Composition, method, and use
Inhibiting type I interferon signaling with specific inhibitors addresses the challenge of persistent RA-related pain by providing effective pain relief without impacting inflammatory disease activity, revealing a novel mechanism for managing RA pain.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- 4E THERAPEUTICS INC
- Filing Date
- 2024-05-01
- Publication Date
- 2026-06-02
AI Technical Summary
Current analgesic compounds fail to provide effective and long-term relief for rheumatoid arthritis (RA)-related pain, which persists even in patients achieving inflammatory remission, highlighting the need for new analgesic strategies that specifically target the underlying mechanisms of pain.
Inhibiting type I interferon signaling, particularly through the use of type I interferon inhibitors, to block the interaction between type I interferon and its receptor or downstream signaling, thereby preventing and reversing RA-related pain without significantly affecting inflammatory disease activity.
Type I interferon inhibitors effectively treat and prevent RA-related pain by targeting the specific cytokine pathway, offering a novel approach that is mechanically separate from inflammatory disease management.
Smart Images

Figure 2026517798000181 
Figure 2026517798000182 
Figure 2026517798000183
Abstract
Description
[Technical Field]
[0001] Related applications This application claims priority and interest to UK Patent Application No. 2306456.1 filed on 2 May 2023 and UK Patent Application No. 2401979.6 filed on 13 February 2024, the entirety of each of these applications being incorporated herein by reference.
[0002] Areas of disclosure The present invention relates to a type I interferon inhibitor, related uses and kits for use in treating or preventing pain associated with rheumatoid arthritis (RA) in patients, and a method for identifying patients who have such pain and require treatment with such inhibitors. [Background technology]
[0003] Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by chronic inflammation and progressive joint deterioration, causing significant pain and stiffness. It is estimated that about 1% of the world's population will develop RA. The pain associated with RA is extremely debilitating and affects the quality of life of those affected.
[0004] The breakdown of T cell and / or B cell tolerance initiates the complex processes of RA. This leads to the activation and subsequent production of various antibodies that recognize autoantibodies, including modified IgG (rheumatoid factor), citrullinated or carbamylated proteins, and disease-specific IgG autoantibodies directed towards type II collagen. Circulating autoantibodies activate the innate and adaptive immune systems through the production of various inflammatory factors, including cytokines. Cytokines can be classified as circulating pro-inflammatory and / or inflammatory cytokines in the joints, but anti-inflammatory cytokines and natural cytokine antagonists are also involved.
[0005] RA is accompanied by increased levels of different classes of cytokines, which change dynamically throughout the disease process, thereby exhibiting hierarchical dominance in different combinations of cytokines. Examples of cytokines with altered systemic levels associated with RA include increased levels of the pro-inflammatory cytokines interleukin (IL)-1, IL-32, IL-33, IL-36, tumor necrosis factor (TNF)-α, as well as increased levels of IL-1, TNF-α, IL-6, IL-15, IL-16, IL-17, IL-18, granulocyte-macrophage colony-stimulating factor (GM-CSF), and various types of interferon (IFN). Some anti-inflammatory cytokines associated with RA include IL-10, IL-4, IL-13, IL-20, IL-27, IL-35, IL-37, IL-38, as well as native cytokine antagonists for the IL-1 receptor, soluble forms of IL-1 and TNF receptors, and IL-18 binding proteins (Alunno et al, 2017; Selim et al, 2017; Ridgley et al, 2018).
[0006] Pain is the most troublesome symptom of rheumatoid arthritis (RA), and its cause is not well understood. People with RA may experience pain at rest and during daily activities, and may show increased sensitivity to induced pain in response to stimuli such as normal movement and gentle pressure on joints. In addition, other evidence of widespread pain and central sensitization is common and contributes to pain in people with RA (Heisler et al, 2020).
[0007] Pain associated with rheumatoid arthritis (RA) is thought to be a complex interplay of factors, including changes in immune cells and several areas of the nervous system, such as primary afferent sensitization, spinal cord sensitization, and changes at the upper spinal cord level. Peripheral nerve dysfunction, including increased excitability and ectopic activity, is likely to contribute to pain. Such sensitization may be caused by pro-inflammatory factors present systemically and / or in the synovial fluid in RA, including TNF, IL-1, IL-6, IL-17, interferons, and other cytokines, inflammatory lipids (e.g., PGE2), neuropeptides (CGRP, SP, etc.), and growth factors (e.g., NGF) (Cao et al, 2020).
[0008] Disease-modifying antirheumatic drugs (DMARDs) may be effective in bringing about remission of inflammatory diseases, but pain often persists even without inflammation (Vergne-Salle et al, 2020). While DMARDs can reduce pain from high levels associated with high disease activity, complete pain relief is rare in practice. Chronic pain is estimated to remain in about 10–25% of patients receiving DMARD treatment who have achieved inflammatory remission.
[0009] As a result, RA patients often try to treat the pain symptoms of RA with analgesics, but the analgesic compounds currently available that are prescribed to people with RA do not provide an effective and / or long-term solution for preventing or treating RA-related pain.
[0010] Therefore, persistent pain associated with rheumatoid arthritis remains a real problem.
[0011] For many RA patients, the priority is the pursuit of adequate pain relief. The lack of adequate pain relief in RA patients illustrates the great need to find new analgesic strategies. In particular, there is a need for new analgesic strategies for pain relief during the weeks before DMARDs become effective, for patients with inadequate inflammatory disease suppression, and for patients who have been successfully treated but still experience persistent pain. Identifying specific cell types and the molecular mechanisms of pain associated with RA would enable more specific and effective analgesics. [Overview of the project] [Means for solving the problem]
[0012] Against this backdrop, the inventors unexpectedly discovered that RA-related pain is highly dependent on a specific type of peripheral nociceptor that can be sensitized through type I interferon signaling. The inventors also surprisingly found that sensitization and increased pain are reversible by blocking a specific type of cytokine signaling: type I interferon signaling. Consistently, inhibiting the interaction between type I interferon and its receptor, or blocking downstream signaling of the type I interferon receptor, can both prevent and completely reverse RA-related pain. Particularly, and surprisingly, blocking type I interferon signaling did not strongly affect inflammatory disease activity, suggesting that pain is a process mechanically separated from inflammatory disease. The inventors also show that type I interferon signaling present in RA patients indicates that the type I interferon class is the major pain-causing cytokine.
[0013] Accordingly, in one embodiment, the present invention provides a type I interferon inhibitor for use in treating or preventing pain associated with rheumatoid arthritis in patients.
[0014] In a related aspect, the present invention provides the use of type I interferon inhibitors in the manufacture of pharmaceuticals for treating or preventing pain associated with rheumatoid arthritis in patients.
[0015] In a further relevant aspect, the present invention provides a method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising the step of administering a type I interferon inhibitor to the patient.
[0016] Therefore, the present invention represents a novel and advantageous approach for treating or preventing RA-related pain in patients. As will be further discussed herein, the inventors' discovery that pain can be treated or prevented by specifically targeting the type I interferon pathway is remarkable.
[0017] Preferred non-limiting embodiments that embody specific aspects of the present invention will be described with reference to the following drawings. [Brief explanation of the drawing]
[0018] Figure 1, including panels 1A-1I: Perturbations of primary sensory neuron types in antibody-induced arthritis.
[0019] [Figure 1A] A mouse model of cartilage antibody (Cab)-induced arthritis. [Figure 1B] Arthritis mice exhibit transient arthritis (clinical score) from day 6 to day 23 after Cab injection in C57BL / 6N mice. [Figure 1C] Mechanical allodynia was present as early as 4 hours and persisted until 63 days after Cab injection (n=6). [Figure 1D] An illustrative example of DRG neuronal populations driven by different Cre and CreERT2 mouse strains. Percentage of reflex response to blue light stimulation in these mouse strains (crossed with R26-ChR2) under different stages of RA. [Figure 1E]Uniform manifold approximation and projection (UMAP) shows the distribution of cell clusters (86,052 cells) from scRNA-seq of DRG from control and RA mice. NonmyelSC, non-myelin Schwann cells; MyelSC, myelin Schwann cells; VSMC, vascular smooth muscle cells; EC, endothelial cells. [Figure 1F] The heatmap represents the predicted similarity score of individual neurons to neuron types, based on annotations using a machine learning classifier by Usoskin et al (2015). [Figure 1G] UMAP of neuronal clusters (6,200 cells) from scRNA-seq of DRG from control and RA mice. [Figure 1H] The average of the maximum predicted scores of the neurons predicted within each cluster. [Figure 1I] Neuronal perturbations in arthritis at different disease stages. Figure 2, including panels 2A-2J: IFN signaling in sensory neurons during arthritis. [Figure 2A] Mean scores of arthritis-inducing co-regulatory gene modules in DRG neurons across different time points. [Figure 2B] Heatmap of mean expression of arthritis-induced modules in DRG neurons across different time points in RA. [Figure 2C] Dot plot of GO biological pathway analysis for module genes. [Figure 2D] Visualization of the string network of the co-regulation module. [Figure 2E] Box plots of gene module scores for individual neuron clusters at different time points in arthritis. [Figure 2F] Activity heatmaps of four recurrent SCENIC regulons in individual neuron types during arthritis. [Figure 2G] Serum levels of IFNa at different time points in arthritis. [Figure 2H]Pain-like behavior tests with von Fley filaments (threshold) and 2g of von Fley filaments (tremor count) indicate that Endo-bN-acetylglucosaminidase (EndoS)-treated Cab antibodies failed to initiate pain. [Figure 2I] The box plots show the co-regulatory gene module scores for neurons from control mice, EndoS-treated mice, and IFNAR1 antibody-blocked mice. [Figure 2J] Expression heatmaps of top differentially regulated genes at day 0.25 in DRG neurons of arthritis (left) and mice injected with EndoS-treated Cab or blocked by IFNAR1 antibody (right). Figure 3, including panels 3A-3G: Polymodal C-nociceptors are involved in arthritis-related pain. [Figure 3A] Skin-nerve recordings. Representative C-fiber recordings (CV < 1.2 m / s) showing activity during force ramp application (10 seconds, 0–100 mN) from mice injected with saline ("C-type control", center panel) or Cab ("C-type RA", right panel), with inserts showing action potential waveforms induced during mechanical stimulation. The mechanical threshold in each fiber was determined using this force ramp protocol. [Figure 3B] Mechanical thresholds of mice injected with physiological saline ("control") or Cab ("RA"). Dots represent individual values for each fiber, and lines represent the mean and standard deviation [unpaired t-test (*p<0.05)]. [Figure 3C] Mechanically induced firing frequencies in mice injected with physiological saline ("control") or Cab ("RA") during carbum application, where thick lines represent the average number of action potentials in a vial per second, and shaded areas represent SEM (p<0.01 by two-way ANOVA with repeated measures for therapeutic effect; *p<0.05, †p<0.005 by unpaired t-test against control). [Figure 3D] Number of mechanically induced action potentials during force lamp application [unpaired t-test (*p<0.05)]. [Figure 3E]Mechanical escape threshold (Von Frye filament test), coping response to 2g of Von Frye filament (tremor count), and acetone test using subthreshold blue light (470nm) in Gfra3-CreERT2*R26-ChR2 (Gfra3-CHR2) mice (n=8). [Figure 3F] Mechanical and cold sensitivity (n=8) in Gfra3-CreERT2*R26-ArchT (Gfra3-ArchT) mice before and after exposure to yellow light (566 nm) (0.44 mWatt / mm2, 45 mins). [Figure 3G] Percentage of reflex response to different von Frey filaments with and without application of yellow light (0.44 mWatt / mm2, 45 min), before antibody injection (baseline) and after antibody injection (early and late RA) (n=8). *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05. Figure 4, including panels 4A-4F: Sustained interferon signaling causes arthritis-related pain. [Figure 4A] Perturbations in non-neuronal DRG cells at different stages of arthritis. [Figure 4B] The KEGG pathway of differentially expressed genes in endometrial macrophages. [Figure 4C] Quantitative PCR of INFa and IFNb expression in DRGs. [Figure 4D] Reversal of arthritis-induced pain with TYK2 inhibitor treatment. Five oral administrations of a TYK2 inhibitor (15 mg / kg, twice daily, days 13-21) blocked Cab-induced mechanical hypersensitivity, but vehicle treatment (EtOH:TPGs:PEG300=5:5:90) was ineffective (n=5-6). [Figure 4E] Systemic administration of IFNAR1 mAb (1 mg, ip) does not affect arthritis compared to the isotype group (mouse IgG). [Figure 4F]IFNAR1 mAb administration one hour prior to Cab injection prevents mechanical allodynia, and delivery on days 22 and 45 reverses established pain associated with arthritis (n=5). *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05. [Figure 5] Phosphorylation status of STAT1 (S-727), MNK1 (T-197 / 202), and eIF4E (S-209) in the dorsal root ganglia. Phospho-STAT1, MNK1, and eIF4E are increased in mice with chondroantibody-induced arthritis. Numbers indicate different animals. Cont, control mouse; RA-d33, animal-derived sample 33 days after arthritis induction; RA-d33 anti-IFNR animal with IFNAR1 (interferon α / β receptor subunit 1) neutralization 33 days after arthritis induction. 2 hours, 12 hours, and 33 hours refer to the time after arthritis induction. Figure 6, including panels 6A-6B: Mechanical and cold hypersensitivity in mice with chondroantibody-induced arthritis. [Figure 6A] In C57BL / 6N mice, mechanical allodynia began 4 hours after antibody injection and continued until day 63, with a significant decrease in escape threshold at 4 hours, 12 days, 30 days, and 63 days compared to control mice using the von Frey up-down test (n=6). Increased tremor counts were observed in both the acetone test and with 2g of von Frey filaments in both the early and late phases. No difference in latency between the Cab group and the control group was detected in the Hargreaves test or pinprick test. [Figure 6B] Immunohistochemical characterization of mouse strains by comparing reporters with neuronal cluster markers. NF200, Neurofilament 200; CGRP, Calcitonin gene-related peptide; IB4, Isolectin B4; TH, Tyrosine hydroxylase. Scale bars for inserts = 100 μm and 20 μm. Figure 7, including panels 7A-7E: Single-cell RNA sequencing in the DRG of antibody-injected mice. [Figure 7A] An illustrative workflow for scRNA-seq sampling of cells in DRG from antibody-induced arthritis mice. [Figure 7B] The violin plot represents sample metrics after initial quality control of scRNA-seq data. [Figure 7C] The dot plot represents the top three marker genes for each major cell type in sequenced cells in the DRG. [Figure 7D] The dot plot represents the top three marker genes for each neuronal cluster of DRG neurons. [Figure 7E] UMAP shows the DRG neuron cluster distribution and the same distribution with randomly sampled (25%) datasets, where cells are mixed from control and RA samples. Figure 8, including panels 8A–8K: Sc-RNA seq datasets of neuronal and immune cells in the DRG of RA. [Figure 8A] UMAP represents the distribution of cell clusters (86,052 cells) from different time points in RA and control DRG samples. [Figure 8B] Stacked bar plot (percentage) of cell type composition at different stages of RA. [Figure 8C] UMAP of the distribution of subclusters of immune cells. [Figure 8D] Stacked bar plots (percentages) of immune cell composition at different stages of rheumatoid arthritis (RA). [Figure 8E] CCL2 (MCP-1) and CCL4 (MIP-1β) in serum from arthritis-derived animals. [Figure 8F] The feature plots show the expression of Ccl2 and Ccl4 in control and RA12 hour single-cell datasets (9500 cells each). [Figure 8G] Stacked bar plots (percentages) of neuronal compositions at different stages of arthritis. [Figure 8H] Heatmap of DRG neuron type and regulon activity over time, based on SCENIC analysis. [Figure 8I]UMAP of the distribution of sequenced cells from control DRG samples, EndoS-treated Cab antibody arthritis samples, and Cab antibody arthritis samples treated with IFNAR1 antibody. [Figure 8J] (I) UMAP of the distribution of cell clusters from DRG samples. [Figure 8K] The stacked bar plots represent the composition of immune cell subclusters in (J) (percentage). [Figure 9-1] Gene expression of cytokine receptors in DRG neuron types. In the upper panel, dot plots represent the gene expression of cytokine receptors (TNF-α receptor, CCR, CXCR, CSF receptor, interleukin receptor, Fcγ receptor, and type I interferon receptors IFNAR1 and IFNAR2) for each neuronal cluster of DRG neurons, and in the lower panel, dot plots represent the gene expression of cytokine receptors in the PEP1 cluster at different time points in arthritis. Figure 10, including panels 10A–10D: TrkA-positive population of sensory neurons is responsible for arthritis-related pain. [Figure 9-2] Same as above. [Figure 10A] These are representative C-type fiber recordings during static force application from mice injected with physiological saline ("C-type control," upper panel) or Cab ("C-type RA," lower panel), with inserts showing all action potential waveforms induced during mechanical stimulation. [Figure 10B] Mean number of mechanically induced action potentials during static indentation (p=0.05 by two-way ANOVA with repeated measures for therapeutic effect, p<0.05 by unpaired t-test against control). [Figure 10C]In Wnt1-Cre*R26-ChR2 (Wnt1-CHR2) mice stimulated with blue light, normal mice exhibited a lower escape threshold in the von Fli up-down test and increased tremor counts in the 2g von Filament and Acetone test (below reflex threshold: 12.7 × 10⁻³ mWatt / mm², below coping threshold: 18.5 × 10⁻³ mWatt / mm²), while the combination of blue LED (below reflex threshold: 11.7 × 10⁻³ mWatt / mm², below coping threshold: 14.5 mWatt / mm²) further exacerbated hypersensitivity to mechanical and cold stimuli in RA mice (n=6~7) in both the early and late stages. In Mrgprd-Cre*R26-ChR2 (MrgprD-CHR2) mice, a reduced escape threshold was observed only in the von Fly test combined with blue light below the threshold in normal mice, and no difference was detected between the group without light and the group without light. In TrkA-CreERT2*R26-ChR2 (TrkA-CHR2) mice, a reduced escape threshold was observed in the early and late RA phases with blue light (below the reflection threshold: 12.6 × 10⁻³ mWatt / mm²) compared to the group without light, and only the combination of blue light (below the coping threshold: 31.6 × 10⁻³ mWatt / mm²) could enhance the number of tremors in the 2g von Fly filament and acetone test in the early phase. In the Sst-Cre*R26-ChR2 (SSt-CHR2) or Vglut3-Cre*R26-ChR2 (Vglut3-CHR2) strains, no effect involving gain of function induced by blue LED was observed in normal mice or RA mice. [Figure 10D]In normal TrkA-CreERT2*R26-ArchT (TrkA-ArchT) mice, exposure to yellow LED light (0.44 mWatt / mm2, 30 mins) reduced the percentage of reflex responses to 1.4 g and 2.0 g of von Fleigh filaments. In antibody-induced arthritis mice, inhibition of the TrkA population by yellow light (0.44 mWatt / mm2, 30 mins) stimulation reversed mechanical and cold allodynia and mechanical coping in both early and late RA phases (n=7-8). *** indicates p<0.001, ** indicates p<0.01, and * indicates p<0.05. Figure 11: The PEP1 population, including panels 11A-11C, was involved in normal mechanical and cold sensitization. [Figure 11A] Gfra3+ neurons (TOM) in the DRG of Gfra3-CreERT2*R26-Tom (Gfra3-Tom) mice, stained with DAPI (blue) as a nuclear counterstain. Scale bar = 100 μm. [Figure 11B] Percentage of blue light reflection response (n=8) in Gfra3-CreERT2*R26-ChR2 (Gfra3-CHR2) mice, where the response curve shifted to the left after antibody injection. [Figure 11C] The combination of blue light (below the reflection threshold: 30.2 × 10⁻³ mWatt / mm²; below the coping threshold: 39.6 × 10⁻³ mWatt / mm²) can increase mechanical and cold sensitivity by lowering the mechanical threshold and increasing the number of coping episodes in the 2g von filament and acetone test, but does not affect thermal sensitivity in Gfra3-CHR2 mice (n=25). After inhibition with yellow LED (0.44 mWat / mm², 45 min), Gfra3-CreERT2*R26-ArchT (Gfra3-ArchT) mice show only a higher escape threshold compared to the von filament test before exposure to yellow light (n=16). Tests *** show p<0.001, and ** shows p<0.01. [Figure 12]The TYK2 inhibitor duklavacitinib suppressed pain in mice with chronic arthritis. Oral administration of the TYK2 inhibitor duklavacitinib (15 mg / kg, twice daily, 7 times) reversed joint pain, dexterity, and limb function, but the analgesic effect of duklavacitinib washed out 24 hours after the last injection (n=10). ***p<0.001. [Figure 13] Systemic inhibition of MNK completely blocked RA-induced pain. (A) IP injection of the MNK1 / 2 inhibitor, eFT508 (DMSO:PEG300:Tween®-80:tomivocertib / HY-100022 in saline, 1 mg / kg) at 48 days post-antibody injection completely reversed joint pain (tremor count in squeeze test) and mechanical hypersensitivity in antibody-induced arthritis mice (n=10). (B) Oral administration of 4ET-03-053 (MNK1 / 2 inhibitor, PEG300:PEG300 in saline, 1 mg / kg) at 51 days post-antibody injection to arthritis mice. Joint pain (squeeze test) was measured at 1 hour and 24 hours after delivery of 4ET-03-053 (n=6). *p<0.05, ***p<0.001. [Figure 14] Local inhibition of MNK-attenuated type I IFN-induced mechanical hypersensitivity. In veh+IFN mice, intraplantar (i.pl.) administration of IFNA3 (300U / 10μl) induced a mechanical hypersensitivity response in the foot accompanied by a lower avoidance threshold (allodynia) and a greater number of tremors (coping). Pretreatment with the MNK inhibitor eFT508 (10:40:50 MSO:PEG300:2 mg / kg in saline) delayed the onset of IFN-induced mechanical allodynia by 24 hours and reversed it more rapidly. There was no change in mechanical sensitivity in BSA (0.1%, control) injected mice (n=5). [Figure 15]eIF4E inhibitors reversed chronic RA pain. 56 days after antibody injection, the eIF4E / eIF4G interaction inhibitor, 4EGI-1 (DMSO:PEG300:Tween®-80:1 mg / kg in saline in a 5:40:5:50 ratio), completely reversed joint and mechanical allodynia and coping in arthritis mice (n=5), but the effect washed out within 24 hours. **p<0.01. [Figure 16A] MNK inhibitors blocked the hyperexcitability of DRG neurons induced by IFN-α. (A) Representative traces of action potential firing in the control (BSA, n=9 cells) and IFN-α (n=11 cells) groups. The number of spikes was significantly higher in the IFN-α group at each ramp intensity. In the graph on the right, for each ramp current, the left bar represents the control value and the right bar represents the IFN value. (B) Representative traces of action potential firing in IFN+ vehicle (n=13 cells) and IFN+MNK1 / 2 inhibitor (n=15 cells). Increased firing induced by type I interferon was reversed by pre-conditioning with the MNK1 / 2 inhibitor (eFT508, 10uM, 1h). In the graph on the right, for each ramp current, the left bar represents the IFN+ vehicle value and the right bar represents the IFN+MNK1 / 2 inhibition value. (C) Small to medium-sized DRG neurons were sampled for patch-clamp electrophysiology experiments. Resting membrane potentials were similar between groups, and there was no significant effect of IFN-α treatment. Differences between groups were assessed using two-way ANOVA followed by Fisher's LSD test. *p<0.05. [Figure 16B] Same as above. [Figure 16C] Same as above. [Figure 17] Type I IFN protein levels were elevated in donor tissue regeneration (DRG) from RA patients with joint pain. Western blotting showed increased IFNα protein and phospho-STAT (S727) levels in donor DRG from rheumatoid arthritis (n=4) and patients with joint pain compared to healthy donor tissue without rheumatoid arthritis or pain (n=6). *p<0.05. [Modes for carrying out the invention]
[0020] Rheumatoid arthritis (RA) is a complex autoimmune disease in which many cytokines and immune cells play a role. The causes associated with RA are not well understood, and many factors are thought to be involved. For example, any of the long list of numerous pro-inflammatory cytokines associated with RA, inflammatory lipid mediators, neuropeptides, and NGF can cause sensory sensitization and pain when injected into experimental animals. These include, for example, TNF-α, IL-1b, IL-6, IL-8, IL-12, IL-15, IL-17, IL-18, IL-23, prostaglandin E2 (PGE2), NGF (nerve growth factor), GM-CSF, CGRP, SP, and PGE2 (Cunha et al, 2000; Poole et al, 1995; Amann et al, 1996; Iyengar et al, 2017; Kim et al, 2011; Lee et al, 2020; Ji et al, 2021; Barragan-Iglesias et al, 2020; Achuthan et al, 2016; Raoof et al, 2018). In Ridgley et al. (2018), the cytokines IL-23 / Th17 axis and IL-8 were associated with the progression of joint pain. Inhibitors targeting multiple cytokine pathways (e.g., GM-CSF, G-CSF, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-17, IL-22, IL-23, IFN), i.e., JAK1 / JAK2 inhibitors, have been shown to alleviate RA-related pain (Simon et al, 2021). In addition, inflammatory mediators are thought to contribute to RA-related pain.
[0021] The present invention, as described herein, specifically inhibits the type I interferon cytokine class to alleviate pain associated with rheumatoid arthritis (RA). Such type I inhibitors do not necessarily affect the inflammatory components of RA. Previously, it was thought that pain associated with RA was caused by various interacting cytokines, so the inventors' discovery was unexpected and surprising, as it was not known that specifically inhibiting type I interferons could alleviate pain associated with RA.
[0022] Until the present invention, the onset and progression of pain in rheumatoid arthritis (RA) was thought to be associated with numerous different cytokines, and the key molecules and their relative involvement in pain remained unclear. Attempts to treat pain by targeting other cytokine types have failed; for example, adalimumab (an antibody that specifically inhibits the tumor necrosis factor (TNF) cytokine class) failed to treat RA-related pain.
[0023] Those skilled in the art will be familiar with type I interferons. Interferons are a family of potent immune-stimulating cytokines, broadly divided into three subtypes: type I interferons (α, β, ε, κ, and ω), type II interferons (γ), and type III interferons (λ).
[0024] Therefore, type I interferons include one or more selected from the group: interferon-α, interferon-β, interferon-ε, interferon-κ, and interferon-ω.
[0025] Interferon-α is the most abundant, best-characterized, and exists in 13 different but homologous subtypes, excluding pseudogenes. Different genes can be active in different cells and under different conditions. In some embodiments, interferon-α is one or more selected from the list including: IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21. In one embodiment, type I interferon is interferon-α.
[0026] In contrast, interferon-beta is represented by only one gene (IFNB1). In another embodiment, type I interferon is interferon-beta.
[0027] Type I interferon production is strictly regulated to levels that are virtually undetectable in healthy individuals. However, during pro-inflammatory states, type I interferon can be produced rapidly in large quantities. Plasma cell-like dendritic cells (pDCs) that are rich in intracellular pattern recognition receptors such as Toll-like receptor (TLR)-7 and TLR-9 are particularly prominent in their tendency to secrete type I interferon. In ligation of type I interferon receptors, type I interferon exerts its effects on intracellular signaling proteins, including but not limited to IRF7, IRF9, STAT1 and STAT2, JAK1, TYK2, AKT, MAPK, and NFκB. These then induce upregulated expression of a stereotypical set of genes known as interferon-stimulating genes (ISGs). ISGs are upregulated in a subset of patients with rheumatoid arthritis (RA). Examples of ISGs include, but are not limited to, IFIT1, BST2, IFITM3, B2M, OASL or EPSTI1, HERC5, IFI44L, ISG15, LY6E, MX1, MX2, RSAD2 or IFI27, IFI44, IFI44L, IFI6, RSAD2, or other genes activated by type I interferon intracellular signaling.
[0028] The effects of type I interferon are pro-inflammatory, including dendritic cell maturation and activation, Th1 and Th17 polarization, and reduced regulatory T cells (T1). reg ) Function, as well as increased B cell activation and subsequent antibody production.
[0029] Type I interferons, interferon-alpha and interferon-beta, along with a long list of other cytokines and inflammatory factors, have been previously considered in relation to the onset and / or progression of RA disease (Castaneda-Delgado et al, 2017; Ridgley et al, 2018 and van der Pouw Kraan, 2007). It is quite clear from all of these studies that the actual role (if any) type I interferons played in the pathogenesis of RA was not clear.
[0030] As discussed herein and in the appended examples, the present invention surprisingly identifies the crucial role of type I interferon in pain associated with rheumatoid arthritis (RA), and that such pain can be treated or prevented by inhibiting type I interferon.
[0031] The term "inhibitor" includes the meaning of a small molecule or biological substance that reduces or prevents the activity of one or more of its targets, such as a particular reactant, catalyst, or enzyme. As understood, the present invention relates to inhibitors of type I interferon, and therefore reduces or prevents the activity of one or more of type I interferon. Such activities include pro-inflammatory effects, dendritic cell maturation, dendritic cell activation, Th1 and Th17 polarization, and T reg This may include decreased function, increased B cell activation, increased antibody production, activation of type I interferon receptors, activation of type I interferon-stimulated intracellular signaling, expression of one or more type I interferon-stimulating genes, and / or expression of one or more type I interferon-suppressing genes.
[0032] In some embodiments, type I interferon inhibitors specifically target the type I interferon pathway or specifically inhibit type I interferon. In this context, "specifically" means that the type I interferon inhibitor reduces or prevents the activity of one or more type I interferons to a substantially (or significantly) higher level than it reduces or prevents the activity of one or more other types of molecules, such as another cytokine. Thus, in this case, the primary function of the inhibitor is to reduce or prevent the activity of one or more type I interferons.
[0033] "Patients" include patients who are experiencing RA-related pain and patients who may develop RA-related pain.
[0034] As is understood, rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by chronic inflammation and progressive deterioration of the joints. The progression of the disease is classified into early stages (joint pain, stiffness, swelling, and tenderness), middle stages (inflammation damages the cartilage of the joint bones, reducing the patient's mobility and range of motion), severe stages (further increased impact on mobility and movement, development of joint deformities, and formation of rheumatoid nodules), and end stages (symptoms become much more chronic and severe, making it difficult to manage daily activities and potentially requiring assistive devices).
[0035] In preferred embodiments, the patient is a human or an animal (such as a fish, bird, reptile, amphibian, or mammal). Mammals include, but are not limited to, primates (including humans), cattle, sheep, goats, horses, dogs, cats, minks, rabbits, guinea pigs, hamsters, ferrets, rats, mice, or cattle, sheep, horses, dogs, cats, rodents, or mouse species.
[0036] Various delivery systems are known and can be used to administer type I interferon inhibitors to patients, including, for example, encapsulation in various forms (liposomes, microparticles, microcapsules, etc.), delivery via small molecules or proteins, delivery via gene vectors (viruses, etc.), and gene therapy (DNA or RNA). Methods of administration include, but are not limited to, intradermal, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. Type I interferon inhibitors can be administered by any convenient route, for example, by infusion or bolus injection, by absorption through the epithelial or mucocutaneous lining (e.g., oral mucosa, rectal, and intestinal mucosa), and may be administered together with other bioactive agents. Type I interferon inhibitors can also be delivered in vesicles, particularly liposomes. Administration can be systemic or topical. Those skilled in the art will be able to select the appropriate route of administration for a particular patient and type I interferon inhibitor therapy. The substance may be administered to the patient in therapeutic doses.
[0037] "RA-related pain" includes the meaning of at least one type of pain that is related to and / or caused by RA, as discussed herein.
[0038] Pain may be associated with the onset of rheumatoid arthritis (RA). The onset of RA can be measured, for example, using a disease activity score (DAS) that indicates the severity of RA disease activity at a given moment. For example, DAS28 is a measure of disease activity in RA, where the number 28 refers to the 28 joints examined in this assessment.
[0039] Pain associated with RA can be identified, determined, assessed, and / or quantified using recognized tests and scales. Those skilled in the art can select appropriate methods—for example, by: (i) Use a questionnaire such as the Visual Analog Pain Scale (VAS) or Patient Pain VAS to assess "experienced pain," and / or (ii) Clinical examination and quantification of joint tenderness and / or swelling (possible 28 swollen joint counts and tender joint counts), and / or (iii) Measure the distance (mm) on the 10cm line between the “pain-free” anchor and the patient’s mark and provide a score range of 0 to 100 (higher scores indicate greater pain intensity). Based on the distribution of pain VAS scores as no pain, mild pain, moderate pain, or severe pain, it is recommended to use the following cut points for pain VAS: no pain (0-4mm), mild pain (5-44mm), moderate pain (45-74mm), and severe pain (75-100mm); and / or (iv) A standardized "Quantitative Sensory Test (QST)" for assessing neuropathic pain (German Research Network for Neuropathic Pain (DFNS)).
[0040] It will be understood that pain associated with alternative diagnoses (i.e., pain not related to and / or caused by RA, but instead associated with other conditions such as psoriatic arthritis, acute viral polyarthritis, polyarthritis, calcium pyrophosphate deposition disease, and systemic lupus erythematosus (SLE)) can be ruled out by other tests such as X-rays (of the hands, wrists, and feet), magnetic resonance imaging (MRI), serological studies for infection, and synovial fluid analysis.
[0041] "To treat RA-related pain" includes reducing the severity of at least one type of RA-related pain in a patient. This term includes reducing or preventing the progression or worsening of pain. This term also includes reducing or delaying the positive prognosis of RA-related pain.
