Methods for Detecting Alicyclobacillus Contaminants

The use of specific primer pairs and probes targeting the vdcC gene variants in Alicyclobacillus species allows for the accurate detection of spoilage-causing strains, addressing the limitations of current assays by predicting spoilage in food and beverages.

JP2026502884APending Publication Date: 2026-01-27INVISIBLE SENTINEL INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025537022
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-23
Filing Date
2023-12-20
Publication Date
2026-01-27

Smart Images

  • Figure 2026502884000001_ABST
    Figure 2026502884000001_ABST
Patent Text Reader

Abstract

The present embodiments relate to mixtures, systems, kits, and methods useful for detecting Alicyclobacillus strains expressing novel genetic variants of the vdcC gene. Alicyclobacillus strains expressing these variants produce guaiacol, which causes spoilage in fruit juice products. The methods and mixtures can be used to predict the spoilage potential of fruit juice products contaminated with Alicyclobacillus.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 477,057, filed December 23, 2022, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically and is incorporated herein by reference in its entirety. The Sequence Listing is provided as the file 02138WO-SequenceListing.xml, created on December 18, 2023, and is 11,000 bytes in size.

[0003] FIELD OF THE INVENTION The present embodiments relate to mixtures, systems, kits, and methods for detecting novel genetic variants in Alicyclobacillus species that contaminate food and beverage products. The presence of genetic variants in contaminating Alicyclobacillus can be used to predict the spoilage potential of food and beverage products. [Background technology]

[0004] Background of the Invention The genus Alicyclobacillus includes several species of acidophilic, thermophilic, spore-forming, aerobic, and facultatively anaerobic motile Gram-positive bacilli that can grow at pH levels ranging from 0.5 to 6.5 and temperatures ranging from 4°C to 70°C. They can survive harsh conditions, such as thermal sterilization, by forming spores. A major cause of spoilage and revenue loss in the food and beverage industry is the contamination of approximately 30% of raw materials used in fruit juice production with members of the genus Alicyclobacillus. Examples include species such as A. acidoterrestris, A. terrestris, A. pomorum, A. acidocaldarius, and A. acidiphilus. Viable Alicyclobacillus spores are also heat-resistant, and the high temperatures experienced during thermal pasteurization can promote spore germination, resulting in spoilage, unsalable product, and product recall. However, not all Alicyclobacillus bacteria cause spoilage. Furthermore, current assay methods cannot distinguish between spoilage-causing and non-spoilage-causing Alicyclobacillus. There is a need in the art for a sensitive and definitive detection assay that can detect Alicyclobacillus strains associated with beverage spoilage, rather than simply detecting all Alicyclobacillus strains. The present embodiment addresses this need. Summary of the Invention

[0005] Summary of the Invention The present disclosure relates to mixtures, methods, systems, and kits suitable for detecting novel genetic variants in Alicyclobacillus species that contaminate food and beverage products, the presence of which can be used to predict the spoilage potential of food and beverage products.

[0006] Tests are available to confirm the presence of Alicyclobacillus bacteria. These are known in the art as ACB tests. However, as demonstrated herein, a positive ACB test alone does not necessarily indicate spoilage; rather, spoilage occurs through the production of guaiacol by the vanillic acid decarboxylase gene product expressed by some, but not all, Alicyclobacillus strains. The genetic variants disclosed herein produce guaiacol, and their identification indicates spoilage potential in a test sample.

[0007] The inventions described herein may suitably include mixtures that can be used to detect the disclosed genetic variants. For example, the mixtures disclosed herein may include a pair of primers that bind to one of the three disclosed variants of the vanillic acid decarboxylase (vcdC) gene of Alicyclobacillus strains. The three disclosed genetic variants have the sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. Each of the pair of primers binds to a target nucleic acid molecule having one of the sequences of SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, its complement, or a fragment thereof. The mixture may include deoxynucleotide triphosphate nucleotides, a DNA polymerase, a buffer, and a test sample suspected of containing at least one of the three genetic variants.

[0008] In one example, the test sample can be a food, food suspension, food solution, or beverage, such as fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drink, fruit-flavored tea, wine, or fruit-flavored water.

[0009] The primer pairs in the mixture can be SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, or SEQ ID NO: 8 and SEQ ID NO: 5. Additionally, the primer pairs can be the complements of one or more of these sequences.

[0010] In some embodiments, the mixture can include a probe that binds to one of the target nucleic acid molecules, or its complement, or a fragment thereof. The probe can bind to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or their complement, or a fragment thereof. The probe can have the sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11. Specifically, a probe having SEQ ID NO: 9 can be mixed with a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5 that binds to the target nucleic acid molecule of SEQ ID NO: 1 or its complement. A probe having SEQ ID NO: 10 can be mixed with a primer pair of SEQ ID NO: 6 and SEQ ID NO: 7 that binds to the target nucleic acid molecule of SEQ ID NO: 2 or its complement. A probe having SEQ ID NO: 11 can be mixed with a primer pair of SEQ ID NO: 8 and SEQ ID NO: 5 that binds to the target nucleic acid molecule of SEQ ID NO: 3 or its complement. These probes and primer pairs in the disclosed mixtures can also be complements of the sequences disclosed herein.

[0011] The present disclosure includes methods for detecting organisms, such as Alicyclobacillus species, suspected of having one of the three target nucleic acid molecules (genetic variants) described herein. For example, the method can include reacting a test sample described herein with a first primer and a second primer that bind to the target nucleic acid molecule under conditions sufficient to generate a detectable amplicon. The first primer and the second primer can be one of the primer pairs disclosed herein or their complements. The detectable amplicon can be one of the target nucleic acid molecules disclosed herein or a fragment thereof. The method can also include detecting the presence or absence of the detectable amplicon. In one example, the detectable amplicon is generated by one or more of polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR). In one example, the amplicon may be detected by one or more techniques including direct detection of a measurement of a physical property of the amplicon, detecting UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule that generates a total detectable signal proportional to the copy number of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules that generate a total detectable signal proportional to the copy number of the amplicon in the sample.

[0012] The method can also include reacting the test sample with a probe described herein. The probe can be labeled with a detectable label.

[0013] In one embodiment, the primer pair and probe used in the disclosed method include a probe having SEQ ID NO: 9 and a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5 for detecting a target nucleic acid molecule of SEQ ID NO: 1. In a non-limiting example, this embodiment can be used to detect a target nucleic acid molecule in a saccharifying strain of Alicyclobacillus acidoterrestris.

[0014] In another embodiment, the primer pair and probe used in the disclosed methods include a probe having SEQ ID NO: 10 and a primer pair of SEQ ID NO: 6 and SEQ ID NO: 7 for detecting a target nucleic acid molecule of SEQ ID NO: 2. In a non-limiting example, this embodiment can be used to detect a target nucleic acid molecule in a saccharifying strain of Alicyclobacillus herbarius.

[0015] In yet another embodiment, the primer pair and probe used in the disclosed methods include a probe having SEQ ID NO: 11 and a primer pair of SEQ ID NO: 8 and SEQ ID NO: 5 for detecting a target nucleic acid molecule of SEQ ID NO: 3. In a non-limiting example, this embodiment can be used to detect a target nucleic acid molecule in a saccharifying strain of Alicyclobacillus dauci.

[0016] These methods can be used to detect contaminants that contain one of the target nucleic acids disclosed herein, its complement, or a fragment thereof. The methods disclosed herein can also be used to detect possible spoilage in a test sample disclosed herein.

[0017] In some embodiments, the methods include reacting a test sample with two or more of the primer pairs disclosed herein. In such instances, the methods can be used to detect two or more contaminants in the test sample, each contaminant comprising one of the three target nucleic acid molecules disclosed herein.

[0018] In addition to two or more primer pairs, the method can include reacting the test sample with two or more of the probes disclosed herein. Such a mixture can be used to detect two or more contaminants in the test sample, each contaminant comprising one of the three target nucleic acid molecules disclosed herein.

[0019] The present disclosure also includes systems for detecting the disclosed target nucleic acid molecules, or organisms or contaminants containing one or more target nucleic acid molecules. In one example, the system can include one of the mixtures disclosed herein and an instrument configured to perform an amplification assay on the mixture. In some embodiments, the system can include a sample container. In some embodiments, the system can include one or more PCR reaction mixtures, such as one of the mixtures disclosed herein. Each PCR reaction mixture can be contained in one of the sample containers. In some embodiments, the system further includes one or more sample temperature controllers. The temperature controllers can be used to bring the sample to the temperature required to perform the amplification assay.

[0020] The present disclosure also includes kits. The kits may include reagents that can be used to create the mixtures disclosed herein and to perform the methods disclosed herein. In one example, the kits may include a first primer and a second primer that form a primer pair. The first primer may be substantially homologous to one of the target nucleic acid molecules disclosed herein, and the second primer may be substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous. The kits may further include deoxynucleotide triphosphate nucleotides and a buffer. In some embodiments, the kits may further include a DNA polymerase.

[0021] In some embodiments, the kit comprises a primer pair disclosed herein. In one example, the first primer has a sequence substantially homologous to the sequence of SEQ ID NO: 4, and the second primer has a sequence substantially homologous to the sequence of SEQ ID NO: 5. In yet another example, the kit further comprises a probe having a sequence substantially homologous to or substantially complementary to the sequence of SEQ ID NO: 9.

[0022] In another example, the kit includes a primer pair comprising a first primer having a sequence substantially homologous to the sequence of SEQ ID NO: 6 and a second primer having a sequence substantially homologous to the sequence of SEQ ID NO: 7. In yet another example, the kit further includes a probe having a sequence substantially homologous to or substantially complementary to the sequence of SEQ ID NO: 10.

[0023] In another example, the kit includes a primer pair comprising a first primer having a sequence substantially homologous to the sequence of SEQ ID NO: 8 and a second primer having a sequence substantially homologous to the sequence of SEQ ID NO: 5. In yet another example, the kit further includes a probe having a sequence substantially homologous to or substantially complementary to the sequence of SEQ ID NO: 11.

[0024] In some embodiments, the probes in the kits disclosed herein may be covalently linked to a detectable label. In another example, the probes in the kits disclosed herein may also include a quencher configured to quench the signal from the detectable label.

[0025] The following is explained: A1. a first primer that specifically binds to a target nucleic acid molecule comprising the sequence of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof; a second primer that specifically binds to the complement of the target nucleic acid molecule; Deoxynucleotide triphosphate nucleotides; DNA polymerase; buffer; and a test sample suspected of having a nucleic acid that is substantially homologous to a target nucleic acid molecule; A mixture comprising:

[0026] A2. the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:4; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; Mixtures as described in clause A1.

[0027] A3. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:6; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; Mixtures as described in clause A1.

[0028] A4. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:8; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; Mixtures as described in clause A1.

[0029] A5. The mixture of any one of clauses A1 to A4, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to a target nucleic acid molecule, or a fragment thereof, or a complement thereof.

[0030] A6. The mixture of clause A5, further comprising a detectable label, wherein the probe is covalently attached to the detectable label.

[0031] A7. The mixture of clause A5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9 or its complement, and the sequence of the target nucleic acid molecule comprises SEQ ID NO: 1, its complement, or a fragment thereof.

[0032] A8. The mixture of clause A5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 10 or its complement, and the sequence of the target nucleic acid molecule comprises SEQ ID NO: 2, its complement, or a fragment thereof.

[0033] A9. The mixture of clause A5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 11 or its complement, and the sequence of the target nucleic acid molecule comprises SEQ ID NO: 3, its complement, or a fragment thereof.

[0034] A10. The mixture according to clause A1, wherein the test sample comprises a food, a food suspension, a food solution, or a beverage.

[0035] A11. The mixture described in clause A10, wherein the test sample comprises one or more of the following list: fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice products, blended fruit juice, carbonated fruit drinks, fruit-flavored tea, wine, and fruit-flavored water.

