Isolated nucleases and their use
RNA-mediated endonucleases with compact structure and diverse TAM recognition address CRISPR/Cas9 limitations, enhancing gene editing efficiency and flexibility for clinical applications.
Patent Information
- Application Number
- JP2025556683
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-29
- Filing Date
- 2024-03-22
- Publication Date
- 2026-04-10
AI Technical Summary
CRISPR/Cas9 technology faces limitations such as large protein size, which hinders adenovirus-mediated gene delivery, and high protein ratios in lentivirus, as well as off-target effects due to a simple PAM sequence, restricting its clinical applications.
Development of RNA-mediated endonucleases, specifically IS200/IS605 family nucleases with a compact protein structure and diverse TAM recognition, offering higher editing efficiency and flexibility.
The new nucleases provide smaller molecular weight and improved gene editing efficiency, enabling diverse and specific gene editing tools for clinical applications.
Smart Images

Figure 2026511240000001_ABST
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to Chinese Patent Application No. 202310304837.4, filed on 27 March 2023, and PCT Application No. PCT / CN2023 / 135175, filed on 29 November 2023, the entire contents of which are incorporated herein by reference in their entirety for all purposes.
[0002] Technical field This application relates to the field of molecular biology, and more specifically to isolated nucleases and their use. More specifically to nucleases, guide RNAs and nucleic acid constructs encoding the nucleic acid constructs thereof, as well as compositions, recombinant vectors, recombinant host cells and kits comprising nucleases. More specifically to methods for introducing double-strand breaks into targeted genes in host cells, methods for deleting, replacing or inserting targeted genes in host cells, and methods for obtaining host cells into which targeted genes are deleted, replaced or inserted. More specifically to the use of nucleases, nucleic acid and nucleic acid constructs encoding nucleases, guide RNAs and their nucleic acid constructs, compositions, recombinant vectors or recombinant host cells for introducing double-strand breaks into targeted genes in host cells, or deleting, replacing or inserting targeted genes in host cells, and for preparing drugs or preparations for gene therapy, cell therapy, genomic research, and stem cell induction and post-induction differentiation. [Background technology]
[0003] With the rapid development of modern biotechnology and the advent of the post-genomic era, people are entering the stage of rewriting or redesigning genetic information from the stage of reading biological genetic DNA information. The discovery of CRISPR / Cas9 technology has brought about a revolutionary breakthrough in gene editing technology. CRISPR / Cas9 is an RNA-mediated targeted gene editing tool, which can specifically recognize and cleave different endogenous DNA sequences through reprogramming of sgRNA. Cas9 has two nuclease domains, RuvC and HNH, which are respectively involved in the cleavage of either strand of DNA. By mutating any of these sites, Cas9 can be converted into single-stranded Cas9 nickase. All important new technologies related to Cas9, such as base editing and prime editing, are designed based on Cas9 nickase.
[0004] However, some drawbacks of CRISPR / Cas9 limit its application: First, the CDS sequence of spCas9 has a length exceeding 4.1 Kb, which exceeds the maximum effective packaging capacity of adenovirus (AAV). Therefore, adenovirus-mediated gene delivery is difficult; although lentivirus has a stronger packaging capacity than AAV (with a loading upper limit of about 9 kb), the protein ratio in spCas9 is still too high, limiting the possibility of subsequent operations. These drawbacks severely limit the application of spCas9 in clinical medicine. Subsequently, CRISPR / Cas12 or 12f systems with smaller molecular weights emerged, but the editing efficiency of proteins such as Cas12 is not better than that of spCas9. Therefore, spCas9 is still widely accepted and currently in use. Second, the PAM sequence of spCas9, which is the NGG sequence, is relatively simple and has a higher incidence rate in the genome. Its advantage lies in the flexibility to reprogram sgRNA to complete the recognition and cleavage of various DNA sequences. However, this flexibility also brings about off-target effects of suboptimal genome editing results.
[0005] Therefore, gene editing technologies realized using RNA-mediated endonucleases, namely, insertion sequences IscB and TnpB from the IS200 / IS605 family, emerged later. They are widely distributed in microorganisms and have a more compact protein structure with a size of about 400 aa, which is less than 1 / 3 of spCas9. Therefore, they have greater potential for operations related to enzyme applications. TnpB cleaves DNA adjacent to the 5’TTGAT transposon-related motif (TAM) via reRNA (right element RNA derived from the RE element in the ISDra2 transposon) mediation, thereby disrupting and mutating DNA sequences in the genome. The DNA cleavage function of TnpB needs to satisfy two conditions simultaneously: (1) the TAM sequence; (2) the sequence located at the 3’ end of reRNA compatible with the target gene. Different nucleases can recognize different TAMs. Therefore, the discovery of higher-activity nuclease tools and the verification and detection of their functions can provide more, better, and more flexible options for the development of gene editing strategies.
[0006] It should be noted that the methods described in this section are not necessarily methods that have been previously considered or utilized. Unless otherwise clearly indicated, none of the methods described in this section should be assumed to be prior art solely because they are included in this section. Similarly, the problems described in this section should not be considered to be universally recognized in any prior art unless otherwise clearly indicated.
Summary of the Invention
Means for Solving the Problems
[0007] To solve the above problems, the present application aims to find an RNA-mediated endonuclease having a suitable protein molecular weight and a good gene editing effect, and to provide more diverse and specific tools for gene editing.
[0008] This application provides an isolated nuclease, and the nuclease has the following formula: (X1)(X2) a (X3)(X4)(X5) b (X6)(X7) c (X8)(X9) d (X 10 )(X 11 ) e (X 12 )(X 13 ) f (X 14 (X 15 ) g (X 16 ) (where a, b, c, d, e, f, and g are the number of amino acids; (X1), (X3), (X4), (X6), (X8), (X 10 ), (X 12 ), (X 14 ), and (X 16 ) are independently polar amino acids or aliphatic amino acids; (X2) is any amino acid, and a is 15 or 16; (X5) is any amino acid, and b is 2; (X7) is any amino acid, and c is 2, 3, or 4; (X9) is any amino acid, and d is 14, 15, 16, 17, or 18; (X 11 ) is any amino acid, and e is 1 or 2; (X 13 ) is any amino acid, and f is 6; and (X 15 ) is any amino acid, and g is 5) and contains an amino acid sequence as shown.
[0009] According to embodiments of the present application, an isolated nuclease can be provided, the nuclease having nuclease activity in at least one of the following variant sequences of the nuclease: (i) at least one amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197; (ii) at least one sequence obtained by performing deletion, substitution, insertion, or mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids on the amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197; (iii) at least one amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197; and (iv) at least one sequence obtained by further fusing the amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197 with another sequence.
[0010] According to embodiments of this application, a guide RNA can be provided, the guide RNA comprising a reRNA comprising a nucleotide sequence or a variant thereof as shown in any one of SEQ ID NOs. 198 to 394, and the guide RNA can bind to a specific nuclease.
[0011] According to embodiments of the present invention, nucleic acids can be provided, which encode the nuclease and / or guide RNA described in this application.
[0012] According to embodiments of this application, it is possible to provide a nucleic acid construct that includes the nucleic acid described in this application and further includes a promoter.
[0013] According to embodiments of the present application, a composition may be provided which comprises an IS200 / IS605 family nuclease or a functional fragment thereof, or a nucleic acid encoding an IS200 / IS605 family nuclease or a functional fragment thereof, wherein the nuclease or functional fragment thereof has endonuclease activity; and also comprises a guide RNA, or a nucleic acid encoding a guide RNA, wherein the guide RNA can bind to a specific nuclease.
[0014] According to embodiments of this application, a recombinant vector can be provided, which comprises a nucleic acid encoding a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, or a composition described in this application.
[0015] According to embodiments of this application, recombinant host cells can be provided, which comprise a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, or a recombinant vector described in this application.
[0016] Embodiments of this application can provide a method for introducing double-strand breaks into targeted genes in host cells, the method comprising delivering a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, or a recombinant vector described in this application to a host cell.
[0017] Embodiments of this application can provide a method for deleting, replacing, or inserting a target gene in a host cell, the method comprising delivering a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, or a recombinant vector described in this application to a host cell.
[0018] Embodiments of this application can provide a method for obtaining a host cell in which a targeted gene is deleted, replaced, or inserted, the method comprising delivering a nuclease, a guide RNA, a nucleic acid, a nucleic acid construct, a composition, or a recombinant vector to a host cell as described in this application.
[0019] According to embodiments of this application, it is possible to provide the use of a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, a recombinant vector described in this application, or a recombinant host cell described in this application for introducing double-strand breaks into a targeted gene of a host cell.
[0020] Embodiments of this application can provide the use of a nuclease, guide RNA, nucleic acid, nucleic acid construct, composition, recombinant vector, or recombinant host cell described herein for deleting, replacing, or inserting a target gene in a host cell.
[0021] Embodiments of this application can provide the use of nucleases, guide RNAs, nucleic acids, nucleic acid constructs, compositions, recombinant vectors, or recombinant host cells described herein for gene therapy, cell therapy, genomic research, and for preparing drugs or preparations for stem cell induction and post-induction differentiation.
[0022] According to embodiments of this application, a kit can be provided which comprises a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, a recombinant vector described in this application, or a recombinant host cell described in this application.
[0023] The protein molecular weight of the nuclease described in this application is much smaller than that of spCas9, less than one-third of the latter, which offers more possibilities for various in vivo delivery in subsequent gene therapies and can solve the problem of difficulties in spCas9 delivery caused by its protein size; also, compared to asCas12, which has a similarly low protein molecular weight, the nuclease has higher gene editing efficiency, which offers the potential to become a new gene editing application tool; furthermore, since different nucleases can recognize different transposon-associated motifs, the novel nucleases discovered in this application will bring more options for subsequent application scenarios at different scales.
[0024] It should be understood that the contents described in this section are not intended to identify any definitive or important features of the embodiments of this application, nor are they intended to limit the scope of this application. Other features of this application will be readily apparent through the following description.