[0042] "Preventing RA-related pain" means inhibiting the manifestation of at least one type of RA-related pain, i.e., the subject may be pain-free, or pain may be reduced with the administration of a substance such as a type I interferon inhibitor, or may be pain-free at all.
[0043] In one embodiment, the pain is functional pain such as inflammatory joint pain.
[0044] "Dysfunction pain" encompasses a specific type of inflammatory pain that may occur and / or be experienced in the skin, muscles, tendons, bones, and joints through communication between immune cells and other non-neuronal cells and sensory neurons. Dysfunction pain includes peripheral nerve dysfunction, such as increased excitability and / or ectopic activity of afferent nerves. This may occur independently of peripheral stimulation of nociceptors and may be caused by central sensitization or other central action mechanisms. Dysfunction pain is caused by impairment of normal sensory nociceptive function, resulting in spontaneous or stimulus-induced chronic pain. In contrast, nociceptive pain is the body's "normal" defense against harmful or potentially harmful stimuli.
[0045] Peripheral sensitization can also facilitate the subsequent amplification of signaling in central circuits at all levels of ascending neural pathways, a process referred to as central sensitization. Such central sensitization in the spinal cord is attributed to the expansion of the receptive field through the temporal and spatial summation of repetitive nociceptive inputs, the increased pain sensitivity resulting from enhanced neurotransmission via N-methyl-D-aspartate (NMDA) receptors leading to synaptic changes, and the activation of spinal microglia and secondary myelitis through local cytokine release. Pain associated with RA has been suggested to involve changes in the brain (upper spinal cord). Pain is continuously regulated through descending pathways that integrate inputs about mood, stress, sleep, etc., that influence pain perception. The runaway area of descending pain regulation is the rostral ventromedial medulla, which integrates input information and determines the amount of pain signaling that enables it to be transmitted through the spinal cord to the brain (Cao et al, 2020).
[0046] Peripheral sensitization can result from joint inflammation. This pain sensitivity indicates sensitization of peripheral or central nociceptive pathways and can be the cause of clinical pain reported by people with RA (Joharatnam et al, 2015).
[0047] The term "joint" includes the meaning of an anatomical area of a patient where two or more skeletal components are connected. For example, the metacarpophalangeal joint is the joint between the first and second phalanges, the proximal interphalangeal joint is where the bones of the fingers meet the bones of the hand, and the elbow joint is the connection between the humerus, ulna, and radius. A joint may include the bone itself, cartilage, ligaments, joint capsule, synovial membrane, bursa, and / or synovial fluid. Joints can be fibrous joints, cartilaginous joints, synovial joints, ankle joints, ellipsoidal joints (such as those found at the wrist and the base of the index finger), elbow joints, glenohumeral joints, humeral (shoulder) joints, sacroiliac joints, hip joints, knee joints, and temporomandibular joints.
[0048] "Inflammatory joint pain" means that pro-inflammatory factors (e.g., cytokines, lipid mediators, peptides, growth factors) are present systemically (e.g., in the serum) and / or locally at the site of pain, e.g., in the joint (e.g., synovial joint), resulting in pain, swelling, and tenderness. Inflammatory pain can be assessed by identifying clinical inflammation.
[0049] "Clinical inflammation" implies that the level of inflammation can be detected using standard clinical measures and markers of inflammation. Those skilled in the art will be able to select appropriate measures, such as erythrocyte sedimentation rate (ESR or "sed" rate), swollen / tender joint count, hand tenderness, C-reactive protein (CRP), ferritin, plasma fibrinogen, and acute phase reactants (APRs) such as platelet count. Those skilled in the art will also be able to select appropriate markers of inflammation, such as pro-inflammatory cytokines present systemically and / or locally at the site of pain, such as TNF, IL-6, IL-1, GM-CSF, IL-17, IL-20, IL-23, and IL-24. Change and statistical tests used to compare cytokine levels will be known to those skilled in the art.
[0050] In one embodiment, the pain is not inflammatory pain. “Not inflammatory pain” means that pain is present in the absence of clinical inflammation. Non-inflammatory pain is pain that is not related to a measure of inflammation and is common in patients with RA. In this case, the patient experiences RA-related pain despite the presence of apparent absence (or “healthy” levels) of pro-inflammatory factors. While not bound by theory, the inventors believe that in such situations, some level of asymptomatic inflammation remains.
[0051] In one embodiment, the pain is not neuropathic pain or neuroplastic pain.
[0052] In alternative embodiments, the pain is neuropathic pain or neuroplastic pain. Neuropathic pain may occur alone or in combination with other forms of pain, such as inflammatory pain. In some embodiments where type I interferon inhibitors may be particularly useful, neuropathic pain occurs in combination with inflammatory pain.
[0053] "Neurogenic pain" means pain caused by a lesion, disease, and / or injury to the nervous system. This can include the peripheral nervous system (PNS) and / or the central nervous system (CNS). In some embodiments, neuropathic pain may be peripheral neuropathic pain, central neuropathic pain, or mixed (peripheral and central) neuropathic pain. Appropriate tests for determining the presence of pain will be well known to those skilled in the art. For example, appropriate tests for determining whether pain is neuropathic pain will be well known to those skilled in the art, such as using questionnaires (e.g., VAS) and quantitative sensory tests. For example, a clinician may look for underlying lesions to the CNS or PNS, or triggers consistent with the onset of neuropathic pain. Magnetic resonance imaging (MRI), quantitative sensory testing (QST), abdominal muscle assessment, or skin biopsy may also be used.
[0054] "Neuroplastic pain" means that pain symptoms are caused by learned neural pathways in the brain, not by persistent structural damage or disease of the body. Neuroplastic pain does not involve damage or alteration of the input sensory system. Neuroplastic changes in brain structure and function can result in chronic pain and may also be involved in the maintenance of pain symptoms. Appropriate tests for determining the presence of pain will be well known to those skilled in the art. For example, clinical examinations to determine the presence of pain not proportional to the injury, burning and stabbing pain of ongoing / spontaneous pain, and / or neurological examinations to determine the presence of nerve damage, or neurological examinations to determine the presence of lesions / injuries in the spinal cord or brain.
[0055] Regardless of the origin of the pain and the mechanisms of action involved (as discussed herein), the pain “experience” can be perceived as the same thing by the patient. For example, non-inflammatory pain processes, such as those involved in some neuropathic pain, can produce the same pain symptoms as those produced by inflammatory pain processes.
[0056] In one embodiment, the pain is chronic pain. “Chronic pain” includes pain that persists beyond the expected healing period. Chronic pain is in contrast to acute pain, which has a much shorter duration. Chronic pain can be nociceptive and / or neuropathic chronic pain. Chronic pain often persists regardless of treatment for rheumatoid arthritis (RA).
[0057] Preferably, “chronic pain” is pain that is present for 12 weeks or more, 3 months or more, 13 weeks or more, 14 weeks or more, 15 weeks or more, 16 weeks or more, 4 months or more, 5 months or more, 6 months or more, 7 months or more, 8 months or more, 9 months or more, 10 months or more, 11 months or more, 12 months or more, 1 year or more, 13 months or more, 14 months or more, 15 months or more, 16 months or more, 17 months or more, 18 months or more, 2 years or more, 3 years or more, 4 years or more, 5 years or more, 10 years or more, or for the remainder of the patient’s life.
[0058] "Present pain" means that the pain may persist, recur, and / or progress over that period.
[0059] "Pain may persist over time" means that the pain is continuous, so that at all time points assessed, the pain may be at the same, lower, or higher intensity than at the start. For example, when tested over multiple time points, there may be no statistically significant changes in the perceived pain tests and measures discussed herein. Therefore, the pain may persist over time without improving or worsening.
[0060] "Pain may recur over time" means that there is an initial statistically significant improvement in at least one of the recognized pain tests and measures, but the improvement is reversed at a later stage. Therefore, pain may recur for more than 12 weeks, 3 months, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 2 years, 3 years, 4 years, 5 years, 10 years, or for the remainder of the patient's life, even if it is absent at one or more time points assessed.
[0061] "Pain may progress over time" means that, when tested over multiple time points, there is a statistically significant improvement in at least one of the recognized pain tests and measures discussed herein. Therefore, pain improves (i.e., decreases) over time.
[0062] In yet another embodiment, the pain is one or more selected from the group consisting of analgesia, allodynia, hyperalgesia, and arthralgia.
[0063] "Pain hypersensitivity" refers to a condition in which a patient experiences increased sensitivity to pain, i.e., an abnormal pain response. In patients with pain hypersensitivity, the pain threshold (the point at which something unpleasant or offensive causes pain) may be lower compared to patients without pain hypersensitivity. Different types of pain hypersensitivity include hyperalgesia and allodynia. Hyperalgesia and allodynia can be caused by neurological and non-neurological mechanisms (e.g., skin, joints) and can be experienced in focal areas, discrete areas, or in a more diffuse, whole-body form.
[0064] "Allodynia" refers to a pain response to stimuli that would not normally cause pain. In allodynia, the patient experiences pain in situations where the stimulus would not normally cause pain (i.e., a non-painful stimulus can be experienced as painful). Different types of allodynia include mechanical / tactile allodynia, static mechanical allodynia, dynamic mechanical allodynia, thermal (high or low temperature) allodynia, and motor allodynia (i.e., pain is caused by normal movement of a joint or muscle). Those skilled in the art will recognize the use of preferred methods for determining allodynia, such as cotton swabs or brushes, pressure algorithms and standardized monofilaments for evaluating dynamic mechanical allodynia, quantitative sensory testing (QST), thermal testers, or the von Frye test used in RA patients or animal models of RA.
[0065] "Hyperalgesia" refers to an exaggerated or inappropriate response to painful stimuli. In hyperalgesia, a patient may experience pain in situations where pain is "normal," but the intensity of the pain may be experienced more severely than in patients without hyperalgesia. Patients with hyperalgesia may respond more quickly to painful stimuli than in patients without hyperalgesia. Painful stimuli experienced by patients with hyperalgesia may last longer than the same painful stimuli experienced by the patient or other patients when hyperalgesia is absent. Hyperalgesia can be primary, secondary, referred, visceral, or a combination thereof. Those skilled in the art will recognize preferred methods for determining hyperalgesia, for example, by applying a painful stimulus to the patient and evaluating the pain experienced, quantitative sensory testing (QST), or pressure algorithms and weighted pinprick stimuli.
[0066] In these forms of increased sensitivity, neurons may have increased excitability in the absence of any stimulus (chronic or spontaneous pain) and / or produce an increased number of action potentials compared to normal neurons after a stimulus (hypersensitivity to pain). Increased sensitivity can be caused by a lower firing threshold, decreased polarity, larger and / or longer receptor potential amplitudes, and more efficient generation of action potentials from receptor potentials. In some situations, increased sensitivity is caused by ectopic activity of sensory neurons, such as inactive or silent nociceptors, which can be considered "non-silent" or "wake-up."
[0067] "Arthralgia" means that the pain is joint pain. Such joint pain may be present in the presence or absence of disease inflammation, for example, during or after remission of RA, or in RA patients where the inflammatory disease is well suppressed. Preferably, RA-related joint pain that should be prevented or treated is that which is not present in the prodromal stage of RA. Those skilled in the art will recognize suitable methods for determining joint pain, for example, by using questionnaires and performing a physical examination of the patient.
[0068] To be understood and as described herein, pain is, - Systemic inflammation, and / or - Local inflammation, and / or - Related to and / or potentially caused by clinical inflammation.
[0069] "Systemic inflammation" means that inflammation can occur anywhere in the body. Inflammatory factors (e.g., cytokines, lipid mediators, peptides, growth factors) can be present in blood cells and / or serum.
[0070] "Local inflammation" means that inflammation can be present only in a localized area of the body. Inflammatory factors (e.g., cytokines, lipid mediators, peptides, growth factors) may be present in specific organs, joints, or other locations in the body, and may not be present in other locations. Inflammatory factors may differ from or overlap with those present in systemic inflammation.
[0071] "Caused by systemic inflammation, and / or local inflammation, and / or clinical inflammation" means that the pain is a direct result of systemic inflammation, and / or local inflammation, and / or clinical inflammation.
[0072] "Related to systemic inflammation, and / or local inflammation, and / or clinical inflammation" means that pain is not necessarily caused by systemic inflammation, and / or local inflammation, and / or clinical inflammation, but rather that pain coexists with such inflammatory conditions.
[0073] In one embodiment, the pain is not related to and / or caused by rheumatoid arthritis inflammatory disease activity.
[0074] "Rheumatoid arthritis inflammatory disease activity" means that an RA patient is in an active RA inflammatory disease state. "Active RA inflammatory disease state" means that inflammation reaches a level of clinical inflammation that can be assessed as described herein, for example, by the Clinical Disease Activity Index (CDAI), by periodic assessment of patient index data (RAPID3), or by the DAS28 score. Inflammatory disease activity can be classified as low activity, moderate activity, or high activity, as is known in the art. For example, a DAS28 score of 2.6 or higher and less than 3.1 indicates low activity, a score of 3.1 or higher and less than 5.1 indicates moderate activity, and a score of 5.1 or higher indicates high activity.
[0075] A patient may be in an inactive RA inflammatory disease state before, during, or after being considered to have RA. A patient is considered to have RA if diagnosed in such a way, including a differential diagnosis of other inflammatory polyarthritis conditions.
[0076] Patients who are in an inactive RA inflammatory disease state before being considered to have RA may have experienced any of the pains described herein and, similarly, have circulating antibodies against citrullinated peptides (ACPA) / cyclic citrullinated peptides (CCP). In preferred embodiments, the inactive RA inflammatory disease state is not present before the patient has RA.
[0077] Patients in an inactive RA inflammatory disease state while considered to have "RA" may be able to suppress the inflammatory disease with DMARDs, but discontinuing DMARD use will either (i) cause the patient to return to an active RA inflammatory state, or (ii) cause the patient to remain in an inactive RA inflammatory disease state (i.e., RA remission). "Remission" includes the meaning of a reduction or disappearance of inflammatory signs and / or symptoms. A person skilled in the art will be able to select an appropriate method for determining remission, e.g., an indicated remission score of less than 2.6.
[0078] "Not caused by inflammatory disease activity of rheumatoid arthritis" means that the pain is not a direct result of RA inflammatory disease activity (also called active RA inflammatory disease state). Therefore, eliminating or reducing this RA inflammatory disease activity should not alleviate or stop the pain.
[0079] "Pain unrelated to inflammatory disease activity in rheumatoid arthritis" means that pain does not necessarily occur simultaneously with inflammatory disease activity in RA. Therefore, pain can be present even when there is no inflammatory disease activity in RA (also called an inactive RA inflammatory state).
[0080] In another embodiment, the pain is located in the affected joint and / or the opposite portion of the affected joint and / or the head of the affected joint and / or the tail of the affected joint.
[0081] "Affected joint" includes the meaning of the joint in which inflammation, swelling, tenderness, and / or pain first developed.
[0082] "The opposite side of the affected joint" includes the meaning of the part of the joint opposite to the affected joint in relation to the left-right axis.
[0083] The terms "head of the affected joint" and "tail of the affected joint" refer to the cranial (upper) and caudal (lower) parts of the affected joint relative to the craniocaudal axis. For example, if the affected joint is the right knee joint, the opposite part of the affected joint can be the left knee joint, the head of the affected joint can be any of the shoulder joints, and the tail of the affected joint can be any of the ankle joints.
[0084] In alternative or additional embodiments, the pain is extra-articular pain. “Extra-articular pain” means that the pain is not joint pain. Such extra-articular pain, discomfort, or itching may be experienced as originating from the patient's skin.
[0085] In one embodiment, type I interferon inhibitors do not prevent or treat inflammatory diseases accompanied by increased type I interferon signaling.
[0086] "Inflammatory diseases with increased type I interferon signaling" include any of the following: rheumatoid arthritis, polyarthritis, Ecardi-Goutierre syndrome (AGS) 1, systemic lupus erythematosus (SLE), Crohn's disease, psoriasis, psoriatic arthritis, osteoarthritis, dermatomyositis, primary Sjögren's syndrome, systemic scleroderma, type I interferon disease, and fibromyalgia.
[0087] In one embodiment, pain is present alongside disease inflammation.
[0088] "Coexisting with disease inflammation" means that pain can be present in a patient at the same time as they are in an active rheumatoid arthritis (RA) inflammatory state. Patients may or may not be receiving treatment such as disease-modifying antimicrobial agents (DMARDs). If a patient is receiving DMARD treatment and is still in an active RA inflammatory state, it is likely that the inflammation is not completely suppressed.
[0089] In an alternative embodiment, pain is present even when there is no disease inflammation.
[0090] Patients may have transitioned from an active rheumatoid arthritis (RA) inflammatory state to an inactive RA inflammatory state due to treatment with disease-modifying antimicrobial agents (DMARDs). If a patient is receiving DMARD treatment and is no longer in an active RA inflammatory state, it can be assumed that their inflammation is suppressed.
[0091] In preferred embodiments, pain is not present prior to disease inflammation. "Prior to disease inflammation" includes the prodromal stage of RA. Patients exhibiting both pain (such as joint pain) and circulating antibodies against citrullinated peptides (ACPA) / cyclic citrullinated peptides (CCP) may be considered to be in the prodromal stage of RA.
[0092] In one embodiment, pain is present during or after remission of disease inflammation.
[0093] "During remission of disease inflammation" means that pain may be present in patients who have a reduction in inflammatory signs and / or symptoms. Patients may or may not still be in an active rheumatoid arthritis (RA) inflammatory disease state. The reduction in inflammatory signs and / or symptoms can be caused by treatments such as disease-modifying anti-inflammatory drugs (DMARDs). During remission of disease inflammation, RA patients enter an inactive rheumatoid arthritis (RA) inflammatory disease state and may still depend on such treatments to remain in that state.
[0094] "Post-remission of disease inflammation" means that pain may be present in patients where inflammatory signs and / or symptoms are no longer present / measurable. The patient may still be in an inactive RA inflammatory disease state. The disappearance of inflammatory signs and / or symptoms may be triggered by treatments such as DMARDs. After remission of disease inflammation, RA patients become independent of such treatments and remain in an inactive RA inflammatory disease state.
[0095] As is understood and as described herein, patients may have had or are currently receiving pain treatment, but pain may persist, and / or recur, and / or progress.
[0096] Pain treatments are known in the art and may include nonsteroidal anti-inflammatory drugs (NSAIDs) such as celecoxib, diclofenac, etoricoxib, ibuprofen, and naproxen; corticosteroids; glucocorticoids (e.g., prednisolone); acetaminophen (also known as paracetamol); weak opioids such as codeine, dextropropoxifen, and tramadol; antidepressants such as tricyclic antidepressants; anticonvulsants; or combinations thereof. If pain persists, recurs, or progresses, pain treatment may be considered ineffective, suboptimal, and / or failed.
[0097] NSAIDs are estimated to alleviate symptoms in only about 15 out of 100 people. Steroids and weak opioids can help reduce pain and swelling in affected joints, but long-term use can cause severe side effects, so they are mainly used for the short-term management of RA pain (McWilliams et al, 2022; Day et al, 2019). Paracetamol has weak anti-inflammatory effects and has been shown to be less effective than NSAIDs in relieving RA-related pain (Bullock et al, 2018; Evidence review G Analgesics, NICE guidelines, 2018).
[0098] "The patient may have received pain treatment" means that the patient is no longer receiving pain treatment at the time the pain assessment described herein is performed.
[0099] "The patient may be receiving pain treatment" means that the patient is still receiving pain treatment when the pain assessment described herein is performed.
[0100] In one embodiment, pain is related to and / or caused by increased type I interferon signaling in the patient.
[0101] Changes in type I interferon signaling (increase or decrease) can be detected in serum and at different locations in the patient (such as sensory neurons and surrounding tissues or cells). Depending on the location of the sample (e.g., blood, synovial membrane, or sensory neuron, nerve, or skin sample), the markers for increased / decreased type I interferon signaling may differ. Therefore, the method for determining whether type I interferon signaling is different compared to a healthy control is adapted depending on the type of sample obtained from the patient.
[0102] The statement "Pain is associated with type I interferon signaling in patients" implies that pain is not necessarily caused by an increase in type I interferon signaling in patients, but rather that pain can occur concurrently with an increase in type I interferon signaling in patients.
[0103] The statement "pain is caused by increased type I interferon signaling in the patient" implies that pain is a direct result of increased type I interferon signaling in the patient. Therefore, reducing the increased type I interferon signaling in the patient may alleviate or stop the pain.
[0104] Preferably, increased type I interferon signaling - Increased type I interferon intracellular signaling in patients - Increased levels of type I interferon in patients, - Increased activation of type I interferon receptors in patients, - Increased expression of one or more type I interferon-stimulating genes in patients, and / or - Including reduced expression of one or more type I interferon suppressor genes in the patient.
[0105] As can be understood, patients may have increased levels of type I interferon without increased intracellular signaling, for example, due to intracellular negative feedback mechanisms that can lead to the maintenance or reduction of signaling.
[0106] Alternatively, patients may have increased levels of type I interferon and / or increased activation of type I interferon receptors without increased expression of one or more interferon-stimulating genes, for example, due to intracellular inhibitors of interferon-induced transcription (which may or may not affect signaling).
[0107] “Increased” signaling, levels, activation, and expression, and “decreased” expression, mean, for example, that signaling, levels, activation, or expression are statistically significantly increased or decreased compared to baseline in patients without pain or in healthy controls. In some embodiments, the p-values are <0.05, <0.04, <0.03, <0.02, <0.01, <0.001, and <0.0001.
[0108] Those skilled in the art will be able to select an appropriate assay for measuring intracellular signaling of type I interferon in patients.
[0109] Those skilled in the art will be able to select an appropriate assay for measuring the level of type I interferon in a patient. Methods may include, but are not limited to, quantitative PCR (qPCR), single-cell or bulk RNA sequencing, hybridization-based methods, or enzyme-linked immunosorbent assays (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), mass spectrometry, and reporter cell assays. For example, the transcription level of any of the interferon-α genes listed herein can be evaluated.
[0110] Those skilled in the art will be able to select an appropriate assay for measuring the activation of type I interferon receptors. Methods may include, but are not limited to, quantitative PCR (qPCR), single-cell or bulk RNA sequencing, hybridization-based methods, or enzyme-linked immunosorbent assays (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), mass spectrometry, and phosphorylation / dephosphorylation status. For example, phosphorylation of the intracellular domains of IFNAR1, IFNAR2, TYK2, MNK1, MNK2, and / or eukaryotic translation initiation factor 4E (eIF4E) can be evaluated.
[0111] Those skilled in the art will be able to select an appropriate assay for measuring the increased expression of one or more type I interferon-stimulated genes or the decreased expression of one or more type I interferon-suppressor genes. Methods may include, but are not limited to, quantitative PCR (qPCR), single-cell or bulk RNA sequencing, hybridization-based methods, or enzyme-linked immunosorbent assays (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), mass spectrometry, and reporter cell assays. For example, the transcriptional level of any of the interferon-stimulated genes listed herein can be evaluated.
[0112] As can be understood, for example, the level of significant multiplicative change in transcription levels measured by qPCR may depend on the specific transcript being measured and the specific household transcript used for standardization. In some embodiments, the multiplicative change values are at least 1.2x, at least 1.3x, at least 1.4x, at least 1.5x, at least 1.6x, at least 1.7x, at least 1.8x, at least 1.9x, at least 2x, at least 3x increase, at least 4x, at least 5x, at least 6x, at least 7x, at least 8x increase, at least 9x increase, at least 10x increase, at least 20x, at least 30x, at least 40x, and at least 50x.
[0113] In some embodiments, the sample may be obtained systemically, such as from a blood sample (e.g., whole blood cells, peripheral blood mononuclear cells) or serum. In additional and / or alternative embodiments, the sample may be obtained locally, such as from the dorsal root ganglia (DRG), synovial membrane, nerve, skin, or muscle. Anatomically, DRGs emerge from the dorsal roots of spinal nerves. They carry sensory messages (i.e., pain and temperature) from various peripheral receptors toward the central nervous system for response. While the role of DRGs in chronic pain is well established, it has not been known which specific cell types influenced pain associated with rheumatoid arthritis (RA).
[0114] Increases or decreases can occur over time and can be measured by periodically obtaining samples. In one embodiment, the increase or decrease may be a transient increase in signaling, level, activation, or expression that returns to baseline after several hours. In another embodiment, the increase may be a sustained increase or decrease, where the signaling, level, activation, or expression remains increased or decreased over several days, weeks, or months. In some embodiments, a systemic increase in type I interferon signaling is transient. In another embodiment, a local increase in type I interferon signaling is sustained.
[0115] A suitable type I interferon is selected from the group including: interferon α, interferon β.
[0116] In another embodiment, pain is associated with an increase in the number and / or activity of one or more active sensory neurons in the patient, preferably an increase in the number and / or activity of one or more nociceptors in the patient.
[0117] The term "sensory neuron" includes afferent neurons, a specific type of cell in the nervous system that translates stimuli into behavior, or the meaning of a stepwise electrical potential or stepwise electrical potential. In vertebrates, the cell bodies of sensory neurons are located within the dorsal ganglia, cervical ganglia, and trigeminal ganglia of the spinal cord. Sensory information is transmitted from the ganglia to the brain via the spinal cord or brainstem.
[0118] As is understood, certain types of sensory neurons are nociceptors (also called pain receptors). Nociceptors respond to damage to or the threat of damage to body tissue, leading to the perception of pain (often, but not always). The brain produces the sensation of pain to divert attention to the part of the body, thus mitigating the threat, and this process is called nociception.
[0119] Nociceptors can be found internally (such as in muscles, joints, bladder, viscera, and the gastrointestinal tract) or externally (such as in skin nociceptors, corneal nociceptors, and mucous membranes) and can detect different types of harmful stimuli.
[0120] Harmful stimuli are detected at the peripheral ends of mature nociceptors and converted into electrical energy. When this energy reaches a threshold, an action potential is induced and sent toward the central nervous system (CNS). This, in turn, leads to the perception of pain. The sensory specificity of nociceptors is established by a high threshold only for specific characteristics of the stimulus. Nociceptors are triggered only when a high threshold is reached by a chemical, thermal, or mechanical environment.
[0121] Most nociceptors are classified by the type of modality to which they respond. For example, some nociceptors may respond to one modality and are called monomorphic nociceptors. Other nociceptors may respond to one or more of these modalities and are therefore designated as polymorphic nociceptors, such as C polymorphic nociceptors. Other nociceptors do not respond to any of these modalities (although they may respond to stimulation under conditions of inflammation of the surrounding tissue) and are called inactive or silent nociceptors. Alternatively, nociceptors can be classified by the axon that transmits the pain signal and can fall into either A fiber nociceptors (such as Aδ and Aβ nociceptors) that conduct at speeds greater than 5 m / s, or C fiber nociceptors that generally conduct at speeds less than 2 m / s. In one embodiment, a sensory neuron is a C polymorphic nociceptor and / or a C fiber nociceptor and / or an A fiber nociceptor.
[0122] The term "active sensory neuron" includes the meaning that a sensory neuron generates one or more electrical currents, resulting in one or more stepwise potentials and / or one or more active potentials. Those skilled in the art may select an appropriate assay for assessing whether a sensory neuron is active, for example, by using electrophysiological techniques.
[0123] It will be understood that a relatively small increase in the number of active sensory neurons is sufficient to produce pain and / or increased pain—for example, the activation or addition of one or more sensory neurons (out of approximately 10,000 in each ganglion) is sufficient to produce pain and / or increased pain.
[0124] In one embodiment, an increase in the number of active sensory neurons is an increase in one or more ganglia (compared to inactive sensory neurons) of at least 0.0001%, at least 0.0002%, at least 0.0005%, at least 0.001%, at least 0.002%, at least 0.005%, at least 0.01%, at least 0.02%, at least 0.05%, at least 0.1%, at least 0.2%, at least 0.5%, at least 1%, at least 2%, at least 5%, and at least 10%.
[0125] In another embodiment, the increase in the number of active sensory neurons is an increase of at least 100%, at least 125%, at least 150%, at least 175%, at least 200%, at least 225%, at least 250%, at least 275%, at least 300%, at least 325%, at least 350%, at least 375%, at least 400%, at least 425%, at least 450%, at least 475%, at least 500%, at least 525%, at least 550%, at least 575%, and at least 600% in one or more sensory ganglia.
[0126] "Increased activity of one or more sensory neurons" means that a sensory neuron may have an increased number of action potentials (also known as nerve impulses), and / or a larger receptor potential amplitude, and / or a longer receptor potential amplitude. This can occur during chronic pain. This increase in the number of action potentials and / or larger receptor potentials results in an increase in pain intensity. Those skilled in the art will be able to select a suitable assay for measuring sensory neuron activity, for example, by using microneurography techniques.
[0127] In one embodiment, the patient's sensory neurons are tropomyosin receptor kinase A (TrkA) expressing sensory neurons, preferably (TrkA) expressing nociceptors.
[0128] TrkA may also be known as tyrosine kinase A, high affinity nerve growth factor (NGF) receptor, neurotrophic tyrosine kinase receptor (NTKR) type 1, or TRK1-transformed tyrosine kinase protein, TRK, TRK1, TrkA, Trk-A, or p140-TrkA. In humans, TrkA is encoded by the NTRK1 gene. This kinase is a membrane-bound receptor that autophosphorylates and activates intracellular signaling via the MAPK pathway upon neurotrophin binding. In some embodiments, TrkA-expressing sensory neurons are located within the DRG.
[0129] In additional or alternative embodiments, the patient's sensory neurons are GDNF family receptor α3 (GFRa3) expressing sensory neurons, preferably GFRa3 expressing nociceptors.
[0130] GFRa3 may also be known as GFRA3 or GFR-α3. In humans, GFRa3 is encoded by the GDNFR3 gene. This protein is a glycosylphosphatidylinositol (GPI)-binding cell surface receptor and a member of the glial cell line-derived neurotrophic factor (GDNF) receptor family. It forms a signaling receptor complex with the RET tyrosine kinase receptor and binds to its ligand, artemin (also known as enovin or neurustin). In some embodiments, GFRa3-expressing sensory neurons are located within the DRG.
[0131] In additional or alternative embodiments, the patient's sensory neurons are transient receptor potential cation channel subfamily V member 1 (TrpV1) expressing sensory neurons, preferably TrpV1 expressing nociceptors.
[0132] TrpV1 may also be known as the transient receptor potential vanilloid subfamily-1 receptor, vanilloid receptor, capsaicin receptor, or VR1. In humans, TrpV1 is encoded by the TRPV1 gene. Four transcriptional variants encoding the same protein but with different 5'UTR sequences have been described for this gene. The protein encoded by this gene is a capsaicin receptor and a non-selective cation channel structurally related to members of the TRP family of ion channels. TrpV1 is a polymorphic channel sensitive to different physical and chemical stimuli, including heat, low pH, and mechanical stimuli, and can be activated by different ligands (vanilloids, capsaicinoids, resiniferoids, cannabinoids, ginsenosides, etc.). In sensory neurons, the TrpV1 channel may interact with the TRPA1 ion channel to mediate the detection of harmful stimuli. In some embodiments, TrpV1-expressing sensory neurons are located within the DRG.
[0133] In additional or alternative embodiments, the patient's sensory neurons are calcitonin gene-related peptide (CGRP) expressing sensory neurons, preferably CGRP-expressing nociceptors.
[0134] CGRP may also be known as Calca. In humans, CGRP is encoded by the Calca gene, also called CT, KC, PCT, CALC1, CGRP1, CGRP-I, and CGRP-α. Calcitonin gene-associated peptides are members of the calcitonin family of peptides that are secreted and stored in the nervous system. In humans, the peptide exists in two forms: CGRPα (also called α-CGRP or CGRPI) and CGRPβ (also called β-CGRP or CGRPII). CGRP can bind to calcitonin receptor-like receptors (CALCRL) and receptor activity-modifying proteins (RAMP1). In some embodiments, CGRP-expressing sensory neurons are located within the DRG. In some embodiments, CGRP-expressing sensory neurons release the CGRP protein, which can influence inflammation by causing vasodilation and increasing vascular permeability, leading to leakage from blood vessels (i.e., leakage of plasma proteins) and swelling. CGRP can also activate immune cells such as mast cells. This leads to a phenomenon known as neurogenic inflammation.
[0135] "Expression" means that the relevant gene is transcribed by the cell, selectively translated, shuttled to the correct location within the cell, such as the cell surface, or secreted from the cell.
[0136] Those skilled in the art may determine whether a sensory neuron is a TrkA, GFRa3, TrpV1, and / or CGRP-expressing sensory neuron using methods known in the art, e.g., in situ hybridization, RNA sequencing, immunostaining, gene reporter strains, optogenetics.
[0137] Type I interferon inhibitors In one embodiment, a type I interferon inhibitor reduces type I interferon signaling in a patient.
[0138] As can be understood, when administered to patients, type I interferon inhibitors can reverse increased type I interferon signaling. Changes in type I interferon signaling can be detected using the methods discussed herein.
[0139] In some embodiments, type I interferon inhibitors are, - Prevent or reduce intracellular signaling of type I interferon in patients, - To prevent or reduce the level of type I interferon in patients, - To prevent or reduce the activation of type I interferon receptors in patients, - To prevent or reduce the expression of one or more type I interferon-stimulating genes in a patient, and / or - Induces and / or increases the expression of one or more type I interferon suppressor genes in the patient.
