabetes (insulin: INS); and Duchenne muscular dystrophy. Neuropathy (dystrophin DMD); giant axonal neuropathy (gigaxonin GAN); dysferlinopathy (dysferlin DYSF); glycogen storage disease type 1a (glucose-6-phosphate G6PC); hemophilia A (coagulation factor VIII; FVIII); hemophilia B (coagulation factor IX; FIX); Huntington's disease (HTT); hypercholesterolemia (low-density lipoprotein receptor; LDLR, or apolipoprotein B; APOB); hypophosphatemic rickets (phosphate-regulatory endopeptidase homolog, X-linked; PHEX); Leber's congenital amaurosis (Leber's congenital amaurosis) tinoid isomerohydrolase: RPE65); Leber's hereditary optic neuropathy (NADH dehydrogenase 4: MT-ND4); long-chain fatty acid oxidation disorders (medium-chain acyl-CoA dehydrogenase: ACADM; very long-chain acyl-CoA dehydrogenase: ACADVL; long-chain 3-hydroxyacyl-CoA dehydrogenase: HADHA; carnitine palmitoyltransferase type 1: CPT1A; carnitine-acylcarnitine transferase: SLC25A20; carnitine palmitoyltransferase type 2: CPT2; carnitine transporter: SLC22A5; short-chain acyl-CoA dehydrogenase: ACADS);Multiple acyl-CoA dehydrogenase deficiency: ETFA, ETFB, ETFDH; 3-hydroxyacyl-CoA dehydrogenase: HADH); limb-girdle muscular dystrophy 2E (sarcoglycan genes: SGCB, SGCC, SGCD); Marfan syndrome (fibrillin: FBN1); mucopolysaccharidoses (α-L-iduronidase: IDUA; iduronate sulfatase: IDS; N-sulfoglucosamine sulfohydrolase: SGSH; α-N-acetylglucosaminidase: NAGLU; heparan-α-glucosaminidase N-acetylglucosaminidase: NAGLU) Glucose transferase: HGSNAT; N-acetylglucosamine-6-sulfatase: GNS; galactose-6-sulfate sulfatase: GALNS; β-galactosidase: GLB1; N-acetylgalactosamine-4-sulfatase: ARSB; β-glucuronidase: GUSB; HYAL1: hyaluronidase; myotonia congenita (chloride channel 1: CLCN1); myotonic dystrophy type 1 (myotonic dystrophy protein kinase: DMPK); neurofibromatosis type 1 (neurofibrillar disease) NF1); phenylketonuria (phenylalanine hydroxylase: PAH); ornithine transcarbamylase (OCT) deficiency; polycystin-1, transient receptor potential channel interacting with: PKD1; polycystin-2, transient receptor potential cation channel interacting with: PKD2; Pompe disease (alpha-glucosidase: GAA); retinitis pigmentosa (cellular retinaldehyde-binding protein: RLBP1); Rett syndrome (methyl-CpG binding protein 2: MECP) 2); sickle cell disease (β-globin: HBB); spinal muscular atrophy (survival motor neuron 1: SMN1); Tay-Sachs disease (hexosaminidase A: HEXA); Wiskott-Aldrich syndrome (WASp); X-linked myotubular myopathy (myotubularin 1: MTM1); X-linked retinitis pigmentosa (X-linked retinitis pigmentosa GTPase regulator: RPGR); X-linked retinoschisis (retinoschisin: RS1); X-linked severe combined immunodeficiency (common gamma chain-encoding gene: IL2RG);
[0132] Gene duplications that cause genetic diseases Genetic diseases that can be treated by the polynucleotides of the present invention can include diseases caused by gene duplication or amplification, where treatment involves removing the exogenous copy or copies, or replacing two or more copies with a single copy. One example is the most common form of Charcot-Marie-Tooth disease type 1A (peripheral myelin protein 22: PMP22).
[0133] Genetic modification to eliminate predisposition to infectious diseases There are situations in which removing antigens from host cells can reduce or eliminate susceptibility to infection. The CCR5 receptor is a co-receptor for CD4 to which human immunodeficiency viruses (HIV types 1 and 2) bind to enter helper T cells, leading to acquired immunodeficiency syndrome (AIDS). Mutations in the human CCR5 gene have no known harmful effects, and therefore it can be mutated or deleted using gene editing of hematopoietic stem cells in the bone marrow, where they originate, or in the thymus, where they mature, or modified ex vivo and retransplanted; this can prevent infection by HIV and eliminate HIV from infected individuals (Epah & Schafer, 2021). In one embodiment of the present invention, the polynucleotides of the present invention are used to treat HIV infection.
[0134] Exogenous gene expression can be used to treat loss-of-function diseases Some diseases are not caused by mutated genes, but by the loss of function of a gene or group of genes through cell death due to aging or abnormal immune responses. These diseases can be treated by introducing functional genes, either episomally present or chromosomally inserted, with the polynucleotides of the present invention. Such diseases include Parkinson's disease (artemin; ARTN; dopa decarboxylase (DDC); glial cell line-derived neurotrophic factor; GDNF; neurturin; NRTN; persephin (PSPN)); wet age-related macular degeneration (anti-vascular endothelial growth factor proteins and antibodies).
[0135] Genetic mutations that predispose to and actively cause cancer Candidate gene targets that, when mutated, lead to cancer include those encoding the DNA repair enzymes BRCA1, BRCA2 (breast and ovarian cancer) and TP53 (multiple cancers).
[0136] Other potential targets include genes that regulate cell growth or division and therefore become oncogenes when mutated, such as ACRV2A (activin receptor type 2A); APC (adenomatous polyposis coli); ATRX (X-linked alpha thalassemia / mental retardation syndrome); CDKN2A (cyclin-dependent kinase inhibitor 2A); CTNNB1 (beta-catenin 1); DAXX (death domain-associated protein); EGFR (epidermal growth factor receptor); FBXW7 (F-box with seven tandem WD40s); MEN1 (multiple endocrine neoplasia) These include: type 1 diabetes; PCBP1 (poly C-binding protein 1); PIK3CA (phosphoinositide 3-kinase); PTEN (phosphatase and tensin homolog); RAS gene family (HRAS, NRAS, and KRAS); RB1 (RB transcriptional corepressor 1); SMAD2, SMAD3, and SMAD4; SOX (sex-determining region Y-box) gene family (including SOX2 and SOX9); TCF7L2 (transcription factor 7L2); and ZFP36L2 (ZFP36 ring finger protein-like 2) (Gerstung et al., 2020).
[0137] Other potential targets include B2M (beta2-microglobulin), a gene that, when mutated, allows tumor growth through immune evasion.
[0138] Other candidate targets include genes such as HER2 (human epidermal growth factor receptor 2) and TERT (telomerase converting transcriptase), which allow tumor growth when the gene is present in extra copies, for example, by genetic recombination or amplification. In one embodiment of the invention, the polynucleotide of the invention comprises a gene as set forth above. In one embodiment of the invention, the polynucleotide of the invention is used to treat cancer.
[0139] immunotherapy An eighth aspect of the present invention applies to immunotherapy via genetic modification of T and B cell progenitor cells, whereby the resulting T cells express receptors that enable them to target antigens on pathogens or cancer cells, and the resulting B cells produce antibodies that target antigens on pathogens or cancer cells. The present invention enables this approach by its ability to modify the majority of cells in the target tissue. Progenitor cells can be modified in the bone marrow, where they originate, or, in the case of T cells, in the thymus, where they mature; alternatively, they can be modified ex vivo and retransplanted. This hematopoietic stem and progenitor cell (HSPC) gene therapy approach can be achieved by gene editing or gene expression (Epah & Schafer, 2021). In principle, all tumor-associated and pathogen-specific antigens listed below (under "DNA Vaccines") can be targeted using modified T and B cells resulting from modification of HSPCs with polynucleotides of the present invention.