[0036] B1. A method for detecting an organism containing a target nucleic acid molecule, wherein the target nucleic acid molecule comprises a sequence substantially homologous to one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, in a test sample, the method comprising: The test sample reacting with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; reacting with a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; Detecting the presence or absence of a detectable amplicon; A method comprising:

[0037] B2. The method of clause B1, further comprising reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds.

[0038] B3. the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:4, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5; the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:6 and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:7; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; The method described in clause B1 or B2.

[0039] B4. the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:4, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:9; the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:6, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:7, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:10; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 11; The method described in clause B2.

[0040] B5. The method of clause B1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0041] C1. A method for detecting a saccharifying strain of Alicyclobacillus acidoterrestris, comprising: The test sample a first primer comprising a sequence that specifically binds to a target nucleic acid comprising the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; react; Detecting the presence or absence of an amplicon A method comprising:

[0042] C2. The method of clause C1, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 4 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

[0043] C3. The method of clause C1 or C2, further comprising reacting the sample with a probe that specifically binds to the target nucleic acid molecule or its complement.

[0044] C4. The method of clause C3, wherein the probe is labeled with a detectable label.

[0045] C5. The method of clause C3, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 9 or its complement.

[0046] D1. A method for detecting a glycolytic strain of Alicyclobacillus herbarius, comprising: The test sample a first primer comprising a sequence that specifically binds to a target nucleic acid comprising the sequence of SEQ ID NO: 2, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO:2, or a fragment thereof, or a complement thereof; react; Detecting the presence or absence of an amplicon A method comprising:

[0047] D2. The method of clause D1, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 6 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 7 or its complement.

[0048] D3. The method of clause D1 or D2, further comprising reacting the test sample with a probe that specifically binds to the target nucleic acid molecule or its complement.

[0049] D4. The method of clause D3, wherein the probe is labeled with a detectable label.

[0050] D5. The method of clause D3, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 10 or its complement.

[0051] E1. A method for detecting a saccharifying strain of Alicyclobacillus dauci, comprising: The test sample a first primer comprising a sequence that specifically binds to a target nucleic acid comprising the sequence of SEQ ID NO: 3, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO:3, or a fragment thereof, or a complement thereof; react; Detecting the presence or absence of an amplicon A method comprising:

[0052] E2. The method of clause E1, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 8 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

[0053] E3. The method of clause E1 or E2, further comprising reacting the sample with a probe that specifically binds to the target nucleic acid molecule or its complement.

[0054] E4. The method of clause E3, wherein the probe is labeled with a detectable label.

[0055] E5. The method of clause E3, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 11 or its complement.

[0056] F1. A method for detecting a contaminant in a test sample comprising a target nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, or a variant thereof, comprising: The test sample reacting with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; reacting with a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; Detecting the presence or absence of an amplicon wherein the presence of the detectable amplicon indicates the presence of a contaminant in the test sample.

[0057] F2. The method of clause F1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0058] F3. The method for detecting the detectable amplicon is direct detection of a measurement of a physical property of the amplicon, detecting UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample. The method of clause F1, comprising one or more of the group consisting of:

[0059] G1. A method for detecting possible spoilage in a test sample, comprising: providing a test sample comprising a food, food suspension, food solution, or beverage; wherein the method comprises: The test sample reacting a first primer comprising a sequence that specifically binds to a target nucleic acid molecule, wherein the target nucleic acid molecule comprises the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; reacting with a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; Detecting the presence or absence of a detectable amplicon wherein the presence of the detectable amplicon indicates a positive spoilage potential of the test sample.

[0060] The method described in clause G1, wherein the test sample comprises fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drink, fruit-flavored tea, wine, or fruit-flavored water.

[0061] The method of clause G1, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0062] The method for detecting the detectable amplicon comprises: direct detection of a measurement of a physical property of the amplicon, detecting UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample. The method of clause G1, comprising one or more of the group consisting of:

[0063] H1. A method for detecting at least one contaminant in a test sample, wherein each contaminant comprises one of three target nucleic acid molecules, each of the three target nucleic acid molecules having a sequence substantially homologous to one of the sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, or a variant thereof, the method comprising: The test sample the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5; the third primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 6; the fourth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; the fifth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; reacting the first primer, the second primer, the third primer, the fourth primer, and the fifth primer under conditions sufficient to produce three detectable amplicons comprising the three target nucleic acid molecules, or fragments thereof, or complements thereof; Detecting the presence or absence of each of the three amplicons wherein the presence of any one of the three amplicons indicates the presence of a contaminant in the test sample.

[0064] H2. The test sample is a first probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 9; a second probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 10; and a third probe comprising a sequence substantially homologous to the sequence of SEQ ID NO:11; The method of clause H1, further comprising reacting with

[0065] I1. A mixture according to any one of clauses A1 to A4; and an instrument configured to perform an amplification assay on the mixture; Including, the system.

[0066] I2. The system of clause I1, further comprising at least one sample container.

[0067] I3. The system of clause I2, further comprising at least one PCR reaction mixture, each of the PCR reaction mixtures contained in one of the at least one sample containers.

[0068] I4. The system of clause I1, further comprising at least one sample temperature control device.

[0069] I5. The system of paragraph I1, wherein the mixture further comprises a probe comprising a sequence that is substantially homologous to the target nucleic acid molecule, or a fragment thereof, or a complement thereof.

[0070] J1. a first primer comprising a sequence substantially homologous to a target nucleic acid molecule comprising the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3; a second primer comprising a sequence substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous; deoxynucleotide triphosphate nucleotides; and buffer, Includes a kit.

[0071] J2. The kit of clause J1, further comprising a DNA polymerase.

[0072] J3. the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:4; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; A kit as described in clause J1.

[0073] J4. The kit of clause J3, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:9.

[0074] J5. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:6; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; A kit as described in clause J1.

[0075] J6. The kit of clause J5, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:10.

[0076] J7. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:8; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; A kit as described in clause J1.

[0077] J8. The kit of clause J7, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:11.

[0078] J9. The kit of any one of clause J4, J6, or J8, wherein the probe is covalently linked to a detectable label.

[0079] J10. The kit of clause J9, wherein the probe also includes a quencher configured to quench a signal from the detectable label. [Brief explanation of the drawings]

[0080] For the purpose of illustrating the embodiments, there are shown in the drawings exemplary embodiments, it being understood, however, that the embodiments are not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. [Figure 1] SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 are shown with annotated primer and probe binding sites, respectively. [Figure 2] FIG. 1 shows a block diagram of an exemplary embodiment of a thermal cycling system according to aspects of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0081] Detailed Description of the Invention The present disclosure provides mixtures, systems, kits, and methods of use for detecting genetic sequence variations in the vanillic acid decarboxylase (vdcC) gene in Alicyclobacillus species that cause spoilage of contaminated food and beverage products. The present disclosure also provides mixtures and methods of use for predicting the spoilage potential of food and beverage products contaminated with Alicyclobacillus bacteria expressing the disclosed vdcC gene variants. Alicyclobacillus bacteria expressing one of the variants disclosed herein produce guaiacol, thereby causing food and beverage spoilage. In contrast, Alicyclobacillus bacteria that do not express one of the variants may exhibit contamination but not produce guaiacol and cause spoilage.

[0082] Various mixtures and methods are described in the embodiments herein. The embodiments can be combined with each other. It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not limiting. All references cited herein are incorporated by reference in their entirety. Nothing herein should be construed as an admission that the subject matter is entitled to antedate such disclosure by virtue of prior invention. The use of examples anywhere herein, including examples of any terms discussed herein, is for illustrative purposes only and in no way limits the scope and meaning of the disclosure or the exemplified terms. Likewise, the present disclosure is not limited to its preferred embodiments.

[0083] The genus Alicyclobacillus includes several species of spore-forming bacteria that can survive in adverse environments. A major cause of spoilage and revenue loss in the fruit juice and wine industries is contamination of approximately 30% of raw materials used in fruit juice production with members of the genus Alicyclobacillus. The Alicyclobacillus strains that cause spoilage are specifically those capable of producing guaiacol. Detection and control of viable spores of these guaiacol-producing Alicyclobacillus strains in raw materials is essential to control contamination of finished juice products. More specifically, detection of the Alicyclobacillus genome variants disclosed herein can determine whether Alicyclobacillus bacteria present in raw materials produce guaiacol and, consequently, cause spoilage.

[0084] Guaiacol is produced by vanillic acid decarboxylase, encoded by the vdcC gene, found in some strains of Alicyclobacillus. Expression of the vdcC gene has been identified as a predictor of juice or wine spoilage in Alicyclobacillus species, including Alicyclobacillus acidoterrestris, Alicyclobacillus hervarius, and Alicyclobacillus dausii.

[0085] Tests are available to confirm the presence of Alicyclobacillus bacteria. These are known in the art as ACB tests. However, as demonstrated herein, a positive ACB test alone does not necessarily indicate spoilage; rather, spoilage occurs due to the production of guaiacol by the vanillic acid decarboxylase gene product expressed by some, but not all, Alicyclobacillus strains.

[0086] The genetic variability of the vdcC gene in different species of Alicyclobacillus is shown in the following example: Three gene sequences presented herein as SEQ ID NOs: 1, 2, and 3 were identified in different Alicyclobacillus species.

[0087] The genomic region of the vdcC gene variant found in Alicyclobacillus acidoterrestris was identified to contain the sequence of SEQ ID NO: 1: GAGACGGACTACATGGTCGGCGTCAACACCTGCGTGCCCATGTATCAGCAACTCAAGGACGCGTTCCCGAACGAAATCGTGGCCGTCAATGCCATGTACACGCATGGCCTCGTCGCCATTATCTCGACCAAGAAACGGTACGGTGGGTTTGC (SEQ ID NO: 1).

[0088] The genomic region of the vdcC gene variant found in Alicyclobacillus hervarius was identified to contain the sequence of SEQ ID NO: 2: GAGGTCGACTACATGATTGGGTTGAACACGTCGGTTCCACTCTATCACCAGTTGAAGCAGGCCTATCCGGATGAAATCGTCGCGGTGAACGCGATGTATACGCATGGGCTGGTGGCGATTATTTCGACAAAGACTCGTTATGGGGCTTTGC (SEQ ID NO: 2).

[0089] The genomic region of the vdcC gene variant found in Alicyclobacillus dausii was identified to contain the sequence of SEQ ID NO: 3: GAGACTGACTACATGGTGGGTGTGAATACATGTGTGCCGATCTACCAGCAGCTGAAGGAAGCTTTTCCGAACGAGATCGTGGCTGTGAATGCAATGTACACGCACGGACTGGTGGCCATCGTCTCGACGAAGAAGCGGTACGGCGGCTTTGC (SEQ ID NO: 3).

[0090] In order that the present disclosure may be more readily understood, certain terms are defined.

[0091] Unless otherwise defined, all technical and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed embodiments belong. Certain terms are explained below or elsewhere herein to provide additional guidance to the practitioner in describing the disclosed mixtures and methods and how to use them. It will further be understood that the same thing can be said in more than one way. Thus, alternative language or synonyms may be used for one or more of the terms described herein, and no special meaning is given to a term depending on whether it is described in detail or discussed herein.

[0092] Unless otherwise required by context, singular terms will include pluralities and plural terms will include the singular.

[0093] The articles "a," "an," and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "a sample" means one sample or more than one sample.

[0094] As used herein, the adverb "about" or "approximately" means that a numerical value is approximate and that small variations will not significantly affect the practice of the disclosed embodiments. When numerical limitations are used, unless the context dictates otherwise, "about" means that the numerical value may vary by ±5% while remaining within the range of the disclosed embodiments. Thus, about 100 means 95 to 105.

[0095] As used herein, the terms "detecting" or "detection" are used in the broadest sense to include the qualitative and / or quantitative determination of an analyte.

[0096] As used herein, the term "analyte" refers to a substance that is measured in an analytical procedure. Non-limiting examples of analytes include RNA, DNA, nucleic acid molecules encoded by cells, synthetic nucleic acid molecules, and amplification products (e.g., amplicons).

