cell

Abstract

The present invention relates to donor cells engineered for use in universal donor cell therapy for homogeneous, ready-made administration, and having improved persistence in the host immune system. The present invention also relates to the use of miRNA expression constructs in such engineered donor cells. The cells are engineered donor cells in which one or more cell surface expression polypeptides involved in immune signaling are functionally regulated, resulting in reduced rejection by the host immune system.

Description

Technical Field

[0001] Background of the Invention Field of the Invention The present invention generally relates to the field of cell biology. More specifically, the present invention particularly relates to the use of miRNA gene constructs for creating universal donor cell (UDC) therapies for allogeneic off-the-shelf administration, in which cells can persist longer by avoiding rejection by the patient's immune system.

Background Art

[0002] Description of Related Art Autologous cell therapies such as chimeric antigen receptor (CAR) T cell therapy have been established as effective treatments for conditions such as hematological malignancies. However, approaches based on such cell therapies are subject to high manufacturing costs and complex logistics, limiting their widespread adoption. The ability to use allogeneic cells, i.e., cells that are not genetically similar to the patient, would be a promising solution to overcome these challenges, as they enable the production of multiple therapeutic doses from a single healthy donor unit, allowing for significant cost reduction and off-the-shelf availability.

[0003] However, in order to fully utilize allogeneic cell-based strategies, it would be necessary to avoid immune rejection and enhance the ability of allogeneic cells to persist in the context of the host / patient's immune system, which is required to obtain a more persistent clinical response. Therefore, strategies are needed to continuously, e.g., permanently modify donor cells in order to provide engineered allogeneic cells with improved persistence in vivo.

[0004] The major histocompatibility complex (MHC) is a term used to describe the gene clusters in animals and humans that encode various cell surface markers, antigen-presenting molecules, and other proteins involved in immune function. The human leukocyte antigen (HLA) complex is synonymous with human MHC (Viatte S, Scur PH, Seo P. Human leukocyte antigens (HLA): A roadmap. In: UpToDate, Post TW (Ed), UpToDate, Waltham, MA).

[0005] HLA / MHC class I deficiency, also known as bear lymphocyte syndrome I (BLS I), is a form of severe combined immunodeficiency syndrome (SCID) characterized by defects in the expression of molecules involved in the cell surface expression of HLA-I molecules. Most commonly, BLS I is thought to be caused by gene mutations in the TAP proteins, namely TAP1, TAP2, and TAPBP (Online Mendelian Inheritance in Man (OMIM), 604571). Cases of β2 microglobulin (B2M) deficiency have also been reported, in which patients exhibit similar features to typical HLA I deficiency but have more extensive immunological defects (Ardeniz et al., 2015, PMID:25702838).

[0006] HLA / MHC class II deficiency, also known as bear lymphocyte syndrome I (BLS II), is another form of SCID characterized by defects in the expression of molecules involved in the cell surface expression of the HLA-II molecule. BLS II expression is most commonly due to genetic defects in the transcription factors involved in HLA-II expression, namely CIITA, RFXANK, RFX5, and RFXAP (Online Mendelian Inheritance in Man (OMIM), 209920).

[0007] Allogeneic infusion of engineered donor cells, such as CAR T cells, further requires suppression of endogenous T cell receptor (TCR) expression to mitigate allogeneic reactivity of donor-derived T cells and graft-versus-host disease (GvHD). This can be achieved using various genetic engineering approaches, most typically gene editing technologies such as CRISPR knockout. However, further alternative and improved approaches to provide allogeneic TCR-deficient T cells for this purpose are still needed.

[0008] In short, the present invention addresses each of these problems and the need in the art to provide improved, effective homogeneous engineered donor cells. [Overview of the Initiative] [Means for solving the problem]

[0009] Summary of the Invention The present invention is defined in the appended claims. The descriptions herein are intended to illustrate and further aid in understanding the claimed invention.

[0010] In a first aspect, the present invention provides engineered donor cells in which rejection by the host immune system is reduced, and in which one or more cell surface-expressed polypeptides involved in immune signaling are functionally regulated.

[0011] In a second embodiment, the present invention provides a miRNA expression construct comprising one or more miRNA hairpins targeting B2M, NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, RFXAP, CIITA, TCRa, TCRb, CD3d, CD3g, CD3e, and / or CD3z. In one embodiment, the construct further comprises an expressed transcript.

[0012] In a third aspect, the present invention provides a DNA molecule comprising the miRNA expression construct of the present invention.

[0013] In a fourth aspect, the present invention provides a plasmid comprising the miRNA expression construct or DNA molecule of the present invention.

[0014] In a fifth aspect, the present invention provides a vector comprising a miRNA expression construct, a DNA molecule, or a plasmid.

[0015] In a sixth aspect, the present invention provides engineered donor cells comprising the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention.

[0016] In a seventh aspect, the present invention provides a method for downregulating polypeptides in cells, comprising expressing the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention in cells.

[0017] In an eighth aspect, the present invention provides a method for preparing engineered donor cells, comprising transfecting or transducing cells with the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention.

[0018] In the ninth aspect, the present invention relates to a method for preparing engineered donor cells from a patient donor or a healthy donor, the method being (a) Taking cells from the patient, (b) Transfecting or transducing cells using the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention, (c) Expressing a miRNA expression construct Includes.

[0019] In a tenth aspect, the present invention provides engineered effector cells that can be obtained or obtained by the method of the present invention.

[0020] In an eleventh aspect, the present invention provides a composition comprising the engineered donor cells of the present invention.

[0021] In a 12th aspect, the present invention provides the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention for use in therapy.

[0022] In a 13th aspect, the present invention provides the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention for use in a method of treating cancer, an infectious disease, an autoimmune disease or a genetic disorder.

[0023] In a 14th aspect, the present invention provides a method of treating cancer, an infectious disease, an autoimmune disease or a genetic disorder, comprising administering the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention.

[0024] In a 15th aspect, the present invention provides the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention for use in the manufacture of a medicament for treating cancer, an infectious disease, an autoimmune disease or a genetic disorder.

[0025] In a 16th aspect, the present invention provides the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention for use in a method of stem cell therapy.

[0026] In a 17th aspect, the present invention provides a method of stem cell therapy, comprising administering the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention.