[0140] Those skilled in the art will be able to evaluate the ability of type I interferon inhibitors to reduce type I interferon signaling in patients through in vitro or in vivo assays. In the case of an in vitro assay, the type I interferon inhibitor can be applied to cells. In one embodiment, an in vitro method for screening type I interferon inhibitors suitable for use in the treatment or prevention of pain associated with rheumatoid arthritis in patients may include: i) applying the inhibitor to sensory neurons with increased type I interferon signaling; and ii) measuring the decrease in type I interferon signaling.
[0141] In vivo assays allow for the administration of type I interferon inhibitors to patients. Methods for measuring intracellular type I interferon signaling, type I interferon levels, type I interferon receptor activation, type I interferon-stimulating gene expression, and type I interferon-suppressing gene expression are discussed herein.
[0142] "Type I interferon inhibitors prevent" means that type I interferon inhibitors may prevent (i) increased intracellular signaling of type I interferon in the patient, (ii) increased levels of type I interferon in the patient, (iii) increased activation of type I interferon receptors in the patient, and / or (iv) increased expression of one or more type I interferon-stimulating genes in the patient.
[0143] "Type I interferon inhibitors reduce" means that type I interferon inhibitors can reduce (i) increased intracellular signaling of type I interferon in the patient, (ii) increased levels of type I interferon in the patient, (iii) increased activation of type I interferon receptors in the patient, and / or (iv) increased expression of one or more type I interferon-stimulating genes in the patient.
[0144] The statement "Type I interferon inhibitors induce the expression of one or more type I interferon suppressor genes in patients" includes the meaning that type I interferon inhibitors can "turn on" or "de-suppress" the expression of one or more type I interferon suppressor genes in patients.
[0145] The statement "Type I interferon inhibitors increase the expression of one or more type I interferon suppressor genes in patients" includes the meaning that type I interferon inhibitors may increase the reduced expression of one or more reduced type I interferon suppressor genes in patients.
[0146] Preferably, type I interferon inhibitors are selected from the group including interferon α / β receptor α-chain (IFNAR1) inhibitors, interferon α / β receptor subunit 2 (IFNAR2) inhibitors, tyrosine kinase 2 (TYK2) inhibitors, type I interferon antagonists, MAP kinase interacting serine / threonine protein kinase ("MNK") inhibitors (such as MNK1 inhibitors and / or MNK2 inhibitors), and eukaryotic translation initiation factor 4E (eIF4E) inhibitors.
[0147] The term "Type I interferon antagonist" means that the drug can neutralize, counteract, inhibit, or block one or more Type I interferons.
[0148] Suitable type I interferon inhibitors may be selected from a group including small molecules and biological forms (e.g., antibodies, antibody mimetics, decoy receptors, receptor bodies, vaccines).
[0149] "Small molecule" includes the meaning of low molecular weight organic compounds. "Biological" includes the meaning of biological preparations such as proteins and / or oligos or polypeptides, enzymes, antibodies, their antibody portions, vaccines, antibody mimetics, or combinations thereof. Such antibodies may be monoclonal antibodies and can be produced using methods known in the art. Other polyclonal or chimeric antibody preparations may also be used.
[0150] The term "antibody mimetic" includes the meaning of drugs that mimic antibodies (e.g., aphibodies or other substances).
[0151] "That antibody portion" includes the meaning of antibody fragments (for example, nanobodies).
[0152] As is understood, neutralization can occur by an antibody, its antibody portion (such as lontalizumab, cifalimumab, or S95021), or by an interferon decoy receptor that binds to type I interferon (such as interferon α and / or interferon β) to block interferon receptor binding. Neutralization can also occur by inducing active immunity (endogenous antibodies) against type I interferon (such as interferon α and / or interferon β) using a vaccine-based approach (such as interferon α quinoid (IFN-K)).
[0153] IFNAR1 inhibitors In one embodiment, the type I interferon receptor consists of IFNAR1 and IFNAR2 subunits.
[0154] IFNAR1 may also be known as CRF2-1, IFN-R-1, IFN-α / β receptor 1, IFN-α / β receptor 1, α-type antiviral protein, β-type antiviral protein, cytokine receptor class II member 1, cytokine receptor family 2 member 1, interferon (α, β, and ω) receptor 1, interferon receptor 1, interferon α / β receptor α chain, interferon β receptor 1, and type I interferon receptor 1. In humans, IFNAR1 is encoded by the IFNAR1 gene. This receptor is a membrane protein that forms one of the two chains of interferon α and interferon β receptors.
[0155] IFNAR2 may also be known as IFN-α / β receptor 2, IFNα / β receptor subunit 2, human interferon α / β receptor, interferon (α, β, and ω) receptor 2, interferon α-binding protein, interferon receptor, interferon α / β receptor β chain, and type I interferon receptor 2. In humans, IFNAR2 is encoded by the IFNAR2 gene. This receptor is a membrane protein that forms the other of the two chains of the interferon α and interferon β receptors.
[0156] While not bound by theory, IFNAR1 and IFNAR2 inhibitors may have extracellular inhibitory effects (e.g., by inhibiting the binding of receptors to type 1 interferon) and / or intracellular inhibitory effects (e.g., by inhibiting downstream signaling of activated IFNAR1 or IFNAR2).
[0157] In some embodiments, type I interferon inhibitors may inhibit both IFNAR1 and IFNAR2. In some embodiments, the IFNAR2 inhibitor is an IFNAR2a inhibitor, an IFNAR2b inhibitor, and / or an IFNAR2c inhibitor.
[0158] Examples of IFNAR1 inhibitors include aniflorumab (AstraZeneca) (DrugBank accession number: DB11976), a human monoclonal antibody against IFNAR1, MAR1-5A3 (in vivo MAb anti-mouse IFNAR1, BioXCell), and monoclonal antibodies that react with mouse IFNAR1.
[0159] TYK2 inhibitors As is understood, in humans, TYK2, encoded by the TYK2 gene, is a member of the tyrosine kinase family and associates with IFNAR receptors. Upon binding, TYK2 can phosphorylate receptor units, thereby activating downstream signaling.
[0160] While not bound by theory, TYK2 inhibitors may act by inhibiting association with and / or phosphorylation of the IFNAR receptor, or by any other means of inhibiting downstream signaling of type I interferon-activated TYK2.
[0161] Examples of TYK2 inhibitors include the allosteric tyrosine kinase 2 (TYK2) inhibitors duklavacitinib (also known as Sotyktu) (Bristol Myers Squibb), brepocitinib and PF-06826647 (also known as lopsacitinib) (Pfizer Inc), NDI-034858, NDI-031232, NDI-031301, NDI-031407 (Nimbus Therapeutics), ESK-001 (Alumis Inc), VTX-958 (Ventyx Biosciences Inc), ICP-488 (InnoCare Pharma Ltd), GLPG3667 (Galapagos Inc), WO-2022 / 175745, and WO-2022 / 136914 (Sudo Examples include TYK2 inhibitors listed in Biosciences, TYK2 inhibitors listed in WO-2022 / 104206, WO-2022 / 011338 and WO-2022 / 011337 (Neuron23), TYK2 inhibitors listed in WO-2013 / 125543 and WO-2013 / 146963 (Takeda), WO-2019 / 178079 and WO-2010 / 010190 (AbbVie Inc), and TYK2 inhibitors listed in EP2634185B1, WO-2015 / 032423, WO-2018 / 073438, WO-2021 / 204762 and WO-2020 / 074461 (Sareum Ltd).
[0162] MNK inhibitors As is understood, in humans, MNK1 and MNK2 are encoded by the MKNK1 and MKNK2 genes, respectively. These proteins are members of the serine / threonine kinase family, and MNK activation associates with the activation of the IFNAR receptor. Upon receptor binding, TYK2 can phosphorylate receptor units to activate downstream signaling that leads to MNK kinase activation.
[0163] While not bound by theory, MNK inhibitors may function by inhibiting MNK activity on downstream substrates or by any other means to inhibit downstream signaling of type I interferons.
[0164] Those skilled in the art can recognize and / or identify MNK inhibitors.
[0165] Examples of MNK inhibitors are listed in the following documents, all of which are incorporated herein by reference. - MNK inhibitors as described in WO2019 / 079369, WO2015 / 200481, WO2018 / 152117, WO2017 / 075412, WO2017 / 075394, WO2017 / 087808, WO2020 / 086713, US2019 / 152988, US2019 / 330216, US2017 / 266185, US2018 / 085368, US2018 / 085368, US2018 / 228803, US11083727, US2019 / 275039, US2017 / 266185 (eFFECTOR Therapeutics Inc); -MNK inhibitors as described in WO2023 / 278686, WO2023 / 014943, and WO2022 / 006331 (4E Therapeutics), -WO2013 / 174744, WO2012 / 163942, WO2014 / 118226, WO2014 / 048894, WO2013 / 174735, WO2015 / 1811 04, WO2015 / 181063, WO2018 / 134335, WO2017 / 081003, WO2014 / 118229, WO2014 / 118135, WO2014 / 07 MNK inhibitors such as those listed in 6162, WO2014 / 044691, WO2015 / 104254, WO2015 / 004024, WO2015 / 074986, WO2014 / 128093, WO2014 / 048869, WO2013 / 034570, WO2012 / 156367, WO2016 / 102427, WO2016 / 096721, WO2018 / 134148 (Bayer Schering Pharma AG), -MNK inhibitors as described in WO2017 / 085483 and WO2017 / 085484, as well as CN108495855, EP3377501, and JP2018-534314 (LifeArc), - MNK inhibitors such as those listed in CN116425750 (Nuowosida Pharmaceutical Co., Ltd), - MNK inhibitors such as ETC-7114 and ETC-206 (the latter also known as tinodacertib) available from MedChem Express, as well as MNK inhibitors as described in WO2013 / 147711, WO2014 / 088519, WO2019 / 013703, WO2015 / 050505 (Agency For Science Technology & Research Bioprocessing Technology Institute), - MNK inhibitors such as those described in CN110903286 (Shenyang Pharmaceutical University), -MNK inhibitors such as those described in WO2007 / 147874 (Swedish Orphan Biovitrum AB), -MNK inhibitors as described in WO2007 / 115822, WO2006 / 136402, WO2008 / 006547, WO2007 / 059905 (Evotec (Goettingen) AG), -MNK inhibitors as described in WO2013 / 087581, WO2013 / 034570, WO2012 / 163942, WO2012 / 175591, WO2013 / 041634, WO2013 / 144189 (Bayer Intellectual Property GmbH), -MNK inhibitors as described in WO2015 / 169677, WO2015 / 091156, WO2006 / 066937, WO2014 / 206922, WO2011 / 104340, WO2015 / 082324, WO2010 / 023181, WO2011 / 104338, WO2013 / 149909, WO2011 / 104334, WO2006 / 066937, US2015 / 361055 (Boehringer Ingelheim Pharma GmbH & Co KG), - MNK inhibitors such as those described in CN103417545 (Taicang Shengzhou Biotechnology Co., Ltd), -MNK inhibitors as described in WO2020 / 155842 (Novostar Pharmaceuticals Ltd), -MNK inhibitors as described in WO2020 / 115072 (Instituto Ramon y Cajal de Investigacion Sanitaria), - MNK inhibitors as described in US2018 / 244654 and WO2017 / 075367 (Northwestern University), -MNK inhibitors as described in WO2020 / 233716, CN111978317, CN111978318 (Shanghai Daoshang Biology Tech Co.,Ltd.), -MNK inhibitors as described in WO2020 / 108619 (Shanghai De Novo Pharmatech Co Ltd), -MNK inhibitors as described in WO2017 / 165908 and WO2023 / 093700 (South Australian Health and Medical Research Institute and Ocean University of China), -MNK inhibitors as described in WO2017 / 068064 (Ryvu Therapeutics), -MNK inhibitors as described in WO2010 / 055072 (Friedrich Miescher Institute for Biomedical Research), - MNK inhibitors listed in WO2018 / 228275 (Beijing InnoCare Pharma Tech Co Ltd), -MNK inhibitors as described in WO2021 / 127589 (The Children's Hospital of Philadelphia), -MNK inhibitors as described in WO2016 / 081589 and WO2021 / 127438 (University of Maryland), -MNK inhibitors as described in WO2016 / 128465 (Basilea Pharmaceutica Ltd, Allschwil), -MNK inhibitors as described in WO2023 / 168381 (University of Maryland), -MNK inhibitors as described in WO2021 / 005183 (Centro de Investigacion Biomedica en Red and Institut Quimic de Sarria and Vall d'Hebron Institut de Recerca), - MNK inhibitors as described in US2020 / 197400 (New York University), - MNK inhibitors as described in WO2022 / 237682 (Jumbo Drug Bank Co Ltd), and - MNK inhibitors as described in WO2022 / 038563 (Hepagene Therapeutics (HK) Ltd).
[0166] In preferred embodiments, the type I interferon inhibitor is an MNK inhibitor (such as an inhibitor of MNK1 and / or MNK2). Preferably, the MNK inhibitor is a small molecule or an antibody or a part thereof. Preferably, the MNK inhibitor is selected from the group consisting of eFT508 (also known as tomibocertib), 4ET-03-053, BAY1143269, ETC-1907206 (also known as ETC-206 (AUM001) and tinodacertib), and derivatives of the above compounds.
[0167] The formula for eFT508 (manufacturer MedChemExpress, Selleck Chemicals) (as described in WO2015 / 200481 and WO2020 / 086713) is as follows: [ka]
[0168] The formula for 4ET-03-053 (as described in WO2023 / 278686) is as follows: [ka]
[0169] The additional MNK inhibitors listed in WO2023 / 278686 are as follows: [ka]
[0170] A more preferred MNK inhibitor includes the following formula and its derivatives (described in WO2023 / 278686). [ka]
[0171] Further preferred MNK inhibitors include the following formulas of 4ET-01-21 and its derivatives (as described in WO2022 / 006331). [ka]
[0172] The formula for BAY-1143269 (compound 806820 of WO2013 / 034570) is as follows: [ka]
[0173] The formula for ETC-1907206 (also known as Chinoda Seltive, AUM001, or ETC206, and described in WO2013 / 147711) is as follows: [ka]
[0174] In some embodiments, the MNK inhibitor is an MNK inhibitor described by Li, Q. et al., Discovery of D25, a Potent and Selective MNK Inhibitor for Sepsis-Associated Acute Spleen Injury, J.Med.Chem. 2024, 67, 4, 3167-89, which is incorporated herein by reference. For example, in some embodiments, the MNK inhibitor is the following compound D25 from Li et al. [ka]
[0175] In some embodiments, the MNK inhibitor is compound 7g, compound 18, or Forbazole C from Li et al. [ka]
[0176] In some embodiments, the MNK inhibitor is DS12881479 as described in Matsui, Y., et al., A novel inhibitor stabilizes the inactive conformation of MAPK-interacting kinase 1, Acta Cryst. 2018, F74, 156-60. [ka]
[0177] MNK inhibitors of structure I and structure II In one embodiment, the MNK inhibitor has structure (I): [ka] A compound of or a pharmaceutically acceptable salt thereof, wherein R 1a , R 1b , and R 3 Each of these is a compound or a pharmaceutically acceptable salt thereof, as defined herein.
[0178] In another embodiment, the MNK inhibitor has structure (II): [ka] A compound of or a pharmaceutically acceptable salt thereof, wherein R 1a , R 1b , R 2 X, Y, and L are compounds or pharmaceutically acceptable salts thereof, as defined herein.
[0179] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.
[0180] The following definitions apply to Structures (I) and (II) and their subgenera.
[0181] "Amino" refers to the -NH2 radical.
[0182] "Carboxy" or "carboxyl" refers to the -CO2H radical.
[0183] "Cyano" refers to the -CN radical.
[0184] "Hydroxy" or "hydroxyl" refers to the -OH radical.
[0185] "Nitro" refers to the -NO2 radical.
[0186] "Oxo" refers to the =O substituent.
[0187] "Thiol" refers to the -SH substituent.
[0188] "Thioxo" refers to =S.
[0189] "Alkyl" consists of only carbon and hydrogen atoms and has 1 to 12 carbon atoms (C1 - C 12A saturated linear or branched hydrocarbon chain radical has 1 to 8 carbon atoms (C1-C8 alkyl), or 1 to 6 carbon atoms (C1-C6 alkyl), or any value within these ranges, e.g., C4-C6 alkyl, and is bonded to the rest of the molecule by single bonds, e.g., methyl, ethyl n-propyl, 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl, etc. The number of carbon atoms mentioned relates to the carbon skeleton and carbon branching, but does not include carbon atoms belonging to any substituent. Unless otherwise specified herein, alkyl groups are optionally substituted.
[0190] "Alkenyl" consists only of carbon and hydrogen atoms, contains one or more carbon-carbon double bonds, and has 2 to 12 carbon atoms (C2-C2). 12 An alkenyl group refers to an unsaturated linear or branched hydrocarbon chain radical having 2 to 8 carbon atoms (C2-C8 alkenyls) or 2 to 6 carbon atoms (C2-C6 alkenyls), or any value within these ranges, which is bonded to the rest of the molecule by single bonds, such as ethenyl, propa-1-enyl, buta-1-enyl, penta-1-enyl, penta-1,4-dienyl, etc. The number of carbon atoms mentioned relates to the carbon skeleton and carbon branching, but does not include carbon atoms belonging to any substituent. Unless otherwise specifically specified herein, alkenyl groups are optionally substituted.
[0191] The term "alkynyl" refers to a group of 2 to 12 carbon atoms (C2-C2). 12Alkynyl refers to an unsaturated linear or branched hydrocarbon radical having 2 to 9 carbon atoms (C2-C9 alkynyl), or 2 to 6 carbon atoms (C2-C6 alkynyl), or any value within these ranges, and having at least one carbon-carbon triple bond. Examples of alkynyl groups may be selected from the group consisting of ethynyl, propargyl, buta-1-inyl, buta-2-inyl, etc. The number of carbons mentioned relates to the carbon skeleton and carbon branching, but does not include carbon atoms belonging to any substituent. Unless otherwise specifically specified herein, alkynyl groups are optionally substituted.
[0192] "alkoxy" is the formula -OR a radicals (where R in the formula) a (It is an alkyl radical) consisting of 1 to 12 carbon atoms (C1 to C 12 This refers to an alkyl radical as defined above, containing alkoxy, 1 to 8 carbon atoms (C1-C8 alkoxy), or 1 to 6 carbon atoms (C1-C6 alkoxy), or any value within these ranges. Unless otherwise specified herein, the alkoxy group is optionally substituted.
[0193] "Aminil" is, formula -NR a R b It refers to the radical of, in the formula, R a is H or C1-C6 alkyl, and R b These are C1-C6 alkyl groups as defined above. Unless otherwise specified, the C1-C6 alkyl portion of the aminyl group is optionally substituted.
[0194] "Aminoalkylcycloalkyl" is defined by formula -R a R b NR c R d It refers to the radical of, in the formula, R a R is a cycloalkyl as defined herein, b It is a C1-C6 alkyl group, and R c is H or C1-C6 alkyl, and R dThese are C1-C6 alkyl groups as defined above. Unless otherwise specified, the cycloalkyl and C1-C6 alkyl portions of the aminylalkylcycloalkyl group are optionally substituted.
[0195] An "aromatic ring" refers to a cyclic planar molecule or a part of a molecule (i.e., a radical) that has a ring of resonant bonds that exhibits high stability compared to other bond configurations with the same set of atoms. Generally, aromatic rings contain a set of covalently bonded coplanar atoms and an even number of π electrons that are not multiples of 4 (i.e., 4n+2 π electrons, n=0, 1, 2, 3, etc.) (e.g., alternating double and single bonds). Examples of aromatic rings include, but are not limited to, phenyl, naphthenyl, imidazolyl, pyrrolyl, pyridinyl, pyrimidinyl, pyrazinyl, pyridonyl, pyridadinyl, and pyrimidonyl. Unless otherwise specifically defined herein, an "aromatic ring" includes all optionally substituted radicals.
[0196] "Aryl" refers to a group of 6 to 18 carbon atoms, for example, 6 to 10 carbon atoms (C6~C6). 10 The term refers to a carbocyclic cyclic radical comprising an aryl group and at least one carbocyclic aromatic ring. For the purposes of embodiments of this disclosure, an aryl radical is a monocyclic, dicyclic, tricyclic, or tetracyclic cyclic system, which may include a fused cyclic system or a bridging cyclic system. Examples of aryl groups include, but are not limited to, aryl groups derived from acetantrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluorantene, fluorene, as-indacene, s-indacene, indane, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene.
[0197] As used herein, "aryl" includes fused ring systems containing non-aromatic moieties. For example, in some embodiments, the aryl has the following structure: [ka] It may have one of the following.
[0198] Unless otherwise specified herein, aryl groups are optionally substituted.
[0199] The terms "arylalkyl" or "aralkyl" refer to the group-alkyl-aryl, where alkyl and aryl groups are as defined herein. The aralkyl groups in this disclosure are optionally substituted. Examples of arylalkyl groups include, for example, benzyl, 1-phenylethyl, 2-phenylethyl, 3-phenylpropyl, 2-phenylpropyl, and fluorenylmethyl.
[0200] "Cyanoalkyl" refers to an alkyl group containing at least one cyano substituent. The -CN substituent may be on a primary, secondary, or tertiary carbon. Unless otherwise specifically provided herein, cyanoalkyl groups are optionally substituted.
[0201] A "carbocyclic structure" or "carbocyclic ring" refers to a ring system in which each ring atom is carbon.
[0202] "Cycloalkyl" refers to a non-aromatic monocyclic or polycyclic carbocyclic radical consisting only of carbon and hydrogen atoms, which includes 3 to 15 ring carbon atoms (C3-C3). 15 Cycloalkyl), 3-10 ring carbon atoms (C3-C 10The monocyclic groups may include cycloalkyl groups, or condensed or crosslinked ring systems having 3 to 8 ring carbon atoms (C3-C8 cycloalkyl groups), or any value within these ranges, for example, 3 to 4 carbon atoms (C3-C4 cycloalkyl groups), which are saturated or partially unsaturated and bonded to the rest of the molecule by single bonds. Examples of monocyclic groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic radicals include adamantyl, norbornyl, dekalinyl, and 7,7-dimethyl-bicyclo[2.2.1]heptanyl. Unless otherwise specified herein, cycloalkyl groups are optionally substituted.
[0203] "Alkylcycloalkyl" is defined by formula -R a R b It refers to the radical group, and in the formula, R a R is a cycloalkyl group, b is an alkyl group as defined above. Unless otherwise specified herein, alkylcycloalkyl groups are optionally substituted.
[0204] "Condensation" refers to any ring structure described herein that is condensed into another ring structure.
[0205] "Halo" refers to bromo, chloro, fluoro, or iodine.
[0206] "Haloalkyl" refers to the alkyl radical defined above, which is substituted with one or more halo radicals, such as trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, etc. Unless otherwise specified herein, the haloalkyl group is optionally substituted.
[0207] "Halocycloalkyl" refers to a cycloalkyl radical as defined above, substituted with one or more halo radicals, such as trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, etc. Unless otherwise specifically provided herein, the halocycloalkyl group is optionally substituted.
[0208] "Haloalkylcycloalkyl" is a compound of the formula -R a R b It refers to the radical group, and in the formula, R a R is a cycloalkyl group, b is a haloalkyl group as defined above. Unless otherwise specified herein, haloalkylcycloalkyl groups are optionally substituted.
[0209] "Halocycloalkylalkyl" is a compound of the formula -R a R b It refers to the radical group, and in the formula, R a R is an alkyl group, b is a halocycloalkyl group as defined above. Unless otherwise specified herein, halocycloalkyl alkyl groups are optionally substituted.
[0210] "Heterocyclylcycloalkyl" is a compound of the formula -R a R b It refers to the radical group, and in the formula, R a R is a cycloalkyl group, b is a heterocyclyl group as defined herein. Unless otherwise specified herein, heterocyclylcycloalkyl groups are optionally substituted.
[0211] "Hydroxyalkyl" refers to an alkyl radical as defined above, which is substituted by one or more hydroxyl radicals. The hydroxyalkyl radical is bonded to the main chain via an alkyl carbon atom. Unless otherwise specifically provided herein, the hydroxyalkyl group is optionally substituted.
[0212] "Heterocyclyl," "heterocyclic," or "heterocyclic" refers to a 3- to 18-membered, e.g., 3- to 10-membered or 3- to 8-membered non-aromatic ring radical having 1 to 10, e.g., 2 to 10 ring carbon atoms and 1 to 6 ring heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Unless otherwise specifically stated herein, heterocyclyl radicals are partially or completely saturated and are monocyclic, bicyclic, tricyclic, or tetracyclic ring systems, which may include fused ring systems, spirocyclic ring systems, and / or bridging ring systems. The nitrogen, carbon, and sulfur atoms in heterocyclyl radicals are optionally oxidized, and the nitrogen atom may be optionally quaternized. Non-restrictive examples of heterocyclic units having a monocycle include azilidinyl, azilidinyl, uralyl, azetidinyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolidinyl, isothiazolyl, isothiazolinone, oxathiazolinonyl, oxazolidinyl, hydantoinyl, tetrahydrofuranil, pyrrolidinyl, morpholinil, piperazinyl, piperidinyl, dihydropyranil, tetrahydropyranil, piperidine-2-I (valerolactam), 2,3,4,5-tetrahydro-1H-azepinyl, 2,3-dihydro-1H-indole, and 1,2,3,4-tetrahydroquinoline. Non-limiting examples of heterocyclic units having two or more rings include hexahydro-1H-pyrrolidinyl, 3a,4,5,6,7,7a-hexahydro-1H-benzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-1H-indolyl, 1,2,3,4-tetrahydroquinolinyl, chromanil, isochromanil, indolinil, isoindolinil, and decahydro-1H-cycloocta[b]pyrrolyl. As used herein, “heterocyclyl” includes fused ring systems containing additional non-heterocyclyl components. For example, in some embodiments, a heterocyclyl has the following structure: [ka] It may have one of the following.
[0213] Unless otherwise specified herein, heterocyclyl groups are optionally substituted.
[0214] "Haloheterocyclyl" refers to a heterocyclyl group containing at least one halo substituent. The halo substituent may be located on a primary, secondary, or tertiary carbon. Unless otherwise specified herein, the haloheterocyclyl group is optionally substituted.
[0215] "Haloheterocyclylalkyl" is a compound of formulas -R a R b It refers to the radical group, and in the formula, R a R is an alkyl group, b is a haloheterocyclyl group as defined herein. Unless otherwise specified herein, haloheterocyclylalkyl groups are optionally substituted.
[0216] "Heterocyclylalkyl" is a compound of formulas -R a R b It refers to the radical group, and in the formula, R a R is an alkyl group, b is a heterocyclyl group as defined herein. Unless otherwise specified herein, heterocyclylalkyl groups are optionally substituted.
[0217] A "heteroaryl" refers to a 5- to 18-membered, for example, 5- to 6-membered cyclic radical containing 1 to 6 cyclic heteroatoms selected from the group consisting of 1 to 13 cyclic carbon atoms, nitrogen, oxygen, and sulfur, as well as at least one aromatic ring. Heteroaryl radicals can be monocyclic, bicyclic, tricyclic, or tetracyclic systems, which may include condensed or bridging cyclic systems, and the nitrogen, carbon, or sulfur atoms in the heteroaryl radical may be optionally oxidized, and the nitrogen atom may be optionally quaternized. Examples include azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzodioxolyl, benzofuranil, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanil, benzonaphthofuranil, benzoxazolyl, benzodioxolyl, benzodioxynil, benzopyranil, benzopyranonil, benzofuranil, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, sinnolinil, dibenzothiadiazolyl, dibenzothiophenyl, furanil, isothiazolyl, imidazolyl, indazolyl, indazolyl, indazolyl, isoindo Examples include, but are not limited to, lyl, indolinyl, isoindolinyl, isoquinolyl, indolidinyl, isoxazolyl, naphthilidinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, 1-oxidepyridinyl, 1-oxidepyrimidinyl, 1-oxidepyradinyl, 1-oxidepyridazinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxadinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridadinyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thiophenyl (i.e., thienyl). As used herein, "heteroaryl" includes fused ring systems in which a heteroatom (e.g., oxygen, sulfur, nitrogen, etc.) is not part of the aryl moiety. For example, in some embodiments, heteroaryls may have the following structures: [ka]
[0218] Unless otherwise specified herein, heteroaryl groups are optionally substituted.
[0219] Non-limiting examples of heteroaryl rings containing monocyclic rings include 1,2,3,4-tetrazolyl, [1,2,3]triazolyl, [1,2,4]triazolyl, triazinyl, thiazolyl, 1H-imidazolyl, oxazolyl, furanyl, thiophenyl, pyrimidinyl, 2-phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4-dimethylaminopyridinyl. Non-limiting examples of heteroaryl rings containing two or more fused rings include benzofuranyl, benzothiophenyl, benzoxazolyl, benzthiazolyl, benztriazolyl, synnolinyl, naphthilidinyl, phenantridinyl, 7H-prinyl, 9H-prinyl, 6-amino-9H-prinyl, 5H-pyrrolo[3,2-d]pyrimidinyl, 7H-pyrrolo[2,3-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, 2-phenylbenzo[d]thiazolyl, 1H-indolyl, 4,5,6,7-tetrahydro-1-H-indolyl, quinoxalinyl, 5-methylquinoxalinyl, quinazolinyl, quinolinyl, 8-hydroxyquinolinyl, and isoquinolinyl.
[0220] A non-limiting example of the heteroaryl group described above is a C1-C5 heteroaryl having 1-5 carbocyclic atoms and at least one additional ring atom which is a heteroatom independently selected from nitrogen (N), oxygen (O), or sulfur (S) (preferably 1-4 additional ring atoms which are heteroatoms). Examples of C1-C5 heteroaryls include, but are not limited to, triazinyl, thiazole-2-yl, thiazole-4-yl, imidazole-1-yl, 1H-imidazole-2-yl, 1H-imidazole-4-yl, isoxazolin-5-yl, furan-2-yl, furan-3-yl, thiophene-2-yl, thiophene-4-yl, pyrimidine-2-yl, pyrimidine-4-yl, pyrimidine-5-yl, pyridine-2-yl, pyrididine-3-yl, and pyrididine-4-yl.
[0221] Unless otherwise specified, when two substituents combine to form a ring having a specific number of ring atoms (for example, when two R groups, together with the nitrogen (N) to which they are bonded, form a ring having 3 to 7 ring members), the ring may have a carbon atom and one or more additional heteroatoms (e.g., 1 to 3) optionally and independently selected from nitrogen (N), oxygen (O), or sulfur (S). The ring may be saturated or partially saturated and may be optionally substituted.
[0222] For the purposes of this disclosure, fused ring units containing a single heteroatom, as well as spirocyclic rings, bicyclic rings, etc., are considered to belong to the cyclic family corresponding to heteroatom-containing rings. For example, the following formula: [ka] 1,2,3,4-tetrahydroquinoline having the following formula is considered a heterocyclic unit for the purposes of this disclosure. [ka] A 6,7-dihydro-5H-cyclopentapyrimidine having the above characteristics is considered a heteroaryl unit for the purposes of this disclosure. When a fused ring unit contains heteroatoms in both a saturated ring and an aryl ring, the aryl ring is dominant, determining the type of category to which the ring is assigned. For example, the following formula: [ka] 1,2,3,4-tetrahydro-[1,8]naphthyridine having this property is considered a heteroaryl unit for the purposes of this disclosure.
[0223] Whenever the terms or their prefix roots appear in the name of a substituent, that name should be interpreted as including those limitations provided herein. For example, whenever the terms “alkyl” or “aryl” or their prefix roots appear in the name of a substituent (e.g., arylalkyl, alkylamino), that name should be interpreted as including those limitations given above for “alkyl” and “aryl.”
[0224] The term “substituted” is used throughout this specification. “Substituted” is defined herein as a moiety having one or more hydrogen atoms replaced by substituents or several (e.g., 1 to 10) substituents, whether acyclic or cyclic. A substituent can replace one or two hydrogen atoms of a single moiety at a time. In addition, these substituents can replace two hydrogen atoms on two adjacent carbon atoms to form the substituent, new moiety, or unit. Examples of substituted units requiring a single hydrogen atom replacement include halogens and hydroxyls. Examples of substitutions involving two hydrogen atoms include carbonyls and oxyminos. Examples of substitutions involving two hydrogen atoms from adjacent carbon atoms include epoxys. Throughout this specification, the term “substituted” is used to indicate that a moiety may have one or more hydrogen atoms replaced by substituents. Where a moiety is described as “substituted,” any number of hydrogen atoms may be replaced. For example, difluoromethyl is a substituted C1 alkyl, trifluoromethyl is a substituted C1 alkyl, 4-hydroxyphenyl is a substituted aromatic ring, (N,N-dimethyl-5-amino)octanyl is a substituted C8 alkyl, 3-guanidinopropyl is a substituted C3 alkyl, and 2-carboxypyridinyl is a substituted heteroaryl.
[0225] The variable groups defined herein, such as alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryloxy, aryl, heterocyclic, and heteroaryl groups, can be optionally substituted, whether used alone or as part of another group. The optionally substituted groups are as shown.
