Compositions and methods for treating neurological disorders using dopaminergic neurons with enhanced anti-inflammatory activity

Abstract

A method for generating a population of cells useful for treating brain disorders in a subject is disclosed. The present disclosure provides compositions and methods for modifying miR-155 in pluripotent cells, differentiating the engineered pluripotent cells to produce imbalanced 155-3p or 155-5p in DA neurons, and engrafting miR-155-3p or miR-155-5p-biased DA neuron precursors, astrocyte precursors, and / or leptomeningeal precursors in a human subject, thereby producing anti-inflammatory effects.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 479,486, filed January 11, 2023, entitled "Compositions and Methods for Treating a Neurologic Disease Using Dopaminergic Neurons with Enhanced Anti-inflammatory Activity," the entire contents of which are incorporated herein by reference.

[0002] FIELD OF THE INVENTION The present disclosure relates generally to the fields of molecular biology and medicine, and more particularly to methods for generating dopamine neurons from pluripotent cells. [Background technology]

[0003] background MicroRNA (miRNA) MicroRNAs (miRNAs) are a recently discovered class of small non-coding RNA molecules that have emerged as potent regulators of multiple aspects of cellular function.

[0004] miRNAs are approximately 22 bases long and play important roles in a wide range of cellular phenomena, such as development, differentiation, survival, stress response, apoptosis, proliferation, homeostasis, and differentiation. Recent studies have identified specific miRNA expression profiles associated with the initiation and progression of various disorders, including cancer and inflammatory and autoimmune disorders. Furthermore, studies on miRNA gain- and loss-of-function have revealed that pathogenic miRNAs accelerate their key roles in vivo.

[0005] Its mechanism of action involves the formation of a complex between multiple miRNA bases and the 3' non-coding portion of the target mRNA. This interaction results in destabilization of the target mRNA and / or inhibition of protein synthesis. Recognition between a miRNA and its target is essentially controlled by a sequence of approximately seven bases (recognition sequence or seed) located in the 5' portion of the miRNA. For this reason, it is likely that each miRNA can regulate the stability of a wide range of distinct mRNAs. The term "target gene" or "target mRNA" refers to the mRNA target of a microRNA, where the "target gene" or "target mRNA" is post-transcriptionally regulated by the microRNA based on near-perfect or perfect complementarity between the miRNA and its target site, resulting in cleavage of the target mRNA, or limited complementarity, often conferred by the so-called seed sequence (nucleotides 2-7 of the miRNA) and its target site, resulting in translational inhibition of the target mRNA.

[0006] Approximately 2000 miRNAs have been identified in humans to date (miRBase Release 19, www.mirbase.org) and are likely to regulate more than 30% of transcripts. miRNA regulation is therefore considered a major form of gene expression regulation.

[0007] miRNAs are transcribed in the nucleus in the form of long precursors (pri-miRNAs), which undergo a first maturation step in the nucleus to produce smaller hairpin-shaped pre-miRNAs. These miRNA precursors (pre-miRs) are then transported from the nucleus to the cytoplasm, where they undergo a final maturation step by the Dicer enzyme, generating a "mature" microRNA duplex consisting of a 5p and a 3p species. Either the 5p or 3p strand of the duplex is preferentially incorporated into the RNA-induced silencing complex (RISC) (a process known as miRNA strand selection), resulting in target mRNA suppression, whereas the passenger strand (called the "star" strand; note: miR-xx* or miR-3p strand) is degraded without being incorporated into RISC. Because the 5p and 3p species have different seed sequences, preferential loading of one of the strands into RISC determines target gene specificity.

[0008] MIR-155HG Pri-miR-155 is transcribed from a monocistronic locus within the host B-cell integration cluster (BIC) located on chromosome 21. MIR-155HG (also known as BIC, MIRHG2, miPEP155, and NCRNA00172) is transcribed by RNA polymerase II, and the resulting approximately 1,500-nucleotide RNA is capped and polyadenylated. The 23-nucleotide single-stranded miR-155 present in exon 3 is subsequently processed from the parent RNA molecule.

[0009] Figure 1. Schematic diagram of MIR-155HG (accession number NC_000021). This gene spans 13,024 bp, consists of three exons, and encodes a 1,500-bp noncoding primary-miRNA (pri-miRNA) (accession number NR_001458). The primary miRNA transcript (pri-miRNA) is processed by a microprocessor consisting of Drosha and DiGeorge syndrome critical region 8 (DGCR8) proteins. This produces precursor miRNAs (pre-miRNAs), which are exported from the nucleus by exportin 5 in a RanGTP-dependent mechanism. In the cytoplasm, the pre-miRNA is processed by Dicer and its associated proteins to produce mature miRNA duplexes, which are loaded into the RNA-induced silencing complex (RISC). Here, strand selection occurs, and the retained strand targets RISC to complementary mRNA transcripts, where it can carry out its effector function.

[0010] Once miR-155-5p / -3p are assembled into RISC, these molecules subsequently recognize their target messenger RNAs (mRNAs) through base-pairing interactions between nucleotides 2–8 (the seed region) of miR-155-5p / -3p and complementary nucleotides, primarily in the 3′-untranslated region (3′-UTR) of the mRNA (see Figures 4 and 5 below). Ultimately, miR-155-5p / -3p act as adaptors for RISC, and the mRNAs bound to the complex are subjected to translational repression (i.e., inhibition of translation initiation) and / or degradation after deadenylation.

[0011] Evidence suggests that this process occurs during loading of mature miRNAs into the Argonaute (Ago) protein, an essential component of RISC. Specifically, the 5' end of the retained miRNA strand interacts with a binding pocket located at the interface between the MID (middle) and PIWI domains within the Ago protein, while the 3' end fits into a hydrophobic cleft within the PAZ domain. The strand that binds to this pocket, either the 5' or 3' strand, designated miR-155-5p and miR-155-3p, respectively, is selected based on two criteria. The first selection criterion is based on the thermodynamic characteristics of each miRNA duplex end. Ago exhibits a tendency to incorporate the strand with the lowest internal stability at the 5' end, likely due to increased access to the MID / PAZ binding pocket, which is thought to be facilitated by regions such as the PAZ phosphate-binding pocket. The second criterion involves the type of nucleotide at the 5' end of the miRNA strand, which is selected via a nucleotide specificity loop found within the Ago MID domain. In the case of human Ago2, this bias is manifested by a preference for 5'-terminal uridine monophosphate (UMP) and adenosine monophosphate (AMP), which have approximately 20-fold higher affinity than cytidine monophosphate (CMP) and guanosine monophosphate (GMP), both of which sterically clash with the specificity loop in the MID domain. Together, these two criteria determine the strand selection process, resulting in asymmetric functional utilization of the miRNA 5p and 3p strands. However, these criteria do not explain all miRNA strand asymmetries, and removal of critical amino acids within C. elegans Ago-like proteins does not inhibit all strand selection. This is further supported by a recent bioinformatics analysis of both miRNA strands, which identified that 17-25% of tested miRNAs did not adhere to either of these selection criteria.

[0012] miR-155 chain selection Testing human miR-155 mature duplexes using strand selection criteria reveals the underlying reason for the higher relative expression of the miR-155-5p strand compared to the miR-155-3p strand. The 5'-terminal UMP of the miR-155-5p strand is known to have approximately 20-fold higher Ago-binding affinity than the 5'-terminal CMP nucleotide of the miR-155-3p strand. This correlates with the lower thermodynamic stability of the 5' end of the miR-155-5p strand (ΔG = 0.89 kcal mol-1, calculated by RNAcofold) compared to that of the miR-155-3p strand (ΔG = -3.38 kcal mol-1). This indicates a mechanism underlying miR-155 strand selection, suggesting that only significant structural or sequence changes outside the miRNA termini likely affect strand selection and trigger miR-155-3p arm-switching events.

[0013] In the case of miR-155, databases report the occurrence of 13 miR-155-3p isomiRs in humans, the most abundant of which are expressed at levels equal to or exceeding those of the canonical miR-155-3p. These highly expressed isomiRs have been found in cancerous tissues, such as breast cancer and renal cell carcinoma, and miR-155-3p has been shown to exert a selective regulatory function. Most of these miR-155-3p isomiRs feature deletions in the 5p or 3p strands that may affect strand selection, although isomiRs that may represent reported arm-switching mechanisms, such as 3' uridylation, are not highly abundant.

[0014] Systematic analysis of arm-switching events from high-throughput expression data can be performed using miRSwitch, a tool that utilizes publicly available miRNA sequencing data to identify the abundance of miR-155-5p and miR-155-3p strands in various tissues and conditions. Within these publicly available datasets, there are few instances of actual arm-switching events. B lymphocytes show the highest miR-155-3p expression (8009 reads). However, this represents only 1.71% of the total miR-155 reads. Most datasets showing significant miR-155-3p expression are similar, representing less than 2% of the total miR-155 strand population. This makes it tempting to conclude that miR-155-3p synthesis is unlikely to be a regulated event, but rather a by-product of excessive miR-155-5p synthesis due to natural imprecision in processing. However, such conclusions are somewhat contradictory in the subcutaneous squamous cell carcinoma dataset, where 478 miR-155-3p reads were found, representing approximately 12.9% of the total miR-155 strand population. Thus, increased concentrations of miR-155-3p isomiRs and miR-155-3p strand percentages in cancerous tissues may indicate specific miR-155 processing dysregulation within these conditions.

[0015] To date, miR-155-3p has not received much attention in the literature, likely due to a combination of non-functionality of its putative miRNA* strand, low expression levels that preclude its detection, and its overshadowing by its highly expressed and functionally well-characterized partner, the miR-155-5p strand. The latter regulates the immune system and has been implicated in a wide range of pathologies, including rheumatoid arthritis, multiple sclerosis, infectious diseases, and cancer. Regardless of the non-functionality of either putative miR-155-3p strand, miR-155-3p has only been functionally investigated and implicated in a handful of biological processes, including immune response, cardiac remodeling, and cancer.

[0016] miR-155-3p in inflammation: an overview Evidence suggests that miR-155-3p is functionally relevant to the immune environment as a pro-inflammatory regulator in multiple immune cells, including dendritic cells, macrophages, T cells, and astrocytes. Immune-responsive miRNAs, such as miR-155-5p, play an important role in the dynamic regulation of inflammatory signaling because they can simultaneously target multiple transcripts and their biogenesis does not require protein synthesis, thus enabling cost-effective and rapid amplification or suppression of cellular signals that fine-tune the immune response. These attributes are crucial in inflammatory signaling, and misregulation of secreted factors can cause widespread tissue damage in autoimmune diseases and chronic inflammation. Interestingly, temporal analysis of miRNA strand expression indicates that induction of miR-155-3p appears to be limited to the early immune response, potentially indicating conservation of miRNA functionality within this time frame before induction of its partner strand occurs. Such a function may reside in a positive feedback loop established between miR-155-3p and the NF-kB signaling pathway. Specifically, by suppressing NF-kB inhibitors, miR-155-3p may act to remove regulatory checkpoints that may prevent a rapid and strong inflammatory response, promoting the upregulation of miR-155-5p, which primarily acts to enhance pro-inflammatory downstream signals, such as TNF-α.

[0017] Gene editing technology Since its inception, gene editing technology has proven to be a useful tool in the development of in vitro disease models. Homologous recombination (HR), which involves the replacement of endogenous genomic sequences with exogenous donor DNA / RNA and the precise insertion of exogenous DNA / RNA at defined mammalian chromosomal locations, was first developed in the 1980s (Smithies et al., 1984) and subsequently applied to genome modification of mouse embryonic stem cells (ESCs) (Hasty et al., 1991). The discovery of the I-SceI yeast meganuclease, which promotes HR endogenous cellular mechanisms to repair DNA / RNA double-strand breaks (DSBs) in the presence of donor DNA / RNA (Jacquier and Dujon, 1985), led to the establishment of genome editing strategies in mouse cells (Choulika et al., 1995) and ESCs (Cohen-Tannoudji et al., 1998) based on proteins derived from unicellular organisms.

[0018] The advent of zinc finger nuclease (ZFN) technology improved the efficiency of genome editing in mammalian cells (Bibikova et al., 2001) and led to the generation of the first knockout rat (Geurts et al., 2009). Following its use in animal and cellular models (Petersen and Niemann, 2015), ZFN-based genome editing has been utilized to correct genetic mutations in patient-derived iPSCs (Soldner et al., 2011; Reinhardt et al., 2013; Kiskinis et al., 2018; Wang et al., 2018; Korecka et al., 2019) or insert known disease-associated mutations in iPSCs derived from healthy individuals (Verheyen et al., 2018), enabling direct investigation of specific genomic alterations and disease phenotypes. Additionally, ZFNs have been applied to generate engineered systems to study cell fate decisions and improve iPSC differentiation protocols ( Hockemeyer et al., 2009 ), as well as to generate cell-type specific reporter systems for investigating disease pathogenesis ( Zhang et al., 2016 ).

[0019] Genome editing technology advanced further with the advent of transcription activator-like effector nucleases (TALENs), which have proven to be an efficient technique for generating animal models (Tesson et al., 2011). TALENs have also been used in the study of neurological disorders through the introduction of disease-causing mutations in control iPSCs (Wen et al., 2014; Lenzi et al., 2015; Akiyama et al., 2019) and / or the correction of gene mutations in patient-derived iPSCs (Maetzel et al., 2014; Wen et al., 2014; Li HL et al., 2015; Tanaka et al., 2018; Akiyama et al., 2019), leading to greater confidence in the underlying mechanisms of disease and the development of therapeutic approaches. Furthermore, TALEN technology has been used to develop reporter systems for stem cell-based academic research ( Cerbini et al., 2015 , Pei et al., 2015 ).

[0020] Following the development of TALEN technology, the clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas13) system (Gasiunas et al., 2012, Jinek et al., 2012) rapidly demonstrated its revolutionary ability to manipulate the genomes of mammalian cells in culture (Cong et al., 2013, Mali et al., 2013) and animal models (Wang H. et al., 2013). Similar to ZFNs or TALENs, CRISPR-Cas13 uses separate RNA cleavage and binding modules. However, the CRISPR-Cas13 system utilizes its own native endonuclease and relies on CRISPR RNA (crRNA) and trans-activating RNA (transRNA) to specifically bind to target RNA sequences and activate Cas13. Thus, the long and complicated process of producing engineered nucleases has been rapidly overcome by the flexibility and simplicity of generating different CRISPR-based approaches, which only require the design of RNAs that match specific targets. The extraordinary potency of CRISPR-Cas13, along with its great versatility for generating a wide range of substitutions, duplications, deletions, inversions, and numerous other complex modifications, ranging up to chromosomal rearrangements, has revolutionized the field of genome editing. However, several limitations exist that require further improvement.Increased efficiency and reduced off-target effects have been achieved through engineering the Cas13 protein (Kleinstiver et al., 2015, 2016; Anders et al., 2016; Slaymaker et al., 2016; Chen et al., 2017; Casini et al., 2018; Hu et al., 2018; Lee et al., 2018; Nishimasu et al., 2018) and modifications to the design and structure of guide RNAs (Jinek et al., 2012; Hsu et al., 2013; Cui et al., 2018; Filippova et al., 2019; Moon et al., 2019), as well as the discovery and application of Cas proteins with distinct and specific gene editing properties (Zetsche et al., 2015; Abudayyeh et al., 2016). CRISPR-based transcriptional modulation has been achieved through a variety of methods, including gene expression modulation (e.g., CRISPR interference, CRISPRi) or activation (e.g., CRISPR activation, CRISPRa). CRISPR-based transcriptional modulation has been achieved through the use of repressor or activator transcription domains fused to catalytically inactive Cas13 (dCas13) and guide RNAs directed against the promoter or regulatory region of a specific gene (Gilbert et al., 2013).

[0021] CRISPR-based manipulation techniques have enabled researchers to ablate the function of specific genetic elements or correct disease-causing mutations. In parallel, CRISPR tools are now being implemented for the active control and modulation of desired messenger RNA (mRNA). This allows for the investigation of transcriptome dynamics and the establishment of causal relationships between observed transcriptional changes and cellular phenotypes. Previously, RNA interference (RNAi) technology enabled the inhibition of desired transcripts using microRNAs (miRNAs), but this had significant off-target effects due to cross-reactivity with targets with limited sequence similarity and mistargeting effects associated with endogenous miRNAs (Flynt and Lai, 2008). Investigation of Cas proteins capable of targeting RNA led to the development of engineered RNA guide and RNA-targeting enzymes (CasRx) (Konermann et al., 2018), which showed improved efficiency in knocking down endogenous mRNA levels compared to RNAi technology and enabled facile manipulation of alternative splicing in human cells. Furthermore, Konermann and colleagues successfully applied Cas-Rx editing to modulate the balance of tau isoforms in a patient-derived cortical neuron model of FTD. Some forms of FTD with parkinsonism are linked to chromosome 17 (FTDP-17), while other tauopathies are caused by mutations in the intron following exon 10 of MAPT (Boeve and Hutton, 2008). These variants disrupt intron splicing sites, increasing the expression of 4R tau isoforms containing more microtubule-binding domains (Kar et al., 2005), inducing pathological changes and driving the progression of neurodegeneration (Schoch et al., 2016). CasRx-mediated exon exclusion reduced 4R tau expression to levels similar to those in unaffected control neurons, suggesting that this technique can be used for transcriptional modulation in in vitro models.Interestingly, the small size of CasRx makes it suitable for packaging in adeno-associated virus (AAV) for delivery to postmitotic neurons, which holds promise for future clinical applications in the treatment of neurological disorders. It can also be paired with arrays encoding multiple guide RNAs for multiplexing. Thus, CasRx technology paves the way for transcriptome manipulation and RNA-targeted therapeutic applications.

[0022] Differentiation into lineage-specific cell populations Cell populations that retain the ability to differentiate into multiple specialized cell types are useful for developing multiple lineage-specific differentiated cell populations. These cell populations that retain the ability to further differentiate into specialized cell populations contain pluripotent cells. The pluripotent cells can be of embryonic and / or non-embryonic stem cell origin.

[0023] It is contemplated that these lineage-specific differentiated cell populations will find use in cell replacement therapy for patients with diseases that result in the loss of function of a defined cell population. In addition to their direct therapeutic value, lineage-specific differentiated cells are also valuable academic research tools for a variety of purposes, including in vitro screening assays to identify, confirm, and test functional details or to test the delivery of therapeutic molecules to treat cell lineage-specific diseases.

[0024] To date, embryonic stem cells, somatipharmac stem cells, and induced pluripotent stem cells have been used as therapeutic agents and model systems for neurodegenerative diseases. Academic research and technological development related to the directed differentiation of embryonic stem cells and somatic stem cells has been conducted in the fields of central nervous system (CNS) diseases, such as Huntington's disease, Alzheimer's disease, Parkinson's disease, and multiple sclerosis. However, the results of these studies have shown that these cells used in vivo have little ability to enable patients to restore neuronal system function and often result in unwanted tumor growth in patients.

[0025] Thus, there is a need for compositions and methods for obtaining cell populations that can be used both in academic research and as therapeutic agents to treat disease when patient cells have lost a specific function.

[0026] In the case of Parkinson's disease, for example, the loss of midbrain dopaminergic (DA) neurons leads to the appearance of disease symptoms.Therefore, there is a need for a method for producing DA neuronal cells from pluripotent cells, because such cells can be used both therapeutically and in disease models to identify new therapeutic agents for the treatment of Parkinson's disease and other primary and secondary parkinsonian disorders, including but not limited to, idiopathic Parkinson's disease, vascular parkinsonism, drug-induced parkinsonism, and non-idiopathic parkinsonian disorders, including but not limited to, Parkin and other familial and genetic diseases.

[0027] A variety of efforts have been made to generate midbrain DA neurons from pluripotent cells.For example, the method for generating midbrain DA neurons from pluripotent cells typically requires the use of both LDN-193189 (inhibits ALK1 / 2 / 3 / 6 and blocks SMAD1 / 5 / 8), which is a BMP signaling inhibitor, and SB-431542 (inhibits ALK4 / 5 / 7 and blocks SMAD2 / 3), which is a TGF-beta signaling inhibitor, as described in, for example, United States Patent No. 10,280,398, the entire contents of which are incorporated herein by reference.Because these methods utilize the combination of two inhibitors of Small Mothers Against Decapetaplegic (SMAD) signaling, these methods are typically referred to as " dual SMAD inhibition " or " dual SMADi ".

[0028] One method of generating DA neurons using dual SMAD inhibition includes differentiating pluripotent stem cells, wherein the plurality of pluripotent stem cells are differentiated with at least one inhibitor of TGFβ / Activin-Nodal signaling, at least one inhibitor of bone morphogenetic protein (BMP) signaling, and at least two activators of sonic hedgehog (SHH) signaling, e.g., purmorphamine and SHH. The method includes exposing the cells to C25II and at least one inhibitor of glycogen synthase kinase 3β (GSK3β) signaling that activates wingless (Wnt) signaling, wherein exposure of the cells to at least one inhibitor of TGFβ / activin-Nodal signaling and at least one inhibitor of BMP signaling begins on day 0, and the cells are exposed to the at least one inhibitor of GSK3β signaling in an amount effective to produce a cell population comprising at least about 10% differentiated cells that express both forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 alpha (LMX1A) from day 3 to day 11 after initial exposure of the cells to the at least one inhibitor of TGFβ / activin-Nodal signaling and at least one inhibitor of BMP signaling.

[0029] Additionally, U.S. Pat. No. 10,858,625, the entirety of which is incorporated herein by reference, describes another method for generating DA neurons using a dual SMAD technique, comprising contacting a plurality of pluripotent stem cells with at least one inhibitor of TGFβ / Activin-Nodal signaling, and contacting the cells with at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of Wingless (Wnt) signaling to induce expression of Forkhead box protein A2 (FOXA2) and LIM homeostasis factor (LIM) ... and obtaining a population of differentiated cells expressing LMX1A-box transcription factor 1 alpha (LMX1A), wherein the concentration of at least one activator of Wnt signaling is increased during contact with the cells, where i) the increase in concentration begins between about 2 days and about 6 days after initial contact of the at least one activator of Wnt signaling with the cells, and ii) the concentration of the at least one activator of Wnt signaling is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling in contact with the cells.

[0030] Additionally, U.S. Pat. No. 10,273,452, the entirety of which is incorporated herein by reference, discloses another method of producing DA neurons using a dual SMAD technique, comprising the steps of contacting a plurality of starting cells with an inhibitor of Small Mothers Against Decapentaplegic (SMAD) protein signaling ("SMAD inhibitor"), wherein the starting cells are selected from the group consisting of multipotent cells, pluripotent cells, and combinations thereof; contacting the cells with a bone morphogenetic protein (BMP); and contacting the cells with a compound selected from the group consisting of BRL-54443, parthenolide, phenanthroline, and combinations thereof, wherein the cells are contacted with the SMAD inhibitor and the BMP in amounts effective to induce detectable expression of SIX1 and PAX6 in the plurality of cells.

[0031] Methods for obtaining enriched populations of midbrain dopaminergic (DA) neurons are described in US Pat. No. 10,828,335, which is incorporated herein by reference in its entirety. In general, the method includes the steps of: (a) obtaining a population of pluripotent cells; (b) culturing the population of cells in a medium containing an inhibitor of BMP signaling, an inhibitor of TGFβ signaling, an activator of Sonic hedgehog (SHH) signaling, an activator of Wnt signaling, and a MEK inhibitor, optionally without the addition of FGF8; (c) transferring the population of cells to a suspension culture in a medium containing an inhibitor of BMP signaling, an activator of SHH signaling, and an activator of Wnt signaling, thereby forming cell aggregates, optionally with the addition of FGF8; (d) dissociating the cell aggregates and seeding the dissociated cells in culture to obtain a neural lineage cell population; (e) further differentiating the neuronal lineage cell population in a maturation medium containing neuronal lineage maturation factors to generate a cell population comprising midbrain neuron cells; and (f) obtaining an enriched population of midbrain DA neurons using a transgenic screenable or selectable marker under the control of a pan-neuronal promoter expressed by cells of the cell population.

[0032] A method for preparing pluripotent stem cells for neural differentiation is described in U.S. Patent No. 9,487,752, which is incorporated herein by reference in its entirety. Generally, the method includes the steps of: a) culturing a population of human pluripotent stem cells in a medium containing transforming growth factor β (TGFβ) and basic fibroblast growth factor (bFGF), which maintains the pluripotency of the cells; b) priming the pluripotent stem cells in an adherent culture and a serum-free culture medium essentially free of exogenously added TGFβ and bFGF in the absence of mouse feeder cells prior to the formation of aggregates, wherein the priming occurs for at least one day and the levels of TGFβ and bFGF are gradually reduced; c) forming aggregates from the cells of step b) in suspension culture; and d) further differentiating the aggregates into a cell population containing neural cells, thereby producing human neural cells. Another method involves generating midbrain DA neurons from pluripotent cells using single SMAD inhibition (single SMADi). See, e.g., U.S. Patent No. 10,590,383, which is incorporated herein by reference in its entirety. Generally, the method includes culturing human pluripotent cells in the presence of the following signaling modulators: (a) a single inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, (b) at least one activator of Sonic Hedgehog (SHH) signaling, and (c) at least one activator of Wingless (Wnt) signaling, and culturing the cells in the presence of the modulators for a period of time sufficient to provide a cell composition comprising FOXA2+ / LMX1+ cells, wherein the culturing does not include culturing the human pluripotent cells in the presence of a second inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling. [Prior art documents] [Patent documents]

[0033] [Patent Document 1] U.S. Patent No. 10,280,398 [Patent Document 2] U.S. Patent No. 10,858,625 [Patent Document 3] U.S. Patent No. 10,273,452 [Patent Document 4] U.S. Patent No. 10,828,335 [Patent Document 5] U.S. Patent No. 9,487,752 [Patent Document 6] U.S. Patent No. 10,590,383 [Brief explanation of the drawings]

[0034] [Figure 1] Figure 1 shows the classical miRNA biogenesis pathway.

[0035] [Figure 2] Figure 2 shows hsa-miR-155 and miR-155-3p and miR-155-3p products.

[0036] [Figure 3] Figure 3 shows pre-miR-155.

[0037] [Figure 4] Figure 4 shows hsa-miR-155-3p protein targets (anti-inflammatory bias).

[0038] [Figure 5] Figure 5 shows hsa-miR-155-5p protein targets (pro-inflammatory bias). Summary of the Invention [Means for solving the problem]

[0039] Abstract Precursors of mature miRNAs (precursor miRNAs, e.g., pre-miRNAs) are modified in pluripotent cells to alter the inflammatory effects of differentiated cell populations. More specifically, the modified pluripotent cells are down-differentiated into neural lineages and grafted into differentiated cell populations to quench nervous system inflammation.

[0040] Naturally occurring precursor miRNA molecules can be modified in cell populations (pluripotent cells or differentiated cells, such as midbrain DA neurons) to increase miR-155-3p strand selection compared to wild-type miR-155-5p strands, which are typically enriched in cell populations (pluripotent cells or differentiated cells, such as midbrain DA neurons).Naturally occurring precursor miRNA molecules can be modified in pluripotent cell populations to increase miR-155-3p strand selection compared to wild-type miR-155-3p strands in differentiated cell populations, such as midbrain DA neurons.Either -5p or -3p region can be modified, or both, and the stem-loop region can also be modified.In either case, the modification is designed to create miR-155-3p strand bias compared to wild-type or miR-155-5p strands.

[0041] Disclosed are cell populations that have been modified to increase or decrease the expression of specific miRNAs, miR-155-3p or miR-155-5p, and therapeutic methods using such cell populations in the treatment of diseases, e.g., neurodegenerative disorders, where the neurodegenerative disorder is selected from the group including parkinsonian disorders, multiple sclerosis, Parkinson's disease (PD), epilepsy, amyotrophic lateral sclerosis (ALS), stroke, Rett syndrome, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, stroke, Alzheimer's disease, and Huntingdon's disease.

[0042] Specifically, a method for inducing lineage-specific differentiation of pluripotent cells into miR-155-5p or miR-155-3p-enhanced DA neuron cells is described.The midbrain-fate FOXA2+LMX1A+TH+ miR-155-5p or miR-155-3p-biased DA neurons generated using the disclosed methods are further intended for various uses, including but not limited to, in in vitro drug discovery assays, in neurological academic research, and as therapeutic agents for reversing disease, or damage or loss of dopamine neurons in patients, or reducing inflammation in patients.Furthermore, compositions and methods are provided for differentiating miR-155-5p or miR-155-3p-enhanced DA neurons from human pluripotent stem cells for use in disease modeling, particularly in Parkinson's disease-like disorders and Parkinson's disease. In some embodiments, the differentiated cell populations are not predicted to have no miR-155-5p DA neurons, but instead they are biased towards miR-155-3p guide formation or miR-155-3p strand selection. In some embodiments, the differentiated cell populations are not predicted to have no miR-155-3p DA neurons, but instead they are biased towards miR-155-5p guide formation or miR-155-5p strand selection.

[0043] iPSC differentiation The differentiation of pluripotent cells into DA neurons is known in the art. See, for example, U.S. Patent No. 10,280,398 and (incorporated herein by reference) Chambers, et al., Nat Biotechnol 27, (2009) (disclosing dual SMAD differentiation) and U.S. Patent No. 10,590,383 (disclosing single SMAD differentiation).