[0097] As used herein, an "amplicon" is an amplification product. An amplicon can be generated by amplifying a nucleic acid sequence from a test sample. An amplicon can include, but is not limited to, a PCR product.

[0098] As used herein, "PCR product" refers to any product produced as a result of a PCR reaction.

[0099] As used herein, the term "sample" refers to any material that may contain or is suspected of containing a particular item (e.g., an analyte). Illustratively, a sample can be a fluid medium or liquid. In some embodiments, samples high in dissolved solids can be used without further processing. In some embodiments, samples with high solids (non-dissolved) can be analyzed by processing the sample using a filter or used in combination with additional manual procedures. In some embodiments, the sample is unfiltered. In some embodiments, the sample is filtered. In some embodiments, the sample is purified. In some embodiments, the sample is unpurified. A sample can be a liquid, suspension, extracted or lysed sample, or supercritical fluid. Examples of samples include, but are not limited to, food swabs, food extracts, food suspensions, food cultures, amplification reactions, PCR reactions, etc. A sample can also be derived from another sample. For example, a PCR reaction can be performed on a nucleic acid mixture extracted, isolated, and / or purified from another sample (e.g., juice). This PCR reaction results in a sample derived from another sample.

[0100] As used herein, the term "beverage" means a liquid for drinking. As used herein, the term "food" refers to a raw, cooked, or processed edible substance, ice, beverage, or ingredient used or intended to be used in whole or in part for human consumption. Non-limiting examples of food include fresh fruit, cooked fruit, wine, canned fruit, etc. The term food includes food suspensions and food cultures.

[0101] The terms "food suspension" and "food solution" are used interchangeably throughout this application and refer to raw, cooked, or processed food that is in, or placed or suspended in, a solution. Non-limiting examples of food suspensions include fruit juices, blended juice products, carbonated fruit drinks, tea, wine, and fruit-flavored waters. Food suspensions may be mixed, vortexed, or blended. Food suspensions may be filtered or unfiltered. As used herein, a "food culture" is a food sample that has been cultured under conditions that concentrate the sample. This process is also referred to as "concentration."

[0102] As used herein, the term "juice" refers to juice at any stage in the juice manufacturing process prior to packaging into a container capable of containing the juice.

[0103] As used herein, the term "juice product" includes any food or beverage produced during the manufacture of juice.

[0104] The term "spoilage" as used herein refers to the process by which a food product becomes unfit for consumption. Spoilage of juice products can include undesirable changes in taste, flavor, aroma, viscosity, body, aroma, smell, and appearance, or the presence of contaminating components, such as guaiacol.

[0105] The term "spoilers" refers to any microorganism that can cause spoilage of a food or beverage. Juice spoilage microorganisms are any microorganisms that can alter the flavor, aroma, or appearance of a juice in a way that is deemed undesirable by the manufacturer, or that can cause juice spoilage. Non-limiting examples of juice spoilage microorganisms include members of the genus Alicyclobacillus, including A. acidoterrestris, A. terrestris, A. pomorum, A. acidocaldarius, A. suci, A. dauci, A. herbarious, and A. acidiphilus.

[0106] As used herein, the terms "nucleic acid," "nucleic acid molecule," and "nucleotide" are consistent with their usage in the art and are intended to include naturally occurring species or functional analogs thereof. Nucleic acids are composed of one or more nucleotides and can include oligonucleotides and polynucleotides. As used herein, "polynucleotide," "nucleic acid molecule," and "nucleic acid" may be used interchangeably and may refer to polymeric forms of nucleotides of any length. As used herein, "oligonucleotide" refers to a single-stranded multimer of nucleotides of about 2 to 200 nucleotides, illustratively about 15 to about 40 nucleotides, about 150 nucleotides, about 152 nucleotides, about 16 to about 25 nucleotides, about 18 to about 22 nucleotides, about 26 to about 34 nucleotides, or about 28 to about 32 nucleotides in length, e.g., 18, 19, 20, 21, or 22 nucleotides in the case of a primer, and 28, 29, 30, 31, or 32 nucleotides in the case of a probe. Oligonucleotides may be synthetic or enzymatically produced. An example of a nucleic acid molecule is DNA, which can contain deoxyribonucleotides or modified deoxyribonucleotides. As used herein, the term "nucleotide" is also intended to encompass nucleotide analogs, which are a type of nucleotide that contains modified nucleic acid bases, sugars, and / or phosphate moieties compared to naturally occurring nucleotides.

[0107] As used herein, "target nucleic acid" or grammatical equivalents thereof can refer to a nucleic acid molecule or sequence that is desired to be identified, detected, hybridized, sequenced, analyzed and / or further manipulated.

[0108] As used herein, the term "primer" is defined as an isolated, at least partially single-stranded, often completely single-stranded polynucleotide, e.g., an oligonucleotide, having one strand with a free 3' hydroxyl (-OH) group. A primer may have a modification at the 5' end to enable a coupling reaction or to couple the primer to another moiety, such as a detectable moiety, a detectable tag, etc. A primer may also contain an auxiliary moiety, e.g., a region non-complementary to the target nucleic acid, which can be used as a tag for the hybridized complex or the amplicon generated by the amplification reaction.

[0109] As used herein, the term "probe" is defined as a detectable, illustratively partially single-stranded, and often completely single-stranded, polynucleotide, e.g., an oligonucleotide, that is capable of specifically hybridizing to a target nucleic acid to enable detection of the target nucleic acid.

[0110] As used herein, "specifically hybridize" means that a probe, primer, or oligonucleotide recognizes and physically interacts (i.e., base pairs with) a substantially complementary nucleic acid (e.g., a sample nucleic acid) under high stringency conditions, but does not substantially base pair with other nucleic acids. "High stringency conditions" refer to conditions configured to allow identification of a target nucleic acid sequence. Such conditions typically occur at about T minus 5°C (5° below the T of the probe). Functionally, high stringency conditions are used to identify nucleic acid sequences with at least 80% sequence identity. In some embodiments, this can mean at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[0111] As used herein, a "substantially complementary" nucleic acid means that the nucleic acid specifically hybridizes to a designated sequence. As used herein, "substantially homologous" means that the nucleic acid specifically hybridizes to the complement of the designated sequence.

[0112] As used herein, "conditions sufficient to produce a detectable amplicon" includes conditions (e.g., temperature, pH, salt conditions, buffer reagents, polymerization reagents, extension reagents, or ligation reagents) that support specific amplification of a target region to which a nucleic acid molecule serving as a primer specifically hybridizes. Such conditions can support, for example, temperature cycling amplification reactions, including polymerase chain reaction (PCR), isothermal amplification reactions such as NASBA and TMA, ligase chain reaction (LCR), or other nucleic acid amplification methods.

[0113] As used herein, the term "simultaneously" refers to detecting multiple analytes simultaneously or near simultaneously. As used herein, a "method of simultaneously detecting multiple analytes with a single signal" or variations thereof can refer to a method of detecting multiple analytes with a single signal using a single assay (e.g., a single well, a single dot, a single location on an array) or using a single use of an apparatus. "Simultaneously" can mean detecting multiple analytes simultaneously or near simultaneously on separate apparatus.

[0114] As used herein, the term "single signal" refers to the detection of a signal based on a single moiety or method. For example, if the single signal is red, then the presence of red alone indicates multiple analytes. That is, in this non-limiting example, the red color indicates the presence of multiple analytes in the sample. In contrast, if one analyte is indicated by red and a second analyte is indicated by yellow, the use of two colors (i.e., signals) does not constitute detection of multiple analytes with a single signal. Signals are not limited to colorimetric detection. Examples of signals that can be used are provided herein. This is in contrast to detecting the presence of multiple analytes in a sample, which requires using different signals in the same reaction or performing separate reactions and methods to detect the multiple analytes. That is, embodiments described herein provide, in part, methods for detecting multiple analytes simultaneously with a single signal, such that detection of a single signal indicates the presence of multiple analytes in the sample, or the absence of a single signal indicates the absence of multiple analytes in the sample.

[0115] As used herein, the term "heterologous" with respect to an interaction unit refers to a group, molecule, or moiety that is not natural to the analyte. For example, an amplification product may contain only nucleic acid molecules or nucleotide bases. However, the amplification product may be bound or attached to a heterologous tag, including, but not limited to, a hapten, biotin, digoxigenin, and a fluorescent molecule (e.g., fluorescein or rhodamine). Examples of heterologous interaction units include, but are not limited to, a hapten, biotin, a nucleic acid molecule, a peptide fragment (e.g., His tag, GST tag), an enzyme, streptavidin, avidin, a fluorescent molecule, and the like. This list is non-limiting, and any interaction unit can be used. The analyte can be labeled with a molecule such as digoxigenin, rhodamine, fluorescein, DNP, BRDU, etc., and then detected by a capture reagent specific for the given molecule.

[0116] As used herein, the term "different analytes" means that the analytes are not identical. However, different analytes may have different physical and / or functional characteristics, even if they share the same name. For example, different organisms may contain different variants of a gene and its protein product. These variants may have the same function and therefore share the same name. For example, there are multiple species of Alicyclobacillus, each of which may contain variations in the vdcC gene and have different spoilage potential. The present method can be used to detect multiple analytes, including different vdcC gene variants from multiple species of Alicyclobacillus, each of which has a high spoilage potential.

[0117] In some embodiments, one or more primers are provided that specifically hybridize to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof.

[0118] In some embodiments, the primer has the sequence of SEQ ID NO:4: GAGACGGACTACATGGTCGG (SEQ ID NO: 4), or substantially homologous to its complement.

[0119] In some embodiments, the primer has the sequence of SEQ ID NO:5: GCAAAGCCGCCGTACCG (SEQ ID NO: 5), or substantially homologous to its complement.

[0120] In some embodiments, the primer has the sequence of SEQ ID NO:6: GAGGTCGACTACATGATTGG (SEQ ID NO: 6), or substantially homologous to its complement.

[0121] In some embodiments, the primer has the sequence of SEQ ID NO:7: GCAAAGCCCCCATAACG (SEQ ID NO: 7), or substantially homologous to its complement.

[0122] In some embodiments, the primer has the sequence of SEQ ID NO:8: GAGACTGACTACATGGTGGG (SEQ ID NO: 8), or substantially homologous to its complement.

[0123] In some embodiments, one or more probes are provided that specifically hybridize to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof.

[0124] In some embodiments, the probe has the sequence of SEQ ID NO:9: ATGCGTATACATCGCGTTCACCGCGACGATT (SEQ ID NO: 9), or its complement, or a fragment thereof. The probe of SEQ ID NO:9 binds to SEQ ID NO:1.

[0125] In some embodiments, the probe has the sequence of SEQ ID NO: 10: GTGCGTGTACATTGCATTCACAGCCACGATC (SEQ ID NO: 10), or its complement, or a fragment thereof. The probe of SEQ ID NO:10 binds to SEQ ID NO:2.

[0126] In some embodiments, the probe has the sequence of SEQ ID NO:11: ATGCGTGTACATGGCATTGACGGCCACGATT (SEQ ID NO: 11), or its complement, or a fragment thereof. The probe of SEQ ID NO:11 binds to SEQ ID NO:3.

[0127] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complement thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO: 4, the complement of SEQ ID NO: 4, SEQ ID NO: 5, or the complement of SEQ ID NO: 5.

[0128] In some embodiments, the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complement thereof, wherein the probe is substantially homologous to SEQ ID NO: 9 or a complement thereof.

[0129] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO:2, or a fragment thereof, or a complement thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO:6, the complement of SEQ ID NO:6, SEQ ID NO:7, or the complement of SEQ ID NO:7.

[0130] In some embodiments, the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 2, or a fragment thereof, or a complement thereof, wherein the probe is substantially homologous to SEQ ID NO: 10 or a complement thereof.

[0131] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO:3, or a fragment thereof, or a complement thereof, wherein the primer is substantially homologous to a sequence of SEQ ID NO:8, the complement of SEQ ID NO:8, SEQ ID NO:5, or the complement of SEQ ID NO:5.