[0226] The compounds of this disclosure (i.e., compounds of structures (I) to (II)), or their pharmaceutically acceptable salts, may contain one or more geometrically asymmetric centers, and thus may give rise to stereoisomers, enantiomers, diastereomers, and other stereoisomeric forms defined with respect to absolute stereochemistry as (R)- or (S)-, or in the case of amino acids as (D)- or (L)-. Thus, embodiments include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or decomposed using prior art such as chromatography and fractional crystallization. Prior art for preparing / isolating individual enantiomers includes chiral synthesis from suitable optically pure precursors, or, for example, the decomposition of racemates (or racemates of salts or derivatives) using chiral high-pressure liquid chromatography (HPLC). Where a compound described herein contains an olefin double bond or other geometrically asymmetric center, unless otherwise specified, the compound is intended to include both E and Z geometric isomers. Similarly, all tautomer forms are also intended to be included.
[0227] Embodiments of the present disclosure include rotational isomers and conformationally restricted states of all forms of the compounds of the present disclosure. This also includes atropisomers, which are stereoisomers arising from rotational hindrance around a single bond, where steric strain or other causative factors create a rotational barrier high enough to allow isolation of individual conformational isomers. As an example, certain compounds of the present disclosure may exist as a mixture of atropisomers or may be purified or concentrated for the presence of a single atropisomer.
[0228] In some embodiments, the compound of structure (I) or (II) is a mixture of enantiomers or diastereomers. In other embodiments, the compound of structure (I) or (II) is substantially a single enantiomer or diastereomer.
[0229] "Tautomerism" refers to a proton shift from one atom of a molecule to another atom of the same molecule. Therefore, embodiments include tautomers of the disclosed compounds.
[0230] In some embodiments, the MNK inhibitor has the following structure (Ia): [ka] or having a pharmaceutically acceptable salt thereof, in the formula, R 1a and R 1b Each of them is an alkyl group independently. In some embodiments, R 1a and R 1b They are the same. In a particular embodiment, R 1a and R 1b They are different. R 1a or R 1b This can be an alkyl group such as methyl, ethyl, propyl, isopropyl, or tert-butyl. 1a or R 1b The substituents may be the same alkyl group or different alkyl groups. For example, R 1a It can be a methyl group, on the other hand, R 1b This could be an ethyl group. Another example is R 1a It can be an isopropyl group, on the other hand, R 1b This can be a tert-butyl group. Substituent R 1a or R 1b Any combination of alkyl groups can be used.
[0231] In some embodiments, R 1a and R 1b These combine to form a cyclic portion. In a particular embodiment, the compound has the following structure (Ib): [ka] or having a pharmaceutically acceptable salt thereof, in the formula R 1a and R 1bThese can bond together to form ring A.
[0232] Structure (Ib), substituent R 1a or R 1b These can combine to form a cyclic compound represented as cyclic portion A. For example, cyclic portion A of structure (Ib) may include a five-membered ring. Cyclic portion A of structure (Ib) may be an unsubstituted cyclic compound. For example, cyclic portion A may be an unsubstituted five-membered ring such as cyclopentane. Furthermore, cyclic portion A of structure (Ib) may have one or more alkyl substitutions. For example, alkyl substitutions on cyclic portion A may include methyl, ethyl, propyl, isopropyl, cyclopropyl, or tert-butyl groups. The substitution position may be at the 2nd, 3rd, 4th, or 5th position of cyclopentane. The degree of substitution may be monosubstituted, disubstituted, trisubstituted, or tetrasubstituted. For example, cyclic portion A may be 2,2,5,5-tetramethylcyclopentane. Different substitution patterns can be introduced on the cyclopentane ring using synthetic routes. For example, cyclic portion A may be 3,3,4,4-tetramethylcyclopentane.
[0233] In addition, cyclic portion A may have a fused ring. A portion of cyclic portion A may include a fused benzene ring. For example, cyclic portion A may include a benzene ring fused with a cyclopentyl or cyclohexyl ring. For example, a synthetic route for preparing a benzene-condensed cyclohexyl compound may include the use of 1-tetralone. Furthermore, cyclic portion A may include a cyclopentyl or cyclohexyl ring fused with other cyclic structures.
[0234] The cyclic portion A may contain a six-membered ring. The cyclic portion A may be an unsubstituted cyclic portion. For example, the cyclic portion A may be an unsubstituted six-membered ring such as cyclohexane. Furthermore, the cyclic portion A may have one or more alkyl substitutions. For example, alkyl substitutions on the cyclic portion A may include methyl, ethyl, propyl, isopropyl, cyclopropyl, or tert-butyl groups. The cyclic portion A may have one or more heteroatom-containing substituents (e.g., alcohols, sulfonamides, or carboxylic acids). The substitution position may be at the 2nd, 3rd, 4th, 5th, or 6th position of cyclohexane. The degree of substitution may be monosubstituted, disubstituted, trisubstituted, or tetrasubstituted. For example, the cyclic portion A may be 3,5-dimethylcyclohexane. Different substitution patterns can be introduced on the cyclohexane ring using synthetic routes. For example, the cyclic portion A may be 2,3,4,5,6-pentamethylcyclohexane.
[0235] The cyclic portion A may include a heterocyclic compound. A heterocyclic compound is a cyclic compound having atoms of at least two different elements, such as carbon and oxygen atoms. For example, cyclic portion A may be tetrahydropyran. Tetrahydropyran contains one oxygen atom and five carbon atoms in a six-membered ring. Heterocyclic compounds may be further substituted with alkyl substituents or functional groups at various positions with varying degrees of substitution. Note that some of the structures shown in this disclosure contain an oxygen atom in the cyclic compound, but such structures are provided for illustrative purposes only. Different heteroatoms may be introduced into the cyclic compound using synthetic routes. For example, cyclic portion A of structure (Ib) may include piperidine (nitrogen atom), phosphinate (phosphorus atom), silinane (silicon atom), or thiane (sulfur atom).
[0236] The cyclic portion A may be unsaturated. Unsaturated cyclic compounds may include aromatic cyclic compounds such as benzene, pyridine, diazine, oxazine, dioxin, or thiazine. Alternatively, the cyclic portion A may be saturated.
[0237] The cyclic portion A may have one or more functional group substitutions. For example, the functional groups may include hydroxyl, amine, amide, carboxylic acid, ether, or sulfonamide. Thus, the cyclic portion A may include 4-hydroxylcyclohexane, 4-carboxylatecyclohexane, 4-methoxylcyclohexane, or 4-alkylsulfonamidecyclohexane. The substitution position may be at the 2nd, 3rd, 4th, 5th, or 6th position of cyclohexane. The degree of substitution may be monosubstituted, disubstituted, trisubstituted, tetrasubstituted, or pentasubstituted. One or more functional groups may be introduced onto the heterocyclic compound at various substitution positions and to varying degrees.
[0238] Substituent R of structures (Ia) and (Ib) 2 It may contain nitrogen-containing functional groups. For example, substituent R 2 The nitrogen-containing functional group may include amides, amidines, amines, amine oxides, azos, carbamates, carbodiimides, enamines, aromatic heterocycles, non-aromatic heterocycles, hydrazones, hydroxamic acids, imides, imines, nitriles, sulfonamides, or ureas. For example, aromatic heterocycles may include pyrrole, imidazole, pyrazole, thiazole, pyridine, pyridazine, pyrimidine, pyrazine, or triazine. Substituent R 2 The nitrogen-containing functional group may be unsubstituted or substituted. For example, pyridazine may be substituted with an amine group at the 3-position, as shown in 4ET-004-006 below. In another example, pyridazine may be substituted with an amide containing a cyclopropyl ring at the 3-position, as shown in 4ET-004-003 below. The degree and position of substitution on the nitrogen-containing functional group may vary. Substituent R 2 The nitrogen-containing functional group is -C n H 2n It can be bonded via an alkyl chain represented by -, where n is between 0 and 5. In this regard, substituent R 2 Furthermore, the nitrogen-containing functional groups of the skeletal structures (Ia) and (Ib) are separated by n carbon atoms.
[0239] Substituent R of structures (Ia) and (Ib) 2may contain an aromatic heterocycle. For example, in some embodiments, substituent R 2 may contain a 4-aminopyrimidinyl moiety. In some specific embodiments, the compound is a compound of structure (Ic),
Chemical formula
[0240] In some embodiments, the amine is a primary amine. In some embodiments, R 3 is -NH2.
[0241] In some embodiments, R 3 may contain a secondary amine. When the amine is a secondary amine, R 3 may further contain a functional group at one end. For example, the functional group may include hydroxyl, sulfonamide, carboxylic acid, ester, amine, amide, morpholine, piperazine, or thiomorpholine. The secondary amine and the functional group may be linked via an alkyl chain represented by -C n H 2n -, where n is 1 to 5. That is, the secondary amine and the functional group of substituent R 3 may be separated by n carbon atoms. For example, a secondary amine bonded to a hydroxyl group separated by a carbon atom forms an amino alcohol (HO-C2H4NH-), which is shown below as Examples 4ET-02-001, 4ET-03-004, 4ET-03-007, and 4ET-03-011. As another example, a secondary amine bonded to a sulfonamide group separated by two carbon atoms forms an aminosulfonamide (CH3SO2NHC2H4NH-), which is shown below as Examples 4ET-02-004, 4ET-03-012, 4ET-03-013, and 4ET-03-014.
[0242] Substituent R 3The amine may include a tertiary amine. Substituent R 3 The tertiary amine of may be cyclic. Substituent R 3 The cyclic tertiary amine of may be part of a saturated 5-membered or 6-membered ring. For example, in a saturated 5-membered ring, substituent R 3 The cyclic tertiary amine of may be pyrrolidine, imidazolidine, or pyrazolidine. In a saturated 6-membered ring, substituent R 3 The cyclic tertiary amine of may be piperidine or piperazine.
[0243] The tertiary amine may further include a functional group at one end. For example, the functional group may include hydroxyl, sulfonamide, carboxylic acid, ester, amide, amine, morpholine, piperazine, or thiomorpholine. The tertiary amine and the functional group may be bonded via an alkyl chain represented by -C n H 2n -, where n is 1 to 5. That is, the tertiary amine and the functional group of substituent R 3 may be separated by n carbon atoms.
[0244] Substituent R 3 The tertiary amine of may be cyclic. Substituent R 3 The cyclic tertiary amine of may be part of an unsaturated 5-membered or 6-membered ring. For example, in an unsaturated 5-membered ring, substituent R 3 The cyclic tertiary amine of may be pyrazole, imidazole, or oxazole. In an unsaturated 6-membered ring, substituent R 3 The cyclic tertiary amine of may be pyridine, diazine, triazine, or oxazine.
[0245] Substituent R 3 The amine may also include an amide group. Substituent R 3 The amide group of may further include a functional group at one end. For example, the functional group may include hydroxyl, sulfonamide, carboxylic acid, ester, amine, amide, morpholine, piperazine, or thiomorpholine. The amide and the functional group of substituent R
[0246] Substituent R 3 The amide and the functional group of may be -Cn H 2n It can be bonded via an alkyl chain represented by -, where n is between 0 and 5. That is, substituent R 3 The amides and functional groups can be separated by n carbon atoms. For example, an amide bonded to a morpholine group by one methylene group forms a morpholine amide, which is shown below as Examples 4ET-02-007, 4ET-03-027, and 4ET-03-028. An amide bonded to a morpholine group by two methylene groups forms a morpholine amide, which is shown below as Example 4ET-02-031. Substituent R 3 The amide can also be directly bonded to one of the functional groups.
[0247] Substituent R 3 The amide can be directly bonded to the cyclic structure. For example, substituent R 3 The amide can be directly bonded to cyclopropane. In this case, there is no carbon atom between the amide and cyclopropane. Substituent R 3 Structures having an amide group directly bonded to cyclopropane as part of the cyclopropane include the following: 4ET-02-003, 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-002, 4ET-03-009, 4ET-03-017, 4ET-03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026, 4ET-03-034, and 4ET-04-003. The cyclopropane may be unsubstituted or substituted with one or more functional groups. For example, substituted cyclopropanes may contain fluorine, hydroxyl, hydroxylmethylene, alkyl, carboxylic acid, amine, aminomethylene, ester, ether, amide, sulfonamide, morpholine, piperazine, or thiomorpholine groups bonded to the cyclopropane ring. The substitution position on the cyclopropane to which the functional group is bonded may be 1-, 2-, or 3-position. The functional group bonded to the cyclopropane may have an additional alkyl chain (-C) between the functional group and the cyclopropane. n H 2nSubstituent R) may have -), where n is between zero and 5. When n is equal to zero, there is no methylene between the functional group and cyclopropane. That is, the functional group can be directly bonded to the 1st, 2nd, or 3rd position of cyclopropane. Similarly, when n is equal to 1, there is one methylene between the functional group and cyclopropane. In this case, the functional group is one carbon away from cyclopropane, which gives further flexibility to the structure. Substituent R 3 Structures having an amide group directly bonded to a substituted cyclopropane as part of the structure include the following: 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026, and 4ET-03-034.
[0248] Substituent R 3 The amide can be directly bonded to cyclobutane. In this case, there is no carbon atom between the amide and cyclobutane. Cyclobutane may further have functional groups. For example, the functional groups may include hydroxyl, alkyl, carboxylic acid, amine, ester, ether, amide, sulfonamide, morpholine, piperazine, or thiomorpholine. The substitution position on cyclobutane to which the functional group is bonded may be the 1-, 2-, 3-, or 4-position. The functional group may have an additional alkyl chain (C) between the functional group and cyclobutane. n H 2n ) may have such a formula, where n is between zero and 5.
[0249] A cyclic structure bonded to an amide, either via an alkyl chain or directly, can form a heterocyclic compound containing at least one heteroatom. Heterocyclic compounds may include a three-membered ring with one heteroatom or a four-membered ring with one heteroatom. For example, a three-membered ring with one heteroatom may include aziridine or ethylene oxide. Another example is a four-membered ring with one heteroatom, which may include azetidine or oxetane. Azetidine directly bonded to an amide is shown, for example, in 4ET-02-017 below. As described above, functional groups can be bonded to heterocyclic compounds. In the case of ethylene oxide (epoxide), chiral epoxides can be produced using Sharpless epoxidation.
[0250] The examples herein have only one substitution on the cyclic structure, but such configurations are provided for illustrative purposes only. Embodiments of the present disclosure also include disubstituted cyclic structures. For example, a total of two amine groups may be bonded to cyclopropane, with the first amine group bonded to position 1 of cyclopropane and the second amine group bonded to position 2 of cyclopropane.
[0251] Substituent R 3 The amide can be an inverse amide. Substituent R 3 Instead of the nitrogen atom of the amide being directly bonded to the structure (Ic), the substituent R 3 The carbon atoms of the amide may be bonded to structure (Ic). An inverse amide bonded to structure (Ic) is shown, for example, in 4ET-03-024 below. Substituent R 3The embodiments of the present disclosure described above, which include an amide, may be replaced with a reverse amide. For example, the amide groups in embodiments such as 4ET-02-003, 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-002, 4ET-03-009, 4ET-03-017, 4ET-03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026, 4ET-03-034, 4ET-04-003, 4ET-02-007, 4ET-03-027, 4ET-03-028, and 4ET-02-031 may be replaced with a reverse amide.
[0252] Structure (Ic) is a substituent R 3 It may have amide analogs. For example, a thioamide group may be used instead of the amide group shown in 4ET-02-013 below. Similar to amide substituents, the thioamide group may be replaced with an inverse thioamide. In this regard, substituent R 3 Instead of the nitrogen atom of the thioamide being directly bonded to structure (Ic), substituent R 3 The carbon atoms of the thioamide may be bonded to structure (Ic).
[0253] In addition, substituent R 3 Other amide analogs may be used in structure (Ic). For example, a urea group may be used instead of the amide group shown in 4ET-02-015 below. As another example, a thiourea group may be used instead of the amide group. Substituent R 3 As part of the structure (Ic), amides, inverse amides, thioamides, inverse thioamides, ureas, and thioureas are interchangeable.
[0254] In some MNK inhibitors of this disclosure, the 4-aminopyrimidine moiety in structure (Ic) may be modified. The pyrimidine moiety and parent structure shown in structure (Ia) or (Ib) are linked via an amine linker (-NH-) in structure (Ic). The amine linker may be extended. For example, the amine linker may have a further alkyl chain (-C) between the amine and the pyrimidine moiety. n H 2nThe formula may include -), where n is 1 to 5. For example, as shown in 4ET-04-004, one extra carbon atom (n=1) may be added so that the amine linker and pyrimidine are 1 carbon away from the parent structure, which gives structure (Ic) more structural flexibility through further degrees of freedom. A one-carbon extension between the amine and pyrimidine moieties, which is the insertion of a methylene unit, provides a benzylpyrimidine moiety. As another example, the amine linker is an additional alkyl chain (-C) between the amine and the parent structure shown as structure (Ia) or (Ib). n H 2n The formula may include -), where n is 1 to 5. For example, as shown in 4ET-04-015, one extra carbon atom (n=1) may be added to the amine linker and the parent structure shown as structure (Ia) or (Ib) such that the parent structure is 1 carbon away from the parent structure. A one-carbon extension, which is the insertion of a methylene unit between the amine and structure (Ia) or (Ib), provides a methylaminopyrimidine moiety. In this regard, methylene units may be added on both sides of the amine linker of structure (Ic). The amine linker extension having an extra methylene unit may be used in conjunction with any of the other variations of structures (Ia), (Ib), and (Ic) disclosed herein.
[0255] In addition, the pyrimidine moiety in structure (Ic) may be modified by substituting two nitrogen atom isomers to form different unsaturated six-membered rings, such as 1,2-diazine (pyridazine) or 1,4-diazine (pyrazine). For example, in structure (Ic) shown in Examples 4ET-04-003 and 4ET-04-006 below, 1,2-diazine (pyridazine) may be used instead of 1,3-diazine (pyrimidine). These modifications may be used in combination with any other variation of structures (Ia), (Ib), and (Ic) disclosed herein.
[0256] The pyrimidine in structure (Ic) can be replaced with a five-membered heterocyclic compound. A pyrimidine is a six-membered heterocyclic compound having two nitrogen atoms. Generally, five-membered heterocyclic compounds have different chemical and physical properties than six-membered heterocyclic compounds. Some MNK inhibitors of this disclosure can take advantage of such differences between five-membered and six-membered heterocyclic compounds. For example, a five-membered heterocyclic compound may contain a nitrogen atom and a sulfur atom. For example, a five-membered heterocyclic compound having N and S may include a thiazole, as shown in Example 4ET-04-001 below. As another example, a five-membered heterocyclic compound having S may include a thiophene. A five-membered heterocyclic compound may contain a nitrogen atom and an oxygen atom. For example, a five-membered heterocyclic compound having N and O may include an oxazole or isoxazole. In yet another example, a five-membered heterocyclic compound may contain two nitrogen atoms. For example, a five-membered heterocyclic compound having two nitrogen atoms may include an imidazole or pyrazole. These modifications may be used in combination with any other variation of structures (Ia), (Ib), and (Ic) disclosed herein.
[0257] As an example of how the various modifications disclosed herein can be used in combination with one another, an amine linker having an additional carbon atom may be bonded to the pyridazine moiety, and the pyridazine moiety may be bonded to a pyridone skeleton having an amine or sulfonamide. As another example, an amine linker having an additional carbon atom may be bonded to the pyridazine moiety, and the pyridazine moiety may be directly bonded to the amino group.
[0258] In some MNK inhibitors of this disclosure, the 4-aminopyrimidine moiety and the parent structure, for example, the pyridone moiety in structure (Ic), may be linked via another nitrogen-containing linker. The pyrimidine moiety and parent structure shown in structure (Ia) or (Ib) are linked via the amine linker (-NH-) in structure (Ic). Embodiments of this disclosure may be configured to introduce an amide group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized by using an amide-containing starting material in the Buchwald-Hartwig amination. For example, the resulting MNK inhibitor may contain an amide between the 4-aminopyrimidine moiety and the parent structure, such as the amide shown in Example 4ET-04-013, or an inverse amide shown in Example 4ET-04-014.
[0259] Furthermore, embodiments of the present disclosure may be configured to introduce a sulfonamide group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized by using a sulfonamide-containing starting material in the Buchwald-Hartwig amination. Another approach involves the use of a sulfonyl chloride reagent or intermediate. For example, the resulting MNK inhibitor may contain, between the 4-aminopyrimidine moiety and the parent structure, a sulfonamide as shown in Examples 4ET-04-010 and 4ET-04-011 below, or an inverse sulfonamide as shown in Example 4ET-04-012.
[0260] In addition, embodiments of the present disclosure may be configured to introduce an ether group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized by using an alcohol-containing starting material in a Buchwald-Hartwig amination. Another approach involves using an alcohol-containing starting material in an Ullmann coupling reaction.
[0261] Substituent R of structure (Ic) 1a or R 1b The substituent R in structure (Ia) may be an alkyl group as discussed in the specification. Alternatively, the substituent R in structure (Ic) may be an alkyl group. 1aor R 1b These may combine to form a cyclic compound shown as the following ring structure A. For a detailed discussion of ring structure A of structure (Ib), see structure (Id): [ka] or applies to its pharmaceutically acceptable salt, where R 3 It may contain amines.
[0262] One embodiment has the following structure (II): [ka] An MNK inhibitor having, or a pharmaceutically acceptable salt thereof, wherein, R 1a However, it is a C1-C6 alkyl or aryl compound. R 1b However, is it a C1-C6 alkyl or aryl compound? Alternatively, R 1a and R 1b However, together with the carbon to which they are bonded, they form cycloalkyl, cycloalkenyl, heterocyclyl, aryl, or heteroaryl groups. R 2 However, -NHR 3a , -NHC(=O)R 3b ,-NHC(=S)R 3b , or -C(=O)R 3c And, R 3a However, the group is hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, and each of these can be optionally hydroxyl, C3-C6 cycloalkyl, -NHS(O)2CH3, heterocyclyl, -C(=O)OH, or -C(=O)N(R) 3d )R 3d , or -N(R 3d )R 3d It is substituted with one or more substituents selected from the group consisting of, R 3bHowever, these are C1-C6 alkyl, C3-C6 cycloalkyl, or heterocyclyl, and each of these can be optionally hydroxyl, halo, C1-C6 alkyl, C3-C6 cycloalkyl, -NHS(O)2CH3, -N(R 3d )R 3d , heterocyclyl, -C(=O)OH, -C(=O)N(R 3d )R 3d It is substituted with one or more substituents selected from the group consisting of -NHC(=O)CH3 and -CH2C(=O)OH. R 3c However, -N(R 3d )R 3d or heterocycline, R 3d However, at each occurrence, it is independently hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl. L is -NH- or -CH2NH-, The present invention provides an MNK inhibitor or a pharmaceutically acceptable salt thereof, wherein X is N and Y is CH, or X is CH and Y is N.
[0263] In some embodiments, R 1a and R 1b When both are -CH3, or R 1a and R 1b When R is bonded to form a 5-membered or 6-membered cycloalkyl or heterocycline, 2 However, the structure is as follows: -NH2 or [ka] It does not have.
[0264] In some embodiments, R 1a is a C1-C6 alkyl group. In some embodiments, R 1a is methyl. In a particular embodiment, R 1a is an arrow. In a particular embodiment, R 1a It is phenyl.
[0265] In a particular embodiment, R 1b is a C1-C6 alkyl group. In some embodiments, R 1b is methyl. In some embodiments, R 1a and R 1b These, together with the carbon to which they are bonded, form a cycloalkyl group. In more specific embodiments, the cycloalkyl group is cyclopentyl or cyclohexyl. In some embodiments, R 1a and R 1b These, together with the carbon to which they are bonded, form a cycloalkenyl. In some embodiments, the cycloalkenyl is cyclopentenyl, cyclohexenyl, or cycloheptenyl. In certain embodiments, R 1a and R 1b These, together with the carbon to which they are bonded, form a heterocycline. In some specific embodiments, R 1a and R 1b These, together with the carbon to which they are bonded, form an aryl group. In some embodiments, R 1a and R 1b These two atoms, together with the carbon atom to which they are bonded, form a heteroaryl compound.
[0266] In a more specific embodiment, the compound has the following structure: [ka] One of them, or having a pharmaceutically acceptable salt thereof, in the formula, [ka] However, it shows a double bond or a single bond, R 4 However, at each occurrence, independently, it is either C1-C6 alkyl, C3-C6 cycloalkyl, halo, haloalkyl, hydroxyl, -NHS(O)2CH3, or -C(O)OH. or two R 4However, together with the carbon to which they are bonded, they form a cycloalkyl group. W is either N or O, Z is either C or O, n is 0, 1, 2, 3, or 4.
[0267] In some embodiments, n is 0, 1, or 2. In some more specific embodiments, [ka] Only one of the positions represented by is a double bond, and the rest are single bonds. In some embodiments, the compound has the following structure: [ka] It holds.
[0268] In some more specific embodiments, the compound has the following structure: [ka] It holds.
[0269] In some embodiments, the compound has the following structure: [ka] Take one of them.
[0270] In a more specific embodiment, R 2 -NHR 3a In a more specific embodiment, R 2 The structure is as follows: -NH2, [ka] Take one of them.
[0271] In some embodiments, R 2 is -NHC(=O)R 3bIn a more specific embodiment, R 2 The structure is as follows: [ka] Take one of them.
[0272] In a particular embodiment, R 2 is -NHC(=S)R 3b In a particular embodiment, R 2 The structure is as follows: [ka] It holds.
[0273] In a particular embodiment, R 2 is -C(=O)R 3c In a particular embodiment, R 2 The structure is as follows: -NH2, [ka] Take one of them.
[0274] In a particular embodiment, R 2 The structure is as follows: -NH2 or [ka] Take one of them.
[0275] In some embodiments, X is CH and Y is N. In certain embodiments, X is N and Y is CH. In some embodiments, L is -NH-. In further embodiments, L is -CH2NH-.
[0276] In some embodiments, R 3a is a branched C1-C6 alkyl group. In some embodiments, R 3a It is isopropyl.
[0277] In various different embodiments, the compounds have one of the structures listed in Table 1 below, or a pharmaceutically acceptable salt thereof. The compounds in Table 1 were prepared as described in WO2022 / 006331 and / or as by methods known in the art. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14] [Table 1-15] [Table 1-16] [Table 1-17] [Table 1-18] [Table 1-19] [Table 1-20] [Table 1-21] [Table 1-22] [Table 1-23] [Table 1-24] [Table 1-25] [Table 1-26]
[0278] MNK inhibitors of formula (I') and formula (IA): In some embodiments, the MNK inhibitor is expressed by formula (I'): [ka] A compound of or a pharmaceutically acceptable salt thereof, in which, R 1 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloalkyl groups, R 2’ but, [ka] Selected from the group consisting of, R 3’ However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloachil, R 1c and R 1d These combine to form a 3-7 membered ring having 0-2 heteroatoms selected from the group consisting of N, O, and S, and the 3-7 membered ring can optionally be halo, oxo, or C. 1~6 Alkyl, R 8 , and -C(=O)OR 9 They may be further substituted with one or more substituents selected from the group consisting of the following: Z 1 and Z 2 However, each can be directly joined or -{C(R 4a )(R 4b)} p -Y 1 - and p is 0, 1, 2, 3, 4, or 5, Y 1 However, direct bonding, -O-, or -N(R) 8 )- and, R 4a Each instance of occurrence independently involves hydrogen, halogen, and C. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, or two R 4a However, it forms a direct bond by bonding to two adjacent carbon atoms. R 4b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 5 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6 However, hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6a However, -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, [ka] Selected from the group consisting of, q is 1, 2, 3, 4, 5, or 6, e is 1, 2, 3, 4, 5, or 6. X 2 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxy, C 3~7 Branched alkoxy, C 1~6 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6 Alkyl), N(C 1~6 Alkyl)2, C 1~5 (COOH), C 1~6 Selected from the group consisting of (NHSO2Me), X 3 However, hydrogen, halogen, C 1~5 Alkyl, C 3~7 Branched alkyl, C 1~5 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~5 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~5Alkoxy, C 3~7 Branched alkoxy, C 1~5 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6 Alkyl), N(C 1~6 Alkyl)2, COOH, C 1~5 (COOH), NHSO2Me, C 1~5 Selected from the group consisting of (NHSO2Me), R 7 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 8 However, C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C 1~6 Alkyl), CO(C 3~7 Branched alkyl), SO2(C 1~6 Alkyl), and SO2(C 3.7 Selected from the group consisting of branched alkyl groups, R 9 However, hydrogen, C 1~6 Selected from the group consisting of alkyl and aralkyl.
[0279] In a more specific embodiment, the MNK inhibitor is given by formula (IA): [ka] Pyridine-1,5-dione, or a pharmaceutically acceptable salt thereof, in the formula, Z 1 but, [ka] and Selected from the group consisting of, R 1 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloalkyl groups, R 2’ but, [ka] Selected from the group consisting of, R 3’ However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloachil, R 4a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4e However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl and C 3~7 It is a branched haloalkyl, R 4f However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl and C 3~7 It is a branched haloalkyl, R 1c and R 1d Together, they are arbitrarily selected as X 1 Forms an optionally substituted 3- to 7-membered ring containing a group, X 1 However, CF2, CHCO2R 12 , O, NH, NR 8 Selected from the group consisting of , and SO2, m is 0, 1, or 2, n 1 However, it is 1, 2, or 3, R 5 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6 However, hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6a However, -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, [ka] Selected from the group consisting of, q is 1, 2, 3, 4, 5, or 6, e is 1, 2, 3, 4, 5, or 6. X 2 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxy, C 3~7 Branched alkoxy, C 1~6 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6 Alkyl), N(C 1~6 Alkyl)2, C 1~5 (COOH), C 1~6 Selected from the group consisting of (NHSO2Me), X 3 However, hydrogen, halogen, C 1~5 Alkyl, C 3~7 Branched alkyl, C 1~5 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~5Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~5 Alkoxy, C 3~7 Branched alkoxy, C 1~5 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6 Alkyl), N(C 1~6 Alkyl)2, COOH, C 1~5 (COOH), NHSO2Me, C 1~5 Selected from the group consisting of (NHSO2Me), R 7 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 8 However, C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C 1~6 Alkyl), CO(C 3~7 Branched alkyl), SO2(C 1~6 Alkyl), and SO2(C 3.7 Selected from the group consisting of branched alkyl groups, R 10 However, hydrogen, C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C 1~6 Alkyl), CO(C 3~7 Branched alkyl), SO2(C 1~6 Alkyl), and SO2(C 3.7 Selected from the group consisting of branched alkyl groups, R 11 However, hydrogen and C 1~6 Selected from the group consisting of alkyl groups, R 12 However, hydrogen and C 1~6 Selected from the group consisting of alkyl groups.
[0280] The following definitions apply to formulas (I') and (IA) and their sub-genera.
[0281] As used herein, the term "halogen" means chlorine, bromine, fluorine, and iodine.
[0282] Where used herein, unless otherwise stated, “alkyl” and / or “aliphatic” refers to linear and branched carbon chains having 1 to 20 carbon atoms or any number within this range, e.g., 1 to 6 carbon atoms or 1 to 4 carbon atoms, whether used alone or as part of a substituent. 1~6 (C) independently refers to the number of carbon atoms in the alkyl moiety or the alkyl moiety of a larger alkyl-containing substituent. Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, etc. Alkyl groups can be optionally substituted. Non-limiting examples of substituted alkyl groups include hydroxymethyl, chloromethyl, trifluoromethyl, aminomethyl, 1-chloroethyl, 2-hydroxyethyl, 1,2-difluoroethyl, 3-carboxypropyl, etc. (C) 1~6 In substituents having multiple alkyl groups, such as alkyl)2amino, the alkyl groups may be the same or different.
[0283] As used herein, unless otherwise stated, “hydroxyalkyl” refers to a linear or branched carbon chain having 1 to 20 carbon atoms, or any number within this range, for example, 1 to 6 carbon atoms, or 1 to 4 carbon atoms including a hydroxyl substituent, whether used alone or as part of a substituent. 1~6 (C) independently refers to the number of carbon atoms in the alkyl moiety or the alkyl moiety of a larger alkyl-containing substituent. Non-limiting examples of hydroxyalkyl groups include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxy-iso-propyl, hydroxy-n-butyl, hydroxy-sec-butyl, and hydroxy-iso-butyl. Hydroxyalkyl groups can be optionally substituted. (C) 2~6 In substituents having multiple alkyl groups, such as hydroxyalkyl)2amino, the hydroxyalkyl groups may be the same or different.
[0284] As used herein, the terms “alkenyl” and “alkynyl” groups, whether used alone or as part of a substituent, refer to linear and branched carbon chains having two or more carbon atoms, preferably 2 to 20 carbon atoms, wherein an alkenyl chain has at least one double bond in the chain, and an alkynyl chain has at least one triple bond in the chain. Alkenyl and alkynyl groups can be optionally substituted. Non-limiting examples of alkenyl groups include ethenyl, 3-propenyl, 1-propenyl (also 2-methyltenyl), isopropenyl (also 2-methylten-2-yl), and buten-4-yl. Non-limiting examples of substituted alkenyl groups include 2-chloroethenyl (also 2-chlorovinyl), 4-hydroxybuten-1-yl, 7-hydroxy-7-methylocto-4-en-2-yl, and 7-hydroxy-7-methylocto-3,5-dien-2-yl. Non-limiting examples of alkynyl groups include ethynyl, prop-2-inyl (also propargyl), propyne-1-yl, and 2-methylhexa-4-in-1-yl. Non-limiting examples of substituted alkynyl groups include 5-hydroxy-5-methylhexa-3-inyl, 6-hydroxy-6-methylhepta-3-in-2-yl, and 5-hydroxy-5-ethylhepta-3-inyl.