[0044] Disclosed is an in vitro method for preparing a cell composition comprising modified human cells expressing both Forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 (LMX1) (FOXA2 / LMX1 cells), the method comprising culturing modified human pluripotent cells in the presence of the following signal transduction modulators: (a) a single inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, (b) at least one activator of Sonic hedgehog (SHH) signaling, and (c) at least one activator of Wingless (Wnt) signaling, and culturing the cells in the presence of the modulators for a period of time sufficient to provide a cell composition comprising the FOXA2 / LMX1 cells. In some preferred embodiments, LMX1 is LIM homeobox transcription factor 1 alpha (LMX1A). In some embodiments, the inhibitor of SMAD signaling is a BMP inhibitor, such as LDN-193189 (e.g., about 0.2 μM to about 4 μM, more preferably greater than 0.2 μM to about 4 μM, about 1 μM, 2 μM, 3 μM, 4 μM, or any range of concentrations derivable therein), dorsomorphin, DMH-1, or noggin. As shown in the examples below, increasing the concentration of LDN-193189 (e.g., 2 μM compared to 0.2 μM) resulted in improved differentiation of iPS cells into FOXA2+ / LMX1+ cells or dopamine neurons. In some embodiments, the BMP inhibitor is LDN-193189. The SMAD signaling inhibitor can be a TGFβ inhibitor (TGFβ signaling pathway inhibitor), such as SB431542 (e.g., SB431542 present at a concentration of about 5-100, 20-60, 30-50 μM, or about 40 μM). In some embodiments, the pluripotent cells are cultured with the SMAD inhibitor on days 1-15, 1-16, or 1-17 of culture. The pluripotent cells are cultured with the SMAD inhibitor substantially continuously or daily for 15, 16, or 17 days.The inhibitor of SMAD signaling may be present at a concentration of about 50-2000, 50-500, 500-2500, or 500-2000 nM, or about 180-240 nM. In some embodiments, the method further comprises contacting the pluripotent cells with a MEK inhibitor. The MEK inhibitor may be PD0325901. In some embodiments, PD0325901 is present at a concentration of about 0.25-2.5 μM or about 0.5-1.5 μM. In some embodiments, the MEK inhibitor is contacted with the pluripotent cells for about 1-3 days, or on days 1-3, 2-4, 3-5, or on days 1, 2, 3, 4, or 5 after initiation of contact with the inhibitor of SMAD signaling (e.g., the contacting step may occur for about 72 hours beginning on day 2 or day 3 of differentiation). The MEK inhibitor may be contacted with the pluripotent cells about 48 to about 72 hours, 24 to 96 hours, or 24 to 48 hours after initiation of contact with the inhibitor of SMAD signaling. In some embodiments, the MEK inhibitor is contacted with the pluripotent cells daily or substantially continuously for about 3 to 4 days, beginning about 1 to 2 days after initiation of contact with the inhibitor of SMAD signaling. In some embodiments, the MEK inhibitor is contacted with the pluripotent cells on days 2 to 5, 3 to 6, or 3 to 5 after initiation of contact with the inhibitor of SMAD signaling on day 1. The activator of Wnt signaling may be a GSK3 inhibitor, such as CHIR99021. CHIR99021 may be present at a concentration of about 0.5-3 μM, or greater than about 1.25 μM to about 2 μM (e.g., about 1.5-2.0 μM, about 1.55-1.75 μM, or about 1.55, 1.65, 1.75 μM, or any range inducible therein; in some embodiments, higher concentrations, e.g., 4-7 μM or 6 μM, may be used on days 9-17 or 11-17 after initiation of contact with the inhibitor of SMAD signaling on day 1). In some embodiments, the activator of Wnt signaling contacts the pluripotent cells 1-3 days after initiation of contact with the inhibitor of SMAD signaling. The activator of Wnt signaling may contact the pluripotent cells 12-48 hours or 24-48 hours after initiation of contact with the inhibitor of SMAD signaling.The pluripotent cells are cultured with the activator of Wnt signaling substantially continuously or daily for 10, 11, 12, 13, 14, 15, or about 16 days. The activator of Wnt signaling may be contacted with the pluripotent cells 2 to 17 days after initiation of contact with the inhibitor of SMAD signaling on day 1. In some embodiments, the activator of SHH signaling is purmorphamine, C25II Shh, or C24II Shh. In some embodiments, C25II Shh may be used instead of or in combination with C24II Shh. The method may further include contacting the pluripotent cells with two activators of SHH signaling, such as purmorphamine and C25II Shh. In some embodiments, at least one activator of SHH signaling is contacted with the pluripotent cells on the same day as initiation of contact with the inhibitor of SMAD signaling or within 24 to 48 hours after initiation of contact with the inhibitor of SMAD signaling. In some embodiments, at least one activator of SHH signaling is contacted with the pluripotent cells simultaneously with or 1-7 days after initiation of contact with the inhibitor of SMAD signaling on day 1.

[0045] In some embodiments, about at least 40%, at least 60%, at least 80%, or at least 85% of the modified differentiated cell population express both FOXA2 and LMX1 (e.g., LMX1A). In some embodiments, about at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% of the modified differentiated cell population express both FOXA2 and tyrosine hydroxylase (TH).

[0046] Methods for modifying miRNA profiles in cell populations. It will be understood from the description provided herein that modifying pre-miR-155 in pluripotent stem cells, e.g., iPSCs, can be done by several means: 1. Transiently transfecting pluripotent cells with miRNA (or a modified form thereof, as described herein below). 2. Stably or transiently transfecting pluripotent cells with expression vectors encoding mature miRNAs (or modified forms thereof, as described herein below) or miRNA mimics. 3. Stably or transiently transfecting pluripotent cells with an expression vector encoding the pre-miRNA (or a modified form thereof, as described herein below). 4. Stably or transiently transfecting pluripotent cells with an expression vector encoding the pri-miRNA (or a modified form thereof, as described herein below). 5. miRNA antagonists may be introduced into cells using siRNA or expression vectors, eg, antagomirs, using transfection protocols known in the art. 6. Polynucleotides that down-regulate miRNAs. 7. Editing miR-155HG, such as miR-155-5p or miR-155-3p or stem-loop.

[0047] In each case, the miR-155 is miR-155-5p or miR-155-3p. In each case, the modified miR-155-5p is SEQ ID NO: 6. In each case, the modified miR-155-3p is SEQ ID NO: 7 or 9-21. In each case, the modified miR-155 is SEQ ID NO: 8. Thus, the cell population has been genetically modified to express an exogenous miRNA or a polynucleotide agent capable of downregulating a miRNA (miR-155-5p or miR-155-3p).

[0048] Differentiation into miR-155-5p or miR-155-3p-enhanced DA neurons After modifying the pluripotent cells (e.g., hESCs or iPSCs), the modified pluripotent cells are differentiated into midbrain DA neurons as known in the art. In some embodiments, the midbrain DA neuron cell population differentiated from the modified pluripotent cells comprises three cell populations: A9 dopamine neurons, astrocytes, and vascular leptomeningeal cells (VLMCs). It is believed that modification of each of the cell types (not just dopamine cells) will affect the inflammatory response. Thus, in some embodiments, the insertion / modification locus is present in all three cell types. In some embodiments, the insertion / modification locus is not present in all three cell types. The non-coding BIC locus is a good target for inserting modified miR-155 because it is expressed in all three cell types. In some embodiments, the A9 dopamine neurons are miR-155-3p-biased or miRNA-155-5p-biased. In some embodiments, the astrocytes are miRNA-155-3p-biased or miR-155-5p-biased. In some embodiments, the VLMCs are miRNA-155-3p-biased or miRNA-155-5p-biased. In some embodiments, a cell population of miRNA-155-3p-biased A9 dopamine neurons or miR-155-5p-biased A9 dopamine neurons is implanted into an animal, for example, a mouse or a human. In some embodiments, the VLMCs are miRNA-155-3p-biased or miRNA-155-5p-biased. In some embodiments, a cell population of miR-155-3p-biased astrocytes or miRNA-155-5p-biased astrocytes is implanted into an animal, for example, a mouse or a human. In some embodiments, a cell population of miR-155-3p-biased VLMCs or miR-155-5p-biased VLMCs is implanted into an animal, such as a mouse or a human. In some embodiments, the implanted cells have an anti-inflammatory effect. In some embodiments, pluripotent cells are differentiated using the single SMAD or dual SMAD methods disclosed herein. In some embodiments, pluripotent cells are differentiated using single SMAD, dual SMAD, or other approaches.

[0049] Compositions, cell populations, and pluripotent cell populations Disclosed are compositions comprising modified pluripotent cells, wherein a hairpin-like RNA, eg, pre-miR-155, is modified.

[0050] Disclosed is a composition comprising a modified pluripotent cell, wherein the pluripotent cell has been modified to promote miR-155-3p chain selection in differentiated cells. Disclosed is a composition comprising a modified pluripotent cell, wherein the pluripotent cell has been modified to promote miR-155-3p chain selection in differentiated cells. Disclosed is a composition comprising a modified pluripotent cell, wherein the pluripotent cell has been modified to promote miR-155-5p chain selection in differentiated cells. In some embodiments, the differentiated cell is a DA neuron.

[0051] Provided herein are genetically engineered mammalian stem and progenitor cells with increased differentiation potential into DA neural lineage cells, wherein the DA neural lineage cells have enhanced miR-155-3p chain selection compared to wild-type cells. Provided herein are genetically engineered mammalian stem and progenitor cells with increased differentiation potential into DA neural lineage cells, wherein the DA neural lineage cells have enhanced miR-155-3p chain selection compared to wild-type cells. Provided herein are genetically engineered mammalian stem and progenitor cells with increased differentiation potential into DA neural lineage cells, wherein the DA neural lineage cells have enhanced miR-155-5p chain selection compared to wild-type cells. Provided herein are genetically engineered mammalian stem and progenitor cells with increased differentiation potential into DA neural lineage cells, wherein the DA neural lineage cells have enhanced miR-155-5p chain selection compared to wild-type cells.

[0052] Provided herein are isolated modified pluripotent cells containing disrupted pre-miR-155-3p, disrupted pre-miR-155-5p, or both disrupted pre-miR-155-3p and pre-miR-155-5p. Isolated modified pluripotent cells containing disrupted pre-miR-155 stem loops. Isolated modified pluripotent cells containing disrupted pre-miR-155-3p, pre-miR-155-5p, and pre-miR-155 stem loops.

[0053] Provided herein are isolated, modified pluripotent cells comprising disrupted pre-miR-155-3p, disrupted pre-miR-155-5p, or disrupted pre-miR-155-3p and pre-miR-155-5p, wherein miR-155-3p strand selection is increased relative to wild-type miR-155-3p strand selection. Provided herein are isolated, modified pluripotent cells comprising disrupted pre-miR-155-3p, disrupted pre-miR-155-5p, or disrupted pre-miR-155-3p and pre-miR-155-5p, wherein miR-155-5p strand selection is increased relative to wild-type miR-155-5p strand selection.

[0054] Provided herein are genetically engineered mammalian cells comprising a heterologous sequence in their genome, the heterologous sequence comprising a transgene encoding a miR-155-3p strand selection agent, wherein the miR-155-3p strand selection agent promotes differentiation of the cells into a miR-155-3p-enriched DA cell population or promotes maintenance of the cells as a miR-155-3p-enriched DA cell population. In some embodiments, the miR-155-3p strand selection agent is SEQ ID NO: 7 or 8. In some embodiments, the miR-155-3p strand selection agent is SEQ ID NO: 9-21. In some embodiments, the miR-155-3p strand selection agent is SEQ ID NO: 6. In some embodiments, the engineered mammalian cells are differentiated using the single-SMAD or dual-SMAD methods disclosed herein.

[0055] Provided herein are genetically engineered mammalian cells comprising a heterologous sequence in their genome, the heterologous sequence comprising a transgene encoding a miR-155-5p strand selection agent, wherein the miR-155-5p strand selection agent promotes the differentiation of the cells into a miR-155-5p-enriched DA cell population or promotes the maintenance of the cells as a miR-155-5p-enriched DA cell population. In some embodiments, the miR-155-5p strand selection agent is SEQ ID NO: 6 or 8. In some embodiments, the miR-155-5p strand selection agent is SEQ ID NO: 7. In some embodiments, the engineered mammalian cells are differentiated using the single-SMAD or dual-SMAD methods disclosed herein.

[0056] Provided is a method for predisposing pluripotent cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons, comprising upregulating the level of at least one miRNA selected from the group consisting of miR-155-3p or miR-155-5p in the pluripotent cells, thereby predisposing the pluripotent cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons.

[0057] A method for predisposing pluripotent cells to differentiation into miR-155-3p-biased DA neurons is provided, comprising upregulating the level of exogenous miR-155-3p in the pluripotent cells and downregulating the level of miR-155-5p in the pluripotent cells, thereby predisposing the pluripotent cells to differentiation into miR-155-3p-biased DA neurons.

[0058] A method for predisposing pluripotent cells to differentiation into miR-155-5p-biased DA neurons is provided, comprising upregulating the level of exogenous miR-155-5p in the pluripotent cells and downregulating the level of miR-155-3p in the pluripotent cells, thereby predisposing the pluripotent cells to differentiation into miR-155-5p-biased DA neurons.

[0059] Provided is a method for predisposing pluripotent stem cells to differentiation into miR-155-3p-biased DA neurons or miR-155-5p DA neurons, the method comprising upregulating the level of at least one exogenous miRNA comprising or selected from the group consisting of miR-155-3p or miR-155-5p in the pluripotent stem cells, thereby predisposing the pluripotent stem cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons.

[0060] Provided is a population of isolated genetically modified cells comprising miR-155-5p and miR-155-3p or comprising at least one modified miRNA selected from the group consisting of miR-155-5p and miR-155-3p, wherein the genetically modified cells have a pluripotent cell phenotype. Provided is a population of isolated genetically modified cells comprising miR-155-5p and miR-155-3p or comprising at least one modified miRNA selected from the group consisting of miR-155-5p and miR-155-3p, and / or comprising at least one polynucleotide agent that hybridizes to and inhibits the function of at least one miRNA selected from the group consisting of miR-155-5p and miR-155-3p, wherein the genetically modified cells have a pluripotent cell phenotype.

[0061] Provided is a population of isolated genetically modified cells comprising miR-155-5p and miR-155-3p or comprising at least one modified miRNA selected from the group consisting of miR-155-5p and miR-155-3p, wherein the genetically modified cells have a DA neural cell phenotype. Provided is a population of isolated genetically modified cells comprising miR-155-5p and miR-155-3p or comprising at least one modified miRNA selected from the group consisting of miR-155-5p and miR-155-3p, and / or comprising at least one polynucleotide agent that hybridizes to and inhibits the function of at least one miRNA selected from the group consisting of miR-155-5p and miR-155-3p, wherein the genetically modified cells have a DA neural cell phenotype.

[0062] Provided is a population of genetically modified isolated cells comprising at least one modified miRNA comprising miR-155-3p or miR-155-5p or selected from the group consisting of miR-155-3p or miR-155-5p, and / or at least one polynucleotide agent that hybridizes to and inhibits the function of at least one miRNA comprising miR-155-3p or miR-155-5p or selected from the group consisting of miR-155-3p or miR-155-5p. In some embodiments, the population of genetically modified isolated cells is pluripotent cells. In some embodiments, the population of genetically modified isolated cells is neural cells. In some embodiments, the population of genetically modified isolated cells is DA neural cells.

[0063] Provided is a method for predisposing pluripotent cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons, comprising upregulating the level of at least one exogenous miRNA comprising or selected from the group consisting of miR-155-3p or miR-155-5p.

[0064] Provided is a method for predisposing pluripotent cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons, the method comprising downregulating the expression of at least one miRNA selected from the group consisting of miR-155-3p or miR-155-5p.

[0065] Provided is a method for predisposing pluripotent cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons, comprising contacting iPSCs with an agent that downregulates the amount and / or activity of miR-155-3p, thereby predisposing the iPSCs to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons.

[0066] Provided is a method for predisposing pluripotent cells to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons, comprising treating iPSCs with an agent that downregulates the amount and / or alters the activity of miR-155-5p, thereby predisposing the iPSCs to differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons.

[0067] As used herein, the phrase "predisposing pluripotent cells to differentiate into miR-155-3p-biased or miR-155-5p-biased DA neurons" refers to differentiating pluripotent cells along a neuronal lineage. The resulting cells may be fully differentiated into DA neurons or partially differentiated into DA neurons.

[0068] According to some embodiments, the pluripotent cells are isolated from a tissue selected from the group comprising bone marrow, adipose tissue, placenta, umbilical cord blood, and umbilical cord.

[0069] According to some embodiments, the pluripotent cells are autologous to the subject. According to some embodiments, the pluripotent cells are non-autologous to the subject. According to some embodiments, the pluripotent cells are semi-allogeneic to the subject.

[0070] According to some embodiments, miR-155-3p-biased or miR-155-5p-biased DA neuron cells are produced by differentiating pluripotent cells. The miR-155-3p-biased or miR-155-5p-biased DA neuron cells are produced by introducing at least one modified miRNA into pluripotent cells. According to some embodiments, the introduction of at least one miRNA into pluripotent cells is carried out by transfecting the pluripotent cells with an expression vector comprising a polynucleotide sequence encoding the pre-miRNA of at least one miRNA. In some embodiments, the at least one miRNA is miR-155-3p or miR-155-5p and / or a pre-miR-155 stem-loop species.

[0071] In some embodiments, the introduction of at least one miRNA into pluripotent cells is achieved by transfecting the pluripotent cells with an expression vector comprising a polynucleotide sequence encoding at least one miRNA. In some embodiments, the at least one miRNA is miR-155-3p or miR-155-5p and / or pre-miR-155 stem loop. In some embodiments, the at least one miRNA is selected from SEQ ID NOs: 6-21.

[0072] According to some embodiments, the method further comprises, after generation of the DA neurons, analyzing the expression of at least one marker selected from the group consisting of FOXA2, LMX1A, and TH.

[0073] DA neuron cell population A DA neuron cell population in which the level of miR-155-3p (5'CUCCUACAUAUUAGCAUUAACA3') or its variant is increased or decreased compared to wild-type. A DA neuron cell population in which the level of miR-155-3p (5'CUCCUACAUAUUAGCAUUAACA3') or its variant is increased or decreased compared to miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3').

[0074] A DA neuron cell population in which the level of miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3') or its variant is increased or decreased compared to wild-type. A DA neuron cell population in which the level of miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3') or its variant is increased or decreased compared to miR-155-5p (5'GGAAUGCUAAUCGUGAUAGGGGUU3').

[0075] A DA neuron cell population in which the level of miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') or its variants is increased or decreased compared to wild-type. A DA neuron cell population in which the level of miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') or its variants is increased or decreased compared to miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3').

[0076] A DA neuron cell population in which the level of miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') or its variants is increased or decreased compared to wild-type. A DA neuron cell population in which the level of miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') or its variants is increased or decreased compared to miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3').

[0077] DA neuron cell populations in which the levels of miR-155-5p (5'GGAAUGCUAAUCGUGAUAGGGGUU3') or its variants are increased or decreased compared with miR-155-3p (5'CUCCUACAUAUUAGCAUUAACA3').

[0078] DA neuron cell populations in which the levels of miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3') or its variants are increased or decreased compared with miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3').

[0079] DA neuron cell populations in which the levels of miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') or its variants are increased or decreased compared with miR-155-3p (5'CUCCUACAUAUUAGCAUUAACA3').

[0080] DA neuron cell populations in which the levels of miR-155-3p (5'CUCCUACAUAUUAGCAUUAACA3') or its variants are increased or decreased compared with miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3').

[0081] A composition comprising an in vitro cell population, wherein a majority of cells in the cell population are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-5p-enhanced midbrain dopamine (DA) neurons.A composition comprising an in vitro cell population, wherein a majority of cells in the cell population are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-5p-modified midbrain dopamine (DA) neurons.

[0082] A composition comprising an in vitro cell population, wherein a majority of cells within the cell population are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-3p-modified midbrain dopamine (DA) neurons.

[0083] Disclosed is a composition comprising an in vitro cell population comprising modified miR-155-3p pluripotent cells and their differentiation into DA neurons to produce a miR-155-3p-biased DA neuron cell population with an anti-inflammatory phenotype. In some embodiments, the cell population is differentiated using the single-SMAD or dual-SMAD methods disclosed herein.

[0084] Disclosed is a composition comprising an in vitro cell population comprising modified pre-miR-155 pluripotent cells and their differentiation into DA neurons to produce a miR-155-5p-biased DA neuron cell population with a pro-inflammatory phenotype. In some embodiments, the cell population is differentiated using the single-SMAD or dual-SMAD methods disclosed herein.

[0085] In some embodiments, the DA neuronal cell population comprises three distinct cell populations: (1) A9 dopamine neurons, (2) astrocytes, and (3) vascular leptomeningeal cells (VLMCs).

[0086] In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway produces miR-155-3p-biased dopamine neurons. In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway produces miR-155-3p-biased astrocytes. In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway produces miR-155-3p-biased VLMCs. In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway (using a single SMAD, dual SMAD, or other approach) produces miR-155-3p-biased dopamine neurons, astrocytes, and VLMCs. In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway produces miR-155-3p-biased dopamine neurons, astrocytes, and VLMCs, wherein expression of miR-155-3p is higher in dopamine neurons compared to miR-155-3p-biased astrocytes and miR-155-3p-biased VLMCs. In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway produces miR-155-3p-biased dopamine neurons, astrocytes, and VLMCs, wherein expression of 155-3p is higher in astrocytes compared to miR-155-3p-biased dopamine neurons and miR-155-3p-biased VLMCs.In some embodiments, transfection of pluripotent cells with miR-155-3p and differentiation along a neuronal pathway produces miR-155-3p-biased dopamine neurons, astrocytes, and VLMCs, where expression of miR_155-3p is higher in VLMCs compared to miR-155-3p-biased dopamine neurons and miR_155-3p-biased dopamine neurons.

[0087] In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway produces miR-155-5p-biased dopamine neurons. In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway produces miR-155-5p-biased astrocytes. In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway (using a single SMAD, dual SMAD, or other approach) produces miR-155-5p-biased VLMCs. In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway produces miR-155-5p-biased dopamine neurons, astrocytes, and VLMCs. In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway produces miR-155-5p-biased dopamine neurons, astrocytes, and VLMCs, wherein expression of miR-155-5p is higher in dopamine neurons compared to miR-155-5p-biased astrocytes and miR-155-5p-biased VLMCs. In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway produces miR-155-5p-biased dopamine neurons, astrocytes, and VLMCs, wherein expression of miR-155-5p is higher in astrocytes compared to miR-155-5p-biased dopamine neurons and miR-155-5p-biased VLMCs.In some embodiments, transfection of pluripotent cells with miR-155-5p and differentiation along a neuronal pathway produces miR-155-5p-biased dopamine neurons, astrocytes, and VLMCs, wherein expression of miR-155-5p is higher in VLMCs compared to miR-155-5p-biased dopamine neurons and miR-155-5p-biased dopamine neurons.

[0088] In some embodiments, transfection of pluripotent cells is in a genomic safe harbor or transcription cassette whereby a pol II promoter drives expression of a minigene, the primary transcript of which contains the native sequence pre-mir-155, resulting in a miR-155-3p biased cell population, or an altered sequence resulting in a miR-155-5p biased cell population.

[0089] cell culture Another aspect of the present disclosure relates to a culture of modified pluripotent cells modified by the above-described method. The culture may be contained in a container. The pluripotent cells may be contained in a pharmaceutical preparation, such as a pharmaceutical preparation formulated for injection.

[0090] Another aspect of the present disclosure relates to a culture of modified midbrain dopaminergic (DA) neurons produced by the above-described method. The culture may be contained in a container. The neurons may be contained in a pharmaceutical preparation, such as a pharmaceutical preparation formulated for injection.

[0091] Diagnostic methods In some embodiments, a method for screening a test compound is disclosed, comprising: (a) contacting the test compound with miR-155-5p or miR-155-3p-enhanced DA neural cells; and (b) measuring the function, physiology, or viability of the cells. In some embodiments, the measuring step comprises testing for a toxicological response or an altered electrophysiological response of the cells.

[0092] Treatment method Provided is a method for treating a brain disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a population of isolated cells comprising miR-155-3p-biased or miR-155-5p-biased cells, thereby treating the brain disease or disorder. In some embodiments, the population of isolated miR-155-3p-biased or miR-155-5p-biased cells is a pluripotent cell. In some embodiments, the population of isolated miR-155-3p-biased or miR-155-5p-biased cells is a neural cell. In some embodiments, the population of isolated miR-155-3p-biased or miR-155-5p-biased cells is a DA neural cell. In some embodiments, the population of isolated miR-155-3p-biased or miR-155-5p-biased cells is an A9 dopamine neuron. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated cell population is astrocytes. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated cell population is VLMCs.

[0093] In some embodiments, a method of treating a disease in a mammalian subject is disclosed, comprising administering to the subject a therapeutically effective amount of miR-155-5p or miR-155-3p-biased DA neural cells. The mammalian subject may be a human. The disease may be a disease of the central nervous system (CNS). In some embodiments, the disease is a parkinsonian disorder, Parkinson's disease (PD), or Parkinson-plus syndrome (PPS). In some embodiments, the disease is multiple sclerosis, epilepsy, amyotrophic lateral sclerosis (ALS), stroke, Rett syndrome, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, stroke, Alzheimer's disease, or Huntington's disease. According to some embodiments, the method of treating a disease is for use in treating a neurological disease.

[0094] In one embodiment, a method of in vivo cell engraftment for therapeutic treatment is provided, comprising: a) providing a subject exhibiting i) a population of midbrain dopamine (DA) neurons in which miR-155-5p is expressed more than miR-155-3p, and ii) at least one neurological condition; and b) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow for in vivo engraftment and provide dopamine (DA) neuron system function. In one embodiment, a method of in vivo cell engraftment for therapeutic treatment is provided, comprising: a) providing a subject exhibiting i) a population of midbrain dopamine (DA) neurons in which miR-155-3p is expressed more than miR-155-5p, and ii) at least one neurological condition; and b) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow for in vivo engraftment and provide dopamine (DA) neuron system function. In one embodiment, the neurological symptom is selected from the group consisting of tremor, bradykinesia (extremely slow movements), flexed posture, postural sway, and rigidity. In one embodiment, the subject exhibits a reduction in the neurological symptom. In one embodiment, the population of midbrain dopamine (DA) neurons is derived from a cell population selected from the group including primates and humans. In one embodiment, the human cells are derived from a patient with symptoms of Parkinson's disease (PD).

[0095] In one aspect, disclosed are in vitro cell populations having a unique molecular profile in that the microRNA (miR or miRNA) and / or miRNA profile of the cell population comprises more miR-155-3p compared to miR-155-5p, or more modified miR-155-3p compared to unmodified miR-155-3p, or more modified miR-155-5p compared to unmodified miR-155-5p. In one aspect, disclosed are in vitro cell populations having a unique molecular profile in that the microRNA (miR or miRNA) and / or miRNA profile of the cell population comprises more miR-155-5p compared to miR-155-3p. In one aspect, an in vitro cell population is disclosed, wherein the in vitro cell population has a unique molecular profile in that the microRNA (miR or miRNA) and / or miRNA profile of the cell population contains more miR-155-3p compared to miR-155-5p.In one embodiment, the in vitro cell composition is 1 fold or more, 2 fold or more, 3 fold or more, 4 fold or more, 5 fold or more, 6 fold or more, 7 fold or more, 8 fold or more, 9 fold or more, 10 fold or more, 11 fold or more, 12 fold or more, 13 fold or more, 14 fold or more, 15 fold or more than miR-155-5p. In one embodiment, the in vivo miR-155-3p comprises, or alternatively consists essentially of, or even consists of, more than, 16-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, 95-fold or more, or 99-fold or more miR-155-3p. The in vitro cell composition may be 1 fold or more, 2 fold or more, 3 fold or more, 4 fold or more, 5 fold or more, 6 fold or more, 7 fold or more, 8 fold or more, 9 fold or more, 10 fold or more, 11 fold or more, 12 fold or more, 13 fold or more, 14 fold or more, 15 fold or more than miR-155-3p. more, 16-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, 95-fold or more, or 99-fold or more miR-155-5p, or alternatively, consists essentially of, or even consists of, miR-155-5p.In some embodiments, the in vitro cell population is a pluripotent cell. In some embodiments, the in vitro cell population is a DA neuron. In some embodiments, the in vitro cell population is an A9 dopamine neuron, an astrocyte, or a vascular leptomeningeal cell (VLMC). These compositions are useful for treating diseases, such as neurological diseases, Parkinson's disease, and related disorders, including but not limited to parkinsonian disorders.

[0096] The present disclosure also provides a pharmaceutical composition comprising, alternatively consisting essentially of, or even consisting of a pharmaceutically acceptable carrier and an effective amount of cells differentiated from pluripotent cells. In one embodiment, the differentiated cell population has a unique molecular profile in that the microRNA (miR) contains more miR-155-3p than miR-155-5p, or more modified miR-155-3p than unmodified miR-155-3p, or more modified miR-155-5p than unmodified miR-155-5p. In one embodiment, the differentiated cell population has a unique molecular profile in that the microRNA (miR) contains more miR-155-3p than wild-type. In one embodiment, the differentiated cell population has a unique molecular profile in that the microRNA (miR) contains more miR-155-5p than miR-155-3p. In one aspect, the differentiated cell population has a unique molecular profile in that the microRNAs (miRs) contain more miR-155-5p compared to wild-type cells. In one aspect, the differentiated cell population has a unique molecular profile in that the microRNAs (miRs) contain more miR-155-3p compared to miR-155-5p. In one aspect, the differentiated cell population has a unique molecular profile in that the microRNAs (miRs) contain more miR-155-5p compared to wild-type cells. In some embodiments, the cells differentiated from the pluripotent cells are DA neurons. In some embodiments, the cells differentiated from the pluripotent cells are A9 dopamine neurons, astrocytes, or vascular leptomeningeal cells (VLMCs).

[0097] In a further embodiment, the cell population of the above-described composition is identified by a microRNA (miR) profile by a lack of upregulation of miR-155-5p relative to miR-155-3p. In a further embodiment, the cell population of the above-described composition is identified by a microRNA (miR) profile by a lack of upregulation of miR-155-3p relative to miR-155-5p.

[0098] For each of the compositions described above, the composition can be administered to a subject identified as likely to have a neurological disorder, such as Parkinson's disease.

[0099] The composition is useful for preparing a medicament and / or for carrying out a method for one or more of a) inhibiting the progression of, b) preventing, or c) treating Parkinson's disease or related disorders in a subject in need thereof. The method comprises, alternatively consists essentially of, or even consists of administering an effective amount of the above-mentioned pharmaceutical composition to the subject. Non-limiting examples of related disorders are selected from the group consisting of Huntington's disease, Alzheimer's disease, and multiple sclerosis. These conditions are well known in the art and can be diagnosed by a treating physician.

[0100] Therapy and patient health can be monitored by determining the level of inflammatory response during and after treatment.

[0101] Also provided herein are isolated or purified cell populations isolated from bodily fluids (e.g., urine, saliva, lymph, breast milk, blood, serum, and / or plasma) of non-diseased subjects or differentiated from iPSCs. In one embodiment, the cell populations have a unique molecular profile in that the microRNA (miR) profile in the cell population comprises upregulation of miR-155-3p, or upregulation of miR-155-3p compared to miR-155-5p, or upregulation of miR-155-3p compared to wild-type.

[0102] Also provided herein are isolated or purified cell populations isolated from bodily fluids (e.g., urine, saliva, lymph, breast milk, blood, serum, and / or plasma) of non-diseased subjects or differentiated from iPSCs. In one embodiment, the cell populations have a unique molecular profile in that the microRNA (miR) profile in the cell population comprises upregulation of miR-155-5p, or upregulation of miR-155-5p compared to miR-155-3p, or upregulation of miR-155-5p compared to wild-type.

[0103] Pharmaceutical compositions are provided comprising a population of isolated cells described herein and a pharmaceutically acceptable carrier. In some embodiments, the population of isolated cells comprises a miR-155-3p-biased or miR-155-5p-biased cell population. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated cell population is a pluripotent cell. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated cell population is a neural cell. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated cell population is a DA neural cell. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated cell population is an A9 dopamine neuron, an astrocyte, or a vascular leptomeningeal cell (VLMC).

[0104] Provided is a method for treating a neurological disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an isolated population, thereby treating the brain disease or disorder. In some embodiments, the isolated population of cells comprises a miR-155-3p-biased or miR-155-5p-biased cell population. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated population of cells is a pluripotent cell. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated population of cells is a neural cell. In some embodiments, the miR-155-3p-biased or miR-155-5p-biased isolated population of cells is a DA neural cell.

[0105] According to some embodiments, the isolated population of cells is for use in treating a brain disease or disorder. According to some embodiments, the brain disease or disorder is a neurodegenerative disorder. According to some embodiments, the neurodegenerative disorder is selected from the group consisting of parkinsonism, multiple sclerosis, Parkinson's disease, epilepsy, amyotrophic lateral sclerosis (ALS), stroke, Rett syndrome, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, stroke, Alzheimer's disease, and Huntington's disease. According to some embodiments, the isolated population is for use in treating a neurological disease.