[0027] In a 18th aspect, the present invention provides the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention for use in the manufacture of a medicament for stem cell therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] [Figure 1]Figure 1 shows the downregulation of HLA-ABC expression in gene-modified primary T cells using a target sequence for B2M miRNA, as normalized values ​​of median HLA-ABC fluorescence intensity (MFI) compared to expression from T cells modified with scrambled control miRNA. [Figure 2] Figure 2 shows genetically modified T cells with various HLA class I expressions. It includes flow cytometry histograms of HLA-ABC expression and accompanying descriptive statistics. The Comp-FL7 channel reflects the median HLA-ABC fluorescence intensity (MFI, right column of the table). The percentages on the left of the histogram represent normalized HLA-ABC expression compared to control transduced T cells called Scrambled-mCherry (mCherry only). [Figure 3-1] Figure 3 shows the downregulation of HLA class I expression. Flow cytometry histograms and normalized values ​​for HLA-ABC expression are shown. The histograms are based on gating for genetically modified cells, i.e., those positive for the mCherry reporter gene. [Figure 3-2] Same as above. [Figure 4-1] Figure 4 shows a flow cytometry gating strategy using B2M_T5 as an example. Gating was initially based on T cell selection, doublets, and dead cell elimination. Subsequently, mCherry vs. HLA-ABC histograms were plotted to evaluate the silencing of HLA-ABC expression in genetically modified (mCherry-positive) and unmodified cells. [Figure 4-2] Same as above. [Figure 4-3] Same as above. [Figure 5]Figure 5 shows a multi-hairpin miRNA construct for HLA class I using B2M_T5. The histogram reveals partial improvements in HLA-ABC silencing when B2M_T5 is increased to two- and three-hairpin (hp) miRNA constructs. Normalized expression levels reflect over 90% silencing of HLA class I (n=3 donors). [Figure 6] Figure 6 shows genetically modified HEK293 cells with varying HLA class I expression. Flow cytometry histograms and accompanying descriptive statistics for HLA-ABC expression are shown. The YL2 channel reflects mCherry reporter gene expression, and the median HLA-ABC expression is listed under the VL1 channel (last column of the table). The percentage on the left of the histogram indicates normalized HLA-ABC gene silencing compared to control transduced HEK293 cells (mCherry only). [Figure 7-1] Figure 7 shows the downregulation of TCR a / b expression. Flow cytometry histograms and normalized values ​​of the percentage of cells expressing TCR a / b and MFI expression. The histograms are based on gating for genetically modified cells, i.e., those positive for the mCherry reporter gene. [Figure 7-2] Same as above. [Figure 8-1] Figure 8 shows a flow cytometry gating strategy using TRAC_T1 as an example. Gating was initially based on T cell selection, doublet exclusion, and gating against viable cells. Subsequently, mCherry vs. TCR a / b and CD3e were plotted to evaluate the silencing of TCR expression in genetically modified (mCherry-positive) and unmodified cells. [Figure 8-2] Same as above. [Figure 8-3] Same as above. [Figure 8-4] Same as above. [Figure 8-5] Same as above. [Figure 9-1]Figure 9 shows the downregulation of TCR a / b expression. Flow cytometry histograms and normalized values ​​for the percentage of cells expressing TCR a / b and MFI levels. The histograms are based on gating for genetically modified cells, i.e., those positive for the mCherry reporter gene. [Figure 9-2] Same as above. [Figure 10-1] Figure 10 shows a flow cytometry gating strategy using CD3z_T1 as an example. Gating was initially based on T cell selection, doublet exclusion, and gating against live cells. Subsequently, we plotted mCherry versus TCR a / b and CD3e to evaluate the silencing of TCR expression in genetically modified (mCherry-positive) and unmodified cells. [Figure 10-2] Same as above. [Figure 10-3] Same as above. [Figure 10-4] Same as above. [Figure 10-5] Same as above. [Figure 11] Figure 11 shows the efficiency of TCR silencing in Jurkat cells. The single hairpin CD3z_T2 construct resulted in complete silencing of TCR a / b expression (black, unstained control). Similarly, a reduction of over 90% of CD3e on the surface of Jurkat cells was shown. [Figure 12] Figure 12 shows multi-hairpin miRNA constructs for TCR silencing using CD3z_T2. The histograms show slight improvements in TCR silencing when CD3z_T2 is increased to two- and three-hairpin (hp) constructs. Normalized expression levels reflect over 95% silencing of the TCR. [Figure 13-1]Figure 13 shows histograms of multi-targeting constructs for silencing TCR expression. Except for the untransduced (UTD) state, all histograms reflect cell surface expression in genetically modified T cells (gated with mCherry-positive cells). The "Parental Population Frequency" column shows the proportion of cells gated for histogram creation, i.e., the proportion of transduced T cells. TCR a / b are reported in the BL1 channel, and CD3e is reported in RL2. * = transduced with a higher copy number (MOI=2.0). [Figure 13-2] Same as above. [Figure 14-1] Figure 14 shows the mixed lymphocyte response (MLR) using CD3z_T2 and TRAC_T1 modified T cells. (A) PBMCs from the same donor were transduced with miRNAs targeting either the CD3z_T2 or TRAC_T1 target sequence. T cells with 95% and 30% TCR silencing were generated with transduction rates of 65–80%. Control transduced T cells carried only the mCherry reporter gene and expressed TCR levels equivalent to untransduced T cells (UTDs). (B) CD137 expression in unstimulated cells, MLR (1:1 ratio with irradiated mismatched PBMCs), and cells activated with CD3 / CD28 microbeads (positive control). CD137 expression was not observed in any of the unstimulated PBMC populations. In MLR, a significant decrease in CD137 expression was observed in CD8+ T cells transduced with our TRAC_T1 construct (see upper quadrant compared to unmodified cells in the lower quadrant). Significant loss of CD137 expression was observed in CD3z_T2 transduced cells (lower panel, upper quadrant). When normalized to CD137 expression in control (mCherry only) transduced CD8+ T cells, less than 5% of cells transduced with the CD3z_T2 construct were activated. A notable decrease in CD137 expression was also observed when using the CD3z_T2 construct under CD3 / CD28 microbead activation conditions. [Figure 14-2] Same as above. [Figure 14-3] Same as above. [Figure 14-4] Same as above. [Figure 15-1] Figure 15 shows the screening of miRNAs for silencing HLA class II expression. A. A summary of the transduction rate and HLA-II expression silencing in primary T cells, showing the construct pATN504 which achieves a comparable gene modification rate and the most efficient silencing of HLA-CP / DQ / DR cell surface expression. B. Flow cytometry histogram of primary T cells modified with a CIITA-targeting miRNA construct (second screening). The histogram is based on gating for gene-modified cells, i.e., those positive for the mCherry reporter gene. [Figure 15-2] Same as above. [Figure 16] Figure 16 shows the manipulation of allogeneic and hypoimmunogenic CAR19 T cells with regulated HLA-I expression silencing. All bimodal gene constructs were designed to silence TCR cell surface expression via the use of optimized miRNAs targeting CD3z and to co-express anti-CD19 CAR (CAR19) and the RQR8 reporter gene. Constructs pATN292 and pATN293 were designed to further silencing HLA class I expression using miRNAs targeting B2M_T2 and B2M_T5, respectively. Finally, pATN294 expresses a dual miRNA targeting B2M_T5 to achieve maximum HLA-I silencing. [Figure 17-1]Figure 17 shows the characterization of the production and immunophenotypic characteristics of allogeneic and hypoimmunogenic miCAR19 T cells. A. Schematic diagram of the miCAR T cell production process. B. Flow cytometry dot plots of miCAR19 T cells (pATN293 with silencing of TCRα / β and HLA-ABC) before and after depletion of TCRα / β-positive cells. CAR-positive cells were detected based on CD34 positivity (RQR8). The remaining cells after TCRα / β depletion lack TCRα / β, are silenced for HLA-ABC, and fully express the RQR8 reporter gene (CD34). C. Flow cytometry histogram showing cell surface expression of HLA-ABC in engineered miCAR19 T cells. Cells modified with pATN296 express similar levels of HLA-ABC as untransduced T cells. Cells modified with constructs carrying miRNA-targeting B2M_T2 and B2M_T5 (pATN292 and pATN293) downregulated HLA-ABC expression (80% and 90%, respectively), while cells modified with a construct carrying dual miRNA of B2M_T5 had the most efficient downregulation of HLA-ABC (95%). [Figure 17-2] Same as above. [Figure 17-3] Same as above. [Figure 18-1]Figure 18 shows the extended immunophenotypic characterization of allogeneic and hypoimmunogenic miCAR19 T cells. All cell products were analyzed using flow cytometry 24 hours after thawing. For positive controls, untransduced T cells and CAR19 T cells were activated with CD3 / CD28 microbeads on the thawing day. UTD: Untransduced T cells; UTD act: Untransduced T cells; CAR19: CAR19 T cells activated with CD3 / CD28 microbeads; CAR19 act: CAR19 T cells activated with CD3 / CD28 microbeads; 296: CAR19 T cells with TCR silencing; 294: CAR19 T cells (B2M_T5_T5) with TCR and HLA-I silencing, 5% residual HLA-I; 293: CAR19 T cells (B2M_T5) with TCR and HLA-I silencing, 10% residual HLA-I; 292: CAR19 T cells (B2M_T2) with TCR and HLA-I silencing, 20% residual HLA-I. A. The CD4+ / CD8+ T cell ratio shows no difference across all T cell products produced. B. The expression levels of PD1, TIGIT, and TIM3 were shown to be low in both CD4 and CD8 T cell populations after production. Positive controls (CD3 / CD28 microbead activation) expressed PD1, TIGIT, and TIM3 highly. C. Memory phenotypes based on the expression of CD45RA and CD62L indicate that CD4+ T cells were mostly central memory (TCM), while CD8+ T cells were predominantly naive / stem cell memory (TSCM). A small proportion of effector memory T cells (TEM) and effector memory T cells (TEMRA) reexpressing CD45RA were present, excluding the activated T cell population. D. Activation status, as measured by the presence of CD69 and CD25-positive cells, indicates negligible activation in all T cell products produced. [Figure 18-2] Same as above. [Figure 19-1]Figure 19 shows the specific cytotoxicity of tumor cells by allogeneic and hypoimmunogenic miCAR19 T cells. UTD: Untransduced T cells; 296: CAR19 with TCR silencing; 294: CAR19 (B2M_T5_T5) with TCR and HLA-I silencing, 5% residual HLA-I; 293: CAR19 (B2M_T5) with TCR and HLA-I silencing, 10% residual HLA-I; 292: CAR19 (B2M_T2) with TCR and HLA-I silencing, 20% residual HLA-I. A. In short-term cytotoxicity assays, miCAR19 T cells with various HLA-I silencing techniques performed equally well in terms of functional activity against CD19-expressing tumor cells. Engineered miCAR19 T cells (effector, E) and JeKo-1 cells (target, T) were co-cultured at 1:1 and 3:1 E:T ratios for 24, 48, and 72 hours. Target cell viability (GFP-expressing JeKo-1 cells) was assessed by detecting GFP positivity by flow cytometry at the indicated time points. Data points on the graphs represent the mean and standard deviation from n=3 donors. The dotted line on each representative graph indicates the percentage of JeKo-1 cells initially plated in the co-culture. B and C demonstrate that allogeneic and low immunogenic miCAR19 T cells maintain efficient cytotoxicity of CD19-expressing tumor cells. B. In short-term cytotoxicity assays, miCAR19 T cells with various HLA-I silencing regimens function equally well in terms of functional activity against CD19-expressing tumor cells. Engineered miCAR19 T cells (effector, E) and JeKo-1 cells (target, T) were co-cultured in E:T ratios of 1:9, 1:3, 1:1, and 3:1. Target cell viability (GFP-expressing JeKo-1 cells) was assessed by detecting GFP positivity by flow cytometry at the indicated time points. Data points on the graph represent the mean and standard deviation from n=3 donors.C. In long-term assays, miCAR19 T cells with 80% HLA-I silencing (engineered from construct 292) were found to efficiently deplete JeKo-1 tumor cells over four restimulations with the same number of target cells. D. Allogeneic and low immunogenic miCAR19 T cells maintain efficient cytotoxicity of CD19-expressing tumor cells. In repeated killing assays, all miCAR19 T cells with altered HLA-I silencing performed equally well in lysing target cells over four exposures to JeKo-1 