[0132] In some embodiments, the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 3, or a fragment thereof, or a complement thereof, wherein the probe is substantially homologous to SEQ ID NO: 11 or a complement thereof.

[0133] In some embodiments, the probe is covalently linked to a detectable label. In some embodiments, the detectable label is selected from the following list: 1,5-IAEDANS; 1,8-ANS; 2'-chloro-7'phenyl-1,4-dichloro-6-carboxyfluorescein (VIC); 3(4)-carboxyfluorescein dipivalate NHS ester; 3(4)-carboxyfluorescein dipivalate hydroxyhexylcarboxamide; 3(4)-carboxyfluorescein dipivalate hydroxyhexylcarboxamide phosphoramidite; 3(4)-carboxyfluorescein dipivaloyl-N-succinimidyl ester; 4-methylumbelliferone; 5-carboxy-2,7-dichlorofluorescein; 5-carboxyfluorescein. Fluorescein (5-FAM); 5-carboxynaphthofluorescein; 5-carboxyfluorescein dipivalate; 5-carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-carboxyfluorescein); 5-HAT (hydroxytryptamine); 5-hydroxytryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-carboxytetramethylrhodamine); 6-carboxyfluorescein (6-FAM); 6-carboxyfluorescein dipivalate; 6-carboxynaphthofluorescein; 6-carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-amino-4-methylcoumarin; 7-aminoactinomycin D (7-AAD); 7-hydroxy-4-methylcoumarin; 9-amino-6-chloro-2-methoxyacridine; ABQ; ABY; Acid Fuchsin; ACMA (9-amino-6-chloro-2-methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavine; Acriflavine Feulgen SITSA; Alexa Fluor 350; Alexa Fluor 405; Alexa Fluor 430; Alexa Fluor 488; Alexa Fluor 500; Alexa Fluor 514; Alexa Fluor 532; Alexa Fluor 546; Alexa Fluor 555; Alexa Fluor 568; Alexa Fluor 594; Alexa Fluor 610;Alexa Fluor 633; ​​Alexa Fluor 635; Alizarin Complexone; Alizarin Red; AMC; AMCA-S; AMCA (aminomethylcoumarin); AMCA-X; Aminoactinomycin D; Aminocoumarin; Aminomethylcoumarin (AMCA); Aniline Blue; Anthrosyl Stearate; APTRA-BTC; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7GLL; Atab Lin;ATTO390;ATTO425;ATTO465;ATTO488;ATTO495;ATTO520;ATTO532;ATTO550;ATTO565;ATTO590;ATM594;ATTO610; ATTO611X;ATTO620;ATTO633;ATTO635;ATTO647;ATTO647N;ATTO655;ATTO680;ATTO700;ATTO725;ATTO740;ATTO-TAG CBQCA; ATTO-TAG FQ; Auramine; Aurophosphine G; Aurophosphine; BAO9 (Bisaminophenyloxadiazole); BCECF (High pH); BCECF (Low pH); Berberine Sulfate; Bimane; Bisbenzamide; Bisbenzimide (Hoechst); Bis-BTC; Brancofol FFG; Brancofol SV; BOBO-1; BOBO-3; Bodipy 492 / 515; Bodipy 493 / 503; Bodipy 500 / 510; Bodipy 505 / 515; Bodipy 530 / 550; Bodipy 542 / 563; Bodipy 558 / 568; Bodipy 564 / 570; Bodipy 576 / 589; Bodipy 581 / 591; Bodipy 630 / 650-X; Bodipy 650 / 665-X; Bodipy 665 / 676; Bodipy Fl; Bodipy FL ATP; Bodipy Fl-ceramide; Bodipy R6G; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X; SE; Bodipy TR; Bodipy TR ATP; Bodipy TR-X SE; BO-PRO-1; BO-PRO-3; Brilliant Sulfoflavin FF; BTC; BTC-5N; Calcein; Calcein Blue; Calcium Crimson; CAL Fluor Gold 540;CAL Fluor Orange 560; CAL Fluor Red 590; CAL Fluor Red 610; CAL Fluor 635; Calcium Green; Calcium Green-1 Ca2+ dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White White); Carboxyfluorescein diacetate; Carboxyfluorescein diacetate succinimidyl ester; Carboxyfluorescein dipivalate succinimidyl ester; Carboxyfluorescein succinimidyl ester (CFSE); Carboxy-X-rhodamine (5-ROX); Cascade Blue; Cascade Yellow; Catecholamines; CCF2 (GeneBlazer); CFDA; Chromomycin A; Chromomycin A; CL-NERF; CMFDA; Coumarin phalloidin; CPM methylcoumarin; CTC; CTC formazan; Cy2; Cy3.1 8; Cy3.5; Cy3; Cy5.1 8; Cyclic AMP Fluorosensor (FiCRhR); Dabsyl; Dansyl; Dansylamine; Dansylcadaverine; Dansyl chloride; Dansyl DHPE; Dansyl fluoride; DAPI; Dapoxil; Dapoxil 2; Dapoxil 3'DCFDA; DCFH (Dichlorodihydrofluorescein diacetate); DDAO; DHR (Dihydrorhodamine 123); Di-4-ANEPPS; Di-8-ANEPPS (non-ratio); DiA (4-di-16-ASP); Dichlorodihydrofluorescein Dichlorodiacetic acid (DCFH); DiD-lipophilic tracer; DiD (DiIC18(5)); DIDS; dihydrorhodamine 123 (DHR); DiI (DiIC18(3)); dinitrophenol; DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); dipivaloyl-3(4)-(N-(6'-hydroxyhexyl))-carboxamide; DM-NERF (high pH); DNP; dopamine; DTAF; DY-630-NHS; DY-635-NHS; DyLight 405; DyLight 488; DyLight 549; DyLight 633;DyLight 649; DyLight 680; DyLight 800; ELF 97; Eosin; Erythrosine; Erythrosine ITC; Ethidium Bromide; Ethidium Homodimer-1 (EthD-1); Euchrysin; EukoLight; Europium(III) Chloride; Fast Blue; FDA; Feulgen (pararosaniline); FIF (formaldehyde-induced fluorescence); FITC; Furazo Orange; Fluo-3; Fluo-4; Fluorescein (FITC); Fluorescein amidite (FAM); Fluorescein diacetate; Fluorescein diacetate 6-Isothiocyanate; Fluorescein Dipivaloylamidite; Fluorescein Phosphoramidite; Fluoro-Emerald; Fluoro-Gold (Hydroxystilbamidine); Fluoro-Ruby; Fluoro-X; FM1-43; FM4-46; Fura Red (High pH); Fura Red / Fluo-3; Fura-2; Fura-2 / BCECF; Genacryl Brilliant Red B; Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow SGF; GeneBlazer (CCF2); Gloxalic Acid; Granular Blue blue); hematoporphyrin; HEX; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS; hydroxycoumarin; hydroxystilbamidine (Fluorogold); hydroxytryptamine; Indo-1; high calcium; Indo-1; low calcium; indodicarbocyanine (DiD); indotricarbocyanine (DiR); IntraWhite Cf; JC-1; JOE; JO-JO-1; JO-PRO-1; JUN; LaserPro ); Laurodan; LDS751 (DNA); LDS751 (RNA); Leukophor PAF; Leukophor SF; Leukophor WS; Lissamine rhodamine; Lissamine rhodamine B; Calcein / ethidium homodimer; LOLO-1; LO-PRO-1; Lucifer Yellow; Lysotracker Blue; Lysotracker Blue-White; Lysotracker Green; Lysotracker Red; Lysotracker Yellow; Lysosensor Blue; Lysosensor Green;Lithosensor Yellow / Blue; Mag Green; Magdala Red (Phloxine B); Magufla Red; Magufla-2; Magufla-5; Mag-Indo-1; Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxillon Brilliant Flavin 10 GFF; Maxillon Brilliant Flavin 8GFF; Merocyanine; Methoxycoumarin; Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mithramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronine Stilbene); NBD; NBD-amine; Nile Red; Nitrobenzoxazidol; Noradrenaline; Nuclear Fast Red; Nuclear Yellow; Nylosan Brilliant Flavin EBG; Oregon Green; Oregon Green 488-X; Oregon Green; Oregon Green 488; Oregon Green 500; Oregon Green 514; Pacific Blue; Pararosaniline (Feulgen); PBFI; Phloxine B (Magdala Red); Phorwite AR (Phorwite AR); Holwight BKL; Holwight Rev; Holwight RPA; Phosphine 3R; PKH26 (Sigma); PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO-PRO-1; PO-PRO-3; Primulin; Procion Yellow; Propidium iodide (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrrosal Brilliant Flavin 7GF; QSY7; Quinacrine Mustard; Resorufin; RH414; Rhod-2 (Rhod-2); Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5GLD; Rhodamine 6G; Rhodamine B; Rhodamine B200; Rhodamine B Extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine phallicidin; Rhodamine phalloidin; Rhodamine Red; Rhodamine WT; Rose Bengal; S65A; S65C; S65 L;S65T;SBFI;Serotonin;Cebron Brilliant Red 2B;Cebron Brilliant Red 4G;Cebron Brilliant Red B;Cebron Orange;Cebron Yellow L;SITS;SITS (primulin);SITS (stilbene isothiosulfonic acid);SNAFL calcein;SNAFL-1;SNAFL-2;SNARF calcein;SNARF1;Sodium Green;Spectrum Aqua;Spectrum Green;Spectrum Orange;Spectrum Red;SPQ (6-methoxy-N-(3-sulfopropyl)quinolinium);Stilbene;Sulforhodamine B can C; Sulforhodamine Extra; SUN; SYBR Green; SYTO11; SYTO12; SYTO13; SYTO14; SYTO15; SYTO16; SYTO17; SYTO18; SYTO20; SYTO21; SYTO22; SYTO23; SYTO24; SYTO25; SYTO40; SYTO41; SYTO42; SYTO43; SYTO44; SYTO45; SYTO59; SYTO60; SYTO61; SYTO62; SYTO63; SYTO64; SYTO80; SYTO81; SYTO82; SYTO83; SYTO84; SYTO85; SYTOX Blue; SYTOX Green; SYTOX Orange; TAMARA; tetracycline; tetrachlorofluorescein (TET); tetramethylrhodamine (TAMRA); Texas Red; Texas Red X conjugate; thiadicarbocyanine (DiSC3); thiazine red R; thiazole orange; thioflavin 5; thioflavin S; thioflavin TCN; thiolite; thiozole orange; tinopol CBS (calcofluor white); TMR;TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TRITC (tetramethylrhodamine isothiocyanate); True Blue; TruRed; Ultralight; Uranine B; Uvitex SFC; WW781; X-rhodamine; XRITC; Xylene Orange; Y66F; Y66H; Y66W; Yamica Yellow; YO-PRO-1; YO-PRO-3; YOYO-1 or YOYO-3; and any combination thereof.

[0134] In some embodiments, the probe further comprises a quencher of the detectable label, wherein the quencher of the detectable label is covalently attached to the isolated nucleic acid molecule. In some embodiments, the probe comprises a quencher selected from the group consisting of BBQ-650, BHQ-1, BHQ-2, BHQ-3, Black Hole Quencher (BHQ), Dabcyl, Eclipse, IBFQ, Iowa Black, TAMARA, TAMRA, ZEN, or ZEN Iowa Black, and any combination thereof.

[0135] In some embodiments, quenching of the detectable label ceases following hydrolysis of a covalent bond within the probe, where a first hydrolysis product comprises the detectable label and a second hydrolysis product comprises a quencher of the detectable label; the detectable label and the quencher are separated; or the hydrolysis prevents the quencher molecule from quenching the detectable signal.

[0136] In some embodiments, a mixture is provided comprising a target nucleic acid molecule and a probe described herein, wherein the target nucleic acid molecule is substantially homologous to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, and a primer and, optionally, a probe specifically bind to the target nucleic acid molecule. In some embodiments, the mixture comprises one or more primers described herein. In some embodiments, the mixture comprises one or more probes described herein. In some embodiments, the mixture comprises one or more primers and one or more probes described herein.