[0140] DNA vaccines In a ninth aspect of the present invention, an immunological protein or proteins derived from a pathogen or cancer cell are expressed in antigen-presenting cells of a host to prime the immune system as a DNA vaccine to target the pathogen or cancer cell. This invention allows significantly more antigen-presenting cells to express the antigen than current DNA vaccine delivery methods, and uses less DNA, which may improve tolerance at the injection site. The tumor-associated antigen sequence to be comprised in the polynucleotide of the present invention may be selected from cancer cells carrying any of the mutations described above, and may include, but is not limited to, AFP: alpha (α)-fetal protein; AIM-2: interferon-inducible protein 2 absent in melanoma; ALL: acute lymphoblastic leukemia; AML: acute myeloid leukemia; 707-AP: 707 alanine proline; APL: acute promyelocytic leukemia; ART-4: adenocarcinoma antigen 4 recognized by T cells; BAGE: B antigen; bcr-abl: breakpoint cluster region Abelson; CAMEL: antigen recognized by cytotoxic T lymphocytes on malignant melanoma; CAP-1: carcinoembryonic antigen peptide-1; CASP-8: caspase 8; CDC27: cell division cycle 27; CDK4: cyclin-dependent kinase 4; CEA: carcinoembryonic antigen; CLCA2: calcium-activated chloride channel 2; CML: chronic myeloid leukemia Disease; CT: cancer testis (antigen); CTL: cytotoxic T lymphocyte; Cyp-B: cyclophilin B; DAM: malignant melanoma differentiation antigen (the epitopes of DAM-6 and DAM-10 are equivalent but have different gene sequences. DAM-6 is also known as MAGE-B2, and DAM-10 is also known as MAGE-B1); ELF2: elongation factor 2; Ep-CAM: epithelial cell adhesion molecule; EphA2, 3: type A ephrin receptor 2, 3; Ets: E-26 transformation-specific (transcription factor family); ETV6-AML1: Ets mutated gene 6 / acute myeloid leukemia 1 gene ETS; FGF-5: fibroblast growth factor type 5; FN: fibronectin; G250: glycoprotein 250; GAGE: G antigen; GnT-V: N-acetylglucosaminyltransferase V; Gp100: glycoprotein 100 kDa; HAGE: helicase antigen; HER-2 / neu: human epithelial receptor type 2 / neu; HLA-A*0201-R170I;Arginine (R) to isoleucine (I) exchange at residue 170 of the α-helix of the α2-domain in the HLA-A2 gene; H / N: head and neck; HSP70-2M: heat shock protein 70-2 mutant; HST-2: human signet ring tumor 2; hTERT: human telomerase reverse transcriptase; iCE: intestinal carboxylesterase; IL-13Rα2: interleukin-13 receptor α2 chain; KIAA0205; LAGE: L antigen; LDLR / FUT: low-density lipid receptor / GDP-L-fucose: β-D-galactosidase 2-α-L-fucosyltran Spherase; MAGE: melanoma antigen; MART-1 / Melan-A: melanoma antigen recognized by T cell-1 / melanoma antigen A; MART-2: melanoma antigen recognized by T cell-2; MC1R: melanocortin 1 receptor; M-CSF: macrophage colony-stimulating factor gene; MHC: major histocompatibility complex; MSI: microsatellite instability; MUC1, 2: mucin 1, 2; MUM-1, -2, -3: melanoma ubiquitous mutation type 1, 2, 3; NA88-A: neuraminidase cDNA clone from patient M88; Neo- PAP; Neo-poly(A) polymerase; NPM / ALK: nucleophosmin / anaplastic lymphoma kinase fusion protein; NSCLC: non-small cell lung cancer; NY-ES0-1: New York esophagus 1; OA1: ocular albinism type 1 protein; OGT: O-linked N-acetylglucosaminyltransferase gene; OS-9; P15: protein 15; p190 minor bcr-abl; 190 kDa bcr-abl protein; Pml / RARα: promyelocytic leukemia / retinoic acid receptor α; PRAME; melanoma preferentially expressed antigen; PSA: prostate-specific antigen; P SMA: prostate-specific membrane antigen; PTPRK: receptor protein-tyrosine phosphatase kappa; RAGE: renal antigen; RCC: renal cell carcinoma; RU1, 2: renal ubiquitous 1, 2; SAGE: sarcoma antigen; SART-1, -2, -3: tumor rejection ubiquitous antigens 1, 2, 3; SCC: ubiquitous cell carcinoma; SSX-2: synovial sarcoma, X breakpoint 2; survivin-2B: intron 2-retaining survivin; SYT / SSX: synaptotagmin I / synovial sarcoma, X fusion protein; TAA: tumor-associated antigen; TEL / AML1: translocation Ets family leukemia / acute myeloid leukemia type 1;TGFβRII: transforming growth factor beta receptor 2; TPI: triosephosphate isomerase; TRAG-3: taxol resistance-associated protein 3; TRG: testin-related gene; TRP-1: tyrosinase-related protein 1, or gp75; TRP-2: tyrosinase-related protein 2; TRP-2 / INT2: TRP-2 / intron 2; TRP-2 / 6b: TRP-2 / novel exon 6b; TSTA: tumor-specific transplantation antigen; WT1: Wilms tumor gene (Novellino et al., 2004).
[0141] Antigens may be derived from viruses, bacteria, fungi, or eukaryotic parasites, such as Acinetobacter baumannii; Actinomyces israeli, Actinomyces gerencseriae, and Propionibacterium propionicus; Trypanosoma brucei; HIV (human immunodeficiency virus); Entamoeba histolytica; Anaplasma; Angiostrongylus; Anisakis; Bacillus anthracis; Arcanobacterium haemolyticum; Junin virus; Ascaris lumbricoides; Aspergillus spp.; Astrovirus spp.; Babesia spp.; Bacillus cereus; Bacteroides spp.; Balantidium coli; Bartonella; Baylisascaris spp.; BK virus; Piedraia hortae; Blastocystis spp.; Blastomyces dermatitidis; Machupo virus; Clostridium botulinum (botulinum toxin); Sabia virus; Brucella spp.; Yersinia pestis; Burkholderia cepacia cepacia); Burkholderia spp.; Mycobacterium ulcerans; Caliciviridae spp.; Campylobacter spp.; Candida albicans; and other Candida spp.Enteric disease due to Capillaria philippinensis; liver disease due to Capillaria hepatica and pulmonary disease due to Capillaria aerophila; Bartonella bacilliformis; Bartonella henselae; Group A streptococci and staphylococci; Trypanosoma cruzi; Haemophilus ducreyi; Varicella-zoster virus (VZV); Alphaviruses; Chlamydia trachomatis; Chlamydophila pneumoniae; Vibrio cholerae; Fonsecaea pedrosoi; Batrachochytrium dendrabatidis; Clonorchis sinensis; Clostridium difficile; Coccidioides immitis and Coccidioides posadasii; Colorado tick fever virus (CTFV); rhinoviruses and coronaviruses; severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2); Crimean-Congo hemorrhagic fever virus; Cryptococcus neoformans; Clostridium spp.; Ancylostoma braziliense; Cyclospora cayetanensis; Taenia solium solium; cytomegalovirus; dengue virus (DEN-1, DEN-2, DEN-3 and DEN-4); flavivirus; Desmodesmus armatus; Dientamoeba fragilis; Corynebacterium diphtheriae;Diphyllobothrium tapeworm (Diphyllobothrium); Dracunculus medinensis; Ebola virus (EBOV); Echinococcus spp.; Ehrlichia spp.; Enterobius vermicularis (pinworm); Enterococcus spp.; Enterovirus spp.; Rickettsia prowazekii (Typhus typhus); Parvovirus B19; Human herpesvirus type 6 (HHV-6) and human herpesvirus type 7 (HHV-7); Fasciola hepatica (Fasciola hepatica) and Fasciola gigantica (Fasciolopsis buski); Filarioidea superfamily; Clostridium perfringens (Clostridium perfringens); Fusobacterium spp.; Clostridium perfringens (Clostridium perfringens) perfringens; Clostridium spp.; Geotrichum candidum; Giardia lamblia; Burkholderia mallei; Gnathostoma spinigerum and Gnathostoma hispidum; Neisseria gonorrhoeae; Klebsiella granulomatis; Streptococcus pyogenes; Streptococcus agalactiae; Haemophilus influenzae influenzae); enteroviruses, Coxsackie A viruses, and enterovirus type 71 (EV71); Sin Nombre virus; Heartland virus; Helicobacter pylori; Escherichia coli, enterotoxigenic E. coli, O157:H7, O111, and O104:H4; Bunyaviridae; Hendra virus; hepatitis A virus; hepatitis B virus; hepatitis C virus; hepatitis D virus; hepatitis E virus; herpes simplex virus types 1 and 2 (HSV-1 and HSV-2);Histoplasma capsulatum; Ancylostoma duodenale and Necator americanus; human bocavirus (HBoV); Ehrlichia ewingii; Anaplasma phagocytophilum; human metapneumovirus (hMPV); Ehrlichia chaffeensis; human papillomavirus; human parainfluenza virus (HPIV); Hymenolepis nana and Hymenolepis diminuta; Epstein-Barr virus (EBV); orthomyxovirus; Isospora belli; Kingella kingae; Lassa virus; Legionella pneumophila pneumophila; Leishmania spp.; Mycobacterium leprae and Mycobacterium lepromatosis; Restospira spp.; Listeria monocytogenes; Borrelia burgdorferi; Borrelia garinii and Borrelia afzelii; Wuchereria bancrofti and Brugia malayi; Lymphocytic choriomeningitis virus (LCMV); Plasmodium spp.; Marburg virus; Measles virus; Middle East respiratory syndrome (MERS) coronavirus; Burkholderia pseudomallei; Neisseria meningitidis; Metagonimus yokagawai); Microsporidia phylum; Molluscum contagiosum virus (MCV); Monkeypox virus; Mumps virus;Rickettsia typhi; Mycoplasma pneumoniae; Mycoplasma genitalium; Chlamydia trachomatis; Neisseria gonorrhoeae; Nipah virus; Norovirus; Nocardia asteroides and Nocardia spp.; Onchocerca volvulus; Opisthorchis viverrini and Opisthorchis felineus; Paracoccidioides brasiliensis; Paragonimus westermani and other Paragonimus spp.; Pasteurella spp.; Pediculus head lice humanus capitis; body louse (Pediculus humanus corporis); pubic louse (Pthirus pubis); Bordetella pertussis; Yersinia pestis; Streptococcus pneumoniae; Pneumocystis jirovecii; poliovirus; Prevotella spp.; Naegleria fowleri; JC virus; Chlamydophila psittaci; Coxiella burnetii; rabies virus; Borrelia hermsii, Borrelia recurrentis, Borrelia spp.; respiratory syncytial virus (RSV); Rhinosporidium sayberi seeberi); rhinovirus; Rickettsia; Rickettsia akari; Rift Valley fever virus; Rocky Mountain spotted fever (Rickettsia rickettsii); rotavirus;Rubella virus; Salmonella spp.; Severe acute respiratory syndrome (SARS) coronavirus; Sarcoptes scabiei; Group A Streptococcus spp.; Schistosoma spp.; Shigella spp.; Varicella-zoster virus (VZV); Variola major or minor; Sporothrix schenckii; Staphylococcus spp.; Strongyloides stercoralis; Measles virus; Treponema pallidum; Taenia spp.; Clostridium tetani; Trichophyton spp.; Trichophyton tonsurans; Trichophyton spp.; Epidermophyton floccosum floccosum, Trichophyton rubrum, and Trichophyton mentagrophytes; Trichophyton rubrum; Hortaea werneckii; Malassezia spp.; Streptococcus pyogenes; Toxocara canis, Toxocara cati; Toxoplasma gondii; Trichinella spiralis; Trichomonas vaginalis; Trichuris trichiura; Mycobacterium tuberculosis; Francisella tularensis; Salmonella enterica serovar Typhi Typhi, Paratyphi, and Typhimurium; Ureaplasma urealyticum; Coccidioides immitis, Coccidioides posadasii; Venezuelan equine encephalitis virus; Guanarito virus;May be derived from Vibrio vulnificus, Vibrio parahaemolyticus, West Nile virus, Trichosporon beigelii, Yersinia pseudotuberculosis, Yersinia enterocolitica, yellow fever virus, Zeaspora fungus, and Zika virus.