tumor cells, with tumor cells added to the culture on days 1, 3, 7, and 10, while untransduced T cells were unable to control tumor growth. [Figure 19-2] Same as above. [Figure 19-3] Same as above. [Figure 19-4] Same as above. [Figure 20-1]Figure 20 shows mixed lymphocyte reactions with mismatched CD8+ T cells and NK cells using allogeneic and hypoimmunogenic miCAR19 T cells. UTD: Untransduced T cells; 296: CAR19 with TCR silencing; 294: CAR19 (B2M_T5_T5) with TCR and HLA-I silencing, 5% residual HLA-I; 293: CAR19 (B2M_T5) with TCR and HLA-I silencing, 10% residual HLA-I; 292: CAR19 (B2M_T2) with TCR and HLA-I silencing, 20% residual HLA-I. A. Host PBMCs were primed with mitomycin-treated graft donor cells (CAR19 T cells), and then CD8-positive T cells were isolated and labeled with CellTrace Violet (CTV) dye. Next, primed CD8+ T cells (effector, E) were co-cultured with graft miCAR19 T cells (target cells, T) in a 1:1 E:T ratio. Six days after plating the co-culture, the cells were analyzed by flow cytometry. Untransduced (UTD) T cells and allogeneic miCAR19 T cells (296, without HLA-I silencing) were mostly depleted by the primed CD8+ T cells, while all miCAR19 T cell populations with HLA-I silencing (292, 293, and 294) remained equally protected, regardless of whether they had 80%, 90%, or 95% HLA-I silencing. B. Primed CD8+ T cells were activated and proliferated only in co-culture with UTD and 296 miCAR T cells, as exemplified by dilution of CTV signaling. Corresponding to the lack of cytotoxicity of HLA-I silencing miCAR T cells, equal CTV signaling was observed for primed CD8+ T cells exposed to the same miCAR19 T cell population. C. Host NK cells (effector cells, E) were co-cultured with graft miCAR19 T cells (target cells, T) in a 5:1 E:T ratio. After 24 hours, cells were analyzed by flow cytometry and used to assess the proportion of NK cells and T cells based on CD56 and CD5 expression, respectively.miCAR19 T cells with graft UTD and full HLA-I expression (pATN296) remained equally protected, while miCAR19 T cells with the highest HLA-I silencing (294) were most susceptible to NK cell-mediated cytotoxicity. Graft miCAR19 T cells with 80% (292) and 90% (293) HLA-I silencing were correspondingly protected from NK cell-mediated cytotoxicity. C and D demonstrate that "adjusted" HLA-I silencing protects miCAR19 T cells from NK cell rejection in accordance with HLA-I expression. D. Host NK cells (effector cells, E) were co-cultured with graft miCAR19 T cells (target cells, T) across a range of E:T ratios. Untransduced graft T cells and miCAR19-allo T cells fully expressing HLA-I were not lysed, but CAR19-allo T cells with 95% HLA-I silencing were most susceptible to NK cell-mediated cytotoxicity at all E:T ratios. Notably, graft miCAR19 T cells with 80–90% modified HLA-I silencing remained largely protected from NK cell-mediated cytotoxicity. E. Host NK cells (effector cells, E) were co-cultured with graft miCAR19 T cells (target cells, T) across a range of E:T ratios. Host NK cells most significantly rejected graft T cells with HLA-I silencing over the first 24 hours of co-culture (E:T ratio 5:1). All assays were performed with n=3 NK cell donors. F. Rejection of CD19 CAR T cells by primed CD8 T cells or NK cells correlates with in vitro HLA-ABC levels. CD8+ T cells from three different donors were first primed with CD19 CAR T cells and then plated in a 1:1 ratio with CD19 CAR T cells (graft cells) expressing different levels of HLA-ABC. The number of remaining graft cells was analyzed after 6 days of co-culture. G. Rejection of CD19 CAR T cells by primed CD8 T cells or NK cells correlates with in vitro HLA-ABC levels.NK cells from three different donors were plated in a 5:1 ratio with CD19 CAR T cells (graft cells) expressing different levels of HLA-ABC. After 48 hours of co-culture, the number of remaining graft cells was analyzed. [Figure 20-2] Same as above. [Figure 20-3] Same as above. [Figure 20-4] Same as above. [Figure 21-1] Figure 21 shows that TCR-silencing CAR T cells are not activated in the CD3 stimulation assay. T cells were stimulated with anti-CD3 antibody (OKT3) over a concentration range of 0–17.5 ug / mL, and the expression levels of the CD137 / CD69 activation marker were evaluated after 24 hours. Non-transduced T cells and control CAR T cells (278) were shown to be activated and similarly increased by OKT3 from 0.54 ug / mL. Notably, the expression of the activation marker remained unchanged over this same concentration range for the TCR-silencing CAR T cell population, confirming the loss of TCR function during receptor silencing. UTD: Untransduced T cells; 278 scrambled CAR T cells; 296: CAR19 with TCR silencing; 294: CAR19 (B2M_T5_T5) with TCR and HLA-I silencing, 5% residual HLA-I; 293: CAR19 (B2M_T5) with TCR and HLA-I silencing, 10% residual HLA-I; 292: CAR19 (B2M_T2) with TCR and HLA-I silencing, 20% residual HLA-I. A. Expression of activation markers on all viable cells (CD8+CD4+CAR T cells). B. Expression of activation markers in the CD8+CAR T cell population. C. No cytokine-independent proliferation of multiple engineered miCAR19 T cells. Engineered T cells were cultured for 13 days with or without IL-7 and IL-15. Cell survival was observed in all cell populations in the presence of cytokines, but no proliferation was reported in cells in their absence. [Figure 21-2] Same as above. [Figure 22-1] Figure 22 demonstrates the principle of simultaneous HLA-ABC receptor silencing and co-expression of HLA-E-B2M fusion proteins from a single bimodal gene construct. A. All bimodal gene constructs were designed to silence TCR cell surface expression via the use of optimized miRNA targeting CD3z and to co-express anti-CD19 CAR (CAR19), HLA-E-B2M fusion proteins, and the RQR8 reporter gene. Construct pATN302 was designed to further silencing HLA class I expression using miRNA targeting B2M_T2, while pATN304 contained a dual miRNA targeting B2M_T5. B. HEK293 cells were genetically modified via lentiviral vector transduction and analyzed by flow cytometry to assess cell surface expression of HLA class I molecules. The histograms show the membrane expression of HLA-ABC and HLA-E proteins in genetically modified cells (based on gating of CAR19-positive cells) and unmodified cells. Cells modified with pATN306 express HLA-ABC at similar levels to unmodified cells, but with co-expression of the HLA-E-B2M fusion protein. Cells modified with constructs carrying B2M-targeting miRNAs (pATN302 and pATN304) downregulate HLA-ABC expression but also overexpress HLA-E. Approximately 60% and 90% silencing of HLA-ABC is shown for cells modified with pATN302 (carrying a B2M_T2-targeting miRNA) and pATN304 (B2M_T5 dual miRNA), respectively. [Figure 22-2] Same as above. [Figure 23-1] Figure 23 shows the final overview and details of the sequences used herein. [Figure 23-2] Same as above. [Figure 23-3] Same as above. [Figure 23-4] Same as above. [Figure 23-5] Same as above. [Figure 23-6] Same as above. [Figure 23-7] Same as above. [Figure 23-8] Same as above. [Figure 24] Figure 24 shows that various cell types, including stem cells, progenitor cells, or fully differentiated cells, can be used for the production of universal donor cells according to the present invention. Engineering these cells can be carried out in a single gene modification step when using the bimodal gene construct shown. In doing so, the universal donor cells are conferred with properties that improve their persistence when injected into a patient (host) as a cell therapy product (graft). On the one hand, the optimized miRNA gene silencing cassette is designed to functionally silencing the expression of HLA class I and HLA class II molecules. Therefore, in a particularly preferred embodiment of the present invention, both HLA-I and HLA-II are downregulated. On the other hand, the same gene construct allows for the expression of immunomodulatory receptors on the surface of universal donor cells. Therefore, in a preferred embodiment of the present invention, CD47 and / or PD-L1 are also upregulated, preferably both CD47 and PD-L1 are upregulated. In one embodiment of the present invention, where HLA-I expression is reduced by 50-90%, non-classical HLAs may not be upregulated. However, in embodiments showing a decrease of more than 90% in HLA-I expression, non-classical HLA may be upregulated, preferably functionally silenced and reduced to a negligible level, most preferably with a modified non-classical HLA sequence fused to the B2M protein, such as an HLA-E, G, or F sequence, most preferably with the gene encoding the B2M protein being codon-optimized. In this embodiment, the function of the non-classical HLA is to reduce NK-mediated cytotoxicity. In summary, the multi-engineered manipulation of universal cells of the present invention aims to limit the rejection of these graft cells by the host immune system. [Figure 25-1]Figure 25 shows an explanatory diagram and results for Example 7. A. Three constructs used: (i) a single hairpin (1hp) miRNA targeting CD3z(T2), (ii) a dual hairpin (2hp) miRNA targeting two different regions of the CD3z transcript (T1_T2), and (iii) an untargeted miRNA (with a scrambled guide chain sequence). B. A pure population of TCR-mCh+ cells was obtained. C. Amplification of T cells for production. D. Notably, despite equivalent numbers of cells being collected for each condition, the yield of TCR-silencing T cells (engineered from dual miRNA CD3z_T1_T2) was almost twice as high as that of TCR-silencing cells engineered from a single miRNA gene construct targeting CD3z_T2 (unpaired t-test, p=0.0136). Therefore, in a particularly preferred embodiment of the present invention, the two miRNA hairpins inhibit CD3z expression, each of the two hairpins targets a different region of the CD3z transcript, preferably the hairpins being CD3z_T1 and CD3z_T2, respectively. [Figure 25-2] Same as above. [Figure 25-3] Same as above. [Figure 26-1]Figure 26 shows induced pluripotent stem cells (iPSCs) transduced with the UDC constructs shown in Table 4 of Example 8. UTD: Untransduced iPSC; 1689: iPSC transduced with a construct that silences β2M_T5 and CIITA_T19, overexpressing CD47, PDL1, RQR8, and β2M-HLAE; 1690: iPSC transduced with a construct that silences β2M_T5 and CIITA_T19, overexpressing CD47, PDL1, and RQR8; 1692: iPSC transduced with a construct that silences scr48, overexpressing CD47, PDL1, RQR8, and β2M-HLAE. HLA-DPDQDR silencing cannot be evaluated in this cell type because these cells do not express these molecules. A. All UDC-transduced cells show that more than 90% of them express OCT4, and these cells exhibit an undifferentiated phenotype. B. iPSCs transduced with UDC show overexpression of CD47, PD-L1, and HLA-E. C. iPSCs transduced with UDC show overexpression of CD47, PD-L1, and HLA-E, as well as HLA-ABC silencing. D. iPSCs transduced with UDC show overexpression of CD47 and PD-L1, as well as HLA-ABC silencing. [Figure 26-2] Same as above. [Figure 26-3] Same as above. [Figure 26-4] Same as above. [Figure 27] Figure 27 shows T cells transduced with the UDC construct shown in Table 4 of Example 8. UTD: Untransduced T cell; Transduced: T cell transduced with UDC. Transduced T cells showed overexpression of CD47 and PD-L1, as well as HLA-ABC and HLA-DPDQDR silencing. [Figure 28-1]Figure 28 shows an explanatory diagram and results for Example 9. A. Overall study design. B. Main study design. C. Flow cytometry analysis to confirm engraftment of modified cells. D. Survival curve illustrating complete survival over 100 days in mice administered with TCR silencing T cells. E. Changes in relative body weight percentage show a downward trend in mice administered with control proliferating T cells, while mice administered with TCR silencing T cells continued to gain weight over the 100-day study period. [Figure 28-2] Same as above. [Figure 28-3] Same as above. [Figure 29] Figure 29 shows the explanatory diagram and results of Example 10, demonstrating sustained and "tuned" silencing of TCR / CD3 and HLA-I in an in vivo model of T cell graft mice. A. In vivo study design in NSG mice. B. Flow cytometry tracking of miCAR19 T cells from in vivo sampling. The dot plot shows the definitive identification of miCAR19 T cells based on CAR positivity and CD3 silencing. Representative histograms show HLA-I expression based on sampling from day 4 and day 32. Notably, "tuned" silencing of HLA-I was clearly detectable at varying levels on day 4 (one day after CAR T cell infusion) and persisted in all sampled tissues until the end of the study on day 32. [Modes for carrying out the invention]