[0106] kit A kit comprising compounds necessary for modifying pre-miR-155-5p or pre-miR-155-3p DA neurons.A kit comprising compounds necessary for differentiating pluripotent cells into miR-155-5p or miR-155-3p DA neurons.A kit comprising compounds necessary for differentiating pluripotent cells into miR-155-5p-biased or miR-155-3p-biased DA A9 dopamine neurons, astrocytes, and vascular leptomeningeal cells (VLMCs).

[0107] Also provided are kits for one or more of a) inhibiting progression, b) preventing, or c) treating Parkinson's disease or a related disorder in a subject in need thereof, comprising an effective amount of the above-described isolated or purified cell population and / or pharmaceutical composition and / or reagent and / or instructions for use. DETAILED DESCRIPTION OF THE INVENTION

[0108] Detailed Description Throughout this disclosure, various publications, patents, and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents, and published patent specifications are hereby incorporated by reference into this disclosure in order to more fully describe the state of the art to which this disclosure pertains.

[0109] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of those in the art. Such techniques are explained in detail in the literature, for example, in the following publications: For example, Sambrook and Russell eds. MOLECULAR CLONING: A LABORATORY MANUAL, 3rd edition (2001); the series CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FM Ausubel et al. eds. (2007)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc., NY); PCR 1: A PRACTICAL APPROACH (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A PRACTICAL APPROACH (MJ MacPherson, BD Hames and GR Taylor eds. (1995)); ANTIBODIES, A LABORATORY MANUAL (Harlow and Lane eds. (1999)); CULTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUE (RI Freshney 5th edition (2005); OLIGONUCLEOTIDE SYNTHESIS (MJ Gait ed. (1984)); Mullis et al. U.S. Patent No. 4,683,195; NUCLEIC ACID HYBRIDIZATION (B.D. Hames & S.J. Higgins eds. (1984)); NUCLEIC ACID HYBRIDIZATION (M.L.M. Anderson (1999)); TRANSCRIPTION AND TRANSLATION (B.D. Hames & S.J. Higgins eds.(1984)); IMMOBILIZED CELLS AND ENZYMES (IRL Press (1986)); B. Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING (1984); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (JH Miller and MP Calos eds. (1987) Cold Spring Harbor Laboratory); GENE TRANSFER AND EXPRESSION IN MAMMALIAN CELLS (SC Makrides ed. (2003)) IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLOGY (Mayer and Walker, eds., Academic Press, London (1987)); WEIR'S HANDBOOK OF EXPERIMENTAL IMMUNOLOGY (LA Herzenberg et al. eds (1996)). .

[0110] definition As used herein, certain terms may have the meanings defined below. As used in this specification and claims, the singular forms "a," "an," and "the" include singular and plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a single cell, as well as multiple cells, including mixtures thereof.

[0111] As used herein, the term "about" refers to ±10%.

[0112] As used herein, the term "comprising" is intended to mean that compositions and methods include the recited elements, but do not exclude others. "Consisting essentially of," when used to define compositions and methods, is intended to mean excluding other elements of any essential importance to the composition or method. "Consisting of" is intended to mean excluding other components of greater than trace elements for the claimed compositions and substantial method steps. Embodiments defined by each of these transition terms are within the scope of this disclosure. Thus, it is intended that methods and compositions may include (comprise) additional steps and components, or alternatively may include (consist essentially of) insignificant steps and compositions, or alternatively may include (consist only of) the recited method steps or compositions.

[0113] The terms "comprises," "comprising," "includes," "including," "having," and their conjugations mean "including but not limited to."

[0114] The term "consisting of" means "including and limited to."

[0115] The term "consisting essentially of" means that a composition, method, or structure may include additional ingredients, steps, and / or moieties, but only if the additional ingredients, steps, and / or moieties do not materially alter the basic and novel characteristics of the claimed composition, method, or structure.

[0116] All numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are approximations that vary (+) or (-) by increments of 0.1. Although not always explicitly stated, all numerical designations shall be understood to be preceded by the term "about." The term "about" also includes the exact value "X," as well as small increments or decrements of "X," e.g., "X+0.1" or "X-0.1." It should also be understood, although not always explicitly stated, that the reagents described herein are merely exemplary, and that equivalents of such are known in the art.

[0117] As used herein, the term "activator" or "activating" refers to small molecules, peptides, proteins, and compounds that activate molecules and result in directed differentiation of the modified pluripotent cells described herein. Exemplary activators include, but are not limited to, CHIR, sonic hedgehog (SHH) C25II, the small molecule Smoothened agonist purmorphamine, fibroblast growth factor (FGF), and the like.

[0118] As used herein, the term "activator of Sonic Hedgehog (SHH) signaling" refers to any molecule or compound that activates the SHH signaling pathway, including molecules or compounds that bind to PCT or Smoothened agonists, etc. Examples of such compounds are the protein Sonic Hedgehog (SHH) C25II and the small molecule Smoothened agonist purmorphamine.

[0119] The term "administration" can refer to a single dose, continuous or intermittent administration over the course of treatment. Methods for determining the most effective means and dosage of administration are known to those skilled in the art and vary depending on the composition used for treatment, the purpose of the treatment, the target cells being treated, the disease being treated, and the subject being treated. Single or multiple administrations can be performed, with the dose level and pattern selected by the treating physician. Appropriate dosage formulations and methods for administering drugs are known in the art. The route of administration can also be determined, and methods for determining the most effective route of administration are known to those skilled in the art and vary depending on the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and the target cells or tissues. Non-limiting examples of routes of administration include oral administration, intranasal administration, inhalation, injection, and topical application.

[0120] The agents of the present disclosure may be administered for therapy by any suitable route of administration, it being understood that the preferred route will vary with the condition and age of the recipient, and the disease being treated.

[0121] The term "aggregates", i.e., embryoid bodies, refers to homogeneous or heterogeneous clusters of cells, including differentiated cells, partially differentiated cells, and / or pluripotent stem cells, cultured in suspension.

[0122] As used herein, the term "cell" refers to a single cell as well as a population of cells (i.e., more than one). A population can be a pure population containing one cell type, for example, a population of neuronal cells, or a population of undifferentiated embryonic cells. Alternatively, a population can contain more than one cell type, for example, a mixed cell population. This is not meant to limit the number of cells in a population; for example, in one embodiment, a mixed population of cells can contain at least one differentiated cell. In some embodiments, there is no limit to the number of cell types that a cell population can contain.

[0123] As used herein, the term "CHIR99021" or "CHIR" or "aminopyrimidine" or "3-[3-(2-carboxyethyl)-4-methylpyrrole-2-methylidenyl]-2-indolinone" refers to the IUPAC designation 6-(2-(4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-ylamino)ethylamino)nicotinonitrile. CHIR99021 is an example of a small molecule chemical inhibitor of glycogen synthase kinase 3β (GSK3β), which activates the WNT signaling pathway, and is highly selective, exhibiting nearly 1000-fold selectivity against a panel of related and unrelated kinases, with an IC50 of 100 for human GSK3β. 50 = 6.7 nM and nanomolar IC for rodent GSK3β homologs 50 It has a value.

[0124] "DA neuron cells" or "DA neurons" are midbrain-fate cells that express FOXA2+, LMX1A+, and TH+.

[0125] As used herein, the term "differentiation" refers to the process by which an unspecialized embryonic cell acquires the characteristics of a specialized cell, such as a particular type of neuron, brain cell, heart, liver, or muscle cell. Differentiation is usually controlled by the interaction of a cell's genes with extracellular physical and chemical conditions through signaling pathways involving proteins embedded in the cell surface.

[0126] As used herein, the term "cell differentiation" refers to the pathway by which less specialized cells (i.e., stem cells) develop or mature to have more distinct morphologies and functions (e.g., iPSCs progress from neural crest precursors to cells of a neuronal lineage to floor plate midbrain precursor cells to midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons).

[0127] The terms "derived from," "established from," or "differentiated from," when referring to any cell disclosed herein, refer to cells obtained (e.g., isolated, purified, etc.) from a parent cell in a cell line, tissue (e.g., a dissociated embryo, or fluid using any manipulation, including, without limitation, single cell isolation, in vivo culture, treatment, and / or mutagenesis). Cells may be derived from another cell using, for example, chemical treatment, irradiation, induction of new protein expression by, for example, infection with a virus, transfection with a DNA / RNA sequence, contact (treatment) with a morphogen, etc., as well as selection (e.g., by continuous culture) of any cell type contained in the cultured parent cell. Derived cells can be selected from a mixed population by response to growth factors, cytokines, progression of selected cytokine treatment, adherence, lack of adherence, sorting procedures, etc.

[0128] As used herein, the term "directed differentiation" refers to the manipulation of stem cell culture conditions to induce differentiation into specific (e.g., desired) cell types, such as floor-plate mesencephalic precursor cells and mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons. In one embodiment, the term "directed differentiation" with respect to cells refers to the use of small molecules, growth factor proteins, and other growth conditions that promote the transition of cells from a pluripotent state to more mature or specialized cell fates (e.g., central nervous system cells, neural cells, floor-plate mesencephalic precursor cells, and mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons, etc.). In one preferred embodiment, the initiation of directed differentiation is the contact of cells with LDN / SB on day 0. Cells undergoing directed differentiation as described herein result in the formation of the non-default cell types floor-plate mesencephalic precursor cells and mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons.

[0129] As used herein, the term "dopamine neurons" or "dopaminergic neurons" generally refers to cells capable of expressing dopamine. "Midbrain dopamine neurons" or "mDA" refer to putative dopamine-expressing cells in forebrain structures and dopamine-expressing cells in forebrain structures.

[0130] The term "complementary DNA" or "cDNA" means a single- or double-stranded DNA that contains a sequence complementary to an mRNA sequence and does not contain any intron sequences.

[0131] The term "antisense" refers to a nucleic acid molecule that is complementary to the respective mRNA molecule. Antisense constructs are indicated by a "-" or "*" symbol, or by an "a" or "antisense" before the DNA or RNA, e.g., "aDNA" or "aRNA."

[0132] The term "base pair" or "bp" refers to the partnership between adenine (A) and thymine (T) or cytosine (C) and guanine (G) in a double-stranded DNA molecule. In RNA, uracil (U) substitutes for thymine. Generally, the partnership is achieved by hydrogen bonding. For example, the sense nucleotide sequence "5'-ATCGU-3'" can form a perfect base pair with its antisense sequence "5'-ACGAT-3'". G and U can also form non-Watson-Crick pairings, for example, "5'-TGC-3'" can pair with "5'-GUA-3'".

[0133] The term "conserved" means that a nucleotide sequence is conserved relative to a preselected (reference) sequence when it non-randomly hybridizes to the exact complement of the preselected sequence.

[0134] The terms "complementary" or "complementarity" or "complementation" refer to matching base pairing between two polynucleotides (i.e., mRNA and cDNA sequences) related by the aforementioned "base pair (bp)" rules. For example, the sequence "5'-AGT-3'" is complementary to the sequence "5'-ACT-3'" and also to "5'-ACU-3'." G and U can also be complementary to each other in an RNA duplex or RNA-DNA pairing sequence. For example, the sequence "5'-UGC-3'" is complementary to the sequence "5'-GUA-3'" and also to "5'-GUG-3'" as well as "5'-GCG-3'" and "5'-GCA-3'." Complementarity can be between two DNA strands, a DNA and an RNA strand, or between two RNA strands. Complementarity can be "partial," "complete," or "total." Partial complementarity or complementarity occurs when only a portion of the nucleic acid bases match according to the base-pairing rules. Complete or total complementarity or complementarity occurs when the bases are completely or perfectly matched between nucleic acid strands. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions and detection methods that rely on binding between nucleic acids. Complementarity or percent complementarity refers to the number of mismatched bases relative to the total bases in one strand of nucleic acid. Thus, 50% complementarity means that half of the bases are mismatched and half are matched. Two strands of nucleic acid can be complementary even if the two strands differ in the number of bases. In this situation, complementarity occurs between the corresponding portions of the bases in the longer strand that pair with the bases in the shorter strand.

[0135] The term "complementary bases" refers to nucleotides that normally pair when DNA or RNA is in a double-stranded configuration, e.g., DNA-DNA, DNA-RNA, and RNA-RNA duplexes, as well as any duplex formed by pairing between partial DNA and partial RNA hybrid sequences.

[0136] The term "complementary nucleotide sequence" means that a sequence of nucleotides in a single-stranded molecule of DNA or RNA is sufficiently complementary to a sequence of nucleotides in another single strand to specifically hybridize between the two strands, resulting in hydrogen bonding.

[0137] As used herein, the term "derivative" refers to a chemical compound that has a similar core structure.

[0138] The term "differentiation" refers to the process by which less specialized cells form at least new, more "specialized" cell type progeny.

[0139] The term "day of differentiation" refers to the day of incubation of cells in medium, which is the start of exposure of pluripotent cells to differentiation medium on day 1. In some preferred embodiments, the differentiation medium on day 1 comprises a single SMAD inhibitor. Prior to incubation or culture in differentiation medium, the cells may be incubated for 1, 2, or 3 days, for example, in medium comprising or consisting of Essential 8™ Basal Medium and Essential 8™ Supplement (Thermo Fisher Scientific, Waltham, Mass.), optionally supplemented with a ROCK inhibitor (e.g., including, for example, H1152 at about 0.25-5 μM, 0.5, 0.75, 1, 1.25, 1.5, 2, 3, 4, or any range inducible therein, on day −2) and / or blebbestatin (e.g., at a concentration of about 0.1-20 μM, more preferably about 1.25-5 μM, or about 2.5 μM) prior to incubation in differentiation medium (i.e., on day 0, day −1, and / or day −2).

[0140] The term "effective amount" is intended to refer to the amount of a composition, compound, or agent (cell population) administered or delivered to a subject that is most likely to result in the desired response to treatment. The amount is empirically determined based on the patient's clinical parameters, including, but not limited to, stage of disease, age, sex, and histology.

[0141] The term "embryonic stem (ES) cells" refers to pluripotent stem cells derived from an early embryo. The phrase "embryonic stem cells" refers to embryonic cells that are capable of differentiating into cells of all three germ layers (i.e., endoderm, ectoderm, and mesoderm) or remaining in an undifferentiated state. The phrase "embryonic stem cells" can include cells obtained from embryonic tissue formed after conception (e.g., blastocyst), before implantation of the embryo (i.e., preimplantation blastocyst), expanded blastocyst cells (EBC) obtained from blastocysts at the postimplantation / pregastrulation stage (see WO2006 / 040763), and embryonic germ (EG) cells obtained from fetal germline tissue at any time during pregnancy, preferably before 10 weeks of gestation.

[0142] The term "essentially free" refers to a medium that has no or essentially no specified component derived from a source other than the cells in the medium. "Essentially free" of exogenously added growth factors or signaling inhibitors, such as TGFβ, bFGF, TGFβ superfamily signaling inhibitors, can refer to minimal or undetectable amounts of the exogenously added component. For example, a medium or environment essentially free of TGFβ or bFGF may contain less than 5 ng / mL, less than 4 ng / mL, less than 3 ng / mL, less than 2 ng / mL, less than 1 ng / mL, less than 0.9 ng / mL, less than 0.8 ng / mL, less than 0.7 ng / mL, less than 0.6 ng / mL, less than 0.5 ng / mL, less than 0.4 ng / mL, less than 0.3 ng / mL, less than 0.2 ng / mL, less than 0.1 ng / mL, less than 0.01 ng / mL, less than 0.001 ng / mL, or any range derivable therein. For example, a medium or environment that is essentially free of signal transduction inhibitors may contain less than 0.2 μM, less than 0.1 μM, less than 0.09 μM, less than 0.08 μM, less than 0.07 μM, less than 0.06 μM, less than 0.05 μM, less than 0.04 μM, less than 0.03 μM, less than 0.02 μM, less than 0.01 μM, less than 0.005 μM, less than 0.001 μM, or any range derivable therein.

[0143] The term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound. Examples of excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

[0144] The term "exon" refers to a portion or portions of a gene transcript sequence that encodes a protein reading frame (cDNA), for example, the cDNA of a cellular gene, growth factor, insulin, antibody, and their analogs / homologs and derivatives.

[0145] The term "expression," when applied to a gene, refers to the differential production of miR or mRNA transcribed from the gene or the protein product encoded by the gene. A differentially expressed gene can be overexpressed (high expression) or underexpressed (low expression) compared to the expression level of normal or control cells, a given patient population, or an internal control gene (housekeeping gene). In one embodiment, this refers to a difference that is about 1.5 times higher or lower than the expression level detected in a control sample, or alternatively about 2.0 times higher, alternatively about 2.0 times higher, alternatively about 3.0 times higher, alternatively about 5 times higher, alternatively about 10 times higher, alternatively about 50 times higher, or even more alternatively more than about 100 times higher. If the expression level of a gene of interest in a single patient is determined to be higher than the median expression level of the patient population, the patient is determined to have high expression (upregulation) of the gene of interest. Alternatively, if the expression level of a gene of interest in a single patient is determined to be lower than the median expression level of a patient population (down-regulated), then that patient is determined to have low expression of the gene of interest.

[0146] As used herein, the term "floor plate mesencephalic progenitor cells," referring to in vivo cells located in the midbrain, including during embryonic development of midbrain neurons, refers to cells that can differentiate into dopamine-producing cells. In some embodiments, "floor plate mesencephalic progenitor cells" refer to cells in culture used to artificially generate cultured cells in vitro, such as those in the cultured cells disclosed herein at approximately day 11 after the initiation of directed differentiation as described herein, that express an overlapping or identical set of markers compared to those expressed by in vivo cells, i.e., co-express the floor plate marker FOXA2 and the tectal plate markers LMX1A, OTX2, NGN2, and DDC. Preferably, floor plate mesencephalic progenitor cells are "FOXA2+LMX1A+" or "FOXA2 / LMX1A+." In some embodiments, the cells in the differentiated progenitor population that are underrepresented are FOXA2 / LMX1A / TH+.

[0147] As used herein, the terms "floor plate-derived DA neurons" or "bona fide midbrain DA neurons" or "midbrain-fate FOXA2+LMX1A+ dopamine (DA) neurons" or "floor plate midbrain dopamine (DA) neurons" or "engraftable midbrain DA neurons" or "mDA neurons" or "FOXA2+LMX1A+TH+" or "FOXA2 / LMX1A / TH" or "FOXA2+LMX1A+NURR1+TH+" or "FOXA2 / LMX1A / NURR1 / TH" refer to a population of engraftable midbrain DA neurons typically obtained by the methods described herein at or by about day 25 after the initiation of directed differentiation. In a preferred embodiment, "bona fide midbrain DA neurons" are FOXA2+ / LMX1A+ / NURR1+ / TH+. These neurons have been labeled "engraftable" after transplantation experiments in mice and primates, demonstrating their ability to reverse Parkinson-like neurological conditions without significant interference from nervous system overgrowth and teratoma formation. Midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons can be maintained in vitro for several months while retaining their engraftment potential.

[0148] As used herein, cells used to obtain floor plate midbrain progenitor cells and midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons are obtained from a variety of sources, including embryonic and non-embryonic sources, e.g., hESCs and non-embryonic hiPSCs (human induced pluripotent stem cells), somatic stem cells, disease stem cells, i.e., isolated pluripotent cells and engineered induced stem cells isolated from Parkinson's disease patients, cancer stem cells, human or mammalian pluripotent cells, etc.

[0149] The term "gene" refers to a nucleic acid composition in which an oligonucleotide or polynucleotide sequence encodes RNA and / or a polypeptide (protein). A gene may be either RNA or DNA. A gene may encode non-coding RNA, such as small hairpin RNA (shRNA), microRNA (miRNA), rRNA, tRNA, snoRNA, snRNA, and their RNA precursors and derivatives. Alternatively, a gene may encode protein-coding RNA, such as messenger RNA (mRNA) and its RNA precursors and derivatives, essential for protein / peptide synthesis. In some cases, a gene may encode a protein-coding RNA that also contains at least a microRNA or shRNA sequence.

[0150] The term "gene delivery" refers to a genetic engineering method selected from the group including polysome transfection, liposome transfection, chemical transfection, electroporation, viral infection, DNA / RNA recombination, transposon insertion, jumping gene insertion, microinjection, gene gun penetration, and combinations thereof.

[0151] As used herein, the locus (MIR-155HG or BIC) may be native, i.e., unedited, or edited. If edited, transcription of pre-MIR-155 may result in processing that enhances miR-155-3p or miRNA-155-5p.

[0152] The term "genetic manipulation" refers to a DNA / RNA recombination method selected from the group including DNA / RNA restriction and ligation, homologous recombination, transgene recombination, transposon insertion, jumping gene integration, retroviral infection, and combinations thereof.

[0153] As used herein, the term "glycogen synthase kinase 3β inhibitor" or "GSK3β inhibitor" refers to a compound that inhibits glycogen synthase kinase 3β enzyme, see, for example, Doble, et al., J Cell Sci. 2003; 116:1175-1186, which is incorporated herein by reference. GSK3β inhibitors can activate the WNT signaling pathway, see, for example, Cadigan, et al., J Cell Sci. 2006; 119:395-402, Kikuchi, et al., Cell Signaling. 2007; 19:659-671, which are incorporated herein by reference.

[0154] As used herein, the term "highly enriched population" refers to a population of cells, e.g., a population of cells in a culture dish, that express a marker at a higher percentage or amount than a comparison population; for example, treating a cell culture contacted with LSB with purmorphamine on day 1 and CHIR on day 3 results in a highly enriched population of floor plate midbrain progenitor cells compared to treatment with LSB alone. In other examples, enriched populations are populations obtained by sorting or separating cells that express one or more markers from cells that do not express the desired markers, e.g., a CD142-enriched population, an A9-enriched population, etc.

[0155] The term "homologous" or "homology" refers to the similarity between a polynucleotide and a gene or mRNA sequence. A nucleic acid sequence can be, for example, partially or completely homologous to a particular gene or mRNA sequence. Homology can be expressed as a percentage determined by the number of similar nucleotides relative to the total number of nucleotides. Also, thymine (T) and uracil (U) are homologous to each other. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, but preferably less than 25% identity, with one of the sequences of the present disclosure.

[0156] The term "hybridize" or "hybridization" refers to the formation of a duplex between nucleotide sequences that are sufficiently complementary to form a complex through base pairing. When a primer (or splice template) "hybridizes" with a target (template), such a complex (or hybrid) is sufficiently stable to perform the priming function required for DNA / RNA polymerase to initiate DNA / RNA synthesis. There is a specific, i.e., non-random, interaction between two complementary polynucleotides that can be competitively inhibited.

[0157] The term "induced pluripotent stem cells," commonly abbreviated as "iPS cells" or "iPSCs," refers to a type of pluripotent stem cell that is artificially prepared from a non-pluripotent cell, typically an adult somatic cell, or a terminally differentiated cell, such as a fibroblast, hematopoietic cell, muscle cell, neuron, epidermal cell, or the like, by introducing or contacting it with a reprogramming factor. Induced pluripotent stem cells have pluripotency (i.e., they can differentiate into the three embryonic germ cell layers: endoderm, ectoderm, and mesoderm). According to some embodiments, induced pluripotent stem cells are formed by inducing expression of Oct-4.

[0158] As used herein, the term "inhibitor" or "signal transduction inhibitor" refers to a compound or molecule (e.g., a small molecule, peptide, peptidomimetic, natural compound, protein, siRNA, antisense nucleic acid, aptamer, or antibody) that interferes with (i.e., reduces or suppresses or eliminates or blocks) the signal transduction function of a molecule or pathway, in relation to inhibiting a signal transduction molecule or pathway of a signal transduction molecule, e.g., an inhibitor of SMAD signaling, an inhibitor of glycogen synthase kinase 3β (GSK3β). In other words, an inhibitor is any compound or molecule that alters any activity of a named protein (signaling molecule, any molecule involved in a named signaling molecule, a named associated molecule, e.g., glycogen synthase kinase 3β (GSK3β)) (including, but not limited to, signaling molecules described herein), by, by way of example only, directly interfering with SMAD signaling, contacting SMAD mRNA, causing a conformational change in SMAD, reducing SMAD protein levels, or interfering with the interaction of SMAD with signaling partners (including, e.g., those described herein), and affecting the expression of SMAD target genes (e.g., those described herein). Inhibitors also include molecules that indirectly regulate SMAD biological activity by blocking upstream signaling molecules. Thus, in one embodiment, the inhibitor induces (alter) or alters differentiation from a default cell type to a non-default cell type, e.g., one of the methods disclosed herein, including LDN / SB, CHIR, and SHH activators (which can inhibit glycogen synthase kinase 3β), differentiated precursor cells into non-default neural precursor cells. The inhibitor "alter," "decreases," or "blocks" default signaling to direct cell differentiation toward non-default cell types, e.g., to differentiate into floor plate midbrain precursor cells and midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons, as described herein.Therefore, inhibitors are natural compounds or small molecules that change the activity of signal molecules in a manner that contributes to the differentiation of the starting cell population (day 0) into floor-plate mesencephalic precursor cells. When precursor cells are contacted with inhibitors, these small molecules can contribute to further differentiation into mesencephalic-destined FOXA2 / LMX1A+ dopamine (DA) neurons. In addition to causing inhibition of designated molecules by binding to or affecting upstream molecules from designated signaling molecules, inhibitors are also described in terms of competitive inhibition (binding to the active site in a manner that eliminates or reduces the binding of another known binding compound) and allosteric inhibition (binding to a protein in a manner that changes the conformation of the protein, interfering with the binding of the compound to the active site of the protein). In some cases, inhibitors are referred to as "direct inhibitors," which refer to the inhibition of signaling targets or signaling target pathways by actually contacting the signaling target; for example, a direct inhibitor of gamma secretase is a DAPT molecule that binds to gamma secretase protein.

[0159] The term "intron" refers to a portion or portions of a gene transcript sequence that encodes a non-protein reading frame, for example, in-frame introns, 5'-UTR, and 3'-UTR.

[0160] The term "isolated," as used herein, refers to a molecule or biological or cellular material that is substantially free of other materials. In one aspect, the term "isolated" refers to a nucleic acid, e.g., DNA or RNA, or a protein or polypeptide, or a cell or cellular organelle, or a tissue or organ, that has been separated from other DNA or RNA, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in their natural source. The term "isolated" also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium if produced by recombinant DNA / RNA techniques, or chemical precursors or other chemicals if chemically synthesized. Furthermore, "isolated nucleic acid" is meant to include nucleic acid fragments that are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to polypeptides that have been isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term "isolated" is also used herein to refer to cells or tissues that have been isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.

[0161] As used herein, the term "kit" refers to any delivery system for delivering materials. In the context of cell differentiation, a kit may refer to a combination of materials for contacting stem cells, and such a delivery system may include a system that allows for the storage, transport, or delivery of reaction reagents and / or auxiliary materials (e.g., buffers, instructions for performing cell differentiation, etc.) from one location to another in an appropriate container (e.g., tube, etc.) (e.g., compounds, proteins, detection agents (e.g., antibodies that bind to tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), etc.). For example, the kit may include relevant reaction reagents for inhibiting signaling pathways, such as inhibitors for reducing transforming growth factor beta (TGFβ) / activin-Nodal signaling, such as SB431542 (or an SB431542 substitute), inhibitors for reducing SMAD signaling, such as LDN-193189 (or an LDN-193189 substitute), inhibitors for reducing glycogen synthase kinase 3β (GSK3β), 1 Examples include those for activation of Wingless (Wnt or Wnts) signaling, also known as activators of WNT signaling (WNT agonists), such as CHIR99021 (or CHIR99021 substitutes), activators of Sonic Hedgehog (SHH) signaling (e.g., smoothened (SMO) receptor small molecule agonists), such as the Sonic Hedgehog (SHH) C25II molecule, purmorphamine, and other activators with fibroblast growth factor 8 (FGF8) activity. It comprises one or more enclosed containers (e.g., boxes or bags, test tubes, Eppendorf tubes, capillary tubes, multi-well plates, etc.) containing molecules such as fibroblast growth factor 8 (FGF8), as well as neuronal maturation molecules such as brain-derived neurotrophic factor (BDNF), ascorbic acid (AA), glial cell line-derived neurotrophic factor, dibutyryl cAMP, and transforming growth factor beta 3, such as molecules that can replace these components, and / or auxiliary materials.In one embodiment, the reagents in the kit may be in solution, frozen, or lyophilized. In one embodiment, the reagents in the kit may be in individual containers or provided in specific combinations, such as LSB (LDN-193189 and SB431542), a sonic hedgehog (SHH) C25II molecule and purmorphamine, a sonic hedgehog (SHH) C25II molecule, purmorphamine, and CHIR99021, or purmorphamine and CHIR99021, a neuronal system maturation molecule, etc.

[0162] The terms "absence of upregulation" and "absence of downregulation" mean that the microRNA marker is not determined to be over- or under-expressed compared to a predetermined value. In one embodiment, the predetermined value is a preliminary value from a subject before subsequent measurement (such as before treatment), or a value from a subject population with or without clinical symptoms of a related disorder. For example, when the present disclosure relates to the treatment of Parkinson's disease, the predetermined value may be the mean or median exosomal miRNA value measured from a subject population with or without fibrotic disease or liver disease or related disorders.

[0163] As used herein, the term "LDN-193189" refers to C 25 H 22It refers to the small molecule DM-3189, with the chemical formula N6, and the IUPAC name 4-(6-(4-(piperazin-1-yl)phenyl)pyrazolo[1,5-a]pyrimidin-3-yl)quinoline. LDN-193189 can function as a SMAD signaling inhibitor. LDN-193189 is also a highly potent small molecule inhibitor of ALK2, ALK3, and ALK6, protein tyrosine kinases (PTKs), and inhibits signaling of members of the ALK1 and ALK3 family of type I TGFβ receptors, resulting in inhibition of transduction of multiple biological signals, including bone morphogenetic protein (BMP) BMP2, BMP4, BMP6, BMP7, and activin cytokine signals, and subsequent SMAD phosphorylation of Smad1, Smad5, and Smad8 (Yu et al. (2008) Nat Med 14:1363-1369; Cuny et al. (2008) Bioorg. Med. Chem. Lett. 18: 4388-4392, incorporated herein by reference).

[0164] As used herein, the term "LSB" refers to a combination of two compounds, LDN-193189 and SB431542, that can reduce or block signal transduction consisting of transforming growth factor beta (TGFβ) / activin-Nodal signaling and Small Mothers Against Decapentaplegic (SMAD) signaling in cells.

[0165] As used herein, the term "method" refers to ways, means, techniques, and procedures for accomplishing a given task, including, but not limited to, ways, means, techniques, and procedures that are either known to or readily developed from known ways, means, techniques, and procedures by practitioners in the fields of chemistry, pharmacology, biology, biochemistry, and medicine.

[0166] The term "messenger RNA" or "mRNA" refers to the assembly of pre-mRNA exons that are formed after introns are removed by the intracellular RNA splicing machinery (spliceosome) and function as protein-coding RNA for peptide / protein synthesis. Peptides / proteins encoded by mRNA include, but are not limited to, enzymes, growth factors, insulin, antibodies, and their analogs / homologs and derivatives.