[0285] As used herein, “cycloalkyl” refers to a non-aromatic carbon-containing ring comprising a cycloalkyl, alkenyl, and alkynyl group, whether used alone or as part of another group, for example, having 3 to 14 ring carbon atoms, preferably 3 to 7 or 3 to 6 ring carbon atoms, or 3 to 4 ring carbon atoms, and optionally containing one or more (e.g., 1, 2, or 3) double or triple bonds. Cycloalkyl groups can be monocyclic (e.g., cyclohexyl) or polycyclic (e.g., including fused ring systems, bridging ring systems, and / or spiro-ring systems), with carbon atoms located inside or outside the ring system. Any preferred ring position of the cycloalkyl group can be covalently bonded to the defined chemical structure. Cycloalkyl rings can be optionally substituted. Non-limiting examples of cycloalkyl groups include cyclopropyl, 2-methyl-cyclopropyl, cyclopropenyl, cyclobutyl, 2,3-dihydroxycyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclopentadienyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctanyl, dekalinyl, 2,5-dimethylcyclopentyl, 3,5-dichlorocyclohexyl, 4-hydroxycyclohexyl, 3,3,5-trimethylcyclohexa-1-yl, octahydropentenyl, octahydro-1H-indenyl, 3a,4,5,6,7,7a-hexahydro-3H-indenyl-4-yl, decahydroazlenyl, bicyclo[6.2.0]decanyl, decahydronaphthalinyl, and dodecahydro-1H-fluorenyl. The term "cycloalkyl" also includes carbocyclic hydrocarbon rings, non-limiting examples of which include bicyclic-[2.1.1]hexanyl, bicyclic[2.2.1]heptanyl, bicyclic[3.1.1]heptanyl, 1,3-dimethyl[2.2.1]heptan-2-yl, bicyclic[2.2.2]octanyl, and bicyclic[3.3.3]undecanyl.
[0286] The term "haloalkyl" is intended to include both branched and linear saturated aliphatic hydrocarbon groups having a specified number of carbon atoms, substituted with one or more halogens. Haloalkyls include perhaloalkyls, where all hydrogens of the alkyl group are replaced with halogens (e.g., -CF3, -CF2CF3). Haloalkyls can optionally be substituted with one or more substituents in addition to halogens. Examples of haloalkyls include, but are not limited to, fluoromethyl, dichloroethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl groups.
[0287] The term "alkoxy" refers to the -O-alkyl group, which is defined above. Alkoxy groups can be optionally substituted. The term C3-C6 cyclic alkoxy refers to a ring containing 3-6 carbon atoms and at least one oxygen atom (e.g., tetrahydrofuran, tetrahydro-2H-pyran). C3-C6 cyclic alkoxy groups can be optionally substituted.
[0288] The term “aryl,” used alone or as part of another group, is defined herein as a monocyclic unsaturated aromatic ring with six carbon members, or a polycyclic unsaturated aromatic ring with 10 to 14 carbon members. An aryl ring can be, for example, a phenyl or naphthyl ring optionally substituted with one or more moies, each capable of replacing one or more hydrogen atoms. Non-limiting examples of aryl groups include phenyl, naphthylene-1-yl, naphthylene-2-yl, 4-fluorophenyl, 2-hydroxyphenyl, 3-methylphenyl, 2-amino-4-fluorophenyl, 2-(N,N-diethylamino)phenyl, 2-cyanophenyl, 2,6-di-tert-butylphenyl, 3-methoxyphenyl, 8-hydroxynaphthylene-2-yl, 4,5-dimethoxynaphthylene-1-yl, and 6-cyano-naphthylene-1-yl. The aryl group also includes a phenyl or naphthyl ring fused with one or more saturated or partially saturated carbon rings (e.g., bicyclo[4.2.0]octa-1,3,5-trienyl, indanyl) which may be substituted with one or more carbon atoms of an aromatic and / or saturated or partially saturated ring.
[0289] The terms "arylalkyl" or "aralkyl" refer to the group-alkyl-aryl, where alkyl and aryl groups are as defined herein. The aralkyl groups in this disclosure are optionally substituted. Examples of arylalkyl groups include, for example, benzyl, 1-phenylethyl, 2-phenylethyl, 3-phenylpropyl, 2-phenylpropyl, and fluorenylmethyl.
[0290] Whether used alone or as part of another group, the terms “heterocyclic” and / or “heterocyclic” and / or “heterosilyl” are defined herein as one or more rings having 3 to 20 atoms, where at least one atom in at least one ring is a heteroatom selected from nitrogen (N), oxygen (O), or sulfur (S), and the rings containing the heteroatoms are further non-aromatic. In heterocyclic groups containing two or more fused rings, the non-heteroatom bearing rings may be aryl (e.g., indolinyl, tetrahydroquinolinyl, chromanyl). Exemplary heterocyclic groups have 3 to 14 ring atoms, of which 1 to 5 are heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). One or more N or S atoms in a heterocyclic group can be oxidized. Heterocyclic groups can be optionally substituted.
[0291] Non-restrictive examples of heterocyclic units having a monocycle include azilidinyl, azilidinyl, uralyl, azetidinyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolidinyl, isothiazolyl, isothiazolinone, oxathiazolinonyl, oxazolidinyl, hydantoinyl, tetrahydrofuranyl, pyrrolidinyl, morpholinyl, piperazinyl, piperidinyl, dihydropyranyl, tetrahydropyranyl, piperidine-2-onyl (valerolactam), 2,3,4,5-tetrahydro-1H-azepinyl, 2,3-dihydro-1H-indole, and 1,2,3,4-tetrahydroquinoline. Non-restrictive examples of heterocyclic units having two or more rings include hexahydro-1H-pyrrolidinyl, 3a,4,5,6,7,7a-hexahydro-1H-benzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-1H-indolyl, 1,2,3,4-tetrahydroquinolinyl, chromanil, isochromanil, indolinil, isoindolinil, and decahydro-1H-cycloocta[b]pyrrolyl.
[0292] Whether used alone or as part of another group, the term "heteroaryl" is defined herein as one or more rings having 5 to 20 atoms, where at least one atom in at least one ring is a heteroatom selected from nitrogen (N), oxygen (O), or sulfur (S), and at least one of the rings containing the heteroatoms is aromatic. In heteroaryl groups containing two or more fused rings, the non-heteroatom bearing rings may be carbocyclic (e.g., 6,7-dihydro-5H-cyclopentapyrimidine) or aryl (e.g., benzofuranyl, benzothiophenyl, indolyl). Exemplary heteroaryl groups have 5 to 14 ring atoms and contain 1 to 5 ring heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). One or more N or S atoms in a heteroaryl group can be oxidized. Heteroaryl groups can be substituted. Non-limiting examples of heteroaryl rings containing monocyclic rings include 1,2,3,4-tetrazolyl, [1,2,3]triazolyl, [1,2,4]triazolyl, triazinyl, thiazolyl, 1H-imidazolyl, oxazolyl, furanyl, thiophenyl, pyrimidinyl, 2-phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4-dimethylaminopyridinyl. Non-limiting examples of heteroaryl rings containing two or more fused rings include benzofuranyl, benzothiophenyl, benzoxazolyl, benzthiazolyl, benztriazolyl, synnolinyl, naphthilidinyl, phenantridinyl, 7H-prinyl, 9H-prinyl, 6-amino-9H-prinyl, 5H-pyrrolo[3,2-d]pyrimidinyl, 7H-pyrrolo[2,3-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, 2-phenylbenzo[d]thiazolyl, 1H-indolyl, 4,5,6,7-tetrahydro-1-H-indolyl, quinoxalinyl, 5-methylquinoxalinyl, quinazolinyl, quinolinyl, 8-hydroxyquinolinyl, and isoquinolinyl.
[0293] A non-limiting example of the heteroaryl group described above is a C1-C5 heteroaryl having 1-5 carbocyclic atoms and at least one additional ring atom which is a heteroatom independently selected from nitrogen (N), oxygen (O), or sulfur (S) (preferably 1-4 additional ring atoms which are heteroatoms). Examples of C1-C5 heteroaryls include, but are not limited to, triazinyl, thiazole-2-yl, thiazole-4-yl, imidazole-1-yl, 1H-imidazole-2-yl, 1H-imidazole-4-yl, isoxazolin-5-yl, furan-2-yl, furan-3-yl, thiophene-2-yl, thiophene-4-yl, pyrimidine-2-yl, pyrimidine-4-yl, pyrimidine-5-yl, pyridine-2-yl, pyrididine-3-yl, and pyrididine-4-yl.
[0294] Unless otherwise stated, when two substituents combine to form a ring having a specific number of ring atoms (for example, when two R groups, together with the nitrogen (N) to which they are bonded, form a ring having 3 to 7 ring members), the ring may have a carbon atom and one or more additional heteroatoms (e.g., 1 to 3) optionally and independently selected from nitrogen (N), oxygen (O), or sulfur (S). The ring may be saturated or partially saturated and may be optionally substituted.
[0295] For the purposes of this disclosure, fused ring units containing a single heteroatom, as well as spirocyclic rings, bicyclic rings, etc., are considered to belong to the cyclic family corresponding to heteroatom-containing rings. For example, the following formula: [ka] 1,2,3,4-tetrahydroquinoline having the following formula is considered a heterocyclic unit for the purposes of this disclosure. [ka] A 6,7-dihydro-5H-cyclopentapyrimidine having the above characteristics is considered a heteroaryl unit for the purposes of this disclosure. When a fused ring unit contains heteroatoms in both a saturated ring and an aryl ring, the aryl ring is dominant, determining the type of category to which the ring is assigned. For example, the following formula: [ka] 1,2,3,4-tetrahydro-[1,8]naphthyridine having this property is considered a heteroaryl unit for the purposes of this disclosure.
[0296] Whenever the terms or their prefix roots appear in the name of a substituent, that name should be interpreted as including those limitations provided herein. For example, whenever the terms “alkyl” or “aryl” or their prefix roots appear in the name of a substituent (e.g., arylalkyl, alkylamino), that name should be interpreted as including those limitations given above for “alkyl” and “aryl.”
[0297] The term “substituted” is used throughout this specification. “Substituted” is defined herein as a moiety having one or more hydrogen atoms replaced by substituents or several (e.g., 1 to 10) substituents, whether acyclic or cyclic. A substituent can replace one or two hydrogen atoms of a single moiety at a time. In addition, these substituents can replace two hydrogen atoms on two adjacent carbons to form the substituent, new moiety, or unit. Examples of substituted units requiring a single hydrogen atom replacement include halogens and hydroxyls. Examples of substitutions involving two hydrogen atoms include carbonyls and oxyminos. Examples of substitutions involving two hydrogen atoms from adjacent carbon atoms include epoxys. Throughout this specification, the term “substituted” is used to indicate that a moiety can have one or more hydrogen atoms replaced by substituents. Where a moiety is described as “substituted,” any number of hydrogen atoms may be replaced. For example, difluoromethyl is a substituted C1 alkyl, trifluoromethyl is a substituted C1 alkyl, 4-hydroxyphenyl is a substituted aromatic ring, (N,N-dimethyl-5-amino)octanyl is a substituted C8 alkyl, 3-guanidinopropyl is a substituted C3 alkyl, and 2-carboxypyridinyl is a substituted heteroaryl.
[0298] The variable groups defined herein, such as alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryloxy, aryl, heterocyclic, and heteroaryl groups, can be optionally substituted, whether used alone or as part of another group. Groups that have been optionally substituted are indicated as such.
[0299] The following are non-restrictive examples of substituents that can substitute for hydrogen atoms on a portion of a molecule: halogens (chlorine (Cl), bromine (Br), fluorine (F), and iodine (I)), -CN, -NO2, oxo (=O), -OR x , -SRx , -N(R x )2, -NR x C(O)R x , -SO2R x , -SO2OR x , -SO2N(R x )2, -C(O)R x , -C(O)OR x ,-C(O)N(R x )2, C 1~6 Alkyl, C 1~6 Haloalkyl, C 1~6 Alkoxy, C 2~8 Alkenil, C 2~8 Alkinyl, C 3~14 The group is cycloalkyl, aryl, heterocyclic, or heteroaryl, and each of the alkyl, haloalkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, heterocyclic, and heteroaryl groups is halogen, -CN, -NO2, oxo, and R x It is arbitrarily substituted with 1 to 10 (e.g., 1 to 6 or 1 to 4) bases independently selected from R x Each instance independently produces hydrogen, -OR x+1 , -SR x+1 , -C(O)R x+1 , -C(O)OR x+1 ,-C(O)N(R x+1 )2, -SO2R x+1 -S(O)2OR x+1 , -N(R x+1 )2, -NR x+1 C(O)R x+1 , C 1~6 Alkyl, C 1~6 Haloalkyl, C 2~8 Alkenil, C 2~8 Alkynyl, cycloalkyl (e.g., C 3~6 Two R atoms together with the atom(s) to which they are bonded (cycloalkyl), aryl, heterocyclic, or heteroaryl. x The unit forms a selectively substituted carbon ring or hetero ring, and the carbon ring or hetero ring has 3 to 7 ring atoms, R x+1 Each instance of appearance independently involves hydrogen and C. 1~6 Alkyl, C1~6 Haloalkyl, C 2~8 Alkenil, C 2~8 Alkynyl, cycloalkyl (e.g., C 3~6 Two R atoms together with the atom(s) to which they are bonded (cycloalkyl), aryl, heterocyclic, or heteroaryl. x+1 The unit forms a selectively substituted carbon ring or hetero ring, which preferably has 3 to 7 ring atoms.
[0300] In some embodiments, the substituents are i)-OR x+2 For example, -OH, -OCH3, -OCH2CH3, -OCH2CH2CH3, ii)-C(O)R x+2 For example, -COCH3, -COCH2CH3, -COCH2CH2CH3, iii)-C(O)OR x+2 For example, -CO2CH3, -CO2CH2CH3, -CO2CH2CH2CH3, iv)-C(O)N(R x+2 )2, for example, -CONH2, -CONHCH3, -CON(CH3)2, v)-N(R x+2 )2, for example, -NH2, -NHCH3, -N(CH3)2, -NH(CH2CH3), vi) Halogens, -F, -Cl, -Br, and -I vii)-CH e X g (In the formula, X is a halogen, m is between 0 and 2, and e+g=3), for example, -CH2F, -CHF2, -CF3, -CCl3, or -CBr3. viii)-SO2R x+2 For example, -SO2H, -SO2CH3, -SO2C6H5, ix) C1-C6 linear, branched, or cyclic alkyl groups, x) Cyano xi) Nitro, xii)N(R x+2 )C(O)R x+2 , xiii) Oxo (=O), xiv) Complex algebras, and xv) Selected from heteroaryls, Each R x+2 However, independently, hydrogen, optionally substituted C1-C6 linear or branched alkyl (e.g., optionally substituted C1-C4 linear or branched alkyl), or optionally substituted C3-C6 cycloalkyl (e.g., optionally substituted C3-C4 cycloalkyl), or two R x+2 The units can come together to form a ring containing 3 to 7 ring atoms. In a particular embodiment, each R x+2 These are, independently, hydrogen, C1-C6 linear or branched alkyl, and C3-C6 cycloalkyl or C3-C6 cycloalkyl optionally substituted with a halogen or a C3-C6 cycloalkyl.
[0301] The compounds described herein may contain asymmetric atoms (also referred to as chiral centers), and some compounds may contain one or more asymmetric atoms or centers, thus giving rise to optical isomers (enantiomers) and diastereomers. The teachings and compounds disclosed herein include such enantiomers and diastereomers, as well as racemic and decomposed enantiomerically pure R and S stereoisomers, as well as other mixtures of R and S stereoisomers, and their pharmaceutically acceptable salts. Optical isomers can be obtained in pure form by standard procedures known to those skilled in the art, including, but not limited to, the formation of diastereomer salts, kinetic decomposition, and asymmetric synthesis. The teachings also include cis and trans isomers of compounds containing alkenyl moieties (e.g., alkenes and imines). It is also understood that the teachings include all possible positional isomers and mixtures thereof, which can be obtained in pure form by standard separation procedures known to those skilled in the art, including, but not limited to, column chromatography, thin-layer chromatography, and high-performance liquid chromatography.
[0302] The MNK inhibitors disclosed herein are given by formula (I'): [ka] A pyridine-1,5-dione having, or a pharmaceutically acceptable salt thereof, wherein, R 1 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloalkyl groups, R 2’ but, [ka] Selected from the group consisting of, R 3’ However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloachil, R 1c and R1d These come together to form a 3-7 membered ring having 0-2 heteroatoms selected from the group consisting of N, O, and S, and the 3-7 membered ring is halo, oxo, C 1~6 Alkyl, R 8 , and -C(=O)OR 9 They may be further optionally substituted with one or more substituents selected from the group consisting of the following: Z 1 and Z 2 However, each can be directly joined or -{C(R 4a )(R 4b )} p -Y 1 - and p is 0, 1, 2, 3, 4, or 5, Y 1 However, direct bonding, -O-, or -N(R) 8 )- and, R 4a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, or two R 4a However, it forms a direct bond by bonding to two adjacent carbon atoms. R 4b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 5 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6 However, hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6a However, -(CO)C 1~6 Alkyl, -(CO)C 3~7 Branched alkyl, -(CO)C1~6 hydroxyalkyl, [ka] Selected from the group consisting of, q is 1, 2, 3, 4, 5, or 6, e is 1, 2, 3, 4, 5, or 6. X 2 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxy, C 3~7 Branched alkoxy, C 1~6 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6Alkyl), N(C 1~6 Alkyl)2, C 1~5 (COOH), C 1~6 Selected from the group consisting of (NHSO2Me), X 3 However, hydrogen, halogen, C 1~5 Alkyl, C 3~7 Branched alkyl, C 1~5 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~5 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~5 Alkoxy, C 3~7 Branched alkoxy, C 1~5 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6 Alkyl), N(C 1~6 Alkyl)2, COOH, C 1~5 (COOH), NHSO2Me, C 1~5 Selected from the group consisting of (NHSO2Me), R 7 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 8 However, C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C 1~6 Alkyl), CO(C 3~7 Branched alkyl), SO2(C 1~6 Alkyl), and SO2(C 3.7 Selected from the group consisting of branched alkyl groups, R 9 However, hydrogen, C 1~6Selected from the group consisting of alkyl and aralkyl.
[0303] In a more specific embodiment, the compound exhibiting MNK inhibition is given by the following formula (IA): [ka] Having a structure represented by, or a pharmaceutically acceptable salt thereof, in the formula, Z 1 but, [ka] and Selected from the group consisting of, R 1 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloalkyl groups, R 2’ but, [ka] Selected from the group consisting of, R 3’ However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloachil, R 4a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4d However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO2(C 1~6 Alkyl), NHSO2(C 3~7 Branched alkyl, and NHSO2(C 3~7 Selected from the group consisting of cycloalkyls, R 4e However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl and C 3~7 It is a branched haloalkyl, R 4f However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl and C 3~7 It is a branched haloalkyl, R 1c and R 1dTogether, they form an X which is arbitrarily chosen to be part of the ring. 1 Forms an optionally substituted 3- to 7-membered ring containing a group, X 1 However, -C(F)2-, -CH(CO2R 12 )-, -O-, -NH-, -N(R 8 Selected from the group consisting of )- and -S(=O)2-, m is 0, 1, or 2, n 1 However, it is 1, 2, or 3, R 5 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6 However, hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6a However, -(CO)C1~6 alkyl, -(CO)C 3~7 Branched alkyl, -(CO)C1~6 hydroxyalkyl, [ka] Selected from the group consisting of, q is 1, 2, 3, 4, 5, or 6, e is 1, 2, 3, 4, 5, or 6. X 2 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Hydroxyalkyl, C3~7 Branched hydroxyalkyl, C 1~6 Alkoxy, C 3~7 Branched alkoxy, C 1~6 Haloalkoxy, C 3~7 Branched haloalkoxy, NH2, NH(C) 1~6 Alkyl), N(C 1~6 Alkyl)2, C 1~5 (COOH), C 1~6 Selected from the group consisting of (NHSO2Me), X 3 However, hydrogen, halogen, C 1~5 Alkyl, C 3~7 Branched alkyl, C 1~5 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~5 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~5 Alkoxy, C 3~7 Branched alkoxy. C 1~5 Haloalkoxy, C 3~7 Branched haloalkoxy. NH2, NH(C 1~6 Alkyl), N(C 1~6 Alkyl)2, COOH, C 1~5 (COOH), NHSO2Me, C 1~5 Selected from the group consisting of (NHSO2Me), R 7 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 8 However, C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C 1~6 Alkyl), CO(C3~7 Branched alkyl), SO2(C 1~6 Alkyl), and SO2(C 3.7 Selected from the group consisting of branched alkyl groups, R 10 But, hydrogen. C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C 1~6 Alkyl), CO(C 3~7 Branched alkyl), SO2(C 1~6 Alkyl), and SO2(C 3.7 Selected from the group consisting of branched alkyl groups. R 11 However, hydrogen and C 1~6 Selected from the group consisting of alkyl groups, R 12 However, hydrogen and C 1~6 Selected from the group consisting of alkyl groups.
[0304] In a more specific embodiment, the compound of the present disclosure is of formula (IIA): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , n 1 , Z 1 , R 5 , R 6 , and R 7 This is defined herein.
[0305] In a more specific embodiment, the compound of the present disclosure is of formula (III): [ka] Contains compounds having or pharmaceutically acceptable salts thereof.1c , R 1d , R 1 , R 3’ , R 4d , R 4c , n 1 , and R 6 are as defined herein.
[0306] In more specific embodiments, the compounds of the present disclosure are of formula (IV): [Chemical formula] a compound having or a pharmaceutically acceptable salt thereof. R 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , n 1 , Z 1 , and R 6 are as defined herein.
[0307] In more specific embodiments, the compounds of the present disclosure are of formula (V): [Chemical formula] a compound having or a pharmaceutically acceptable salt thereof. R 1c , R 1d [[ID=4d , R 4c , n 1 , and Z 1 However, as defined herein, R 8a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7Branched alkoxy, NHCO(C 1~6 alkyl), NHCO(C 3~7 branched alkyl), NHSO2(C 1~6 alkyl), and NHSO2(C 3~7 branched alkyl), selected from the group consisting of R 8d is, at each occurrence, independently hydrogen, halogen, C 1~6 alkyl, C 3~7 branched alkyl, C 1~6 haloalkyl, C 3~7 branched haloalkyl, C 1~6 hydroxyalkyl, C 3~7 branched hydroxyalkyl, hydroxy, C 1~6 alkoxyl, C 3~7 branched alkoxy, NHCO(C 1~6 alkyl), NHCO(C 3~7 branched alkyl), NHSO2(C 1~6 alkyl), and NHSO2(C 3~7 branched alkyl), selected from the group consisting of R 9a is hydrogen, halogen, C 1~6 alkyl, C 3~7 branched alkyl, C 1~6 haloalkyl, C 3~7 branched haloalkyl, C 1~6 hydroxyalkyl, C 3~7 branched hydroxyalkyl, hydroxy, C 1~6 alkoxyl, and C 3~7 branched alkoxy selected from the group consisting of R 9b is hydrogen, halogen, C 1~6 alkyl, C 3~7 branched alkyl, C 1~6 haloalkyl, C 3~7 branched haloalkyl, C 1~6 hydroxyalkyl, C 3~7 branched hydroxyalkyl, hydroxy, C 1~6 alkoxyl, and C 3~7 branched alkoxy selected from the group consisting of R 9a and R 9bThese come together to form a 3- to 7-membered ring that is optionally substituted. q is 1, 2, or 3, z is 0, 1, or 2.
[0309] In a more specific embodiment, the compound of the present disclosure is of formula (VII): [ka] A compound having or a pharmaceutically acceptable salt thereof, wherein, R 1 , R 2’ , R 3’ , R 4d , R 4c , Z 1 , X 1 , and n 1 However, as defined herein, R 8a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8d However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, q is 1, 2, or 3, z is 0, 1, or 2.
[0310] In a more specific embodiment, the compounds of the present disclosure are of formula (VIII): [ka] A compound having or a pharmaceutically acceptable salt thereof, wherein, R 1 , R 3’ , R 4d , R 4c , Z 1 , R 5 , R 6 , R 7 , and n 1 However, as defined herein, R 8a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8d However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 9a However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 9b However, hydrogen, halogen, C 1~6Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7分 C-type haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, q is 1, 2, or 3, z is 0, 1, or 2.
[0311] In more specific embodiments, the compounds of the present disclosure are of formula (IX): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , Z 1 , R 6 , R 8a , R 8b , R 8c , R 8d , n 1 , and z are as defined herein.
[0312] In a more specific embodiment, the compound of the present disclosure is of formula (X): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , Z 1 , R 6 , R 8a , R 8b , R 8c , R8d , R 9a , R 9b , n 1 , and z are as defined herein.
[0313] In more specific embodiments, the compounds of the present disclosure are of formula (XI): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , Z 1 , R 6 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , n 1 , and z are as defined herein.
[0314] In a more specific embodiment, the compound of the present disclosure is of formula (XII): [ka] A compound having or a pharmaceutically acceptable salt thereof, wherein, R 1 , R 3’ , R 4d , R 4c , Z 1 , R 5 , R 6 , R 7 , X 1 , and n 1 However, as defined herein, R 8a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8c However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, R 8d However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHSO2(C 1~6 Alkyl), and NHSO2(C 3~7 Selected from the group consisting of branched alkyl groups, q is 1, 2, or 3, z is 0, 1, or 2.
[0315] In a more specific embodiment, the compound of the present disclosure is of formula (XIII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , Z 1 , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 , and z are as defined herein.
[0316] In more specific embodiments, the compounds of the present disclosure are of formula (XIV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , Z 1 , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1, and z are as defined herein.
[0317] In a more specific embodiment, the compounds of the present disclosure are of formula (XV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , Z 1 , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 , and z are as defined herein.
[0318] In more specific embodiments, the compounds of the present disclosure are of formula (XVI): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 5 , R 6 , R 7 , and n 1 This is defined herein.
[0319] The compounds disclosed herein are of formula (XV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , R4e , R 4f , R 6 , and n 1 This is defined herein.
[0320] In more specific embodiments, the compounds of the present disclosure are of formula (XVI): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 6 , and n 1 This is defined herein.
[0321] In a more specific embodiment, the compound of the present disclosure is of formula (XVII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 6 , and n 1 This is defined herein.
[0322] In a more specific embodiment, the compounds of the present disclosure are of formula (XVIII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4a , R 4b, R 4d , R 4c , R 5 , R 6 , R 7 , and n 1 This is defined herein.
[0323] In a more specific embodiment, the compound of the present disclosure is of formula (XIX): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , R 4b , R 6 , and n 1 This is defined herein.
[0324] In more specific embodiments, the compounds of the present disclosure are of formula (XX): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d , R 4c , R 4a , R 4b , R 6 , and n 1 This is defined herein.
[0325] In more specific embodiments, the compounds of the present disclosure are of formula (XX): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1c , R 1d , R 1 , R 3’ , R 4d, R 4c , R 4a , R 4b , R 6 , and n 1 This is defined herein.
[0326] In a more specific embodiment, the compounds of the present disclosure are of formula (XXI): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 2’ , R 3’ , R 4d , R 4c , R 4e , R 4f , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , n 1 q and z are as defined herein.
[0327] In a more specific embodiment, the compound of the present disclosure is of formula (XXII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 2’ , R 3’ , R 4d , R 4c , R 4e , R 4f , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , m, n 1 q and z are as defined herein.
[0328] In a more specific embodiment, the compound of the present disclosure is of formula (XXIII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 2’ , R 3’ , R 4d , R 4c , R 4e , R 4f , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 q and z are as defined herein.
[0329] In more specific embodiments, the compounds of the present disclosure are of formula (XXIV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 2’ , R 3’ , R 4d , R 4c , R 4e , R 4f , R 8a , R 8b , R 8c , R 8d , X 1 , m, n 1 q and z are as defined herein.
[0330] In a more specific embodiment, the compounds of the present disclosure are of formula (XXV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 5 , R 6 , R 7 , R 8a , R 8b , R8c , R 8d , R 9a , R 9b , n 1 q and z are as defined herein.
[0331] In a more specific embodiment, the compounds of the present disclosure are of formula (XXVI): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 6 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , n 1 q and z are as defined herein.
[0332] In a more specific embodiment, the compound of the present disclosure is of formula (XXVII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 6 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , n 1 q and z are as defined herein.
[0333] In a more specific embodiment, the compound of the present disclosure is of formula (XXVIII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 6 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , n 1 q and z are as defined herein.
[0334] In more specific embodiments, the compounds of the present disclosure are of formula (XXIX): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4a , R 4b , R 4d , R 4c , R 5 , R 6 , R 7 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , m, n 1 q and z are as defined herein.
[0335] In a more specific embodiment, the compound of the present disclosure is of formula (XXX): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4a , R 4b , R 4d , R 4c , R 6 , R8a , R 8b , R 8c , R 8d , R 9a , R 9b , m, n 1 q and z are as defined herein.
[0336] In more specific embodiments, the compounds of the present disclosure are of formula (XXXI): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4a , R 4b , R 4d , R 4c , R 6 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , m, n 1 q and z are as defined herein.
[0337] In a more specific embodiment, the compound of the present disclosure is of formula (XXXII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4a , R 4b , R 4d , R 4c , R 6 , R 8a , R 8b , R 8c , R 8d , R 9a , R 9b , m, n 1 q and z are as defined herein.
[0338] In a more specific embodiment, the compound of the present disclosure is of formula (XXXIII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 5 , R 6 , R 7 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 q and z are as defined herein.
[0339] In more specific embodiments, the compounds of the present disclosure are of formula (XXXIV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e , R 4f , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 q and z are as defined herein.
[0340] In a more specific embodiment, the compounds of the present disclosure are of formula (XXXV): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4e, R 4f , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 q and z are as defined herein.
[0341] In a more specific embodiment, the compound of the present disclosure is of formula (XXXVI): [ka] or a pharmaceutically acceptable salt thereof. 1 , R 3’ , R 4d , R 4c , R 4a , R 4b , R 5 , R 6 , R 7 , R 8a , R 8b , R 8c , R 8d , X 1 , n 1 q and z are as defined herein.
[0342] In a more specific embodiment, the compound of the present disclosure is of formula (XXXVII): [ka] Contains compounds having or pharmaceutically acceptable salts thereof. 1 , R 3’ , R 4d , R 4c , R 4a , R 4b , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , m, n 1 q and z are as defined herein.
[0343] In a more specific embodiment, the compound of the present disclosure is of formula (XXXVIII): [ka] or a pharmaceutically acceptable salt thereof. 1 , R 3’ , R 4d , R 4c , R 4a , R 4b , R 6 , R 8a , R 8b , R 8c , R 8d , X 1 , m, n 1 q and z are as defined herein.
[0344] In more specific embodiments, the compounds of the present disclosure are of formula (XXXVIIII)~(LI): [ka] It contains compounds having or pharmaceutically acceptable salts thereof.
[0345] In some embodiments, Z 1 teeth, [ka] In some embodiments, Z 1 teeth, [ka] That is the case.
[0346] In some embodiments, R 1 is hydrogen. In some embodiments, R 1 is a halogen. In some embodiments, R 1 C 1~6 It is alkyl. In some embodiments, R 1 C 3~7 It is a branched alkyl group. In some embodiments, R 1 C1~6 In some embodiments, R 1 C 3~7 It is a branched haloalkyl. In some embodiments, R 1 C 1~6 It is hydroxyl. In some embodiments, R 1 C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 1 is cyano. In some embodiments, R 1 C 1~6 It is an alkoxyl. In some embodiments, R 1 C 3~7 It is a branched alkoxy. In some embodiments, R 1 is hydroxyl. In some embodiments, R 1 C 3~6 It is cycloalkyl. In some embodiments, R 1 is halogen, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C substituted with one substituent selected from the group consisting of hydroxyalkyl groups 3~6 It is cycloalkyl. In some embodiments, R 1 is halogen, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C substituted with two substituents selected from the group consisting of hydroxyalkyl groups 3~6 It is cycloalkyl. In some embodiments, R 1 is halogen, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C substituted with three substituents selected from the group consisting of hydroxyalkyl groups 3~6 It is a cycloalkyl group.
[0347] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] In some embodiments, R 2’ teeth, [ka] That is the case.
[0348] In some embodiments, R 3’ is hydrogen. In some embodiments, R 3’ is a halogen. In some embodiments, R 3’ C 1~6 It is alkyl. In some embodiments, R 3’ C 3~7 It is a branched alkyl group. In some embodiments, R 3’ C 1~6 In some embodiments, R 3’ C 3~7 It is a branched haloalkyl. In some embodiments, R 3’ C 1~6 It is hydroxyl. In some embodiments, R 3’ C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 3’ is cyano. In some embodiments, R 3’ C1~6 It is an alkoxyl. In some embodiments, R 3’ C 3~7 It is a branched alkoxy. In some embodiments, R 3’ is hydroxyl. In some embodiments, R 3’ C 3~6 It is cycloalkyl. In some embodiments, R 3’ is halogen, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C substituted with one substituent selected from the group consisting of hydroxyalkyl groups 3~6 It is cycloachil. In some embodiments, R 3’ is halogen, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C substituted with two substituents selected from the group consisting of hydroxyalkyl groups 3~6 It is cycloachil. In some embodiments, R 3’ is halogen, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C substituted with three substituents selected from the group consisting of hydroxyalkyl groups 3~6 It is cycloacyl.