[0142] To enhance the level of immune response, the antigen or antigen gene on the DNA vaccine polypeptide of the present invention may be coexpressed or fused with an immunogenic protein that acts as an adjuvant. Examples of such proteins include lethal toxin subunit B (LT-B) from pathogenic E. coli strains, Vibrio cholerae toxin subunit B (CT-B), and Clostridium tetani tetanus toxin (convulsion toxin); these may contain mutations that reduce toxicity. Alternatively, the DNA vaccine plasmid may be coadministered with one of these adjuvants, or with adjuvants including aluminum-based mineral salts (aluminum phosphate, aluminum hydroxide); calcium phosphate; MF59 (oil-in-water emulsion of less than 1 μm); and monophosphoryl lipid A (MPL: AS03, AS04).
[0143] RNA therapy In other aspects, the present invention is designed to express RNA and achieve a therapeutic effect by translating the RNA into protein or by functioning as a CRISPR guide RNA. In a tenth aspect of the present invention, the expressed RNA itself is the therapeutic product. The encoded RNA can be a single-stranded antisense RNA, including an antisense oligonucleotide (ASO), or a double-stranded small interfering RNA (siRNA), designed to alter the expression of a host chromosomal gene to achieve a desired therapeutic effect (Zhu et al., 2022). Antisense RNA binds to target mRNA through Watson-Crick base pairing and can downregulate expression by reducing or preventing translation through steric inhibition or induce exon skipping. Exon skipping converts out-of-frame mutations to in-frame mutations and is used in therapeutic applications, such as in a few cases of Duchenne muscular dystrophy (Aartsma-Rus et al., 2007).
[0144] Therapeutic effects can be achieved by degrading host mRNAs through RNA interference (RNAi) using small interfering RNAs or hairpin microRNAs (miRNAs). The miRNAs are first sequentially processed by the RNase III enzymes DICER1 and DROSHA to generate double-stranded RNA analogs of the small interfering RNAs. The mechanism of action is mediated by the Argonaute 2 protein (AGO2, part of the RNA-induced silencing complex RISC), whereby the double-stranded siRNA associates with AGO2, removing one strand (the passenger strand), and the remaining antisense guide strand directs the RISC complex to the corresponding mRNA target, which is then cleaved by AGO2 (Roberts et al., 2020).
[0145] Although antisense oligonucleotides and small interfering RNAs are typically chemically modified, often by the introduction of phosphorothioate (PS) linkages instead of phosphodiester bonds, to reduce their degradation by ribonucleases (Roberts et al., 2020), the nuclear location of the Gentrafix plasmid and its ability to sustainably express RNA may allow unmodified RNA to produce a therapeutic effect.
[0146] Recombinant protein production It is known in the art that cell lines derived from multicellular eukaryotic cells can be used to produce recombinant proteins in vitro by transfection with plasmids carrying a protein-encoding gene or genes—this represents an eleventh aspect of the present invention. Classes of recombinant proteins include antibodies, antibody fragments, antigens, enzymes, and hormones. Mammalian cell lines commonly used for recombinant protein production include rodent-derived cell lines: CHO (Chinese hamster ovary cells) and NS0 (mouse myeloma cells), and human-derived cell lines: HEK (human embryonic kidney cells), PER.C6 (human retinoblastoma cells), and CAP-T (primary human amniotic cells) (Bandaranayake and Almo, 2014). Transfection of adherent cell lines with DNA typically requires a high DNA:cell ratio, and frequently the transgene is not expressed in the majority of cells in culture. The present invention modifies the majority of cells, which will result in higher yields of recombinant protein (transient gene expression) within the transfected cell pool and more cells expressing at high levels for subsequent clonal selection.
[0147] Genetic strain modification and gene drive In a further embodiment of the present invention, the polynucleotides of the present invention are designed to modify the germline cells of an animal by modifying sperm-producing cells (spermatogonia) or oocytes, thereby expressing the components of the polynucleotides of the present invention using constitutive or tissue-specific promoters. This may be used to co-express a gene or genes encoding a therapeutic compound. Alternatively, gene editing functions (e.g., CRISPR) may be expressed, which will allow the modifications to be passed on to the offspring of the gene-edited animal. This can be used to correct gene mutations, preventing them from being transmitted to offspring or introducing beneficial traits.
[0148] Another aspect of germline modification is the introduction of a "gene drive" gene cassette, which will be transmitted to most, and possibly all, offspring (Wedell et al., 2019). Gene drives can be based on naturally occurring selfish genetic elements, such as transmission distortion factors, that are targeted to gametogenesis and thereby become overrepresented in eggs or sperm. Alternatively, synthetic meiotic drivers based on CRISPR-mediated gene editing are used to copy the gene drive onto homologous chromosomes, allowing it to be rapidly transmitted to the resulting population. These can be used to control disease vectors, such as mosquitoes, or invasive mammals that adversely affect natural populations, for example, by skewing the sex ratio to produce only males. This can be achieved in rodent populations by relocating the Sry sex-determining gene from the X chromosome to an autosome.
[0149] Pharmaceutical Composition In a further aspect of the invention, there is provided a pharmaceutical composition comprising a polynucleotide of the invention, or a plasmid embodiment of a polynucleotide of the invention, and a pharmaceutically acceptable excipient.
[0150] Pharmaceutically acceptable excipients may include carriers, diluents, and / or other medicinal substances, pharmaceutical agents, or adjuvants, etc. Optionally, the pharmaceutically acceptable excipient includes a saline solution. Optionally, the pharmaceutically acceptable excipient includes human serum albumin.
[0151] A typical "pharmaceutically acceptable excipient" includes any carrier that does not itself induce adverse reactions in the individual receiving the composition. Pharmaceutically acceptable excipients can also include diluents, such as water, saline, glycerol, and the like. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. Typical pharmaceutical excipients can include one or more of Tris buffer, histidine, sodium chloride, and sodium phosphate.
[0152] Treatment The present invention further provides a polynucleotide of the invention, or a plasmid embodiment of a polynucleotide of the invention, or a pharmaceutical composition of the invention, for use in a method of / method of treating a disease. Optionally, the method of treatment comprises administering to a patient an effective amount of a polynucleotide of the invention, or a plasmid embodiment of a polynucleotide of the invention, or a pharmaceutical composition of the invention.
[0153] The present invention further provides a method of treatment comprising the step of administering to a patient an effective amount of a polynucleotide of the present invention, or a plasmid embodiment of a polynucleotide of the present invention, or a pharmaceutical composition of the present invention.
[0154] The present invention further provides the use of a polynucleotide of the invention, or a plasmid embodiment of a polynucleotide of the invention, or a pharmaceutical composition of the invention, in the manufacture of a medicament for use in a method of treating / method of treating a disease. For the avoidance of doubt, the terms "method of treatment" and "method of treating a disease" are used synonymously herein. Optionally, the method of treating / method of treating a disease comprises administering to a patient an effective amount of a composition or polynucleotide of the invention, or a plasmid embodiment of a polynucleotide of the invention.
[0155] The term "treating" includes both therapeutic treatment and prophylactic or preventative treatment, where the objective is to prevent or alleviate infection. For example, treatment can include directly affecting or curing, suppressing, inhibiting, preventing, reducing the severity of, delaying the onset of, or reducing the symptoms associated with, e.g., an infection, or a combination thereof. "Preventing" can refer, inter alia, to delaying the onset of symptoms, preventing the recurrence of disease, and the like. "Treating" can also include "suppressing" or "inhibiting" an infection or disease, e.g., reducing the severity, number, frequency of occurrence, or latency of symptoms, relieving symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, or a combination thereof.