[0167] The term "microRNA" or "miRNA" refers to a single-stranded RNA capable of binding to targeted gene transcripts (mRNAs) with partial complementarity to the microRNA sequence. Mature microRNAs are typically approximately 17–27 oligonucleotides in length and, depending on the complementarity between the microRNA and its target mRNA, can either directly degrade its intracellular mRNA target or suppress protein translation of its targeted mRNA. Natural microRNAs are found in nearly all eukaryotic organisms, functioning as defenses against viral infections and enabling the regulation of the expression of specific genes during plant and animal development. In principle, a single microRNA often targets multiple target mRNAs to achieve its full functionality, while multiple miRNAs may target the same gene transcript to enhance the effects of gene silencing.

[0168] The term "microRNA precursor" or "pre-miRNA" refers to a hairpin-like single-stranded RNA containing a stem arm and a stem-loop region that interacts with the intracellular RNase III Dicer endoribonuclease to produce one or more mature microRNAs (miRNAs) that can silence a targeted gene or a specific group of targeted genes containing full or partial complementarity to the mature microRNA sequence. The stem arm of a pre-miRNA can form either a fully (100%) or partially (mismatched) hybrid duplex, while the stem-loop connects to one end of the stem-arm duplex to form a circle or hairpin loop configuration required for assembly into the RNA-induced silencing complex (RISC) with certain Argonaute proteins (AGOs).

[0169] As used herein, the term "neurological disease or condition" refers to a pathological condition that has symptoms and clinical markers of fibrotic tissue, such as systemic sclerosis, kidney, lung, or heart strain, myocardial infarction, and chronic liver disease (e.g., hepatitis, alcoholic liver disease, or non-alcoholic steatohepatitis), and / or in various organs or tissues, such as the liver, heart, kidney, lung, pancreas, joints, and eye. Non-limiting examples of fibrotic conditions and related disorders are provided in Figure 9, including, but not limited to, scleroderma, keloids, and rheumatoid arthritis.

[0170] The terms "neuron," or "neural cell," or "neural cell type," or "neural lineage" can include any neuronal lineage cell and, unless otherwise specified, can be interpreted to refer to a cell at any stage of neuronal ontogeny without any limitation. For example, neurons can include neuronal precursor cells, mature neurons, and nervous system cell types, such as astrocytes.

[0171] As used herein, the term "neural lineage cells" refers to cells that contribute to the nervous system (both central and peripheral) or neural crest cell fate during development or in adults. The nervous system includes the brain, spinal cord, and peripheral nervous system. Neural crest cell fate includes the skull, trunk, vagus nerve, sacrum, and heart, and gives rise to parts of the mesoectoderm, cranial cartilage, skull, thymus, teeth, melanocytes, iris pigment cells, cranial ganglia, dorsal root ganglia, sympathetic / parasympathetic ganglia, endocrine cells, enteric nervous system, and heart.

[0172] The term "non-coding RNA" or "ncRNA" refers to RNA transcripts that cannot be used to synthesize peptides or proteins through intracellular translational mechanisms.Non-coding RNA includes long and short regulatory RNA molecules, such as microRNA (miRNA), short hairpin RNA (shRNA), small interfering RNA (siRNA), and double-stranded RNA (dsRNA).These regulatory RNA molecules usually function as gene silencers, and interfere with the expression of intracellular genes that contain either complete or partial complementarity to non-coding RNA.

[0173] The term "nucleic acid composition" refers to an oligonucleotide or polynucleotide, for example, a DNA or RNA sequence, or a mixed DNA / RNA sequence, in either a single-stranded or double-stranded molecular structure.

[0174] The term "nucleic acid template" refers to a double-stranded DNA molecule, a double-stranded RNA molecule, a hybrid molecule, such as a DNA-RNA or RNA-DNA hybrid, or a single-stranded DNA or RNA molecule.

[0175] The term "nucleotide" refers to a monomeric unit of DNA or RNA consisting of a sugar moiety (pentose), a phosphate, and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via the glycosidic carbon (the 1' carbon of the pentose), and the base and sugar combination is a nucleoside. A nucleoside containing at least one phosphate group attached to the 3' or 5' position of the pentose is a nucleotide. DNA and RNA are composed of different types of nucleotide units called deoxyribonucleotides and ribonucleotides, respectively.

[0176] The term "nucleotide analog" refers to a purine or pyrimidine nucleotide that is structurally different from adenine (A), thymine (T), guanine (G), cytosine (C), or uracil (U), but is sufficiently similar to substitute for the normal nucleotide in a nucleic acid molecule.

[0177] The term "oligonucleotide" refers to a molecule composed of two or more, preferably more than three, and usually more than 10 monomer units of DNA and / or RNA. Oligonucleotides longer than 13 nucleotide monomers are also referred to as polynucleotides. The exact size depends on many factors, which depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be produced in any manner, including chemical synthesis, DNA replication, RNA transcription, reverse transcription, or a combination thereof.

[0178] The terms "overexpression" or "underexpression" refer to increased or decreased expression, or alternatively, differential expression, of a gene in a test sample compared to the expression level of that gene in a control sample. In one aspect, the test sample is a diseased cell and the control sample is a normal cell. In another aspect, the test sample is an experimentally manipulated or biologically altered cell and the control sample is a cell prior to the experimental manipulation or biological alteration. In yet another aspect, the test sample is a sample from a patient and the control sample is a similar sample from a healthy individual. In a still further aspect, the test sample is a sample from a patient and the control sample is a similar sample from a patient without the desired clinical outcome. In one embodiment, differential expression is about 1.5-fold, or alternatively about 2.0-fold, or alternatively about 2.0-fold, or alternatively about 3.0-fold, or alternatively about 5-fold, or alternatively about 10-fold, or alternatively about 50-fold, or even more alternatively more than about 100-fold higher or lower than the expression level detected in a control sample. Alternatively, genes are referred to as "overexpressed" or "underexpressed." Alternatively, genes may be referred to as "upregulated" or "downregulated."

[0179] The term "parkinsonism" refers to a group of disorders all associated with a lack of dopamine in the basal ganglia, the part of the brain that controls movement. Symptoms include tremor, bradykinesia (extremely slow movements), flexed posture, postural instability, and rigidity. A diagnosis of parkinsonism requires the presence of at least two of these symptoms, one of which must be tremor or bradykinesia. The most common form of parkinsonism is idiopathic or classic Parkinson's disease (PD), but a small minority of diagnoses, approximately 15 percent of all cases, may also have one of the Parkinson's Plus Symptoms (PPS) syndromes. These syndromes, also known as atypical parkinsonism, include corticobasal degeneration, dementia with Lewy bodies, multiple system atrophy, and progressive supranuclear palsy. Generally, Parkinson's disease involves the abnormal function and death of key nerve cells in the brain, primarily in an area of ​​the brain called the substantia nigra. Many of these important nerve cells produce dopamine, so when these neurons die, the amount of dopamine produced by differentiation in the brain decreases, and movement cannot be controlled normally. The intestines also have dopamine cells that degenerate in Parkinson's disease patients, which may be an important causative factor in the gastrointestinal symptoms that are part of the disease. The symptoms experienced by individuals vary from person to person. The main motor signs of Parkinson's disease include: tremors in the hands, arms, legs, jaw, and face; bradykinesia or slowness of movement; rigidity or stiffness of the limbs and trunk; and postural instability or impaired balance and coordination.

[0180] The term "pharmaceutical composition" is intended to include a combination of a population of active exosomes or cell populations with an inert or active carrier, e.g., a solid support, that renders the composition suitable for diagnostic or therapeutic use in vitro, in vivo, or ex vivo.

[0181] The term "pharmaceutically acceptable carrier" includes standard pharmaceutical carriers, such as phosphate buffered saline solution, water, and emulsions, such as oil / water emulsions or water / oil emulsions, as well as any of various types of wetting agents. The composition may also include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see Martin (1975) Remington's Pharm. Sci., 15th Ed. (Mack Publ. Co., Easton).

[0182] The terms "pluripotency" or "pluripotent" refer to stem or undifferentiated cells that have the capacity to differentiate into all of the cells that make up one or more tissues or organs, for example, any of the three germ layers: endoderm (stomach lining, digestive tract, lungs), mesoderm (muscle, bone, blood, urogenital tract), or ectoderm (epidermal tissue and nervous system).

[0183] The term "post-transcriptional gene silencing" refers to a targeted gene knockout or knockdown effect at the level of mRNA degradation or translational repression, which is usually triggered by either exogenous / viral DNA or RNA transgenes or small inhibitory RNAs.

[0184] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein when referring to gene products.

[0185] In one embodiment of the present disclosure, a "predetermined threshold level" or "threshold" is used to categorize expression as high or low. As a non-limiting example of the present disclosure, the threshold level of exosomal miR is the level of miR expression found in a subject diagnosed with fibrotic disease or liver disease or related disorders. Alternatively or additionally, the predetermined threshold level is the miRNA expression level of that individual subject measured before subsequent measurements, for example, before treatment or before further administration of treatment.

[0186] In one aspect of the present disclosure, miR expression may be provided as a ratio above a threshold level and therefore categorized as high expression or upregulation, while ratios below the threshold level may be categorized as downregulation or low expression.

[0187] As used herein, the term "predetermined value" of a gene is selected so that patients with an expression level of the gene higher than the predetermined value are more likely to experience a generally desirable clinical outcome than patients with an expression level of the same gene lower than the predetermined value, and vice versa. The expression level of a gene, for example, that disclosed in the present disclosure, is associated with a clinical outcome. Those skilled in the art can determine the predetermined value of a gene by comparing the expression level of the gene in patients with a more desirable clinical outcome with those with a less desirable clinical outcome. In one aspect, the predetermined value is the gene expression value that best separates patients into a group with a more desirable clinical outcome and a group with a less desirable clinical outcome. Such gene expression values ​​can be determined mathematically or statistically using methods well known in the art.

[0188] The term "primary RNA transcript" means an RNA sequence that is directly transcribed from a gene without any RNA processing or modification, which may be selected from the group consisting of mRNA, hnRNA, rRNA, tRNA, snoRNA, snRNA, pre-microRNA, viral RNA, and RNA precursors thereof, and derivatives.

[0189] The term "precursor messenger RNA" or "pre-mRNA" refers to the primary RNA transcript of a protein-coding gene, which in eukaryotes is produced by the eukaryotic type II RNA polymerase (Pol-II) machinery through an intracellular mechanism called transcription. The pre-mRNA sequence contains a 5'-untranslated region (UTR), a 3'-UTR, exons, and introns.

[0190] The term "promoter" is used herein in its ordinary sense to refer to a nucleotide region containing a DNA or RNA regulatory sequence, where the regulatory sequence is derived from a gene capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding sequence.

[0191] As used herein, the terms "purified," "purifying," "purification," "isolated," "isolating," "isolation," and their grammatical equivalents refer to the reduction of the amount of at least one contaminant from a sample. For example, the desired cell type is purified by at least 10%, preferably at least 30%, more preferably at least 50%, even more preferably at least 75%, and most preferably at least 90%, with a corresponding reduction in the amount of undesired cell types; for example, directed differentiation of pluripotent cells results in a desired increase in the purity of differentiated floor plate mesencephalic precursor cells or mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons. In other words, "purifying" and its equivalents refer to the removal of certain cells (e.g., undesired cells) from a sample, either mechanically, for example, by flow cytometer cell sorting, or through directed differentiation. For example, to differentiate a purified population of forkhead box protein A2 (FOXA2)+ LIM homeobox transcription factor 1, alpha (LMX1A)+ progenitor cells, the progenitor cells are purified by removing contaminating PAX6 neuronal cells by sorting a mixed cell population into double-positive forkhead box protein A2 (FOXA2)+ LIM homeobox transcription factor 1, alpha (LMX1A)+ cells by flow cytometry, and midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons are also purified or "selected" from non-dopamine (DA) (default cells) by using specified cell culture methods, including the compositions and methods disclosed herein. Removal or selection of non-midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neuronal cells results in an increased proportion of the desired midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons in the sample. Thus, purification of a cell type results in an "enrichment," i.e., an increase in the amount, of the desired cells in the sample, i.e., midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons.

[0192] The term "RNA interference" or "RNAi" refers to a post-transcriptional gene silencing mechanism in eukaryotes, which can be triggered by small inhibitory RNA molecules, such as microRNA (miRNA), short hairpin RNA (shRNA), and small interfering RNA (siRNA). These small RNA molecules typically function as gene silencers, interfering with the expression of cellular genes that contain either full or partial complementarity to the small RNA.

[0193] The term "RNA processing" refers to the cellular mechanisms responsible for RNA maturation, modification, and degradation, including RNA splicing, intron excision, exosome digestion, nonsense-mediated decay (NMD), RNA editing, RNA processing, and combinations thereof.

[0194] As used herein, the term "SB431542" refers to the compound having CAS number 301836-41-9, molecular formula C 22 H 18 N4O3, and refers to a molecule that can reduce or block transforming growth factor beta (TGFβ) / activin-Nodal signaling, having the name 4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]-benzamide.

[0195] The term "sense" refers to a nucleic acid molecule that is in the same sequence order and composition as the homologous mRNA. The sense configuration is indicated by a "+", "s", or "sense" symbol.

[0196] "Sma Mothers Against Decapentaplegic" or "Small Mothers Against Decapentaplegic" or "SMAD" refers to signaling molecules.

[0197] The term "small or short hairpin RNA" or "shRNA" refers to a single-stranded RNA containing a pair of partially or perfectly matched stem-arm nucleotide sequences, which are separated by a mismatched loop oligonucleotide to form a hairpin-like structure. Many natural miRNAs are stored in cells in the form of shRNAs, such as precursor microRNAs (pre-miRNAs).

[0198] The term "small interfering RNA" or "siRNA" refers to short double-stranded RNAs that are approximately 18-27 perfectly base-paired ribonucleotide duplexes in size and can degrade target gene transcripts with near-perfect complementarity.

[0199] As used herein, the term "Sonic Hedgehog (SHH or Shh)" refers to a protein that is one of at least three proteins in the mammalian signaling pathway family called hedgehogs; another is Desert Hedgehog (DHH), while the third is Indian Hedgehog (IHH). Shh interacts with at least two transmembrane proteins by interacting with the transmembrane molecules Patched (PTC) and Smoothened (SMO). Shh typically binds to PCT, which in turn allows activation of SMO as a signaling factor. In the absence of SHH, PTC typically inhibits SMO, which activates a transcriptional repressor, so transcription of certain genes does not occur. When Shh is present and bound to PTC, PTC is unable to interfere with the function of SMO. With SMO uninhibited, certain proteins can enter the nucleus and act as transcription factors, allowing certain genes to be activated (Gilbert, 2000). See Developmental Biology (Sunderland, Mass.: Sinauer Associates, Inc., Publishers).

[0200] As used herein, the term "stem cell" refers to cells that can divide indefinitely in culture and produce specialized cells.Stem cells can be obtained from patients, including animals and humans, for example, human stem cells refer to human stem cells.Stem cells can be obtained from various sources, including embryonic and non-embryonic, for example, umbilical cord cells, cells derived from children, and cells derived from adults.Adult stem cells generally refer to cells that are not originally obtained from fetuses, in other words, cells derived from newborns, discarded umbilical cords, discarded placental cells, cells derived from children, cells derived from adults, etc.

[0201] The terms "subject," "individual," or "patient" are used interchangeably herein and refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, mice, rats, rabbits, monkeys, cows, sheep, pigs, dogs, cats, farm animals, sport animals, pets, horses, and primates, particularly humans.

[0202] "Suspension culture" refers to a culture in which cells, or aggregates of cells, double while suspended in liquid medium.

[0203] The term "suitable for therapy" or "suitably treated with a therapy" means that the patient is more likely to exhibit one or more desirable clinical outcomes compared to a patient with the same disease and receiving the same treatment but with different characteristics under consideration for comparative purposes.

[0204] The term "template" refers to a nucleic acid molecule being copied by a nucleic acid polymerase. The template can be single-stranded, double-stranded, or partially double-stranded, depending on the polymerase. The synthesized copy is complementary to the template or to at least one strand of a double-stranded or partially double-stranded template. Both RNA and DNA are synthesized in the 5' to 3' direction. The two strands of a nucleic acid duplex are always aligned so that the 5' ends of the two strands (and necessarily the 3' ends) are at opposite ends of the duplex.

[0205] The term "transgene" refers to a gene, nucleic acid, or polynucleotide that has been introduced into a cell or organism by artificial or natural means, e.g., by an exogenous nucleic acid. The exogenous nucleic acid may be from a different organism or cell, or it may be one or more additional copies of a nucleic acid that naturally occurs in the organism or cell. As a non-limiting example, the exogenous nucleic acid is at a different chromosomal location than that of the native cell, or is otherwise flanked by different nucleic acid sequences than those found in nature.

[0206] "Transfection" refers to a method of gene delivery in which a foreign nucleotide sequence (e.g., a DNA or RNA molecule) is introduced into a cell, preferably by a non-viral method. In some embodiments, the foreign DNA or RNA is introduced into a cell by transient transfection of an expression vector encoding a polypeptide of interest, whereby the foreign DNA or RNA is introduced but is eliminated by the cell over time and during mitosis. "Transient transfection" refers to a method in which the introduced expression vector and the polypeptide encoded by the vector are not permanently integrated into the genome of the host cell or elsewhere in the cell, and therefore can be eliminated from the host cell or its progeny over time.

[0207] As used herein, the term "treating" includes arresting, substantially inhibiting, slowing or reversing the progression of, substantially alleviating the clinical or outward symptoms of, or substantially preventing the appearance of, a condition. For example, in the case of Parkinson's disease, the term "treating" contemplates a more favorable clinical assessment by the treating physician or assistant, and / or a reduction in the expression of fibrosis markers, such as αSMA, CTGF, collagen, matrix molecules, and / or a shift to normal readings in tests diagnosing liver function and / or Parkinson's disease.

[0208] As used herein, the term "undifferentiated" refers to cells that have not yet developed into a specialized cell type.

[0209] The term "vector" refers to a recombinant nucleic acid composition, e.g., recombinant DNA (rDNA) or RNA, capable of transporting and existing in different genetic environments. Generally, another nucleic acid is operably linked to it. A vector may be capable of autonomous replication in a cell, in which case the vector and attached segment are replicated. One type of preferred vector is an episome, i.e., a nucleic acid molecule capable of extrachromosomal replication. Preferred vectors are those capable of autonomous replication and expression of nucleic acids. Vectors capable of directing the expression of genes encoding one or more polypeptides and / or non-coding RNAs are referred to herein as "expression vectors" or "expression-competent vectors." Particularly important vectors allow for the cloning of cDNA from mRNA produced using reverse transcriptase. The vector may contain components consisting of a viral or type II RNA polymerase (Pol-II or pol-2) promoter or both, a Kozak consensus translation initiation site, a polyadenylation signal, multiple restriction / cloning sites, a pUC origin of replication, an SV40 early promoter for expressing at least an antibiotic resistance gene in replication-competent prokaryotic cells, an SV40 origin of replication in mammalian cells as needed, and / or a tetracycline responsive element. The structure of the vector may be a linear or circular form of single- or double-stranded DNA or RNA selected from the group consisting of a plasmid, a viral vector, a transposon, a retrotransposon, a DNA or RNA transgene, a jumping gene, and a combination thereof.

[0210] As used herein, the terms "WNT" or "wingless" in relation to a ligand refer to a group of secreted proteins that can interact with WNT receptors, e.g., receptors within the Frizzled and LRPDerailed / RYK receptor families (i.e., Int1 (integration 1) in humans).

[0211] The term "5' end" refers to the end lacking a nucleotide at the 5' position of consecutive nucleotides, in which the 5'-hydroxyl group of one nucleotide is joined to the 3'-hydroyl group of the next nucleotide by a phosphodiester linkage. Other groups, such as one or more phosphates, may be present at the end.

[0212] The term "3' end" refers to the end lacking a nucleotide at the 3' position of consecutive nucleotides, where the 5'-hydroxyl group of one nucleotide is joined to the 3'-hydroxyl group of the next nucleotide by a phosphodiester linkage. Other groups, most often hydroxyl groups, may be present at the end.

[0213] Throughout this application, various embodiments may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all possible subranges as well as individual numerical values ​​within that range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values ​​within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the broadness of the range.

[0214] Whenever a range of numerical values ​​is given herein, it is meant to include all recited numbers (fractions or integers) within the given range. The phrases "ranging from" a first given number to a second given number and "ranging from" a first given number to a second given number are used interchangeably herein and are meant to include the first and second given numbers and all fractions and integers therebetween.

[0215] Please note that for each miR described herein, the corresponding sequence (mature and precursor) is provided in the Sequence Listing, which should be considered part of this specification.

[0216] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by those skilled in the art.Although methods and materials similar to or equivalent to those described herein can be used in the implementation or testing of the embodiments disclosed herein, exemplary methods and / or materials are described below.In the event of any discrepancy, this patent specification, including definitions, shall prevail.In addition, materials, methods, and examples are merely illustrative and are not necessarily intended to be limiting.

[0217] Before describing at least one embodiment in detail, it is to be understood that the present disclosure is not necessarily limited in its application to the details set forth in the following description or illustrated by the examples, as the present disclosure is capable of other embodiments or of being practiced or carried out in various ways.

[0218] composition Sequence number SEQ ID NO: 1: Human hsa-miR-155-5p MIMAT0000646

[0219] UUAAUGCUAAUCGUGAUAGGGGUU

[0220] SEQ ID NO: 2: Mouse miR-155-5p MIMAT0000646

[0221] UUAAUGCUAAUUGUGAUAGGGGUU

[0222] SEQ ID NO: 3: Human hsa-miR-155-3p MIMAT0004658

[0223] CUCCUACAUAUUAGCAUUAACA

[0224] SEQ ID NO: 4: Mouse-miR-155-3p MIMAT0004658

[0225] CUCCUACCUGUUAGCAUUAACA

[0226] SEQ ID NO: 5 >hsa-miR-155 stem loop MI0000681

[0227] CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG

[0228] SEQ ID NO: 6: Modified hsa-miR-155-5p

[0229] GGAAUGCUAAUCGUGAUAGGGGUU

[0230] SEQ ID NO: 7: Modified hsa-miR-155-3p

[0231] UUCCUACAUAUUAGCAUUAACA

[0232] SEQ ID NO: 8: Modified hsa-miR-155 stem loop

[0233] CUGUUAAUGCUAAUCGUGAUAGGG A UUUUUGCCUCCAACUGA U UCCUACAUAUUAGCAUUAACAG

[0234] SEQ ID NO: 9: miR-155-3p isomiR

[0235] 3'-ACC ** UACGAUUAUACAUCCUC

[0236] SEQ ID NO: 10: miR-155-3p isomiR

[0237] 3'- * CAAUUACGAUUAUACAUCCU *

[0238] SEQ ID NO: 11: miR-155-3p isomiR

[0239] 3'-ACAAUUACGAUUAUACAUCCU *

[0240] SEQ ID NO: 12: miR-155-3p isomiR

[0241] 3'- *** ACUACGAUUAUACAUCCUC

[0242] SEQ ID NO: 13: miR-155-3p isomiR

[0243] 3'- ** AAUUACGAUUAUACAUCCU*

[0244] SEQ ID NO: 14: miR-155-3p isomiR

[0245] 3'- *** AUUACGAUUAUACAUCCUC

[0246] SEQ ID NO: 15: miR-155-3p isomiR

[0247] 3'- ****** ACGAUUAUACAUCCUCA

[0248] SEQ ID NO: 16: miR-155-3p isomiR

[0249] 3'- ****** ACGAUUAUACAUCCUCAG

[0250] SEQ ID NO: 17: miR-155-3p isomiR

[0251] 3'- * CAA * UACGAUUAUACAUCCUC

[0252] SEQ ID NO: 18: miR-155-3p isomiR

[0253] 3'- *** AUUACGAUUAUACAUCCUCA

[0254] SEQ ID NO: 19: miR-155-3p isomiR

[0255] 3'- *** CUUACGAUUAUACAUCCUC

[0256] SEQ ID NO: 20: miR-155-3p isomiR

[0257] 3'-ACAAUUACGAUUAUACAU ****

[0258] SEQ ID NO: 21: miR-155-3p isomiR

[0259] 3'- **** UUACGAUUAUACAUCCUC

[0260] Pre-miR-155 MIR-155 (microRNA 155) is an RNA gene and belongs to the miRNA class. Diseases associated with MIR-155 include diffuse large B-cell lymphoma and pancreatic ductal adenocarcinoma. Its associated pathways include the cell differentiation-expansion index and Toll-like receptor signaling pathways, among others. Figure 2 shows the sequence of the pre-miR-155 stem-loop that matures from the pri-miRNA transcript. The mature miR-155 (miR-155-5p) sequence is shown on the left, and the mature miR-155* (miR-155-3p) sequence is shown on the right.

[0261] MiR-155 is processed from an exon of a non-coding RNA transcribed from the B-cell integration cluster (BIC) located on chromosome 21.

[0262] The miRNA-155 sequence is 24 nucleotides long and is found in Homo sapiens. The Homo sapiens (human) hsa-miR-155-5p sequence is the product of the miR-155-5p, hsa-miR-155, MIR-155, miR-155, hsa-miR-155-5p gene.

[0263] MicroRNA-155 (miR-155) exists as two mature isoforms, miR-155-3p and miR-155-5p, which are generated by ribonucleolytic processing of the pre-miR-155 stem-loop. In other words, the miR-155-3p / 5p product is the result of loading into the RISC complex, where one strand is preferentially loaded (described in the Introduction).

[0264] In certain aspects, compositions are disclosed that comprise, consist essentially of, or consist of one or more modified pre-miR-155. In some embodiments, the miRNA has full complementarity to the wild-type miRNA sequence, excluding one, two, or three nucleotide substitutions, terminal additions, and / or truncations.

[0265] A modified pre-miR-155 having SEQ ID NO: 6 is disclosed. A modified pre-miR-155 having SEQ ID NO: 7 is disclosed. A modified pre-miR-155 stem loop having SEQ ID NO: 8 is disclosed. A modified pre-miR-155 having SEQ ID NO: 6 and SEQ ID NO: 7 is disclosed. A modified pre-miR-155 having SEQ ID NO: 6 and SEQ ID NO: 7 and a pre-miR-155 stem loop having SEQ ID NO: 8 are disclosed. A modified pre-miR-155 having SEQ ID NO: 6 and a pre-miR-155 stem loop having SEQ ID NO: 8 is disclosed. A modified pre-miR-155 having SEQ ID NO: 7 and a pre-miR-155 stem loop having SEQ ID NO: 8 is disclosed.

[0266] In some embodiments, miRNA-155 is a pre-miRNA. In some embodiments, miRNA-155 has SEQ ID NO: 1. In some embodiments, miRNA-155 has SEQ ID NO: 2. In some embodiments, miRNA-155 has SEQ ID NO: 3. In some embodiments, miRNA-155 has SEQ ID NO: 4. In some embodiments, miRNA-155 has SEQ ID NO: 5. In some embodiments, miRNA-155 has SEQ ID NO: 6. In some embodiments, miRNA-155 has SEQ ID NO: 7. In some embodiments, the miRNA-155 stem loop has SEQ ID NO: 8. In some embodiments, miRNA-155 has SEQ ID NO: 6 and SEQ ID NO: 7. In some embodiments, miRNA-155 has SEQ ID NO: 6, SEQ ID NO: 7, and the miRNA-155 stem loop has SEQ ID NO: 8. In some embodiments, miRNA-155 has SEQ ID NO: 6 and the miRNA-155 stem loop has SEQ ID NO: 8. In some embodiments, miRNA-155 has SEQ ID NO:7, and the miRNA-155 stem loop has SEQ ID NO:8. In some embodiments, miRNA-155 has SEQ ID NO:9. In some embodiments, miRNA-155 has SEQ ID NO:10. In some embodiments, miRNA-155 has SEQ ID NO:11. In some embodiments, miRNA-155 has SEQ ID NO:12. In some embodiments, miRNA-155 has SEQ ID NO:13. In some embodiments, miRNA-155 has SEQ ID NO:14. In some embodiments, miRNA-155 has SEQ ID NO:15. In some embodiments, miRNA-155 has SEQ ID NO:16. In some embodiments, miRNA-155 has SEQ ID NO:17. In some embodiments, miRNA-155 has SEQ ID NO:18. In some embodiments, miRNA-155 has SEQ ID NO:19. In some embodiments, miRNA-155 has SEQ ID NO:20. In some embodiments, miRNA-155 has SEQ ID NO:21.

[0267] Pluripotent cells having modified pre-miR-155 that favors miR-155-5p guide formation or strand selection in DA neural cells are disclosed. Pluripotent cells having modified pre-miR-155 that favors miR-155-3p guide formation or strand selection in DA neural cells are disclosed. Pluripotent cells having modified pre-miR-155 that reduces miR-155-5p guide formation or strand selection in DA neural cells are disclosed. Pluripotent cells having modified pre-miR-155 that reduces miR-155-3p guide formation or strand selection in DA neural cells are disclosed.

[0268] In some embodiments, pluripotent cells are disclosed having a modified pre-miR-155 comprising SEQ ID NO: 6, which favors miR-155-3p strand selection in DA neural cells. In some embodiments, pluripotent cells are disclosed having a modified pre-miR-155 comprising SEQ ID NO: 7, which favors miR-155-3p strand selection in DA neural cells. In some embodiments, pluripotent cells have a modified pre-miR-155 stem loop comprising SEQ ID NO: 8, which favors miR-155-3p strand selection in DA neural cells. In some embodiments, pluripotent cells have a modified pre-miR-155 comprising SEQ ID NO: 6 and SEQ ID NO: 7, which favors miR-155-3p strand selection in DA neural cells. In some embodiments, pluripotent cells have a modified pre-miR-155 comprising SEQ ID NO: 6 and SEQ ID NO: 7, which favors miR-155-3p strand selection in DA neural cells. In some embodiments, pluripotent cells have a modified pre-miR-155 comprising SEQ ID NO: 6 and SEQ ID NO: 7, and a modified pre-miR-155 stem loop comprising SEQ ID NO: 8, which favors miR-155-3p strand selection in DA neural cells. In some embodiments, disclosed are pluripotent cells having a modified pre-miR-155 comprising SEQ ID NO: 6 and a modified pre-miR-155 stem loop comprising SEQ ID NO: 8 that favors miR-155-3p strand selection in DA neural cells. In some embodiments, disclosed are pluripotent cells having a modified pre-miR-155 comprising SEQ ID NO: 7 and a modified pre-miR-155 stem loop comprising SEQ ID NO: 8 that favors miR-155-3p strand selection in DA neural cells.

[0269] In some embodiments, pluripotent cells are disclosed that have a modified pre-miR-155 that comprises an increased pyrimidine content that favors miR-155-3p strand selection in DA neural cells.In some embodiments, pluripotent cells are disclosed that have a modified pre-miR-155 that comprises an increased pyrimidine content that reduces miR-155-3p strand selection in DA neural cells.