[0137] In some embodiments, the mixture further comprises a detectable label as described herein. In some embodiments, the detectable label is covalently attached to the probe. In some embodiments, the mixture further comprises a quencher of the detectable label as described herein. In some embodiments, the quencher of the detectable label is covalently attached to the probe. In some embodiments, the mixture comprises a target nucleic acid molecule substantially homologous to SEQ ID NO: 1 or a fragment thereof, a first primer substantially homologous to SEQ ID NO: 4, and a second primer substantially homologous to SEQ ID NO: 5. In some embodiments, the mixture further comprises a probe substantially homologous to SEQ ID NO: 9.

[0138] In some embodiments, the mixture comprises a target nucleic acid molecule or fragment thereof that is substantially homologous to SEQ ID NO: 2, a first primer that is substantially homologous to SEQ ID NO: 5, and a second primer that is substantially homologous to SEQ ID NO: 6. In some embodiments, the mixture further comprises a probe that is substantially homologous to SEQ ID NO: 10.

[0139] In some embodiments, the mixture comprises a target nucleic acid molecule or fragment thereof that is substantially homologous to SEQ ID NO: 3, a first primer that is substantially homologous to SEQ ID NO: 8, and a second primer that is substantially homologous to SEQ ID NO: 5. In some embodiments, the mixture further comprises a probe that is substantially homologous to SEQ ID NO: 11.

[0140] In some embodiments, the mixture is an amplification reaction mixture. In such embodiments, the mixture comprises primers described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer, to which a target nucleic acid can be added. In some embodiments, the mixture further comprises a test sample described herein.

[0141] In some embodiments, the deoxynucleoside triphosphate nucleotides (dNTPs) comprise a mixture of dATP, dCTP, dGTP, and dTTP. In some embodiments, the dNTPs further comprise deoxyuridine triphosphate (dUTP) in combination with uracil DNA glycosylase (UDG) pretreatment as a strategy to prevent carryover PCR contamination. In some embodiments, the dNTPs comprise a mixture of dATP, dCTP, dGTP, and dUTP. In some embodiments, the dUTP is modified. In some embodiments, the dUTP is aminoallyl-dUTP, fluorescein-12-dUTP, 5-bromo-dUTP, or biotin-11-dUTP. Other natural or unnatural dNTPs may also be used.

[0142] In some embodiments, the polymerase is derived from Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu polymerase), Thermococcus litoralis (Wind or Tli polymerase or Vent polymerase), or Thermus thermophilus (Tth polymerase). In some embodiments, the polymerase is specifically modified for the incorporation of uracil. In some embodiments, the polymerase is specifically modified for the incorporation of modified dNTPs.

[0143] In some embodiments, the buffer comprises Tris-HCl and magnesium chloride (MgCl), hi some embodiments, the buffer comprises Tris-HCl, ammonium sulfate ((NH)SO), and magnesium chloride (MgCl).

[0144] In some embodiments, the mixture further comprises a second target nucleic acid molecule described herein. In some embodiments, the mixture further comprises a primer described herein, which hybridizes to the second target nucleic acid molecule or its complement. In some embodiments, the second nucleic acid is selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0145] In some embodiments, the mixture comprises a second and a third target nucleic acid molecule described herein. In some embodiments, the mixture further comprises a primer described herein, which hybridizes to the second and third target nucleic acid molecules or their complements or fragments thereof. In some embodiments, the second and third target nucleic acids are selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0146] In some embodiments, the mixture further comprises a test sample. In some embodiments, the test sample comprises a food, a food suspension, a food solution, or a beverage. In some embodiments, the test sample comprises fresh fruit, cooked fruit, canned fruit, fruit juice, a fruit juice product, a blended fruit juice, a carbonated fruit drink, a fruit-flavored tea, a wine, or a fruit-flavored water.

[0147] In some embodiments, the test sample comprises a solid suspension. In some embodiments, the test sample comprises Alicyclobacillus cells. In some embodiments, the test sample comprises Alicyclobacillus cells separated from a solid suspension. In some embodiments, the test sample comprises genomic DNA from Alicyclobacillus cells. In some embodiments, the test sample comprises digested genomic DNA from Alicyclobacillus cells. In some embodiments, the Alicyclobacillus species is Alicyclobacillus acidoterrestris. In some embodiments, the Alicyclobacillus species is Alicyclobacillus hervarius. In some embodiments, the Alicyclobacillus species is Alicyclobacillus dausii.

[0148] In some embodiments, the mixture further comprises a detectable amplicon, wherein the amplicon is detectable by direct or indirect detection. In some embodiments, the mixture comprises a sequence substantially homologous to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof. In some embodiments, the detectable amplicon is a PCR product.

[0149] In some embodiments, a vessel is provided that contains a mixture as described herein. In some embodiments, the vessel is a tube, a plate, a reaction vessel, or the like.

[0150] How to use Without wishing to be bound by theory, amplicons can be generated by amplifying target nucleic acid molecules in many ways, and the amplicons can be detected in many ways. Non-limiting examples of DNA amplification reactions include polymerase chain reaction (PCR), isothermal amplification, ligase chain reaction (LCR), and rolling circle replication (RCR). Non-limiting examples of PCR reactions include emulsion PCR, real-time PCR (RT-PCR), TaqMan® real-time PCR, multiplex PCR, long-range PCR, single-cell PCR, fast cycling PCR, methylation-specific PCR (MSP), hot-start PCR, high-fidelity PCR, rapid amplification polymorphism DNA analysis (RAPD), rapid amplification of cDNA ends (RACE), in situ PCR, differential display PCR, and bridge PCR (bPCR) amplification. Non-limiting examples of isothermal reactions include isothermal amplification, loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), thermophilic helicase-dependent amplification (tHDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence reaction (3SR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and bridge amplification. An exemplary method for LAMP is described in U.S. Patent Application Publication No. 20130171643. In some embodiments, an internal standard can be added during the DNA amplification reaction.

[0151] After amplification, the amplicons can be detected, for example, by DNA gel, lateral flow detection devices, or vertical flow detection devices. Alternatively, the predicted region, or a fragment thereof, or its complement, can be amplified, and the resulting amplicons can be detected in real time. In one embodiment, positive amplification of DNA can be monitored in real time using, for example, a dsDNA-binding dye such as SYBR Green or EvaGreen®.

[0152] Real-time monitoring can also be achieved by adding specific oligonucleotide hybridization probes, such as molecular beacons or TaqMan® probes, to a mixture containing primers and target nucleic acid molecules. The oligonucleotide probe itself can contain two different oligonucleotide strands. The first oligonucleotide strand can contain a quencher, and the second oligonucleotide strand can contain a fluorophore. Displacement of the two strands from one another during the amplification reaction generates a fluorescent signal. Alternatively, a single oligonucleotide strand can contain both a detectable label and a quencher. In some embodiments, quenching of the detectable label ceases following hydrolysis of a covalent bond within the reporter nucleic acid molecule, where the first hydrolysis product contains the detectable label and the second hydrolysis product contains a quencher of the detectable label; the detectable label and the quencher are separated; or hydrolysis prevents the quencher molecule from quenching the detectable signal. The amplification reaction can be detected by monitoring the emitted fluorescence. Multiplex detection methods can also be used. Other probe configurations can be used, as known in the art.

[0153] In some embodiments, methods are provided for detecting target nucleic acid molecules that are substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof.

[0154] In some embodiments, the methods described herein involve detecting an analyte in a test sample. In some embodiments, the test sample comprises a food, food suspension, food solution, or beverage. In some embodiments, the test sample comprises fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drink, fruit-flavored tea, wine, or fruit-flavored water. In some embodiments, the test sample comprises a suspension of Alicyclobacillus cells. In some embodiments, the test sample comprises a suspension of Alicyclobacillus cells in a centrifugable container. In some embodiments, the test sample comprises Alicyclobacillus cells separated from a suspension of Alicyclobacillus cells. In some embodiments, the test sample comprises a pellet of Alicyclobacillus cells separated from a suspension of Alicyclobacillus cells by centrifugation, and the supernatant is decanted from the pellet. In some embodiments, the test sample comprises Alicyclobacillus cells and a lysis buffer. In some embodiments, the test sample comprises Alicyclobacillus cells whose cell walls have been lysed. In some embodiments, the test sample comprises genomic DNA from lysed Alicyclobacillus cells. In some embodiments, the test sample comprises genomic DNA from lysed Alicyclobacillus cells. In some embodiments, the sample is derived from another sample. For example, a PCR reaction can be performed on a nucleic acid mixture extracted, isolated, and / or purified from another sample (e.g., wine). In this case, the PCR reaction is a sample derived from another sample.

[0155] In some embodiments, detecting an analyte in a test sample is used to detect an organism comprising a nucleic acid molecule having the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a complement thereof, or a fragment thereof. In some embodiments, the organism is a wild-type Alicyclobacillus. In some embodiments, detecting an analyte in a test sample is used to detect a contaminant comprising a nucleic acid molecule having the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a complement thereof, or a fragment thereof, or a variant thereof. In some embodiments, the contaminant is an organism, and the organism is an Alicyclobacillus species. In some embodiments, the contaminant is derived from an Alicyclobacillus species. In some embodiments, detecting an analyte in a test sample is used to determine spoilage potential in the test sample. In some embodiments, a positive spoilage potential indicates the presence of a contaminant, and the contaminant is an organism, and the organism is an Alicyclobacillus species. In some embodiments, a positive spoilage potential indicates the presence of a contaminant derived from an Alicyclobacillus species that produces guaiacol.

[0156] In some embodiments, the Alicyclobacillus species is Alicyclobacillus acidoterrestris. In some embodiments, the Alicyclobacillus species is Alicyclobacillus hervarius. In some embodiments, the Alicyclobacillus species is Alicyclobacillus dausii.

[0157] In some embodiments, the analyte is a nucleic acid molecule. In some embodiments, the analyte is an amplified nucleic acid molecule. In some embodiments, the analyte is a nucleic acid molecule that is amplified by an amplification method (e.g., PCR or RT-PCR) and then detected according to the methods described herein. In some embodiments, the analyte is an amplification product. In some embodiments, the analyte is a PCR product. In some embodiments, the analyte is an amplicon. In some embodiments, the amplicon is generated by PCR. In some embodiments, the amplicon is generated by RT-PCR. In some embodiments, the amplicon is generated by linear amplification. In some embodiments, the amplicon is a single-stranded or double-stranded nucleic acid molecule. In some embodiments, the amplicon is detected directly. In some embodiments, the amplicon is detected indirectly.

[0158] In some embodiments, detection of an analyte in a test sample is used to detect an organism containing a nucleic acid molecule having the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment or variant thereof. In some embodiments, the organism is Alicyclobacillus. For example, if one skilled in the art were to determine whether a juice product sample is contaminated with guaiacol-producing Alicyclobacillus, a nucleic acid sequence specific to the guaiacol-producing Alicyclobacillus species could be amplified (e.g., by PCR) and then detected according to the methods described herein, where detection of the amplification product (i.e., amplicon) indicates that the juice product sample contains a nucleic acid sequence specific to the guaiacol-producing Alicyclobacillus species. This example is not limiting and can be applied to detecting other nucleic acid sequences or other types of analytes present in a sample. The analyte may be contained in the initial sample or may be an analyte derived from the initial sample, for example, by using PCR.

[0159] In some embodiments, the amplicon is detected by all or part of the hybridization methods described herein. In some embodiments, a detectable label is covalently attached to the amplicon and the detectable label is detected. In some embodiments, the detectable label is not covalently attached to the amplicon and the detectable label is detected. In some embodiments, the detectable label is a dye. In some embodiments, the amplicon is indirectly detected using a dye in the reaction mixture.