[0029] Detailed explanation This invention relates to the production of allogeneic cells, allogeneic engineered donor cells, the use of miRNA gene constructs in them, and universal donor cell (UDC) therapy. In particular, this invention utilizes miRNA-based gene constructs to produce allogeneic engineered donor cells in which the expression of one or more cell surface-expressed polypeptides is regulated (e.g., downregulated and / or upregulated).

[0030] In particular, the present invention relates to engineered donor cells in which the expression of a specific combination of cell surface polypeptides is regulated. Specifically, the expression of one or more HLA polypeptides is downregulated by miRNAs that target HLA polypeptides, e.g., B2M, or transcription factors that upregulate HLA expression. While we do not wish to be bound by theory, we believe that the use of miRNAs in this manner can reduce the level of HLA expression to avoid rejection by CD8+ T cells, but also maintain the level of HLA expression to avoid rejection by NK cells. Thus, engineered donor cells according to the present invention are not optimally rejected by the host immune system and are low immunogenic. This allows engineered donor cells to persist longer and therefore be more effective in vivo.

[0031] In particular, the present invention also relates to engineered donor cells in which the expression of one or more TCR polypeptides is downregulated by a miRNA that targets a TCR complex polypeptide, such as CD3z. While we do not wish to be bound by theory, we believe that the use of miRNA in this manner can efficiently and sustainably reduce TCR expression to a negligible level (e.g., 0%). Thus, the engineered donor cells of the present invention are homogeneous and can be used as homogeneous CAR T cells.

[0032] Engineered donor cells In a first aspect, the present invention provides engineered donor cells in which rejection by the host immune system is reduced, and in which one or more cell surface-expressed polypeptides involved in immune signaling are functionally regulated.

[0033] In one embodiment, engineered donor cells are cells derived from a donor for use as therapeutic cells in cell-based therapy. In one embodiment, engineered donor cells are extracted from a donor. In one embodiment, engineered donor cells are not naturally occurring cells. In one embodiment, engineered donor cells are modified. In one embodiment, engineered donor cells contain a miRNA expression construct. In one embodiment, engineered donor cells contain a miRNA expression construct that is not endogenous to the donor cells.

[0034] In one embodiment, engineered donor cells with reduced rejection by the host immune system mean that the immune response by the host immune system to the engineered donor cells is reduced. In one embodiment, the host is human. In one embodiment, the host is a patient. In one embodiment, the engineered donor cells are homogeneous to the host. In one embodiment, the host CD8+ T cell response to the engineered donor cells is reduced. In one embodiment, the host NK response to the engineered donor cells is reduced. In one embodiment, the host CD8+ T cell and NK response to the engineered donor cells is reduced. In one embodiment, the engineered donor cells do not cause GvHD in the host. In one embodiment, the engineered donor cells have a reduced ability to cause GvHD in the host. In one embodiment, rejection by the host immune system is reduced compared to rejection by equivalent unmodified donor cells. In one embodiment, the engineered donor cells are low immunogenic to the host. In one embodiment, engineered donor cells exhibit improved persistence in the host immune system, including improved persistence compared to equivalent unmodified donor cells. In one embodiment, "equivalent unmodified donor cells" are cells derived from the same source / donor as the engineered donor cells, but not modified to contain the miRNA construct according to the present invention.

[0035] In one embodiment, the cell surface-expressed polypeptide involved in immune signaling is a polypeptide encoded by a donor cell and expressed on the cell surface of the donor cell. In one embodiment, the encoded polypeptide is targeted for cell surface expression. In particular, in any embodiment in which the polypeptide is upregulated, the upregulated polypeptide may be a polypeptide expressed on the surface of an engineered donor cell. In particular, in any embodiment in which the polypeptide is functionally downregulated, the downregulated polypeptide may be a polypeptide expressed on the surface of an equivalent unmodified donor cell.

[0036] In one embodiment, a cell surface-expressed polypeptide involved in immune signaling elicits an immune response from the host's immune system. In one embodiment, the polypeptide increases the magnitude of the immune response. In one embodiment, the immune response is directed towards engineered donor cells.

[0037] In one embodiment, functional regulation includes regulating the formation of a functional complex containing a polypeptide on the cell surface. In one embodiment, functional regulation includes directly regulating the polypeptide. In one embodiment, functional regulation includes regulating the expression of the polypeptide. In one embodiment, functional regulation includes regulating the transcription or translation of a polypeptide-encoding gene. Therefore, in one embodiment, functional regulation includes targeting a polypeptide, polypeptide-encoding mRNA, or polypeptide-encoding gene. In one embodiment, regulation is compared to equivalent donor cells that have not been modified or engineered. In one embodiment, regulation is compared to equivalent donor cells that do not contain the non-endogenous miRNA construct. In one embodiment, regulation is compared to equivalent donor cells that do not contain the miRNA construct of the present invention. In one embodiment, regulation in engineered donor cells is permanent.

[0038] In one embodiment, one or more cell surface-expressed polypeptides involved in immune signaling are downregulated. In one embodiment, polypeptides are functionally downregulated. In one embodiment, the localization of polypeptides to the cell surface is inhibited. In one embodiment, the number of polypeptides on the cell surface is reduced. In one embodiment, the formation of functional complexes on the cell surface containing one or more polypeptides is inhibited. In one embodiment, the number of functional complexes on the cell surface containing one or more polypeptides is reduced. In one embodiment, the functional complex is an HLA and / or TCR complex. In one embodiment, the formation of an HLA and / or TCR complex is inhibited.

[0039] In one embodiment, downregulation of one or more cell surface-expressed polypeptides involved in immune signaling is achieved by inhibiting the expression of a target gene. In one embodiment, downregulation of one or more cell surface-expressed polypeptides involved in immune signaling is achieved by silencing the target gene. In one embodiment, the expression of the target gene is reduced compared to equivalent unmodified donor cells. In the context of the present invention, it will be understood that all reductions in the expression or inhibition of, for example, polypeptides and genes in engineered donor cells may be considered compared to equivalent unmodified donor cells. In a typical embodiment, the expression of the target gene is reduced to 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 0%, or negligible. In a preferred embodiment, downregulation includes modifications that maintain a reduced expression level, which can improve the persistence of engineered donor cells in the host immune system, for example, by inhibiting NK cell killing in engineered donor cells. Therefore, in one embodiment, the expression of the target gene is not reduced to less than 30%, less than 20%, or less than 10%.

[0040] In one embodiment, downregulation of one or more cell surface-expressed polypeptides involved in immune signaling is achieved by miRNA inhibition of a target gene. In one embodiment, the miRNA includes a sequence that binds complementary to the mRNA transcript of the target gene, thereby inhibiting the expression of the target gene. In one embodiment, downregulation is achieved by a miRNA that inhibits the expression of a gene encoding a cell surface-expressed polypeptide. In one embodiment, downregulation is achieved by a miRNA that inhibits the expression of a transcription factor that induces the expression of a gene encoding a cell surface-expressed polypeptide.

[0041] In one embodiment, downregulation of cell surface-expressed polypeptides involved in immune signaling is achieved by a miRNA construct containing a single miRNA hairpin targeting the polypeptide-encoding gene. In one embodiment, downregulation is achieved by a miRNA construct containing two miRNA hairpins targeting the polypeptide-encoding gene. In one embodiment, downregulation is achieved by a miRNA construct containing three miRNA hairpins targeting the polypeptide-encoding gene. In embodiments where more than one miRNA hairpin targeting the same gene exists, the miRNA hairpins may target different transcript sequences contained in the mRNA transcript encoded by that gene. In one embodiment, the inhibition by miRNA is persistent in engineered donor cells.

[0042] In one embodiment, one or more downregulated surface-expressed polypeptides are selected from the group consisting of HLA class I (HLA-I) polypeptides and HLA class II (HLA-II) polypeptides. In one embodiment, one or more downregulated surface-expressed polypeptides are polypeptides necessary for functional HLA class I and / or HLA class II formation. Therefore, in one embodiment, HLA is downregulated. In one embodiment, HLA-I is downregulated. In one embodiment, HLA-II is downregulated. In one embodiment, both HLA-I and HLA-II are downregulated.

[0043] In one embodiment, downregulation of HLA class I polypeptides is achieved by miRNAs that inhibit the expression of one or more of the following: B2M (beta-2-microglobulin), NLRC5 (NLR family CARD domain-containing 5), TAP1, TAP2, TAPBP, RFX5 (regulatory factor X5), RFXANK (regulatory factor X-related ankyrin-containing protein), and / or RFXAP (regulatory factor X-related protein).

[0044] In one embodiment, downregulation of HLA class I polypeptide is achieved by a miRNA that inhibits B2M expression. In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTGACTTTCCATTCTCTGCTGG (SEQ ID NO: 1; B2M_T2). In one embodiment, the miRNA includes a sequence complementary to the sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTGACTTTCCATTCTCTGCTGG (SEQ ID NO: 1; B2M_T2). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTATGCACGCTTAACTATCTTA (SEQ ID NO: 2; B2M_T3). In one embodiment, the miRNA contains a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTATGCACGCTTAACTATCTTA (SEQ ID NO: 2; B2M_T3). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TAAACCTGAATCTTTGGAGTAC (SEQ ID NO: 3; B2M_T5). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TAAACCTGAATCTTTGGAGTAC (SEQ ID NO: 3; B2M_T5). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCAGCAGAGAATGGAAAGTCAA (SEQ ID NO: 30; B2M_T2). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCAGCAGAGAATGGAAAGTCAA (SEQ ID NO: 30; B2M_T2).In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GTACTCCAAAGATTCAGGTTTA (SEQ ID NO: 31; B2M_T5). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GTACTCCAAAGATTCAGGTTTA (SEQ ID NO: 31; B2M_T5). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CGTGCATAAGTTAACTTCCAAT (SEQ ID NO: 32; B2M_T6). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CGTGCATAAGTTAACTTCCAAT (SEQ ID NO: 32; B2M_T6). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCTGTCTCCATGTTTGATGTAT (SEQ ID NO: 33; B2M_T7). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCTGTCTCCATGTTTGATGTAT (SEQ ID NO: 33; B2M_T7). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GGTTGTGGTTAATCTGGTTTAT(SEQ ID NO: 34;B2M_T8). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GGTTGTGGTTAATCTGGTTTAT(SEQ ID NO: 34;B2M_T8).In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCTTGCTTAGAATTTGGGGGAA (SEQ ID NO: 35; B2M_T9). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCTTGCTTAGAATTTGGGGGAA (SEQ ID NO: 35; B2M_T9). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CATCCGACATTGAAGTTGACTT (SEQ ID NO: 36; B2M_T10). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CATCCGACATTGAAGTTGACTT (SEQ ID NO: 36; B2M_T10). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCAGCGTACTCCAAAGATTCAG (SEQ ID NO: 37; B2M_T11). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCAGCGTACTCCAAAGATTCAG (SEQ ID NO: 37; B2M_T11). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCCCACTGAAAAAGATGAGTAT(SEQ ID NO: 38;B2M_T12). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCCCACTGAAAAAGATGAGTAT(SEQ ID NO: 38;B2M_T12).In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CGTACTCCAAAGATTCAGGTTT (SEQ ID NO: 39; B2M_T13). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CGTACTCCAAAGATTCAGGTTT (SEQ ID NO: 39; B2M_T13). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with AAGGCATGGTTGTGGTTAATCT (SEQ ID NO: 40; B2M_T14). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with AAGGCATGGTTGTGGTTAATCT (SEQ ID NO: 40; B2M_T14). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GACTGGTCTTTCTATCTCTTGT (SEQ ID NO: 41; B2M_T15). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GACTGGTCTTTCTATCTCTTGT (SEQ ID NO: 41; B2M_T15). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GATCGAGACATGTAAGCAGCAT (SEQ ID NO: 42; B2M_T16). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GATCGAGACATGTAAGCAGCAT (SEQ ID NO: 42; B2M_T16).In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTGCTATGTGTCTGGGTTTCAT (SEQ ID NO: 43; B2M_T17). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTGCTATGTGTCTGGGTTTCAT (SEQ ID NO: 43; B2M_T17). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TAAGATAGTTAAGCGTGCATAA (SEQ ID NO: 44; B2M_T3). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TAAGATAGTTAAGCGTGCATAA (SEQ ID NO: 44; B2M_T3).