[0270] In certain embodiments, pre-miRNA-155 sequences are disclosed, wherein the pre-miRNA-155 incorporated into DA neuron cells has an anti-inflammatory effect in a human subject. In certain embodiments, pre-miRNA-155 sequences are disclosed, wherein the pre-miRNA-155 incorporated into DA neuron cells has a pro-inflammatory effect in a human subject.

[0271] microRNA method Disclosed are methods for ex vivo differentiation of pluripotent cells into neural progenitor cells and DA neurons using modified microRNAs. In some embodiments, cell populations are differentiated using the single SMAD or dual SMAD methods disclosed herein. In some embodiments, cell populations are differentiated using the single SMAD or dual SMAD methods disclosed herein or other approaches. In some embodiments, miR-155-5p is modified. In some embodiments, miR-155-3p is modified. In some embodiments, miR-155-5p stem-loop is modified.

[0272] Modified miRNA, modified miR-155, modified miR-155-5p, modified miR-155-3p, modified miR-155-stem loop can be prepared by any suitable method, for example, by isolating natural products, for example, from cell populations, or can be produced recombinantly, for example, by chemical synthesis or by using recombinant DNA technology.When producing by using recombinant DNA technology, miRNA can be produced, for example, through a transcription reaction involving the use of DNA template and RNA polymerase obtained by recombinant DNA technology.Examples of suitable RNA polymerase include T7 RNA polymerase, T3 RNA polymerase, and SP6 RNA polymerase.They can be produced in eukaryotic cells or prokaryotic cells, for example, E. coli, or other bacteria, for example, yeast, mammals, humans, mice, or monkeys.

[0273] In some cases, miRNA or the nucleic acid encoding miRNA is produced synthetically using well-known methods or isolated from cells or tissues.Typically, miRNA or the nucleic acid molecule containing or encoding miRNA is obtained by using genetic engineering techniques to produce recombinant nucleic acid molecules, which can then be isolated or purified by techniques well known to those skilled in the art.In these recombinant methods, the nucleic acid encoding miRNA is cloned into a suitable expression vector.Designing the DNA encoding the miRNA provided herein is well within the skill of those skilled in the art.

[0274] Any suitable host / vector system can be used to express one or more of the miRNAs described herein. It is well within the skill of one of ordinary skill in the art to select an appropriate system based, for example, on whether the miRNA or a nucleic acid molecule encoding the miRNA has been isolated and purified for subsequent use and / or whether the miRNA will be expressed in vivo after administration to a subject.

[0275] In certain examples, the miRNA (including precursor miRNA) described herein is encoded by a vector, so that the miRNA is expressed in vivo after the vector is administered to a subject.The choice of vector can be influenced by the cell type that the vector is targeted to, including the specific regulatory elements contained in the vector for the expression of heterologous nucleic acid, and such selection is well within the skill of a person skilled in the art.For example, the nucleic acid encoding miRNA can be under the control of a tissue- or cell-specific promoter, so that the miRNA is only expressed in a specific tissue or cell type.Tissue- or cell-specific promoters are well known in the art.

[0276] In a further example, the nucleic acid encoding the miRNA is cloned into a viral vector, including but not limited to, retroviral, adenoviral, lentiviral, and adeno-associated viral vectors. Viral vectors can be replication-deficient or replication-competent, although replication-deficient vectors are typically selected for use in subsequent therapeutic applications.

[0277] The activity of miRNAs can be assessed using in vitro assays and animal models well known to those skilled in the art. miRNAs can also be evaluated in human clinical trials, with appropriate monitoring.

[0278] Methods for influencing miRNA strand selection are disclosed. Methods for influencing pre-miR-155 strand selection are disclosed. Methods for influencing miR-155-3p strand selection are disclosed. Methods for influencing miR-155-5p strand selection are disclosed. In some embodiments, the strand selection is in pluripotent cells.

[0279] Methods are disclosed for influencing the ratio of miR-155-3p and miR-155-5p chains in pluripotent cells. Methods are disclosed for influencing the ratio of miR-155-3p and miR-155-5p chains in pluripotent cells. In some embodiments, the ratio of miR-155-3p to miR-155-5p is greater. In some embodiments, the ratio of miR-155-5p to miR-155-3p is greater. In some embodiments, miR-155-3p is 5% more than miR-155-3p. In some embodiments, miR-155-3p is 5%, 6%, 7%, 8%, 9%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% more than miR-155-5p. In some embodiments, miR-155-5p is 5%, 6%, 7%, 8%, 9%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% more abundant than miR-155-3p.

[0280] Regardless of whether the method affects miRNA strand selection or the ratio of miR-155-3p and miR-155-5p strands in pluripotent cells, in some embodiments, the method includes modifying miR-155-3p. In some embodiments, the method includes modifying miR-155-5p. In some embodiments, the method includes modifying the pre-miR-155 stem loop. In some embodiments, the method includes modifying miR-155-3p and modifying miR-155-5p. In some embodiments, the method includes modifying miR-155-3p, modifying miR-155-5p, and modifying the pre-miR-155 stem loop. In some embodiments, the method includes modifying miR-155-3p and modifying the pre-miR-155 stem loop. In some embodiments, the method comprises modifying miR-155-5p and modifying the pre-miR-155 stem loop. In some embodiments, the modification comprises SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. In some embodiments, the modification comprises SEQ ID NO: 9-21.

[0281] Gene editing of iPSCs method In some embodiments, the method comprises gene editing miR-155-3p in a pluripotent cell or a population of pluripotent cells. In some embodiments, the method comprises gene editing miR-155-5p in a pluripotent cell or a population of pluripotent cells. In some embodiments, the method comprises gene editing a pre-miR-155 stem loop in a pluripotent cell or a population of pluripotent cells. In some embodiments, the gene editing comprises altering 5' nucleotides 1-2 of miR-155-3p in a pluripotent cell or a population of pluripotent cells. In some embodiments, the gene editing comprises altering 5' nucleotide 1 of miR-155-3p in a pluripotent cell or a population of pluripotent cells. In some embodiments, the gene editing comprises altering 5' nucleotide 1 of miR-155-3p from C to U in a pluripotent cell or a population of pluripotent cells. In some embodiments, the gene editing comprises altering 5' nucleotides 1-2 of miR-155-5p in the pluripotent cell or pluripotent cell population. In some embodiments, the gene editing comprises altering 5' nucleotides 1-6 of miR-155-5p in the pluripotent cell or pluripotent cell population. In some embodiments, the gene editing comprises changing 5' nucleotides 1-6 of miR-155-5p from UUAAUG to GGAAUG in the pluripotent cell or pluripotent cell population. In some embodiments, the gene editing comprises altering one nucleotide base pair of the stem loop in the pluripotent cell or pluripotent cell population. In some embodiments, the gene editing comprises changing nucleotide 25 of the stem loop from G to A and nucleotide 43 from C to U in the pluripotent cell or pluripotent cell population.

[0282] Disclosed is a method for affecting the ratio of miRNA-155miR-155-3p and miR-155-3p strands in DA neural cells.In some embodiments, the method comprises influencing miRNA strand selection in pluripotent cells as discussed above, and differentiating the modified miRNA pluripotent cells into DA neural cells.In some embodiments, the method comprises modifying miR-155-3p and / or miR-155-5p and / or pre-miR-155 stem loop in pluripotent cells as discussed above, and differentiating the modified miRNA pluripotent cells into DA neural cells.

[0283] In some embodiments, a method of gene editing a pluripotent stem cell is disclosed.

[0284] Gene editing techniques Transiently transfect pluripotent cells Transfection is the introduction of DNA, RNA, or proteins into eukaryotic cells and is used in academic research to study and modulate gene expression. Therefore, transfection techniques serve as analytical tools that facilitate the characterization of gene function, protein synthesis, cell growth, and development. Transfection assays not only enable advances in cellular academic research but also enhance drug discovery strategies. Similar strategies, such as viral transfection or viral transduction, utilize lentiviral particles to insert foreign material into eukaryotic cells. Meanwhile, bacterial transformation is a horizontal gene transfer process in which bacteria incorporate foreign genetic material.

[0285] There are a wide variety of transfection methods, including physical, chemical, and biological techniques. These techniques generally involve the use of transient or stable transfection methods to introduce nucleic acids into cells.

[0286] Transient transfection techniques involve the introduction of DNA or RNA into cells, but in this method, the DNA or RNA is not integrated into the cell chromosomes. This technique promotes high transfection efficiency, and gene transcripts can be analyzed after a period of 1 to 4 days. For large-scale transient gene expression (TGE) in mammalian cell culture, transfection vehicles such as polyethyleneimine (PEI) and calcium phosphate (CaPi) can be used. Furthermore, large-scale TGE methods have also been developed using Chinese hamster ovary (CHO) cells in the absence of serum. 1 .

[0287] Stable transfection techniques involve integration of the transfected DNA or RNA into the cell chromosome or formation of an episome. Stably transfected cells can then be identified using selectable markers such as dihydrofolate reductase (DHFR), hygromycin B phosphotransferase (HPH), and adenosine deaminase (ADA), among others.

[0288] Some commonly used transfection techniques include calcium phosphate precipitation, lipofection, electroporation and viral delivery.In addition, these methods can be used in co-transfection.These techniques involve the simultaneous delivery of two separate nucleic acids to the same cell, and are often used to achieve stable transfection.Transfection methods have evolved, including some new methods, such as the gene gun delivery system that uses high-speed microparticles to deliver nucleic acid to cells, and the in vivo transfection protocol that facilitates the systemic delivery of siRNA molecules.

[0289] Calcium phosphate transfection The calcium phosphate transfection technique involves precipitation of DNA or RNA and calcium phosphate. Precipitation is facilitated by mixing a HEPES-buffered saline solution containing sodium phosphate with a calcium chloride solution and DNA or RNA. Glycerol shock is often used to enhance uptake of DNA or RNA into certain cells. This technique is cost-effective and can be used for transient or stable transfection in a wide range of cells; however, relatively small pH changes (±0.1) can affect the efficiency of transformation. Furthermore, maintaining consistency of reagents is essential for reproducible assay results. However, this transfection method does not work in RPMI or other media with high phosphate concentrations.

[0290] Liposome-mediated transfection Liposome-mediated transfection (lipofection) technique involves the use of cationic lipids or non-lipid polymers that form liposomes. Examples of lipofection transfection reagents include DOTMA (N-[1-(2,3,-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride) and X-tremeGENE™ transfection reagent, which are suitable for transfecting various DNA or RNA, small RNA, CRISPR / Cas7-11, and CRISPR / Cas13 components into various cell systems. Lipid transfection can also be adapted to cost-effective and high-throughput systems, but these transfections are usually cell type specific.

[0291] Electroporation This technique involves exposing cell membranes to high-intensity electrical pulses, thereby causing temporary destabilization in specific areas of the cell. During this transient destabilization event, the cell membrane becomes highly permeable, allowing the entry of a variety of exogenous molecules, including DNA or RNA.

[0292] Electroporation is a facile, non-chemical technique that can produce high transformation efficiencies in a variety of cell types. Although the technique does not alter the morphology and function of target cells, the method can cause cell death if transfection is not performed under optimal conditions.

[0293] Viral transfection This method involves the use of viral vectors to deliver nucleic acids to cells. Viral delivery systems, such as lentiviral, adenoviral, and oncoretroviral vectors, can be used to transfer nucleic acids even in difficult-to-transfect cells.

[0294] Although viral delivery methods are highly efficient, they can be very labor-intensive. Furthermore, most viruses require careful monitoring of containment and biosafety levels. Before performing viral transfection, it is also important to consider several limiting factors, such as the solubility of the viral vector, cell line packaging, and host cell specificity.

[0295] In some embodiments, modifying pluripotent cells can be done in several ways. 8. Transiently transfect pluripotent cells with mature miRNA (or its modified form, as described below). The miRNA designed according to the teachings of this specification can be produced according to any oligonucleotide synthesis method known in the art, including both enzymatic synthesis and solid-phase synthesis. The equipment and reagents for carrying out solid-phase synthesis are commercially available, for example, from Applied Biosystems. Any other means for such synthesis may also be used, and the actual synthesis of the oligonucleotides is well within the skill of one in the art and can be accomplished by established procedures detailed, for example, in Sambrook, J. and Russell, DW 5 (2001), "Molecular Cloning: A Laboratory Manual", Ausubel, RM et al., eds. (1994, 1989), "Current Protocols in Molecular Biology," Volumes I-III, John Wiley & Sons, Baltimore, Md., Perbal, B. (1988), "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York, and Gait, MJ, ed. (1984), "Oligonucleotide Synthesis", utilizing solid-phase chemistry, e.g., cyanoethyl phosphoramidites, followed by deprotection, desalting, and purification, e.g., by automated trityl-ion methods or HPLC. 9. Stably or transiently transfecting pluripotent cells with expression vectors encoding mature miRNAs or miRNA mimics. 10. Stably or transiently transfecting pluripotent cells with an expression vector encoding a pre-miRNA. The pre-miRNA sequence may comprise 1-17, 1-50, 19-25, 45-90, 60-80, or 60-70 nucleotides. The pre-miRNA sequence may comprise miR-155-5p and / or miR-155-3p as described herein. The pre-miRNA sequence may also be a modified pri-miRNA, e.g., SEQ ID NOs: 6-8. The pre-miRNA sequence may also comprise the sequence of a miRNA or a variant thereof. 11. Stably or transiently transfect pluripotent cells with an expression vector encoding a pri-miRNA. The sequence of the pri-miRNA may include the pre-miRNA, miR-155-5p, and / or miR-155-3p described herein, and variants thereof. Preparation of miRNA mimics can be performed by chemical synthesis or recombinant methods.

[0296] The miRNA antagonist may be introduced into cells using siRNA or an expression vector, such as Anatgomir, using transfection protocols known in the art.

[0297] Altering strand selection without gene editing In another alternative, drugs can be added to pluripotent cells (during incubation or maturation) to change strand selection (-3p or miR-155-3p) without changing the genotype of the cells (i.e., without gene editing). Mechanisms that can change transcription in this way include activating, deactivating, or mimicking signal transduction pathways in cells, and up-regulating, down-regulating, activating, or inactivating transcription factors (at the transcriptional, translational, or post-translational levels). Transcription factor activity can be modulated at the post-transcriptional level, for example, by stimulating their phosphorylation / dephosphorylation or targeting them for degradation by modulating the ubiquitination activity of cells. Such compounds can be small molecules, such as drugs, or small biological molecules, such as peptides, or signal transduction molecules, such as cAMP or cGMP. Alternatively, such compounds can be macromolecules, such as proteins.

[0298] Disclosed is a method for differentiating pluripotent cells into miR-155-3p or miR-155-5p biased DA neurons by down-regulating specific miRNAs, i.e., miR-155-3p or miR-155-5p.Disclosed is a method for differentiating pluripotent cells into miR-155-3p biased DA neurons and miR-155-5p unbiased DA neurons by down-regulating specific miRNAs, i.e., miR-155-3p or miR-155-5p.Down-regulating such miRNAs can be carried out by using polynucleotides that can hybridize to miRNA molecules in cells under physiological conditions or gene editing techniques.In some embodiments, pluripotent cells are differentiated using the single SMAD or double SMAD method disclosed herein to produce DA neurons.

[0299] Polynucleotides that down-regulate miRNAs As mentioned herein above, the miRNA-downregulating polynucleotides described herein above can be provided as modified polynucleotides using various methods known in the art.

[0300] For example, an oligonucleotide (e.g., miRNA) or polynucleotide may contain heterocyclic nucleosides consisting of purine and pyrimidine bases joined by 3' and 5' phosphodiester linkages. Preferably, the oligonucleotides or polynucleotides used are modified in either the backbone, internucleoside linkages, or bases, as broadly described herein below.

[0301] Specific examples of preferred oligonucleotides or polynucleotides useful in this embodiment include oligonucleotides or polynucleotides containing modified backbones or non-natural internucleoside linkages. Oligonucleotides or polynucleotides with modified backbones are described in U.S. Patent Nos. 4,469,863, 4,476,301, 5,023,243, 5,177,196, 5,188,897, 5,264,423, 5,276,019, 5,278,302, 5,286,717, 5,321,131, 5,399,676, and 5,405,939. Nos. 5,453,496, 5,455,233, 5,466,677, 5,476,925, 5,519,126, 5,536,821, 5,541,306, 5,550,111, 5,563,253, 5,571,799, 5,587,361, and 5,625,050.

[0302] Preferred modified oligonucleotide or polynucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linkage analogs, and those with polarity inversion, where adjacent pairs of nucleoside units are linked by 3'-5' and 5'-3' or 2'-5' and 5'-2'.Various salts, mixed salts, and free acid forms of the above-mentioned modifications can also be used.

[0303] Alternatively, modified oligonucleotide or polynucleotide backbones that do not contain phosphorus atoms have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages, including those described in U.S. Patent Nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,264,562, 5,264,564, 5,405,938, 5,434,257, and 5,466 ,677, No. 5,470,967, No. 5,489,677, No. 5,541,307, No. 5,561,225, No. 5,596,086, No. 5 ,602,240, 5,610,289, 5,602,240, 5,608,046, 5,610,289, 5,618,704, As disclosed in US Pat. Nos. 5,623,070, 5,663,312, 5,633,360, 5,677,437, and 5,677,439, these include those having morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others having mixed N, O, S, and CH2 constituent moieties.

[0304] Other oligonucleotides or polynucleotides that can be used are those that are modified in both the sugar and internucleoside linkage, i.e., the backbone of the nucleotide unit is replaced with a novel group. The base unit is maintained for complementary interaction with the appropriate polynucleotide target. Examples of such oligonucleotide mimics include peptide nucleic acids (PNAs). PNA oligonucleotides refer to oligonucleotides in which the sugar backbone is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The bases are retained and are directly or indirectly bound to the aza nitrogen atoms of the amide portion of the backbone. U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, each of which is incorporated herein by reference. Other backbone modifications that can be used are disclosed in U.S. Patent No. 6,303,374.

[0305] Oligonucleotide or polynucleotide may also comprise base modification or substitution.As used herein, "unmodified" or "natural" bases include purine bases adenine (A) and guanine (G), and pyrimidine bases thymine (T), cytosine (C) and uracil (U)."Modified" bases include other synthetic and natural bases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5- These include, but are not limited to, uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine. Additional modified bases include those disclosed in U.S. Pat. No. 3,687,808; Kroschwitz, JI, ed. (1990), "The Concise Encyclopedia Of Polymer Science And Engineering," pages 858-859, John Wiley & Sons; Englisch et al. (1991), "Angewandte Chemie," International Edition, 30, 613; and Sanghvi, YS, "Antisense Research and Applications," Chapter 15, pages 289-302, ST Crooke and B. Lebleu, eds., CRC Press, 1993.Such modified bases are particularly useful for increasing the binding affinity of oligomeric compounds. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6 to 1.2°C (Sanghvi, YS et al. (1993), "Antisense Research and Applications," pages 276-278, CRC Press, Boca Raton), and are currently the preferred base substitution, especially when combined with 2'-O-methoxyethyl sugar modifications.

[0306] Promoter sequence for inducing transcription To express miRNA or a polynucleotide agent that regulates miRNA in pluripotent cells or DA nervous system cells, the polynucleotide sequence encoding the miRNA (or pre-miRNA, or pri-miRNA, or a polynucleotide that down-regulates the miRNA) is preferably ligated to a nucleic acid construct suitable for expression in pluripotent cells (or DA nervous system cells). Such a nucleic acid construct comprises a promoter sequence for inducing the transcription of the polynucleotide sequence in the cells in a constitutive or inducible manner.

[0307] It will be understood that the nucleic acid constructs of some embodiments disclosed herein can also utilize miRNA homologs that exhibit a desired activity (e.g., DA cell differentiation ability). Such homologs can be at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any of the sequences described herein above, as determined, for example, using the BestFit software in the Wisconsin Sequence Analysis Package, utilizing the Smith and Waterman algorithm with a gap weight of 50, a length weight of 3, an average match of 10, and an average mismatch of -9.

[0308] Additionally, homologs may be at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110% or more of a homologue to a sequence described herein above, as determined, for example, using the BestFit software in the Wisconsin Sequence Analysis Package utilizing the algorithm of Smith and Waterman with a gap weight of 50, a length weight of 3, an average match of 10, and an average mismatch of -9. The sequence may be at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical.

[0309] Constitutive promoters suitable for use in some embodiments disclosed herein are promoter sequences that are active under most environmental conditions and in most cell types, such as cytomegalovirus (CMV) and Rous sarcoma virus (RSV). Inducible promoters suitable for use in some embodiments disclosed herein include, for example, tetracycline-inducible promoters (Zabala M, et al., Cancer Res. 2004, 64(8): 2799-804).

[0310] Eukaryotic promoters typically contain two types of recognition sequences: the TATA box and upstream promoter elements. The TATA box, located 25–30 base pairs upstream of the transcription start site, is thought to be responsible for directing RNA polymerase to begin RNA synthesis. Other upstream promoter elements determine the rate at which transcription is initiated.

[0311] Preferably, the promoters utilized by the nucleic acid constructs of some embodiments disclosed herein are active in the particular cell population to be transformed, i.e., pluripotent cells.

[0312] Enhancer elements can stimulate transcription from linked homologous or heterologous promoters up to 1,000-fold. Enhancers are active when placed downstream or upstream of the transcription start site. Many enhancer elements derived from viruses have a wide host range and are active in various tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer / promoter combinations suitable for some embodiments include those derived from polyomavirus, human or mouse cytomegalovirus (CMV), various retroviruses such as murine leukemia virus or mouse or Rous sarcoma virus, and long terminal repeats derived from HIV. See Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, NY 1983, which is incorporated herein by reference.

[0313] In constructing an expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

[0314] In addition to the elements already described, the expression vector of some embodiments may contain other specialized elements, typically intended to increase the expression level of cloned nucleic acid or facilitate the identification of cells carrying recombinant DNA or RNA. For example, some animal viruses contain DNA or RNA sequences that promote extrachromosomal replication of the viral genome in permissive cell types. Plasmids carrying these viral replicons will replicate episomally as long as the appropriate factors are provided on the plasmid or by genes in the genome of the host cell.

[0315] The vector may or may not contain a eukaryotic replicon. If a eukaryotic replicon is present, the vector can be amplified in eukaryotic cells using an appropriate selectable marker. If the vector does not contain a eukaryotic replicon, episomal amplification is not possible. Instead, recombinant DNA or RNA is integrated into the genome of the engineered cell, and the promoter induces the expression of the desired nucleic acid.

[0316] Examples of mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81 available from Invitrogen, pCI available from Promega, pMbac, pPbac, pBK-RSV, and pBK-CMV available from Strategene, pTRES available from Clontech, and derivatives thereof. Other expression vectors are available from SBI or Sigma.

[0317] Expression vectors containing regulatory elements derived from eukaryotic viruses, such as retroviruses, can also be used. SV40 vectors include pSVT7 and pMT2. Bovine papillomavirus-derived vectors include pBV-1MTHA, and Epstein-Barr virus-derived vectors include pHEBO and p205. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector that allows protein expression under the direction of the SV-40 early promoter, SV-40 late promoter, metallothionein promoter, mouse mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown to be effective for expression in eukaryotic cells.

[0318] As mentioned above, viruses are highly specialized infectious agents that have evolved, in many cases, to evade host defense mechanisms. Typically, viruses infect and replicate in specific cell types. The targeting specificity of viral vectors utilizes their natural specificity to specifically target a given cell type, thereby introducing a recombinant gene into the infected cell. Therefore, the type of vector used in some embodiments will depend on the cell type to be transformed. The ability to select an appropriate vector depending on the cell type to be transformed is well within the skill of those skilled in the art, and therefore, a general description of selection considerations is not provided herein. For example, bone marrow cells can be targeted using human T-cell leukemia virus type 1 (HTLV-1), and kidney cells can be targeted using a heterologous promoter present in the baculovirus Autographa californica nuclear polyhedrosis virus (AcMNPV), as described in Liang CY et al., 2004 (Arch Virol. 149: 51-60).

[0319] According to one embodiment, lentiviral vectors are used to transfect pluripotent cells.

[0320] A variety of methods can be used to introduce the expression vectors of some embodiments into pluripotent cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor, Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988), and Gilboa et al. Biotechniques 4 (6): 504-512, 1986, and include, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors. Additionally, see US Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.

[0321] Introduction of nucleic acids by viral infection offers several advantages over other methods, such as lipofection and electroporation, as higher transfection efficiencies can be obtained due to the infectivity of the virus.

[0322] Other vectors may also be used that are non-viral, for example, cationic lipids, polylysine, and dendrimers.

[0323] Transfection using nanoparticles or minicircle DNA / RNA vectors miRNAs, miRNA mimics, and pre-miRs can also be transfected into cells using nanoparticles, e.g., gold nanoparticles, and by ferric oxide magnetic NPs; see, e.g., Ghosh et al., Biomaterials. 2013 January; 34(3):807-16; Crew E, et al., Anal Chem. 2012 January. 3; 84(1):26-9.

[0324] Other modes of transfection without integration include the use of minicircle DNA / RNA vectors or the use of PiggyBac transposons, which allow the transfection of genes that can later be removed from the genome.

[0325] Host expression system for expressing miRNA As described hereinabove, various prokaryotic or eukaryotic cells can be used as host expression systems to express the miRNAs or polynucleotide agents capable of down-regulating miRNAs in some embodiments.These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage DNA / RNA, plasmid DNA / RNA, or cosmid DNA / RNA expression vectors containing coding sequences, yeast transformed with recombinant yeast expression vectors containing coding sequences, and plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus CaMV, tobacco mosaic virus TMV) or transformed with recombinant plasmid expression vectors containing coding sequences, such as Ti plasmids.Mammalian expression systems can also be used to express the miRNAs in some embodiments.

[0326] Examples of bacterial constructs include the pET series of E. coli expression vectors (Studier et al. (1990) Methods in Enzymol. 185:60-89).

[0327] In yeast, several vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Patent No. 5,932,447. Alternatively, vectors that promote integration of foreign DNA / RNA sequences into the yeast chromosome can be used.

[0328] The conditions used for contacting pluripotent cells are selected in terms of duration / cell concentration / miRNA concentration / ratio between cells and miRNA, allowing miRNA (or its inhibitor) to induce its differentiation.The present disclosure also contemplates incubation with differentiation factors that promote the differentiation of stem cells into DA neural cell populations.Incubation with such differentiation factors can be carried out before, simultaneously with, or after contact with miRNA.Examples of such agents are provided in the Examples section below.

[0329] CRISPR / Cas13 systems for gene editing Alternatively, or in addition, pluripotent cells may be genetically modified to express such differentiation factors using expression constructs, such as those described herein above.Furthermore, pluripotent cells may be genetically modified using CRISPR / Cas13 system, CRISPR / Cas7-11 system, or equivalent system, so that they no longer express the silenced / downregulated target, such as pre-miR-155, miR-155-5p, or miR-155-3p.

[0330] Although some gene editing techniques are known in the art, most preferably, CRISPR / Cas13 technique can be used to generate modified pluripotent cells.This process is well known to those skilled in the art.CRISPR / Cas13 technique uses single guide RNA (sgRNA) and Cas13 nuclease.

[0331] Certain rules govern strand selection of miRNAs:

[0332] Duplex thermodynamics determines strand selection

[0333] The strand with the weakest 5' bond is the most likely to be the guide.

[0334] The guide has a uridine at the 5' end and is purine-rich (A / G)

[0335] The passenger strand tends to have a 5' "C" bias

[0336] The passenger strand is pyrimidine-rich (U / C)

[0337] Applicants have discovered that changing the 5' "GC" to "AU" in pluripotent cells (arrow 1 in Figure 2) will favor miR-155-3p strand selection in DA neuronal cells. Applicants have discovered that changing the 5' "GC" to "AU" in pluripotent cells (arrow 1 in Figure 2) will reduce wild-type miR-155-3p strand selection in DA neuronal cells. Accordingly, Applicants have discovered that changing the 5' "GC" to "AU" in pluripotent cells (arrow 1 in Figure 2) will favor modified miR-155-3p strand selection in DA neuronal cells and reduce wild-type miR-155-3p strand selection in DA neuronal cells. This is shown in SEQ ID NO:8, which is reproduced here with the modified bases underlined: SEQ ID NO:8: CUGUUAAUGCUAAUCGUGAUAGGG AUUUUUGCCUCCAACUGA U UCCUACAUAUUAGCAUUAACAG

[0338] Applicants have also discovered that changing the 5' "GC" to "AU" in pluripotent cells (arrow 1 in Figure 2) will reduce wild-type miR-155-5p strand selection in DA neuronal cells. Accordingly, Applicants have also discovered that changing the 5' "GC" to "AU" in pluripotent cells (arrow 1 in Figure 2) will favor miR-155-3p strand selection in DA neuronal cells and reduce wild-type miR-155-5p strand selection in DA neuronal cells. This is shown in SEQ ID NO:8, which is reproduced here with the modified bases underlined: SEQ ID NO:8: CUGUUAAUGCUAAUCGUGAUAGGG A UUUUUGCCUCCAACUGA U UCCUACAUAUUAGCAUUAACAG

[0339] Applicants have also discovered that changing the 5' "GC" to "AU" in pluripotent cells (arrow 1 in Figure 2) will favor miR-155-3p strand selection in DA neuronal cells, reduce wild-type miR-155-3p strand selection, and reduce wild-type miR-155-5p strand selection in DA neuronal cells. This is shown in SEQ ID NO:8, which is reproduced here with the modified bases underlined: SEQ ID NO:8: CUGUUAAUGCUAAUCGUGAUAGGG A UUUUUGCCUCCAACUGA U UCCUACAUAUUAGCAUUAACAG

[0340] Applicants discovered that increasing the (-5p) pyrimidine content of the upward-facing portion in pluripotent cells would favor miR-155-3p strand selection in DA neural cells and reduce wild-type miR-155-3p strand selection in DA neural cells.

[0341] Applicants discovered that increasing the (-5p) pyrimidine content of the upward-facing portion in pluripotent cells would favor miR-155-3p strand selection in DA neural cells and reduce wild-type miR-155-5p strand selection in DA neural cells.

[0342] Applicant discovered that increasing the (-5p) pyrimidine content of the upward portion in pluripotent cells favors miR-155-3p strand selection in DA neural cells, reduces wild-type miR-155-3p in DA neural cells, and reduces wild-type miR-155-5p strand selection.

[0343] Applicants discovered that changing UUAAUG to GGAAUG (5' nucleotides 1-6) in pluripotent cells favors miR-155-3p strand selection in DA neural cells and reduces wild-type miR-155-3p strand selection in DA neural cells.

[0344] Applicants discovered that changing UUAAUG to GGAAUG (5' nucleotides 1-6) in pluripotent cells favors miR-155-3p strand selection in DA neural cells and reduces wild-type miR-155-5p strand selection in DA neural cells.

[0345] Applicants discovered that changing UUAAUG to GGAAUG (5' nucleotides 1-6) in pluripotent cells favors miR-155-3p strand selection in DA neural cells, reduces wild-type miR-155-3p, and reduces wild-type miR-155-5p strand selection in DA neural cells.

[0346] Such editing in pluripotent cells may enable miR-155-3p biased pluripotent cells. Such editing in pluripotent cells may enable miR-155-5p unbiased pluripotent cells.