[0156] A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result, such as increasing the level of the transgene in a subject (such that a functional transgene is produced at a level sufficient to alleviate symptoms of a disease or disorder).
[0157] In a preferred embodiment of the present invention, the diseases and disorders to be treated are those discussed herein.
[0158] Administration In preferred embodiments of the invention, a polynucleotide of the invention, or a plasmid embodiment of a polynucleotide of the invention, or a pharmaceutical composition of the invention, is administered to a patient in need thereof by injection, microinjection, inhalation, jet injection, oral ingestion, liposome-, lipid nanoparticle-, virus-, virus-like particle-, or microcarrier-mediated delivery.
[0159] Manufacturing method In a further aspect of the invention, there is provided a host cell comprising a polynucleotide of the invention or a plasmid embodiment of a polynucleotide of the invention. Suitable host cells, such as Escherichia coli, are described herein. In a preferred embodiment of the invention, the E. coli cell expresses the genes repA, telN, sopA, and sopB from bacteriophage N15.
[0160] In a preferred embodiment of the invention, the SopA expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, at least 350, or at least 375 amino acids of SEQ ID NO:6; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:6; or (iii) SEQ ID NO: 6 Includes:
[0161] In a preferred embodiment of the invention, the sopA polynucleotide sequence is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 1100 nucleotides of SEQ ID NO: 7; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:7; or (iii) SEQ ID NO: 7 Includes:
[0162] The sequence variants retain the ability to function as SopA proteins when expressed. Suitable assays for determining SopA protein activity are known to those skilled in the art and involve culturing a plasmid-replicating E. coli strain for multiple generations by inoculating flasks of nutrient broth at low density, growing to high density, and repeating over several days. Comparison of daily plasmid preparations from the strains by agarose gel electrophoresis or quantitative PCR will allow detection of any plasmid loss.
[0163] In a preferred embodiment of the invention, the SopB expressed by said polynucleotide sequence is: (i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, or at least 340 amino acids of SEQ ID NO:8; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:8; or (iii) SEQ ID NO: 8 Includes:
[0164] In a preferred embodiment of the invention, the sopB polynucleotide sequence is: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides of SEQ ID NO:9; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:9; or (iii) SEQ ID NO: 9 Includes:
[0165] The sequence variants retain the ability to function as SopB proteins when expressed. Suitable assays for determining SopB protein activity are known to those skilled in the art and involve culturing the plasmid-replicating in vitro strain for multiple generations by inoculating flasks of nutrient broth at low density, growing to high density, and repeating over several days. Comparison of daily plasmid preparations from the strains by agarose gel electrophoresis or quantitative PCR will allow detection of any plasmid loss.
[0166] In a further aspect of the invention, there is provided a method of producing a plasmid embodiment of the invention, comprising culturing a host cell as defined herein, lysing the cell, and purifying the plasmid or plasmids from the cell lysate.
[0167] In a further aspect of the invention there is provided a eukaryotic cell comprising a polynucleotide of the invention or a plasmid embodiment of the invention.
[0168] Example Example 1 Plasmids pBITTdtA (Fig. 5A) and pBITTraB2 (Fig. 5B) were constructed to express pores TdtA and TraB, respectively, to determine whether they are membrane-associated in human cells.
[0169] To generate pBITTdtA, the pBITREPB plasmid (see Example 4) was digested with SpeI and XbaI and ligated with the tdtA cistron flanked by SpeI and XbaI restriction enzyme sites. To generate pBITTraB, the traB cistron was inserted into the SpeI and XbaI sites of the pBITREPB plasmid. pBITTraB2 was then generated by adding a PCR-generated FLAG tag to the 3' end of the traB cistron by ligating BamHI-XbaI into pBITTraB.
[0170] Human embryonic kidney cells (HEK293) were grown to 70-80% confluency on glass coverslips in standard 6-well plates and transfected with 1 μg of pBITTraB2 or pBITTdtA using TurboFect reagent (Life Technologies, UK) according to the manufacturer's protocol. As a negative control, we used the pMCPK plasmid, which expresses mCherry but lacks the pore cistron. After 72 hours, the cells were incubated with 200 μg / ml wheat germ agglutinin (WGA) conjugated to Alexa Fluor 647 (Invitrogen) in DMEM containing 10% fetal bovine serum for 30 minutes at 37°C in 5% carbon dioxide, followed by three washes with phosphate-buffered saline. Next, cells were fixed with 4% paraformaldehyde (PFA; Merck, UK) in phosphate-buffered saline (PBS) for 10 minutes at room temperature and washed three times with PBS. Cells were permeabilized by incubating in 0.05% Triton X-100 in PBST (PBST) for 15 minutes and then blocked in PBST containing 10% fetal bovine serum for 1 hour. Primary antibody: mouse anti-FLAG antibody (Merck, UK) was applied at a dilution of 1:1000 in PBST-10% fetal bovine serum and incubated for 1 hour at ambient temperature. Unbound antibody was removed using three washes with PBST, and secondary antibody (goat anti-mouse Alexa Fluor 488; Abcam, UK) was applied at a dilution of 1:1000 for 1 hour at ambient temperature. Unbound antibody was removed using three washes with PBST (the first containing 0.1 μg / ml DAPI (Life Technologies, UK)), and coverslips were mounted with FluorSave reagent (EMD Millipore, USA), air-dried in the dark, and photographed at 63x magnification.
[0171] The microphotographs in Figure 5 demonstrate the colocalization of FLAG-tagged pore membrane proteins (green, Figure 5C - TdtA and Figure 5D - TraB) with cell membrane staining for wheat germ agglutinin (red).
[0172] Example 2 Experiments were performed to determine whether a plasmid bearing the membrane pore TdtA could transfer plasmid DNA to neighboring cells compared with the control plasmid pMCPK, which lacks the pore (Fig. 10B ).
[0173] HEK293 cells on glass coverslips in 6-well plates were grown with Dulbecco's modified Eagle's medium (DMEM-GlutaMAX; Life Technologies, UK) and 10% fetal bovine serum (FBS; Merck, UK) until they reached 70–80% confluency. Cells were transfected with 1 μg of each mCherry-expressing plasmid DNA: pMCPK (negative control) or pBITTdtA (expressing the TdtA pore). After 24 h, the cells were transfected with 0.5 μg of pdClover2-N1 (Figure 11A) (Addgene, USA), which expresses the green fluorescent protein Clover2. After a further 48 h, the cells were rinsed with PBS buffer and fixed with 4% paraformaldehyde for 10 min. The paraformaldehyde was then removed by washing three times with PBS for 5 min. Cells were then permeabilized with 0.05% Triton X-100 in PBS for 15 minutes and blocked with PBS, 0.05% Triton X-100, and 10% fetal bovine serum for 1 hour. Cells were incubated with 1:1000 rabbit anti-mCherry antibody (Abcam, UK) in 0.05% Triton X-100 and 10% fetal bovine serum in PBS for 1 hour at room temperature, followed by three 10-minute washes with 0.05% Triton X-100 in PBS. Cells were incubated with 1:1000 goat anti-rabbit Alexa Fluor 594 antibody (Abcam, UK) in 0.05% Triton X-100 and 10% fetal bovine serum in PBS (protected from light) for 1 hour. Coverslips were mounted using FluorSave reagent (Merck, UK) and air-dried in the dark.
[0174] The total number of cells expressing both mCherry and Clover2 was recorded, and these were equivalent at approximately 25% of the total cell number for the two mCherry plasmids, indicating equivalent transfection efficiency (Figure 6A). The number of Clover2 cells (green) adjacent to the double-fluorescent cells was then recorded, and these were statistically significantly (T-test p = 0.049) in excess for pBITTdtA compared to pMCPK. This indicates secretion of pdClover2-N1 from cells containing pBITTdtA.
[0175] Example 3 Experiments were performed to test the specificity of export through the TraB pore using plasmids with and without the clt locus required for DNA secretion by TraB.
[0176] Plasmid pCMV-Clover2-CLT (Fig. 11B) was constructed by synthesizing the clt locus (SEQ ID NO: 26; Thermo Fisher Scientific, Germany) and cloning it into the single AseI site of pdClover2-N1.
[0177] HEK293 cells on glass coverslips in 6-well plates were grown with Dulbecco's modified Eagle's medium (DMEM-GlutaMAX; Life Technologies, UK) and 10% fetal bovine serum (FBS; Merck, UK) until they reached 70-80% confluency. Cells were first transfected with 1 μg of pBITTraB2, which expresses mCherry and the TraB pore. After 24 h, the cells were transfected with 0.5 μg of a plasmid expressing the green fluorescent protein Clover2 (either the negative control pdClover2-N1 or pCMV-Clover2-CLT, which additionally contains the clt locus). After a further 48 h, the cells were rinsed with PBS buffer and fixed with 4% paraformaldehyde for 10 min. The paraformaldehyde was then removed by washing three times with PBS for 5 min. Cells were then permeabilized with 0.05% Triton X-100 in PBS for 15 minutes and blocked with PBS, 0.05% Triton X-100, and 10% fetal bovine serum for 1 hour. Cells were incubated with 1:1000 rabbit anti-mCherry antibody (Abcam, UK) in 0.05% Triton X-100 and 10% fetal bovine serum in PBS for 1 hour at room temperature, followed by three 10-minute washes with 0.05% Triton X-100 in PBS. Cells were then incubated with 1:1000 goat anti-rabbit Alexa Fluor 594 antibody (Abcam, UK) in 0.05% Triton X-100 and 10% fetal bovine serum in PBS (protected from light) for 1 hour. Coverslips were mounted using FluorSave reagent (EMD Millipore, USA) and air-dried.