[0349] In some embodiments, R 4a is hydrogen. In some embodiments, R 4a is a halogen. In some embodiments, R 4a C 1~6 It is alkyl. In some embodiments, R 4a C 3~7 It is a branched alkyl group. In some embodiments, R 4a C 1~6 In some embodiments, R 4a C 3~7 It is a branched haloalkyl. In some embodiments, R 4a is hydroxyl. In some embodiments, R 4a C 1~6It is an alkoxyl. In some embodiments, R 4a C 3~7 It is a branched alkoxy. In some embodiments, R 4a NHCO(C 1~6 It is alkyl. In some embodiments, R 4a NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 4a NHCO(C 3~7 It is a cycloalkyl. In some embodiments, R 4a NHSO2(C 1~6 It is alkyl. In some embodiments, R 4a NHSO2(C 3~7 It is a branched alkyl group. In some embodiments, R 4a NHSO2(C 3~7 It is a cycloalkyl group.
[0350] In some embodiments, R 4b is hydrogen. In some embodiments, R 4b is a halogen. In some embodiments, R 4b C 1~6 It is alkyl. In some embodiments, R 4b C 3~7 It is a branched alkyl group. In some embodiments, R 4b C 1~6 In some embodiments, R 4b C 3~7 It is a branched haloalkyl. In some embodiments, R 4b is hydroxyl. In some embodiments, R 4b C 1~6 It is an alkoxyl. In some embodiments, R 4b C 3~7 It is a branched alkoxy. In some embodiments, R 4b NHCO(C 1~6 It is alkyl. In some embodiments, R 4b NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R4b NHCO(C 3~7 It is a cycloalkyl. In some embodiments, R 4b NHSO2(C 1~6 It is alkyl. In some embodiments, R 4b NHSO2(C 3~7 It is a branched alkyl group. In some embodiments, R 4b NHSO2(C 3~7 It is a cycloalkyl group.
[0351] In some embodiments, R 4c is hydrogen. In some embodiments, R 4c is a halogen. In some embodiments, R 4c C 1~6 It is alkyl. In some embodiments, R 4c C 3~7 It is a branched alkyl group. In some embodiments, R 4c C 1~6 In some embodiments, R 4c C 3~7 It is a branched haloalkyl. In some embodiments, R 4c is hydroxyl. In some embodiments, R 4c C 1~6 It is an alkoxyl. In some embodiments, R 4c C 3~7 It is a branched alkoxy. In some embodiments, R 4c NHCO(C 1~6 It is alkyl. In some embodiments, R 4c NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 4c NHCO(C 3~7 It is a cycloalkyl. In some embodiments, R 4c NHSO2(C 1~6 It is alkyl. In some embodiments, R 4c NHSO2(C 3~7 It is a branched alkyl group. In some embodiments, R 4cNHSO2(C 3~7 It is a cycloalkyl group.
[0352] In some embodiments, R 4d is hydrogen. In some embodiments, R 4d is a halogen. In some embodiments, R 4d C 1~6 It is alkyl. In some embodiments, R 4d C 3~7 It is a branched alkyl group. In some embodiments, R 4d C 1~6 In some embodiments, R 4d C 3~7 It is a branched haloalkyl. In some embodiments, R 4d is hydroxyl. In some embodiments, R 4d C 1~6 It is an alkoxyl. In some embodiments, R 4d C 3~7 It is a branched alkoxy. In some embodiments, R 4d NHCO(C 1~6 It is alkyl. In some embodiments, R 4d NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 4d NHCO(C 3~7 It is a cycloalkyl. In some embodiments, R 4d NHSO2(C 1~6 It is alkyl. In some embodiments, R 4d NHSO2(C 3~7 It is a branched alkyl group. In some embodiments, R 4d NHSO2(C 3~7 It is a cycloalkyl group.
[0353] In some embodiments, R 4e is hydrogen. In some embodiments, R 4e is a halogen. In some embodiments, R 4e C 1~6It is alkyl. In some embodiments, R 4e C 3~7 It is a branched alkyl group. In some embodiments, R 4e C 1~6 In some embodiments, R 4e C 3~7 It is a branched haloalkyl group.
[0354] In some embodiments, R 4f is hydrogen. In some embodiments, R 4f is a halogen. In some embodiments, R 4f C 1~6 It is alkyl. In some embodiments, R 4f C 3~7 It is a branched alkyl group. In some embodiments, R 4f C 1~6 In some embodiments, R 4f C 3~7 It is a branched haloalkyl group.
[0355] In some embodiments, R 1c and R 1d They come together to form an optionally substituted three-membered ring. In some embodiments, R 1c and R 1d They come together to form an optionally substituted four-membered ring. In some embodiments, R 1c and R 1d They come together to form an optionally substituted five-membered ring. In some embodiments, R 1c and R 1d They come together to form an optionally substituted 6-membered ring. In some embodiments, R 1c and R 1d They come together to form an optionally substituted 7-membered ring. In some embodiments, R 1c and R 1d They came together, X 1 It forms an optionally substituted three-membered ring containing the group. In some embodiments, R 1c and R1d They came together, X 1 It forms an optionally substituted four-membered ring containing the group. In some embodiments, R 1c and R 1d They came together, X 1 It forms an optionally substituted five-membered ring containing the group. In some embodiments, R 1c and R 1d They came together, X 1 It forms an optionally substituted 6-membered ring containing the group. In some embodiments, R 1c and R 1d They came together, X 1 It forms an optionally substituted 7-membered ring containing the group.
[0356] In some embodiments, X 1 is CF2. In some embodiments, X 1 CHCO2R 12 In some embodiments, X 1 In some embodiments, X 1 is NH. In some embodiments, X 1 , NR 8 In some embodiments, X 1 It is SO2.
[0357] In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2.
[0358] In some embodiments, n 1 In some embodiments, n 1 In some embodiments, n 1 The answer is 3.
[0359] In some embodiments, R 5 is hydrogen. In some embodiments, R 5 is a halogen. In some embodiments, R 5 C 1~6It is alkyl. In some embodiments, R 5 C 3~7 It is a branched alkyl group. In some embodiments, R 5 C 1~6 In some embodiments, R 5 C 3~7 It is a branched haloalkyl. In some embodiments, R 5 C 1~6 It is an alkoxyl. In some embodiments, R 5 C 3~7 It is a branched alkoxy. In some embodiments, R 5 It is hydroxyl.
[0360] In some embodiments, R 6 is hydrogen. In some embodiments, R 6 is NH2. In some embodiments, R 6 NHR 6a In some embodiments, R 6 is NHCH2CH2OH. In some embodiments, R 6 R is NHCH2CH2NHSO2Me. In some embodiments, R 6 C 1~6 It is an alkoxyl. In some embodiments, R 6 C 3~7 It is a branched alkoxy. In some embodiments, R 6 It is hydroxyl.
[0361] In some embodiments, R 6a is -(CO)C1~6 alkyl. In some embodiments, R 6a is -(CO)C 3~7 It is a branched alkyl group. In some embodiments, R 6a R is a -(CO)C1-6 hydroxyalkyl group. In some embodiments, R 6a teeth, [ka] In some embodiments, R6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] In some embodiments, R 6a teeth, [ka] That is the case.
[0362] In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6.
[0363] In some embodiments, e is 1. In some embodiments, e is 2. In some embodiments, e is 3. In some embodiments, e is 4. In some embodiments, e is 5. In some embodiments, e is 6.
[0364] In some embodiments, X 2 is hydrogen. In some embodiments, X 2 is a halogen. In some embodiments, X 2 C 1~6 It is alkyl. In some embodiments, X 2 C 3~7 It is a branched alkyl group. In some embodiments, X 2 C 1~6 In some embodiments, X 2 C 3~7 It is a branched haloalkyl. In some embodiments, X 2 is hydroxyl. In some embodiments, X 2 C 1~6 It is a hydroxyalkyl group. In some embodiments, X 2 C 3~7 It is a branched hydroxyalkyl group. In some embodiments, X 2 C 1~6 It is an alkoxy. In some embodiments, X 2 C 3~7 It is a branched alkoxy. In some embodiments, X 2 C 1~6 In some embodiments, X 2 C 3~7 It is a branched haloalkoxy. In some embodiments, X 2is NH2. In some embodiments, X 2 , NH(C 1~6 It is alkyl. In some embodiments, X 2 is, N(C 1~6 It is alkyl)2. In some embodiments, X 2 C 1~5 (COOH) is the case in some embodiments. 2 C 1~6 (NHSO2Me)
[0365] In some embodiments, X 3 is hydrogen. In some embodiments, X 3 is a halogen. In some embodiments, X 3 C 1~5 It is alkyl. In some embodiments, X 3 C 3~7 It is a branched alkyl group. In some embodiments, X 3 C 1~5 In some embodiments, X 3 C 3~7 It is a branched haloalkyl. In some embodiments, X 3 is hydroxyl. In some embodiments, X 3 C 1~5 It is a hydroxyalkyl group. In some embodiments, X 3 C 3~7 It is a branched hydroxyalkyl group. In some embodiments, X 3 C 1~5 It is an alkoxy. In some embodiments, X 3 C 3~7 It is a branched alkoxy. In some embodiments, X 3 C 1~5 In some embodiments, X 3 C 3~7 It is a branched haloalkoxy. In some embodiments, X 3 is NH2. In some embodiments, X 3 , NH(C 1~6It is alkyl. In some embodiments, X 3 is, N(C 1~6 It is alkyl)2. In some embodiments, X 3 is COOH. In some embodiments, X 3 C 1~5 (COOH) is the case in some embodiments. 3 is NHSO2Me. In some embodiments, X 3 C 1~5 (NHSO2Me)
[0366] In some embodiments, R 7 is hydrogen. In some embodiments, R 7 is a halogen. In some embodiments, R 7 C 1~6 It is alkyl. In some embodiments, R 7 C 3~7 It is a branched alkyl group. In some embodiments, R 7 C 1~6 In some embodiments, R 7 C 3~7 It is a branched haloalkyl. In some embodiments, R 7 C 1~6 It is an alkoxyl. In some embodiments, R 7 C 3~7 It is a branched alkoxy. In some embodiments, R 7 It is hydroxyl.
[0367] In some embodiments, R 8 C 1~6 It is alkyl. In some embodiments, R 8 C 1~6 In some embodiments, R 8 C 3~7 It is a branched haloalkyl. In some embodiments, R 8 C 1~6 It is hydroxyl. In some embodiments, R 8 C 3~7It is a branched hydroxyalkyl. In some embodiments, R 8 C 1~6 It is an alkoxyl. In some embodiments, R 8 C 3~7 It is a branched alkoxy. In some embodiments, R 8 CO(C 1~6 It is alkyl. In some embodiments, R 8 CO(C 3~7 It is a branched alkyl group. In some embodiments, R 8 SO2(C 1~6 It is alkyl. In some embodiments, R 8 SO2(C 3.7 It is a branched alkyl group.
[0368] In some embodiments, R 8a is hydrogen. In some embodiments, R 8a is a halogen. In some embodiments, R 8a C 1~6 It is alkyl. In some embodiments, R 8a C 3~7 It is a branched alkyl group. In some embodiments, R 8a C 1~6 In some embodiments, R 8a C 3~7 It is a branched haloalkyl. In some embodiments, R 8a C 1~6 It is a hydroxyalkyl group. In some embodiments, R 8a C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 8a is hydroxyl. In some embodiments, R 8a C 1~6 It is an alkoxyl. In some embodiments, R 8a C 3~7 It is a branched alkoxy. In some embodiments, R 8a NHCO(C 1~6 It is alkyl. In some embodiments, R 8aNHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 8a NHSO2(C 1~6 It is alkyl. In some embodiments, R 8a NHSO2(C 3~7 It is a branched alkyl group.
[0369] In some embodiments, R 8b is hydrogen. In some embodiments, R 8b is a halogen. In some embodiments, R 8b C 1~6 It is alkyl. In some embodiments, R 8b C 3~7 It is a branched alkyl group. In some embodiments, R 8b C 1~6 In some embodiments, R 8b C 3~7 It is a branched haloalkyl. In some embodiments, R 8b C 1~6 It is a hydroxyalkyl group. In some embodiments, R 8b C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 8b is hydroxyl. In some embodiments, R 8b C 1~6 It is an alkoxyl. In some embodiments, R 8b C 3~7 It is a branched alkoxy. In some embodiments, R 8b NHCO(C 1~6 It is alkyl. In some embodiments, R 8b NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 8b NHSO2(C 1~6 It is alkyl. In some embodiments, R 8b NHSO2(C 3~7 It is a branched alkyl group.
[0370] In some embodiments, R8c is hydrogen. In some embodiments, R 8c is a halogen. In some embodiments, R 8c C 1~6 It is alkyl. In some embodiments, R 8c C 3~7 It is a branched alkyl group. In some embodiments, R 8c C 1~6 In some embodiments, R 8c C 3~7 It is a branched haloalkyl. In some embodiments, R 8c C 1~6 It is a hydroxyalkyl group. In some embodiments, R 8c C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 8c It is hydroxyl.
[0371] In some embodiments, R 8c C 1~6 It is an alkoxyl. In some embodiments, R 8c C 3~7 It is a branched alkoxy. In some embodiments, R 8c NHCO(C 1~6 It is alkyl. In some embodiments, R 8c NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 8c NHSO2(C 1~6 It is alkyl. In some embodiments, R 8c NHSO2(C 3~7 It is a branched alkyl group.
[0372] In some embodiments, R 8d is hydrogen. In some embodiments, R 8d is a halogen. In some embodiments, R 8d C 1~6 It is alkyl. In some embodiments, R 8d C 3~7It is a branched alkyl group, and in some embodiments, R 8d C 1~6 In some embodiments, R 8d C 3~7 It is a branched haloalkyl. In some embodiments, R 8d C 1~6 It is a hydroxyalkyl group. In some embodiments, R 8d C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 8d is hydroxyl. In some embodiments, R 8d C 1~6 It is an alkoxyl. In some embodiments, R 8d C 3~7 It is a branched alkoxy. In some embodiments, R 8d NHCO(C 1~6 It is alkyl. In some embodiments, R 8d NHCO(C 3~7 It is a branched alkyl group. In some embodiments, R 8d NHSO2(C 1~6 It is alkyl. In some embodiments, R 8d NHSO2(C 3~7 It is a branched alkyl group.
[0373] In some embodiments, R 9a is hydrogen. In some embodiments, R 9a is a halogen. In some embodiments, R 9a C 1~6 It is alkyl. In some embodiments, R 9a C 3~7 It is a branched alkyl group. In some embodiments, R 9a C 1~6 In some embodiments, R 9a C 3~7 It is a branched haloalkyl. In some embodiments, R 9a C 1~6 It is a hydroxyalkyl group. In some embodiments, R 9a C3~7 It is a branched hydroxyalkyl. In some embodiments, R 9a is hydroxyl. In some embodiments, R 9a C 1~6 It is an alkoxyl. In some embodiments, R 9a C 3~7 It is a branched alkoxy.
[0374] In some embodiments, R 9b is hydrogen. In some embodiments, R 9b is a halogen. In some embodiments, R 9b C 1~6 It is alkyl. In some embodiments, R 9b C 3~7 It is a branched alkyl group. In some embodiments, R 9b C 1~6 In some embodiments, R 9b C 3~7 It is a branched haloalkyl. In some embodiments, R 9b C 1~6 It is a hydroxyalkyl group. In some embodiments, R 9b C 3~7 It is a branched hydroxyalkyl. In some embodiments, R 9b is hydroxyl. In some embodiments, R 9b C 1~6 It is an alkoxyl. In some embodiments, R 9b C 3~7 It is a branched alkoxy.
[0375] In some embodiments, R 9a and R 9b They come together to form a three-membered ring. In some embodiments, R 9a and R 9b They come together to form a four-membered ring. In some embodiments, R 9a and R 9b They come together to form a 5-membered ring. In some embodiments, R 9a and R 9bThey come together to form a 6-membered ring. In some embodiments, R 9a and R 9b They come together to form a 7-membered ring. In some embodiments, R 9a and R 9b They come together to form an optionally substituted three-membered ring. In some embodiments, R 9a and R 9b They come together to form an optionally substituted four-membered ring. In some embodiments, R 9a and R 9b They come together to form an optionally substituted five-membered ring. In some embodiments, R 9a and R 9b They come together to form an optionally substituted 6-membered ring. In some embodiments, R 9a and R 9b They come together to form a 7-membered ring with arbitrary substitutions.
[0376] In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3.
[0377] In some embodiments, z is 0. In some embodiments, z is 1. In some embodiments, z is 2.
[0378] In some embodiments, R 10 is hydrogen. In some embodiments, R 10 C 1~6 It is alkyl. In some embodiments, R 10 C 1~6 In some embodiments, R 10 C 3~7 It is a branched haloalkyl. In some embodiments, R 10 C 1~6 It is hydroxyl. In some embodiments, R 10 C 1~6 It is an alkoxyl. In some embodiments, R 10 C3~7 It is a branched alkoxy. In some embodiments, R 10 CO(C 1~6 It is alkyl. In some embodiments, R 10 CO(C 3~7 It is a branched alkyl group. In some embodiments, R 10 SO2(C 1~6 It is alkyl. In some embodiments, R 10 SO2(C 3.7 It is a branched alkyl group.
[0379] In some embodiments, R 11 is hydrogen. In some embodiments, R 11 C 1~6 It is alkyl.
[0380] In some embodiments, R 12 is hydrogen. In some embodiments, R 12 C 1~6 It is alkyl.
[0381] In some embodiments, the compounds or substructures of formula (IA), (I') exclude N-(6-((8”-methyl-1”,5”-dioxo-1”,5”-dihydro-2”H-dispiro[cyclopropane-1,1'-cyclohexane-4',3”-imidazo[1,5-a]pyridine]-6”-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide and / or 3-((6-((8”-methyl-1”,5”-dioxo-1”,5”-dihydro-2”H-dispiro[cyclopropane-1,1'-cyclohexane-4',3”-imidazo[1,5-a]pyridine]-6”-yl)amino)pyrimidine-4-yl)amino)propanoic acid.
[0382] The MNK inhibitor disclosed herein is given by formula (LII): [ka] A compound having or a pharmaceutically acceptable salt thereof, wherein m, n 1 , R3’ , and R 2’ This is defined herein.
[0383] R 2’ , R 3’ , m, and n 1 Examples, though not limited to them, are shown in Table 2. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6]
[0384] The MNK inhibitor disclosed herein is defined by formula (LIII): [ka] A compound having or a pharmaceutically acceptable salt thereof, wherein R 3’ , R 2’ , and n 1 Non-restrictive examples are defined in Table 3 below. [Table 3-1] [Table 3-2] [Table 3-3]
[0385] The MNK inhibitor disclosed herein is given by formula (LIV): [ka] A compound having or a pharmaceutically acceptable salt thereof, wherein R 3 , R 4f , and n 1 Non-exclusive examples are defined herein in Table 4 below. [Table 4]
[0386] In some embodiments, MNK inhibitors are, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-3',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclobutan-1,1'-cyclobutan-3',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, Benzyl 6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1-carboxylate, tert-butyl6”-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8”-methyl-1”,5”-dioxo-1”,5”-dihydro-2”H-dispiro[azetidine-3,1'-cyclohexane-4',3”-imidazo[1,5-a]pyridine]-1-carboxylate, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[azetidine-3,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, 6"-((6-((2-hydroxyethyl)amino)pyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, Benzyl 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1-carboxylate, 1-(aminomethyl)-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropane-1-carboxamide, (1R,5S,6r)-N-(6-((8”-methyl-1”,5”-dioxo-1”,5”-dihydro-2”H-dispiro[cyclopropane-1,1'-cyclohexane-4',3”-imidazo[1,5-a]pyridine]-6”-yl)amino)pyrimidine-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-2-azaspiro[3,3]heptan-6-carboxamide, 2-methyl-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-2-azaspiro[3,3]heptan-6-carboxamide, (1R,5S,6r)-3-methyl-N-(6-((8”-methyl-1”,5”-dioxo-1”,5”-dihydro-2”H-dispiro[cyclopropane-1,1'-cyclohexane-4',3”-imidazo[1,5-a]pyridine]-6”-yl)amino)pyrimidine-4')-3”-azabicyclo[3.1.0]hexane-6-carboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-1-(methylsulfonamidemethyl)cyclopropane-1-carboxamide, 1-((dimethylamino)methyl)-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropane-1-carboxamide, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclobutan-1,1'-cyclobutan-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclopentan-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopentan-1,1'-cyclopentan-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-3,3-difluoro-8"-methyl-2"H-dispiro[cyclobutane-1,1'-cyclobutane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopentan-1,1'-cyclobutane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclobutan-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclohexane-1,1'-cyclobutane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, Ethyl 6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-2-carboxylate, tert-butyl(6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-2"yl)carbamate, N-(6-((2,2-difluoro-8”-methyl-1”,5”-dioxo-1”,5”-dihydro-2”H-dispiro[cyclopropane-1,1'-cyclohexane-4',3”-imidazo[1,5-a]pyridine]-6”-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, 6"-((6-aminopyrimidine-4-yl)amino)-2,2-difluoro-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cycloheptane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-2'-ene-1",5"-dione, A compound selected from or a pharmaceutically acceptable salt thereof.
[0387] MNK inhibitors of formula (IB) In some embodiments, the MNK inhibitor is expressed by formula (IB): [ka] A compound of or a pharmaceutically acceptable salt thereof, in which, W 1 and W 2 However, independently, they are O, S, or N-OR', and R' is a lower alkyl group. Y is -N(R 5” ), -O-, -S-, -C(O)-, -S=O, -S(O)2-, or -CHR 9 -and, R 1” However, it is hydrogen, a lower alkyl, a cycloalkyl, or a heterocycline, and any lower alkyl, cycloalkyl, or heterocycline is optionally substituted with 1, 2, or 3 J groups. n 2 However, it is 1, 2, or 3, R 2” and R 3” However, each is independently hydrogen, alkyl, alkenyl, alkynyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene, and any alkyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene is optionally substituted with 1, 2, or 3 J groups. Alternatively, R 2” and R 3” These, together with the carbon atoms to which they are bonded, form a cycloalkyl or heterocycline, and any cycloalkyl or heterocycline is optionally substituted with one, two, or three J groups. R 4a” and R 4b” However, each is independently hydrogen, halogen, hydroxyl, thiol, hydroxyalkylene, cyano, alkyl, alkoxy, acyl, thioalkyl, alkenyl, alkynyl, cycloalkyl, aryl, or heterocyclyl. R 5” However, whether it is hydrogen, cyano, or lower alkyl, Alternatively, R5” and R 8 However, together with the atoms to which they are bonded, they form condensed heterocyclines that are optionally substituted with 1, 2, or 3 J groups. R 6” , R 7” , and R 8 However, each is independently hydrogen, hydroxyl, halogen, cyano, amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl, and any amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, amino, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl is optionally substituted with 1, 2, or 3 J groups. Alternatively, R 7” and R 8 However, together with the atoms to which they are bonded, they form condensed heterocyclines or heteroaryls that are optionally substituted with one, two, or three J groups. J is -SH, -SR 9 ,-S(O)R 9 -S(O)2R 9 -S(O)NH2, -S(O)NR 9 R 9 -NH2, -NR 9 R 9 -COOH, -C(O)OR 9 , -C(O)R 9 -C(O)-NH2, -C(O)-NR 9 R 9 hydroxy, cyano, halogen, acetyl, alkyl, lower alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, thioalkyl, cyanoalkylene, alkylaminyl, NH2-C(O)-alkylene, NR 9 R 9-C(O)-alkylene, -CHR 9 -C(O)-lower alkyl, -C(O)lower alkyl, alkylcarbonyl aminyl, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, cycloalkylcarbonyl aminyl, cycloalkyl aminyl, -CHR 9 -C(O)-cycloalkyl, -C(O)cycloalkyl, -CHR 9 -C(O)-aryl, -CHR 9 -aryl, -C(O)-aryl, -CHR 9 -C(O)-heterocycloalkyl, -C(O)-heterocycloalkyl, heterocyclylaminyl, or heterocyclyl, or any two J groups bonded to the same carbon or heteroatom may together form an oxo. R 9 The compound is a hydrogen, lower alkyl, or -OH group, or a pharmaceutically acceptable salt thereof.
[0388] The following definitions apply to formula (IB) and its sub-genera.
[0389] "Amino" refers to the -NH2 substituent.
[0390] "Aminocarbonyl" refers to the -C(O)NH2 substituent.
[0391] "Carboxyl" refers to the -CO2H substituent.
[0392] "Carbonyl" refers to a -C(O)- or -C(=O)- group.
[0393] "Cyano" refers to a -C≡N substituent.
[0394] "Cyanoalkylene" refers to the -(alkylene)C≡N substituent.
[0395] "Acetyl" refers to the -C(O)CH3 substituent.
[0396] "Hydroxy" or "hydroxyl" refers to the -OH substituent.
[0397] "Hydroxyalkylene" refers to the -(alkylene)OH substituent.
[0398] "Oxo" refers to the oxygen atom of an -O- substituent.
[0399] "Thiol" refers to the -SH substituent.
[0400] "Alkyl" consists only of carbon and hydrogen atoms, with 1 to 12 carbon atoms (C1 to C12). 12 A alkyl group refers to a saturated, linear, or branched hydrocarbon radical having 1 to 8 carbon atoms (C1-C8 alkyl) or 1 to 6 carbon atoms (C1-C6 alkyl), which is bonded to the rest of the molecule by a single bond. Examples of alkyl groups include methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, and 2-methylhexyl.
[0401] "Lower alkyl" has the same meaning as alkyl as defined above, but has 1 to 4 carbon atoms (C1 to C4 alkyl).
[0402] "Alkenyl" has at least one double bond and 2 to 12 carbon atoms (C2 to C2). 12 Alkenyls refer to unsaturated alkyl groups having 2 to 8 carbon atoms (C2-C8 alkenyls) or 2 to 6 carbon atoms (C2-C6 alkenyls), which are bonded to the rest of the molecule by single bonds, such as ethenyl, propenyl, butenyl, pentenyl, and hexenyl.
[0403] "Alkynyl" has at least one triple bond and 2 to 12 carbon atoms (C2 to C2). 12 Alkynyl), 2 to 10 carbon atoms (C2 to C2) 10Alkynyl refers to an unsaturated alkyl group having 2 to 8 carbon atoms (C2-C6 alkynyl) or 2 to 6 carbon atoms (C2-C6 alkynyl), which is attached to the rest of the molecule by a single bond, such as ethynyl, propynyl, butynyl, pentynyl, hexynyl, etc.
[0404] An "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain consisting only of carbon and hydrogen, where the rest of the molecule is linked to a radical group. Alkylenes can have 1 to 12 carbon atoms, such as methylene, ethylene, propylene, and n-butylene. The alkylene chain is bonded to the rest of the molecule through single or double bonds. The bonding points of the alkylene chain to the rest of the molecule can be through one carbon or any two carbons in the chain. "Optionally substituted alkylene" refers to alkylene or substituted alkylene.
[0405] "Alkenylene" refers to a divalent alkene. Examples of alkenylenes, though not limited to them, include ethenylene (-CH=CH-) and all its stereoisomers and stereoisomer forms. "Substitutive alkenylene" refers to a divalent substituted alkene. "Optionally substituted alkenylene" refers to an alkenylene or a substituted alkenylene.
[0406] "Alkynylene" refers to a divalent alkyne. Examples of alkynylenes, though not limited to them, include ethynylene and propynylene. "Substitutive alkynylene" refers to a divalent substituted alkyne.
[0407] "alkoxy" is the formula -OR a It refers to the base of R a This is an alkyl group having the number of carbon atoms shown above as defined. Examples of alkoxy groups include, but are not limited to, -O-methyl (methoxy), -O-ethyl (ethoxy), -O-propyl (propoxy), and -O-isopropyl (isopropoxy).
[0408] "Acyl" is expressed as formula -C(O)R a It refers to the radical of R a This is an alkyl group having the indicated number of carbon atoms.
[0409] "Alkylaminyl" is formula -NHR a or -NR a R a This refers to the radical, and in the formula, each R a This is an alkyl radical having the number of carbon atoms defined above.
[0410] "Cycloalkylaminyl" is formula -NHR a This refers to the radical of the expression, where R is located in the formula. a is a cycloalkyl radical as defined herein.
[0411] "Alkylcarbonylaminyl" is represented by the formula -NHC(O)R a This refers to the radical of the expression, where R is located in the formula. a This is an alkyl radical having the number of carbon atoms indicated as defined herein.
[0412] "Cycloalkylcarbonylanilyl" is a compound of the formula -NHC(O)R a This refers to the radical of the expression, where R is located in the formula. a is a cycloalkyl radical as defined herein.
[0413] "Alkylaminocarbonyl" is represented by the formula -C(O)NHR a or -C(O)NR a R a This refers to the radical, and in the formula, each R a This is independently an alkyl radical having the number of carbon atoms shown as defined herein.
[0414] "Cycloalkylaminocarbonyl" is represented by the formula -C(O)NHR a This refers to the radical of the expression, where R is located in the formula. a is a cycloalkyl radical as defined herein.
[0415] "Aryl" refers to a hydrocarbon ring radical comprising hydrogen, 6 to 18 carbon atoms, and at least one aromatic ring. Exemplary aryls are hydrocarbon ring radicals comprising hydrogen and 6 to 9 carbon atoms and at least one aromatic ring, hydrocarbon ring radicals comprising hydrogen and 9 to 12 carbon atoms and at least one aromatic ring, hydrocarbon ring radicals comprising hydrogen and 12 to 15 carbon atoms and at least one aromatic ring, or hydrocarbon ring radicals comprising hydrogen and 15 to 18 carbon atoms and at least one aromatic ring. For the purposes of the present invention, aryl radicals can be monocyclic, bicyclic, tricyclic, or tetracyclic ring systems, and may include fused or bridging ring systems. Examples of aryl groups include, but are not limited to, aryl groups derived from acetantrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluorantene, fluorene, as-indacene, s-indacene, indan, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene. "Optionally substituted aryl" refers to an aryl group or a substituted aryl group.
[0416] "Arirene" refers to a divalent aryl compound, while "substituted arirene" refers to a divalent substituted aryl compound.
[0417] "Aralkill" or "Aralkillene" can be used synonymously, formula -R b -R c This refers to the radical of the expression, where R is located in the formula. b R is an alkylene chain as defined herein, c This includes one or more aryl radicals as defined herein, such as benzyl, diphenylmethyl, etc.
[0418] "Cycloalkyl" refers to a stable non-aromatic monocyclic or polycyclic hydrocarbon radical consisting only of carbon and hydrogen atoms, which may include condensed or bridging ring systems having 3 to 15 carbon atoms, preferably 3 to 10 carbon atoms, 3 to 9 carbon atoms, 3 to 8 carbon atoms, 3 to 7 carbon atoms, 3 to 6 carbon atoms, 3 to 5 carbon atoms, 4 carbon atoms, or 3 carbon atoms. The cycloalkyl ring may be saturated or unsaturated, or may be bonded to the rest of the molecule by a single bond. Examples of monocyclic groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic radicals include adamantyl, norbornyl, dekalinyl, and 7,7-dimethyl-bicyclo[2.2.1]heptanyl.
[0419] "Cycloalkylalkylene" or "cycloalkylalkyl" can be used synonymously, formula -RbR e This refers to the radical, where Rb is an alkylene chain as defined herein, and R e R is a cycloalkyl radical as defined herein. In certain embodiments, R b The cycloalkylalkylene is further substituted with a cycloalkyl group such that the cycloalkylalkylene contains two cycloalkyl moieties. Cyclopropylalkylene and cyclobutylalkylene are exemplary cycloalkylalkylene groups, each containing at least one cyclopropyl or at least one cyclobutyl group.
[0420] "Condensation" refers to any ring structure described herein that is condensed with an existing ring structure in a compound. If the condensed ring system is a heterocyclyl ring or a heteroaryl ring, any carbon atom on the existing ring structure that becomes part of the heterocyclyl ring or the condensed ring may be replaced by a nitrogen atom.
[0421] "Halo" or "halogen" refers to bromo (bromine), chloro (chlorine), fluoro (fluorine), or iodine.
[0422] "Haloalkyl" refers to an alkyl radical having the indicated number of carbon atoms as defined herein, wherein one or more hydrogen atoms of the alkyl group are substituted with a halogen (halo radical) as defined above. The halogen atoms may be the same or different. Exemplary haloalkyls include trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, and 1,2-dibromoethyl.
[0423] A "heterocyclyl," "heterocycle," or "heterocycle" refers to a stable 3- to 18-membered saturated or unsaturated radical consisting of 2- to 12 carbon atoms and 1- to 6 heteroatoms, for example, 1- to 5 heteroatoms, 1- to 4 heteroatoms, 1- to 3 heteroatoms, or 1-2 heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Exemplary heterocycles include, but are not limited to, stable 3- to 15-membered saturated or unsaturated radicals, stable 3- to 12-membered saturated or unsaturated radicals, stable 3- to 9-membered saturated or unsaturated radicals, stable 8-membered saturated or unsaturated radicals, stable 7-membered saturated or unsaturated radicals, stable 6-membered saturated or unsaturated radicals, or stable 5-membered saturated or unsaturated radicals.