[0045] NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, and RFXAP are transcription factors that induce HLA-I expression. In one embodiment, HLA-I downregulation is achieved by miRNAs that inhibit the expression of transcription factors that induce HLA-I expression.

[0046] In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits NLRC5 expression. In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTTGCATAGAAGATAACCTTCC (SEQ ID NO: 4; NLRC_T4). In one embodiment, the miRNA includes a sequence complementary to the sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTTGCATAGAAGATAACCTTCC (SEQ ID NO: 4; NLRC_4). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTAGTCTGTGAGTAAGCAAGGC (SEQ ID NO: 5; NLRC_T9). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTAGTCTGTGAGTAAGCAAGGC (SEQ ID NO: 5; NLRC_T9). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TATAGACCAACAATCATGTATC (SEQ ID NO: 6; NLRC_T11). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TATAGACCAACAATCATGTATC (SEQ ID NO: 6; NLRC_T11). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TGAAAGCATAGCCTGTCTGCTG (SEQ ID NO: 7; NLRC_T16).In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TGAAAGCATAGCCTGTCTGCTG (SEQ ID NO: 7; NLRC_T16). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GGAAGGTTATCTTCTATGCAAA (SEQ ID NO: 45; NLRC_T4). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GGAAGGTTATCTTCTATGCAAA (SEQ ID NO: 45; NLRC_T4). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCCTTGCTTACTCACAGACTAA (SEQ ID NO: 46; NLRC_T9). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCCTTGCTTACTCACAGACTAA (SEQ ID NO: 46; NLRC_T9). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GATACATGATTGTTGGTCTATA (SEQ ID NO: 47; NLRC_T11). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GATACATGATTGTTGGTCTATA (SEQ ID NO: 47; NLRC_T11). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CAGCAGACAGGCTATGCTTTCA (SEQ ID NO: 48; NLRC_T16).In one embodiment, the miRNA contains a sequence complementary to a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CAGCAGACAGGCTATGCTTTCA (SEQ ID NO: 48; NLRC_T16).

[0047] In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits the expression of TAP1. In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits the expression of TAP2. In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits the expression of TAPBP. In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits the expression of RFX5. In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits the expression of RFXANK. In one embodiment, downregulation of HLA class I polypeptides is achieved by a miRNA that inhibits the expression of RFXAP.

[0048] In a preferred embodiment, the endogenous HLA class I of the donor cells is downregulated. Thus, in one embodiment, the engineered donor cells have reduced immunogenicity. In one embodiment, HLA class I expression is reduced to less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, 0%, or negligible levels. In one embodiment, reduced immunogenicity means that the engineered donor cells induce a reduced level of rejection by the subject or patient's immune system. In one embodiment, the engineered donor cells result in a reduced level of rejection or killing by CD8+ T cells in the subject or patient's immune system. In one embodiment, reduced immunogenicity means that the engineered donor cells are more persistent in mismatched hosts. In the context of the present invention, “killing” means killing of the engineered donor cells.

[0049] However, the inventors have also surprisingly found that miRNA can be used to downregulate HLA class I polypeptides such as B2M in donor cells while still favorably maintaining (reduced) levels of HLA class I expression. This is sometimes referred to as B2M "modulation." Thus, in one embodiment, the level of HLA class I expression maintained in engineered donor cells is sufficient to inhibit killing by NK cells. In one embodiment, the reduction in HLA class I expression in engineered donor cells is sufficient to inhibit killing by CD8+ cells, but the level of HLA class I expression maintained in engineered donor cells is still sufficient to inhibit killing by NK cells. In one embodiment, the engineered donor cells of the present invention avoid killing by both CD8+ T cells and NK cells. In one embodiment, CD8+ T cells and NK cells are from the host / patient immune system. In one embodiment, the engineered donor cells of the present invention induce reduced CD8+ T cell-mediated cytotoxicity and reduced NK cell-mediated cytotoxicity. Therefore, in one embodiment, HLA class I expression is reduced to between 50% and 95%, preferably between 50% and 90%, preferably between 70% and 95%, and most preferably between 70% and 90%. In a preferred form of such an embodiment, the engineered donor cells do not contain upregulated genetically modified non-classical HLA polypeptides.

[0050] In one embodiment, downregulation of HLA class II polypeptides is achieved by miRNAs that inhibit the expression of one or more of the following: CIITA (class II major histocompatibility complex transactivator), RFX5, RFXANK, and / or RFXAP.

[0051] CIITA, RFX5, RFXANK, and RFXAP are transcription factors that induce HLA-II expression. In one embodiment, HLA-II downregulation is achieved by miRNAs that inhibit the expression of transcription factors that induce HLA-II expression.

[0052] In one embodiment, downregulation of HLA class II polypeptide is achieved by a miRNA that inhibits CIITA expression. In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTTCCAAGGACTTCAGCTGGGG (SEQ ID NO: 8;CIITA_T13). In one embodiment, the miRNA includes a sequence complementary to the sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTTCCAAGGACTTCAGCTGGGG (SEQ ID NO: 8;CIITA_T13). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTAGTGTCCTCAGAGAACATGC (SEQ ID NO: 9; CIITA_T16). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTAGTGTCCTCAGAGAACATGC (SEQ ID NO: 9; CIITA_T16). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TATTGTACAAGCTTAGCCTGAG (SEQ ID NO: 10; CIITA_T19). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TATTGTACAAGCTTAGCCTGAG (SEQ ID NO: 10; CIITA_T19). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCCCAGCTGAAGTCCTTGGAAA (SEQ ID NO: 49; CIITA_T13).In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CCCCAGCTGAAGTCCTTGGAAA (SEQ ID NO: 49; CIITA_T13). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCATGTTCTCTGAGGACACTAA (SEQ ID NO: 50; CIITA_T16). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCATGTTCTCTGAGGACACTAA (SEQ ID NO: 50; CIITA_T16). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CTCAGGCTAAGCTTGTACAATA (SEQ ID NO: 51; CIITA_T19). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with CTCAGGCTAAGCTTGTACAATA (SEQ ID NO: 51; CIITA_T19).

[0053] In one embodiment, downregulation of HLA class II polypeptides is achieved by a miRNA that inhibits the expression of RFX5. In one embodiment, downregulation of HLA class II polypeptides is achieved by a miRNA that inhibits the expression of RFXANK. In one embodiment, downregulation of HLA class II polypeptides is achieved by a miRNA that inhibits the expression of RFXAP.

[0054] In a preferred embodiment, the endogenous HLA class II of the donor cells is downregulated. Thus, in one embodiment, the engineered donor cells have reduced immunogenicity. In one embodiment, HLA class II expression is reduced to levels of less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, 0%, or negligible. In one embodiment, reduced immunogenicity means that the engineered donor cells induce a reduced level of rejection by the subject's or patient's immune system. In one embodiment, the engineered donor cells induce a reduced level of rejection or killing by CD4+ T cells in the subject's or patient's immune system. In one embodiment, reduced immunogenicity means that the engineered donor cells are more persistent in mismatched hosts. In the context of the present invention, “killing” means killing the engineered donor cells.

[0055] In one embodiment, a reduction in HLA class II expression in engineered donor cells is sufficient to inhibit CD4+ cell-mediated killing. In one embodiment, CD4+ T cells are CD4+ T cells of the host / patient immune system. In one embodiment, the engineered donor cells of the present invention induce a reduction in CD4+ T cell-mediated cytotoxicity. In a preferred embodiment, downregulation of HLA class II expression to reduce CD4+ killing is combined with downregulation of HLA class I expression to reduce CD8+ killing. In a preferred embodiment, this is further combined with reducing HLA class I expression using miRNA while simultaneously maintaining HLA class I expression at a low level to reduce NK killing. In an alternative preferred embodiment, this is further combined with effective functional silencing of HLA class I expression, i.e., silencing to a negligible level of expression / function, and upregulation of HLA-E, F, or G polypeptides fused to non-classical HLA polypeptides, preferably B2M polypeptides according to the present invention.

[0056] In one embodiment of the engineered donor cells of the present invention, one or more downregulated surface-expressed polypeptides are T cell receptor (TCR) polypeptides. In one embodiment, one or more polypeptides form part of the TCR-CD3 complex. In one embodiment, one or more polypeptides associate with the TCR-CD3 complex. In one embodiment, one or more polypeptides are required for the formation of a functional TCR complex. Therefore, in one embodiment, the TCR-CD3 complex is downregulated.

[0057] In one embodiment, downregulation of TCR polypeptides is achieved by miRNAs that inhibit the expression of TCR(TCRα, TRAC), TCRb(TCRβ), CD3g(CD3γ), CD3d(CD3δ), CD3e(CD3ε), and / or CD3z(CD3ζ).

[0058] In the most preferred embodiment, downregulation of the TCR polypeptide is achieved by a miRNA that inhibits CD3z expression. In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTTGGAGCTAAATATAACCAAA (SEQ ID NO: 11; CD3z_T1). In one embodiment, the miRNA includes a sequence complementary to the sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to TTTGGAGCTAAATATAACCAAA (SEQ ID NO: 11; CD3z_T1). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TATCCTAGTACATTGACGGGTT (SEQ ID NO: 12; CD3z_T2). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TATCCTAGTACATTGACGGGTT (SEQ ID NO: 12; CD3z_T2). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTCCACTTCATCTTGTCCTTTC (SEQ ID NO: 13; CD3z_T3). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTCCACTTCATCTTGTCCTTTC (SEQ ID NO: 13; CD3z_T3). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTTGGTTATATTTAGCTCCAAA (SEQ ID NO: 52; CD3z_T1).In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTTGGTTATATTTAGCTCCAAA (SEQ ID NO: 52; CD3z_T1). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with AACCCGTCAATGTACTAGGATA (SEQ ID NO: 53; CD3z_T2). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with AACCCGTCAATGTACTAGGATA (SEQ ID NO: 53; CD3z_T2). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GAAAGGACAAGATGAAGTGGAA (SEQ ID NO: 54; CD3z_T3). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GAAAGGACAAGATGAAGTGGAA (SEQ ID NO: 54; CD3z_T3).