[0025] The accompanying drawings illustrate embodiments and form part of this specification and are used together with the written description herein to illustrate exemplary implementations of the embodiments. The embodiments shown are for illustrative purposes only and do not limit the claims. Throughout the accompanying drawings, the same reference numerals indicate similar but not necessarily identical elements. [Brief explanation of the drawing]
[0026] [Figure 1]A schematic diagram of the RGS bifluorescence surrogate reporter system in Example 1 is shown. [Figure 2] The flow cytometry plot shows the percentage of mRFP+eGFP+ cells present at the Q2 gate in the upper right. [Figure 3]TP_A_1、TP_A_2、TP_A_8、TP_A_12、TP_A_18、TP_B_18、TP_B_41、TP_B_46、T P_B_70、TP_B_71、TP_B_72、TP_B_73、TP_C_23、TP_C_67、TP_C_70、TP_C_74、 TP_D_1、TP_D_3、TP_D_4、TP_D_8、TP_D_17、TP_D_18、TP_D_23、TP_D_24、TP _D_25、TP_D_27、TP_D_30、TP_D_32、TP_D_40、TP_D_43、TP_D_51、TP_D_59、T P_D_61、TP_D_66、TP_D_67、TP_D_71、TP_D_72、TP_D_73、TP_E_2、TP_E_15、 TP_E_17、TP_E_48、TP_F_56、TP_F_71、TP_F_77、TP_F_80、TP_F_83、TP_F_85 、TP_G_14、TP_G_19、TP_G_20、TP_G_24、TP_G_43、TP_G_52、TP_G_53、TP_G_ 61、TP_G_66、TP_G_72、TP_G_75、TP_G_83、TP_G_84、TP_H_1、TP_H_3、TP_H_4 TP_H_5, TP_H_6, TP_H_9, TP_H_11, TP_H_12, TP_H_13, TP_H_15, TP_H_18, TP_H_19, TP_H_20, TP_H_21, TP_H_23, TP_H_24, TP_H_30, TP_H_31, TP_H_32 TP_H_34, TP_H_38, TP_H_39, TP_H_40, TP_H_43, TP_I_1, TP_I_2, TP_I_3, TP_I_4, TP_I_5, TP_I_6, TP_I_7, TP_I_8, TP_I_9, TP_I_10, TP_I_11, TP_I_ 12, TP_I_13, TP_I_15, TP_I_16, TP_I_17, TP_I_18, TP_I_19, TP_I_20, TP_I_21, TP_I_22, TP_I_24, TP_I_25, TP_I_26, TP_I_29, TP_I_31, TP_I_35, TP _I_37, TP_I_38, TP_I_40, TP_I_41, TP_I_44, TP_I_45, TP_I_46, TP_I_47, TP_I_48, TP_I_49, TP_I_50, TP_I_51, TP_I_52, TP_I_53, TP_I_55, TP_I_56,TP_I_58, TP_I_59, TP_I_61, TP_I_62, TP_I_64, TP_I_65, TP_I_66, TP_I_67, TP_I_70 , TP_I_71, TP_I_76, TP_I_77, TP_I_79, TP_I_80, TP_I_82, TP_I_84, TP_I_85, TP_I_86 , TP_I_87, TP_L_1, TP_L_4, TP_L_5, TP_L_8, TP_L_9, TP_L_10, TP_L_11, TP_L_12, TP_ L_15, TP_L_16, TP_L_17, TP_L_21, TP_L_22, TP_L_24, TP_L_25, TP_L_26, TP_L_27, TP_ GFP expression is shown for all active nuclease candidates: L_28, TP_L_31, TP_L_32, TP_L_34, TP_L_36, TP_L_37, TP_L_39, TP_M_1, TP_M_3, TP_M_7, TP_M_11, TP_M_14, TP_M_17, TP_M_19, TP_M_20, TP_M_24, TP_M_31, TP_M_32, TP_M_33, TP_M_34, TP_M_35, TP_M_37, TP_M_40, TP_M_41, TP_M_43, TP_M_46, TP_M_49, TP_M_58, TP_M_65, TP_M_66, TP_M_67, TP_M_70, and TP_M_78. All results were quantified by flow cytometry assay as previously shown in Example 2. [Figure 4-8] This is a partially enlarged view of Figure 3. [Figure 9] The endogenous editing efficiency (quantified by the percentage of reads with insertions or deletions at the target site) of TP_C_23, TP_D_51, TP_D_67, TP_E_15, TP_F_85, TP_G_24, TP_H_5, TP_H_6, TP_H_9, TP_H_11, TP_H_24, TP_H_30, TP_H_32, TP_H_34, TP_H_38, TP_I_1, TP_I_5, TP_I_6, TP_I_12, TP_I_15, TP_I_18, TP_I_20, TP_I_38, TP_I_49, TP_I_64, and TP_I_79 in Example 3 is shown. [Figure 10]Example 2 based on protein sequence TP_A_1、TP_A_2、TP_A_8、TP_A_12、TP_A_18、TP_B_18、TP_B_41、TP_B_46、TP_B_70、TP_B_71、TP_B_72、TP_B_73、TP_C_23、TP_C _67、TP_C_70、TP_C_74、TP_D_1、TP_D_3、TP_D_4、TP_D_8、TP_D_17、TP_D_18、TP_D_23、TP_D_24、TP_D_25、TP_D_27、TP_D_30、TP_D_32、TP_D_40、TP_D_ 43、TP_D_51、TP_D_59、TP_D_61、TP_D_66、TP_D_67、TP_D_71、TP_D_72、TP_D_73、TP_E_2、TP_E_15、TP_E_17、TP_E_48、TP_F_56、TP_F_71、TP_F_77 _F_80、TP_F_83、TP_F_85、TP_G_14、TP_G_19、TP_G_20、TP_G_24、TP_G_43、TP_G_52、TP_G_53、TP_G_61、TP_G_66、TP_G_72、TP_G_75、TP_G_83、TP_G_84 、TP_H_1、TP_H_3、TP_H_4、TP_H_5、TP_H_6、TP_H_9、TP_H_11、TP_H_12、TP_H_13、TP_H_15、TP_H_18、TP_H_19、TP_H_20、TP_H_21、TP_H_23、TP_H_24、T P_H_30、TP_H_31、TP_H_32、TP_H_34、TP_H_38、TP_H_39、TP_H_40、TP_H_43、TP_I_1、TP_I_2、TP_I_3、TP_I_4、TP_I_5、TP_I_6、TP_I_7、TP_I_8、TP_I_9 、TP_I_10、TP_I_11、TP_I_12、TP_I_13、TP_I_15、TP_I_16、TP_I_17、TP_I_18、TP_I_19、TP_I_20、TP_I_21、TP_I_22、TP_I_24、TP_I_25、TP_I_26、TP_I_19 I_29、TP_I_31、TP_I_35、TP_I_37、TP_I_38、TP_I_40、TP_I_41、TP_I_44、TP_I_45、TP_I_46、TP_I_47、TP_I_48、TP_I_49、TP_I_50、TP_I_51、TP_I_52、TP_I_53, TP_I_55, TP_I_56, TP_I_58, TP_I_59, TP_I_61, TP_I_62, TP_I_64, TP_I_65, T P_I_66, TP_I_67, TP_I_70, TP_I_71, TP_I_76, TP_I_77, TP_I_79, TP_I_80, TP_I_82, TP _I_84, TP_I_85, TP_I_86, TP_I_87, TP_L_1, TP_L_4, TP_L_5, TP_L_8, TP_L_9, TP_L_10, TP_L_11, TP_L_12, TP_L_15, TP_L_16, TP_L_17, TP_L_21, TP_L_22, TP_L_24, TP_L_25, T P_L_26, TP_L_27, TP_L_28, TP_L_31, TP_L_32, TP_L_34, TP_L_36, TP_L_37, TP_L_39, TP _M_1, TP_M_3, TP_M_7, TP_M_11, TP_M_14, TP_M_17, TP_M_19, TP_M_20, TP_M_24, TP_M_3 1. The evolutionary branching diagrams for TP_M_32, TP_M_33, TP_M_34, TP_M_35, TP_M_37, TP_M_40, TP_M_41, TP_M_43, TP_M_46, TP_M_49, TP_M_58, TP_M_65, TP_M_66, TP_M_67, TP_M_70, TP_M_78, and ISDra2 are shown. [Figure 11-12] This is a partially enlarged view of Figure 10. [Figure 13] A schematic diagram showing the order of elements in the report vector in Example 4 is shown. [Figure 14] A schematic diagram illustrating how the reporter vector works in Example 4 is shown. [Figure 15-31]TP_A_1、TP_A_2、TP_A_8、TP_A_12、TP_A_18、TP_B_18、TP_B_41、TP_B_46、T P_B_70、TP_B_71、TP_B_72、TP_B_73、TP_C_23、TP_C_67、TP_C_70、TP_C_74、 TP_D_1、TP_D_3、TP_D_4、TP_D_8、TP_D_17、TP_D_18、TP_D_23、TP_D_24、TP _D_25、TP_D_27、TP_D_30、TP_D_32、TP_D_40、TP_D_43、TP_D_51、TP_D_59、T P_D_61、TP_D_66、TP_D_67、TP_D_71、TP_D_72、TP_D_73、TP_E_2、TP_E_15、 TP_E_17、TP_E_48、TP_F_56、TP_F_71、TP_F_77、TP_F_80、TP_F_83、TP_F_85 、TP_G_14、TP_G_19、TP_G_20、TP_G_24、TP_G_43、TP_G_52、TP_G_53、TP_G_ 61、TP_G_66、TP_G_72、TP_G_75、TP_G_83、TP_G_84、TP_H_1、TP_H_3、TP_H_4 TP_H_5, TP_H_6, TP_H_9, TP_H_11, TP_H_12, TP_H_13, TP_H_15, TP_H_18, TP_H_19, TP_H_20, TP_H_21, TP_H_23, TP_H_24, TP_H_30, TP_H_31, TP_H_32 TP_H_34, TP_H_38, TP_H_39, TP_H_40, TP_H_43, TP_I_1, TP_I_2, TP_I_3, TP_I_4, TP_I_5, TP_I_6, TP_I_7, TP_I_8, TP_I_9, TP_I_10, TP_I_11, TP_I_ 12, TP_I_13, TP_I_15, TP_I_16, TP_I_17, TP_I_18, TP_I_19, TP_I_20, TP_I_21, TP_I_22, TP_I_24, TP_I_25, TP_I_26, TP_I_29, TP_I_31, TP_I_35, TP _I_37, TP_I_38, TP_I_40, TP_I_41, TP_I_44, TP_I_45, TP_I_46, TP_I_47, TP_I_48, TP_I_49, TP_I_50, TP_I_51, TP_I_52, TP_I_53, TP_I_55, TP_I_56,TP_I_58, TP_I_59, TP_I_61, TP_I_62, TP_I_64, TP_I_65, TP_I_66, TP_I_67, TP_I_70, TP_I_71, TP_I_76, TP_I_77, TP_I_79, TP_I_80, TP_I_82, TP_I_84, TP_I_85, TP_I_86, T P_I_87, TP_L_1, TP_L_4, TP_L_5, TP_L_8, TP_L_9, TP_L_10, TP_L_11, TP_L_12, TP_L_1 5, TP_L_16, TP_L_17, TP_L_21, TP_L_22, TP_L_24, TP_L_25, TP_L_26, TP_L_27, TP_L_28 This shows YFP expression in Example 4 for all active nuclease candidates: TP_L_31, TP_L_32, TP_L_34, TP_L_36, TP_L_37, TP_L_39, TP_M_1, TP_M_3, TP_M_7, TP_M_11, TP_M_14, TP_M_17, TP_M_19, TP_M_20, TP_M_24, TP_M_31, TP_M_32, TP_M_33, TP_M_34, TP_M_35, TP_M_37, TP_M_40, TP_M_41, TP_M_43, TP_M_46, TP_M_49, TP_M_58, TP_M_65, TP_M_66, TP_M_67, TP_M_70, and TP_M_78. [Modes for carrying out the invention]
[0027] Unless otherwise indicated or unless inconsistent with the context, terms or expressions used herein should be read in conjunction with the entirety of this disclosure and as understood by those skilled in the art. All technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art, unless otherwise defined.
[0028] In this application, the terms “nucleic acid” and “polynucleotide” are used interchangeably and refer to polymeric forms of nucleotides of any length, including deoxyribonucleotides, ribonucleotides, combinations thereof, and analogues thereof.
[0029] In this application, the terms "polypeptide" and "peptide" are used interchangeably and refer to polymers of amino acids of any length. Therefore, polypeptides, oligopeptides, proteins, antibodies, and enzymes are all included in the definition of polypeptide.
[0030] As described in this application, a “fragment” of a sequence refers to a part of a sequence. For example, a fragment of a nucleic acid sequence refers to a part of a nucleic acid sequence, and a fragment of an amino acid sequence refers to a part of an amino acid sequence.
[0031] As described in this application, a “variant” of a sequence is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide but retains essential properties. A typical variant of a polynucleotide has a nucleic acid sequence that differs from another reference polynucleotide, and this difference in nucleic acid sequence may or may not alter the amino acid sequence of the polypeptide encoded by the reference polynucleotide. A typical variant of a polypeptide has an amino acid sequence that differs from another reference polypeptide. Generally, the differences are limited such that the sequences of the reference polypeptide and the variant are generally very similar and identical in many regions. The amino acid sequences of the variant polypeptide and the reference polypeptide may differ by one or more substitutions, additions, or deletions in any combination. The substituted or inserted amino acid residues may or may not be residues encoded by the genetic code. Variants of polynucleotides or polypeptides may be naturally occurring, such as allelic variants, or they may be naturally occurring variants that are unknown. Polynucleotide and polypeptide variants that do not exist naturally may be produced by mutagenesis techniques, direct synthesis, and other recombination methods known to those skilled in the art.
[0032] Amino acids are typically classified according to the properties of their side chains. For example, the side chains may make the amino acid a weak acid (e.g., amino acids D and E) or a weak base (e.g., amino acids K, R, and H); if the side chain is polar, the amino acid becomes hydrophilic (e.g., amino acids L and I); or if the side chain is nonpolar, the amino acid becomes hydrophobic (e.g., amino acids S and C).
[0033] As described in this application, “aliphatic amino acids” have a side chain which is an aliphatic group. The aliphatic group makes the amino acid nonpolar and hydrophobic. The aliphatic group is preferably an unsubstituted branched or linear alkyl group. Non-limiting examples of aliphatic amino acids are A (alanine), V (valine), L (leucine), I (isoleucine), M (methionine), D (aspartic acid), E (glutamic acid), K (lysine), R (arginine), G (glycine), S (serine), T (threonine), C (cysteine), N (asparagine), and Q (glutamine).
[0034] As described in this application, "nonpolar amino acids" have nonpolar side chains that make the amino acid hydrophobic. Non-limiting examples of nonpolar amino acids include A (alanine), V (valine), L (leucine), I (isoleucine), F (phenylalanine), W (tryptophan), M (methionine), P (proline), and G (glycine).
[0035] As described in this application, “polar amino acids” have polar side chains that make the amino acid hydrophilic. Non-limiting examples of polar amino acids include T (threonine), S (serine), C (cysteine), N (asparagine), Q (glutamine), Y (tyrosine), K (lysine), R (arginine), H (histidine), D (aspartic acid), and E (glutamic acid). Polar amino acids can be classified as polar uncharged amino acids or polar charged amino acids.
[0036] As described in this application, “polar uncharged amino acids” have polar side chains of uncharged residues. Non-limiting examples of polar uncharged amino acids include T (threonine), S (serine), C (cysteine), N (asparagine), Q (glutamine), and Y (tyrosine).
[0037] As described in this application, “polar charged amino acids” have a polar side chain of at least one charged residue. Non-limiting examples of polar charged amino acids are K (lysine), R (arginine), H (histidine), D (aspartic acid), and E (glutamic acid). Polar charged amino acids can be classified as either positively charged or negatively charged amino acids.
[0038] As described in this application, a “positively charged amino acid” has a polar side chain of at least one positively charged residue. Non-limiting examples of positively charged amino acids are K (lysine), R (arginine), and H (histidine).
[0039] As described in this application, a “negatively charged amino acid” has a polar side chain of at least one negatively charged residue. Non-limiting examples of negatively charged amino acids are D (aspartic acid) and E (glutamic acid).
[0040] As used in this application, the term "family" refers to a group of nucleic acids or proteins that have high structural similarity and are produced by the same ancestor through replication and mutation, and which usually have related or identical functions.
[0041] The term "nuclease" as used in this application refers to an enzyme capable of cleaving phosphodiester bonds. Nucleases hydrolyze phosphodiester bonds in the nucleic acid backbone. The term "endonuclease" as used in this application refers to an enzyme capable of cleaving phosphodiester bonds between nucleotides.