[0347] The above editing in pluripotent cells may enable two classes of pluripotent cells: miR-155-3p biased pluripotent cells and miR-155-5p unbiased pluripotent cells.

[0348] The method of nucleotide destruction or nucleotide editing technique is known in the art, including but not limited to CRISPR-CAS13 (recognizes and cuts RNA instead of DNA), TALENS, zinc finger, CRISPR-Cas13-based system and CRISPR-Cas7-11.Any method of destroying gene sequence known in the art can be used to carry out the above-mentioned modification of miR-155 in pluripotent cells to generate miR-155-3p or miR-155-5p biased DA neural cell.

[0349] Composition of modified iPSCs Compositions comprising modified pluripotent stem cells are disclosed. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-5p. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-5p, wherein the modification to miR-155-5p comprises altering 5' nucleotides 1-2. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-5p, wherein the modification to miR-155-5p comprises altering 5' nucleotides 1-6. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-5p, wherein the modification to miR-155-5p comprises changing the 5' nucleotide from UUAAUG to GGAAUG.

[0350] In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-3p. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-3p, wherein the modification to miR-155-3p comprises altering 5' nucleotides 1-2. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-3p, wherein the modification to miR-155-3p comprises altering 5' nucleotide 1. In some embodiments, the modified pluripotent stem cells comprise a modification to miR-155-3p, wherein the modification to miR-155-3p comprises changing the 5' nucleotide from C to U.

[0351] In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p and miR-155-5p. In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, wherein the modifications to miR-155-3p comprise altering 5' nucleotides 1-2 and altering miR-155-5p 5' nucleotides 1-2. In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, wherein the modifications to miR-155-3p comprise altering 5' nucleotide 1 and altering miR-155-5p 5' nucleotides 1-6. In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, wherein the modifications to miR-155-3p comprise altering the 5' nucleotide from C to U and the modifications to miR-155-5p comprise altering the 5' nucleotide from UUAAUG to GGAAUG.

[0352] In some embodiments, the modified pluripotent stem cells comprise a modification to the miR-155 stem loop. In some embodiments, the modified pluripotent stem cells comprise a modification to the miR-155 stem loop, wherein the modification to the miR-155 stem loop comprises changing nucleotide 25 from G to A. In some embodiments, the modified pluripotent stem cells comprise a modification to the miR-155 stem loop, wherein the modification to the miR-155 stem loop comprises changing nucleotide 43 from C to U. In some embodiments, the modified pluripotent stem cells comprise a modification to the miR-155 stem loop, wherein the modification to the miR-155 stem loop comprises changing nucleotide 25 from G to A and nucleotide 43 from C to U.

[0353] In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, miR-155-5p, and the miR-155 stem loop. In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, wherein the modifications to miR-155-3p comprise altering 5' nucleotides 1-2, and altering miR-155-5p 5' nucleotides 1-2, and altering one nucleotide base pair in the stem loop. In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, wherein the modifications to miR-155-3p comprise altering 5' nucleotide 1, and altering miR-155-5p 5' nucleotides 1-6, and altering one nucleotide base pair in the stem loop. In some embodiments, the modified pluripotent stem cells comprise modifications to miR-155-3p, wherein the modifications to miR-155-3p comprise changing the 5' nucleotide from C to U; the modifications to miR-155-5p comprise changing the 5' nucleotide from UUAAUG to GGAAUG; and the modifications to the pre-miR-155 stem loop comprise changing nucleotide 25 from G to A and nucleotide 43 from C to U.

[0354] Disclosed is upregulation of at least miR-155-3p in pluripotent cells, which induces an anti-inflammatory phenotype in DA neural cells. Disclosed is upregulation of at least miR-155-3p in pluripotent cells, and differentiation of the modified pluripotent cells into miR-155-3p-biased DA neurons with an anti-inflammatory phenotype, and differentiation of the modified pluripotent cells into miR-155-3p-biased DA neurons with an anti-inflammatory phenotype.

[0355] Disclosed is downregulation of at least miR-155-5p in pluripotent cells, which induces an anti-inflammatory phenotype in DA neural cells. Disclosed is downregulation of at least miR-155-5p in pluripotent cells, and differentiation of the modified pluripotent cells into miR-155-5p unbiased DA neurons with an anti-inflammatory phenotype.

[0356] Disclosed are upregulation of at least miR-155-3p in pluripotent cells to induce an anti-inflammatory phenotype in DA neural cells, while downregulation of at least miR-155-5p in pluripotent cells to similarly induce an anti-inflammatory phenotype in DA neural cells. Disclosed are upregulation of at least miR-155-3p in pluripotent cells and differentiation of the modified pluripotent cells into miR-155-3p-biased DA neurons with an anti-inflammatory phenotype, while downregulation of at least miR-155-5p and differentiation of the modified pluripotent cells into miR-155-3p-biased DA neurons with an anti-inflammatory phenotype.

[0357] Provided is a method for predisposing pluripotent cells to differentiation into miR-155-3p-biased and / or miR-155-5p-unbiased DA neural cells, comprising upregulating the level of at least one exogenous miRNA selected from the group consisting of miR-155-3p and miR-155-5p in the pluripotent cells, thereby predisposing the pluripotent cells to differentiation into cells having an anti-inflammatory or pro-inflammatory phenotype.

[0358] In some embodiments, the pluripotent cells are human or rodent. In some embodiments, the pluripotent cells are human. In some embodiments, the pluripotent cells are isolated from the placenta and umbilical cord of a human newborn. In some embodiments, the pluripotent cells are isolated from human bone marrow. In some embodiments, the pluripotent cells are at least 50% purified, more preferably at least 75% purified, and even more preferably at least 90% purified.

[0359] Differentiation of iPSCs into DA neurons Isolation of pluripotent cells Embryonic stem cells in some embodiments can be obtained using well-known cell culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo preimplantation embryos or from in vitro fertilized (IVF) embryos. Alternatively, single-cell human embryos can be expanded to the blastocyst stage. For the isolation of human ES cells, the zona pellucida is removed from the blastocyst, and the inner cell mass (ICM) is isolated by immunosurgery, in which trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting. The ICM is then seeded into tissue culture flasks containing an appropriate medium that allows its proliferation. After 9 to 15 days, ICM-derived outgrowths are dissociated into clumps by mechanical dissociation or enzymatic digestion, and the cells are then replated in fresh tissue culture medium. Colonies exhibiting undifferentiated morphology are individually selected with a micropipette, mechanically dissociated into clumps, and replated. The resulting ES cells are then split periodically every 4 to 7 days. For further details regarding methods for preparing human ES cells, see U.S. Patent No. 5,843,780 to Thomson et al., Science 282: 1145, 1998; Curr. Top. Dev. Biol. 38: 133, 1998; Proc. Natl. Acad. Sci. USA 92: 7844, 1995; Bongso et al., Hum Reprod 4: 706, 30 1989; and Gardner et al., Fertil. Steril. 69: 84, 1998.

[0360] It is understood that commercially available stem cells can also be used.Human ES cells can be purchased from the NIH Human Embryonic Stem Cell Registry (www.escr.nih.gov).Non-limiting examples of commercially available embryonic stem cell lines are BGO1, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03 and TE32.

[0361] In addition, ES cells have been used in mouse (Mills and Bradley, 2001), golden hamster (Doetschman et al., 1988, Dev Biol. 127: 224-7), rat (Iannaccone et al., 1994, Dev Biol. 163: 288-92), rabbit (Giles et al. 1993, Mol Reprod Dev. 36: 130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36: 424-33), and several livestock species (Notarianni et al., 1991, J Reprod Fertil Suppl. 43: 255-60; Wheeler 1994, Reprod Fertil Dev. 6: 563-8; Mitalipova et al., 2001, Cloning. 3: 59-67], as well as from other species, including non-human primate species (rhesus monkeys and marmosets) Thomson et al., 1995, Proc Natl Acad Sci USA. 92: 7844-8; Thomson et al., 1996, Biol Reprod. 55: 254-9).

[0362] Induced pluripotent stem cells (iPS) (embryonic-like stem cells) can be generated from somatic cells by genetic manipulation of the somatic cells, for example, by retroviral transduction of transcription factors such as Oct-3 / 4, Sox2, c-Myc, and KLF4 into somatic cells, such as fibroblasts, hepatocytes, and gastric epithelial cells. Yamanaka S, Cell Stem Cell. 2007, 1(1):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 February 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008; 451:141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131:861-872. Other embryonic-like stem cells can be generated by nuclear transfer into oocytes, fusion with embryonic stem cells, or by nuclear transfer into zygotes if the recipient cell is arrested in mitosis.

[0363] Pluripotent cells (hES or iPSCs) as used herein may be autologous, syngeneic, or allogeneic related (matched siblings or haploidentical family members), or may be of unrelated, completely mismatched origin.

[0364] Pluripotent cell culture Pluripotent cell culture can be carried out in any medium known in the art that supports pluripotent cells.Methods for preparing and culturing pluripotent stem cells, such as ES cells, can be found in standard textbooks and treatises in cell biology, tissue culture, and embryology, including teratocarcinoma and embryonic stem cells: Guide to Techniques in Mouse Development (1993), Embryonic Stem Cell Differentiation in vitro (1993), Properties and uses of Embryonic Stem Cells: Prospects for Application to Human Biology and Gene Therapy (1998), all of which are incorporated herein by reference.Standard methods used in tissue culture are generally described in Animal Cell Culture (1987), Gene Transfer Vectors for Mammalian Cells (1987), and Current Protocols in Molecular Biology and Short Protocols in Molecular Biology (1987 & 1995).

[0365] As described above, cultured pluripotent cells can be modified. The cultured modified pluripotent cells have at least one modified miRNA, such as pre-mir155-5p or pre-mir155-3p. The cultured modified pluripotent cells have at least one modified miRNA, such as pre-mir155-5p or pre-mir155-3p, to induce differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons. The cultured modified pluripotent cells have at least one modified miRNA, such as pre-mir155-5p or pre-mir155-3p, to induce differentiation into miR-155-3p-biased and / or miR-155-5p-unbiased DA neurons.

[0366] Differentiation method During or after the differentiation step, the pluripotent cells can be monitored for their differentiation state. Cell differentiation can be determined by testing for cell- or tissue-specific markers known to indicate differentiation.

[0367] The following is a list of markers that can be used to confirm differentiation into DA neurons: FOXA2 or LMX1. Additional markers include TH, rthodenticle homeobox 2 (OTX2), nuclear receptor-related 1 protein (NURR1), neuron-specific class III beta-tubulin (Tujl), TTF3, paired-like homeodomain 3 (PITX3), achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF-3), transthyretin (TTR), synapsin, dopamine transporter (DAT), G-protein-coupled inwardly rectifying potassium channel (Kir3.2 / GIRK2), CD142, DCSM1, CD63, and CD99.

[0368] Tissue / cell-specific markers can be detected using immunological techniques well known in the art, Thomson JA et al., (1998). Science 282: 1145-7. Examples include, but are not limited to, flow cytometry for membrane-bound markers, immunohistochemistry for extracellular and intracellular markers, and enzyme immunoassays for secreted molecular markers.

[0369] It will be appreciated that the cells obtained according to the methods described herein may be enriched for a particular cell type, e.g., a precursor cell type or a mature cell type. Thus, for example, differentiation times can be selected to obtain early precursor types or late mature cell types.

[0370] In some embodiments, the DA neurons produced by differentiating iPCs comprise three distinct cell populations: A9 dopamine neurons, astrocytes, and vascular leptomeningeal cells (VLMCs). In some embodiments, the A9 dopamine neurons are miR-155-3p biased. In some embodiments, the A9 dopamine neurons are miR-155-5p biased. In some embodiments, the A9 dopamine neurons are miR-155-5p unbiased. In some embodiments, the astrocytes are miR-155-3p biased. In some embodiments, the astrocytes are miR-155-5p biased. In some embodiments, the astrocytes are miR-155-5p unbiased. In some embodiments, the VLMCs are miR-155-3p biased. In some embodiments, the VLMCs are miR-155-5p biased. In some embodiments, the VLMC is miR-155-5p unbiased.

[0371] In some embodiments, the A9 dopamine neurons are miR-155-3p biased and isolated from astrocytes and vascular leptomeningeal cells. In some embodiments, the A9 dopamine neurons are miR-155-5p biased and isolated from astrocytes and vascular leptomeningeal cells. In some embodiments, the A9 dopamine neurons are miR-155-5p unbiased and isolated from astrocytes and vascular leptomeningeal cells. In some embodiments, the astrocytes are miR-155-3p biased and isolated from A9 dopamine neurons and vascular leptomeningeal cells. In some embodiments, the astrocytes are miR-155-5p biased and isolated from A9 dopamine neurons and vascular leptomeningeal cells. In some embodiments, the astrocytes are miR-155-5p unbiased and isolated from A9 dopamine neurons and vascular leptomeningeal cells. In some embodiments, VLMCs are miR-155-3p biased and isolated from A9 dopamine neurons and astrocytes. In some embodiments, VLMCs are miR-155-5p biased and isolated from A9 dopamine neurons and astrocytes. In some embodiments, VLMCs are miR-155-5p unbiased and isolated from A9 dopamine neurons and astrocytes.

[0372] Further enrichment for specific cell types can be performed using cell sorting techniques, such as FACS and magnetic sorting.

[0373] In addition, cell differentiation may also be followed by specific reporters tagged with GFP or RFP that show an increase in fluorescence upon differentiation.

[0374] Target downregulation It will be understood that by determining the target of a miRNA that is proposed to be upregulated, the scope of the present disclosure can be expanded to include downregulation of the target by means other than contacting with the miRNA. Correspondingly, it will be understood that by determining the target of a miRNA that is proposed to be downregulated, the scope of the present disclosure can be expanded to include upregulation of the target.

[0375] For example, we contemplate that one of the targets of miR-155-3p is related to the protein target in Figure 4. Therefore, it is contemplated that differentiation into miR-155-3p-biased DA neurons can be achieved by downregulating these proteins. It is contemplated that differentiation into miR-155-3p-biased and / or miR-155-5p-unbiased DA neurons can be achieved by upregulating these proteins.

[0376] Thus, provided is a method for generating DA neural system cells, comprising contacting pluripotent cells with an agent that downregulates the amount and / or activity of the following protein targets: EIF2AK2, ZCCHC2, CMPK1, CDK13, ATG9A, YOD1, CLIC4, DCAF8, CSNK2A1, CALM1, BACH1, HDGF, IRF4, TBL1XR1, SETDB1, DAZAP2, and / or CDKN1A, thereby generating miR-155-3p-biased DA neuron cells. Also provided is a method for generating DA neural system cells, comprising contacting pluripotent cells with an agent that upregulates the amount and / or activity of a protein in FIG. 4, thereby generating miR-155-3p-biased DA neuron cells.

[0377] Thus, provided is a method for generating DA neural system cells, comprising contacting pluripotent cells with an agent that downregulates the amount and / or activity of the following protein targets: EIF2AK2, ZCCHC2, CMPK1, CDK13, ATG9A, YOD1, CLIC4, DCAF8, CSNK2A1, CALM1, BACH1, HDGF, IRF4, TBL1XR1, SETDB1, DAZAP2, and / or CDKN1A, thereby generating miR-155-5p unbiased DA neuron cells. Also provided is a method for generating DA neural system cells, comprising contacting pluripotent cells with an agent that upregulates the amount and / or activity of a protein in FIG. 4, thereby generating miR-155-5p unbiased DA neuron cells.

[0378] Downregulation of at least one protein in Figure 4 (or any of the other miRNA targets) can be obtained at the genome and / or transcript level using various molecules that interfere with transcription and / or translation (e.g., RNA silencing agents, ribozymes, DNAzymes, and antisense), or at the protein level using, for example, antagonists, enzymes that cleave polypeptides, etc.

[0379] One example of an agent capable of down-regulating at least one protein in Figure 4 is an antibody or antibody fragment capable of specifically binding thereto. Preferably, the antibody is capable of being internalized by the cell and entering the nucleus. The term "antibody," as used herein, includes intact molecules capable of binding to macrophages, as well as functional fragments thereof, such as Fab, F(ab')2, and Fv. These functional antibody fragments are defined as follows: (1) Fab, a fragment containing a monovalent antigen-binding fragment of an antibody molecule, which can be produced by digesting whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', a fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin followed by reduction to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, a fragment of an antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of a light chain and the variable region of a heavy chain expressed as two chains; and (5) single-chain antibody ("SCA"), a genetically engineered molecule containing the variable region of a light chain and the variable region of a heavy chain linked as a genetically fused single-chain molecule by an appropriate polypeptide linker.

[0380] The down-regulation of hsa-miR-155-3p or hsa-miR-155-5p can also be achieved by RNA silencing.As used herein, the term " RNA silencing " refers to a group of regulatory mechanisms mediated by RNA molecules, such as RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression and translational repression, which cause the expression of corresponding protein-coding genes to be inhibited or "silenced".RNA silencing has been observed in many types of organisms, including plants, animals and fungi.

[0381] As used herein, the term "RNA silencing agent" refers to RNA that can inhibit or "silence" the expression of target gene.In certain embodiments, RNA silencing agent can prevent the complete processing (for example, complete translation and / or expression) of mRNA molecule through post-transcriptional silencing mechanism.RNA silencing agent includes non-coding RNA molecule, for example, RNA duplex comprising paired strand, and precursor RNA from which such small non-coding RNA can be generated.In one embodiment, RNA silencing agent can induce RNA interference.In another embodiment, RNA silencing agent can mediate translational repression.

[0382] RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNA (siRNA).The corresponding process in plants is generally referred to as post-transcriptional gene silencing or RNA silencing, and in fungi, it is called quelling.The process of post-transcriptional gene silencing is considered to be an evolutionarily conserved cellular defense mechanism used to prevent the expression of foreign genes, and is widely shared among diverse plant species and phyla.Such protection from foreign gene expression may occur in response to the production of double-stranded RNA (dsRNA) derived from the random integration of transposon elements into the host genome by viral infection or a cellular response that specifically destroys homologous double-stranded RNA or viral genomic RNA.

[0383] The presence of long dsRNA in cells stimulates the activity of a ribonuclease III enzyme called Dicer. Dicer is responsible for processing dsRNA into short pieces of dsRNA known as short interfering RNA (siRNA). The short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and contain duplexes of about 19 base pairs. The RNAi response also features an endonuclease complex, commonly referred to as the RNA-induced silencing complex (RISC), which mediates the cleavage of single-stranded RNAs with sequences complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA occurs in the center of the region complementary to the antisense strand of the siRNA duplex.

[0384] Thus, the use of dsRNA to downregulate protein expression from mRNA is disclosed.

[0385] According to one embodiment, dsRNA is longer than 30bp.The use of long dsRNA (that is, dsRNA longer than 30bp) is very limited, because it is believed that these longer regions of double-stranded RNA will induce interferon and PKR response.However, the use of long dsRNA can provide many advantages, because cell can select the best silencing sequence, so the need to test a large number of siRNAs is reduced, long dsRNA allows silencing library to have lower complexity than that required for siRNA, and perhaps most importantly, long dsRNA can prevent virus-induced escape mutation when used as therapeutic agent.

[0386] Various studies have shown that long dsRNAs can be used to silence gene expression without inducing stress responses or causing significant off-target effects, see, for example, Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004; 13:115-125; Diallo M., et al., Oligonucleotides. 2003; 13:381-392; Paddison PJ, et al., Proc. Natl Acad. Sci. USA. 2002; 99:1443-1448; Tran N., et al., FEBS Lett. 2004; 573:127-134.

[0387] Specifically, the introduction of long dsRNA (transcripts longer than 30 bases) for gene silencing in cells (e.g., embryonic cells and oocytes) in which the interferon pathway is not activated has been disclosed, see, e.g., Billy et al., PNAS 2001, Vol 98, pages 14428-14433 and Diallo et al., Oligonucleotides, Oct. 1, 2003, 13(5): 381-392. doi: 10.1089 / 154545703322617069.

[0388] The introduction of long dsRNA has been disclosed, which is specifically designed not to induce interferon and PKR pathways to downregulate gene expression.For example, Shinagwa and Ishii Genes & Dev.17 (11): 1340-1345, 2003) developed a vector called pDECAP, which expresses long double-stranded RNA from RNA polymerase II (Pol II) promoter.The transcription product from pDECAP lacks both the 5'-cap structure and the 3'-poly (A) tail, which promotes the transport of dsRNA into the cytoplasm, so the long ds-RNA derived from pDECAP does not induce interferon response.

[0389] Delivery of small inhibitory RNA (siRNA) Another method to circumvent the interferon and PKR pathways in mammalian systems is by the introduction of small inhibitory RNAs (siRNAs) either via transfection or endogenous expression.

[0390] The term "siRNA" refers to small inhibitory RNA duplexes (typically 18-30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21-mers with a central 19-bp duplex region and symmetric 2-base 3'-overhangs at the termini; however, it has recently been shown that chemically synthesized RNA duplexes of 25-30 bases in length can have as much as a 100-fold increase in potency compared to 21-mers at the same positions. The observed increased potency in triggering RNAi obtained using longer RNAs is theorized to result from providing Dicer with a substrate (27-mer) instead of a product (21-mer), which improves the speed or efficiency of entry of siRNA duplexes into RISC.

[0391] The position of the 3'-overhang has been found to affect siRNA potency, with asymmetric duplexes with a 3'-overhang on the antisense strand generally being more potent than those with a 3'-overhang on the sense strand (Rose et al., 2005). This may be due to asymmetric strand loading into RISC, as the opposite potency pattern is observed when targeting antisense transcripts.

[0392] The strands of double-stranded interfering RNA (e.g., siRNA) can be connected to form a hairpin or stem-loop structure (e.g., shRNA).Therefore, as mentioned above, RNA silencing agent can also be short hairpin RNA (shRNA).

[0393] The term "shRNA" as used herein refers to an RNA agent having a stem-loop structure, comprising first and second regions of complementary sequence, the degree of complementarity and the orientation of the regions being sufficient to allow base pairing between the regions, the first and second regions joined by a loop region, and the loop resulting from the lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11, including the endpoints. Some of the nucleotides in the loop may participate in base pairing interactions with other nucleotides within the loop. Examples of oligonucleotide sequences that can be used to form a loop include 5'-UUCAAGAGA-3' (Brummelkamp, ​​TR et al. (2002) Science 296: 550) and 5'-UUUGUGUAG-3' (Castanotto, D. et al. (2002) RNA 8:1454). One skilled in the art will appreciate that the resulting single-stranded oligonucleotide forms a stem-loop or hairpin structure containing a double-stranded region that can interact with the RNAi machinery.

[0394] RNA silencing agents According to another embodiment, the RNA silencing agent may be an miRNA, as further described herein above.

[0395] The synthesis of RNA silencing agents suitable for use herein can be carried out as follows: First, the miRNA target mRNA sequence (e.g., CTGF sequence) is scanned for AA dinucleotide sequences downstream of the AUG start codon. The occurrence of each AA and the 19 nucleotides adjacent to it at 3' is recorded as a potential siRNA target site. Preferably, the siRNA target site is selected from the open reading frame, because untranslated regions (UTRs) are more abundant in regulatory protein binding sites. UTR-binding proteins and / or translation initiation complexes can interfere with the binding of siRNA endonuclease complexes [Tuschl ChemBiochem. 2:239-245]. However, it will be understood that siRNA directed against untranslated regions can also be effective, as it has been shown for GAPDH that siRNA directed against the 5' UTR mediated a reduction of approximately 90% of cellular GAPDH mRNA and completely suppressed protein levels (www.ambion.com / techlib / tn / 91 / 912.html).

[0396] Potential target sites are then compared to the appropriate genome database (e.g., human, mouse, rat, etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov / BLAST / ). Putative target sites that show significant homology to other coding sequences are filtered out.

[0397] Select suitable target sequence as template for siRNA synthesis.Preferred sequence is that which contains low G / C content, because it has been proven that these are more effective in mediating gene silencing compared with that which has G / C content higher than 55%.Several target sites are preferably selected along the length of target gene for evaluation.For better evaluation of selected siRNA, negative control is preferably used in combination.Negative control siRNA preferably contains the same nucleotide composition as siRNA, but lacks significant homology to genome.Therefore, scrambled nucleotide sequence of siRNA is preferably used, provided that it does not show any significant homology to any other gene.

[0398] RNA silencing agents can include nucleic acid analogs, which can have at least one different linkage, such as phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphosphoramidite linkage, and peptide nucleic acid backbone and linkage.Other analog nucleic acids include those with positive backbone, non-ionic backbone, and non-ribose backbone, including those described in U.S. Patent No. 5,235,033 and U.S. Patent No. 5,034,506, which are incorporated by reference.Nucleic acids containing one or more non-naturally occurring or modified nucleotides are also included in one definition of nucleic acid.Modified nucleotide analogs can be located, for example, at the 5'-end and / or 3'-end of nucleic acid molecule.Representative examples of nucleotide analogs can be selected from ribonucleotides whose sugar or backbone is modified. However, it should be noted that ribonucleotides with modified nucleobases, i.e., ribonucleotides containing non-naturally occurring nucleobases rather than naturally occurring nucleobases, such as uridine or cytidine modified at position 5, such as 5-(2-amino)propyluridine, 5-bromouridine; adenosine and guanosine modified at position 8, such as 8-bromoguanosine; deazanucleotides, such as 7-deaza-adenosine; O- and N-alkylated nucleotides, such as N6-methyladenosine, are also suitable. The 2'-OH group may be replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is C1-C6 alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I. Modified nucleotides also include nucleotides conjugated to cholesterol, for example, through a hydroxyprolinol linkage, as described in Krutzfeldt et al., Nature 438:685-689 (2005), Soutschek et al., Nature 432:173-178 (2004), and U.S. Patent Publication No. 20050107325, which are incorporated herein by reference.Further modified nucleotides and nucleic acids are described in US Patent Publication No. 20050182005, which is incorporated herein by reference.Modification of ribose-phosphate backbone can be carried out for various reasons, for example, to increase the stability and half-life of such molecules in physiological environments, to enhance diffusion across cell membranes, or as probes on biochips.Backbone modification can also enhance resistance to degradation, for example, in the harsh endocytic environment of cells.Backbone modification can also reduce nucleic acid clearance by hepatocytes, for example, in the liver and kidney.Mixtures of naturally occurring nucleic acids and analogs can be produced, or mixtures of different nucleic acid analogs and mixtures of naturally occurring nucleic acids and analogs can be produced.

[0399] In some embodiments, the RNA silencing agents provided herein may be functionally associated with a "cell-penetrating peptide." As used herein, a "cell-penetrating peptide" is a peptide containing a short (approximately 12-30 residues) amino acid sequence or functional motif that confers energy-independent (i.e., non-endocytic) translocation properties associated with transport of a membrane-penetrating complex across the plasma membrane and / or nuclear membrane of a cell. Cell-penetrating peptides used in membrane-penetrating complexes contain at least one nonfunctional cysteine ​​residue, either free or derivatized to form a disulfide linkage with a double-stranded ribonucleic acid that has been modified for such linkage. Representative amino acid motifs that confer such properties are listed in U.S. Patent No. 6,348,185, the contents of which are expressly incorporated herein by reference. Cell-penetrating peptides include, but are not limited to, penetratin, transportan, plsl, TAT(48-60), pVEC, MTS, and MAP.

[0400] DNAzyme molecules capable of specifically cleaving mRNA transcripts Another agent capable of downregulating the protein in Figure 4 is a DNAzyme molecule, which can specifically cleave CTGF mRNA transcripts or DNA sequences. DNAzymes are single-stranded polynucleotides that can cleave both single- and double-stranded target sequences (Breaker, RR and Joyce, G. Chemistry and Biology 1995; 2:655; Santoro, SW & Joyce, GF Proc. Natl. Acad. Sci. USA 1997; 943:4262). A generalized model of DNAzymes (the "10-23" model) has been proposed. The "10-23" DNAzyme has a catalytic domain of 15 deoxyribonucleotides flanked by two substrate recognition domains of 7 to 9 deoxyribonucleotides each. This type of DNAzyme can efficiently cleave its substrate RNA at purine:pyrimidine junctions (Santoro, SW & Joyce, GF Proc. Natl. Acad. Sci. USA 20 199; for a review of DNAzymes see Khachigian, LM Curr Opin Mol Ther 4:119-21 (2002)).

[0401] An example of the construction and amplification of synthetic engineered DNAzymes that recognize single-stranded and double-stranded target cleavage sites is disclosed in US Pat. No. 6,326,174 to Joyce et al.

[0402] Antisense polynucleotides capable of specifically hybridizing to mRNA transcripts encoding the proteins in FIG. Downregulation of hsa-miR-155-3p or hsa-miR-155-5p can also be achieved by using antisense polynucleotides capable of specifically hybridizing to mRNA transcripts encoding hsa-miR-155-3p or hsa-miR-155-5p.

[0403] The design of antisense molecules that can be used to effectively downregulate hsa-miR-155-3p or hsa-miR-155-5p should take into account two aspects that are important for antisense approaches: the first is delivery of the oligonucleotide to the cytoplasm of appropriate cells, while the second is the design of an oligonucleotide that specifically binds to a specified mRNA within the cell in a manner that inhibits its translation.

[0404] The prior art teaches several delivery strategies that can be used to efficiently deliver oligonucleotides to a wide variety of cell types (see, e.g., Luft J Mol Med 76: 75-6 (1998), Kronenwett et al. Blood 91: 852-62 (1998), Rajur et al. Bioconjug Chem 8: 935-40 (1997), Lavigne et al. Biochem Biophys Res Commun 237: 566-71 (1997), and Aoki et al. (1997) Biochem Biophys Res Commun 231: 540-5 (1997)).

[0405] Additionally, algorithms are also available for identifying sequences with the highest predicted binding affinity to a target mRNA based on thermodynamic cycles that take into account the energetics of structural changes in both the target mRNA and the oligonucleotide [see, e.g., Walton et al. Biotechnol Bioeng 65: 1-9 (1999)].

[0406] Such algorithms have been successfully used to implement antisense approaches in cells. For example, the algorithm developed by Walton et al. allowed scientists to successfully design antisense oligonucleotides for rabbit beta-globin (RBG) and mouse tumor necrosis factor-alpha (TNF-alpha) transcripts. The same academic research group more recently reported that the antisense activity of rationally selected oligonucleotides against three model target mRNAs (human lactate dehydrogenase A and B and rat gp130) in cell culture, as assessed by kinetic PCR techniques, was demonstrated to be effective in nearly all cases, including tests against three different targets in two cell types using phosphodiester and phosphorothioate oligonucleotide chemistries.

[0407] In addition, several approaches for designing and predicting the efficiency of specific oligonucleotides using in vitro systems have also been published (Matveeva et al., Nature Biotechnology 16: 1374-1375 (1998)).

[0408] Specifically cleaves the mRNA transcripts encoding hsa-miR-155-3p or hsa-miR-155-5p Another agent that can downregulate hsa-miR-155-3p or hsa-miR-155-5p is a ribozyme molecule, which can specifically cleave the mRNA transcript encoding hsa-miR-155-3p or hsa-miR-155-5p.Ribozymes have increasingly been used to sequence-specifically inhibit gene expression by cleaving the mRNA encoding the protein of interest (Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)).The possibility of designing ribozymes to cleave any specific target RNA makes ribozymes a valuable tool in both basic academic research and therapeutic applications.