[0424] Unless otherwise specified herein, heterocyclyl radicals may be monocyclic, bicyclic, tricyclic, or tetracyclic ring systems, which may include condensed or bridging ring systems; nitrogen, carbon, or sulfur atoms in the heterocyclyl radical may be optionally oxidized; nitrogen atoms may be optionally quaternized; and heterocyclyl radicals may be partially or completely saturated. Examples of non-aromatic heterocyclyl radicals include, but are not limited to, azetidinyl, dioxolanil, thienyl[1,3]dithianil, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, thietanyl, trithianil, tetrahydropyranil, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. Heterocyclyls include heteroaryls as defined herein, and examples of aromatic heterocyclyls are listed in the following definition of heteroaryls.
[0425] "Heterocyclylalkyl" or "heterocyclylalkylene" is a compound of the formula -R b R f This refers to the radical of the expression, where R is located in the formula. b R is an alkylene chain as defined herein, f A is a heterocyclyl radical as defined above, and if the heterocyclyl is a nitrogen-containing heterocyclyl, the heterocyclyl can be bonded to an alkyl radical at its nitrogen atom.
[0426] A "heteroaryl" or "heteroarylene" refers to a 5-14 membered cyclic radical comprising a hydrogen atom, 1-13 carbon atoms, 1-6 heteroatoms selected from the group consisting of nitrogen, oxygen, phosphorus, and sulfur, and at least one aromatic ring. For the purposes of the present invention, a heteroaryl radical may be a stable 5-12 membered ring, a stable 5-10 membered ring, a stable 5-9 membered ring, a stable 5-8 membered ring, a stable 5-7 membered ring, or a stable 6-membered ring comprising at least 1 heteroatom, at least 2 heteroatoms, at least 3 heteroatoms, at least 4 heteroatoms, at least 5 heteroatoms, or at least 6 heteroatoms. A heteroaryl may be a monocyclic, bicyclic, tricyclic, or tetracyclic cyclic system, which may include condensed or bridging cyclic systems, and the nitrogen, carbon, or sulfur atom in the heteroaryl radical may be optionally oxidized, and the nitrogen atom may be optionally quaternized. The heteroatoms may be members of aromatic or non-aromatic rings, provided that at least one ring in the heteroaryl is aromatic.Examples, though not limited to them, include azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzofuranil, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, 1,4-benzodioxanil, benzonaphthofuranil, benzoxazolyl, benzodioxolyl, benzodioxynil, benzopyranil, benzopyranonil, benzofuranil, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinil, dibenzofuranil, dibenzothiophenyl, furanil, furanonil, isothiazolyl, imidazolyl, indazolyl, indolyl, isoindodinyl Examples include lyl, indolinyl, isoindolinyl, isoquinolyl, indolidinyl, isoxazolyl, naphthilidinyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxyranil, 1-oxidepyridinyl, 1-oxidepyrimidinyl, 1-oxidepyradinyl, 1-oxidepyradinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxadinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridadinyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and thiophenyl (i.e., thienyl).
[0427] "Heteroarylalkyl" or "heteroarylalkylene" is a compound of the formula -R b R g This refers to the radical of the expression, where R is located in the formula. b R is an alkylene chain as defined above, g This is a heteroaryl radical as defined above.
[0428] "Thioalkyl" is represented by formula -SR a This refers to the radical of the expression, where R is located in the formula. aThis is an alkyl radical as defined above, comprising 1 to 12 carbon atoms, at least 1 to 10 carbon atoms, at least 1 to 8 carbon atoms, at least 1 to 6 carbon atoms, or at least 1 to 4 carbon atoms.
[0429] "Heterocykrillaminyl" is formula-NHR f This refers to the radical of the expression, where R is located in the formula. f This is a heterocyclyl radical as defined above.
[0430] "Thione" refers to a thion (=S) group bonded to a saturated or unsaturated (C3-C8) cyclic or (C1-C8) acyclic carbon atom.
[0431] "Sulfoxide" refers to an -S(O)- group in which a sulfur atom is covalently bonded to two carbon atoms.
[0432] "Sulfone" refers to the -S(O)2- group, in which hexavalent sulfur is bonded to each of two oxygen atoms via a double bond, and further bonded to two carbon atoms via a single covalent bond.
[0433] The term "oxime" is -C(R a )=N-OR a It refers to a radical, and in the formula, R a This is a hydrogen, lower alkyl, alkylene, or arylene group as defined above.
[0434] The compounds of this disclosure may exist in various isomeric forms, as well as in one or more tautomeric forms, including both single tautomers and mixtures of tautomers. The term "isomer" is intended to encompass all isomeric forms of the compounds of the present invention, including tautomeric forms of the compounds of the present invention.
[0435] Some of the compounds described herein may have asymmetric centers and therefore exist in different enantiomer and diastereomer forms. The compounds of this disclosure may be in the form of optical isomers or diastereomers. Accordingly, this disclosure encompasses the compounds of this disclosure described herein and their uses in the form of their optical isomers, diastereomers, and mixtures thereof, including racemic mixtures. Optical isomers of the compounds of this disclosure can be obtained by known techniques such as asymmetric synthesis and chiral chromatography, or by chemical separation of stereoisomers using optically active decomposition agents.
[0436] In some embodiments, the MNK inhibitor is a compound selected from Table 5, or a pharmaceutically acceptable salt thereof. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] [Table 5-9] [Table 5-10] [Table 5-11] [Table 5-12] [Table 5-13]
[0437] Compositions and methods In another embodiment, the present invention provides a pharmaceutical composition comprising a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in a patient, and / or one or more therapeutic agents for treating rheumatoid arthritis, in combination with a pharmaceutically acceptable carrier, diluent, or excipient.
[0438] For example, in a preferred embodiment, the present invention provides a pharmaceutical composition comprising an MNK inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in a patient, and / or one or more therapeutic agents for treating rheumatoid arthritis, in combination with a pharmaceutically acceptable carrier, diluent, or excipient. The MNK inhibitor may be a small molecule, or an antibody or portion thereof, but is preferably selected from the group consisting of eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0439] "Therapeutic agents for treating RA-related pain in patients" includes known and / or clinically approved therapeutic agents, therapeutic agents in clinical trials, or therapeutic agents used or intended to be used to treat RA-related pain. In one embodiment, a therapeutic agent for treating RA-related pain in a patient is any of the pain treatments listed herein.
[0440] While not bound by theory, type I interferon inhibitors can complement treatments for RA-related pain in patients. As described herein, currently approved pain treatments have many drawbacks and side effects, and therefore, combination therapy with type I interferon inhibitors may be useful in treating RA-related pain.
[0441] "Therapeutics for treating RA" includes known and / or clinically approved therapies, therapies in clinical trials, or therapies used or intended to treat RA. Therapeutics are considered effective in treating RA when the patient enters an inactive RA inflammatory disease state and / or remission.
[0442] Treatments for RA include, but are not limited to, “classic” DMARDs such as methotrexate (also known as ametopterin), leflunomide, hydroxychloroquine, and / or sulfasalazine. As is understood, RA patients are often given a combination of these as initial treatment. If the RA disease is not controlled with classical DMARDs, methotrexate is often administered concurrently with “biological” DMARDs such as abatacept (Orencia), adalimumab (Humira), anakinra (Kineret), certolizumab (Cimzia), etanercept (Enbrel), golimumab (Simponi), infliximab (Remicade), rituximab (Rituxan), sarilumab (Kevzara), tocilizumab (Actemra), or a combination thereof. Furthermore, if both “classic” and “biological” DMARDs are ineffective, “targeted synthetic” DMARDs may be used. Examples of such "targeted synthesis" DMARDs include Janus kinase (JAK) inhibitors such as baricitinib (Olumiant), tofacitinib (Xeljanz), upadacitinib (Rinvoq), or combinations thereof.
[0443] While not bound by theory, type I interferon inhibitors can complement therapeutic agents for treating rheumatoid arthritis (RA). As described herein, many therapeutic agents for treating RA, despite their efficacy, are ineffective or suboptimal in treating the pain and inflammatory components of RA. Therefore, type I interferon inhibitors can be administered in combination with therapeutic agents for treating RA to enable simultaneous management of pain and inflammatory disease activity.
[0444] The pharmaceutical composition according to the present invention may be administered together with suitable pharmaceutically acceptable carriers, excipients, and other agents incorporated into the formulation to provide improved transport, delivery, and tolerance, etc.
[0445] "Pharmacologically acceptable" includes the fact that the formulation is sterile and pyrogen-free. Suitable pharmaceutically acceptable carriers, excipients, or diluents are well known in the field of pharmacy. A pharmaceutically acceptable carrier, excipient, or diluent must be "acceptable" in the sense that it is compatible with the agent of the present invention and must not be harmful to its recipient. Typically, a pharmaceutically acceptable carrier, excipient, or diluent is sterile and pyrogen-free water or saline, but other pharmaceutically acceptable carriers, excipients, or diluents may be used.
[0446] Suitable pharmaceutically acceptable carriers, excipients, or diluent materials that can be used in the compositions of the present invention include relevant materials that, under normal storage conditions, are suitable (and / or approved) for pharmaceutical use and / or delivery in appropriate combinations, can maintain their physical and / or chemical integrity, and / or do not affect the physical and / or chemical integrity of any active ingredients and / or any other ingredients present or that may be present in the composition.
[0447] A "pharmaceutically acceptable carrier" is defined as an excipient or stabilizer that is non-toxic to cells or mammals to which it is exposed at the dose and concentration used. Often, a pharmaceutically acceptable carrier is a pH-buffered aqueous solution. Examples of pharmaceutically acceptable carriers include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkylparabens such as parabens methyl or propyl, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol); low molecular weight (less than approximately 10 residues) polypeptides; serum albumin, gelatin, or immunoglobulins. Examples include proteins such as brin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides such as glucose, manose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trealose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or TWEEN® (trademark), polyethylene glycol (PEG), and PLURONIC® S (trademark) or polyethylene glycol (PEG).
[0448] The term "diluent" includes substances that are pharmaceutically acceptable (i.e., safe and non-toxic for administration to individuals such as humans) and useful in the preparation of liquid formulations, such as formulations that are reconstituted after lyophilization. Exemplary diluents include sterile water, bacteriostatic water for injection (BWFI), pH buffer solutions (e.g., phosphate-buffered saline), sterile saline, Ringer's solution, or glucose solution. In alternative embodiments, the diluent may include aqueous solutions of salts and / or buffers.
[0449] In a further embodiment, the present invention provides a pharmaceutical composition as defined herein for use in treating or preventing pain associated with rheumatoid arthritis in patients. In a preferred embodiment of that aspect of the present invention, the pharmaceutical composition comprises an MNK inhibitor such as an inhibitor selected from eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0450] In yet another aspect, the present invention provides the use of a pharmaceutical composition as defined herein in the manufacture of a medicament for treating or preventing pain associated with rheumatoid arthritis in a patient. In a preferred embodiment of that aspect of the present invention, the pharmaceutical composition comprises an MNK inhibitor such as an inhibitor selected from eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0451] In a further embodiment, the present invention provides a method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising the step of administering a pharmaceutical composition as defined herein to the patient. In a preferred embodiment of that aspect of the present invention, the pharmaceutical composition comprises an MNK inhibitor such as an inhibitor selected from eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0452] To be understood, the various delivery systems that can be used to administer pharmaceutical compositions are defined as those used to administer type I interferon inhibitors to patients.
[0453] Clinicians can determine the most appropriate dosing regimen for a patient based on factors such as the patient's weight, age, sex, diagnosis, or prognosis, and the half-life of the therapeutic molecule administered. However, generally, it may be preferable to treat the patient with an effective amount of a type I interferon inhibitor or a pharmaceutical composition according to the embodiments of this specification. If multiple doses are administered, they may be given in stages, for example, once, twice, three times, four or more times per day, week, or month, and may be continued for a necessary and effective period to treat and prevent RA-related pain in the patient and thereby obtain a therapeutically or prophylactically beneficial effect. For example, treatment may be continued for one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve days or more, weeks, months, or years, or even for the remainder of the subject's life. In the case of the use of type I interferon inhibitors, administration is most typically given once a week, or once or twice a month, and continued for as long as it is clinically beneficial.
[0454] The invention also includes methods for treating or preventing pain associated with RA, and methods for treating or preventing RA itself, comprising the step of administering a pharmaceutical composition as defined herein to a patient. This enables simultaneous management of disease and pain using a pharmaceutical composition as defined herein. In preferred embodiments of the aspects of the invention, the pharmaceutical composition comprises an MNK inhibitor such as an inhibitor selected from eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0455] In another embodiment, the present invention provides a kit comprising a type I interferon inhibitor and one or more therapeutic agents for treating rheumatoid arthritis. In a preferred embodiment of that embodiment of the present invention, the type I interferon inhibitor is an MNK inhibitor such as an inhibitor selected from eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0456] In a further embodiment, the present invention relates to a method for identifying patients who have pain associated with rheumatoid arthritis and require treatment with a type I interferon inhibitor, (a) A step of providing test samples from patients with pain associated with rheumatoid arthritis, (b) A step of determining the level of type I interferon signaling in the test sample, (c) A method is provided which includes the step of identifying a patient as a patient who requires treatment with a type I interferon inhibitor based on the decision in step (b).
[0457] "Patients requiring treatment with type I interferon inhibitors" includes patients who would potentially benefit from type I interferon inhibitor therapy. For example, if an individual has RA, such a type I interferon inhibitor would improve their health (e.g., by reducing or eliminating pain symptoms). In another embodiment, if the patient still experiences pain, such type I interferon inhibitor therapy would reduce the likelihood that the patient will begin to experience pain.
[0458] The term “test sample” includes any biological sample from a patient that is tested in the methods and uses of the present invention. It is understood that a test sample may include one or more tissues, cells, and / or biological fluids (e.g., blood, skin, synovial membrane, synovial fluid, sensory ganglia, serum, plasma, serum plasma, urine, saliva, intestinal cells, biopsy (such as muscle biopsy), stool) taken from a patient (e.g., isolated).
[0459] It will also be understood that the methods and uses of the present invention may be carried out using tissues, cells, and / or biological fluids when present within an organism. Thus, the detection methods of the present invention can be used to detect viral infection in test samples both in vitro and in vivo. Preferably, the test sample is serum plasma isolated from an organism.
[0460] "Type I interferon signaling levels" include intracellular type I interferon signaling, type I interferon levels, type I interferon receptor activation, type I interferon-stimulating gene expression, and type I interferon-suppressing gene expression. Methods for determining these levels are discussed herein.
[0461] A method for stratifying diagnosed SLE patients uses the level of type I interferon signaling in test samples to predict (i) patients at risk of greater disease severity and (ii) patients at risk of developing lupus nephritis. The DxCollect® microcollective device (from DxTerity®) measures the relative expression of four messenger RNAs (mRNAs) of type I interferon-responsive genes by PCR and capillary electrophoresis. The patient's interferon status is then classified as high (greater than -0.5) or low / normal (less than -0.5). In some embodiments, such a microcollective device may be used to identify patients who have RA-related pain and require treatment with type I interferon inhibitors.
[0462] Preferably, the method as defined herein further includes the step of administering a type I interferon inhibitor to a patient. In preferred embodiments of the present invention, the type I interferon inhibitor is an MNK inhibitor such as an inhibitor selected from eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
[0463] In further embodiments, the present invention provides a type I interferon inhibitor for use, or a use, or a method, or a composition, or a kit, as substantially described herein, with reference to the appended description, examples, figures, and / or claims.
[0464] The use of the words "a" or "an," when used in conjunction with the term "including" in the claims and / or herein, may mean "one," but also coincide with the meanings of "one or more," "at least one," and "one or more."
[0465] These and other embodiments of the present invention will be better recognized and understood when considered in conjunction with the above description and accompanying drawings. However, it should be understood that the above description, while illustrating various embodiments of the present invention and numerous specific details thereof, is provided for illustrative purposes only and is not limiting. Many substitutions, modifications, additions, and / or rearrangements can be made within the scope of the present invention without departing from the spirit of the invention, and the present invention includes all such substitutions, modifications, additions, and / or rearrangements.
[0466] Any enumeration or discussion of documents clearly previously published in this specification should not necessarily be construed as an acknowledgment that such documents represent part of the cutting edge or common technical knowledge.
[0467] Exemplary Embodiments The following numbered embodiments are non-limiting but illustrative of certain aspects of the present disclosure. 1. A type I interferon inhibitor for use in treating or preventing pain associated with rheumatoid arthritis in patients. 2. Use of type I interferon inhibitors in the manufacture of pharmaceuticals for the treatment or prevention of pain associated with rheumatoid arthritis in patients. 3. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising the step of administering a type I interferon inhibitor to the patient. 4. A type I interferon inhibitor for use, or a method of use, according to any one of Embodiments 1 to 3, wherein the pain is functional pain such as inflammatory joint pain. 5. A type I interferon inhibitor for use, or a method of use, according to any of Embodiments 1 to 3, wherein the pain is not inflammatory pain. 6. A type I interferon inhibitor for use, or a method for use, according to any of the prior embodiments, wherein the pain is not neuropathic pain or neuroplastic pain. 7. A type I interferon inhibitor for use, or a method for use, according to any of the prior embodiments, wherein the pain is chronic pain, for example, pain that has been present for three months or more, or six months or more, or twelve months or more. 8. A type I interferon inhibitor for use, or a method of use, according to any of the prior embodiments, wherein the pain is one or more selected from the group consisting of analgesia, allodynia, hyperalgesia, and arthralgia. 9. The aforementioned pain, - Systemic inflammation, and / or - Local inflammation, and / or - A type I interferon inhibitor, or a use, or method described in any of the prior embodiments, related to and / or caused by clinical inflammation. 10. A type I interferon inhibitor for use, or a method, according to any of the prior embodiments, wherein the pain is not related to and / or caused by rheumatoid arthritis inflammatory disease activity. 11. A type I interferon inhibitor for use, or a method for use, according to any of the prior embodiments, wherein the pain is located in the affected joint and / or the opposite portion of the affected joint and / or the head of the affected joint and / or the tail of the affected joint. 12. A type I interferon inhibitor for use, or a method, according to any of the prior embodiments, wherein the type I interferon inhibitor does not prevent or treat an inflammatory disease accompanied by increased type I interferon signaling. 13. The pain is present with disease inflammation, and / or - A type I interferon inhibitor for use, or a method for use, according to any of the prior embodiments, wherein the pain is present after remission of the disease inflammation. 14. The patient has previously received or is receiving treatment for pain, but the pain persists and / or recurs and / or progresses, using a type I interferon inhibitor, or a method of use, as described in any of the prior embodiments. 15. A type I interferon inhibitor for use, or a method of use, according to Embodiment 14, wherein the pain treatment is selected from the group consisting of nonsteroidal anti-inflammatory drugs (NSAIDs) such as celecoxib, diclofenac, etoricoxib, ibuprofen, and naproxen; steroids such as corticosteroids and glucocorticoids; opioids such as acetaminophen, codeine, dextropropoxifen, and tramadol; antidepressants such as tricyclic antidepressants; anticonvulsants; or combinations thereof. 16. A type I interferon inhibitor for use, or a method for use, according to any of the prior embodiments, wherein the pain is related to and / or caused by increased type I interferon signaling in the patient. 17. Increased type I interferon signaling - Increased type I interferon intracellular signaling in the aforementioned patients - Increased level of type I interferon in the aforementioned patient, - Increased activation of type I interferon receptors in the aforementioned patients, - Increased expression of one or more type I interferon-stimulating genes in the patient, and / or - A type I interferon inhibitor for use, or a use, or a method according to any of the prior embodiments, comprising the reduced expression of one or more type I interferon suppressor genes in the patient. 18. A type I interferon inhibitor for use, or a use, or a method according to any of the prior embodiments, wherein the type I interferon is selected from the group comprising interferon α and interferon β. 19. A type I interferon inhibitor for use, or a method for use, according to any of the prior embodiments, wherein the pain is related to an increased number and / or activity of one or more active sensory neurons in the patient, preferably an increased number and / or activity of one or more active nociceptors in the patient. 20. The type I interferon inhibitor for use, or method, according to Embodiment 19, wherein the sensory neurons of the patient are TrkA-expressing sensory neurons, preferably TrkA-expressing nociceptors. 21. A type I interferon inhibitor for use, or a method for use, according to Embodiment 19 or 20, wherein the sensory neurons of the patient are GFRa3-expressing sensory neurons, preferably GFRa3-expressing nociceptors. 22. The above-mentioned type I interferon inhibitor, - To prevent or reduce intracellular signaling of type I interferon in the aforementioned patients, - To prevent or reduce the level of type I interferon in the aforementioned patient, - To prevent or reduce the activation of type I interferon receptors in the aforementioned patients, - To prevent or reduce the expression of one or more type I interferon-stimulating genes in the patient, and / or - A type I interferon inhibitor for use according to any of the prior embodiments, or a use or method thereof, which induces and / or increases the expression of one or more type I interferon suppressor genes in the patient. 23. A type I interferon inhibitor for use, or a use, or a method according to any of the prior embodiments, wherein the type I interferon inhibitor is selected from the group comprising IFNAR1 inhibitors, IFNAR2 inhibitors, TYK2 inhibitors, type I interferon antagonists, MNK inhibitors (such as MNK1 inhibitors and / or MNK2 inhibitors), and eukaryotic translation initiation factor 4E (eIF4E) inhibitors. 24. A type I interferon inhibitor for use, or a method of use, according to any of the prior embodiments, wherein the type I interferon inhibitor is selected from the group comprising a small molecule, an antibody, an antibody moiety, an antibody mimetic, a decoy receptor, a receptor body, or a vaccine. 25. A type I interferon inhibitor for use, or a use, or a method according to any of the prior embodiments, wherein the type I interferon inhibitor is selected from the group comprising duklavacitinib, aniflorumab, NDI-034858, NDI-031232, NDI-031301, NDI-031407, ESK-001, VTX-958, ICP-488, lopsacitinib, and GLPG3667. 26. A type I interferon inhibitor for use, or a method of use, according to any one of Embodiments 1 to 24, wherein the type I interferon inhibitor is an MNK inhibitor such as an MNK1 inhibitor and / or an MNK2 inhibitor. 27. A type I interferon inhibitor for use, or a method for use, according to claim 26, wherein the MNK inhibitor is selected from the group consisting of eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof. 28. A pharmaceutical composition comprising a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in a patient, and / or one or more therapeutic agents for treating rheumatoid arthritis, in combination with a pharmaceutically acceptable carrier, diluent, or excipient. 29. A pharmaceutical composition as defined in Embodiment 28, for use in the treatment or prevention of pain associated with rheumatoid arthritis in patients. 30. Use of the pharmaceutical composition defined in Embodiment 28 in the manufacture of a pharmaceutical for treating or preventing pain associated with rheumatoid arthritis in a patient. 31. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising the step of administering a pharmaceutical composition defined in Embodiment 28 to the patient. 32. A kit comprising a type I interferon inhibitor and one or more therapeutic agents for the treatment of rheumatoid arthritis. 33. A method for identifying patients who have pain associated with rheumatoid arthritis and require treatment with type I interferon inhibitors, (a) A step of providing test samples from patients with pain associated with rheumatoid arthritis, (b) A step of determining the level of type I interferon signaling in the test sample, (c) A method comprising the step of identifying the patient as a patient requiring treatment with a type I interferon inhibitor based on the decision in step (b). 34. The method according to embodiment 33, further comprising the step of administering a type I interferon inhibitor to a patient. 35. Type I interferon inhibitors for use, or methods of use, as substantially described herein with reference to the attached description, examples, figures, and / or embodiments. [Examples]
[0468] Example 1: Materials and Method 1.1 Animals All experiments were conducted according to protocols approved by the Stockholm Animal Experiment Ethics Committee (Stockholms Norra Djurfoersoeksetiska Naemnd, Sweden, 9702-2018 and 10406-2020). Animals were provided with free access to food and water and maintained a 12-hour light / dark cycle. Wild-type C57BL / 6N mice (adults, 8-9 weeks old) were ordered from Charles River (Scanbur AB). Wnt1Cre (JAX#003829), Vglut3Cre (JAX#028534), Gfra3CreERT2 (JAX#029489), Rosa26RtdTomato (Ai14, JAX#007914), Rosa26RChR2-EYFP (Ai32, JAX#012569), and Rosa26RArchT-EGFP (Ai40D, JAX#021188) were ordered from The Jackson Laboratory. SstCre (a generous gift from Jens Hjerling-Leffler, JAX#013044). MrgprDCre was ordered from Mutant Mouse Resource & Research Centers (MMRRC_036118), and TrkACreERT2 mice were generated in the lab as described above (Furlan et al, 2016). All strains were backcrossed with C57BL / 6N wild-type mice for at least three passengers before being used for breeding. The strains obtained from the crosses are as follows: Wnt1Cre, TrKACreERT2, SstCre, Vglut3Cre, Gfra3CreERT2, and MrgprDCre mice were crossed with R26TOM and R26CHR2 for characterization, and with R26CHR2 for gain-of-function behavior experiments. TrkACreERT2 and Gfra3CreERT2 mice were crossed with R26ArchT for loss-of-function behavior experiments. The strains obtained from the crosses are as follows:Wnt1Cre / +;R26RTOM / + (abbreviated as Wnt1TOM), Wnt1Cre / +;R26RChR2 / + (abbreviated as Wnt1ChR2), TrkACreERT2 / +;R26RChR2 / ChR2 (abbreviated as TrkAChR2), TrkACreERT2 / +;R26RArchT / ArchT (abbreviated as TrkAArchT), MrgprDCre / +;R26RTOM / + (abbreviated as MrgprDTOM), MrgprDCre / +;R26RChR2 / + (abbreviated as MrgprDChR2), SstC re / +;R26RTOM / + (abbreviated as SstTOM), SstCre / +;R26RChR2 / + (abbreviated as SstChR2), Vglut3Cre / +;R26RTOM / + (abbreviated as Vglut3TOM), Vglut3Cre / +;R26RChR2 / + (abbreviated as SstChR2), Gfra3CreERT2 / CreERT2;R26RChR2 / ChR2 (abbreviated as Gfra3ChR2), Gfra3CreERT2 / CreERT2;R26RArchT / ArchT (abbreviated as Gfra3ArchT).
[0469] In TrkACreERT2 and Gfra3CreERT2 mice, tamoxifen (Sigma, T5648) was dissolved in corn oil (Sigma, 8267) at a concentration of 20 mg / ml and delivered by intraperitoneal (ip) injection to P14 offspring in a single injection, followed by two consecutive days of intraperitoneal (ip) injections to adults (140 mg / kg for both offspring and adults). A control group of test mice also received tamoxifen injections.
[0470] 1.2 Antibody-induced arthritis models Arthritis was induced by intravenous injection of a 6 mg cartilage antibody cocktail (Cab) containing four arthritis-inducing monoclonal antibodies (ACC1:CII antibody anti-citrullinated C1 epitope, M2139; collagen type II antibody, L10D9; collagen type XI antibody, 15A; and anti-cartilage oligomer matrix protein antibody) on day 0, followed by intraperitoneal administration of 25 μg of lipopolysaccharide (LPS, 055:B5, Sigma) on day 5 (Li et al, 2020). Control mice received intravenous injection of 150 μl of saline on day 0 and intravenous injection of 100 μl of saline or 25 μg of LPS on day 5.
[0471] The onset of arthritis was checked at different points in time using an arthritis scoring system. In short, each inflamed (both swollen and red) finger was assigned a score of 1 point, and if inflammation occurred on the dorsal side of the foot or wrist / ankle, 2.5 points were assigned for moderate inflammation and 5 points for severe inflammation, resulting in a maximum of 15 points per limb and a total of 60 points per mouse (Bas et al, 2012).
[0472] 1.3 Photo-induced response Channel rhodopsin 2 (ChR2) was activated using a flexible fiber optic bundle monitored by a power controller (DC2200, Thorlabs), and the escape reflex was induced using a pulsed laser of low to high intensity (470 nm, 10 Hz, 50 ms on / off) applied to the plantar surface of the hind paw. Wnt1Cre-ChR2, TrkACreERT2-ChR2, SstCre-ChR2, Vglut3Cre-ChR2, Gfra3CreERT2-ChR2, and MrgprDCre-ChR2 mice were acclimatized to a cluttered floor for 1 hour, and the test was performed alternately between the left and right hind paw for 20 seconds at least 10-minute intervals.
[0473] In excitatory optogenetics, the light threshold was determined as the minimum light power that elicited an escape response (for reflexes) or noxious defense response, such as tremor, lifting, licking, and protection (for coping) of one hind leg. The percentage of escape reflex-responding mice in different strains is reported. In all experiments, subthreshold light stimulation (intensity 0.2% lower than the threshold) was applied concurrently with the following tests.
[0474] 1.4 Behavioral Testing For sensory-behavioral testing, mice were acclimatized to the test environment twice prior to baseline assessment. After performing two baseline recordings on different days, animals were randomly assigned to saline control, LPS control, and arthritis groups. Mechanical sensitivity was determined by assessing foot escape using von Fry filaments (Stoelting), and the up-down method was applied as described above (Presley et al, 1994). A series of filaments with logarithmically incremental stiffness of 0.04, 0.07, 0.16, 0.4, 0.6, 1.0, and 2.0 (g) were applied to the plantar surface of the hind foot and held for 3 seconds. A 2g cutoff was applied to avoid tissue damage. Active foot escape was recorded as a positive response. The 50% probability escape threshold (the force of the von Fry hair that the animal would respond to 50% of presentations) was calculated.
[0475] To assess thermal sensitivity, a radiant heat source (IITC, Woodland Hills, CA, USA) was directed onto the plantar surface of the hind paws through a glass surface. In short, mice were placed in a plexiglass cubicle on a glass surface. The thermal nociceptive stimulus originated from a projection bulb beneath the glass surface, and the stimulus was delivered separately to one hind paw at a time. Latency was defined as the time required for the paw to exhibit active escape. Each hind paw was tested three times, and the mean escape latency was calculated.
[0476] To quantitatively scale pain responses: Mechanical stimulus responses were measured by applying 2.0 g of von Fley filaments to both the hind paw and coping episodes (foot tremor, lifting / protection, or licking). Cold allergy was measured by applying one drop of acetone to both hind paws, and the mice's response to acetone was recorded for 45 seconds to calculate coping episodes. Mechanical hyperalgesia (pin prick) was also tested with a safety pin (23G needle, BD), and coping behavior was recorded. Data from both hind paws were presented as medians with interquartile ranges.
[0477] For the gain-of-function study, different pain-like behavioral tests were detected in response to mechanical and thermal stimuli before measuring the light threshold. The light threshold was then determined as the lowest light power that induced either a retreat (reflex) or a noxious defense response (coping) in one of the feet. Subthreshold light stimuli were then applied simultaneously with sensory stimuli: the retreat reflex threshold for the von Frye and Hargreaves tests, and the coping threshold for the 2g von Frye, acetone, and pinprick tests.
[0478] Lactate control mouse (Wnt1) Cre / + TrkACre ERT2 / + ChR2 + / - In mice, photogenetic activation did not induce stimulus-related responses, such as avoidance or tremors. All three strains exhibited mechanical and cold hypersensitivity, but these control mice did not show any difference in sensitivity to mechanical or thermal stimuli compared to those treated with blue LED (data not shown).
[0479] 1.4 Inhibitory Optogenetics To test the inhibitory effects on the TrkA and Gfra3 populations, mechanical and thermal sensitivity were assessed before and after yellow light stimulation (563 nm, 30 minutes for TrkAcreERT2-ArchT mice, 45 minutes for Gfra3CreERT2-ArchT mice). A laboratory-made yellow LED plate (wavelength: 563 nm, 0.44 mWatt / mm2) was placed under the test bed. For mechanical sensitivity, after 1 hour of acclimatization on the mesh bed, the plantar surface of the hind paw was stimulated with a series of calibrated monofilaments (Stoelting, IL, USA) with increasing force (0.07 g, 0.16 g, 0.4 g, 0.6 g, 1.0 g, 1.4 g, and 2.0 g). Each filament was applied 5 times to both hind paws. The percentage of animals exhibiting an escape response is reported.
[0480] 1.5 Preparation of Single-Cell Suspension Cervical and lumbar DRGs were collected from C57BL / 6N mice (8-10 weeks old, Charles River, Sweden) and placed in 6 cm petri dishes with DPBS (Sigma) on ice. Two male mice were included in each suspension experiment. The following single-cell suspensions were prepared according to our previous protocol with modifications (Haring et al, 2020). In short, DRG was cleaved 1-2 times in 2 mL of papain (25 units / mL, Worthington Biochemical), then digested in a 37°C incubator with a mixture of digestive enzymes: papain / collagenase / dispase (papain, 25 units / mL, 4 mL; DNase I, 55 units / mL, 0.5 mL, Worthington Biochemal; and collagenase and dispase 20 mg / mL, 800 ul, Worthington Biochemal), and then crushed 10 times every 10 minutes using a glass Pasteur pipette with a shrinking diameter (pre-coated with 0.5% BSA). The cell suspension was filtered through a 30 μm cell strainer (CellTrics, Sysmex) and washed with an additional 1.5 mL of ACSF (modified ACSF: 87 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 26 mM NaHCO3, 75 mM sucrose, 20 mM glucose, 20.5 mM CaCl, 4 mM MgSO4) and 0.5 mL of DPBS. The cells were spun down by centrifugation (300 g' 6 min, 4°C) and resuspended in 1.5 mL of cold ACSF containing 0.5 mL of DPBS. The cell suspension was carefully packed onto the same volume of OptiPrep density gradient medium (Sigma) and centrifuged at 700 g' 10 min at 4°C. The cell pellet was resuspended in 3 mL of cold ACSF. SYTOX Blue (Invitrogen, ThermoFisher Scientific) was added to stain dead cells. Next, live SYTOX Blue-negative cells were sorted at 4°C using a fluorescence-activated cell sorting (FACS) system (BD FACSAria Fusion / BD FACSAria III). The cells were concentrated by centrifugation (300g for 5 minutes, 4°C) and resuspended in an appropriate volume (approximately 1000 cells / μl) of ACSF solution.