[0042] The term “guide RNA” as used in this application refers to any RNA molecule capable of forming a complex with a nuclease as described in this application. For example, a guide RNA may be a molecule that recognizes a targeted gene. In some embodiments of this application, the guide RNA may comprise a reRNA and a targeted sequence, wherein the reRNA is capable of binding to a specific nuclease, and the targeted sequence may be designed to be complementary to the target strand of the targeted gene.
[0043] The term “transposon-associated motif” (TAM) as used in this application refers to a short nucleotide sequence adjacent to a target gene, which can be recognized by a complex formed by the nuclease and guide RNA described in this application. If the target gene is not adjacent to a transposon-associated motif, the nuclease cannot successfully recognize the target gene. The sequence and length of the transposon-associated motif in this application may vary depending on the nuclease.
[0044] The terms “targeted gene,” “targeted sequence,” “targeted nucleic acid,” “target gene,” “target sequence,” and “target nucleic acid” as used in this application are interchangeable and refer to nucleotide sequences on chromosomal DNA, chloroplast DNA, mitochondrial DNA, plasmid DNA, or any other DNA molecule in the cellular genome, which can be recognized, bound, and selectively cleaved by a complex formed by the nuclease and guide RNA described in this application.
[0045] The term “nucleic acid construct,” as used in this application, is defined herein as a single-stranded or double-stranded nucleic acid molecule, and preferably refers to an artificially constructed nucleic acid molecule. Optionally, a nucleic acid construct further includes one or more operablely linked regulatory sequences that can direct the expression of a coding sequence in a suitable host cell under suitable conditions. The term “expression” is understood to include any steps involved in the production of a protein or polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. The term “regulatory sequence” includes all components necessary or advantageous for polypeptide / protein expression in this application. Each regulatory sequence may be naturally occurring or exogenous to the nucleic acid sequence encoding a protein or polypeptide. These regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, a regulatory sequence should include promoters and termination signals for transcription and translation. Regulatory sequences having linkers may be provided for introduction into specific restriction sites for linking the regulatory sequence to the coding region of the nucleic acid sequence encoding a protein or polypeptide.
[0046] The term “promoter,” as used in this application, refers to a polynucleotide sequence capable of controlling the transcription of a coding sequence. A promoter sequence comprises a specific sequence sufficient to enable RNA polymerase to recognize, bind to, and initiate transcription. In addition, the promoter sequence may optionally include sequences that modulate the recognition, binding, and transcription initiation activity of RNA polymerase in the nucleic acid constructs provided in this application. A promoter may affect the transcription of genes located on the same nucleic acid molecule as the promoter or genes located on a different nucleic acid molecule than the promoter.
[0047] As used in this application, the term “host cell” includes, but is not limited to, animal cells, plant cells, algal cells, fungal cells, yeast cells, or bacterial cells. The term includes offspring of the original cell into which an exogenous nucleic acid fragment has been introduced. An example host cell is the human fetal kidney cell HEK293T. It is understood that, due to natural, accidental, or intentional mutation, offspring of a single parental cell may not necessarily be morphologically or, with respect to genomic or total DNA complement, identical to the original parent.
[0048] As used in this application, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid molecule to which it is ligated. Examples of vectors include, but are not limited to, plasmids, viruses, bacteria, phages, and insertable DNA fragments. The term "plasmid" refers to a circular double-stranded DNA that can receive an exogenous nucleic acid fragment and replicate in prokaryotic or eukaryotic cells.
[0049] Nuclease This application provides an isolated nuclease, the nuclease having the following formula: (X1)(X2) a (X3)(X4)(X5) b (X6)(X7) c (X8)(X9) d (X 10 )(X 11 ) e (X 12 )(X 13 ) f (X 14 )(X 15 ) g (X 16 ) (In the formula, a, b, c, d, e, f, and g are the number of amino acids; (X1), (X3), (X4), (X6), (X8), (X 10 ), (X 12 ), (X 14 ), and (X 16(X) is independently a polar amino acid or an aliphatic amino acid; (X2) is any amino acid and a is 15 or 16; (X5) is any amino acid and b is 2; (X7) is any amino acid and c is 2, 3 or 4; (X9) is any amino acid and d is 14, 15, 16, 17 or 18; (X 11 ) is any amino acid, and e is 1 or 2; (X 13 ) is any amino acid and f is 6; and (X 15 (where is any amino acid and g is 5) It contains the amino acid sequence shown.
[0050] In some embodiments, (X1) is a positively charged amino acid; (X3) is a polar uncharged amino acid; (X4) is a polar uncharged amino acid; (X6) is a polar uncharged amino acid; (X8) is a polar uncharged amino acid; (X 10 ) is a polar uncharged amino acid; (X 12 ) is a polar uncharged amino acid; (X 14 ) is a negatively charged amino acid; and (X 16 (X1) is a polar uncharged amino acid. In some embodiments, (X3) is K. In some embodiments, (X4) is S or T. In some embodiments, (X6) is C. In some embodiments, (X8) is C. In some embodiments, (X 10 ) is C. In some embodiments, (X 12 ) is C. In some embodiments, (X 14 ) is D. In some embodiments, (X 16 ) is N.
[0051] According to embodiments of the present application, an isolated nuclease can be provided, the nuclease having nuclease activity in at least one of the following variant sequences of the nuclease: (i) at least one amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197; (ii) at least one sequence obtained by performing deletion, substitution, insertion, or mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids on the amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197; (iii) at least one amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197; and (iv) at least one sequence obtained by further fusing the amino acid sequence as shown in any one of SEQ ID NOs: 1 to 197 with another sequence.
[0052] In some embodiments, the nuclease is one of the following groups (1)-(9): (1) at least one amino acid sequence as shown in any one of SEQ ID NOs. 52 and 113-147; (2) at least one amino acid sequence as shown in any one of SEQ ID NOs. 27-28, 36-38, 62-85 and 148-171; (3) at least one amino acid sequence as shown in any one of SEQ ID NOs. 13, 86-100 and 105-110; (4) at least one amino acid sequence as shown in any one of SEQ ID NOs. 10-11, 17-19, 29-30 and 174-180; (5) SEQ ID NOs. 34 (6) At least one amino acid sequence as shown in any one of 35, 50, 61 and 181-189; (7) At least one amino acid sequence as shown in any one of sequence numbers 53 and 190-197; (8) At least one amino acid sequence as shown in any one of sequence numbers 101, 103, 104 and 112; (9) At least one amino acid sequence as shown in any one of sequence numbers 7 and 23-25; and a nuclease sequence selected from at least one of the amino acid sequences shown in any one of sequence numbers 3, 21 and 22.
[0053] In some embodiments, the nuclease is one of the following groups (1)-(12): (1) at least one amino acid sequence as shown in any one of SEQ ID NOs: 1, 3-4, 6-7, 21-23, 50, 52, 60-61 and 113-147; (2) at least one amino acid sequence as shown in any one of SEQ ID NOs: 14, 27-28, 36-38, 45-48, 59, 62-85 and 148-171; (3) at least one amino acid sequence as shown in any one of SEQ ID NOs: 13, 43 and 86-112; (4) at least one amino acid sequence as shown in any one of SEQ ID NOs: 15-16, 24-25, 32-35 and 181-189; (5) at least one amino acid sequence as shown in any one of SEQ ID NOs: 9, 11, 17-19, 29 and 174-180; (6 (1) Having a nuclease sequence selected from at least one of the following: (2) at least one amino acid sequence as shown in any one of SEQ ID NOs: 10, 12, 26, 30, 42, and 58; (3) at least one amino acid sequence as shown in any one of SEQ ID NOs: 2, 20, and 31; (4) at least one amino acid sequence as shown in any one of SEQ ID NOs: 8 and 51; (5) at least one amino acid sequence as shown in any one of SEQ ID NOs: 39 and 49; (6) at least one amino acid sequence as shown in any one of SEQ ID NOs: 54 and 55; (7) at least one amino acid sequence as shown in any one of SEQ ID NOs: 53 and 190-197; and (8) at least one amino acid sequence as shown in any one of SEQ ID NOs: 5, 172, and 173.
[0054] In some embodiments, the nuclease belongs to the IS200 / IS605 family. In some embodiments, the nuclease belongs to the IS605 or IS1341 subfamily. In some embodiments, the species source of the nuclease may be bacteria or archaea. In some embodiments, the nuclease seed source is from the following phyla: Actinobacteria, Aquificae, Bacteroidetes, Candidatus Poribacteria, Chloroflexi, Cyanobacteria, Deinococcus-Thermus, Firmicutes, Planctomycetes, Proteobacteria, Spirochaetes, Tenericutes, Thermotogae, Verrucomicrobia, and Candidatus Microarchaea. Examples include Micrarchaeota, Crenarchaeota, or Euryarchaeota.
[0055] Guide RNA According to embodiments of this application, a guide RNA can be provided, the guide RNA comprising reRNA, the reRNA comprising a nucleotide sequence or a variant thereof as shown in any one of SEQ ID NOs: 198-394, and the guide RNA can bind to a specific nuclease. In some embodiments, the reRNA comprises at least one nucleotide sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the nucleotide sequence as shown in any one of SEQ ID NOs: 198-394. In some embodiments, the reRNA comprises at least one nucleotide sequence as shown in any one of SEQ ID NOs: 198-394. In some embodiments, the reRNA is at least one nucleotide sequence as shown in any one of SEQ ID NOs: 198-394.
[0056] In some embodiments, the guide RNA further includes a targeted sequence capable of recognizing a targeted gene adjacent to a transposon-associated motif. In some embodiments, the targeted sequence is at least one of 10–50, 10–40, 10–30, or 15–25 nucleotides in length.
[0057] The sequence and length of the transposon-associated motif in this application may vary depending on the nuclease, and the transposon-associated motif may be recognized by a complex formed by the nuclease and guide RNA described in this application. In some embodiments, the transposon-associated motif is given by the following formula: (X 17 ) h (X 18 )(X 19 )A(X 20 ) (wherein h is the number of nucleotides; A is adenine deoxyribonucleotide; (X 17 (X) is any deoxyribonucleotide, and h is 0 or 1; (X 18 ) is cytosine deoxyribonucleotide or thymine deoxyribonucleotide; (X 19) is cytosine deoxyribonucleotide, thymine deoxyribonucleotide, or guanine deoxyribonucleotide; and (X 20 (This is any deoxyribonucleotide.) It contains the nucleotide sequence as shown.
[0058] nucleic acids, nucleic acid constructs According to embodiments of the present invention, nucleic acids can be provided, which encode the nuclease and / or guide RNA described in this application.
[0059] According to embodiments of this application, a nucleic acid construct comprising the nucleic acid described herein can be provided. In some embodiments, the nucleic acid construct further comprises a promoter. The promoter may be any preferred promoter sequence, i.e., a nucleic acid sequence that can be recognized by a host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates the expression of a protein or polypeptide. The promoter may be any nucleic acid sequence having transcriptional activity in selected host cells, including mutant promoters, truncated promoters, and heterozygous promoters, and may be derived from a gene encoding an extracellular or intracellular protein or polypeptide of the same or different species to the host cell. In some embodiments, the promoter includes CMV, EF1a, SV40, PGK, UbC, human beta-actin, CAG, TRE, UAS, Ac5, GFAP, polyhedrin promoter, TBG, ALB, ApoEHCR-hAAT, CaMKIIa, GAL1, TEF1, GDS, ADH1, CaMV35S, Ubi, H1, U6, T7, T7lac, Sp6, araBAD, trp, lac, Ptac, or pL.
[0060] In some embodiments, the nucleic acid construct is modified by 5'-terminal cap formation and / or 3'-terminal polyadenylation, and the nucleic acid construct retains the activity of the nuclease and / or guide RNA. In some embodiments, the nucleic acid construct is modified by thiophosphate binding modification, 2'-MOE(2-O-(2-methoxyethyl)), PNA (peptide nucleic acid), GNA (glycerol nucleic acid), LNA (locked nucleic acid), GalNAc (N-acetylgalactosamine), LNP (lipid nanoparticles), and PNP (peptide nanoparticles). Methods for modifying nucleic acids are known in the art and are incorporated herein by reference in their entirety.
[0061] In some embodiments, the nucleic acid construct further includes a poly(A) sequence. Poly(A) tail addition signal sequences well known in the art, as well as various truncated forms of the poly(A) tail addition signal, can be used in this application.
[0062] In some embodiments, the nucleic acid construct further includes an optional transcription termination sequence, i.e., a sequence recognized by the host cell to terminate transcription. The termination sequence is operably ligated to the 3' end of the nucleic acid sequence encoding a protein or polypeptide. Any terminator that is functional in a selected host cell may be used in the present invention.
[0063] Optionally, the nucleic acid construct may further include a suitable leader sequence, i.e., an untranslated region in mRNA that is important for translation in the host cell. The leader sequence is operably ligated to the 5' end of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in a selected host cell may be used in the present invention.