[0059] In one embodiment, downregulation of the TCR polypeptide is achieved by a miRNA that inhibits TCR expression. In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TCATGAGCAGATTAAACCCGGC (SEQ ID NO: 14;TRAC_T1). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TCATGAGCAGATTAAACCCGGC (SEQ ID NO: 14;TRAC_T1). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTAGGTTCGTATCTGTTTCAAA (SEQ ID NO: 15;TRAC_T4). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTAGGTTCGTATCTGTTTCAAA (SEQ ID NO: 15;TRAC_T4). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TCAGATTTGTTGCTCCAGGCCA (SEQ ID NO: 15;TRAC_T5). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TCAGATTTGTTGCTCCAGGCCA (SEQ ID NO: 15;TRAC_T5). In another embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCCGGGTTTAATCTGCTCATGA (SEQ ID NO: 55;TRAC_T1).In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with GCCGGGTTTAATCTGCTCATGA (SEQ ID NO: 55;TRAC_T1). In one embodiment, the miRNA targets a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTTGAAACAGATACGAACCTAA (SEQ ID NO: 56;TRAC_T4). In one embodiment, the miRNA contains a sequence complementary to a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TTTGAAACAGATACGAACCTAA (SEQ ID NO: 56;TRAC_T4). In one embodiment, the miRNA targets a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TGGCCTGGAGCAACAAATCTGA (SEQ ID NO: 57;TRAC_T5). In one embodiment, the miRNA includes a sequence complementary to the sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with TGGCCTGGAGCAACAAATCTGA (SEQ ID NO: 57;TRAC_T5).

[0060] In one embodiment, downregulation of the TCR polypeptide is achieved by a miRNA that inhibits the expression of TCRb. In one embodiment, downregulation of the TCR polypeptide is achieved by a miRNA that inhibits the expression of CD3g. In one embodiment, downregulation of the TCR polypeptide is achieved by a miRNA that inhibits the expression of CD3d. In one embodiment, downregulation of the TCR polypeptide is achieved by a miRNA that inhibits the expression of CD3e.

[0061] In a preferred embodiment, the endogenous TCR of the engineered donor cells is downregulated. In one embodiment, these cells are T cells. In one embodiment, these cells are CAR T cells. Thus, in one embodiment, the engineered donor cells are allogeneic, for example, allogeneic CAR T cells. In one embodiment, TCR expression is reduced to levels of 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, 0%, or negligible. In one embodiment, the endogenous TCR of the engineered donor cells is not functionally expressed. In one embodiment, when engineered donor cells are cultured with mismatched peripheral blood mononuclear cells (PBMCs), they induce a reduced level of alloreactivity in the mixed lymphocyte reaction. In one embodiment, mismatch means that the PBMCs originate from a different host than the engineered donor cells. In one embodiment, mismatch means that the PBMCs are allogeneic to the engineered donor cells. In one embodiment, when engineered donor cells are cultured with mismatched PBMCs, they induce reduced levels of CD137 expression in CD8+ CAR T cells. In one embodiment, the level of CD137 expression is reduced to as low as 40%, 30%, 20%, 10%, 5%, 0%, or negligible levels. In one embodiment, engineered donor cells are non-alloreactive. In one embodiment, the reduction is a reduction in the mixed lymphocyte response induced when equivalent unmodified donor cells are cultured with mismatched PBMCs. In one embodiment, engineered donor cells are suitable for allogeneic administration. In one embodiment, engineered donor cells are suitable for use in allogeneic CAR T cell therapy.

[0062] In a particularly preferred embodiment of the engineered donor cells of the present invention, classical HLA polypeptides and TCR polypeptides are downregulated. In this preferred embodiment, the HLA polypeptides are endogenous HLA class I and / or II polypeptides. Thus, in one embodiment, the resulting engineered donor cells have reduced immunogenicity as defined above and are suitable for allogeneic administration as defined above.

[0063] In one embodiment of the engineered donor cells of the present invention, one or more downregulated surface-expressed polypeptides are CD58 polypeptides. In one embodiment, downregulation of CD58 polypeptide is achieved by miRNAs that target CD58 expression. In one embodiment, downregulation of CD58 polypeptide is achieved by miRNAs that inhibit CD58 expression. In one embodiment, CD58 is downregulated to reduce bystander T cell activation. In one embodiment, CD58 is downregulated to limit bystander T cell co-activation. In one embodiment, CD58 is downregulated to reduce rejection by host CD4+ and CD8+ T cells.

[0064] In any embodiment of the present invention, in which the engineered donor cells include one or more miRNA expression constructs targeting the B2M, CIITA, NLRC5, CD3z, and TRAC genes, the transcripts of each of these genes targeted by the miRNA expression constructs may be any of the transcripts defined in Table 1 below. [Table 1-1] [Table 1-2]

[0065] In Table 1, the first column indicates the target protein / gene, and the second and third columns indicate transcripts of that gene that should preferably be targeted by any miRNA expression construct of the present invention that targets the expression of the gene shown in the first column. The second column provides transcripts by referencing the NCBI database, and the third column defines transcripts by referencing the ENSEMBL database. These database references correspond to the published main versions of the databases that were available online as of May 3, 2023. Thus, for example, for any miRNA expression construct of the present invention that includes a CD3z-targeting miRNA hairpin, it is understood that the CD3z-targeting miRNA hairpin may preferably target any of the NM_198053 transcript, NM_001378515 transcript, NM_001378516 transcript, ENST00000362089 transcript, and ENST00000392122 transcript. Therefore, a hairpin targeting CD3z preferably targets a sequence contained in one of the listed transcripts. This applies to all genes and associated transcripts listed in Table 1. In one embodiment, the miRNA expression construct of the present invention, which targets the genes listed in Table 1, targets transcripts that have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the transcripts listed in Table 1. The target transcript is the transcript corresponding to the targeted gene. Preferably, in the miRNA expression construct of the present invention, this may be for all of the designated targeted genes, for example, if there are two, three, four, five, or six designated targeted genes, this may be for all of them.

[0066] In one embodiment, one or more cell surface-expressed polypeptides involved in immune signaling are upregulated. It should be understood that upregulation simply refers to increasing the expression of a polypeptide, which can be from zero expression and does not necessarily mean that the polypeptide was previously expressed. For example, upregulation of a polypeptide that is not expressed in nature, such as CAR, may involve the expression of CAR. For example, upregulation of CD47 and / or PD-L1 may involve increasing the expression of CD47 and / or PD-L1 if one or more of these polypeptides are already expressed in the donor cells. In one embodiment, upregulation involves expressing a polypeptide. In one embodiment, the polypeptide was not expressed by equivalent unmodified donor cells.

[0067] In one embodiment, upregulation is achieved by an expressed transcript. In one embodiment, the expressed transcript encodes one or more cell surface-expressed polypeptides involved in immune signaling. In one embodiment, the expressed transcript is a protein-coding sequence. In one embodiment, the expressed transcript is a nucleic acid. In one embodiment, the expressed transcript is a non-endogenous nucleic acid. In one embodiment, the expressed transcript contains RNA. In one embodiment, the expressed transcript contains mRNA encoding a polypeptide.

[0068] In one embodiment, the upregulated surface-expressed polypeptide involved in immune signaling is selected from the group consisting of non-classical HLA class I polypeptides, CD47, PD-L1, and CAR.

[0069] In one embodiment, the upregulated surface-expressed polypeptide involved in immune signaling is a non-classical HLA-I polypeptide. In one embodiment, the non-classical HLA class I polypeptide is an HLA-E, HLA-G, or HLA-F polypeptide. In one embodiment, the non-classical HLA class I polypeptide is a genetically modified HLA-E, HLA-G, or HLA-F polypeptide. In one embodiment, the genetically modified HLA-E, HLA-G, and / or HLA-F polypeptide is a B2M fusion protein. In one embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein, an HLA-G-B2M fusion protein, or an HLA-F-B2M fusion protein. In one embodiment, the B2M fusion protein comprises the non-classical HLA polypeptide of interest or a functional fragment thereof and a B2M polypeptide or a functional fragment thereof. In one embodiment, the expression of HLA-E, HLA-G, and / or HLA-F polypeptides is not inhibited by the miRNAs of the present invention that target endogenous HLA I and / or HLA II.

[0070] In one embodiment, the non-classical HLA class I molecule is an HLA-B2M fusion protein containing a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the B2M polypeptide encoded by SEQ ID NO: 27. In one embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein containing a sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the B2M polypeptide encoded by SEQ ID NO: 27. In one embodiment, the non-classical HLA class I molecule is an HLA-F-B2M fusion protein containing a B2M polypeptide encoded by SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto. In another embodiment, the non-classical HLA class I molecule is an HLA-G-B2M fusion protein containing a B2M polypeptide encoded by SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto. In these preferred embodiments, the upregulation of the non-classical HLA class I molecule is achieved by codon-optimized sequencing. In these preferred embodiments, the upregulation of non-classical HLA class I molecules is achieved by the expression of a sequence containing SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the sequence is an RNA, such as mRNA, corresponding to SEQ ID NO: 27, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to it.

[0071] In one embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein encoded by SEQ ID NO: 19, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to it. In one embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein containing the sequence of SEQ ID NO: 20, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence.

[0072] In a preferred embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein encoded by a codon-optimized nucleotide sequence. In a preferred embodiment, the non-classical HLA class I molecule is encoded by sequence number 21 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the non-classical HLA class I molecule is an HLA-E-B2M fusion protein containing the sequence of sequence number 22 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence.

[0073] In one embodiment, the upregulated surface-expressed polypeptide involved in immune signaling is CD47. In this specification, CD47 includes full-length and truncated polypeptides, such as functional fragments of CD47. In one embodiment, CD47 is upregulated to inhibit phagocytosis of engineered donor cells by macrophages. In one embodiment, the polypeptide is a functional fragment of CD47. In one embodiment, the polypeptide is a truncated CD47 polypeptide. In one embodiment, the truncated CD47 polypeptide is encoded by the sequence of SEQ ID NO: 23, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the truncated CD47 polypeptide includes the sequence of SEQ ID NO: 24, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence.

[0074] In one embodiment, the upregulated surface-expressed polypeptide involved in immune signaling is PD-L1. In this specification, PD-L1 includes full-length and truncated polypeptides, such as functional fragments of PD-L1. In one embodiment, PD-L1 is upregulated to induce anergy / exhaustion in bystander T cells. In one embodiment, the polypeptide is a functional fragment of PD-L1. In one embodiment, PD-L1 is encoded by the sequence of SEQ ID NO: 25, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the truncated PD-L1 polypeptide includes the sequence of SEQ ID NO: 26, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence.