[0481] 1.6 Single-cell gene expression 3' sequence determination Selected cells were packed into 10' chromium chips G to obtain single-cell droplets using the v3 or v3.1 kit (10' genomics). Target cell recovery of neuron atlas constructs or SNI samples was immobilized on 5000 cells, while samples from the captured active ensemble targeted 1000 cells. Reverse transcription, cDNA amplification, and library construction were performed according to the manufacturer's user guide. Pooled libraries were sequenced on the Illumina NovaSeq6000 system sequencing platform on an SP-100 flow cell, with 91 bp sequences assigned to the 3' end (5'~3') of mRNA in the National Genomics Infrastructure (SciLifeLab). The raw sequencing data were demultiplexed, converted to fastq format, and aligned to mouse reference mm10 (modified with dsRed2-WPRE) using a STAR aligner to generate the gene cell matrix.
[0482] 1.7 Analysis of Single-Cell RNA Sequencing Data R (v.4.1.1) using Seurat (v.4.1.0) was used for the primary scRNA sequence analysis. Individual count matrices generated by CellRanger (v.5.0.1) were merged into a single Seurat object, and all cells with more than 20% of the count derived from mitochondrial genes were discarded. A cutoff was set for the primary data at more than 2000 detected genes. These data were integrated using Harmony (v.0.1.0) and clustered using the default algorithm in Seurat. Putative neuron clusters were identified using the neuron marker gene Rbfox3. Non-neuronal clusters from the control sample were extracted, integrated, and clustered, and cell labels were assigned based on genetic markers from the literature (Yim et al, 2022). Labels (Seurat) were then transferred to all remaining non-neuronal data using the non-neuronal control data. After this, all remaining original data with >999 detected genes were integrated, clustered, and labels were assigned from the primary data. All neurons from this secondary data were discarded to ensure that only high-quality neurons were used in the final analysis. The primary (>2000 detected genes) and secondary (>999 detected genes) datasets were then merged to generate a complete working dataset. More detailed identities of immune cells in the data were assigned using the Peripheral Neural Immunocyte Atlas (Yim et al, 2022). For this purpose, a mixed discriminant analysis (mda)-based classifier (scPred, v.1.9.2) was constructed using this data, and this model was used to learn the cell type labels of immune cells in this data. All cells with a predicted score less than 0.55 were discarded. For neurons, all cells labeled as neurons were extracted from the complete working data, clustered, and an iterative clustering step was used to remove all cells with a normalized number of Rbfox3 less than 0.5 and a normalized number of Apoe greater than 2.Next, using the Zeisel et al. data with annotations from Usoskin et al., a classifier was constructed as before, cell type labels for neuron data were learned using the model, and unassigned neurons were discarded as described above. For pseudo-bulk DE analysis, neuron types were folded together, and data from each individual time point after RA introduction were compared to the control (t0) using the Wilcoxon rank-sum test with Seurat function FindMarkers with an adj.p.val cutoff set to 1 × 10⁻²⁰. DE genes for each cell type between individual RA time points and the control were defined in a similar manner. Co-regulatory gene modules in the dataset were identified using Fcoex (v.1.10.0). To reduce the computational load, a random set (25%) of cells from each cell type time point pair was sampled. Fcoex was run on the first 200 genes using "time point" as the target. The resulting set of modules was further filtered to include only differentially expressed genes and modules consisting of at least 10 genes. Module scores were calculated and scaled to a range of 0-1. Gene enrichment analysis of gene modules was performed using enrichR (v.3.0) with the "GO_Biological_Process_2021" database. For perturbation analysis (Augur v.1.0.0), all genes located on the Y chromosome and non-protein-coding genes were discarded first. Subsequently, the analysis was performed to compare each individual time point with a control for each neuron type. A default minimum of 20 cells was used per type / time point, and therefore some neuron types were not compared for each time point.
[0483] The gene expression matrix was imported into R (4.1.0) and analyzed using Seurat (4.0.6) with the standard pipeline (Satijalab). To construct a spinal cord neural atlas, individual cells were excluded from the dataset if they had fewer than 2,000 genes or a proportion of more than 20% of mitochondrial genes. Raw counts were normalized using the global scaling normalization method "LogNormalize," which normalizes each cell's feature expression measure to total expression, multiplies by a scaling factor of 10,000, and then performs a natural logarithmic transformation (log1p). For the subsequent analysis, highly variable features were identified using the FindVariableFeatures() function (defaulting to 2,000 features). For each gene, scaling was performed around the count. The effects of total UMI and the percentage of mitochondrial genes in each cell were regression-regressed using a linear model of the Scaledata() function. The top 50 major components (PCs) were obtained using the RunPCA() function with default parameters. The dimensionality of the dataset and the clusterings below were determined using a combination of the JackStraw() and ElbowPlot() functions. Clustering was performed using the FindClusters() function with a shared nearest neighbor (SNN) modularity optimization technique (Louvain algorithm by default). To avoid possible over-clustering, we opted for an approach where cells were clustered from the highest level of separation through adjustment of dimensionality and resolution, followed by merging transcriptionally very similar clusters or separating functionally hybrid clusters. Non-neuronal cells were excluded. Finally, 27 clusters were generated for the spinal neuron atlas with reduction = "pca", dims = 1:25, and resolution = 0.5. Cell clusters were visualized using the nonlinear dimensionality reduction technique UMAP. Cluster-specific marker genes were identified using the FindAllMarkers() function. Wilcoxon rank-sum test was chosen to identify differential genes that increased the logfc. threshold by at least 0.25.Specific genetic markers, including canonical and novel ones, were selected from a list of differentially expressed genes for unbiased, classified cell clusters.
[0484] For non-neuronal cells derived from SNI and control samples, if an individual cell had fewer than 1000 genes, fewer than 4000 UMIs, or a ratio of more than 10% of mitochondrial genes, the individual cell was excluded from the dataset (protein-coding genes only). The same pipeline as above was applied, with dims (1:5) and resolution (0.4) adjusted for oligodendrocytes and microglia.
[0485] 1.8 Type I IFN signaling blockade Mice injected with cartilage antibody (Cab) received either a neutralizing monoclonal antibody against IFNAR1 (1 mg / mouse, ip, BioXCell) or an isotype of mouse IgG1 antibody (1 mg / mouse, ip, BioXCell) one hour before arthritis induction (day 0) and on days 22 and 45 after Cab injection. Mechanical sensitivity was tested 12 hours (day 0), 36 hours (day 1.5), 60 hours (day 2.5), and 84 hours (day 3.5) after IFNAR1 or isotype injection (n=3-5). A Tyk2 inhibitor (Duclavacitinib / MBS-986165, MCE) was orally administered twice daily (8:00 AM and 8:00 PM, 15 mg / kg in 5:5:90 EtOH:TPGS:PEG300) for 9 days starting 13 days after Cab injection into C57Bl / 6N mice (Burke et al, 2019). The escape threshold of vonfly and the mechanical sensitivity of coping behavior of 2g vonfly were measured 2 hours after morning injection of the TYK2 inhibitor or vehicle (5:5:90 EtOH:TPGS:PEG300) (n=6).
[0486] 1.9 Antibody Endo S treatment For Fc N-glycan cleavage, GST-fusion endoglycosidase S (Endo S) expressed by E. coli was used and incubated with a cartilage antibody cocktail at a ratio of 1:1000 (w / w) and 37°C for 1 hour. All antibodies were purified using a Protein G GraviTrap column (VWR) according to the manufacturer's instructions.
[0487] 1.10 Measurement of cytokines in serum Mice were deeply anesthetized with pentobarbital sodium (60 mg / kg), and blood was collected via the heart. After standing at room temperature for 30 minutes, the blood samples were centrifuged at 1000 g at 4°C, and serum samples were aliquoted from the supernatant and stored at -80°C until the next test. Serum levels of interferon-α (IFNα) and interferon-β (IFNb), as well as 32 other cytokines, were measured by ELISA using the IFN-α / IFN-β2-Plex mouse ProcartaPlex® panel (Thermofisher) and the Mouse ProcartaPlex® panel (Thermofisher).
[0488] 1.11 Gene expression in arthritis DRG (SYBR green qPCR) Total RNA was extracted from mouse cervical and lumbar DRGs using TRIzol reagent (ThermoFisher) and Motorized Pestle Mixer (Argos Technologies), and cDNA was generated from 500 ng of RNA using a high-volume cDNA reverse transcription kit (Applied Biosystems) as described above (Zhang et al, 2018). Quantitative PCR (qPCR) reactions were performed on a QuantStudio5 system (Applied Biosystems) using SYBR Green Master Mix (Thermo Fisher Scientific). The primer pairs used in this study are listed below: Ifna (pan primer, forward: CCTGAGAA / GAGAAGAAACACAGCC; reverse: GGCTCTCCAGAC / TTTCTGCTCTG); Ifnb (forward: AGGGCGGACTTCAAGATC; reverse: CTCATTCCACCCAGTGCT); Gapdh (forward: AACTTTGGCATTGTGGAAGG; reverse: ACACATTGGGGGTAGGAACA). Samples were collected from four mice in each group at different time points: 1 hour, 12 hours, 3 days, 33 days, and 63 days after antibody injection. Naive C57BL / 6N mice (n=8) were used as the control group. All assays were performed redundantly for three independent experiments, and transcript levels were compared to Gapdh using CT(2 -DDCt The analysis was performed using the ) method.
[0489] 1.12 Immunohistochemistry and Western Blotting Mice were deeply anesthetized with pentobarbital sodium (60 mg / kg), perfused transcardially with 20 ml of preheated (37°C) saline, followed by perfusion with 20 ml of preheated 4% paraformaldehyde containing 0.2% picric acid in 0.16 M phosphate buffer (pH 7.2-7.4) and 50 ml of cryofixative. L4 / L5 DRGs were dissected and post-fixed in the same fixative at 4°C for 90 minutes. After cryoprotection for 48 hours in 10% sucrose with 0.1 M phosphate buffer containing 0.01% sodium azide (VWR International) and 0.02% bacitracin (Sigma), the tissues were embedded in OCT (HistoLab), frozen with liquid carbon dioxide, and sectioned to a thickness of 12 μm on a CryoStar NX70 cryostat (Thermo Scientific).
[0490] The mounted sections were dried at room temperature for at least 30 minutes, and then incubated in a humid chamber at 4°C for 48 hours in phosphate-buffered saline (PBS) containing 0.2% (weight / volume) BSA(Sigma) and 0.3% Triton® X-100(Sigma), either antidiluted or antidiluted. Immunoactivity was visualized using the TSA Plus kit (PerkinElmer) as described above. For double labeling, mouse and human ganglion sections already stained with LPA1 were rinsed in PBS using the TSA+ kit and incubated with CGRP antibody (1:1000) in a humid chamber at 4°C for 48 hours. After washing, CGRP staining was visualized at room temperature for 90 minutes with secondary IgG(H+L) antibody conjugated with carbocyanin 3 (Cy3, 1:150, Jackson ImmunoResearch Laboratories). For IB4 staining, slides were washed in PBS for 20 minutes and incubated with IB4 from Griffonia simplicifolia I (GSA I) (2.5 g / ml, Vector Laboratories, Burlingame, CA) (1:400), followed by incubation overnight with goat anti-GSA I antiserum (1:2,000, Vector Laboratories). Finally, sections were incubated with FITC-conjugated donkey anti-goat antibody for 2 hours at room temperature (1:200, Jackson Laboratories) to visualize IB4 binding. Counterstaining was performed on single-labeled sections at room temperature for 10 minutes using 0.001% propidium iodide (PI, Sigma). Double-labeled sections were counterstained 15 times with DAPI (Sigma) at room temperature. After rinsing with PBS, sections were fixed with fluorescent mounting medium (Agilent Dako). Western blotting was performed at the indicated times on dissected DRGs from control and arthritis animals, processed using standard procedures, and phospho-Stat1 (Ser-727), phospho-Mnk1 (Thr-197 / 202), and phospho-eIF4E (Ser-209) were detected using antibodies from Cell Signaling Technologies.
[0491] 1.13 Records of the tibial nerve elucidated by ex vivo Extracellular recordings from a single cutaneous primary afferent axon in isolated mouse glabrous skin-tibial nerve preparations were obtained following a previously published procedure (Reeh PW, 1986; Walcher et al, 2018). Briefly, Cab or vehicle-injected mice (both male and female) were euthanized by cervical dislocation, glabrous skin from one leg to which the tibial nerve was attached was dissected and placed dermis-side down in a custom-made two-compartment Teflon® recording chamber approximately three months later (days 85–98). The chamber containing the preparation was continuously perfused at a rate of 5 ml / min with an oxygenated external solution consisting of 107.8 mM NaCl, 26.2 mM NaHCO3, 9.64 mM sodium gluconate, 7.6 mM sucrose, 5.55 mM glucose, 3.5 mM KCl, 1.67 mM NaH2PO4, 1.53 mM CaCl2, and 0.69 mM MgSO4, and the pH was adjusted to 7.4 by continuously supplying gas with 95% O2-5% CO2. The temperature of the bath solution was maintained at 33 ± 1 °C using a heat exchanger connected to a thermostat (Zimmermann et al, 2009). The tibial nerve was placed in a chamber adjacent to the bath filled with mineral oil and then split into small bundles individually placed on gold wire electrodes. A reference electrode was positioned in a recording chamber immersed in the aqueous solution. The input signal was recorded at 25 kHz on a PC hard drive for offline analysis using a digitized high-gain AC differential amplifier (Neurolog NL104A, DigiTimer) (PowerLab 8™, ADInstruments). The LabChart software package (ADInstruments) was used for recording and offline analysis. The receptive field of mechanical responsiveness was identified by probing the flap with a blunt glass rod. Once a suitable fiber was found, mechanical stimulation was applied using a mechanical stimulator consisting of a tension / length feedback controller (300C-I; Aurora Scientific). Two different force protocols were used to characterize the mechanical response. Thresholds and firing frequencies were measured during a continuous force ramp of 0–100 mN (ramp duration 10 seconds).Firing frequencies were also recorded during the application of static forces of 0–5, 10, 20, 40, 50, 75, 150, and 200 mN (step duration 10 seconds, force interval 50 seconds). Only mechanically responsive C fibers [conductivity <1.2 m / s (Koltzenburg et al, 1997)] were used in these experiments. Experimenters were blinded to genotype until data analysis was complete.
[0492] 1.14 Statistics Clinical scores are presented as mean ± mean standard error (SEM), behavioral data from the von Frye filament test (discontinuous data) are presented as medians with interquartile ranges, and non-parameters were evaluated by the Mann-Whitney test. Heat sensitivity behavioral data are presented as mean using SEM. Coping behavior tests included the 2g von Frye test and acetone cold allodynia, the Kruskal-Wallis test, followed by Dunn's multiple comparison test. Cytokine expression results with p-values less than 0.05 were considered significant. Data were analyzed using Prism 9.0 (GraphPad software).
[0493] Example 2 Example 2: Results 2.1 Pain associated with arthritis is related to persistent molecular changes in transcription. Monoclonal antibodies directed at proteins targeted by autoantibodies present in the blood and synovial fluid of early rheumatoid arthritis patients, such as anti-citrullinated collagen type II, collagen type II, collagen type XI, and cartilage oligomeric matrix proteins, as well as post-translational modified proteins, induce arthritis in mice (Krishnamurthy et al, 2016, Li et al, 2020, Wigerblad et al, 2016). Similar to patients, arthritis, the spread of epitopes of the autoimmune response, and ultimately bone erosion are observed. Cocktail injection of autoreactive cartilage-binding antibodies (Li et al, 2020) (Figure 1A) resulted in macroscopic clinical arthritis, including swelling and redness, observed between 6 and 23 days post-injection (Figure 1B). Mice developed allodynia within 4 hours before inflammation (4 hours, day 1, day 3), during inflammation (day 9, day 12, day 17, day ...
Claims
1. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising the step of administering a type I interferon inhibitor to the patient.
2. The method according to claim 1, wherein the pain is functional pain such as inflammatory joint pain.
3. The method according to claim 1, wherein the pain is not inflammatory pain.
4. The method according to any one of the prior claims, wherein the pain is not neuropathic pain or neuroplastic pain.
5. The method according to any one of the prior claims, wherein the pain is chronic pain, for example, pain that has been present for three months or more, or six months or more, or twelve months or more.
6. The method according to any one of the prior claims, wherein the pain is one or more selected from the group consisting of analgesia, allodynia, hyperalgesia, and arthralgia.
7. The aforementioned pain, - Systemic inflammation, and / or - Local inflammation, and / or - A method according to any one of the prior claims, relating to and / or caused by clinical inflammation.
8. The method according to any one of the prior claims, wherein the pain is not related to and / or caused by rheumatoid arthritis inflammatory disease activity.
9. The method according to any one of the prior claims, wherein the pain is located in the affected joint and / or the opposite portion of the affected joint and / or the head of the affected joint and / or the tail of the affected joint.
10. The method according to any one of the prior claims, wherein the type I interferon inhibitor does not prevent or treat inflammatory diseases associated with increased type I interferon signaling.
11. - The pain is present along with disease inflammation, and / or - The method according to any one of the prior claims, wherein the pain is present after the remission of the disease inflammation.
12. The method according to any one of the prior claims, wherein the patient has received or is receiving pain treatment, but the pain persists and / or recurs and / or progresses.
13. The method according to claim 12, wherein the pain treatment is selected from the group consisting of nonsteroidal anti-inflammatory drugs (NSAIDs) such as celecoxib, diclofenac, etoricoxib, ibuprofen, and naproxen; steroids such as corticosteroids and glucocorticoids; opioids such as acetaminophen, codeine, dextropropoxifen, and tramadol; antidepressants such as tricyclic antidepressants; anticonvulsants; or combinations thereof.
14. The method according to any one of the prior claims, wherein the pain is related to and / or caused by increased type I interferon signaling in the patient.
15. Increased type I interferon signaling - Increased intracellular signaling of type I interferon in the aforementioned patients - Increased level of type I interferon in the aforementioned patient, - Increased activation of type I interferon receptors in the aforementioned patients, - Increased expression of one or more type I interferon-stimulating genes in the patient, and / or - The method according to claim 14, comprising the reduced expression of one or more type I interferon suppressor genes in the patient.
16. The method according to any one of the prior claims, wherein the type I interferon is selected from the group including interferon α and interferon β.
17. The method according to any one of the prior claims, wherein the pain is related to an increased number and / or activity of one or more active sensory neurons in the patient, preferably an increased number and / or activity of one or more active nociceptors in the patient.
18. The method according to claim 17, wherein the sensory neurons of the patient are TrkA-expressing sensory neurons, preferably TrkA-expressing nociceptors.
19. The method according to claim 17 or 18, wherein the sensory neurons of the patient are GFRa3-expressing sensory neurons, preferably GFRa3-expressing nociceptors.
20. The aforementioned type I interferon inhibitor - Prevent or reduce intracellular signaling of type I interferon in the aforementioned patient, - To prevent or reduce the level of type I interferon in the aforementioned patient, - To prevent or reduce the activation of type I interferon receptors in the aforementioned patients, - Prevent or reduce the expression of one or more type I interferon-stimulating genes in the patient, and / or - The method according to any one of the prior claims, which involves inducing and / or increasing the expression of one or more type I interferon suppressor genes in the patient.
21. The method according to any one of the prior claims, wherein the type I interferon inhibitor is selected from the group consisting of MNK inhibitors (such as MNK1 inhibitors and / or MNK2 inhibitors), IFNAR1 inhibitors, IFNAR2 inhibitors, TYK2 inhibitors, type I interferon antagonists, and eukaryotic translation initiation factor 4E (eIF4E) inhibitors.
22. The method according to any one of the prior claims, wherein the type I interferon inhibitor is selected from the group consisting of a small molecule, an antibody, an antibody moiety, an antibody mimetic, a decoy receptor, a receptor body, and a vaccine.
23. The method according to any one of the prior claims, wherein the type I interferon inhibitor is selected from the group consisting of duklavacitinib, aniflorumab, NDI-034858, NDI-031232, NDI-031301, NDI-031407, ESK-001, VTX-958, ICP-488, lopsacitinib, and GLPG3667.
24. The method according to any one of claims 1 to 22, wherein the type I interferon inhibitor is an MNK inhibitor such as an MNK1 inhibitor and / or an MNK2 inhibitor.
25. The method according to claim 24, wherein the MNK inhibitor is selected from the group consisting of eFT508, 4ET-03-053, BAY1143269, ETC-1907206, and derivatives thereof.
26. The aforementioned MNK inhibitor has structure (II): 【Chemistry 126】 A compound of or a pharmaceutically acceptable salt thereof, in which, R 1a However, C 1 ~C 6 Alkyl or aryl, R 1b However, C 1 ~C 6 Is it alkyl or aryl? Alternatively, R 1a and R 1b However, together with the carbon to which they are bonded, they form cycloalkyl, cycloalkenyl, heterocyclyl, aryl, or heteroaryl groups. R 2 is -NHR 3a -NH-C(=O)R 3b -NH-C(=S)R 3b or -C(=O)R 3c and R 3a However, hydrogen, C 1 ~C 6 Alkyl, or C 3 ~C 6 They are cycloalkyl, and each of them can optionally be hydroxyl, C 3 ~C 6 Cycloalkyl, -NHS(O) 2 CH 3 , heterocyclyl, -C(=O)OH, -C(=O)N(R 3d ) R 3d , or -N(R 3d ) R 3d It is substituted with one or more substituents selected from the group consisting of, R 3b However, C 1 ~C 6 Alkyl, C 3 ~C 6 The cycloalkyl or heterocyclyl compounds are, each of which may optionally be hydroxyl, halo, or C. 1 ~C 6 Alkyl, C 3 ~C 6 Cycloalkyl, -NHS(O) 2 CH 3 , -N(R 3d ) R 3d , heterocyclyl, -C(=O)OH, -C(=O)N(R 3d ) R 3d , -NHC(=O)CH 3 ien-CH 2 It is substituted with one or more substituents selected from the group consisting of C(=O)OH, R 3c However, -N(R 3d ) R 3d or heterocycline, R 3d However, at each appearance, hydrogen and C appear independently. 1 ~C 6 Alkyl, or C 3 ~C 6 It is a cycloalkyl, L is -NH- or -CH 2 It is NH-, The method according to claim 24, wherein X is N and Y is CH, or X is CH and Y is N.
27. R 1a and R 1b Both are -CH 3 When that is the case, or R 1a and R 1b When R is bonded to form a 5-membered or 6-membered cycloalkyl or heterocycline, 2 However, the structure is as follows: -NH 2 or 【Chemistry 127】 The method according to claim 26, which does not have
28. The method according to claim 26, wherein the MNK inhibitor is selected from Table 1.
29. The aforementioned MNK inhibitor is given by formula (I'): 【Chemistry 128】 A compound of or a pharmaceutically acceptable salt thereof, in which, R 1 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloalkyl groups, R 2’ but, 【Chemistry 129】 Selected from the group consisting of, R 3’ However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, cyano, C 1~6 Alkoxyl, C 3~7 Branched alkoxys, hydroxyls, and halogens, C 1~6 Alkyl, C 1~6 Haloalkyl and C 1~6 C is optionally substituted with 1 to 3 substituents selected from the group consisting of hydroxyalkyl groups. 3~6 Selected from the group consisting of cycloachil, R 1c and R 1d together form a 3- to 7-membered ring having 0 to 2 heteroatoms selected from the group consisting of N, O, and S, and the 3- to 7-membered ring is optionally halo, oxo, C 1~6 alkyl, R 8 , and -C(=O)OR 9 and may be further substituted with one or more substituents selected from the group consisting of, Z 1 and Z 2 are each independently a direct bond or -{C(R 4a )(R 4b )} p -Y 1 -, p is 0, 1, 2, 3, 4, or 5, and Y 1 is a direct bond, -O-, or -N(R 8 )-. R 4a However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C) 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO 2 (C 1~6 Alkyl), NHSO 2 (C 3~7 Branched alkyl groups), and NHSO 2 (C 3~7 Selected from the group consisting of cycloalkyls, or two R 4a However, it bonds directly to two adjacent carbon atoms, R 4b However, at each appearance, hydrogen, halogen, and C appear independently. 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, NHCO(C) 1~6 Alkyl), NHCO(C 3~7 Branched alkyl), NHCO(C 3~7 Cycloalkyl), NHSO 2 (C 1~6 Alkyl), NHSO 2 (C 3~7 Branched alkyl groups), and NHSO 2 (C 3~7 Selected from the group consisting of cycloalkyl, R 5 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6 However, hydrogen, NH 2 NHR 6a , NHCH 2 CH 2 OH, NHCH 2 CH 2 NHSO 2 Me, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 6a However, -(CO)C 1 ~ 6 Alkyl, -(CO)C 3~7 Branched alkyl, -(CO)C 1 ~ 6 Hydroxyalkyl, 【Chemistry 130】 Selected from the group consisting of, q is 1, 2, 3, 4, 5, or 6, e is 1, 2, 3, 4, 5, or 6. X 2 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxy, C 3~7 Branched alkoxy, C 1~6 Haloalkoxy, C 3~7 Branched haloalkoxy, NH 2 NH(C 1~6 Alkyl), N (C 1~6 Alkyl) 2, C 1~5 (COOH), C 1~6 (NHSO) 2 Selected from the group consisting of Me), X 3 However, hydrogen, halogen, C 1~5 Alkyl, C 3~7 Branched alkyl, C 1~5 Haloalkyl, C 3~7 Branched haloalkyl, hydroxy, C 1~5 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~5 Alkoxy, C 3~7 Branched alkoxy, C 1~5 Haloalkoxy, C 3~7 Branched haloalkoxy, NH 2 NH(C 1~6 Alkyl), N (C 1~6 Alkyl) 2 COOH, C 1~5 (COOH), NHSO 2 Me, C 1~5 (NHSO) 2 Selected from the group consisting of Me), R 7 However, hydrogen, halogen, C 1~6 Alkyl, C 3~7 Branched alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Alkoxyl, C 3~7 Selected from the group consisting of branched alkoxys and hydroxyls, R 8 However, C 1~6 Alkyl, C 1~6 Haloalkyl, C 3~7 Branched haloalkyl, C 1~6 Hydroxyalkyl, C 3~7 Branched hydroxyalkyl, C 1~6 Alkoxyl, C 3~7 Branched alkoxy, CO(C) 1~6 Alkyl), CO(C 3~7 Branched alkyl), SO 2 (C 1~6 Alkyl), and SO 2 (C 3.7 Selected from the group consisting of branched alkyl groups, R 9 However, hydrogen, C 1~6 The method according to claim 24, selected from the group consisting of alkyl and aralkyl.
30. The aforementioned MNK inhibitor N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-3',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclobutan-1,1'-cyclobutan-3',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, Benzyl 6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1-carboxylate, tert-butyl6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[azetidine-3,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1-carboxylate, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[azetidine-3,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, 6"-((6-((2-hydroxyethyl)amino)pyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, Benzyl 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1-carboxylate, 1-(aminomethyl)-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropane-1-carboxamide, (1R,5S,6r)-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-2-azaspiro[3.3]heptan-6-carboxamide, 2-methyl-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-2-azaspiro[3,3]heptan-6-carboxamide, (1R,5S,6r)-3-methyl-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide, N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)-1-(methylsulfonamidemethyl)cyclopropane-1-carboxamide, 1-((dimethylamino)methyl)-N-(6-((8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropane-1-carboxamide, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclobutane-1,1'-cyclobutane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[aziridine-2,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclopentane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopentan-1,1'-cyclopentan-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-3,3-difluoro-8"-methyl-2"H-dispiro[cyclobutane-1,1'-cyclobutane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopentan-1,1'-cyclobutan-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclobutan-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclohexane-1,1'-cyclobutane-3',3"-imidazo[1,5-a]pyridine]-1",5"-dione, Ethyl 6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-2-carboxylate, tert-butyl(6"-((6-(cyclopropanecarboxamide)pyrimidine-4-yl)amino)-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-2"yl)carbamate, N-(6-((2,2-difluoro-8"-methyl-1",5"-dioxo-1",5"-dihydro-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-6"-yl)amino)pyrimidine-4-yl)cyclopropanecarboxamide, 6"-((6-aminopyrimidine-4-yl)amino)-2,2-difluoro-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cycloheptane-4',3"-imidazo[1,5-a]pyridine]-1",5"-dione, 6"-((6-aminopyrimidine-4-yl)amino)-8"-methyl-2"H-dispiro[cyclopropane-1,1'-cyclohexane-4',3"-imidazo[1,5-a]pyridine]-2'-ene-1",5"-dione, The method according to claim 29, wherein the compound is selected from, or a pharmaceutically acceptable salt thereof.
31. The aforementioned MNK inhibitor has formula IB: 【Chemistry 131】 A compound of or a pharmaceutically acceptable salt thereof, in which, W 1 and W 2 However, independently, they are O, S, or N-OR', and R' is a lower alkyl group. Y is -N(R 5” )-, -O-, -S-, -C(O)-, -S=O, -S(O) 2 -, or -CHR 9 - and R 1” However, it is hydrogen, a lower alkyl group, a cycloalkyl group, or a heterocycline, and any lower alkyl group, cycloalkyl group, or heterocycline is optionally substituted with one, two, or three J groups. n 2 However, it is 1, 2, or 3. R 2” and R 3” However, each is independently hydrogen, alkyl, alkenyl, alkynyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene, and any alkyl, aryl, araalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclyl, or heterocyclylalkylene is optionally substituted with one, two, or three J groups. Alternatively, R 2” and R 3” However, together with the carbon atoms to which they are bonded, they form a cycloalkyl or heterocycline, and any cycloalkyl or heterocycline is optionally substituted with one, two, or three J groups. R 4a” and R 4b” However, each is independently hydrogen, halogen, hydroxyl, thiol, hydroxyalkylene, cyano, alkyl, alkoxy, acyl, thioalkyl, alkenyl, alkynyl, cycloalkyl, aryl, or heterocyclyl. R 5” However, whether it is hydrogen, cyano, or lower alkyl, Alternatively, R 5” and R 8 However, together with the atoms to which they are bonded, they form condensed heterocyclines that are optionally substituted with one, two, or three J groups. R 6” , R 7” , and R 8 However, each is independently hydrogen, hydroxyl, halogen, cyano, amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl, and any amino, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, amino, alkylaminyl, alkylcarbonylaminyl, cycloalkylcarbonylaminyl, cycloalkylaminyl, heterocyclylaminyl, heteroaryl, or heterocyclyl is optionally substituted with one, two, or three J groups. Alternatively, R 7” and R 8 However, together with the atoms to which they are bonded, they form condensed heterocyclines or heteroaryls which are optionally substituted with one, two, or three J groups. J is -SH, -SR 9 , -S(O)R 9 , -S(O) 2 R 9 , -S(O)NH 2 , -S(O)NR 9 R 9 , -NH 2 , -NR 9 R 9 , -COOH, -C(O)OR 9 , -C(O)R 9 , -C(O)-NH 2 , -C(O)-NR 9 R 9 hydroxy, cyano, halogen, acetyl, alkyl, lower alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, thioalkyl, cyanoalkylene, alkylaminyl, NH 2 -C(O)-alkylene, NR 9 R 9 -C(O)-alkylene, -CHR 9 -C(O)-lower alkyl, -C(O) lower alkyl, alkylcarbonylaminyl, cycloalkyl, cycloalkylalkylene, cycloalkylalkenylene, cycloalkylcarbonylaminyl, cycloalkylaminyl, -CHR 9 -C(O)-cycloalkyl, -C(O)cycloalkyl, -CHR 9 -C(O)-aryl, -CHR 9 -aryl, -C(O)-aryl, -CHR 9 -C(O)-heterocycloalkyl, -C(O)-heterocycloalkyl, heterocyclylaminyl, or heterocyclyl, or any two J groups bonded to the same carbon or heteroatom may together form an oxo. R 9 The method according to claim 24, wherein is hydrogen, a lower alkyl group, or -OH.
32. The method according to claim 31, wherein the MNK inhibitor is a compound selected from Table 5, or a pharmaceutically acceptable salt thereof.
33. A pharmaceutical composition comprising a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in a patient, and / or one or more therapeutic agents for treating rheumatoid arthritis, in combination with a pharmaceutically acceptable carrier, diluent, or excipient.
34. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising the step of administering the pharmaceutical composition according to claim 33 to the patient.
35. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, comprising administering to the patient a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in the patient, and / or one or more therapeutic agents for treating rheumatoid arthritis.
36. A kit containing a type I interferon inhibitor and one or more therapeutic agents for treating rheumatoid arthritis.
37. A method for identifying patients who have pain associated with rheumatoid arthritis and require treatment with type I interferon inhibitors, (a) A step of providing test samples from patients with pain associated with rheumatoid arthritis, (b) A step of determining the level of type I interferon signaling in the test sample, A method comprising (c) identifying the patient as a patient requiring treatment with a type I interferon inhibitor based on the decision in step (b).
38. The method according to claim 37, further comprising the step of administering a type I interferon inhibitor to the patient.