[0064] Optionally, the nucleic acid construct may further include a propeptide coding region that encodes an amino acid sequence located at the amino terminus of the polypeptide. The resulting polypeptide is called a zymogen or propolypeptide. Propolypeptides are generally inactive and can be converted to mature, active polypeptides by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
[0065] Optionally, a nucleic acid construct may further include a regulatory sequence that can adjust polypeptide expression according to the growth conditions of the host cell. Examples of regulatory sequences include systems that turn gene expression on or off in response to chemical or physical stimuli, including the presence of a regulatory compound. Other examples of regulatory sequences are those that enable gene amplification. In these examples, a nucleic acid sequence encoding a protein or polypeptide should be operably ligated to the regulatory sequence.
[0066] composition According to embodiments of the present application, a composition may be provided which comprises an IS200 / IS605 family nuclease or a functional fragment thereof, or a nucleic acid encoding an IS200 / IS605 family nuclease or a functional fragment thereof, wherein the nuclease or functional fragment thereof has endonuclease activity; and also comprises a guide RNA, or a nucleic acid encoding a guide RNA, wherein the guide RNA can bind to a specific nuclease.
[0067] In some embodiments, the composition is selected from at least one of the following groups (1) to (198), where any one of the following groups (1) to (198) comprises a nuclease-associated sequence and a guide RNA-associated sequence. (1) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 1 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 198; (2) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 2 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 199; (3) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 3 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 200; (4) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 4 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 201; (5) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 5 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 202; (6) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 6 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 203; (7) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 7 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 204; (8) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 8 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 205; (9) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 9 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 206; (10) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 10 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 207; (11) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 11 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 208; (12) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 12 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 209; (13) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 13 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 210; (14) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 14 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 211; (15) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 15 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 212; (16) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 16 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 213; (17) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 17 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 214; (18) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 18 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 215; (19) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 19 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 216; (20) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 20 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 217; (21) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 21 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 218; (22) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 22 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 219; (23) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 23 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 220; (24) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 24 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 221; (25) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 25 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 222; (26) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 26 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 223; (27) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 27 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 224; (28) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 28 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 225; (29) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 29 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 226; (30) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 30 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 227; (31) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 31 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 228; (32) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 32 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 229; (33) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 33 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 230; (34) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 34 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 231; (35) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 35 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 232; (36) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 36 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 233; (37) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 37 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 234; (38) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 38 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 235; (39) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 39 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 236; (40) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 40 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 237; (41) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 41 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 238; (42) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 42 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 239; (43) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 43 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 240; (44) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 44 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 241; (45) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 45 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 242; (46) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 46 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 243; (47) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 47 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 244; (48) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 48 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 245; (49) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 49 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 246; (50) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 50 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 247; (51) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 51 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 248; (52) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 52 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 249; (53) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 53 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 250; (54) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 54 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 251; (55) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 55 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 252; (56) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 56 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 253; (57) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 57 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 254; (58) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 58 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 255; (59) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 59 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 256; (60) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 60 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 257; (61) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 61 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 258; (62) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 62 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 259; (63) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 63 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 260; (64) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 64 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 261; (65) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 65 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 262; (66) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 66 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 263; (67) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 67 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 264; (68) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 68 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 265; (69) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 69 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 266; (70) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 70 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 267; (71) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 71 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 268; (72) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 72 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 269; (73) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 73 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 270; (74) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 74 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 271; (75) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 75 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 272; (76) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 76 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 273; (77) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 77 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 274; (78) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 78 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 275; (79) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 79 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 276; (80) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 80 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 277; (81) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 81 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 278; (82) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 82 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 279; (83) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 83 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 280; (84) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 84 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 281; (85) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 85 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 282; (86) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 86 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 283; (87) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 87 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 284; (88) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 88 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 285; (89) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 89 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 286; (90) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 90 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 287; (91) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 91 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 288; (92) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 92 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 289; (93) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 93 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 290; (94) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 94 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 291; (95) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 95 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 292; (96) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 96 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 293; (97) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 97 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 294; (98) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 98 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 295; (99) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 99 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 296; (100) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 100 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 297; (101) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 101 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 298; (102) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 102 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 299; (103) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 103 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 300; (104) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 104 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 301; (105) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 105 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 302; (106) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 106 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 303; (107) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 107 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 304; (108) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 108 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 305; (109) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 109 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 306; (110) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 110 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 307; (111) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 111 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 308; (112) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 112 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 309; (113) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 113 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 310; (114) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 114 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 311; (115) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 115 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 312; (116) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 116 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 313; (117) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 117 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 314; (118) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 118 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 315; (119) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 119 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 316; (120) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 120 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 317; (121) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 121 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 318; (122) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 122 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 319; (123) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 123 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 320; (124) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 124 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 321; (125) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 125 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 322; (126) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 126 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 323; (127) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 127 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 324; (128) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 128 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 325; (129) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 129 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 326; (130) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 130 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 327; (131) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 131 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 328; (132) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 132 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 329; (133) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 133 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 330; (134) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 134 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 331; (135) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 135 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 332; (136) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 136 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 333; (137) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 137 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 334; (138) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 138 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 335; (139) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 139 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 336; (140) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 140 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 337; (141) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 141 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 338; (142) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 142 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 339; (143) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 143 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 340; (144) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 144 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 341; (145) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 145 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 342; (146) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 146 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 343; (147) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 147 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 344; (148) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 148 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 345; (149) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 149 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 346; (150) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 150 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 347; (151) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 151 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 348; (152) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 152 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 349; (153) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 153 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 350; (154) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 154 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 351; (155) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 155 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 352; (156) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 156 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 353; (157) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 157 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 354; (158) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 158 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 355; (159) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 159 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 356; (160) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 160 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 357; (161) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 161 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 358; (162) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 162 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 359; (163) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 163 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 360; (164) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 164 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 361; (165) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 165 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 362; (166) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 166 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 363; (167) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 167 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 364; (168) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 168 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 365; (169) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 169 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 366; (170) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 170 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 367; (171) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 171 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 368; (172) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 172 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 369; (173) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 173 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 370; (174) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 174 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 371; (175) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 175 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 372; (176) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 176 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 373; (177) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 177 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 374; (178) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 178 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 375; (179) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 179 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 376; (180) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 180 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 377; (181) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 181 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 378; (182) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 182 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 379; (183) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 183 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 380; (184) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 184 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 381; (185) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 185 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 382; (186) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 186 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 383; (187) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 187 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 384; (188) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 188 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 385; (189) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 189 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 386; (190) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 190 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 387; (191) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 191 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 388; (192) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 192 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 389; (193) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 193 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 390; (194) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 194 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 391; (195) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 195 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 392; (196) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 196 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 393; (197) The nuclease-related sequence is an amino acid sequence containing the sequence shown in SEQ ID NO: 197 or a nucleic acid encoding that amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in SEQ ID NO: 394; (198) A variant of any one of the aforementioned groups (1) to (197), Nuclease-related sequences are amino acid sequences of nuclease variants in each group, or nucleic acid sequences that encode variants, and the variants are as follows: (i)~(iii): (i) at least one sequence obtained by performing deletion, substitution, insertion, or mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids on the amino acid sequence of the nuclease in each group; (ii) at least one amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the amino acid sequence shown in any one of Sequence IDs 1 to 197; and (iii) At least one sequence obtained by further fusing an amino acid sequence as shown in any one of Sequence IDs 1 to 197 with another sequence. It has a variant sequence of the aforementioned nuclease having nuclease activity selected from among.
[0068] In some embodiments, the guide RNA-associated sequence further includes a targeted sequence capable of recognizing a targeted gene adjacent to a transposon-associated motif. In some embodiments, the targeted sequence is at least one of 10–50, 10–40, 10–30, or 15–25 nucleotides in length.
[0069] The sequence and length of the transposon-associated motif in this application may vary depending on the nuclease, and the transposon-associated motif may be recognized by a complex formed by the nuclease and guide RNA described in this application. In some embodiments, the transposon-associated motif is given by the following formula: (X 17 ) h (X 18 )(X 19 )A(X 20 ) (wherein h is the number of nucleotides; A is adenine deoxyribonucleotide; (X 17 (X) is any deoxyribonucleotide, and h is 0 or 1; (X 18 ) is cytosine deoxyribonucleotide or thymine deoxyribonucleotide; (X 19 ) is cytosine deoxyribonucleotide, thymine deoxyribonucleotide, or guanine deoxyribonucleotide; and (X 20 (This is any deoxyribonucleotide.) It contains the nucleotide sequence as shown.
[0070] The targeted genes in this application include any gene of interest, such as a gene for a native functional protein, an artificial chimeric gene, or a gene for non-coding RNA. In some embodiments, the gene for a native functional protein includes a fluorescein reporter gene, a luciferase gene, and a resistance gene. In some embodiments, the artificial chimeric gene includes a gene for a chimeric antigen receptor. In some embodiments, the fluorescein reporter gene includes a gene encoding a green fluorescent protein, a red fluorescent protein, a blue fluorescent protein, or a yellow fluorescent protein. In some embodiments, the luciferase gene includes a gene encoding firefly luciferase or sea urchin luciferase. In some embodiments, the resistance gene includes a gene encoding puromycin resistance, G418 resistance, kanamycin resistance, tetracycline resistance, or bleomycin resistance.
[0071] In some embodiments, the nucleic acid encoding the amino acid sequence and / or the nucleic acid encoding the guide RNA further includes a promoter. The promoter may be any preferred promoter sequence, i.e., a nucleic acid sequence that can be recognized by a host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates the expression of a protein or polypeptide. The promoter may be any nucleic acid sequence having transcriptional activity in selected host cells, including mutant promoters, truncated promoters and heterozygous promoters, and may be derived from a gene encoding an extracellular or intracellular protein or polypeptide of the same or different species to the host cell. In some embodiments, the promoter includes CMV, EF1a, SV40, PGK, UbC, human beta-actin, CAG, TRE, UAS, Ac5, GFAP, polyhedrin promoter, TBG, ALB, ApoEHCR-hAAT, CaMKIIa, GAL1, TEF1, GDS, ADH1, CaMV35S, Ubi, H1, U6, T7, T7lac, Sp6, araBAD, trp, lac, Ptac, or pL. In some embodiments, nucleic acids encoding amino acid sequences and / or guide RNA further include poly(A) sequences. Poly(A) tail addition signal sequences well known in the art, as well as various truncated forms of poly(A) tail addition signals, can be used in this application.
[0072] In some embodiments, the nucleic acid encoding the amino acid sequence and / or the nucleic acid encoding the guide RNA further includes an optional transcription termination sequence that controls the expression of the exogenous nucleic acid fragment, i.e., a sequence recognized by the host cell to terminate transcription. Any terminator that is functional in a selected host cell may be used in the present invention.
[0073] In some embodiments, the nucleic acid encoding the amino acid sequence and / or the nucleic acid encoding the guide RNA further includes an optional transcription termination sequence, i.e., a sequence recognized by the host cell to terminate transcription. The termination sequence is operably ligated to the 3' end of the nucleic acid sequence encoding the protein or polypeptide. Any terminator that is functional in a selected host cell may be used in the present invention.
[0074] Optionally, the nucleic acid encoding the amino acid sequence and / or the nucleic acid encoding the guide RNA may further include a suitable leader sequence, i.e., an untranslated region in mRNA that is important for transcription in the host cell. The leader sequence is operably ligated to the 5' end of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in a selected host cell may be used in the present invention.
[0075] Optionally, nucleic acids encoding amino acid sequences and / or guide RNA may further include a propeptide coding region encoding an amino acid sequence located at the amino terminus of the polypeptide. The resulting polypeptide is called a zymogen or propolypeptide. Propolypeptides are generally inactive and can be converted to mature, active polypeptides by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
[0076] Optionally, nucleic acids encoding amino acid sequences and / or guide RNA may further include regulatory sequences that can regulate polypeptide expression according to host cell growth conditions. Examples of regulatory sequences include systems that turn gene expression on or off in response to chemical or physical stimuli, including the presence of regulatory compounds. Other examples of regulatory sequences enable gene amplification. In these examples, the nucleic acid sequence encoding a protein or polypeptide should be operably ligated to the regulatory sequence.
[0077] Recombinant vectors, recombinant host cells, and kits According to embodiments of this application, recombinant vectors can be provided, each comprising a nucleic acid encoding a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, or a composition described in this application. The recombinant vector may be any suitable vector. In some embodiments, the recombinant vector may be, but is not limited to, a recombinant cloning vector, a recombinant eukaryotic expression plasmid, or a recombinant viral vector. In some embodiments, the recombinant eukaryotic expression plasmid may be pcDNA3.1, pCMV, pUC18, pUC19, pUC57, pBAD, pET, pENTR, pGenlenti, or pAAV. In some embodiments, the recombinant viral vector may be a recombinant adenovirus vector, a recombinant adeno-associated virus vector, a recombinant retrovirus vector, a recombinant herpes simplex virus vector, or a recombinant vaccinia virus vector. Recombinant vectors of the present invention may be constructed using methods well known in the art. For example, depending on the restriction sites contained in the skeletal vector used, appropriate restriction sites can be added to both ends of the nucleic acid construct of the present invention, and then introduced into the skeletal vector.