[0160] In some embodiments, the amplicons are detected after the amplification reaction. In some embodiments, one or more amplicons are detected in real time, for example, using real-time PCR. In some embodiments, the amplicons are detected during the amplification reaction, and in other embodiments, one or more amplicons are detected after the amplification reaction. In some embodiments, the amplicons are detected using a DNA gel. In some embodiments, the amplicons are detected using a lateral flow or vertical flow detection device. In some embodiments, two or more amplicons are detected using a single signal. In some embodiments, the amplification is detected in real time using a dye. In some embodiments, the dye is SYBR Green or EvaGreen. In some embodiments, the amplification is detected in real time using one or more oligonucleotide probes. In some embodiments, the one or more oligonucleotide probes include a quencher probe and a fluorescent probe. In some embodiments, a fluorescent signal is generated when the oligonucleotide probe interacts with the amplicon. In some embodiments, the oligonucleotide probe is a molecular beacon. In some embodiments, the oligonucleotide probe is a TaqMan® probe.

[0161] In some embodiments, two or more amplicons can be generated and detected from the same sample. In some embodiments, three amplicons can be generated and detected from the same sample. In some embodiments, amplification is detected using a multiplex assay. In some embodiments, the multiplex detection method targets all Alicyclobacillus. In some embodiments, the multiplex detection method targets Alicyclobacillus acidoterrestris, Alicyclobacillus hervarius, or Alicyclobacillus dausii. In some embodiments, the multiplex detection assay has an internal amplification control (IAC).

[0162] In some embodiments, a second or subsequent analyte is further detected. In some embodiments, the second or subsequent analyte comprises a marker for an Alicyclobacillus species. In some embodiments, the marker is an amplicon. In some embodiments, the marker is unlabeled. In some embodiments, the marker is labeled. In some embodiments, the second or subsequent analyte comprises a marker for an Alicyclobacillus species. In some embodiments, the second or subsequent analyte comprises a marker for Alicyclobacillus acidoterrestris, Alicyclobacillus hervarius, or Alicyclobacillus dausii.

[0163] Buffers may also be included in the present invention. Without wishing to be bound by theory, an example of a buffer includes, but is not limited to, a PCR buffer. PCR buffers are suitable for nucleotide amplification and are known in the art. Without wishing to be bound by theory, an example of a buffer includes, but is not limited to, a lysis buffer. Examples of lysis buffers include 2% Tween (v / v) and 0.1% Triton (v / v); 2% Tween (v / v) and 0.1% SDS (w / v); 2% Tween (v / v) and 0.1% BSA (w / v); 2% Tween (v / v) and 1% BSA (w / v), 0.1% SDS (w / v), 1% BSA (w / v), or combinations thereof. Examples of lysis buffers include, for example, 5% Tween / PBS; 2% Tween / PBS + 0.1% SDS; 2% Tween / PBS + 1% BSA. Other examples of lysis buffers include, but are not limited to, 5% Tween-80 (v / v); 5% Triton X-100 (v / v); 5% NP40 (v / v); 2% Tween-80 (v / v); 2% Triton X-100 (v / v); 2% NP40 (v / v); 1% Tween-80 (v / v); 1% Triton X-100 (v / v); and 1% NP40 (v / v). The detergent and other components of the buffer can be made up of any suitable buffer appropriate for the protein, including, but not limited to, water and phosphate-buffered saline. The lysis buffer can be used to prepare samples prior to detection of sequences, analytes, amplicons, or organisms, as described herein. In some embodiments, no lysis buffer is used.

[0164] In some embodiments, a method for detecting an organism containing a target nucleic acid molecule substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, in a test sample includes reacting the test sample with a first primer and a second primer. In some embodiments, the first primer and the second primer comprise a sequence substantially homologous to the sequence of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, or a complement thereof. Primer pairs can include primers of SEQ ID NO:4 and SEQ ID NO:5, primers of SEQ ID NO:6 and SEQ ID NO:7, and primers of SEQ ID NO:8 and SEQ ID NO:5.

[0165] In some embodiments, the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds, or to the complementary strand. In some embodiments, the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:9, SEQ ID NO:10, or SEQ ID NO:11, or a complement thereof. In some embodiments, the probe is labeled with a detectable label.

[0166] In some embodiments, the methods include reacting a mixture described herein with a test sample. In some embodiments, the methods include generating and detecting a detectable amplicon, wherein the detectable amplicon comprises a sequence substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof. In some embodiments, the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0167] In some embodiments, the method comprises detecting detectable amplicons using one or more techniques independently selected from the group consisting of: direct detection of a measurement of a physical property of the amplicon, e.g., a measurement of UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; complexing the amplicon with a detectable label and detecting the presence of the label; detecting a detectable signal from a labeled probe or primer, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; or detecting a detectable signal from two or more labeled probes or primers, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample.

[0168] In some embodiments, the methods comprise detecting a detectable label described herein, wherein the detectable label is covalently attached to a probe; the probe is covalently attached to a quencher molecule that quenches the detectable label; the detectable label is bound to a quencher; and the binding between the detectable label and the quencher results in quenching of the detectable label.

[0169] In some embodiments, the method comprises contacting the reaction mixture with a lateral flow or vertical flow detection device to detect the amplicons.

[0170] In some embodiments, the methods include detecting a target nucleic acid molecule comprising a sequence substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, and / or SEQ ID NO:3, or a fragment thereof, or a complement thereof, which detection indicates a positive spoilage probability. In some embodiments, a positive spoilage probability indicates the presence of a contaminating Alicyclobacillus strain comprising a nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, and / or SEQ ID NO:3, or a fragment thereof, or a complement thereof.

[0171] In some embodiments, methods are provided for detecting a contaminant in a test sample that comprises a target nucleic acid molecule that is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, or a variant thereof. In some embodiments, the method comprises detecting a target nucleic acid as described herein.

[0172] In some embodiments, a method for detecting a contaminant in a test sample comprising a nucleic acid molecule having the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, or a variant thereof, comprises generating and detecting a detectable amplicon, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0173] In some embodiments, the method for detecting a contaminant comprises generating and detecting a detectable amplicon, wherein detecting the detectable amplicon comprises one or more techniques from the group of techniques consisting of: direct detection of a measurement of a physical property of the amplicon, for example, a measurement of UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; or detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample.

[0174] In some embodiments, methods are provided for determining potential spoilage in a test sample that contains a target nucleic acid molecule having a sequence that is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof. In some embodiments, the methods for determining potential spoilage in a test sample include detecting one or more of the target nucleic acid sequences described herein.

[0175] In some embodiments, a positive spoilage potential indicates the presence of a contaminating Alicyclobacillus strain that produces guaiacol.

[0176] In one embodiment, a sample is assayed for both Alicyclobacillus species and guaiacol production. In one embodiment, the sample is assayed for the presence of at least (1) a gene present in all strains of Alicyclobacillus and (2) the presence of a vanillic acid decarboxylase (vdcC) gene present in guaiacol-producing species (e.g., a vdcC gene comprising SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3), where detecting the presence of both gene targets indicates a positive result for the presence of a contaminating bacterial strain of Alicyclobacillus that may be causing spoilage of the sample. In another embodiment, one, two, or three variant regions of the vdcC gene are detected in the assay.

[0177] In one embodiment, a method is performed that includes assaying (e.g., by amplification and detection) a sample for the presence of at least (1) a gene present in all strains of Alicyclobacillus and (2) the presence of a vanillic acid decarboxylase (vdcC) gene present in guaiacol-producing species, where detection of the presence of both gene targets indicates a positive result for the presence of a contaminating bacterial strain of Alicyclobacillus that may be causing spoilage of the sample. In one embodiment, a method is performed in which an amplification reaction is performed using a primer set for one or more (e.g., one, two, three or more) vdcC gene variants, and the amplification products are detected, e.g., using a probe for each target. In one embodiment, a method is performed in which an amplification reaction is performed using a primer set for the Alicyclobacillus 16s ribosomal RNA gene and a primer set for one or more (e.g., one, two, three or more) vdcC gene variants, and the amplification products are detected, e.g., using a probe for each target.

[0178] kit In some embodiments, kits for use with the methods described herein are provided. The kits may include a detection device, a sample collection device, a buffer container, instructions, a positive control, a negative control, or any combination thereof. With respect to kits, a positive control is a sample known to contain an analyte detectable by the device present in the kit. In contrast, a negative control does not contain an analyte detectable by the kit.

[0179] In one embodiment, the kit may include DNA oligonucleotide primers and probes for use in the PCR assays described herein for detecting spoilage bacteria in beverages. In a particular embodiment, the kit may include reagents targeting one or more (e.g., one, two, three, or more) vdcC gene variant regions involved in guaiacol production. In a particular embodiment, the kit may include reagents for two or more PCR reactions: (1) targeting the Alicyclobacillus 16s ribosomal RNA gene to detect all Alicyclobacillus species; and (2) targeting one or more (e.g., one, two, three, or more) vdcC gene variant regions involved in guaiacol production. In one embodiment, the kit includes reagents for amplifying and detecting one, two, or three variants of vdcC to detect Alicyclobacillus across species that produce guaiacol and cause beverage / juice spoilage. In one particular embodiment, the kit can include reagents for performing a multiplex PCR reaction targeting one or more vdcC gene variants involved in guaiacol production. In one particular embodiment, the kit includes reagents for performing a multiplex PCR reaction targeting (1) the Alicyclobacillus 16s ribosomal RNA gene to detect all Alicyclobacillus species, and (2) one or more vdcC gene variants involved in guaiacol production, thereby detecting multiple strains of Alicyclobacillus across species that produce guaiacol and cause beverage / juice spoilage. The kit can include primers for one or more (e.g., one, two, three or more) vdcC gene variants in a single reaction vessel. The kit can include primers and probes for both the 16s ribosomal RNA gene and one or more (e.g., one, two, three or more) vdcC gene variants in a single reaction vessel. [Example]

[0180] Example Various aspects of the present disclosure will now be described with reference to the following non-limiting examples.

[0181] Example 1: Detection of Alicyclobacillus species and identification of guaiacol production using GENE-UP® PRO ACB, IFU Method No. 12, and the Cosmo Bioassay GENE-UP (registered trademark) PRO ACB method YSG broth (99 mL) was added to a 7 oz. concentrate bag with a mesh divider. All samples except the negative control contained a total of approximately 10 5 An inoculum of CFU (in 1 ml) of target organism was added. The sample bag was incubated at 45°C for 24 hours, after which 50 ml of concentrated sample was transferred to a 50 ml falcon tube and centrifuged at 500 rcf for 10 minutes. The supernatant (25 ml) was transferred to a new 50 ml falcon tube and centrifuged at 4,000 rcf for 10 minutes. The supernatant was decanted, leaving the pellet. The samples were then analyzed by the GENE-UP® ACB PRO PCR System (including the novel vdcC target detection feature, as described herein) in the following steps:

[0182] The ACB buffer (500 μL) from the PCR kit was added to the pellet and vortexed. Lysis was performed by transferring 20 μL of this pellet / buffer mixture to a lysis tube (Biomerieux, Marcy-l'Etoile, France). The lysis tube was vortexed at 2,500 rpm for 5 minutes in an OHAUS digital mixer. 5 μL of the lysate was then transferred to the ACB master mix tube. These tubes were then transferred to the GENE-UP® loading platform, and the ACB protocol was performed. The output from the GENE-UP® software is binary (presence / absence), but additional quantitative data is provided to the user. The Cy5 channel results were used to determine the presence / absence of guaiacol-producing bacteria. Each culture was plated as follows, following the IFU protocol for measuring guaiacol production using the Cosmobio Guaiacol Detection Kit:

[0183] Cosmo Bioassay: Guaiacol production was measured using the Cosmobio Guaiacol Detection Kit according to the manufacturer's instructions (Cosmobio Co., Ltd., Tokyo, Japan). Briefly, a loopful of plated colonies was added to each YSG-vanillin tube and incubated at 45°C for 3 hours. The three reagents included in the kit were added to each tube, and a color change was assessed compared with the negative control. The Alicyclobacillus cultures used were grown on BAT plates from the IFU confirmation plate. If a sample did not grow on the confirmation plate, a culture grown on a YSG plate was used.