[0409] Triplex-forming oligonucleotides (TFOs). Another method for regulating the expression of hsa-miR-155-3p or hsa-miR-155-5p genes in cells is by triplex-forming oligonucleotides (TFOs).Recent studies have shown that TFOs can be designed that can recognize and bind to polypurine / polypyrimidine regions in double-stranded helical DNA in a sequence-specific manner.These recognition rules have been outlined by Maher III, LJ, et al., Science, 1989; 245:725-730; Moser, HE, et al., Science, 1987; 238:645-630; Beal, PA, et al., Science, 1992; 251:1360-1363; Cooney, M., et al., Science, 1988, 241:456-459, and Hogan, ME, et al., EP Publication 375408.

[0410] Modifications of oligonucleotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration), have helped to overcome inherent problems with TFO activity, such as charge repulsion and instability, and it has recently been shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review, see Seidman and Glazer, J Clin Invest 2003; 112:487-94).

[0411] Generally, triplex-forming oligonucleotides have the following sequence correspondence:

[0412] Oligo 3'--AGGT

[0413] double stranded 5'--AGCT

[0414] duplex 3'--TCGA

[0415]

[0416]

[0417]

[0418]

[0419] However, A-AT and G-GC triplets have been shown to have the highest triple helix stability (Reither and Jeltsch, BMC Biochem, 2002, Sep. 12, Epub). The same authors showed that TFOs designed according to the A-AT and G-GC rules do not form nonspecific triplexes, indicating that triplex formation is indeed sequence-specific.

[0420] Triplex-forming oligonucleotides are preferably at least 15, more preferably 25, even more preferably 30 or more nucleotides in length, up to 50 or 100 bp.

[0421] Transfection of TFOs into cells (e.g., by cationic liposomes) and formation of triple helix structures with target DNA induces conformational and functional changes, blocking transcription initiation and elongation and allowing the introduction of desired sequence changes in endogenous DNA, resulting in specific downregulation of gene expression. Examples of such suppression of gene expression in TFO-treated cells include knockout of the episomal supFG 1 and endogenous HPRT genes in mammalian cells (Vasquez et al., Nucl Acids Res. 1999; 27:1176-81 and Puri, et al., J Biol Chem, 2001; 276:28991-98), as well as sequence- and target-specific downregulation of expression of the Ets2 transcription factor, which is important in prostate cancer pathogenesis (Carbone, et al., Nucl Acid Res. 2003; 31:833-43), and the pro-inflammatory ICAM-1 gene (Besch et al., J Biol Chem, 2002; 277:32473-79). In addition, Vuyisich and Beal have recently shown that sequence-specific TFOs can bind to dsRNA and inhibit the activity of dsRNA-dependent enzymes, such as RNA-dependent kinases (Vuyisich and Beal, Nuc. Acids Res 2000; 28:2369-74).

[0422] In addition, TFOs designed according to the above principles can induce directed mutagenesis capable of carrying out DNA repair, and thus can provide both down- and up-regulation of the expression of endogenous genes (Seidman and Glazer, J Clin Invest 2003; 112:487-94).Detailed descriptions of the design, synthesis, and administration of effective TFOs can be found in U.S. Patent Applications Nos. 2003 017068 and 2003 0096980 to Froehler et al., Nos. 2002 0128218 and 2002 0123476 to Emanuele et al., and U.S. Patent No. 5,721,138 to Lawn.

[0423] Modification of the hsa-miR-155-3p or hsa-miR-155-5p locus using CRISPR In some embodiments, the components of the CRISPR system described herein (for example, by transient transfection of one or more vectors or transfection of RNA) are transiently transfected, and the cells modified through the activity of the CRISPR complex are used to establish new cell lines, including cells that contain modifications but lack any other exogenous sequences. In some embodiments, cells that are transiently or non-transiently transfected with one or more vectors described herein, or cell lines derived from such cells, are used in the evaluation of one or more test compounds.

[0424] It is also contemplated that hsa-miR-155-3p or hsa-miR-155-5p can be silenced by genetic modification of the hsa-miR-155-3p or hsa-miR-155-5p locus.It is also contemplated that hsa-miR-155-3p or hsa-miR-155-5p can be silenced by genetic modification of the hsa-miR-155-BIC locus.This modification can include the complete deletion of part or all of the coding region so that functional protein is not produced.Modification can also include the mutation or deletion of part or all of the promoter so that the coding region is not transcribed. In some embodiments, silencing hsa-miR-155-3p or hsa-miR-155-5p comprises the introduction of CRISPR / Cas13 or CRISPR / Cas7-11 reagents to genetically delete and / or modify the hsa-miR-155-3p or hsa-miR-155-5p genomic locus.

[0425] The conditions used to contact the mesenchymal stem cells are selected in terms of duration / concentration of cells / concentration of hsa-miR-155-3p or hsa-miR-155-5p down-regulator / ratio of cells to hsa-miR-155-3p or hsa-miR-155-5p down-regulator that allow the hsa-miR-155-3p or hsa-miR-155-5p down-regulator to induce its differentiation.

[0426] The isolated cell populations obtained according to the methods described herein are typically heterogeneous, although homogeneous cell populations are also contemplated.

[0427] According to certain embodiments, the cell population is genetically modified to express an exogenous miRNA or a polynucleotide agent capable of down-regulating an miRNA.

[0428] As described above, to induce differentiation into miR-155-3p-biased, miR-155-5p-unbiased, or miR-155-5p-biased DA neurons, one of the following miRNAs, miR-155-3p or miR-155-5p, is modified in pluripotent cells. In some embodiments, the modification causes downregulation of a specific miRNA, i.e., miR-155-3p or miR-155-5p. In some embodiments, the modification causes upregulation of a specific miRNA, i.e., miR-155-3p or miR-155-5p. In some embodiments, the modification causes upregulation of a specific miRNA, i.e., miR-155-3p, and downregulation of a specific miRNA, i.e., miR-155-5p. In some embodiments, the modification causes upregulation of a specific miRNA, i.e., miR-155-5p, and downregulation of a specific miRNA, i.e., miR-155-3p. Downregulation of such miRNAs can be achieved using polynucleotides that can hybridize to the miRNAs under physiological conditions in a cell.

[0429] In some embodiments, manipulation of specific miRNAs in pluripotent cells can generate cells expressing miR-155-3p-biased, miR-155-3p-unbiased, miR-155-5p-biased, or miR-155-5p-unbiased DA neural cells. miR-155-3p-biased DA neural cells can have anti-inflammatory effects. miR-155-5p-biased DA neural cells can have pro-inflammatory effects. miR-155-3p-unbiased DA neural cells can have anti-inflammatory effects. miR-155-5p-unbiased DA neural cells can have pro-inflammatory effects.

[0430] Provided is a method for producing miR-155-3p-biased, or miR-155-3p unbiased, miR-155-5p unbiased, or miR-155-5p-biased DA neural cells, comprising upregulating the level of at least one exogenous miRNA selected from the group consisting of miR-155-3p or miR-155-5p in pluripotent cells. According to certain embodiments, the DA neural cells express at least FOXA2 and LMX1.

[0431] A method for producing miR-155-3p-biased, miR-155-5p-unbiased DA neural cells is provided, comprising upregulating the level of at least one exogenous miRNA selected from the group consisting of miR-155-3p or miR-155-5p in pluripotent cells. According to certain embodiments, the DA neural cells express at least FOXA2 and LMX1.

[0432] MiRNA array analysis in differentiated and undifferentiated cells should reveal several miRNAs that are overexpressed in a statistically significant manner (more than three-fold) and several miRNAs that are downregulated in a statistically significant manner (more than three-fold).

[0433] Methods are disclosed for the ex vivo differentiation of pluripotent cells into neural progenitor cells and DA neurons using microRNAs.

[0434] Numerous methods for differentiating pluripotent cells into DA neuron cells are known in the art, including genetic modification and / or culturing in a medium that promotes differentiation to that fate.The medium typically contains at least one activator of Sonic Hedgehog (SHH) signaling and at least one activator of Wingless (Wnt) signaling.Typically, differentiation is carried out in serum-free medium or serum replacement.

[0435] The present disclosure relates to the field of stem cell biology, specifically to the lineage-specific differentiation of pluripotent or multipotent stem cells, which may include, but are not limited to, non-embryonic induced pluripotent stem cells (iPSCs) as well as human embryonic stem cells (hESCs), somatic stem cells, stem cells derived from patients with disease, or any other cells capable of lineage-specific differentiation. Specifically described are methods using novel culture conditions to induce lineage-specific differentiation of hESCs and / or iPSCs into floor-plate mesencephalic progenitor cells and then into a large population of mesencephalic-fate FOXA2+LMX1A+TH+ dopamine (DA) neurons. The mesencephalic-fate FOXA2+LMX1A+TH+ dopamine (DA) neurons generated using the methods disclosed herein are further contemplated for a variety of uses, including, but not limited to, in in vitro drug discovery assays, neurological academic research, and as therapeutic agents for reversing disease, damage, or loss of dopamine neurons in patients. Additionally, compositions and methods are provided for differentiating midbrain-fate FOXA2+LMX1A+TH+ dopamine (DA) neurons from human pluripotent stem cells for use in disease modeling, particularly Parkinson's disease.

[0436] As mentioned above, the differentiation of pluripotent stem cells into DA neurons is known to those skilled in the art. See U.S. Patent Nos. 10,280,398 and 10,590,383. The following Table 1 is a representative example of the differentiation of pluripotent stem cells into DA neurons. The following Table 1 is a reproduction of Table 6, Condition 9 in U.S. Patent No. 10,590,383. The cell population at day 17 (D17) produces FoxA2+ / Lmx1+ DA precursor cells. When iPSC cells are modified as described herein, the cell population at day 17 (D17) produces FoxA2+ / Lmx1+ modified DA precursor cells. [Table 1-1] [Table 1-2]

[0437] D17 cells consist of three distinct cell populations: A9 DN (majority), astrocytes, and VLMCs.

[0438] When miR-155 is modified in pluripotent cells, it produces a D17 cell population with miRNAs that have anti-inflammatory effects.When miR-155 is modified in pluripotent cells, it produces a D17 cell population with miRNAs that have pro-inflammatory effects.When miR-155 is modified in pluripotent cells, it produces a D17 cell population with miRNAs that have a miR-155-3p bias.When miR-155 is modified in pluripotent cells, it produces a D17 cell population with miRNAs that have a miR-155-5p bias.

[0439] The present disclosure can be further understood by the following numbered paragraphs:

[0440] Paragraph 1. A method for promoting differentiation of pluripotent cells into miR-155-3p-biased or miR-155-5p-biased DA neural cells, comprising: (i) introducing into the pluripotent cells the following exogenous microRNA (miR): miR-155-3p or miR-155-5p; (ii) confirming an increase in expression of at least miR-155-3p or miR-155-5p, thereby promoting differentiation of pluripotent cells into miR-155-3p-biased or miR-155-5p-biased DA neural cells; A method comprising:

[0441] Paragraph 2. The step of introducing: (iii) transfecting the pluripotent cells with an expression vector comprising a polynucleotide sequence encoding a pre-miRNA of the miR; or (iv) transfecting the pluripotent cells with an expression vector comprising a polynucleotide sequence encoding the miR. 2. The method of paragraph 1, comprising any one of:

[0442] Paragraph 3. The method described in paragraph 1, further comprising the step of introducing miR-155-3p antagomir or miR-15505p antagomir into the pluripotent cells prior to the confirming step.

[0443] Paragraph 4. A method for promoting differentiation of pluripotent cells into miR-155-3p-biased or miR-155-5p-biased DA neuron cells, comprising: (v) introducing into the pluripotent cells the following exogenous microRNA (miR): miR-155-3p or miR-155-5p; (vi) confirming the expression of at least one DA neuron marker selected from the group comprising FOXA2 or LMX1, wherein said expression results in at least 50% of the DA neuron cells having increased expression of miR-155-3p or miR-155-5p compared to wild-type; A method comprising:

[0444] Paragraph 5. The step of introducing: (vii) transfecting the pluripotent cells with an expression vector comprising a polynucleotide sequence encoding a pre-miRNA of the miR; or (viii) transfecting the pluripotent cells with an expression vector comprising a polynucleotide sequence encoding the miR. 5. The method of paragraph 4, comprising any one of:

[0445] Paragraph 6. The method of paragraph 4, further comprising the step of introducing miR-155-3p antagomir or miR-155-5p antagomir into the pluripotent cells prior to the confirming step.

[0446] DA neuronal population Provided herein are purified or isolated populations of cells differentiated from pluripotent cells.

[0447] Disclosed are compositions comprising DA neurons with modified pre-miR-155 that have full complementarity to the wild-type miRNA sequence except for one, two, or three nucleotide substitutions, terminal additions, and / or truncations.

[0448] A composition is disclosed comprising a DA neuron having a modified pre-miR-155 having SEQ ID NO:6. A composition is disclosed comprising a DA neuron having a modified pre-miR-155 having SEQ ID NO:7. A composition is disclosed comprising a DA neuron having a modified pre-miR-155 stem loop having SEQ ID NO:8. A composition is disclosed comprising a DA neuron having a modified pre-miR-155 having SEQ ID NO:6 and SEQ ID NO:7. A composition is disclosed comprising a DA neuron having a modified pre-miR-155 having SEQ ID NO:6 and SEQ ID NO:7 and a pre-miR-155 stem loop having SEQ ID NO:8. A composition is disclosed comprising a DA neuron having a modified pre-miR-155 having SEQ ID NO:6 and a pre-miR-155 stem loop having SEQ ID NO:8. A composition is disclosed comprising a DA neuron having a modified pre-miR-155 having SEQ ID NO:7 and a pre-miR-155 stem loop having SEQ ID NO:8. SEQ ID NOs: 6-8 can be used to generate miR-155-3p-biased or miR-155-5p-biased DA neurons. Disclosed are compositions comprising DA neurons having a modified pre-miR-155 having SEQ ID NO: 7 and a pre-miR-155 stem-loop having SEQ ID NO: 8. SEQ ID NOs: 6-8 can be used to generate miR-155-3p-biased and miR-155-5p-unbiased DA neurons.

[0449] Disclosed are compositions comprising DA neurons with modified pre-miR-155 that favors miR-155-3p strand selection. Disclosed are compositions comprising DA neurons with modified pre-miR-155 that favors miR-155-5p strand selection. Disclosed are compositions comprising DA neurons with modified pre-miR-155 that reduces miR-155-3p strand selection. Disclosed are compositions comprising DA neurons with modified pre-miR-155 that reduces miR-155-5p strand selection. Disclosed are compositions comprising DA neurons with modified pre-miR-155 that favors miR-155-3p strand selection and reduces miR-155-5p strand selection.

[0450] In certain embodiments, pre-miRNA-155 sequences are disclosed, wherein the pre-miRNA-155 incorporated into DA neuron cells has an anti-inflammatory effect in a human subject. In certain embodiments, pre-miRNA-155 sequences are disclosed, wherein the pre-miRNA-155 incorporated into DA neuron cells has an anti-inflammatory effect in a human subject. In certain embodiments, pre-miRNA-155 sequences are disclosed, wherein the pre-miRNA-155 incorporated into DA neuron cells has a pro-inflammatory effect in a human subject.

[0451] These compositions are useful in treating diseases such as neurological diseases, PD, and related disorders.

[0452] The present disclosure also provides pharmaceutical compositions comprising, consisting essentially of, or even consisting of purified or isolated miR-155-3p-biased or miR-155-5p-biased DA cell populations. In one embodiment, the pharmaceutical compositions comprise, or alternatively consist essentially of, or even consist of a pharmaceutically acceptable carrier and an effective amount of the miR-155-3p-biased or miR-155-5p-biased DA cell populations.

[0453] The present disclosure also provides pharmaceutical compositions comprising, consisting essentially of, or even consisting of purified or isolated miR-155-3p-unbiased or miR-155-5p-unbiased DA cell populations. In one embodiment, the pharmaceutical compositions comprise, alternatively consist essentially of, or even consist of a pharmaceutically acceptable carrier and an effective amount of the miR-155-3p-biased or miR-155-5p-biased DA cell population.

[0454] Non-limiting examples of carriers include phosphate-buffered saline (PBS), saline, or biocompatible matrix materials, such as collagen matrices. The composition may optionally contain protease inhibitors, glycerol, and / or dimethyl sulfoxide (DMSO). Pharmaceutically acceptable carriers include one or more of a biocompatible matrix or a liquid carrier. The pharmaceutical compositions of the present disclosure can be formulated for freeze-drying or lyophilization using methods known in the art.

[0455] The pharmaceutical compositions are intended for in vitro and in vivo use and may comprise a miR-155-3p-biased DA cell population or a miR-155-5p-biased DA cell population at a concentration of about 1 mg / ml to about 10 mg / ml, or alternatively about 1 to about 8 mg / ml, or alternatively about 2 to about 8 mg / ml, or alternatively 2 to about 5 mg / ml, or about 2 to 4 mg / ml, or alternatively 3 mg / ml to 20 mg / ml. When administered to a subject, an effective amount of a miR-155-3p-biased DA cell population or a miR-155-5p-biased DA cell population is administered to a subject so as to result in at least about 5%, or alternatively at least about 10%, or alternatively at least about 20%, or alternatively at least about 30%, or alternatively at least about 40%, or alternatively at least about 50%, or alternatively at least about 60%, or alternatively at least about 70%, or alternatively at least about 80%, or alternatively at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least about 99% efficacy in the methods provided herein compared to a control not receiving the composition. Comparative efficacy can be determined by suitable in vitro or in vivo methods known in the art and briefly exemplified herein.

[0456] In one embodiment, the composition is a pharmaceutical preparation for use in the therapeutic methods of the present disclosure and for treating appropriate or related diseases. Although examples are given for the treatment of PD, the principles can be applied to other disease conditions, including neurological diseases.

[0457] In a further aspect, the present disclosure provides a pharmaceutical composition comprising, alternatively consisting essentially of, or even consisting of an isolated or purified miR-155-3p-biased DA cell population or miR-155-5p-biased DA cell population at a concentration such that the total composition comprises at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% of the cells.

[0458] In some embodiments, the pluripotent cells are human.

[0459] According to another embodiment, the pluripotent cells are isolated from the placenta and umbilical cord of a human neonate.

[0460] The cell population can be selected such that greater than about 50% (alternatively, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or even greater than about 95%) of the cells express at least one, at least two, at least three, at least four, or at least five markers of DA neurons, or at least one, at least two, at least three, at least four, or at least five markers of DA neural cells, including, but not limited to, FOXA2, LMX1A, NURR1, TH, OTX2, Tujl, TTF3, PITX3, ASCL, EBF-1, EBF-3, TTR, DAT, Kir3.2 / GIRK2, CD 142, DCSM1, CD63, and CD99.

[0461] Pluripotent cells as used herein may be autologous, syngeneic, or allogeneic related (matched siblings or haploidentical family members), or may be of unrelated, completely mismatched origin.

[0462] The isolated cell populations obtained according to the methods described herein are typically heterogeneous, although homogeneous cell populations are also contemplated.

[0463] According to certain embodiments, the cell population is genetically modified to express an exogenous miRNA or a polynucleotide agent that can down-regulate miRNA. In some embodiments, the modified miRNA comprises SEQ ID NO: 6, 7, or 8. In some embodiments, the modified miRNA comprises modification of miR-155-3p or miR-155-5p in the pluripotent cell population.

[0464] The cell population can be selected such that greater than about 50% (alternatively, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or even greater than about 95%) of the cells have a modified miRNA, e.g., miR-155-3p or miR-155-5p.

[0465] Isolation of specific subpopulations of cells can be performed using techniques known in the art, including fluorescence activated cell sorting and / or magnetic separation of cells.

[0466] The cell population may contain DA neurons or DA neuron cell phenotypes, including cell size, cell shape, organelle size, and organelle number. These structural phenotypes may be analyzed using microscopic techniques (e.g., scanning electron microscopy). Antibodies or dyes may be used to highlight distinguishing features to aid in analysis.

[0467] Cell population can be useful for various therapeutic purposes.The representative example of CNS disease or disorder that can be beneficially treated with cell described herein includes but is not limited to pain disorder, movement disorder, dissociative disorder, mood disorder, affective disorder, neurodegenerative disease or disorder, psychiatric disorder and convulsive disorder.

[0468] More specific examples of such conditions include, but are not limited to, Parkinson's disease, ALS, multiple sclerosis, Huntington's disease, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, diabetic neuropathy, glaucatomus neuropathy, macular degeneration, action tremor and tardive dyskinesia, panic disorder, anxiety disorder, depression, alcoholism, insomnia, mania, schizophrenia, autism spectrum disorder, manic-depressive disorder, Alzheimer's disease, and epilepsy.

[0469] Isolation of specific subpopulations of cells Isolation of specific subpopulations of cells can be performed using techniques known in the art, including fluorescence activated cell sorting and / or magnetic separation of cells.

[0470] Differentiation into miR-155-3p or miR-155-3p-enhanced DA neurons can be further understood by the following numbered paragraphs.

[0471] Paragraph 1: Human cells expressing both forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 (LMX1) (FOXA2 + / LMX1 + 1. An in vitro method for preparing a cell composition comprising a cell, the method comprising:

[0472] modifying miR-155 in pluripotent cells;

[0473] The modified pluripotent cells are treated with a signal transduction modulator: (a) A single inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, (b) at least one activator of Sonic Hedgehog (SHH) signaling; and (c) at least one activator of Wingless (Wnt) signaling and culturing the cells in the presence of

[0474] The cells are cultured in the presence of the modulator to detect the FOXA2 + / LMX1 + culturing for a period of time sufficient to provide a cell composition comprising the cells;

[0475] wherein the culturing step does not include culturing the human pluripotent cells in the presence of a second inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling. In vitro method.

[0476] Paragraph 2: An in vitro method for differentiating pluripotent cells into midbrain floor plate precursors, comprising:

[0477] modifying miR-155 in pluripotent cells;

[0478] exposing the plurality of pluripotent cells to (a) at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, (b) at least one activator of Sonic Hedgehog (SHH) signaling, and (c) at least one activator of Wingless (Wnt) signaling;

[0479] Exposure to at least one inhibitor of SMAD signaling begins on day 0;

[0480] exposing the pluripotent cells to at least one activator of Wnt signaling 3 days after initiation of exposure to at least one inhibitor of SMAD signaling;

[0481] exposing the pluripotent cells to at least one inhibitor of SMAD signaling, at least one activator of SHH signaling, and at least one activator of Wnt signaling in amounts effective to produce a plurality of midbrain floor plate progenitor cells, at least 10% of which express both forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 alpha (LMX1A);

[0482] Optionally, further subjecting the plurality of differentiated midbrain floor plate precursor cells to conditions favorable for maturation of the midbrain floor plate precursor cells into dopamine neurons. An in vitro method comprising:

[0483] Paragraph 3: An in vitro method for differentiating pluripotent stem cells, the method comprising: modifying miR-155 in pluripotent cells; exposing a plurality of modified pluripotent stem cells to at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling; and exposing the cells to at least one activator of Sonic Hedgehog (SHH) signaling and at least one activator of Wnt signaling, wherein the cells are exposed to the at least one activator of Wnt signaling for 3 days after the initial exposure of the cells to the at least one inhibitor of SMAD signaling, resulting in a cell population comprising at least about 10% differentiated cells that express both Forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 alpha (LMX1A).

[0484] Paragraph 4: An in vitro method for differentiating pluripotent stem cells, comprising the steps of modifying miR-155 in pluripotent cells and exposing a plurality of modified pluripotent stem cells to at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling to obtain a cell population comprising differentiated cells that express both Forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 alpha (LMX1A).

[0485] Paragraph 5: The method of any one of paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-5p or miR-155-3p.

[0486] Paragraph 6: The method of any one of paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-5p.

[0487] Paragraph 6.1: The method of any one of paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-3p.

[0488] Paragraph 7: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1 to 4, wherein the cells are 155-5p biased or miR-155-3p biased.

[0489] Paragraph 8: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1 to 4, wherein the cells are 155-5p biased.

[0490] Paragraph 9: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1 to 4, wherein the cell is miR-155-3p biased.

[0491] Paragraph 10: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1-4, wherein the cells are miR-155-5p biased and include dopamine neurons, astrocytes, and VLMCs.

[0492] Paragraph 11: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1-4, wherein the cells are miR-155-3p biased and include dopamine neurons, astrocytes, and VLMCs.

[0493] Paragraph 12: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1-4, wherein the cell is miR-155-5p biased and comprises a dopamine neuron, an astrocyte, or a VLMC.

[0494] Paragraph 13: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1-4, wherein the cell is miR-155-3p biased and comprises a dopamine neuron, an astrocyte, or a VLMC.

[0495] Paragraph 14: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1-4, wherein the cells are miR-155-5p biased and expression of miR-155-5p is greater in dopamine neurons compared to astrocytes or VLMCs.

[0496] Paragraph 15: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1 to 4, wherein the cells are miR-155-3p biased and expression of miR-155-3p is greater in dopamine neurons compared to astrocytes or VLMCs.

[0497] Paragraph 16: FOXA2 + / LMX1 +5. The method of any one of paragraphs 1 to 4, wherein the cells are miR-155-5p biased and expression of miR-155-5p is greater in astrocytes compared to dopamine neurons or VLMCs.

[0498] Paragraph 17: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1-4, wherein the cells are miR-155-3p biased and expression of miR-155-3p is greater in astrocytes compared to dopamine neurons or VLMCs.

[0499] Paragraph 18: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1 to 4, wherein the cells are miR-155-5p biased and expression of miR-155-5p is greater in VLMCs compared to dopamine neurons or astrocytes.

[0500] Paragraph 19: FOXA2 + / LMX1 + 5. The method of any one of paragraphs 1 to 4, wherein the cells are miR-155-3p biased and expression of miR-155-3p is greater in VLMCs compared to dopamine neurons or astrocytes.

[0501] Paragraph 20: The method of any one of paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-3p to have SEQ ID NO:7.

[0502] Paragraph 21: The method of any one of paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-5p to have SEQ ID NO:6.

[0503] Paragraph 22: The method of any one of Paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-5p to have SEQ ID NO:8.

[0504] Paragraph 23: The method of any one of paragraphs 1 to 4, wherein the step of modifying miR-155 in the pluripotent cell comprises modifying miR-155-3p to have SEQ ID NO:8.

[0505] Diagnostic methods Compositions and methods for the use of miRNAs as diagnostic tools are disclosed.

[0506] In some embodiments, a method for screening a test compound is disclosed, comprising: (a) contacting a miR-155-3p-biased DA cell population or a miR-155-5p-biased DA cell population with a test compound; and (b) measuring the function, physiology, or viability of the cells. In some embodiments, the measuring step comprises testing for a toxicological response or an altered electrophysiological response of the cells. In some embodiments, the measuring step comprises testing for the differentiation potential of miR-155-3p-biased or miR-155-5p-biased DA neural cells.

[0507] In some embodiments, the health of a subject can be monitored by determining the expression level of at least one anti-inflammatory marker.

[0508] The measurement of above-mentioned miRNA marker can be combined with clinical parameters.But not limited to, the exemplary clinical test for detecting or diagnosing Parkinson's disease includes but is not limited to PGA index, FIB-4 index, Fibrometer, FibroSure, Act test, SAFE, Heapscore, FibroQ, AAR, APRI, CDS, API, Pohls score, Loks model, liver biopsy, ultrasonography, computed tomography, ultrasound elastography and magnetic resonance elastography.

[0509] In some embodiments, if a subject has high levels of miR-155-3p-biased DA neuronal cells or miR-155-5p-biased DA neuronal cells, the subject is likely to have a neurological disease or related disorder; if exosome expression is normal or reversed, the subject is unlikely to have a neurological disease or related disorder, and therefore, no treatment is required. If the subject requires treatment, the miR-155-3p-biased DA cell composition can then be administered to the subject in need of treatment, alone or in combination with other known therapies. The diagnostic method can be repeated during and after treatment to monitor the subject's health status and the effectiveness of the treatment.

[0510] Therapy and patient health can be monitored by determining the levels of one or more, two or more, three or more, or all of the pro-inflammatory or anti-inflammatory markers in a sample isolated from the patient before, during, and after therapy.

[0511] Measurement of expression level or activity level can be achieved by the method known in the art and briefly described herein, for example, by PCR, qPCR, miRNA array, RNA-seq, multiplex miRNA profiling.Tools and methods are known in the art and are commercially available from various suppliers.Measurement can be compared with suitable control, for example, the previous measurement of the subject, or suitable internal control.

[0512] Collection of cell population samples from bodily fluids, such as urine, blood, saliva, breast milk, lymph, serum, or plasma, can be performed using methods known in the art and briefly described herein. Cell populations can be purified from fluids using art-recognized methods, such as those described by Thery et al. (2006) "Isolation and characterization of cell populations from cell culture supernatants and biological fluids" Curr. Protoc. Cell Biol., Chapter 3, or as disclosed in Hong et al. (2014) PLoS One 9(8):e103310, doe:10,1371 and Jayachandran et al. (2012) J. Immun. Methods, 375:207-214, using methods disclosed herein. Commercially available kits are also available, such as PureExo (101BIO, Palo Alto, Calif., for serum and plasma), Exo MIRMIR Plus (Bioo Scientific, Austin, Texas, USA), ExoQuick (SBI, Mountain View, Calif., USA, for tissue culture), and Exo-Spin Kit (Cell Guidance Systems, Carlsbad, Calif., USA). As will be apparent to those skilled in the art, the isolation method will depend on the size and composition of the cells to be isolated. For example, ultracentrifugation can be used for larger cells, with speeds not exceeding about 70,000 g, or alternatively about 60,000 g. Alternatively, ultracentrifugation can be used for smaller cell populations, which are much smaller and therefore require speeds of 90,000, or alternatively 100,000 g, or even higher.

[0513] The methods are useful in the diagnosis of a subject, such as a mammal, animal, or even a human patient. By way of example only, a mammal includes, but is not limited to, a human, monkey, mouse, rat, cow, dog, cat, horse, pig, or sheep.

[0514] In one embodiment, the non-affected subject is one that does not suffer from a neurological disease or related disorder. In one embodiment, the non-affected subject has upregulated miR-155-3p compared to the miR-155-3p profile of a subject that suffers from a neurological disease or related disorder.

[0515] Also provided is a purified or isolated population of cells isolated from the body fluids of a non-diseased subject, wherein the microRNA (miR) profile of the cell population comprises, alternatively consists essentially of, or even consists of upregulation of miR-155-3p compared to the miR profile of a subject afflicted with a neurological disease or related disorder.

[0516] Treatment method When a marker is used as a criterion for selecting patients for the treatments described herein, the marker is measured before and / or during treatment, and the resulting values ​​are used by the clinician in assessing any of the following: (a) the probability or likelihood that the individual is suitable to receive the treatment in the first place, (b) the probability or likelihood that the individual is not suitable to receive the treatment in the first place, (c) responsiveness to treatment, (d) the probability or likelihood that the individual is suitable to continue receiving the treatment, (e) the probability or likelihood that the individual is not suitable to continue receiving the treatment, (f) dosage adjustment, (g) prediction of the likelihood of clinical benefit, or (h) toxicity. As will be well understood by those skilled in the art, measurement of a genetic marker or polymorphism in a clinical setting is a clear indication that this parameter has been used as a criterion for initiating, continuing, adjusting, and / or ceasing the administration of the treatments described herein.