[0078] According to embodiments of this application, recombinant host cells can be provided, which comprise a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, or a recombinant vector described in this application. The recombinant host cell may be any host cell on which the nuclease can be used. In some embodiments, recombinant host cells may include, but are not limited to, animal cells, plant cells, algal cells, fungal cells, yeast cells, or bacterial cells. In some embodiments, animal cells may include mammalian cells. In some embodiments, mammalian cells include primary cells (e.g., mesenchymal stem cells, endothelial cells, epithelial cells, fibroblasts, keratinocytes, melanocytes, smooth muscle cells, and immune cells), immortalized cell lines (e.g., HEK293, NIH-3T3, RAW-264.7, STO, VERO, CT26, hTERT immortalized human endothelial / epithelial / fibroblast / keratinocyte / tubule / cell lines), and cancer cell lines (e.g., Hela, HepG2 / 3, HL-60, HT-1080, HT-29, A549, S Examples include W620, HCT-15, HCT116, MDA-MB-231, MCF7, SK-OV-3, PANC-1, AsPc-1, THP-1, Huh7, KG-1, RAJI, HB-CB, Jurkat, K562, CRL5826, CHO, MDCK, and Renca), embryonic stem cell lines (e.g., H1, H9, WIBR2, WIBR3, G-Olig2, ESF158, RW.4, R1, and D3) and their differentiated cells, or induced pluripotent stem cell lines and their differentiated cells. In some embodiments, plant cells may be monocotyledonous or dicotyledonous plant cells. In some embodiments, monocotyledonous or dicotyledonous plant cells may be rice cells, maize cells, or soybean cells.
[0079] According to embodiments of this application, a kit can be provided which comprises a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, a recombinant vector described in this application, or a recombinant host cell described in this application.
[0080] Method and Use The nuclease-based gene editing tools and methods provided in this application can be applied to many fields, including gene therapy, molecular breeding in animals and plants, industrial microbial engineering, model animal engineering, and scientific research. In particular, in the field of gene therapy, it can be applied to gene knockout based on DNA double-strand breaks in the human genome.
[0081] Embodiments of this application can provide a method for introducing double-strand breaks into targeted genes in host cells, the method comprising delivering a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, or a recombinant vector described in this application to a host cell.
[0082] Embodiments of this application can provide a method for deleting, replacing, or inserting a target gene in a host cell, the method comprising delivering a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, or a recombinant vector described in this application to a host cell.
[0083] Embodiments of this application can provide a method for obtaining a host cell in which a targeted gene is deleted, replaced, or inserted, the method comprising delivering a nuclease, a guide RNA, a nucleic acid, a nucleic acid construct, a composition, or a recombinant vector to a host cell as described in this application.
[0084] The method of delivery to host cells may be any preferred method. In some embodiments, delivery methods include, but are not limited to, cationic liposome delivery, lipoid nanoparticle delivery, cationic polymer delivery, vesicle-exosome delivery, gold nanoparticle delivery, polypeptide and protein delivery, retrovirus delivery, lentivirus delivery, adenovirus delivery, adeno-associated virus delivery, electroporation, Agrobacterium infection, or gene gun. The methods of cell transfection and culture are conventional methods in the art, and appropriate transfection and culture methods may be selected depending on the various cell types.
[0085] The host cell can be any host cell on which the nuclease can be used. In some embodiments, the host cell may be, but is not limited to, animal cells, plant cells, algal cells, fungal cells, yeast cells, or bacterial cells. In some embodiments, animal cells include mammalian cells. In some embodiments, mammalian cells may be primary cells (e.g., mesenchymal stem cells, endothelial cells, epithelial cells, fibroblasts, keratinocytes, melanocytes, smooth muscle cells, and immune cells), immortalized cell lines (e.g., HEK293, NIH-3T3, RAW-264.7, STO, VERO, CT26, hTERT immortalized human endothelial / epithelial / fibroblast / keratinocyte / tubule / cell line), cancer cell lines (e.g., Hela, HepG2 / 3, HL-60, HT-1080, HT-29, A549, S Examples include W620, HCT-15, HCT116, MDA-MB-231, MCF7, SK-OV-3, PANC-1, AsPc-1, THP-1, Huh7, KG-1, RAJI, HB-CB, Jurkat, K562, CRL5826, CHO, MDCK, and Renca), embryonic stem cell lines (e.g., H1, H9, WIBR2, WIBR3, G-Olig2, ESF158, RW.4, R1, and D3) and their differentiated cells, or induced pluripotent stem cell lines and their differentiated cells. In some embodiments, plant cells may be monocotyledonous or dicotyledonous plant cells. In some embodiments, monocotyledonous or dicotyledonous plant cells may be rice cells, maize cells, or soybean cells.
[0086] According to embodiments of this application, it is possible to provide the use of a nuclease described in this application, a guide RNA described in this application, a nucleic acid described in this application, a nucleic acid construct described in this application, a composition described in this application, a recombinant vector described in this application, or a recombinant host cell described in this application for introducing double-strand breaks into a targeted gene of a host cell.
[0087] Embodiments of this application can provide the use of a nuclease, guide RNA, nucleic acid, nucleic acid construct, composition, recombinant vector, or recombinant host cell described herein for deleting, replacing, or inserting a target gene in a host cell.
[0088] The host cell can be any host cell on which the nuclease can be used. In some embodiments, the host cell may be, but is not limited to, animal cells, plant cells, algal cells, fungal cells, yeast cells, or bacterial cells. In some embodiments, animal cells include mammalian cells. In some embodiments, mammalian cells may be primary cells (e.g., mesenchymal stem cells, endothelial cells, epithelial cells, fibroblasts, keratinocytes, melanocytes, smooth muscle cells, and immune cells), immortalized cell lines (e.g., HEK293, NIH-3T3, RAW-264.7, STO, VERO, CT26, hTERT immortalized human endothelial / epithelial / fibroblast / keratinocyte / tubule / cell line), cancer cell lines (e.g., Hela, HepG2 / 3, HL-60, HT-1080, HT-29, A549, S Examples include W620, HCT-15, HCT116, MDA-MB-231, MCF7, SK-OV-3, PANC-1, AsPc-1, THP-1, Huh7, KG-1, RAJI, HB-CB, Jurkat, K562, CRL5826, CHO, MDCK, and Renca), embryonic stem cell lines (e.g., H1, H9, WIBR2, WIBR3, G-Olig2, ESF158, RW.4, R1, and D3) and their differentiated cells, or induced pluripotent stem cell lines and their differentiated cells. In some embodiments, plant cells may be monocotyledonous or dicotyledonous plant cells. In some embodiments, monocotyledonous or dicotyledonous plant cells may be rice cells, maize cells, or soybean cells.
[0089] Embodiments of this application can provide the use of nucleases, guide RNAs, nucleic acids, nucleic acid constructs, compositions, recombinant vectors, or recombinant host cells described herein for gene therapy, cell therapy, genomic research, and for preparing drugs or preparations for stem cell induction and post-induction differentiation.
[0090] The various embodiments and preferences of this application described above can be combined with one another (inso that they are not inherently contradictory to each other) and are suitable for use in this application, and the various embodiments formed by such combinations are deemed to be part of this application. [Examples]
[0091] The exemplary embodiments of this application are described below in conjunction with the accompanying drawings, and various details of the embodiments of this application are included for the sake of clarity. It should be understood that these are illustrative only and are not intended to limit the scope of protection of this application. The scope of protection of this application is defined solely by the claims. Therefore, those skilled in the art should be aware that various changes and modifications can be made to the embodiments described herein without departing from the scope of this application. Similarly, for clarity and brevity, descriptions of well-known functions and structures are omitted below.
[0092] Unless otherwise specified, the reagents and equipment used in the following examples are commercially available conventional products. Unless otherwise specified, the experiments are conducted under conventional conditions recommended by the manufacturers.
[0093] Example 1: Construction of a nuclease activity detection system To verify the activity of candidate nucleases, we established a set of RGS bifluorescent surrogate reporter systems.
[0094] Plasmid 1 consists of a complete set of elements capable of transcribing and expressing a candidate nuclease protein, including a constitutive promoter CMV (as shown in SEQ ID NO: 405) that can initiate transcription in eukaryotic cells, a candidate nuclease sequence (as shown in Table 1), a 5'-nuclear localization signal peptide sequence (as shown in SEQ ID NO: 406), a 3'-nuclear localization signal peptide sequence (as shown in SEQ ID NO: 407), a poly(A) sequence that terminates transcription (as shown in SEQ ID NO: 408), and an ampicillin resistance gene sequence (as shown in SEQ ID NO: 409).
[0095] Method for constructing Plasmid 1: The amino acid sequence (or nucleotide sequence) of the candidate nuclease protein was synthesized via a conventional gene synthesized by BGI Tech Solutions (Beijing Liuhe) Co., Ltd., which has an ECoRI cleavage site inserted at the upstream 5' end of the sequence and a BamH1 cleavage site inserted at the downstream 3' end. Plasmid construction was also carried out by the company involved in gene synthesis, and the specific construction method was as follows: 1. Vector preparation. The plasmid backbone of the pcDNA3.1 plasmid vector was subjected to a double enzymatic digestion reaction using single restriction endonuclease cleavage sites ECoRI and BamHI on the plasmid vector. A linear plasmid vector fragment was obtained by agarose gel electrophoresis, and the enzymatic cleavage band was excised from the gel for recovery to obtain a purified linearized plasmid vector fragment. 2. Ligation. The nucleotide sequence of the candidate nuclease protein obtained by conventional gene synthesis was ligated with the linearized pcDNA3.1 vector fragment using T4 DNA ligase. 3. Transformation and validation. Monoclonal transformants were obtained via LB agar plates to screen for ampicillin resistance, and the exact clones identified by sequencing were used as candidate plasmids for later use.
[0096] Plasmid 2 contains a reRNA sequence (as shown in Table 1), a 20nt targeted sequence GCTCGGAGATCATCATTGCG inserted at the 3' end of the reRNA sequence, a U6 promoter (as shown in Sequence ID No. 410), a PBR322 origin of replication (as shown in Sequence ID No. 411), and an ampicillin resistance gene sequence (as shown in Sequence ID No. 409).
[0097] Method for constructing Plasmid 2: Guide reRNA was synthesized by Beijing Tsingke Biotech Co., Ltd. or General Biosystems (Anhui) Co., Ltd. through conventional gene synthesis. Plasmid construction was also carried out by the companies involved in gene synthesis, and the specific construction method was as follows: 1. Vector preparation. The pUC19-U6 vector was subjected to enzymatic cleavage using BbsI, and linearized plasmid vector fragments were obtained by agarose gel electrophoresis. The enzymatic cleavage bands were excised from the gel for recovery to obtain purified linearized plasmid vector fragments. 2. Ligation. The nucleotide sequence of the guide reRNA obtained through gene synthesis was ligated with the linearized pUC19-U6 vector fragment using a seamless cloning ligation method. 3. Transformation and validation. Monoclonal transformants were obtained through LB agar plates to screen for ampicillin resistance, and the exact clones identified by sequencing were used as candidate plasmids for later use.
[0098] Plasmid 3 contains a TAM sequence (as shown in Table 1), a 20nt targeted sequence GCTCGGAGATCATCATTGCG inserted at the 3' end of the TAM sequence, a CMV promoter (as shown in SEQ ID NO: 412), an ampicillin resistance gene sequence (as shown in SEQ ID NO: 409), and a surrogate reporter gene. The surrogate reporter gene can encode two fluorescent proteins (the RFP sequence as shown in SEQ ID NO: 413 and the GFP sequence as shown in SEQ ID NO: 414). Recognition of the TAM and the 20nt targeted sequence at the 3' end of the TAM is possible by inserting an endonuclease downstream of RFP and an endonuclease upstream of GFP. In the absence of endonuclease activity by the detection system, the reporter gene expresses only RFP to indicate the reference gene expression level of the reporter system, while GFP is designed outside the open reading frame (ORF) and therefore not expressed. If a candidate nuclease has endonuclease activity, it can induce a double-strand break at the targeting site prior to GFP. This results in a frameshift mutation in the leading frame when the DNA is repaired via non-homologous end joining (NHEJ), causing GFP to shift from an out-of-frame state to an in-frame state and begin to be expressed. The stronger the nuclease's cleavage activity, the higher the percentage of GFP expressed after the frameshift. Therefore, GFP expression intensity is positively correlated with nuclease activity. The operating mode of the detection system is shown in Figure 1.
[0099] Method for constructing Plasmid 3: Through an oligo synthesis method, a 20nt targeted sequence containing TAM and an ECoRI enzymatic cleavage site inserted at the 5' end of the upstream sequence and a BamH1 enzymatic cleavage site inserted at the 3' end of the downstream sequence was totally synthesized. The specific construction was as follows: 1. Vector preparation. The plasmid backbone of the RGS-pcDNA3.1 plasmid vector was subjected to a double enzymatic digestion reaction using single restriction endonuclease cleavage sites ECoRI and BamHI on the plasmid vector. A linear plasmid vector fragment was obtained by agarose gel electrophoresis, and the enzymatic cleavage band was excised from the gel for recovery to obtain a purified linearized plasmid vector fragment. 2. Ligation. The nucleotide sequence of the guide reRNA obtained through gene synthesis was ligated with the linearized pUC19-U6 vector fragment using a seamless cloning ligation method. 3. Transformation and validation. Monoclonal transformants were obtained via LB agar plates to screen for ampicillin resistance, and the exact clones identified by sequencing were used as candidate plasmids for later use.