[0075] In one embodiment, the upregulated surface-expressed polypeptide involved in immune signaling is a CAR. In one embodiment, the CAR is an anti-CD19 CAR. In one embodiment, the CAR is encoded by sequence number 17 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the CAR includes the sequence of sequence number 18 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence.

[0076] In one embodiment, surface-expressed non-classical HLA class I is upregulated and surface-expressed HLA class I is downregulated. In another embodiment, surface-expressed non-classical HLA class I is upregulated and surface-expressed classical HLA class I is downregulated. In yet another embodiment, surface-expressed non-classical HLA class I is upregulated and surface-expressed endogenous HLA class I is downregulated. In this preferred embodiment, the downregulated HLA class I is effectively silenced. Therefore, in such embodiments, the downregulated HLA class I inhibits CD8+ T cell killing, and the upregulated non-classical HLA class I inhibits NK cell killing.

[0077] In one embodiment, surface-expressed CARs are upregulated and surface-expressed TCRs are downregulated. In one embodiment, TCRs are downregulated by miRNAs that target sequences included in the endogenous TCR sequence but not in the CAR sequence. In one embodiment, TCR downregulation is achieved by miRNAs that do not target the CD3z activation domain. This is particularly preferred in any embodiment of the present invention in which the miRNA inhibits CD3z expression.

[0078] In one embodiment, the engineered donor cells of the present invention further express a safety switch gene or a suicide gene. In one embodiment, the safety switch or suicide gene facilitates the inducible depletion of the engineered donor cells. In one embodiment, depletion is induced if the engineered donor cells become tumorigenic and / or if the engineered donor cells cause an adverse event such as a cytokine storm (CRS).

[0079] In one embodiment, the suicide gene or safety switch gene is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), CD20 or truncated CD20 (tCD20), and thymidylate synthase (TYMS).

[0080] In one embodiment, the engineered donor cells of the present invention further express a selected gene. In one embodiment, the selected gene is LNGFR, truncated endothelial growth factor receptor (tEGFR), tCD19, CD20 or truncated CD20 (tCD20), tCD34, or derivatives thereof.

[0081] miRNA expression construct for generating allogeneic cells A second aspect of the present invention relates to a miRNA expression construct present in the engineered donor cells of the present invention and which can be used to produce the engineered donor cells of the present invention.

[0082] In a second aspect, the present invention provides a miRNA expression construct comprising one or more miRNA hairpins targeting B2M, NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, RFXAP, CIITA, TCRa, TCRb, CD3d, CD3g, CD3e and / or CD3z.

[0083] In one embodiment, the construct further comprises an expressed transcript. In one embodiment, the expressed transcript is a protein-coding sequence.

[0084] In one embodiment, the miRNA expression construct comprises at least a first and a second miRNA hairpin, the first and second miRNA hairpins targeting a combination of two sequences independently selected from sequences that make up at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of sequence numbers 1 to 16.

[0085] In one embodiment, the miRNA expression construct comprises at least first and second miRNA hairpins, the first and second miRNA hairpins each targeting a combination selected from: SEQ ID NOs: 1 and 2, SEQ ID NOs: 1 and 3, SEQ ID NOs: 1 and 4, SEQ ID NOs: 1 and 5, SEQ ID NOs: 1 and 6, SEQ ID NOs: 1 and 7, SEQ ID NOs: 1 and 8, SEQ ID NOs: 1 and 9, SEQ ID NOs: 1 and 10, SEQ ID NOs: 1 and 11, SEQ ID NOs: 1 and 12, SEQ ID NOs: 1 and 13, SEQ ID NOs: 1 and 14, SEQ ID NOs: 1 and 15, Column numbers 1 and 16, SEQ ID NOs 2 and 2, SEQ ID NOs 2 and 3, SEQ ID NOs 2 and 4, SEQ ID NOs 2 and 5, SEQ ID NOs 2 and 6, SEQ ID NOs 2 and 7, SEQ ID NOs 2 and 8, SEQ ID NOs 2 and 9, SEQ ID NOs 2 and 10, SEQ ID NOs 2 and 11, SEQ ID NOs 2 and 12, SEQ ID NOs 2 and 13, SEQ ID NOs 2 and 14, SEQ ID NOs 2 and 15, SEQ ID NOs 2 and 16, SEQ ID NOs 3 and 3, SEQ ID NOs 3 and 4, SEQ ID NOs 3 and 5, SEQ ID NOs 3 and 6, SEQ ID NOs 3 and 7, SEQ ID NOs 3 and 8, SEQ ID NOs 3 and 9, SEQ ID NOs 3 and 10, Column numbers 3 and 11, SEQ ID NOs 3 and 12, SEQ ID NOs 3 and 13, SEQ ID NOs 3 and 14, SEQ ID NOs 3 and 15, SEQ ID NOs 3 and 16, SEQ ID NOs 4 and 4, SEQ ID NOs 4 and 5, SEQ ID NOs 4 and 6, SEQ ID NOs 4 and 7, SEQ ID NOs 4 and 8, SEQ ID NOs 4 and 9, SEQ ID NOs 4 and 10, SEQ ID NOs 4 and 11, SEQ ID NOs 4 and 12, SEQ ID NOs 4 and 13, SEQ ID NOs 4 and 14, SEQ ID NOs 4 and 15, SEQ ID NOs 4 and 16, SEQ ID NOs 5 and 5, SEQ ID NOs 5 and 6, SEQ ID NOs 5 and 7, SEQ ID NOs 5 and 8, SEQ ID NOs 5 and 9, SEQ ID NOs. 5 and 10, SEQ ID NOs. 5 and 11, SEQ ID NOs. 5 and 12, SEQ ID NOs. 5 and 13, SEQ ID NOs. 5 and 14, SEQ ID NOs. 5 and 15, SEQ ID NOs. 5 and 16, SEQ ID NOs. 6 and 6, SEQ ID NOs. 6 and 7, SEQ ID NOs. 6 and 8, SEQ ID NOs. 6 and 9, SEQ ID NOs. 6 and 10, SEQ ID NOs. 6 and 11, SEQ ID NOs. 6 and 12, SEQ ID NOs. 6 and 13, SEQ ID NOs. 6 and 14, SEQ ID NOs. 6 and 15, SEQ ID NOs. 6 and 16, SEQ ID NOs. 7 and 7, SEQ ID NOs. 7 and 8, SEQ ID NOs. 7 and 9, SEQ ID NOs. 7 and 10, SEQ ID NOs. 7 and 11,SEQ ID NOs: 7 and 12, 7 and 13, 7 and 14, 7 and 15, 7 and 16, 8 and 8, 8 and 9, 8 and 10, 8 and 11, 8 and 12, 8 and 13, 8 and 14, 8 and 15, 8 and 16, 9 and 9, 9 and 10, 9 and 11, 9 and 12, 9 and 13, 9 and 14, 9 and 15, 9 and 16, 10 and 10, 10 and 11, 10 and 12, 10 and 13, Sequence numbers 10 and 14, 10 and 15, 10 and 16, 11 and 11, 11 and 12, 11 and 13, 11 and 14, 11 and 15, 11 and 16, 12 and 12, 12 and 13, 12 and 14, 12 and 15, 12 and 16, 13 and 13, 13 and 14, 13 and 15, 13 and 16, 14 and 14, 14 and 15, 14 and 16, 15 and 15, 15 and 16, 16 and 16.

[0086] In one embodiment, the miRNA expression construct comprises at least a first and a second miRNA hairpin, the first and second miRNA hairpins each targeting a combination selected from: SEQ ID NOs: 30 and 31, 30 and 32, 30 and 33, 30 and 34, 30 and 35, 30 and 36, 30 and 37, 30 and 38, 30 and 39, 30 and 40, 30 and 41, 30 and 42, and SEQ ID NOs: 3 0 and 43, SEQ ID NOs. 30 and 44, SEQ ID NOs. 31 and 31, SEQ ID NOs. 31 and 32, SEQ ID NOs. 31 and 33, SEQ ID NOs. 31 and 34, SEQ ID NOs. 31 and 35, SEQ ID NOs. 31 and 36, SEQ ID NOs. 31 and 37, SEQ ID NOs. 31 and 38, SEQ ID NOs. 31 and 39, SEQ ID NOs. 31 and 40, SEQ ID NOs. 31 and 41, SEQ ID NOs. 31 and 42, SEQ ID NOs. 31 and 43, SEQ ID NOs. 32 and 32, SEQ ID NOs. 32 and 33, SEQ ID NOs. 32 and 34, SEQ ID NOs. 32 and 35, SEQ ID NOs. 32 and 36, SEQ ID NOs. 32 and 37, Sequence Nos. Sequence numbers 32 and 38, Sequence numbers 32 and 39, Sequence numbers 32 and 40, Sequence numbers 32 and 41, Sequence numbers 32 and 42, Sequence numbers 32 and 43, Sequence numbers 33 and 33, Sequence numbers 33 and 34, Sequence numbers 33 and 35, Sequence numbers 33 and 36, Sequence numbers 33 and 37, Sequence numbers 33 and 38, Sequence numbers 33 and 39, Sequence numbers 33 and 40, Sequence numbers 33 and 41, Sequence numbers 33 and 42, Sequence numbers 33 and 43, Sequence numbers 34 and 34, Sequence numbers 34 and 35, Sequence numbers 34 and 36, Sequence numbers 34 and 37, Distribution Column numbers 34 and 38, sequence numbers 34 and 39, sequence numbers 34 and 40, sequence numbers 34 and 41, sequence numbers 34 and 42, sequence numbers 34 and 43, sequence numbers 35 and 35, sequence numbers 35 and 36, sequence numbers 35 and 37, sequence numbers 35 and 38, sequence numbers 35 and 39, sequence numbers 35 and 40, sequence numbers 35 and 41, sequence numbers 35 and 42, sequence numbers 35 and 43, sequence numbers 36 and 36, sequence numbers 36 and 37, sequence numbers 36 and 38, sequence numbers 36 and 39, sequence numbers 36 and 40, sequence numbers 36 and 41,Sequence IDs 36 and 42, 36 and 43, 37 and 37, 37 and 38, 37 and 39, 37 and 40, 37 and 41, 37 and 42, 37 and 43, 38 and 38, 38 and 39, 38 and 40, 38 and 41, 38 and 42, 38 and 43, 39 and 39, 39 and 40, 39 and 41, 39 and 42, 39 and 43, 40 and 40, 40 and 41, 40 and 42, 40 and 43, 41 and 41, 41 and 42, 41 and 43, 42 and 42, 42 and 43, and 43 and 43.