[0517] With regard to therapy, miRNA expression modulation can enable the development of new treatments.

[0518] In some embodiments, a method of inhibiting an inflammatory response in a human subject is disclosed.

[0519] Disclosed are methods for treating Parkinson's disease in a subject in need thereof, comprising administering to a subject in need thereof a therapeutic amount of a DA neuron having modified miR-155. Methods for treating Parkinson's disease in a subject in need thereof, comprising administering to a subject in need thereof a therapeutic amount of a miR-155-3p-biased DA neuron. Methods for treating Parkinson's disease in a subject in need thereof, comprising administering to a subject in need thereof a therapeutic amount of a miR-155-5p-biased DA neuron.

[0520] Disclosed are methods for rescuing or increasing dopamine neuron survival in a subject in need thereof, comprising administering to a subject in need thereof a therapeutic amount of a DA neuron having modified miR-155. Disclosed are methods for rescuing or increasing dopamine neuron survival in a subject in need thereof, comprising administering to a subject in need thereof a therapeutic amount of a miR-155-3p-biased DA neuron. Disclosed are methods for rescuing or increasing dopamine neuron survival in a subject in need thereof, comprising administering to a subject in need thereof a therapeutic amount of a miR-155-5p-biased DA neuron.

[0521] The compositions are useful for preparing a medicament and / or for carrying out a method for one or more of a) inhibiting the progression of, b) preventing, or c) treating a disease, e.g., a neurological disease or related disorder.

[0522] In one embodiment, the composition is useful for preparing a medicament and / or for carrying out a method for one or more of a) inhibiting progression of, b) preventing, or c) treating Parkinson's disease or a related disorder in a subject in need thereof, the method comprising, alternatively consisting essentially of, or even consisting of administering to the subject an effective amount of the above-described pharmaceutical composition comprising miR-155-3p-biased DA neural system cells or miR-155-5p-biased DA neural system cells.

[0523] Therapy and patient health can be monitored using the diagnostic methods disclosed herein.A non-limiting example of such is by determining the levels of one, two or more, three or more, or all of miR-155-3p-biased cells and / or miR-155-5p-biased cells in samples isolated from patients before, during, and after therapy.

[0524] Therapies and patient health can be monitored by determining the levels of miR-155-3p-biased cells and / or miR-155-5p.Therapies and patient health can be monitored by determining the levels of miR-155-3p-biased cells and / or miR-155-5p compared to wild-type.

[0525] The composition can then be administered to a subject identified as likely to have Parkinson's disease or a related disorder. In these methods, the cell population is allogeneic or autologous to the subject receiving the cell population.

[0526] As described above, the composition is administered in an effective amount. For example, an effective amount includes about 1 to about 1,000 mg / kg, or alternatively about 1 to about 500 mg / kg, or alternatively about 5 to about 500 mg / kg, or alternatively about 10 to about 100 mg / kg, or alternatively about 5 mg / kg to about 100 mg / kg, or alternatively about 10 mg / kg to about 80 mg / kg, or alternatively about 10 mg / kg to about 50 mg / kg, or alternatively about 15 mg / kg to about 50 mg / kg, or alternatively greater than 5 mg / kg, or alternatively greater than about 10 mg / kg, or alternatively greater than about 15 mg / kg, or alternatively greater than about 20 mg / kg, or alternatively greater than 25 mg / kg, or alternatively greater than 30 mg / kg, each measured per kg of subject body weight. In one embodiment, the effective amount is per dose, or as a daily dose, or alternatively totaled over the course of treatment.

[0527] The compositions can be administered orally, parenterally (e.g., intramuscularly, intraperitoneally, intravenously, ICV, intracisternal injection or infusion, subcutaneous injection, or implant), intranasally by inhalation spray, intravaginally, rectally, sublingually, via the urethra (e.g., urethral suppository), or topically (e.g., as a gel, ointment, cream, aerosol, etc.), and can be formulated, alone or together, in suitable dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, excipients, and vehicles appropriate for each administration route. Non-limiting examples of carriers include phosphate-buffered saline (PBS), saline, or a biocompatible matrix material. The compositions may optionally contain protease inhibitors, glycerol, and / or dimethyl sulfoxide (DMSO).

[0528] The pharmaceutical composition can be conveniently presented in dosage unit form and can be prepared by any of the methods well known in the field of pharmacy. In the pharmaceutical composition, the active object compound is contained in an amount sufficient to produce the desired therapeutic effect. For example, the pharmaceutical composition of the present disclosure can be in a form suitable for virtually any mode of administration, including, for example, topical, ocular, oral, buccal, systemic, intranasal, injection, transdermal, rectal, and intravaginal, or in a form suitable for administration by inhalation or insufflation.

[0529] Systemic formulations include those designed for administration by injection (e.g., subcutaneous, intravenous, intramuscular, intrathecal, or intraperitoneal injection), as well as those designed for transdermal, transmucosal, oral, or pulmonary administration.

[0530] The composition will generally be used in an amount effective to achieve the intended result, for example, an amount effective to treat or prevent the particular condition being treated.The compound can be administered therapeutically to achieve therapeutic benefit, or prophylactically to achieve prophylactic benefit.Therapeutic benefit refers to the eradication or alleviation of the underlying disorder being treated, and / or the eradication or alleviation of one or more of the symptoms associated with the underlying disorder, such that the patient reports an improvement in mood or condition, although the patient may still suffer from the underlying disorder.Therapeutic benefit also includes stopping or slowing the progression of the disease, regardless of whether improvement is realized.

[0531] The amount of compound administered will depend on various factors, including, for example, the specific condition being treated, the mode of administration, the severity of the condition being treated, the age and weight of the patient, and the bioavailability of the specific active compound. Determining an effective dosage is well within the skill of a person skilled in the art. As known to those skilled in the art, the preferred dosage of the compound of the present disclosure will also depend on the age, weight, general health, and severity of the condition being treated of the individual. When administered by inhalation, the dosage may also need to be adjusted to the individual's gender and / or lung capacity. The dosage and frequency of administration of the composition will also depend on whether the composition is formulated for the treatment of an acute episode of the condition or for the preventive treatment of the disorder. Those skilled in the art will be able to determine the optimal dose for a particular individual.

[0532] Regarding prophylactic administration, compound can be administered to the patient who is at risk of developing one of the above-mentioned conditions.For example, if it is unknown whether a patient is allergic to a certain drug, compound can be administered before the administration of the drug to avoid or alleviate the allergic reaction to the drug.Alternatively, prophylactic administration can be applied to prevent the occurrence of symptoms in patients who have been diagnosed with underlying disorders.

[0533] Effective dosages can be initially estimated from in vitro assays. For example, initial dosages for use in animals can be formulated to achieve therapeutic concentrations and / or dosages of miR-155-3p-biased cellular compositions or miR-155-5p-biased cellular compositions measured in in vitro assays. Calculating dosages that achieve such effective dosages for other animal models or human patients is well within the skill of those skilled in the art. For guidance, see Fingl & Woodbury, "General Principles," in: Goodman and Gilman's The Pharmaceutical Basis of Therapeutics, Chapter 1, pp. 1-46, latest edition, Pergamagon Press, and the references cited therein.

[0534] Initial dosage can also be estimated from in vivo data, for example, animal model.Animal models useful for testing the effectiveness of compounds for treating or preventing various diseases mentioned above are well known in the art.Those skilled in the art can routinely adapt such information to determine the dosage suitable for human administration.

[0535] Dosages typically range from about 0.0001 or 0.001 or 0.01 mg / kg / day to about 1000 mg / kg / day, but may be higher or lower depending on, among other factors, the activity of the composition, its bioavailability, the mode of administration, and the various factors discussed above. Dosage amounts and intervals can be individually adjusted to provide local and / or systemic concentrations of the cell populations sufficient to maintain therapeutic or prophylactic effects. For example, the compositions may be administered once per week, several times per week (e.g., every other day), once per day, or multiple times per day, depending, among other factors, on the mode of administration, the specific indication being treated, and the judgment of the prescribing physician. Those skilled in the art will be able to optimize effective local dosages without undue experimentation.

[0536] Preferably, the compound will provide therapeutic or prophylactic benefit without causing substantial toxicity. The toxicity of miR-155-3p-biased cellular compositions or miR-155-5p-biased cellular compositions can be determined using standard pharmaceutical procedures. The dose ratio between toxicity and therapeutic (or prophylactic) effect is the therapeutic index. Compositions that exhibit a high therapeutic index are preferred.

[0537] Cell population can be useful for various therapeutic purposes.The representative example of CNS disease or disorder that can be beneficially treated with cell described herein includes but is not limited to pain disorder, movement disorder, dissociative disorder, mood disorder, affective disorder, neurodegenerative disease or disorder, psychiatric disorder and convulsive disorder.

[0538] More specific examples of such conditions include, but are not limited to, Parkinson's disease, ALS, multiple sclerosis, Huntington's disease, autoimmune encephalomyelitis, spinal cord injury, cerebral palsy, diabetic neuropathy, glaucatomus neuropathy, macular degeneration, action tremor and tardive dyskinesia, panic disorder, anxiety disorder, depression, alcoholism, insomnia, mania, schizophrenia, autism spectrum disorder, manic-depressive disorder, Alzheimer's disease, and epilepsy.

[0539] The use of differentiated miR-155 modified pluripotent cells may also be indicated for the treatment of traumatic lesions of the nervous system, including spinal cord injury, and for the treatment of stroke caused by hemorrhage or thrombosis or embolism, due to the need to provide survival factors that induce neurogenesis and minimize damage to injured neurons.

[0540] In any of the methods described herein, cells can be obtained from autologous, semi-allogeneic, or non-autologous (i.e., allogeneic or xenogeneic) human donors or embryos or umbilical cord / placenta.For example, cells can be isolated from human cadavers or donor subjects.

[0541] The term semi-allogeneic refers to donor cells that are partially mismatched to recipient cells at the major histocompatibility complex (MHC) class I or class II locus.

[0542] The disclosed miR-155-3p or miR-155-5p-biased DA neural cells can be administered to the individual being treated using a variety of transplantation approaches, the nature of which depends on the implantation site.

[0543] The terms or phrases "transplantation," "cell replacement," or "grafting" are used interchangeably herein and refer to the introduction of the cells disclosed herein into a target tissue. As previously mentioned, the cells may be derived from the recipient or may be derived from an allogeneic, semi-allogeneic, or xenogeneic donor.

[0544] The disclosed miR-155-3p or miR-155-5p-biased DA neural cells can be systemically injected into the circulation, administered intrathecally, or superficially grafted into the central nervous system, spinal cord, or host brain ventricles or subdurally. Successful transplantation is characterized by (i) implant viability, (ii) graft retention at the site of transplantation, and (iii) minimal pathological response at the site of transplantation. Methods for transplanting various neural tissues, such as embryonic brain tissue, into host brains are described in "Neural Grafting in the Mammalian CNS," Bjorklund and Stenevi, eds. (1985); Freed et al., 2001; Olanow et al., 2003). These procedures include intraparenchymal transplantation, i.e., within the host brain (as opposed to extracerebral or extraparenchymal transplantation), achieved by injection or deposition of tissue within the brain parenchyma at the time of transplantation.

[0545] Intraparenchymal transplantation can be performed using two approaches: (i) injection of cells into the host brain parenchyma, or (ii) surgically preparing a gap to expose the host brain parenchyma and then depositing the graft into the gap.

[0546] Both methods result in parenchymal deposition between the graft and the host brain tissue at the time of grafting, and both promote anatomical integration between the graft and the host brain tissue, which is important if the graft is required to become an integral part of the host brain and survive for the life of the host.

[0547] Alternatively, the graft can be placed in a ventricle, such as the cerebral ventricle, or subdurally, i.e., on the surface of the host brain, separated from the host brain parenchyma by the intervening pia mater or arachnoid and pia mater. Grafting into the ventricle can be achieved by injecting donor cells or by growing cells on a matrix such as 3% collagen to form a solid tissue plug, which can then be implanted into the ventricle to prevent displacement of the graft. For subdural grafting, cells can be injected around the brain surface after making a slit in the dura mater. Injection into selected regions of the host brain can be performed by drilling a hole that allows the insertion of a microsyringe needle and puncturing the dura mater. The microsyringe is preferably mounted on a stereotaxic frame, and three-dimensional stereotaxic coordinates are selected to place the needle in the desired location in the brain or spinal cord. Cells can also be introduced into the putamen, basal ganglia, hippocampal cortex, striatum, substantia nigra, or caudate region of the brain, as well as the spinal cord.

[0548] The disclosed miR-155-3p or miR-155-5p-biased DA neural cells may also be transplanted into healthy areas of tissue. In some cases, the exact location of the damaged tissue area may be unknown, and the cells may be unintentionally transplanted into healthy areas. In other cases, it may be preferable to administer the cells to healthy areas, thereby avoiding any further damage to the area. In any case, after transplantation, the cells preferably migrate into the damaged area.

[0549] For transplantation, the disclosed miR-155-3p or miR-155-5p-biased DA neuronal cell suspension is drawn into a syringe and administered to an anesthetized transplant recipient. Multiple injections can be performed using this procedure.

[0550] The cell suspension procedure therefore allows for the grafting of cells to any given site in the brain or spinal cord, is relatively atraumatic, allows for multiple grafts at several different sites or at the same site simultaneously using the same cell suspension, and allows for the mixing of cells derived from different anatomical regions.

[0551] Multiple grafts can be composed of a mixture of cell types and / or transgenes inserted into the cells. Preferably, approximately 10 to approximately 10 types of cells are introduced per graft. Cells can be administered simultaneously to different locations, such as combined intrathecal and intravenous administration, to maximize the chances of targeting the affected area.

[0552] For implantation into the gap, which may be preferred for spinal cord grafting, tissue is removed from an area adjacent to the outer surface of the central nervous system (CNS) to form a graft gap, for example, by removing the bone covering the brain and stopping bleeding with a material such as gelfoam, as described by Stenevi et al. (Brain Res. 114:1-20, 1976). The gap may be created using suction. The graft is then placed into the gap. More than one graft may be placed into the same gap using injections of cells or solid tissue implants. Preferably, the site of implantation is determined by the CNS disorder being treated. Demyelinating MS lesions are distributed across multiple locations throughout the CNS, so effective treatment of MS may depend more on the ability of cells to migrate to the appropriate target site.

[0553] Intranasal administration of the disclosed miR-155-3p or miR-155-5p-biased DA neuronal cells is also contemplated.

[0554] The use of differentiation-engineered miR-155-3p or miR-155-5p pluripotent cells may also be indicated for the treatment of traumatic lesions of the nervous system, including spinal cord injury, and for the treatment of stroke caused by hemorrhage or thrombosis or embolism, due to the need to provide survival factors that induce neurogenesis and minimize damage to injured neurons.

[0555] The disclosed miR-155-3p or miR-155-5p-biased DA neural cells may be useful for neurological diseases, including, but not limited to, amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), pseudobulbar palsy, and progressive bulbar palsy.

[0556] Because non-autologous cells can induce an immune response when administered to the body, several approaches have been developed to reduce the likelihood of rejection of non-autologous cells. Furthermore, because diseases such as multiple sclerosis are inflammatory-based, the problem of immune response is exacerbated. These include administering cells to privileged sites, or alternatively, either suppressing the recipient's immune system, providing anti-inflammatory treatments that may initially be shown to control autoimmune disorders, and / or encapsulating non-autologous / semi-autologous cells in an immunoisolating semi-permeable membrane prior to transplantation.

[0557] As mentioned herein above, the inventors also propose the use of umbilical cord and placenta-derived pluripotent cells, which express very low levels of MHC II molecules and therefore limit the immune response.

[0558] The following experiments can be performed to confirm the potential use of neonatal pluripotent cells isolated from cord I placenta for the treatment of neurological disorders: 1) Differentiated pluripotent cells (into various neural lineage cells or neural lineage precursor cells) can serve as stimulators in unidirectional mixed lymphocyte cultures with allogeneic T cells, and the proliferative response compared to the T cell response to allogeneic lymphocytes isolated from the same donor can be assessed by 3H-thymidine incorporation, with hyporesponsiveness documented. 2) The pluripotent cells can be added to / co-cultured with unidirectional mixed lymphocyte cultures and cell cultures with T cell mitogens (phytohemagglutinin and concanavalin A) to confirm their immunosuppressive effects on T cell-mediated proliferative responses. 3) Umbilical cord and placental cells (unmodified and differentiated) cultured from Brown Norway rats may be enriched for pluripotent cells and injected into Lewis rats with induced experimental autoimmune encephalomyelitis (EAE). Alternatively, umbilical cord and placental cells (unmodified and differentiated) cultured from BALB / c mice (BALB / cxC57BL / 6)F1 or xenogeneic cells (unmodified and differentiated) derived from Brown Norway rats may be enriched for pluripotent cells and injected into C57BL / 6 or SJL / j recipients with induced experimental autoimmune encephalomyelitis (EAE). Clinical efficacy against paralysis may be investigated to evaluate the therapeutic efficacy of xenogeneic fully MHC-mismatched or haploidentical pluripotent cells. Such experiments may provide a basis for treating patients with genetic disorders or genetic predisposition to such disorders with familial haploidentical pluripotent cells. 4) Pluripotent cells cultured from umbilical cord and placenta may be infused with GFP- or RFP-labeled pre-miRs, which will allow us to track the migration and persistence of these cells in the brains of C57BL / 6 recipients in whom we induced EAE. The clinical efficacy of labeled MHC-mismatched pluripotent cells can be assessed by monitoring disease signs, paralysis, and histopathology. The migration and localization of such cells can also be monitored by using fluorescent cells from genetically transduced GFP (green) or Red2 (red) donors.

[0559] As previously mentioned, the present invention also contemplates encapsulation techniques to minimize immune response.

[0560] Encapsulation technique Encapsulation techniques are generally classified as microencapsulation, which involves small spherical vesicles, and macroencapsulation, which involves larger flat sheet membranes and hollow fiber membranes (Uludag, H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64).

[0561] Methods for preparing microcapsules are known in the art and include, for example, those disclosed by Lu MZ, et al., Cell encapsulation with alginate and alpha phenoxycinnamylidene-acetylated poly(allylamine). Biotechnol Bioeng. 2000, 70: 479-83; Chang T M and Prakash S. Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms. Mol. Biotechnol. 2001, 17: 249-60; and Lu MZ, et al., A novel cell encapsulation method using photosensitive poly(allylamine alpha-cyanocinnamylideneacetate). J. Microencapsul. 2000, 17: 245-51.

[0562] For example, microcapsules have been prepared by complexing modified collagen with a perpolymer shell of 2-hydroxyethylmethylacrylate (HEMA), methacrylic acid (MAA), and methylmethacrylate (MMA) to achieve a capsule thickness of 2-5 μm. Such microcapsules can be further encapsulated with an additional 2-5 μm prepolymer shell to impart a negatively charged, smooth surface and minimize plasma protein absorption (Chia, SM et al. Multi-layered microcapsules for cell encapsulation Biomaterials. 2002 23: 849-56).

[0563] Other microcapsules are based on alginate, a marine polysaccharide (Sambanis, A. Encapsulated islets in diabetes treatment. Diabetes Technol. Ther. 2003, 5: 665-8), or its derivatives. For example, microcapsules can be prepared by polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulfate and the polycation poly(methylene-co-guanidine) hydrochloride in the presence of calcium chloride.

[0564] It is understood that cell encapsulation improves when smaller capsules are used. Thus, when capsule size is reduced from 1 mm to 400 μm, the quality control, mechanical stability, diffusion properties, and in vitro activity of encapsulated cells are improved (Canaple L. et al., Improving cell encapsulation through size control. J Biomater Sci Polym Ed. 2002; 13:783-96). Furthermore, nanoporous biocapsules with well-controlled pore sizes as small as 7 nm, tailored surface chemistry, and precise microarchitecture have been found to successfully immunoisolate cellular microenvironments (Williams D. Small is beautiful: microparticle and nanoparticle technology in medical devices. Med Device Technol. 1999, 10:6-9; Desai, TA. Microfabrication technology for pancreatic cell encapsulation. Expert Opin Biol Ther. 2002, 2:633-46).

[0565] immunosuppressants Examples of immunosuppressants include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporine A, chloroquine, hydroxychloroquine, sulfasalazine (sulfasalazopyrin), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE™), etanercept, TNF-alpha blockers, biologic agents that target inflammatory cytokines, and nonsteroidal anti-inflammatory drugs (NSAIDs). Examples of NSAIDs include, but are not limited to, acetylsalicylic acid, choline magnesium salicylate, diflunisal, magnesium, salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, and tramadol.

[0566] In any of the methods described herein, the cells may be administered per se, or preferably as part of a pharmaceutical composition that further comprises a pharmaceutically acceptable carrier.

[0567] Techniques for drug formulation and administration can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0568] Administration Suitable routes of administration include into the circulation (intravenous or intraarterial), into the spinal fluid, or directly into the tissue or organ of interest. Thus, for example, cells can be administered directly into the brain.

[0569] For any preparation used in the method of the present invention, therapeutically effective amount or dosage can be estimated first from in vitro and cell culture assays.Preferably, dosage is formulated in animal models to achieve desired concentration or titer.This information can be used to more accurately determine the dosage that is useful in humans.

[0570] The toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell culture, or in experimental animals. For example, animal models of demyelinating diseases include shiverer (shi / shi, MBP-deficient) mice, MD rats (PLP-deficient), Jimpy mice (PLP-mutant), dog shaking pups (PLP-mutant), twitcher mice (galactosylceramidase-deficient, as in human Krabbe disease), and trembler mice (PMP-22-deficient). Virus-induced demyelination models include those using Theiler's virus and mouse hepatitis virus. Autoimmune EAE is a potential model for multiple sclerosis.

[0571] The data obtained from these in vitro assays and cell culture assays and animal studies can be used to formulate various dosages for use in humans.Dosage can vary depending on the dosage form used and the route of administration used.The exact formulation, route of administration and dosage can be selected by individual physicians in consideration of patient's condition (see, for example, Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. 1).For example, multiple sclerosis patients can monitor their symptoms for the improvement of motor function, which indicates a positive response to treatment.

[0572] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.

[0573] Dosage and interval can be individually adjusted to the level of active ingredient that is sufficient to effectively treat brain disease / disorder.The dosage required to achieve desired effect will depend on individual characteristics and administration route.Detection assay can be used to determine plasma concentration.

[0574] Depending on the severity and responsiveness of the condition to be treated, dosage may be of single or multiple administrations, with the course of treatment lasting from several days to several weeks, or until a diminution of the disease state is achieved.

[0575] The amount of the composition to be administered will, of course, depend on the individual being treated, the severity of the affliction, the mode of administration, the judgment of the prescribing physician, etc. The dosage and timing of administration will depend on careful and ongoing monitoring of the individual's changing condition. For example, a patient with multiple sclerosis being treated will be administered an amount of cells that is sufficient to alleviate the symptoms of the disease, based on symptom monitoring.

[0576] The miR-155-3p or miR-155-5p-biased DA neural cells of the present invention can be co-administered with therapeutic agents useful for treating neurodegenerative disorders, such as gangliosides; antibiotics, neurotransmitters, neurohormones, toxins, neurite-promoting molecules; and antimetabolites and antimetabolite precursors of neurotransmitter molecules, such as L-DOPA.

[0577] kit Kits for administering the compositions, which may contain appropriate dosage amounts, and for carrying out diagnostic methods that include the compositions are also provided. The kits may further include appropriate packaging and / or instructions for using the compositions and / or diagnostic methods. The kits may also include a means for delivering at least one composition and a syringe for injection.

[0578] In addition, the kit may contain compositions and reagents for preparing the miR-155-3p or miR-155-5p-biased DA neural cell composition for administration. The kit may contain a device for administering or dispensing the composition, including, but not limited to, a syringe, pipette, or transdermal patch.

[0579] The kits may include other therapeutic compounds for use in conjunction with the compounds described herein, and thus the methods disclosed herein may include other suitable therapeutic compounds or agents. These compounds may be provided separately from the miR-155-3p or miR-155-5p-biased DA neuronal cell compositions of the present disclosure, or may be mixed therewith. The kits will include appropriate instructions for the preparation and administration of the miR-155-3p or miR-155-5p-biased DA neuronal cell compositions, side effects of the compositions, and any other relevant information. The instructions may be in any suitable form, including, but not limited to, printed matter, videotape, computer-readable disk, or optical disc.

[0580] Kits can also be provided that contain sufficient dosages of the compound or composition to provide effective treatment to an individual for an extended period of time, for example, 1 week, 2 weeks, 3 weeks, 4 weeks, 6 weeks, or 8 weeks or longer.

[0581] The following examples are intended to illustrate, but not limit, what is disclosed herein. For example, although the examples are shown to relate to the isolation, purification, and use of exosome compositions for the treatment of fibrotic or liver diseases or related disorders, the methods and compositions may be modified for the treatment of other neurological diseases as described herein. [Example]

[0582] The above disclosure can be further understood by the following prophetic examples.

[0583] Example 1 Induction of BIC hsa-miR-155 editing

[0584] A major pro-inflammatory network is activated by miR-155-5p.

[0585] Hypothesis: Activation of miR-155-5p>>miR-155-3p enhances inflammatory activity.

[0586] Hypothesis: Activation of miR-155-3p>>miR-155-5p enhances anti-inflammatory activity.

[0587] One miRNA, miR-155, maps to and is processed within the exon of its primary miRNA precursor, a non-coding RNA known as bic. bic / miR-155 exhibits significantly increased expression in activated B and T cells, as well as activated macrophages and dendritic cells (DCs). Overexpression of bic / miR-155 has been reported in B cell lymphomas and solid tumors, and transgenic miR-155 mice have also been shown to develop B cell malignancies in vivo, indicating that the locus may also be associated with cancer. Introducing an edited version of miR-155 into the BIC locus to enhance -5p and miR-155-3p output

[0588] Single-stranded RNA molecules (mirVana™ miRNA mimics and inhibitors, Ambion, Life Technologies, USA) can be delivered into iPSCs using Lipofectamine® 2000 Reagent (Invitrogen, Life Technologies, USA) according to the manufacturer's instructions. Briefly, cells were seeded at 2 × 10 cells per well of a 6-well plate and transfected with 30 nM mimics (miR-155-5p, negative control number 1; miR-155-3p, negative control number 2) or modified hsa-miR-155 (miR-155-5p: SEQ ID NO: 6; miR-155-3p: SEQ ID NO: 7; and miR-155-stem loop: SEQ ID NO: 8). After transfection, the cells can be added to pre-warmed medium and immediately placed in an incubator at 37 ° C under a 5% CO atmosphere. Cells can be harvested 24 and 48 hours after transfection for functional assays.

[0589] To confirm the editing changes of hsa-miR-155; miR-155-3p and miR-155-3p in iPSCs, and the transcriptomes of wild-type and miR-155-3p and miR-155-3p-enhanced versions.

[0590] Characterize differentiation into RNDP-001 to assess possible changes in phenotype / secretome.

[0591] Example 2 Differentiation of engineered pluripotent cells into engineered day 17 DA neurons

[0592] Midbrain neuronal lineage differentiation of modified human induced pluripotent stem cell (iPS) cell lines expanded in VTN-TN in Essential 8 medium was performed using various differentiation medium compositions and...

Claims

1. DA neuron cells in which the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased or decreased compared to wild-type (or naturally occurring, unmodified cells).

2. The DA neuron cell of claim 1 , wherein the variant comprises or consists of a nucleotide sequence having SEQ ID NO:

7.

3. 3. The DA neuron cell of claim 1, wherein the variant comprises a nucleotide sequence in which all of the nucleotides corresponding to nucleotides 2 to 22 of SEQ ID NO: 3 are retained, or consists of a nucleotide sequence in which all of the nucleotides corresponding to nucleotides 2 to 22 of SEQ ID NO: 3 are retained.

4. The DA neuron cell of any one of claims 1 to 3, wherein the DA neuron cell is genetically modified or genetically engineered.

5. 5. The DA neuron cell of claim 1, wherein SEQ ID NO: 8 or a variant thereof is incorporated into the DA neuron cell so as to increase the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof.

6. 6. The DA neuron cell of any one of claims 1 to 5, wherein an additional copy of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is inserted into the DA neuron cell so as to increase the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof.

7. 5. The DA neuron cell of any one of claims 1 to 4, wherein an endogenous genomic sequence encoding miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) or a variant thereof is deleted or mutated in the DA neuron cell so as to reduce the level of miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) or a variant thereof.

8. The DA neuron cell of claim 1 , wherein the DA neuron cell is a human cell.

9. 9. A DA neuron cell according to any one of claims 1 to 8 for use in therapy.

10. 11. The DA neuron cell of claim 10, for use in treating a Parkinson's disease-like disorder in which the level of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof is increased.

11. 9. The DA neuron cell of claim 8, for use in treating a Parkinson's disease-like disorder, in which the level of miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) or a variant thereof is reduced.

12. DA neuron cells for use according to any one of claims 9 to 11, wherein the therapy or treatment is an autologous therapy.

13. DA neuron cells for use according to any one of claims 9 to 11, wherein the therapy or treatment is allogeneic therapy.

14. 1. A method for preparing DA neuron cells suitable for use in treating Parkinson's disease-like disorders, said method comprising the steps of: i) isolating pluripotent cells from a subject; ii) modifying the pluripotent cells to have increased levels of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof to produce modified miR-155-3p cells; iii) differentiating the modified miR-155-3p cells into DA neurons; A method comprising:

15. 1. A method for preparing DA neuron cells suitable for use in treating Parkinson's disease-like disorders, said method comprising the steps of: i) obtaining pluripotent cells; ii) modifying the pluripotent cells to have increased levels of miR-155-3p (CAUAAAGUAGAAAGCACUACU) or a variant thereof to produce modified miR-155-3p cells; iii) differentiating the modified miR-155-3p cells into DA neurons; A method comprising:

16. 16. The method of claim 14 or claim 15, wherein the variant comprises SEQ ID NO:

7.

17. A population of DA neuron cells obtainable by the method of any one of claims 14 to 16.

18. An agent that inhibits or reduces the inflammatory response in a patient.

19. 19. The agent for use according to claim 18, wherein the agent is a population of DA neuronal cells.

20. The agent for use according to claim 18 or claim 19, wherein the agent is a miR-155-3p biased DA neuron cell.

21. 1. A method of reducing miR-155-5p levels in a cell, said method comprising gene editing SEQ ID NO: 3, 4 or 5, or a variant thereof.

22. 22. The method of claim 21 , wherein the variant is SEQ ID NO: 7 or 8.

24. 1. A method of treating a Parkinson's disease-like disorder in a subject, the method comprising administering to the subject an effective amount of miR-155-3p-biased DA neuron cells.

25. 1. A method of treating a Parkinson's disease-like disorder in a subject, the method comprising administering to the subject an effective amount of miR-155-3p-biased DA neuron cells having reduced levels of miR-155-5p (UUAAUGCUAAUCGUGAUAGGGGUU) or a variant thereof.

Images