[0100] [Table 1-1]
[0101] [Table 1-2]
[0102] [Table 1-3]
[0103] [Table 1-4]
[0104] [Table 1-5]
[0105] Example 2: Detection of nuclease activity 2.1 Cell processing: After culturing commercially purchased HEK293T cells to the logarithmic growth phase, they were trypsinized into single cells with 0.25% trypsin (Thermo) and then transferred to 3 × 10⁶ wells of a 96-well cell culture plate pre-coated with PDL (Sigma). 4 The cells were added at the cell concentration per well and cultured overnight at 37°C in 5% CO2.
[0106] 2.2 Cell transfection: The three functional plasmids described in Example 1 (nuclease plasmid, reRNA-targeted sequence plasmid, and RGS bifluorescence reporter plasmid) were cotransfected into HEK293T cells. Here, 60 ng of the nuclease plasmid, 40 ng of the reRNA-targeted sequence plasmid, and 100 ng of the RGS bifluorescence reporter plasmid were added to 96-well cell culture plates, and transfection was performed using Lipofectamine™ 2000 (Invitrogen, Cat. No. 11668019) in a transfection reagent volume (μL):plasmid mass (μg) ratio of 2:1.
[0107] 2.3 Obtaining Results After transfection, cells were cultured for 48 hours, followed by typsinization, harvesting, and detection by flow cytometry. Final screening results were analyzed based on GFP positive expression.
[0108] 2.4 Detection Results Nuclease activity was obtained by flow cytometry, and the data is shown in Figure 2. In the figure, the vertical axis represents RFP expression (%) and the horizontal axis represents GFP expression (%), which reflects the cleavage activity of the nucleases. Furthermore, the statistical results of GFP expression, which reflect the activity of all nucleases, are shown in Figure 3 and Table 2. The results show that the 197 types of nucleases in this application (TP_A_1, TP_A_2, TP_A_8, TP_A_12, TP_A_18, TP_B_18, TP_B_41, TP_B_46, TP_B_70, TP_B_71, TP_B_72, TP_B_73, TP_C_23, TP_C_67, TP_C_70, TP_C_74, TP_D_1, TP_D_3, TP_D_4, TP_D_8, TP_D_17, TP_D_18, TP_D_23, TP_D_24, TP_D _25, TP_D_27, TP_D_30, TP_D_32, TP_D_40, TP_D_43, TP_D_51, TP_D_59, TP_D_61, TP_D_66, TP_D_67, TP_D_71, TP_D_72, TP_D_7 3, TP_E_2, TP_E_15, TP_E_17, TP_E_48, TP_F_56, TP_F_71, TP_F_77, TP_F_80, TP_F_83, TP_F_85, TP_G_14, TP_G_19, TP_G_20, T P_G_24, TP_G_43, TP_G_52, TP_G_53, TP_G_61, TP_G_66, TP_G_72, TP_G_75, TP_G_83, TP_G_84, TP_H_1, TP_H_3, TP_H_4, TP_H_5 , TP_H_6, TP_H_9, TP_H_11, TP_H_12, TP_H_13, TP_H_15, TP_H_18, TP_H_19, TP_H_20, TP_H_21, TP_H_23, TP_H_24, TP_H_30, TP_ H_31, TP_H_32, TP_H_34, TP_H_38, TP_H_39, TP_H_40, TP_H_43, TP_I_1, TP_I_2, TP_I_3, TP_I_4, TP_I_5, TP_I_6, TP_I_7, TP_I _8, TP_I_9, TP_I_10, TP_I_11, TP_I_12, TP_I_13, TP_I_15, TP_I_16, TP_I_17, TP_I_18, TP_I_19, TP_I_20, TP_I_21, TP_I_22,TP_I_24, TP_I_25, TP_I_26, TP_I_29, TP_I_31, TP_I_35, TP_I_37, TP_I_38, TP_I_40, TP_I_41, TP_I_44, TP_I _45, TP_I_46, TP_I_47, TP_I_48, TP_I_49, TP_I_50, TP_I_51, TP_I_52, TP_I_53, TP_I_55, TP_I_56, TP_I_58, TP_I_59, TP_I_61, TP_I_62, TP_I_64, TP_I_65, TP_I_66, TP_I_67, TP_I_70, TP_I_71, TP_I_76, TP_I_77, TP_I _79, TP_I_80, TP_I_82, TP_I_84, TP_I_85, TP_I_86, TP_I_87, TP_L_1, TP_L_4, TP_L_5, TP_L_8, TP_L_9, TP_L_1 0, TP_L_11, TP_L_12, TP_L_15, TP_L_16, TP_L_17, TP_L_21, TP_L_22, TP_L_24, TP_L_25, TP_L_26, TP_L_27, TP _L_28, TP_L_31, TP_L_32, TP_L_34, TP_L_36, TP_L_37, TP_L_39, TP_M_1, TP_M_3, TP_M_7, TP_M_11, TP_M_14, TP TP_M_17, TP_M_19, TP_M_20, TP_M_24, TP_M_31, TP_M_32, TP_M_33, TP_M_34, TP_M_35, TP_M_37, TP_M_40, TP_M_41, TP_M_43, TP_M_46, TP_M_49, TP_M_58, TP_M_65, TP_M_66, TP_M_67, TP_M_70, and TP_M_78) showed good activity.
[0109] On the other hand, the majority of nucleases with inactive or low cleavage activity were also found during the screening process (e.g., TP_A_24, TP_A_54, TP_B_23, TP_D_44, and TP_F_76 in Table 1 of this application). Compared to these inactive or low-activity nucleases, the cleavage activity of the 197 nucleases of this application was significantly higher.
[0110] In addition, Figure 11 shows the evolutionary branching diagram of the nucleases in this application based on protein sequences. The results showed that these nucleases encompass different branches of the superfamily, including ISDra2.
[0111] [Table 2-1]
[0112] [Table 2-2]
[0113] [Table 2-3]
[0114] [Table 2-4]
[0115] [Table 2-5]
[0116] Example 3: Detection of editing efficiency at endogenous gene loci 3.1 Plasmid Construction: Nuclease plasmid (plasmid 1) contains a complete set of elements capable of transcribing and expressing a candidate nuclease protein, including a constitutive promoter CMV (sequence shown in SEQ ID NO: 405) that can initiate transcription in eukaryotic cells, a candidate nuclease sequence (sequence shown in Table 1), a 5'-nuclear localization signal peptide sequence (sequence shown in SEQ ID NO: 406), a 3'-nuclear localization signal peptide sequence (sequence shown in SEQ ID NO: 407), a poly(A) sequence that terminates transcription (sequence shown in SEQ ID NO: 408), and an ampicillin resistance gene sequence (sequence shown in SEQ ID NO: 409). A method for constructing plasmid 1 is described in Example 1.
[0117] The reRNA-targeted sequence plasmid (plasmid 4) contains the reRNA sequence (as shown in Table 1), a 20nt targeted sequence of an endogenous gene inserted at the 3' end of the reRNA sequence (as shown in Table 3), a U6 promoter (as shown in Sequence ID No. 410), a PBR322 origin of replication (as shown in Sequence ID No. 411), and an ampicillin resistance gene sequence (as shown in Sequence ID No. 409). In addition, different targeted sequences of the endogenous gene (as shown in Table 2) can identify different targeted genes adjacent to the TAM sequence.
[0118] Method for constructing plasmid 4: 1. Vector preparation. An reRNA plasmid containing a BBSI-BBSI fragment (pUC19-U6-reRNA-BbsI_BbsI) was subjected to enzymatic cleavage using BbsI to obtain a linearized plasmid vector fragment by agarose gel electrophoresis. The enzymatic cleavage band was excised from the gel for recovery to obtain a purified linearized plasmid vector fragment. 2. Preparation of the 20nt target sequence of the endogenous gene. First, a 20bp DNA sequence adjacent to the 3' end of the TAM sequence was searched for in the endogenous gene sequence. Subsequently, oligonucleotides of the target sequence with BbsI excised ends were synthesized by primer synthesis. Finally, double-stranded oligonucleotides with sticky ends were synthesized by annealing. 3. Ligation. The target sequence of the endogenous gene was ligated with the linearized pUC19-U6-reRNA-BbsI_BbsI vector fragment using T4 ligase. 4. Transformation and validation. Monoclonal transformants were obtained via LB agar plates to screen for ampicillin resistance, and the exact clones identified by sequencing were used as candidate plasmids for later use.
[0119] 3.2 Cell processing: After culturing HEK293T cells (commercially purchased) until the logarithmic growth phase, they were typsinized into single cells with 0.25% trypsin (Thermo) and then transferred to 48-well cell culture plates pre-coated with PDL (Sigma) in 1 × 10⁶ wells. 5 The cells were added at the cell concentration per well and cultured overnight at 37°C in 5% CO2.
[0120] 3.3 Cell transfection: The two functional plasmids described in 3.1 (a nuclease plasmid and a reRNA-targeted sequence plasmid) were cotransfected into HEK293T cells. Here, 300 ng of the nuclease plasmid and 200 ng of the reRNA-targeted sequence plasmid were added to 48-well cell culture plates, and transfection was performed using lipofectamine™ 2000 (Invitrogen, Cat. No. 11668019) in a transfection reagent volume (μL):plasmid mass (μg) ratio of 2:1.
[0121] 3.4 PCR amplification and NGS second-generation sequencing After transfection, cells were cultured for 48 hours, followed by typsinization, harvesting, and extraction of genomic DNA. PCR primers were designed near the target sequence of the endogenous gene, and a PCR product approximately 200 bp long containing a 20 nt target sequence was amplified. The PCR product was sequenced by next-generation sequencing.
[0122] 3.5 Detection Results The results for endogenous gene editing efficiency are shown in Figure 9 and Table 3.
[0123] By analyzing sequence data generated by next-generation sequencing technology, the endogenous gene editing activity of the nuclease was determined by counting the number of base insertions and deletions (indels) generated on the targeted sequence of the endogenous gene. The results showed that the nuclease in this application exhibits good editing efficiency on different endogenous genes.
[0124] It should be noted that the above are merely preferred examples of this application and are not intended to limit it. Various modifications and changes can be made to this application for those skilled in the art. While specific embodiments have been described, there may be, or may not be foreseeable at present, substitutions, modifications, changes, improvements, and substantial equivalents of the above embodiments for the applicant or those skilled in the art. Therefore, the submitted and potentially modified claims are intended to encompass all such substitutions, modifications, changes, improvements, and substantial equivalents. It is important to note that as the art evolves, many of the elements described herein may be replaced by equivalent elements appearing after this application.
[0125] [Table 3-1]
[0126] [Table 3-2]
[0127] [Table 3-3]
[0128] [Table 3-4]
[0129] [Table 3-5]
[0130] Example 4: Detection of nuclease activity in rice protoplasts In this example, nuclease activity in rice protoplasts was evaluated using a pair of synthetic YFP gene reporting vectors (plasmids 5 and 6) constructed using the method described in Example 1 (as shown in Figure 13).
[0131] Plasmid 5 contains promoter ZmUBI (SEQ ID NO: 593), candidate nuclease sequences (as shown in Table 1), NOS terminator (SEQ ID NO: 594), promoter OsU6 (SEQ ID NO: 595), reRNA sequences corresponding to specific nucleases (as shown in Table 1), spacer sequences (SEQ ID NO: 596), and terminator (SEQ ID NO: 597).
[0132] In plasmid 6, the YFP sequence (SEQ ID NO: 598) was split by a spacer sequence (SEQ ID NO: 596) and a TAM sequence corresponding to a specific nuclease in plasmid 5 (as shown in Table 1). Furthermore, the first half of the YFP sequence overlapped with the second half. Plasmid 6 also contains promoter 35S (SEQ ID NO: 599) and terminator (SEQ ID NO: 600).
[0133] After co-transformation of rice protoplasts with plasmids 5 and 6, when the spacer sequence in plasmid 6 is cleaved by the nuclease, the partially overlapping fragment (derived from the central segment of YFP) promotes DSB repair via the homology-dependent DNA repair pathway, thus restoring the normal YFP gene (as shown in Figure 14). Therefore, the cleavage activity of the nuclease can be assessed by observing the number of YFP-positive cells.