[0178] The total number of cells containing both pBITTraB2 and Clover2 plasmids was recorded, and a higher proportion of double-fluorescent cells was found in pCMV-Clover2-CLT than in pdClover2-N1 (T-test, p = 0.029). One explanation for this could be transfer of the clt-containing plasmid from neighboring cells (Figure 7A). We then recorded the number of Clover2 cells (green) adjacent to double-fluorescent cells, and found a statistically significant (p = 0.0046) excess of these in pCMV-Clover2-CLT compared to pdClover2-N1, which may indicate preferential egress of the TraB pore-containing Clover2 cells from cells containing the TraB pore (Figure 7B).
[0179] Example 4 Western blots were performed to detect the expression of two components of the N15 replication system (RepA and TelN) and the pores TraB and TdtA in human cell cultures.
[0180] Two synthetic gene cassettes were generated: one in the plasmid pET5R, which contains the EF-1a promoter located upstream of telN and the 5' end of the repA gene separated by a P2A peptide; the other in p3RTmP, which contains the 3' end of repA followed by an IRES (internal ribosome entry site) element and traB. These were digested with HindIII and NdeI (all restriction enzymes from NEB, UK) and ligated to generate pBITREPB. pBITREPA was generated by replacing the traB cistron with a synthetic tdtA gene bearing a C-terminal FLAG tag as an NheI-XbaI fragment using pBITREPB. Because the IRES (internal ribosome entry site) did not allow expression of either pore cistron, both pBITREPA and pBITREPB were further modified by replacing the IRES with the E2A peptide by synthesizing the regions encoding the C-terminus of repA, E2A, and the N-terminal region of the pore cistron as a HindIII-Bsu36I fragment for tdtA and a HindIII-PpuMI fragment for traB; these were ligated into pBITREPA and pBITREPB cut with the same fragments to generate the plasmids pBITREPA2 (Figure 8A) and pBITREPB2 (Figure 8B).
[0181] The purified plasmids were transfected into low-passage HEK293 cells, and transfection efficiency was confirmed by visual inspection under a microscope to detect mCherry fluorescence 72 hours after transfection. Cells were then rinsed with PBS, lysed in radioimmunoprecipitation assay (RIPA) buffer on ice, heat-denatured (100°C for 5 minutes), reduced with dithiothreitol (DTT), and size-separated in sodium dodecyl sulfate (SDS)-acrylamide gels. After electrophoresis, the proteins were electrophoretically transferred to nitrocellulose and blocked with 3% skim milk powder in Tris-buffered saline (TBST) containing 0.1% Tween 20 detergent for 1 hour. Subsequently, they were immunoblotted for 1 hour at ambient temperature with the following antibodies at a dilution of 1:1000: mouse anti-mCherry antibody (Abcam, UK); anti-2A peptide antibody (Merck, UK), anti-V5 tag antibody (Abcam, UK), and anti-FLAG antibody (Abcam, UK). The membrane was then washed three times for 10 minutes with TBST, and the secondary antibody was applied for 1 hour: goat anti-mouse antibody conjugated with alkaline phosphatase (Abcam, UK), diluted 1:1000 in 3% milk in TBST. The signal was developed by applying Western Blue Stabilized Substrate for Alkaline Phosphatase (Promega, UK). The developed membrane was photographed, and the size of the proteins was confirmed by reference to Prestained Protein Ladder Broad molecular weight (10-245 kDa) (Abcam, UK).
[0182] The results in Figure 9 demonstrate that RepA, TelN, TraB and TdtA are expressed in human cell lines.
[0183] Example 5 Experiments were performed to determine whether a plasmid carrying components of N15 replication function and the gene for a pore that secretes DNA could be moved to neighboring cells compared with a control plasmid lacking the pore.
[0184] HEK293 cells on glass coverslips in 6-well plates were grown with Dulbecco's Modified Eagle Medium (DMEM-GlutaMAX; Life Technologies, UK) and 10% fetal bovine serum (FBS; Merck, UK) until they reached 70-80% confluency. Cells were transfected with 1 μg of the Gentrafix plasmids pBITREPA2 (TelN, RepA, and TdtA pores) and pBITREPB2 (TelN, RepA, and TraB pores) plus the negative control plasmid pMCPK (no Gentrafix components); all plasmids also express the fluorescent reporter mCherry. After 72 h, the cells were rinsed with PBS buffer and fixed with 4% paraformaldehyde for 10 min. The paraformaldehyde was then removed by washing three times with PBS for 5 min. Cells were then permeabilized with 0.05% Triton X-100 in PBS for 15 minutes and blocked with PBS, 0.05% Triton X-100, and 10% fetal bovine serum for 1 hour. Cells were incubated with 1:1000 rabbit anti-mCherry antibody (Abcam, UK) in 0.05% Triton X-100 and 10% fetal bovine serum in PBS for 1 hour at room temperature, then washed three times for 10 minutes with 0.05% Triton X-100 in PBS. Cells were then incubated (protected from light) with 1:1000 goat anti-rabbit Alexa Fluor 594 antibody (Abcam, UK) in 0.05% Triton X-100 and 10% fetal bovine serum in PBS for 1 hour. Coverslips were mounted using FluorSave reagent (EMD Millipore, USA) and allowed to air dry.
[0185] Microphotographs representing 30 different fields were randomly taken and analyzed for the total number of red (mCherry-expressing) cells and the number of clusters per image (Figure 12A-D). Figure 12E shows a representative image, with clusters indicated by arrows.
[0186] A higher total number of red cells was observed with the Gentrafix plasmid compared to the negative control plasmid (Figure 12A; T-test for pBITREPA2, p=3.44×10 -8 ;T-test for pBITREPB2, p=2.64×10 -14 ), which also formed a greater total number of clusters (Figure 12B; T-test for pBITREPA2, p=3.51×10 -10 ;T-test for pBITREPB2, p=3.34×10 -19 ). Gentrafix mCherry significantly increased the total number of cells (Figure 12C; T-test for pBITREPA2, p=5.06×10 -14 ; T-test for pBITREPB2, p=3.54×10 -16 ) and ratio (Figure 12D; T-test for pBITREPA2, p = 1.30 × 10 -13 ;T-test for pBITREPB2, p=5.21×10 -21 ) were present in the clusters more than in the negative control. Of the two plasmids, pBITREPB2 expressing the TraB pore produced more transfected cells and cell clusters than pBITREPA2 expressing the TdtA pore.
[0187] The higher incidence of clusters containing DNA-secreting pores supports evidence for cell-to-cell DNA transfer with the Gentrafix platform. The smaller control plasmid is expected to show a higher proportion of transfected cells due to its higher copy number per unit mass; the smaller plasmid is taken up more efficiently by cells, whereas the Gentrafix plasmid is more abundant.
[0188] Example 6 Experiments were performed to detect direct transfer of plasmids from one cell line to another.
[0189] Low-density HEK293 cells were transfected with pBITREP (Figure 10A), pBITREPA2 (Figure 8A), and pBITREPB2 (Figure 8B). After 24 hours, the plasmid-containing medium was removed, the cells were washed twice, and fresh medium containing deoxyribonuclease I was applied. After another 24 hours, the cell line HEK293 Green Fluorescent Protein (AMS Bio, UK), which contains the green fluorescent protein (GFP) gene integrated into its chromosome, was added to each culture and incubated for 72 hours.
[0190] The mixed cultures were fixed with 4% paraformaldehyde in PBS, blocked with 10% fetal bovine serum, and primary antibodies (mouse anti-GFP and rabbit anti-mCherry, 1:500) were applied for 24 hours at 4°C, followed by secondary antibodies (goat anti-mouse AF488 and goat anti-rabbit AF594). Images were obtained using a Kern & Sohn OCM 167 fluorescence microscope. White arrows indicate cells expressing mCherry alone, while hash arrows indicate cells expressing GFP coexpressed with mCherry; the latter is the result of cell-to-cell gene transfer and is only seen in pBITREPA2 and pBITREPB2, but not in pBITREP, which lacks the pore gene (Figure 13).
[0191] Example 7 Experiments were performed to detect direct transfer of plasmids from one cell line to another across the junction between the two cell lines.
[0192] Highly confluent adherent cultures of MDCK-GFP cells (Innoprot, Spain), Madin-Darby canine kidney cells constitutively expressing green fluorescent protein from a chromosomally integrated gene, were trypsinized, washed with fresh DMEM / fetal bovine serum medium, and suspended in 1 ml of fresh DMEM / fetal bovine serum medium. 20 μl of the cell suspension was applied to each well of a 6-well plate and then incubated overnight (37°C, 5% carbon dioxide) until the cells reattached. Next, the MDCK-GFP cells were transfected with 1 μg of pMCPK and pBITREPB2 plasmids. The following day, the medium was replaced with fresh DMEM / fetal bovine serum containing 5 units of deoxyribonuclease I per ml for 2 hours. The transfected MDCK-GFP cells were then overlaid with non-fluorescent MDCK cells (UK Health and Safety Agency, UK). After the MDCK cells reattached, 3 ml of fresh DMEM / fetal bovine serum was added and the cells were incubated for an additional 48 hours. Cells were then fixed with 4% paraformaldehyde, permeabilized, and treated with anti-mCherry antibody. Images were taken using a Kern & Sohn OCM 167 fluorescence microscope.