[0184] TIFF2026502884000002.tif190170

[0185] Example 2: Primer pairs were designed to amplify SEQ ID NO:1 from Alicyclobacillus acidoterrestris, SEQ ID NO:2 from Alicyclobacillus hervarius, and SEQ ID NO:3 from Alicyclobacillus dausii. The primer pair for SEQ ID NO:1 from Alicyclobacillus acidoterrestris consisted of a first primer with the sequence of SEQ ID NO:4 and a second primer with the sequence of SEQ ID NO:5. The primer pair for SEQ ID NO:2 from Alicyclobacillus hervarius consisted of a first primer with the sequence of SEQ ID NO:6 and a second primer with the sequence of SEQ ID NO:7. The primer pair for SEQ ID NO:3 from Alicyclobacillus dausii consisted of a first primer with the sequence of SEQ ID NO:8 and a second primer with the sequence of SEQ ID NO:5.

[0186] Probes were designed to detect SEQ ID NO: 1 from Alicyclobacillus acidoterrestris, SEQ ID NO: 2 from Alicyclobacillus hervarius, and SEQ ID NO: 3 from Alicyclobacillus dausii. The probe for SEQ ID NO: 1 from Alicyclobacillus acidoterrestris contained a nucleic acid molecule having the sequence of SEQ ID NO: 9. The probe for SEQ ID NO: 2 from Alicyclobacillus hervarius contained a nucleic acid molecule having the sequence of SEQ ID NO: 10. The probe for SEQ ID NO: 3 from Alicyclobacillus dausii contained a nucleic acid molecule having the sequence of SEQ ID NO: 11.

[0187] Sample preparation methods vary depending on the type of sample.

[0188] The sample may be an Alicyclobacillus colony or an Alicyclobacillus culture. The sample may be a food, a food suspension, a food solution, or a beverage. The sample may be fresh fruit, cooked fruit, canned fruit, fruit juice, a fruit juice product, a blended fruit juice, a carbonated fruit drink, a fruit-flavored tea, a wine, or a fruit-flavored water. The sample may be a concentrated sample.

[0189] Illustratively, the sample is transferred to a container, such as a tube or a 96-well plate, for dissolution, and then a dissolution buffer is added to the sample, and the sample is mixed in the buffer by pipetting. The sample can be further mixed in a vortex mixer at 2500 rpm for 5 minutes. The dissolved sample is then precipitated. The supernatant containing the target DNA is in solution at the top of the tube or well. The target nucleic acid molecule can then be amplified, for example, by PCR. The target DNA is then transferred to a container containing PCR reagents. After addition of the sample, a single tube or well may contain, for example, 10 ng of template DNA (200 pg / μL); 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 4; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 5; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO: 9; and PCR buffer. Alternatively, for detection of multiple analytes, a tube or well may contain, for example, 10 ng of template DNA (200 pg / μL); 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 4; 0.2 to 1.0 μM of a primer having the sequence of SEQ ID NO: 5; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 6; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 7; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 8; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO: 9; 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO: 10; 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO: 11; and PCR buffer. Alternatively, for multiplex reactions, the tubes may contain additional primers and probes designed for another bacterial genus, such as E. coli. Helper oligonucleotides or a second probe may also be added. Alternatively, a dye, such as SYBR Green, may be used instead of the probe.

[0190] DNA amplification is accomplished using PCR. Multiplex protocols may be used. An exemplary protocol is 94°C x 1 min, 58.1°C x 2 min, and 72°C x 3 min, repeated 35-40 times, followed by a 4°C hold. Once the run is complete, the results are analyzed. Color compensation is applied to eliminate signal crosstalk. Ct / Cp values ​​are calculated using methods known in the art. Amplification curves have a characteristic shape, with an initial induction phase, an exponential amplification phase, and a final plateau phase. The final plateau phase represents a decrease in reaction efficiency as reagents are consumed and may not be reached in reactions containing low concentrations of target organisms. Amplification curves that deviate from the characteristic shape should be interpreted with caution. For each amplification reaction, the cycle at which the fluorescent signal exceeds background fluorescence is determined and is called the "threshold cycle" (Ct) or "crossing point" (Cp), depending on the instrument. Ct / Cp will occur in early cycles in samples containing high levels of target organisms and will be delayed in reactions containing low levels of target organisms. Real-time PCR may be used to detect a single amplicon; for example, an amplicon having the sequence of SEQ ID NO: 1 may be detected in the FAM channel. Multiple amplicons can be detected in different channels in a multiplexed manner. For example, an amplicon having the sequence of SEQ ID NO: 1 may be detected in the FAM channel, an amplicon having the sequence of SEQ ID NO: 2 may be detected in the ROX channel, and an amplicon having the sequence of SEQ ID NO: 3 may be detected in the Cy5 channel. The HEX channel may serve as an internal amplification control (IAC) indicating a successful PCR reaction and should be detected at a Ct / Cp value between approximately 26–30 cycles.

[0191] The presence of an amplification curve indicates the presence of an amplicon in the sample. The presence of an amplicon with the sequence of SEQ ID NO: 1 indicates a sample positive for Alicyclobacillus acidoterrestris. The presence of an amplicon with the sequence of SEQ ID NO: 2 indicates a sample positive for Alicyclobacillus hervarius. The presence of an amplicon with the sequence of SEQ ID NO: 3 indicates a sample positive for Alicyclobacillus dausii. However, it is important to note that regardless of the Alicyclobacillus species present in the sample, the presence of an amplicon with the sequence of SEQ ID NO: 1, 2, or 3 indicates the presence of an organism capable of causing spoilage by producing guaiacol. A high Ct / Cp value (e.g., ≥ 38) may indicate a false positive. Negative and positive controls can be used to confirm the functionality of the assay. Samples can also be rerun with a higher concentration of template DNA. Presumptive positive samples can be confirmed by microbiological plating and colony PCR.

[0192] result A fruit juice sample was concentrated, the concentrated sample was lysed, and a portion of the lysate was added to a PCR tube. PCR reagents were added, and multiplex PCR was performed using the following primers: Forward: GAGACGGACTACATGGTCGG (SEQ ID NO: 4), Reverse: GCAAAGCCGCCGTACCG (SEQ ID NO: 5), Forward: GAGACTGACTACATGGTGGG (SEQ ID NO: 8), Forward: GAGGTCGACTACATGATTGG (SEQ ID NO: 6), and Reverse: GCAAAGCCCCCATAACG (SEQ ID NO: 7).

[0193] The amplification products were detected using the following fluorescently labeled probes: Probe 1: ATGCGTATACATCGCGTTCACCGCGACGATT (SEQ ID NO: 9), Probe 2: GTGCGTGTACATTGCATTCACAGCCACGATC (SEQ ID NO: 10), and Probe 3: ATGCGTGTACATGGCATTGACGGCCACGATT (SEQ ID NO: 11).

[0194] Example 3: Gene targets predictive of spoilage and detection methods using a vertical flow detection device. Several detection methods can be used to detect the predicted region (SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3), or a fragment thereof.

[0195] Sample preparation methods vary depending on the type of sample.

[0196] The sample may be an Alicyclobacillus colony or an Alicyclobacillus culture. The sample may be a food, food suspension, food solution, or beverage. The sample may be fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drink, fruit-flavored tea, wine, or fruit-flavored water. The sample is transferred to a container, such as a tube or a 96-well plate, for lysis. A lysis buffer is then added to the sample, and the sample is mixed into the buffer by pipetting. The sample may be further mixed in a vortex mixer at 2500 rpm for 5 minutes. The lysed sample is then precipitated. The supernatant containing the target DNA is in solution at the top of the tube or well. The target nucleic acid molecule may then be amplified, for example, by PCR. The target DNA is then transferred to a container containing PCR reagents. After addition of the sample, a single tube or well may contain, for example, 10 ng of template DNA (200 pg / μL); 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 4; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO: 5; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO: 9; and PCR buffer. Alternatively, for detection of multiple analytes, the tube or well may contain, for example, 10 ng of template DNA (200 pg / μL); 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO:4; 0.2 to 1.0 μM of a primer having the sequence of SEQ ID NO:5; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO:6; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO:7; 0.1 to 0.5 μM of a primer having the sequence of SEQ ID NO:8; 200 μM each of deoxynucleoside triphosphate nucleotides (dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / μL Taq); 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO:9; 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO:10; 0.1 to 0.5 μM of a probe having the sequence of SEQ ID NO:11; and PCR buffer.Helper oligonucleotides or second probes may also be added.

[0197] In this example, DNA amplification is accomplished using PCR. Multiplex protocols may be used. An exemplary protocol is 35-40 cycles of 94°C x 1 minute, 58.1°C x 2 minutes, and 72°C x 3 minutes, followed by a 4°C hold.

[0198] The target can be detected, for example, with a vertical flow detector. The sample (e.g., 200 μL) is transferred directly to the window of the vertical flow detector using a pipette. A separate vertical flow detector is used for each PCR tube sample. The vertical flow detector is allowed to develop for 2 minutes ± 15 seconds.

[0199] system In some embodiments, systems are provided for use with the methods described herein. The systems may include kits or mixtures as described above, along with equipment for performing the assays. In at least one embodiment, the system shown in FIG. 2 may include at least one PCR reaction mixture contained in a sample vessel 714. In certain embodiments, the sample vessel 714 may include a PCR reaction mixture configured to permit and / or amplify a template nucleic acid. Certain exemplary embodiments may also include at least one sample block or chamber 716 configured to receive the at least one sample vessel 714. The sample vessel 714 may include any plurality of sample vessels in individual, strip, plate, or other formats, illustratively provided as or received by the sample block or chamber 716.

[0200] One or more embodiments may also include at least one sample temperature controller 718 and / or 720 configured to manipulate and / or adjust the temperature of the sample. Such a sample temperature controller may be configured to raise, lower, and / or maintain the temperature of the sample. In one example, the sample controller 718 is a heating system and the sample controller 720 is a cooling system. Exemplary sample temperature controllers include, but are not limited to, heating and / or cooling blocks, heating elements, exchangers, coils, radiators, refrigerators, filaments, Peltier elements, forced air blowers, handlers, vents, distributors, compressors, condensers, water baths, ice baths, flames and / or other forms of combustion or combustible heat, hot packs, cold packs, dry ice, dry ice baths, liquid nitrogen, microwaves and / or other wave-emitting devices, cooling means, heating means, means for otherwise manipulating the temperature of the sample, and / or other suitable devices configured to raise, lower, and / or maintain the temperature of the sample.

[0201] The exemplary PCR system 700 also includes an optical system 710 configured to detect the amount of fluorescence emitted by the sample 714 (or portions or reagents thereof). Such an optical system 710 may include one or more fluorescence channels, as known in the art, and may detect fluorescence from multiple samples simultaneously or individually.

[0202] At least one embodiment of the PCR system may further include a CPU 706 programmed or configured to operate, control, execute, or otherwise proceed with the heating system 718 and the cooling system 720, for example, to thermocycle the PCR reaction mixture while the optical system 710 collects the fluorescent signal. The CPU 706 may then generate an amplification curve, a melt curve, or any combination, which may or may not be printed, displayed or displayed on the screen of the user terminal 704, or output in any other manner. Optionally, based on the amplification curve and / or the melt curve, a positive, negative, or other call may be output, for example, on the screen of the user terminal 704. Optionally, only a call is output, for example, one call for each target tested.

[0203] The CPU 706 can include a program memory, a microcontroller or microprocessor (MP), random access memory (RAM), and input / output (I / O) circuitry, all interconnected via an address / data bus. The program memory can include an operating system such as Microsoft Windows®, OS X®, Linux®, or Unix®. In some embodiments, the CPU 706 can include or be otherwise communicatively connected to a database or other data storage mechanism (e.g., one or more hard disk drives, optical storage drives, solid-state storage devices, etc.). The database can include data such as melting curves, annealing temperatures, denaturation temperatures, and other data necessary for generating and analyzing melting curves. The CPU 706 can include multiple microprocessors, multiple RAMs, multiple program memories, and multiple different types of I / O circuitry. The CPU 706 can implement the RAM and program memory as, for example, semiconductor memory, magnetically readable memory, and / or optically readable memory.