[0134] The results of YFP fluorescence are as shown in Figs. 15 to 31, which indicate that 197 nucleases in this application have good cleavage activity in rice protoplasts (TP_A_1, TP_A_2, TP_A_8, TP_A_12, TP_A_18, TP_B_18, TP_B_41, TP_B_46, TP_B_70, TP_B_71, TP_B_72, TP_B_73, TP_C_23, TP_C_67, TP_C_70, TP_C_74, TP_D_1, TP_D_3, TP_D_4, TP_D_8, TP_D_17, TP_D_18, TP_D_23, TP_D_24, TP_D_25, TP_D_27, TP_D_30, TP_D_32, TP_D_40, TP_D_43, TP_D_51, TP_D_59, TP_D_61, TP_D_66, TP_D_67, TP_D_71, TP_D_72, TP_D_73, TP_E_2, TP_E_15, TP_E_17, TP_E_48, TP_F_56, TP_F_71, TP_F_77, TP_F_80, TP_F_83, TP_F_85, TP_G_14, TP_G_19, TP_G_20, TP_G_24, TP_G_43, TP_G_52, TP_G_53, TP_G_61, TP_G_66, TP_G_72, TP_G_75, TP_G_83, TP_G_84, TP_H_1, TP_H_3, TP_H_4, TP_H_5, TP_H_6, TP_H_9, TP_H_11, TP_H_12, TP_H_13, TP_H_15, TP_H_18, TP_H_19, TP_H_20, TP_H_21, TP_H_23, TP_H_24, TP_H_30, TP_H_31, TP_H_32, TP_H_34, TP_H_38, TP_H_39, TP_H_40, TP_H_43, TP_I_1, TP_I_2, TP_I_3, TP_I_4, TP_I_5, TP_I_6, TP_I_7, TP_I_8, TP_I_9, TP_I_10, TP_I_11, TP_I_12, TP_I_13, TP_I_15, TP_I_16, TP_I_17, TP_I_18, TP_I_19, TP_I_20, TP_I_21, TP_I_22, TP_I_24, TP_I_25, TP_I_26, TP_I_29, TP_I_31, TP_I_35, TP_I_37, TP_I_38, TP_I_40, TP_I_41, TP_I_44,TP_I_45, TP_I_46, TP_I_47, TP_I_48, TP_I_49, TP_I_50, TP_I_51, TP_I_52, TP_I_53, TP_I_55, TP_I_56, TP_I_58, TP_I_59, TP_I_61, TP_I_62, TP_I_64, TP_I_65, TP_I_66, TP_I_67, TP_I_7 0, TP_I_71, TP_I_76, TP_I_77, TP_I_79, TP_I_80, TP_I_82, TP_I_84, TP_I_85, TP_I_86, TP_I_87, TP_L_1, TP_L_4, TP_L_5, TP_L_8, TP_L_9, TP_L_10, TP_L_11, TP_L_12, TP_L_15, TP_L_16, TP _L_17, TP_L_21, TP_L_22, TP_L_24, TP_L_25, TP_L_26, TP_L_27, TP_L_28, TP_L_31, TP_L_32, TP_L_34, TP_L_36, TP_L_37, TP_L_39, TP_M_1, TP_M_3, TP_M_7, TP_M_11, TP_M_14, TP_M_17, TP_M _19, TP_M_20, TP_M_24, TP_M_31, TP_M_32, TP_M_33, TP_M_34, TP_M_35, TP_M_37, TP_M_40, TP_M_41, TP_M_43, TP_M_46, TP_M_49, TP_M_58, TP_M_65, TP_M_66, TP_M_67, TP_M_70 and TP_M_78).
Claims
1. An isolated nuclease, wherein the nuclease has the following formula: (X 1 )(X 2 ) a (X 3 )(X 4 )(X 5 ) b (X 6 )(X 7 ) c (X 8 )(X 9 ) d (X 10 )(X 11 ) e (X 12 )(X 13 ) f (X 14 )(X 15 ) g (X 16 ) (In the formula, a, b, c, d, e, f, and g are the number of amino acids; (X 1 ), (X 3 ), (X 4 ), (X 6 ), (X 8 ), (X 10 ), (X 12 ), (X 14 ), and (X 16 ) are independently polar amino acids or aliphatic amino acids; (X 2 ) is any amino acid, and a is 15 or 16; (X 5 ) is any amino acid, and b is 2; (X 7 ) is any amino acid, and c is 2, 3, or 4; (X 9 ) is any amino acid, and d is 14, 15, 16, 17, or 18; (X 11 ) is any amino acid, and e is 1 or 2; (X 13 ) is any amino acid, and f is 6; and (X 15 ) is any amino acid, and g is 5. An isolated nuclease containing the amino acid sequence shown.
2. The aforementioned (X 1 ) is a positively charged amino acid; (X 3 ) is a polar uncharged amino acid; (X 4 ) is a polar uncharged amino acid; (X 6 ) is a polar uncharged amino acid; (X 8 ) is a polar uncharged amino acid; (X 10 ) is a polar uncharged amino acid; (X 12 ) is a polar uncharged amino acid; (X 14 ) is a negatively charged amino acid; and (X 16 The nuclease according to claim 1, wherein ) is a polar uncharged amino acid.
3. The above (X 1 The nuclease according to claim 2, wherein ) is K.
4. The above (X 3 The nuclease according to claim 2, wherein ) is S or T.
5. The above (X 4 The nuclease according to claim 2, wherein ) is S or T.
6. The above (X 6 The nuclease according to claim 2, wherein C is (1).
7. The above (X 8 The nuclease according to claim 2, wherein C is (1).
8. The above (X 10 The nuclease according to claim 2, wherein C is (1).
9. The above (X 12 The nuclease according to claim 2, wherein C is (1).
10. The above (X 14 The nuclease according to claim 2, wherein ) is D.
11. The above (X 16 The nuclease according to claim 2, wherein ) is N.
12. An isolated nuclease, wherein the nuclease is (i) or (ii) to (iv) below: (i) at least one amino acid sequence as shown in any one of Sequence IDs 1 to 197; (ii) At least one sequence obtained by performing deletion, substitution, insertion, or mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids on the amino acid sequence as shown in any one of sequence numbers 1 to 197; (iii) at least one amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the amino acid sequence shown in any one of Sequence IDs 1 to 197; and (iv) An isolated nuclease having a nuclease sequence selected from variant sequences of the aforementioned nucleases having nuclease activity in at least one of the sequences obtained by further fusing the amino acid sequence shown in any one of Sequence IDs 1 to 197 with other sequences.
13. The nucleases mentioned above belong to the following groups (1) to (9): (1) At least one amino acid sequence as shown in any one of SEQ ID NOs. 52 and 113-147; (2) At least one amino acid sequence as shown in any one of SEQ ID NOs: 27-28, 36-38, 62-85 and 148-171; (3) At least one amino acid sequence as shown in any one of SEQ ID NOs: 13, 86-100 and 105-110; (4) At least one amino acid sequence as shown in any one of SEQ ID NOs: 10-11, 17-19, 29-30 and 174-180; (5) At least one amino acid sequence as shown in any one of SEQ ID NOs: 34, 35, 50, 61 and 181-189; (6) At least one amino acid sequence as shown in any one of SEQ ID NOs. 53 and 190-197; (7) At least one amino acid combination as shown in any one of sequence numbers 101, 103, 104 and 112; (8) at least one amino acid sequence as shown in any one of SEQ ID NOs: 7 and 23-25; and (9) The nuclease according to claim 12, having a nuclease sequence selected from at least one of the at least one amino acid sequences shown in any one of Sequence IDs 3, 21, and 22.
14. The nucleases mentioned above belong to the following groups (1) to (12): (1) At least one amino acid sequence as shown in any one of SEQ ID NOs: 1, 3-4, 6-7, 21-23, 50, 52, 60-61 and 113-147; (2) At least one amino acid sequence as shown in any one of SEQ ID NOs: 14, 27-28, 36-38, 45-48, 59, 62-85 and 148-171; (3) At least one amino acid sequence as shown in any one of SEQ ID NOs: 13, 43 and 86-112; (4) At least one amino acid sequence as shown in any one of SEQ ID NOs: 15-16, 24-25, 32-35 and 181-189; (5) At least one amino acid sequence as shown in any one of SEQ ID NOs: 9, 11, 17-19, 29 and 174-180; (6) At least one amino acid sequence as shown in any one of SEQ ID NOs: 10, 12, 26, 30, 42, and 58; (7) At least one amino acid sequence as shown in any one of Sequence IDs 2, 20, and 31; (8) At least one amino acid sequence as shown in either SEQ ID NOs: 8 or 51; (9) At least one amino acid sequence as shown in either SEQ ID NO: 39 or 49; (10) At least one amino acid sequence as shown in either SEQ ID NOs: 54 or 55; (11) at least one amino acid sequence as shown in any one of SEQ ID NOs. 53 and 190-197; and (12) The nuclease according to claim 12, having a nuclease sequence selected from at least one of the at least one amino acid sequences shown in any one of Sequence IDs 5, 172 and 173.
15. The nuclease according to any one of claims 1 to 14, wherein the nuclease belongs to the IS200 / IS605 family.
16. The nuclease according to claim 15, wherein the nuclease belongs to the IS605 or IS1341 subfamily.
17. The nuclease according to any one of claims 1 to 14, wherein the seed source of the nuclease includes bacteria or archaea.
18. The seed source of the aforementioned nuclease is from the phyla Actinobacteria, Aquificae, Bacteroidetes, and Candidatus / Polybacterium. Poribacteria, Chromoflexia (green non-sulfur bacteria), Cyanobacteria, Deinococcus-Thermus, Firmicutes, Planctomyces, Proteobacteria, Spirochaetes, Tenericutes, Thermotogae, Verrucomicrobia, Candidatus The nuclease according to claim 17, comprising *Micrarchaeota*, *Crenarchaeota*, or *Euryarchaeota*.
19. A guide RNA, wherein the guide RNA includes reRNA, and the reRNA includes a nucleotide sequence or a variant thereof as shown in any one of SEQ ID NOs. 198 to 394, and the guide RNA is capable of binding to a specific nuclease.
20. The guide RNA according to claim 19, wherein the reRNA comprises at least one nucleotide sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the nucleotide sequence shown in any one of SEQ ID NOs. 198 to 394.
21. The guide RNA according to claim 20, wherein the reRNA comprises at least one nucleotide sequence as shown in any one of sequence numbers 198 to 394.
22. The guide RNA according to claim 21, wherein the reRNA is at least one of the nucleotide sequences shown in any one of sequence numbers 198 to 394.
23. The guide RNA according to any one of claims 19 to 22, wherein the guide RNA further includes a targeted sequence capable of recognizing a targeted gene adjacent to a transposon-associated motif.
24. The guide RNA according to claim 23, wherein the targeted sequence is at least one having a length of 10 to 50, 10 to 40, 10 to 30, or 15 to 25 nucleotides.
25. The aforementioned transposon-related motif is given by the following formula: (X 17 ) h (X 18 )(X 19 )A(X 20 ) (In the formula, h is the number of nucleotides; A is adenine deoxyribonucleotide; (X 17 ) is any deoxyribonucleotide, and h is 0 or 1; (X 18 ) is cytosine deoxyribonucleotide or thymine deoxyribonucleotide; (X 19 ) is cytosine deoxyribonucleotide, thymine deoxyribonucleotide, or guanine deoxyribonucleotide; and (X 20 ) is any deoxyribonucleotide. The guide RNA according to claim 23, comprising the nucleotide sequence shown.
26. A nucleic acid wherein the nucleic acid encodes a nuclease according to any one of claims 1 to 18 and / or a guide RNA according to any one of claims 19 to 25.
27. A nucleic acid construct comprising the nucleic acid described in claim 26.
28. The nucleic acid according to claim 27, wherein the nucleic acid construct comprises a promoter, and the promoter comprises CMV, EF1a, SV40, PGK, UbC, human beta-actin, CAG, TRE, UAS, Ac5, GFAP, polyhedrin promoter, TBG, ALB, ApoEHCR-hAAT, CaMKIIa, GAL1, TEF1, GDS, ADH1, CaMV35S, Ubi, H1, U6, T7, T7lac, Sp6, araBAD, trp, lac, Ptac, or pL.
29. The nucleic acid according to claim 27, wherein the nucleic acid construct is modified by 5'-terminal cap formation and / or 3'-terminal polyadenylation, and the nucleic acid construct retains the activity of a nuclease and / or guide RNA.
30. The nucleic acid according to claim 27, wherein the nucleic acid construct is modified by thiophosphate bond modification, 2'-MOE (2-O-(2-methoxyethyl)), PNA (peptide nucleic acid), GNA (glycerol nucleic acid), LNA (locked nucleic acid), GalNAc (N-acetylgalactosamine), LNP (lipid nanoparticles), and PNP (peptide nanoparticles).
31. A composition, wherein the composition is A substance comprising an IS200 / IS605 family nuclease or a functional fragment thereof, or comprising a nucleic acid encoding the said IS200 / IS605 family nuclease or a functional fragment thereof, wherein the nuclease or functional fragment thereof has endonuclease activity; and A composition comprising a guide RNA or a nucleic acid encoding the guide RNA, wherein the guide RNA can bind to a specific nuclease.