[0193] The negative control pMCPK plasmid remained in the originally transfected MDCK-GFP cells (all red cells were also green), whereas the Gentrafix plasmid pBITREPB2 spread to adjacent MDCK cells in Figure 14 (cells seen at the periphery but not in the GFP micrograph).
[0194] Example 8 To determine which components of the TraB-based Gentrafix system (repA, telN, traB, and clt loci) are essential, experiments were performed by constructing luciferase expression plasmids containing these components and additional plasmids in which one or more of each component was deleted.
[0195] The firefly luciferase gene was cloned into the negative control plasmids pMCPK and pBITREP and the Gentrafix plasmid pBITREPB2. This was achieved by removing the mCherry-puromycin resistance gene cassette by restriction enzyme digestion with BstBI and AvrII, followed by ligation of a newly synthesized firefly luciferase cistron flanked by BstBI and AvrII restriction enzyme sites. The new plasmids were pLUCK (no Gentrafix genes), pLUCKREP (telN and repA), and pLUCKB (telN, repA, traB, clt).
[0196] Next, pLUCKB was used to generate a plasmid lacking the Gentrafix components. To generate a plasmid lacking the clt locus, pLUCKB was cut with AvrII and BstBI, blunted using the NEB Quick Blunting kit (NEB, UK), and self-ligated to generate pLUCKCB(telN, repA, traB).
[0197] To generate a plasmid lacking the N15 replication components repA and telN (i.e., containing traB and clt), pLUCKB was digested with SpeI and MreI to remove the 5' portion of traB and the repA and telN cistrons. The traB-containing plasmid pBITTraBclt was digested with the same enzymes to release the N-terminus of traB, which was then ligated to restore traB, generating plasmid pLUCKOB(traB, clt).
[0198] A repA-deleted plasmid was constructed by digesting pLUCKB with MreI, thereby removing the 3' end of telN, all of repA, and the 5' end of traB. The synthetic MreI fragment "NoRepA" was then ligated to this to restore the telN and traB cistrons interposed by the P2A peptide sequence, generating the plasmid pLUCKTB (telN, traB, clt).
[0199] The telN deletion plasmid was created by cutting pLUCKB with SpeI and SbfI, which removed telN and the 5' end of repA. A PCR product was then generated using primers NoTelNRepA (ATAGGACTAGTGCCGCCACCATGACCTTACAAGAATTCTACGCGG) and NoTelNR (GCGCCCCCTGCAGGTCGCCA) with pLUCKB as a template. This PCR product, which contains the 5' end of repA, was digested with SpeI and SbfI and ligated into pLUCKB. The luciferase plasmid is illustrated in Figure 15.
[0200] For luciferase assays, HEK293 cells were grown in quadruplicate in white, clear-bottom 96-well plates at 37°C and 5% carbon dioxide in a tissue culture incubator until 50% confluence. Cells were then transfected with an equivalent copy number of each plasmid, equivalent to 200 ng of pLUCKB. Over the following four days, the cell culture medium in each well, one plate per day, was replaced with fresh medium supplemented with 150 μg / ml luciferin, and luminescence was measured using a GloMax microplate reader. The signal integration time was empirically set to 10 seconds 6 hours after transfection on day 0. Data obtained over subsequent days was first normalized to the luminescence of untransfected control cells and then normalized to the luminescence observed for each plasmid on day 0. Each plasmid was analyzed in five biological replicates (Figure 16).
[0201] Plasmids containing both repA and traB and clt, i.e., pLUCKB(telN, repA, traB, clt) and pLUCKB(repA, traB, clt), exhibited progressively more pronounced luminescence signals throughout the experiment, correlating with replication and cell-to-cell transfer and demonstrating the importance of the combination of DNA replication components and the DNA secretion pore. In contrast, the four plasmids lacking repA and traB exhibited minimal increases in fluorescence over the course of the experiment. The relative effect of the clt locus can be seen by comparing pLUCKB(telN, repA, traB, clt) with pLUCKB(telN, repA, traB): the latter plasmid lacking the clt locus generated a significantly lower signal than pLUCKB but a higher signal than the plasmid lacking repA and traB, indicating that the clt locus enhances intracellular transfer but is not essential to achieve this. A decrease in cell viability in all cultures resulted in a decrease in all fluorescent signals by day 5.
[0202] Sequence Listing SEQ ID NO:1 - Amino acid sequence of N15RepA [ka] SEQ ID NO:2 - N15repA cistron [ka] SEQ ID NO: 3 - Amino acid sequence of N15TelN [ka] Cistron of SEQ ID NO: 4-N15telN [ka] SEQ ID NO:5-N15telRL [ka] SEQ ID NO: 6 - Amino acid sequence of N15SopA [ka] SEQ ID NO:7 - N15sopA cistron [ka] SEQ ID NO:8 - Amino acid sequence of N15SopB [ka] SEQ ID NO: 9-N15SopB cistron [ka] SEQ ID NO: 10 - Amino acid sequence of Phi29 DNA-dependent DNA polymerase (gene 2) [ka] SEQ ID NO:11 - Phi29 DNA-dependent DNA polymerase cistron (gene 2) [ka] SEQ ID NO: 12—Amino acid sequence of Phi29 terminal protein (gene 3) [ka] SEQ ID NO:13 - Phi29 terminal protein cistron (gene 3) [ka] SEQ ID NO: 14 - Amino acid sequence of Phi29 single-stranded DNA binding protein (gene 5) [ka] SEQ ID NO:15 - Phi29 single-stranded DNA binding protein cistron (gene 5) [ka] SEQ ID NO: 16—Amino acid sequence of Phi29 double-stranded DNA-binding protein (gene 6) [ka] SEQ ID NO:17—Phi29 double-stranded DNA binding protein cistron (gene 6) [ka] SEQ ID NO: 18 - Amino acid sequence of adenovirus type 5 DNA-dependent DNA polymerase [ka] SEQ ID NO: 19 - Cistron of the DNA-dependent DNA polymerase of adenovirus type 5 [ka] SEQ ID NO: 20 - Amino acid sequence of the pro-terminal protein (pTP) of adenovirus type 5 [ka] SEQ ID NO: 21 - Cistron of the adenovirus type 5 pro-terminal protein (pTP) [ka] SEQ ID NO: 22 - Amino acid sequence of the DNA-binding protein (DBP) of adenovirus type 5 [ka] SEQ ID NO: 23 - Cistron of Adenovirus type 5 DNA binding protein (DBP) [ka] SEQ ID NO: 24 - Amino acid sequence of Streptomyces venezuelae pSVH1 TraB [ka] SEQ ID NO: 25 - Streptomyces venezuelae pSVH1 traB cistron [ka] SEQ ID NO: 26 - Streptomyces venezuelae pSVH1clt locus [ka] SEQ ID NO: 27 - Streptomyces venezuelae pSVH1clt repeat sequence [ka] SEQ ID NO: 28 - Amino acid sequence of Thermus thermophilus TdtA [ka] SEQ ID NO: 29 - Thermus thermophilus tdtA cistron [ka] SEQ ID NO: 30-2A "ribosome skipping" peptide consensus sequence [ka] SEQ ID NO:31 - E2A "ribosome skipping" peptide sequence [ka] SEQ ID NO:32 - P2A "ribosome skipping" peptide sequence [ka] SEQ ID NO: 33 - T2A "ribosome skipping" peptide sequence [ka] SEQ ID NO: 34 - Nucleotide sequence of pBITRE [ka] TIFF2026501319000036.tif232161 TIFF2026501319000037.tif236161 SEQ ID NO: 35 - Nucleotide sequence of pBITREPA2 [ka] TIFF2026501319000039.tif233161 TIFF2026501319000040.tif244161 SEQ ID NO: 36 - Nucleotide sequence of pBITREPB2 [ka] TIFF2026501319000042.tif233161 TIFF2026501319000043.tif233161 TIFF2026501319000044.tif51161 SEQ ID NO: 37- [ka] SEQ ID NO: 38- [ka] SEQ ID NO: 39- [ka] SEQ ID NO: 40- [ka] SEQ ID NO: 41- [ka] SEQ ID NO: 42- [ka] SEQ ID NO: 43- [ka] SEQ ID NO: 44 [ka] SEQ ID NO: 45—Nucleotide sequence of pLUCK [ka] TIFF2026501319000054.tif196161 SEQ ID NO: 46—Nucleotide sequence of pLUCKREP [ka] TIFF2026501319000056.tif233161 TIFF2026501319000057.tif233161 TIFF2026501319000058.tif91161 SEQ ID NO: 47 - Nucleotide sequence of pLUCKB [ka] TIFF2026501319000060.tif233161 TIFF2026501319000061.tif233161 TIFF2026501319000062.tif95161 SEQ ID NO: 48—Nucleotide sequence of pLUCKCB [ka] TIFF2026501319000064.tif233161 TIFF2026501319000065.tif233161 TIFF2026501319000066.tif95161 SEQ ID NO: 49 - Nucleotide sequence of pLUCKOB [ka] TIFF2026501319000068.tif233161 TIFF2026501319000069.tif62161 SEQ ID NO:50—Nucleotide sequence of pLUCKTB [ka] TIFF2026501319000071.tif233161 TIFF2026501319000072.tif110161 SEQ ID NO:51 - Nucleotide sequence of pLUCKRB [ka] TIFF2026501319000074.tif233161 TIFF2026501319000075.tif233161 TIFF2026501319000076.tif34161 SEQ ID NO: 52 - Primer for TelNRepA [ka] Primer SEQ ID NO: 53 - No TelNR [ka]
[0203] Further embodiments of the present invention 1.a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that allows the secretion of DNA from a eukaryotic cell A polynucleotide comprising:
[0204] 2.a) Origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) i) protelomerase; or ii) Terminal and DNA-binding proteins required for plasmid replication in eukaryotic cells a polynucleotide sequence encoding d) a polynucleotide sequence encoding a pore that allows for the secretion of DNA from a eukaryotic cell. 2. The polynucleotide of embodiment 1, comprising:
[0205] 3. The polynucleotide of embodiment 2, wherein said origin of replication is derived from bacteriophage N15.