[0204] The microprocessor may be adapted and configured to execute, in addition to other software applications, any one or more of a plurality of software applications and / or any one or more of a plurality of software routines present in the program memory. One of the plurality of routines may include a thermocycling routine, which may include providing control signals to a heating system 718 and a cooling system 720 to heat and cool, respectively, the sample 714 according to a two-stage PCR protocol. Another of the plurality of routines may include a fluorescence routine, which may include providing control signals to an optical system 710 to emit a fluorescent signal and detect the amount of fluorescence scattered by the sample 714. Yet another of the plurality of routines may include a sample calling routine, which may include acquiring fluorescence data (temperature, fluorescence pair) from the optical system 710 during an intra-cycle temperature adjustment segment for each of the N cycles, generating a composite melting curve by combining the fluorescence data from each of the N cycles during the respective intra-cycle temperature adjustment segment, analyzing the composite melting curve to make a positive or negative call, and displaying an indication of the composite melting curve, individual melting curves, and / or the call on the user terminal 704.

[0205] In some embodiments, the CPU 706 can communicate with the user terminal 704, heating system 718, cooling system 720, optical system 710, and sample block 716 via communications network 722-732 via wired or wireless signals, and in some cases via intervening wireless or wired devices, which may be wireless routers, wireless repeaters, cell phone provider base stations, etc. The communications network can be a wireless communications network, such as a fourth- or third-generation cellular network (4G or 3G, respectively), a Wi-Fi network (802.11 standard), a WiMAX network, a wide area network (WAN), a local area network (LAN), or the Internet. Additionally, the communications network can be a dedicated network, a secure public Internet, a virtual private network, and / or other types of networks, such as dedicated access lines, regular telephone lines, satellite links, or combinations thereof. When the communications network comprises the Internet, data communications may occur over the communications network via Internet communications protocols. Additionally, the communications network can be a wired network, with data communications occurring via Ethernet or universal serial bus (USB) connections.

[0206] In some embodiments, CPU 706 may be included within user terminal 704. In other embodiments, CPU 706 may communicate with user terminal 704 via a wired or wireless connection (e.g., as a remote server) and display individual melt curves, composite melt curves, calls, etc. on user terminal 704. In addition to CPU 706 or another CPU similar to CPU 706, user terminal 704 may include a user interface, a communications unit, and user input devices such as a "soft" keyboard displayed on the user interface of user terminal 704, an external hardware keyboard (e.g., a Bluetooth keyboard) communicating via a wired or wireless connection, an external mouse, or other suitable user input device.

[0207] Although the present disclosure has been described in considerable detail with reference to certain preferred embodiments, other versions are possible. Therefore, the spirit and scope of the appended claims should not be limited to the description and preferred versions contained herein. Next, embodiments will be described with reference to the following examples. These examples are provided for illustrative purposes only, and the embodiments should not be construed as being limited to these examples in any way, but rather as encompassing any variations that become apparent as a result of the teachings provided herein. Those skilled in the art will readily recognize a variety of non-critical parameters that can be changed or modified to yield essentially similar results.

Claims

1. a first primer that specifically binds to a target nucleic acid molecule comprising the sequence of any one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof; a second primer that specifically binds to the complement of the target nucleic acid molecule; deoxynucleotide triphosphate nucleotides; DNA polymerase; a buffer; and a test sample suspected of having a nucleic acid that is substantially homologous to the target nucleic acid molecule; A mixture comprising:

2. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:4; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; The mixture of claim 1.

3. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:6; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; The mixture of claim 1.

4. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:8; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; The mixture of claim 1.

5. 5. The mixture of claim 1, further comprising a probe, the probe comprising a sequence that is substantially homologous to a target nucleic acid molecule, or a fragment thereof, or a complement thereof.

6. 6. The mixture of claim 5, further comprising a detectable label, wherein the probe is covalently bound to the detectable label.

7. 6. The mixture of claim 5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 9 or its complement, and the sequence of the target nucleic acid molecule comprises SEQ ID NO: 1, its complement, or a fragment thereof.

8. 6. The mixture of claim 5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 10 or its complement, and the sequence of the target nucleic acid molecule comprises SEQ ID NO: 2, its complement, or a fragment thereof.

9. 6. The mixture of claim 5, wherein the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO: 11 or its complement, and the sequence of the target nucleic acid molecule comprises SEQ ID NO: 3, its complement, or a fragment thereof.

10. 10. The mixture of claim 1, wherein the test sample comprises a food, a food suspension, a food solution, or a beverage.

11. 11. The mixture of claim 10, wherein the test sample comprises one or more of the following list: fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice products, blended fruit juice, carbonated fruit drinks, fruit-flavored tea, wine, and fruit-flavored water.

12. 1. A method for detecting an organism comprising a target nucleic acid molecule, wherein the target nucleic acid molecule comprises a sequence substantially homologous to one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, in a test sample, the method comprising: The test sample reacting with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; reacting with a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; Detecting the presence or absence of a detectable amplicon A method comprising:

13. 13. The method of claim 12, further comprising reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds.

14. the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:4, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5; the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:6, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:7; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8, and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; 14. The method according to claim 12 or 13.

15. the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:4, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:9; the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:6, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:7, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:10; or The first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:8, the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5, and the probe comprises a sequence substantially homologous to the sequence of SEQ ID NO:

11. The method of claim 13.

16. 13. The method of claim 12, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

17. 1. A method for detecting a saccharifying strain of Alicyclobacillus acidoterrestris, comprising: The test sample a first primer comprising a sequence that specifically binds to a target nucleic acid comprising the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; reacting; Detecting the presence or absence of an amplicon A method comprising:

18. 18. The method of claim 17, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 4 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

19. 19. The method of claim 17 or 18, further comprising reacting the sample with a probe that specifically binds to a target nucleic acid molecule or its complement.

20. 20. The method of claim 19, wherein the probe is labeled with a detectable label.

21. 20. The method of claim 19, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 9 or its complement.

22. 1. A method for detecting a glycosylating strain of Alicyclobacillus herbarius, comprising: The test sample a first primer comprising a sequence that specifically binds to a target nucleic acid comprising the sequence of SEQ ID NO:2, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO:2, or a fragment thereof, or a complement thereof; reacting; Detecting the presence or absence of an amplicon A method comprising:

23. 23. The method of claim 22, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 6 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 7 or its complement.

24. 24. The method of claim 22 or 23, further comprising reacting the test sample with a probe that specifically binds to a target nucleic acid molecule or its complement.

25. 25. The method of claim 24, wherein the probe is labeled with a detectable label.

26. 25. The method of claim 24, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 10 or its complement.

27. 1. A method for detecting a glycosylating strain of Alicyclobacillus dauci, comprising: The test sample a first primer comprising a sequence that specifically binds to a target nucleic acid comprising the sequence of SEQ ID NO: 3, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the sequence of SEQ ID NO:3, or a fragment thereof, or a complement thereof; reacting; Detecting the presence or absence of an amplicon A method comprising:

28. 28. The method of claim 27, wherein the first primer is substantially homologous to the sequence of SEQ ID NO: 8 or its complement, and the second primer is substantially homologous to the sequence of SEQ ID NO: 5 or its complement.

29. 29. The method of claim 27 or 28, further comprising reacting the sample with a probe that specifically binds to a target nucleic acid molecule or its complement.

30. 30. The method of claim 29, wherein the probe is labeled with a detectable label.

31. 30. The method of claim 29, wherein the probe is substantially homologous to the sequence of SEQ ID NO: 11 or its complement.

32. 1. A method for detecting a contaminant in a test sample comprising a target nucleic acid molecule having a sequence substantially homologous to the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, or a variant thereof, comprising: The test sample reacting with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; reacting with a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; Detecting the presence or absence of an amplicon wherein the presence of the detectable amplicon indicates the presence of a contaminant in the test sample.

33. 33. The method of claim 32, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

34. The method for detecting the detectable amplicon comprises: Direct detection of a measurement of a physical property of the amplicon, detecting UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample.

33. The method of claim 32, comprising one or more of the group consisting of:

35. 1. A method for detecting possible spoilage in a test sample, comprising: Providing a test sample, including a food, food suspension, food solution, or beverage. wherein the method comprises: The test sample reacting a first primer comprising a sequence that specifically binds to a target nucleic acid molecule, wherein the target nucleic acid molecule comprises the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; reacting with a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; Detecting the presence or absence of a detectable amplicon wherein the presence of the detectable amplicon indicates a positive spoilage potential of the test sample.

36. 36. The method of claim 35, wherein the test sample comprises fresh fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drink, fruit-flavored tea, wine, or fruit-flavored water.

37. 36. The method of claim 35, wherein the detectable amplicon is generated by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

38. The method for detecting the detectable amplicon comprises: direct detection of a measurement of a physical property of the amplicon, detecting UV absorbance at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye and detecting the dye; conjugating the amplicon to a detectable label and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the copy number of the amplicon in the sample.

36. The method of claim 35, comprising one or more of the group consisting of:

39. 1. A method for detecting at least one contaminant in a test sample, wherein each contaminant comprises one of three target nucleic acid molecules, each of the three target nucleic acid molecules having a sequence substantially homologous to one of the sequences of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, or a fragment thereof, or a complement thereof, or a variant thereof, the method comprising: The test sample the first primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 4; the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:5; the third primer comprises a sequence substantially homologous to the sequence of SEQ ID NO:6; the fourth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; the fifth primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 8; reacting the first primer, the second primer, the third primer, the fourth primer, and the fifth primer under conditions sufficient to produce three detectable amplicons comprising the three target nucleic acid molecules, or fragments thereof, or complements thereof; Detecting the presence or absence of each of the three amplicons wherein the presence of any one of the three amplicons indicates the presence of a contaminant in the test sample.

40. The test sample a first probe comprising a sequence substantially homologous to the sequence of SEQ ID NO:9; a second probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 10; and a third probe comprising a sequence substantially homologous to the sequence of SEQ ID NO: 11; 40. The method of claim 39, further comprising reacting

41. A mixture according to any one of claims 1 to 4; and an instrument configured to perform an amplification assay on the mixture Including, the system.

42. 42. The system of claim 41, further comprising at least one sample vessel.

43. 43. The system of claim 42, further comprising at least one PCR reaction mixture, each of said PCR reaction mixtures contained in one of said at least one sample vessel.

44. 42. The system of claim 41, further comprising at least one sample temperature control device.

45. 42. The system of claim 41, wherein the mixture further comprises a probe comprising a sequence that is substantially homologous to the target nucleic acid molecule, or a fragment thereof, or a complement thereof.

46. a first primer comprising a sequence substantially homologous to a target nucleic acid molecule comprising the sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3; a second primer comprising a sequence substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous; deoxynucleotide triphosphate nucleotides; and buffer, Includes a kit.

47. 47. The kit of claim 46, further comprising a DNA polymerase.

48. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:4; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; 47. The kit of claim 46.

49. 49. The kit of claim 48, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:

9.

50. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:6; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 7; 47. The kit of claim 46.

51. 51. The kit of claim 50, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:

10.

52. The first primer comprises a sequence that is substantially homologous to the sequence of SEQ ID NO:8; and the second primer comprises a sequence substantially homologous to the sequence of SEQ ID NO: 5; 47. The kit of claim 46.

53. 53. The kit of claim 52, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to the sequence of SEQ ID NO:

11.

54. 54. The kit of any one of claims 49, 51, or 53, wherein the probe is covalently linked to a detectable label.

55. 55. The kit of claim 54, wherein the probe also comprises a quencher configured to quench a signal from the detectable label.