32. The composition is selected from at least one of the following groups (1) to (198), where any one of the following groups (1) to (198) includes a nuclease-related sequence and a guide RNA-related sequence. (1) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 1 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 198; (2) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 2 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 199; (3) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 3 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 200; (4) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 4 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 201; (5) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 5 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 202; (6) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 6 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 203; (7) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 7; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 204; (8) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 8 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 205; (9) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 9; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 206; (10) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 10; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 207; (11) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 11; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 208; (12) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 12; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 209; (13) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 13; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 210; (14) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 14; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 211; (15) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 15 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 212; (16) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 16 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 213; (17) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 17; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 214; (18) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 18 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 215; (19) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 19; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 216; (20) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 20; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 217; (21) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 21 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 218; (22) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 22; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 219; (23) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 23; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 220; (24) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 24; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 221; (25) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 25; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 222; (26) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 26; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 223; (27) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 27; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 224; (28) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 28; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 225; (29) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 29 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 226; (30) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 30; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 227; (31) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 31; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 228; (32) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 32; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 229; (33) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 33; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 230; (34) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 34; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 231; (35) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 35; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 232; (36) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 36; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 233; (37) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 37; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 234; (38) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 38; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 235; (39) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 39; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 236; (40) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 40; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 237; (41) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 41 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 238; (42) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 42; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 239; (43) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 43; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 240; (44) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 44; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 241; (45) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 45 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 242; (46) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 46; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 243; (47) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 47; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 244; (48) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 48 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 245; (49) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 49; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 246; (50) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 50; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 247; (51) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 51; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 248; (52) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 52; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 249; (53) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 53; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 250; (54) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 54; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 251; (55) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 55; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 252; (56) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 56; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 253; (57) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 57; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 254; (58) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 58; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 255; (59) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 59; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 256; (60) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 60; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 257; (61) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 61 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 258; (62) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 62; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 259; (63) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 63; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 260; (64) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 64; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 261; (65) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 65; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 262; (66) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 66 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 263; (67) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 67; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 264; (68) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 68; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 265; (69) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 69; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 266; (70) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 70; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 267; (71) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 71; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 268; (72) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 72; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 269; (73) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 73; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 270; (74) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 74; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 271; (75) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 75; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 272; (76) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 76; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 273; (77) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 77; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 274; (78) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 78; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 275; (79) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 79; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 276; (80) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 80; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 277; (81) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 81; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 278; (82) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 82; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 279; (83) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 83; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 280; (84) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 84; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 281; (85) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 85; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 282; (86) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 86; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 283; (87) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 87; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 284; (88) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 88 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 285; (89) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 89 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 286; (90) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 90; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 287; (91) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 91; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 288; (92) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 92; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 289; (93) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 93; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 290; (94) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 94; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 291; (95) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 95; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 292; (96) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 96; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 293; (97) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 97; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 294; (98) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 98 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 295; (99) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 99; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 296; (100) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 100; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 297; (101) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 101; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 298; (102) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 102; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 299; (103) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 103; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 300; (104) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 104; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 301; (105) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 105; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 302; (106) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 106; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 303; (107) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 107; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 304; (108) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 108; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 305; (109) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 109; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 306; (110) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 110; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 307; (111) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 111; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 308; (112) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 112; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 309; (113) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 113 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 310; (114) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 114; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 311; (115) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 115; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 312; (116) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 116; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 313; (117) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 117; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 314; (118) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 118; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 315; (119) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 119; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 316; (120) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 120; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 317; (121) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 121; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 318; (122) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 122; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 319; (123) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 123; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 320; (124) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 124; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 321; (125) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 125; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 322; (126) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 126; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 323; (127) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 127; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 324; (128) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 128; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 325; (129) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 129; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 326; (130) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 130; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 327; (131) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 131; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 328; (132) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 132; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 329; (133) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 133; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 330; (134) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 134; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 331; (135) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 135; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 332; (136) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 136; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 333; (137) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 137; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 334; (138) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 138; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 335; (139) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 139; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 336; (140) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 140; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 337; (141) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 141; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 338; (142) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 142; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 339; (143) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 143; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 340; (144) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 144; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 341; (145) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 145; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 342; (146) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 146; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 343; (147) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 147; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 344; (148) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 148; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 345; (149) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 149; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 346; (150) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 150; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 347; (151) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 151; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 348; (152) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 152; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 349; (153) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 153; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 350; (154) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 154; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 351; (155) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 155; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 352; (156) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 156; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 353; (157) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 157; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 354; (158) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 158; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 355; (159) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 159; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 356; (160) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 160; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 357; (161) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 161; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 358; (162) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 162; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 359; (163) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 163; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 360; (164) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 164; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 361; (165) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 165; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 362; (166) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 166; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 363; (167) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 167; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 364; (168) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 168; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 365; (169) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 169; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 366; (170) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 170; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 367; (171) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 171; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 368; (172) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 172; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 369; (173) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 173; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 370; (174) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 174; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 371; (175) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 175; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 372; (176) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 176; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 373; (177) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 177; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 374; (178) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 178; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 375; (179) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 179; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 376; (180) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 180; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 377; (181) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 181; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 378; (182) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 182; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 379; (183) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 183; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 380; (184) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 184; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 381; (185) The nuclease-related sequence is an amino acid sequence containing the sequence shown in Sequence ID No. 185 or a nucleic acid encoding the amino acid sequence; and the guide RNA-related sequence is a nucleotide sequence containing the sequence shown in Sequence ID No. 382; (186) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 186; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 383; (187) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 187; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 384; (188) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 188; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 385; (189) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 189; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 386; (190) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 190; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 387; (191) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 191; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 388; (192) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 192; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 389; (193) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 193; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 390; (194) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 194; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 391; (195) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 195; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 392; (196) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 196; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 393; (197) The nuclease-related sequence is an amino acid sequence or nucleic acid encoding the amino acid sequence as shown in Sequence ID No. 197; and the guide RNA-related sequence is a nucleotide sequence as shown in Sequence ID No. 394; (198) Any one variant from the aforementioned groups (1) to (197), The nuclease-related sequence is the amino acid sequence of the variant of the nuclease in each group, or a nucleic acid sequence encoding the variant, and the variant is one of the following (i) to (iii): (i) at least one sequence obtained by performing deletion, substitution, insertion, or mutation of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids on the amino acid sequence of the nuclease in each group; (ii) at least one amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% identity with the amino acid sequence shown in any one of Sequence IDs 1 to 197; and (iii) At least one sequence obtained by further fusing the amino acid sequence as shown in any one of Sequence IDs 1 to 197 with other sequences. The composition according to claim 31, having a variant sequence of the aforementioned nuclease having nuclease activity selected from the above.
33. The composition according to claim 32, wherein the guide RNA-associated sequence further comprises a targeted sequence capable of recognizing a targeted gene adjacent to a transposon-associated motif.
34. The composition according to claim 33, wherein the targeted sequence is at least one having a length of 10 to 50, 10 to 40, 10 to 30, or 15 to 25 nucleotides.
35. The aforementioned transposon-related motif is given by the following formula: (X 17 ) h (X 18 )(X 19 )A(X 20 ) (In the formula, h is the number of nucleotides; A is adenine deoxyribonucleotide; (X 17 ) is any deoxyribonucleotide, and h is 0 or 1; (X 18 ) is cytosine deoxyribonucleotide or thymine deoxyribonucleotide; (X 19 ) is cytosine deoxyribonucleotide, thymine deoxyribonucleotide, or guanine deoxyribonucleotide; and (X 20 ) is any deoxyribonucleotide. The composition according to claim 33, comprising the nucleotide sequence shown.
36. A recombinant vector comprising a nucleic acid encoding a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, or a composition according to any one of claims 31 to 35.
37. The recombinant vector according to claim 36, wherein the recombinant vector comprises a recombinant cloning vector, a recombinant eukaryotic expression plasmid, or a recombinant viral vector.
38. The recombinant vector according to claim 37, wherein the recombinant eukaryotic expression plasmid comprises pcDNA3.1, pCMV, pUC18, pUC19, pUC57, pBAD, pET, pENTR, pGenlenti, or pAAV.
39. The recombinant vector according to claim 37, wherein the recombinant viral vector includes a recombinant adenovirus vector, a recombinant adeno-associated virus vector, a recombinant retrovirus vector, a recombinant herpes simplex virus vector, or a recombinant vaccinia virus vector.
40. Recombinant host cell, wherein the recombinant host cell comprises a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, or a recombinant vector according to any one of claims 36 to 39.
41. The recombinant host cell according to claim 40, wherein the recombinant host cell includes an animal cell, a plant cell, an algal cell, a fungal cell, a yeast cell, or a bacterial cell.
42. The recombinant host cell according to claim 41, wherein the animal cell comprises a mammalian cell; and the plant cell comprises a monocotyledonous plant cell or a dicotyledonous plant cell.
43. The mammalian cells include primary cells (e.g., mesenchymal stem cells, endothelial cells, epithelial cells, fibroblasts, keratinocytes, melanocytes, smooth muscle cells, and immune cells), immortalized cell lines (e.g., HEK293, NIH-3T3, RAW-264.7, STO, VERO, CT26, hTERT immortalized human endothelial / epithelial / fibroblast / keratinocyte / tubule / cell line), and cancer cell lines (e.g., Hela, HepG2 / 3, HL-60, HT-1080, HT-29, A549, SW620, HCT-15, HCT116, MDA-MB-231, MCF7, SK Recombinant host cells according to claim 42, comprising -OV-3, PANC-1, AsPc-1, THP-1, Huh7, KG-1, RAJI, HB-CB, Jurkat, K562, CRL5826, CHO, MDCK, and Renca), embryonic stem cell lines (e.g., H1, H9, WIBR2, WIBR3, G-Olig2, ESF158, RW.4, R1, and D3) and their differentiated cells, or induced pluripotent stem cell lines and their differentiated cells; wherein the monocotyledonous plant cells or the dicotyledonous plant cells include rice cells, maize cells, or soybean cells.
44. A method for introducing a double-strand break into a targeted gene in a host cell, the method comprising delivering to a host cell a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, or a recombinant vector according to any one of claims 36 to 39.
45. A method for deleting, replacing, or inserting a target gene in a host cell, the method comprising delivering to a host cell a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, or a recombinant vector according to any one of claims 36 to 39.
46. A method for obtaining a host cell in which a targeted gene is deleted, replaced, or inserted, the method comprising delivering to a host cell a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, or a recombinant vector according to any one of claims 36 to 39.
47. The method according to any one of claims 44 to 46, wherein the delivery method includes cationic liposome delivery, lipoid nanoparticle delivery, cationic polymer delivery, vesicle-exosome delivery, gold nanoparticle delivery, polypeptide and protein delivery, retrovirus delivery, lentivirus delivery, adenovirus delivery, adeno-associated virus delivery, electroporation, Agrobacterium infection, or gene gun.
48. The method according to any one of claims 44 to 46, wherein the host cell includes an animal cell, a plant cell, an algal cell, a fungal cell, a yeast cell, or a bacterial cell.
49. The method according to claim 48, wherein the animal cells include mammalian cells; and the plant cells include monocotyledonous plant cells or dicotyledonous plant cells.
50. The mammalian cells include primary cells (e.g., mesenchymal stem cells, endothelial cells, epithelial cells, fibroblasts, keratinocytes, melanocytes, smooth muscle cells, and immune cells), immortalized cell lines (e.g., HEK293, NIH-3T3, RAW-264.7, STO, VERO, CT26, hTERT immortalized human endothelial / epithelial / fibroblast / keratinocyte / tubule / cell line), and cancer cell lines (e.g., Hela, HepG2 / 3, HL-60, HT-1080, HT-29, A549, SW620, HCT-15, HCT116, MDA-MB-231, MCF7). The method according to claim 49, comprising, SK-OV-3, PANC-1, AsPc-1, THP-1, Huh7, KG-1, RAJI, HB-CB, Jurkat, K562, CRL5826, CHO, MDCK, and Renca), embryonic stem cell lines (e.g., H1, H9, WIBR2, WIBR3, G-Olig2, ESF158, RW.4, R1, and D3) and their differentiated cells, or induced pluripotent stem cell lines and their differentiated cells; wherein the monocotyledonous plant cells or the dicotyledonous plant cells comprise rice cells, maize cells, or soybean cells.
51. Use of a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, a recombinant vector according to any one of claims 36 to 39, or a recombinant host cell according to any one of claims 40 to 43 for introducing double-strand breaks into a targeted gene in a host cell.
52. Use of a nuclease according to any one of claims 1 to 18 for deleting, replacing or inserting a target gene in a host cell, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, a recombinant vector according to any one of claims 36 to 39, or a recombinant host cell according to any one of claims 40 to 43.
53. The use according to any one of claims 51 to 52, wherein the host cell includes an animal cell, a plant cell, an algal cell, a fungal cell, a yeast cell, or a bacterial cell.
54. The use according to claim 53, wherein the animal cells include mammalian cells; and the plant cells include monocotyledonous plant cells or dicotyledonous plant cells.
55. The mammalian cells include primary cells (e.g., mesenchymal stem cells, endothelial cells, epithelial cells, fibroblasts, keratinocytes, melanocytes, smooth muscle cells, and immune cells), immortalized cell lines (e.g., HEK293, NIH-3T3, RAW-264.7, STO, VERO, CT26, hTERT immortalized human endothelial / epithelial / fibroblast / keratinocyte / tubule / cell line), and cancer cell lines (e.g., Hela, HepG2 / 3, HL-60, HT-1080, HT-29, A549, SW620, HCT-15, HCT116, MDA-MB-231, MCF7). The use according to claim 54, comprising, SK-OV-3, PANC-1, AsPc-1, THP-1, Huh7, KG-1, RAJI, HB-CB, Jurkat, K562, CRL5826, CHO, MDCK, and Renca), embryonic stem cell lines (e.g., H1, H9, WIBR2, WIBR3, G-Olig2, ESF158, RW.4, R1, and D3) and their differentiated cells, or induced pluripotent stem cell lines and their differentiated cells; wherein the monocotyledonous plant cells or the dicotyledonous plant cells include rice cells, maize cells, or soybean cells.
56. Use of a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, a recombinant vector according to any one of claims 36 to 39, or a recombinant host cell according to any one of claims 40 to 43 for preparing drugs or preparations for gene therapy, cell therapy, genome research, and stem cell induction and post-induction differentiation.
57. A kit comprising a nuclease according to any one of claims 1 to 18, a guide RNA according to any one of claims 19 to 25, a nucleic acid according to claim 26, a nucleic acid construct according to any one of claims 27 to 30, a composition according to any one of claims 31 to 35, a recombinant vector according to any one of claims 36 to 39, or a recombinant host cell according to any one of claims 40 to 43.
Citation Information
Patent Citations
Reprogrammable TNPB polypeptides and use thereof
WO2022159892A1