[0206] 4. The polynucleotide of any one of embodiments 1 to 3, wherein said DNA-dependent DNA polymerase is derived from bacteriophage N15.
[0207] 5. The polynucleotide of any one of embodiments 1 to 4, wherein said DNA-dependent DNA polymerase is encoded by the repA gene.
[0208] 6. The polynucleotide of any one of embodiments 1 to 5, wherein the DNA-dependent DNA polymerase expressed by said polynucleotide sequence comprises SEQ ID NO: 1 or an amino acid sequence that is at least 90% identical to SEQ ID NO: 1 that retains the ability to function as a DNA-dependent DNA polymerase.
[0209] 7. The polynucleotide of any one of embodiments 1 to 6, wherein the polynucleotide sequence of the DNA-dependent DNA polymerase comprises SEQ ID NO: 2, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 2, which polynucleotide sequence when expressed retains the ability to function as a DNA-dependent DNA polymerase.
[0210] 8. The polynucleotide of any one of embodiments 1 to 7, wherein said protelomerase is TelN from bacteriophage N15.
[0211] 9. The polynucleotide of any one of embodiments 1 to 8, wherein the protelomerase expressed by said polynucleotide sequence comprises SEQ ID NO: 3, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 3, wherein the protelomerase retains the ability to function as a protelomerase.
[0212] 10. The polynucleotide of any one of embodiments 1 to 9, wherein said protelomerase polynucleotide sequence comprises SEQ ID NO: 4, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 4, which polynucleotide sequence when expressed retains the ability to function as a protelomerase.
[0213] 11. The polynucleotide of any one of embodiments 1 to 10, further comprising a telRL site, optionally wherein the polynucleotide sequence of the telRL site comprises SEQ ID NO:5.
[0214] 12. The polynucleotide of embodiment 1 or embodiment 2, wherein the DNA-dependent DNA polymerase is derived from bacteriophage Phi29.
[0215] 13. The polynucleotide of embodiment 12, wherein the DNA-dependent DNA polymerase is encoded by gene 2.
[0216] 14. The polynucleotide of embodiment 12 or embodiment 13, wherein the DNA-dependent DNA polymerase expressed by said polynucleotide sequence comprises SEQ ID NO: 10, or an amino acid sequence which is at least 90% identical to SEQ ID NO: 10, wherein the amino acid sequence retains the ability to function as a DNA-dependent DNA polymerase.
[0217] 15. The polynucleotide of embodiment 14, wherein the polynucleotide sequence of said DNA-dependent DNA polymerase comprises SEQ ID NO: 11, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 11, which polynucleotide sequence when expressed retains the ability to function as a DNA-dependent DNA polymerase.
[0218] 16. The polynucleotide of any one of embodiments 12 to 15, wherein the terminal protein and DNA-binding protein are terminal protein TP and DNA-binding proteins p5 and p6 from Bacillus subtilis bacteriophage Phi29 group.
[0219] 17. The polynucleotide of any one of embodiments 12 to 16, wherein the terminal protein expressed by said polynucleotide sequence comprises SEQ ID NO: 12, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 12 that retains the ability to function as a terminal protein.
[0220] 18. The polynucleotide of embodiment 17, wherein the polynucleotide sequence of the terminal protein comprises SEQ ID NO: 13, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 13 that retains the ability to function as a terminal protein when expressed.
[0221] 19. The polynucleotide of any one of embodiments 16 to 18, wherein the DNA-binding proteins p5 and p6 expressed by said polynucleotide sequences comprise SEQ ID NOs: 14 and 16, respectively, or amino acid sequences that are at least 90% identical to SEQ ID NOs: 14 and 16, respectively, that retain the ability to function as DNA-binding proteins.
[0222] 20. The polynucleotide of any one of embodiments 16-19, wherein the polynucleotide sequences of DNA-binding proteins p5 and p6 comprise SEQ ID NOs: 15 and 17, respectively, or polynucleotide sequences that are at least 90% identical to SEQ ID NOs: 15 and 17, respectively, which retain the ability to function as a DNA-binding protein when expressed.
[0223] 21. The polynucleotide of embodiment 1 or embodiment 2, wherein the DNA-dependent DNA polymerase is derived from an adenovirus.
[0224] 22. The polynucleotide of embodiment 21, wherein the DNA-dependent DNA polymerase derived from an adenovirus is encoded by the gene E2B.
[0225] 23. The polynucleotide of embodiment 21 or embodiment 22, wherein the DNA-dependent DNA polymerase expressed by said polynucleotide sequence comprises SEQ ID NO: 18, or an amino acid sequence which is at least 90% identical to SEQ ID NO: 18, wherein the amino acid sequence retains the ability to function as a DNA-dependent DNA polymerase.
[0226] 24. The polynucleotide of any one of embodiments 21 to 23, wherein the polynucleotide sequence of the DNA-dependent DNA polymerase comprises SEQ ID NO: 19, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 19, which polynucleotide sequence, when expressed, retains the ability to function as a DNA-dependent DNA polymerase.
[0227] 25. The polynucleotide of any one of embodiments 21 to 24, wherein the terminal protein and DNA binding protein are the terminal protein pTP and DNA binding protein E2A from adenovirus.
[0228] 26. The polynucleotide of any one of embodiments 21 to 25, wherein the terminal protein expressed by said polynucleotide sequence comprises SEQ ID NO: 20, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 20 that retains the ability to function as a terminal protein.
[0229] 27. The polynucleotide of any one of embodiments 21-27, wherein the polynucleotide sequence of the terminal protein comprises SEQ ID NO: 21, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 21, which retains the ability to function as a terminal protein.
[0230] 28. The polynucleotide of any one of embodiments 21 to 27, wherein the DNA-binding protein expressed by said polynucleotide sequence comprises SEQ ID NO: 22, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 22, which retains the ability to function as a DNA-binding protein when expressed.
[0231] 29. The polynucleotide of any one of embodiments 21-28, wherein the polynucleotide sequence of the DNA binding protein comprises SEQ ID NO: 23, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 23, which polynucleotide sequence retains the ability to function as a DNA binding protein when expressed.
[0232] 30. The polynucleotide of any one of embodiments 1-29, wherein said pore is TraB from Streptomyces.
[0233] 31. The polynucleotide of embodiment 30, wherein the pore expressed by said polynucleotide sequence comprises SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 24, wherein the pore retains the ability to function as a pore.
[0234] 32. The polynucleotide of embodiment 30 or embodiment 31, wherein the polynucleotide sequence of the pore comprises SEQ ID NO: 25, or a polynucleotide sequence which is at least 90% identical to SEQ ID NO: 25, which polynucleotide sequence retains the ability to function as a pore when expressed.
[0235] 33. The polynucleotide of any one of embodiments 30 to 32, further comprising the clt locus.
[0236] 34. The polynucleotide of embodiment 33, wherein the clt locus comprises SEQ ID NO: 26 or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides, wherein the variant maintains the ability to function as a clt locus.
[0237] 35. The polynucleotide of any one of embodiments 1-29, wherein said pore is TdtA from the genus Thermus.
[0238] 36. The polynucleotide of embodiment 35, wherein the pore expressed by said polynucleotide sequence comprises SEQ ID NO: 28, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 28, wherein the pore retains the ability to function as a pore.
[0239] 37. The polynucleotide of embodiment 35 or embodiment 36, wherein the polynucleotide sequence of the pore comprises SEQ ID NO: 29, or a polynucleotide sequence which is at least 90% identical to SEQ ID NO: 29, which polynucleotide sequence when expressed retains the ability to function as a pore.
[0240] 38. The polynucleotide of any one of embodiments 1 to 37, further comprising a promoter.
[0241] 39. The polynucleotide of embodiment 38, wherein the promoter is tissue-specific.
[0242] 40. The polynucleotide of any one of embodiments 1-39, further comprising a payload sequence.
[0243] 41. The polynucleotide of embodiment 40, wherein the payload sequence is a therapeutic gene, a CRISPR RNA-guided nuclease (optionally comprising CRISPR donor DNA), a zinc finger nuclease or TALEN, an antigen gene, or a gene encoding an immunogenic protein or a protein derived from a pathogen or tumor, or an antibacterial, antifungal, or antiviral compound, or an antibody, or a chimeric antigen receptor, or a T-cell receptor, or a B-cell receptor.
[0244] 42. A circular or linear plasmid comprising a polynucleotide as defined in any one of embodiments 1 to 41.
[0245] 43. A linearized plasmid comprising a polynucleotide as defined in any one of embodiments 1 to 10, further comprising a telR sequence and a telL sequence together with a hairpin end.
[0246] 44. A host cell comprising a polynucleotide as defined in any one of embodiments 1 to 41 or a plasmid as defined in embodiment 42 or embodiment 43.
[0247] 45. The host cell of embodiment 44, wherein the host cell is an E. coli cell.
[0248] 46. The host cell of embodiment 45, wherein the E. coli cell expresses the genes telN, repA, sopA, and sopB from bacteriophage N15.
[0249] 47. The host cell of embodiment 46, wherein SopA expressed by the polynucleotide sequence comprises SEQ ID NO: 6, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 6 that retains the ability to function as a SopA protein, and SopB expressed by the polynucleotide sequence comprises SEQ ID NO: 8, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 8 that retains the ability to function as a SopB protein.
[0250] 48. The host cell of embodiment 46 or embodiment 47, wherein the polynucleotide sequence of sopA comprises SEQ ID NO: 7 or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 7, which when expressed retains the ability to function as a SopA protein, and the sopB polynucleotide sequence comprises SEQ ID NO: 9 or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 9, which when expressed retains the ability to function as a SopB protein.
[0251] 49. A pharmaceutical composition comprising a polynucleotide as defined in any one of embodiments 1 to 41, or a plasmid as defined in embodiment 42 or embodiment 43, and a pharmaceutically acceptable excipient.
[0252] 50. A method of treatment comprising administration to an individual in need thereof of a polynucleotide as defined in any one of embodiments 1 to 41, or a plasmid as defined in embodiment 42 or embodiment 43, or a pharmaceutical composition as defined in embodiment 49.
[0253] 51. The method of embodiment 50, wherein the polynucleotide, plasmid or pharmaceutical composition is administered by injection, microinjection, inhalation, jet injection, oral ingestion, liposome, or microcarrier-mediated delivery.
[0254] 52. A method for producing a plasmid of embodiment 42 or embodiment 43, comprising the steps of culturing a host cell as defined in any one of embodiments 44 to 48, lysing the cell, and purifying the plasmid or plasmids from the cell lysate.
[0255] 53. A eukaryotic cell comprising a polynucleotide as defined in any one of embodiments 1 to 41, or a plasmid as defined in embodiment 42 or embodiment 43.
[0256] 54. The polynucleotide of embodiment 1 or embodiment 2, wherein the pore is a type VI secretion system from bacteria such as Agrobacterium, Bartonella, Bordetella, Brucella, Escherichia, Legionella, Helicobacter, Neisseria, Rickettsia, Salmonella, and Shigella.
[0257] 55. The polynucleotide of embodiment 1 or embodiment 2, wherein the origin of replication is derived from a bacterial plasmid, such as pMB1, ColE1, p15A, or pSC101.
[0258] 56. The polynucleotide of embodiment 1 or embodiment 2, wherein the terminal protein, DNA polymerase, and DNA-binding protein are derived from organisms such as coliphage PRD1, pneumococcal bacteriophage Cp-1, Streptomyces, viruses, and archaea, or from linear plasmids of bacteria, fungi, and plants, or from transposable elements, or from mitochondrial DNA.
[0259] 57. a) A recognition site for a restriction endonuclease, such as a homing endonuclease, that is not present in the chromosome of the target host; and b) a polynucleotide sequence encoding the cognate restriction endonuclease 3. The polynucleotide of embodiment 1 or embodiment 2, further comprising:
[0260] 58. a) a first plasmid comprising a polynucleotide according to embodiment 1 or embodiment 2; and b) a second plasmid containing telRL sites, or telR sites and telL sites, and an origin of replication, or an inverted terminal repeat sequence, and a clt sequence, wherein the telRL sites, or telR sites and telL sites, and an origin of replication, or an inverted terminal repeat sequence, and a clt sequence are identical to those of the first plasmid. A composition comprising:
[0261] 59.2A The polynucleotide of embodiment 1 or embodiment 2, further comprising a "ribosome skipping" peptide sequence.
[0262] 60. The polynucleotide of embodiment 59, wherein the "ribosome skipping" peptide sequence comprises SEQ ID NO: 30, 31, 32, or 33.
[0263] References Patent documents listed in the specification [Table 1] Non-patent literature listed in the specification [Table 2] TIFF2026501319000081.tif217161 TIFF2026501319000082.tif221161 TIFF2026501319000083.tif226161 TIFF2026501319000084.tif221161 TIFF2026501319000085.tif59161
Claims
1. a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that allows the secretion of DNA from a eukaryotic cell. A polynucleotide comprising:
2. a) origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) i) protelomerase; or ii) Terminal proteins and DNA-binding proteins required for replication of the plasmid in eukaryotic cells a polynucleotide sequence encoding d) a polynucleotide sequence encoding a pore that allows for the secretion of DNA from a eukaryotic cell. The polynucleotide of claim 1, comprising:
3. The polynucleotide of claim 2, wherein the origin of replication is derived from bacteriophage N15.
4. The polynucleotide of any one of claims 1 to 3, wherein the DNA-dependent DNA polymerase is derived from bacteriophage N15.
5. The polynucleotide of any one of claims 1 to 4, wherein the DNA-dependent DNA polymerase is encoded by the repA gene.
6. 6. The polynucleotide of any one of claims 1 to 5, wherein the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO:1 or an amino acid sequence that is at least 90% identical to SEQ ID NO:1 that retains the ability to function as a DNA-dependent DNA polymerase.
7. The polynucleotide of any one of claims 1 to 6, wherein the protelomerase is TelN from bacteriophage N15.
8. 8. The polynucleotide of any one of claims 1 to 7, wherein the protelomerase expressed by the polynucleotide sequence comprises SEQ ID NO:3, or an amino acid sequence that is at least 90% identical to SEQ ID NO:3 that retains the ability to function as a protelomerase.
9. 9. The polynucleotide of any one of claims 1 to 8, further comprising a telRL site, optionally wherein the polynucleotide sequence of the telRL site comprises SEQ ID NO:
5.
10. 3. The polynucleotide of claim 1, wherein the DNA-dependent DNA polymerase is derived from bacteriophage Phi29.
11. The polynucleotide of claim 10 , wherein the DNA-dependent DNA polymerase is encoded by gene 2.
12. 12. The polynucleotide of claim 10 or claim 11, wherein the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 10 or an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 that retains the ability to function as a DNA-dependent DNA polymerase.
13. The polynucleotide according to any one of claims 10 to 12, wherein the terminal protein and the DNA-binding protein are terminal protein TP and DNA-binding proteins p5 and p6 derived from bacteriophage Phi29 group of Bacillus subtilis.
14. 14. The polynucleotide of any one of claims 10 to 13, wherein the terminal protein expressed by the polynucleotide sequence comprises SEQ ID NO: 12, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 12 that retains the ability to function as a terminal protein.
15. 15. A polynucleotide according to claim 13 or claim 14, wherein the DNA binding proteins p5 and p6 expressed by the polynucleotide sequence comprise SEQ ID NOs: 14 and 16, respectively, or amino acid sequences at least 90% identical to SEQ ID NOs: 14 and 16, respectively, that retain the ability to function as DNA binding proteins.
16. The polynucleotide of any one of claims 1 to 15, wherein the pore is TraB from the genus Streptomyces.
17. 17. The polynucleotide of claim 16, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 24, which retains the ability to function as a pore.
18. 18. The polynucleotide of claim 16 or 17, further comprising the clt locus.
19. 19. The polynucleotide of claim 18, wherein the clt locus comprises SEQ ID NO: 26 or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides, wherein the variant maintains the ability to function as a clt locus.
20. The polynucleotide according to any one of claims 1 to 15, wherein the pore is TdtA derived from the genus Thermus.
21. 21. The polynucleotide of claim 20, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 28, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 28, wherein the pore retains the ability to function as a pore.
22. (a) a promoter; and / or (b) Payload sequence The polynucleotide of any one of claims 1 to 21, further comprising:
23. 23. The polynucleotide of claim 22, wherein the payload sequence is a therapeutic gene, a CRISPR RNA-guided nuclease (optionally comprising CRISPR donor DNA), a zinc finger nuclease or a TALEN (transcription activator-like effector nuclease), an antigen gene, or a gene encoding an immunogenic protein, or a protein from a pathogen or tumor, or an antibacterial, antifungal, or antiviral compound, or an antibody, or a chimeric antigen receptor, or a T-cell receptor, or a B-cell receptor.
24. A circular or linear plasmid comprising a polynucleotide as defined in any one of claims 1 to 23.
25. A pharmaceutical composition comprising a polynucleotide as defined in any one of claims 1 to 23 or a plasmid as defined in claim 24, and a pharmaceutically acceptable excipient.
26. 26. A method of treatment comprising the administration of a polynucleotide as defined in any one of claims 1 to 23, a plasmid as defined in claim 24, or a pharmaceutical composition as defined in claim 25 to an individual in need thereof.