[0087] In one embodiment, the miRNA expression construct comprises at least a first and a second miRNA hairpin, the first and second miRNA hairpins each targeting a combination selected from: SEQ ID NOs: 30 and 44, SEQ ID NOs: 30 and 45, SEQ ID NOs: 30 and 45, SEQ ID NOs: 30 and 46, SEQ ID NOs: 30 and 47, SEQ ID NOs: 30 and 48, SEQ ID NOs: 30 and 49, SEQ ID NOs: 30 and 50, SEQ ID NOs: 30 and 51, SEQ ID NOs: 30 and 52, SEQ ID NOs: 30 and 53, SEQ ID NOs: 30 and 54, SEQ ID NOs: 30 and 55, SEQ ID NOs. 30 and 56, SEQ ID NOs. 30 and 57, SEQ ID NOs. 31 and 44, SEQ ID NOs. 31 and 45, SEQ ID NOs. 31 and 46, SEQ ID NOs. 31 and 47, SEQ ID NOs. 31 and 48, SEQ ID NOs. 31 and 49, SEQ ID NOs. 31 and 50, SEQ ID NOs. 31 and 51, SEQ ID NOs. 31 and 52, SEQ ID NOs. 31 and 53, SEQ ID NOs. 31 and 54, SEQ ID NOs. 31 and 55, SEQ ID NOs. 31 and 56, SEQ ID NOs. 31 and 57, SEQ ID NOs. 44 and 44, SEQ ID NOs. 44 and 45, SEQ ID NOs. 44 and 46, SEQ ID NOs. 44 and 47, SEQ ID NOs. 44 and 48, SEQ ID NOs. 44 and 49, SEQ ID NOs. 44 and 50, SEQ ID NOs. 44 and 51, SEQ ID NOs. 44 and 52, SEQ ID NOs. 44 and 53, SEQ ID NOs. 44 and 54, SEQ ID NOs. 44 and 55, SEQ ID NOs. 44 and 56, SEQ ID NOs. 44 and 57, SEQ ID NOs. 45 and 45, SEQ ID NOs. 45 and 46, SEQ ID NOs. 45 and 47, SEQ ID NOs. 45 and 48, SEQ ID NOs. 45 and 49, SEQ ID NOs. 45 and 50, SEQ ID NOs. 45 and 51, SEQ ID NOs. 45 and 52, SEQ ID NOs. 45 and 53, SEQ ID NOs. 45 and 54, SEQ ID NOs. 45 and 55, Array Numbers 45 and 56, Sequence IDs 45 and 57, Sequence IDs 46 and 46, Sequence IDs 46 and 47, Sequence IDs 46 and 48, Sequence IDs 46 and 49, Sequence IDs 46 and 50, Sequence IDs 46 and 51, Sequence IDs 46 and 52, Sequence IDs 46 and 53, Sequence IDs 46 and 54, Sequence IDs 46 and 55, Sequence IDs 46 and 56, Sequence IDs 46 and 57, Sequence IDs 47 and 47, Sequence IDs 47 and 48, Sequence IDs 47 and 49, Sequence IDs 47 and 50, Sequence IDs 47 and 51, Sequence IDs 47 and 52, Sequence IDs 47 and 53,Sequence IDs 47 and 54, 47 and 55, 47 and 56, 47 and 57, 48 and 48, 48 and 49, 48 and 50, 48 and 51, 48 and 52, 48 and 53, 48 and 54, 48 and 55, 48 and 56, 48 and 57, 49 and 49, 49 and 50, 49 and 51, 49 and 52, 49 and 53, 49 and 54, 49 and 55, 49 and 56, 49 and 57, 50 and 50, 50 and 51, 50 and 52, 50 and 53, 50 and 54, 50 and 55, 50 and Sequence IDs 56, 50 and 57, 51 and 51, 51 and 52, 51 and 53, 51 and 54, 51 and 55, 51 and 56, 51 and 57, 52 and 52, 52 and 53, 52 and 54, 52 and 55, 52 and 56, 52 and 57, 53 and 53, 53 and 54, 53 and 55, 53 and 56, 53 and 57, 54 and 54, 54 and 55, 54 and 56, 54 and 57, 55 and 55, 55 and 56, 55 and 57, 56 and 56, 56 and 57, and 57 and 57.

[0088] The terms "first" and "second," etc., used herein should not be understood to refer to the genetic order of miRNA hairpins, but rather to define multiple distinct miRNA hairpin elements.

[0089] In one embodiment, there are two copies of the first miRNA hairpin and / or two copies of the second miRNA hairpin.

[0090] In one embodiment, there are three copies of the first miRNA hairpin and / or three copies of the second miRNA hairpin.

[0091] In one embodiment, the miRNA expression construct includes at least two different miRNA hairpins that target different regions of the same transcript.

[0092] In one embodiment, the miRNA expression construct includes at least two different miRNA hairpins that target different transcripts of the same gene.

[0093] In one embodiment, the miRNA expression construct includes at least two different miRNA hairpins that target different splice variants of the same gene.

[0094] In one embodiment, the miRNA expression construct further comprises a promoter element. In one embodiment, the promoter element is a promoter. In one embodiment, the promoter is a eukaryotic promoter. In one embodiment, the eukaryotic promoter is a Pol II or Pol III promoter. In one embodiment, the promoter is an inducible promoter, a tissue-specific promoter, a cell lineage-specific promoter, or a synthetic promoter. In one embodiment, the promoter element is selected from the promoter elements in Table 2. In one embodiment, the promoter is a UBI promoter. In one embodiment, the promoter is an EF1α promoter, a derivative of the EF1α promoter, or a short EF1 promoter.

[0095] In one embodiment, the miRNA expression construct further comprises a spacer. In one embodiment, the spacer comprises an enhancer. In one embodiment, the spacer is an enhancer. In one embodiment, the spacer is at least 50 nucleotides long. In one embodiment, the spacer is 50 to 1,000 nucleotides long. In one embodiment, the spacer is between 50 and 900 nucleotides, between 50 and 800 nucleotides, between 100 and 800 nucleotides, or between 50 and 800 nucleotides. In one embodiment, the spacer is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, or 200 nucleotides long. In one embodiment, the spacer is a GFP sequence. In a preferred embodiment, the spacer is a GFP1 sequence. In the most preferred embodiment, the spacer is a GFP1 sequence encoded by a sequence containing sequence number 28, or a sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto. In the preferred embodiment, the spacer is a GFP2 sequence. In the most preferred embodiment, the spacer is a GFP2 sequence encoded by a sequence containing sequence number 29, or a sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto.

[0096] In one embodiment, the spacer is positioned between the promoter and the miRNA hairpin. In one embodiment, the spacer is heterogeneous with respect to the promoter element. In one embodiment, the spacer includes an encoded open reading frame.

[0097] In one embodiment, at least two miRNA hairpins are separated by an intervening sequence.

[0098] In one embodiment, the expressed transcript is at least one gene selected from the group consisting of non-classical HLA class I, chimeric antigen receptor, CD47, and PD-L1.

[0099] In one embodiment, the expressed transcript contains a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NOs: 17, 19, or 21. In another embodiment, the expressed transcript encodes a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NOs: 18, 20, or 22.

[0100] In one embodiment, the expressed transcript encodes any non-classical HLA as defined with respect to upregulated non-classical HLA contained in the engineered donor cells of the present invention.

[0101] In one embodiment, the miRNA expression construct includes a sequence encoding a portion for redirecting the function of immune effector cells. In one embodiment, the miRNA expression construct includes a sequence encoding an engineered T cell receptor. In one embodiment, the miRNA expression construct includes a sequence encoding a CAR. In one embodiment, the CAR is a CAR that targets HIV-infected cells or tumor cells, optionally the CAR is an anti-CD19 CAR, optionally the CAR is FMC63. In one embodiment, the chimeric antigen receptor is a bispecific chimeric antigen receptor or a bi-chimeric antigen receptor.

[0102] In one embodiment, the miRNA hairpin of the miRNA expression construct is under the control of a first promoter, and the sequence encoding the T cell receptor or chimeric antigen receptor is under the control of a second promoter, or the miRNA hairpin and the sequence encoding the T cell receptor or chimeric antigen receptor are under the control of a single promoter. In another embodiment, the miRNA hairpin is under the control of a first promoter, and the sequence encoding the chimeric antigen receptor is under the control of a second promoter. In yet another embodiment, the miRNA hairpin and the chimeric antigen receptor are under the control of the same promoter.

[0103] In one embodiment, the miRNA expression construct further comprises a T cell receptor sequence.

[0104] In one embodiment, the miRNA expression construct further comprises a select gene. In one embodiment, the select gene is LNGFR, truncated endothelial growth factor receptor (tEGFR), tCD19, CD20 or truncated CD20 (tCD20), tCD34, or derivatives thereof.

[0105] In one embodiment, the construct further comprises a sequence encoding a suicide gene or a safety switch gene. In one embodiment, the suicide gene or safety switch gene is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), CD20 or truncated CD20 (tCD20), and thymidylate synthase (TYMS).

[0106] In one embodiment, the miRNA expression construct further comprises an internal ribosome entry site (IRES). In one embodiment, the construct further comprises a peptide cleavage site. In one embodiment, the peptide cleavage site is the 2A peptide. In one embodiment, the 2A peptide is selected from the group comprising 2A, P2A, T2A, E2A, F2A, BmCPV 2A, and BmIFV 2A.

[0107] In one embodiment, the miRNA expression construct is an isolated nucleic acid.

[0108] In one embodiment, the first nucleotide in the miRNA target sequence in one or more or all of the hairpins in the miRNA expression construct is a thymidine nucleotide.

[0109] In a particularly preferred embodiment, the miRNA expression construct includes an EF1s promoter and a spacer containing an enhancer.

[0110] Specific miRNA expression constructs In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting B2M. In one embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting B2M. In one embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting B2M.

[0111] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting TRAC. In one embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting TRAC. In one embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting TRAC.

[0112] In one embodiment, the miRNA expression construct of the present invention targeting TRAC further comprises a miRNA hairpin targeting one or more other TCR complex polypeptides. In one embodiment, the miRNA expression construct of the present invention targeting TRAC further comprises one or more miRNA hairpins targeting TCRB, CD3d, CD3g, CD3e and / or CD3z. In one embodiment, the miRNA expression construct of the present invention targeting TRAC further comprises one or more miRNA hairpins targeting CD3z. In one embodiment, the miRNA expression construct of the present invention targeting TRAC further comprises a single miRNA hairpin targeting CD3z.

[0113] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting CD3z. In one embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting CD3z. In one embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting CD3z.

[0114] In one embodiment, the miRNA expression construct of the present invention comprises a first miRNA hairpin targeting a first CD3z transcript region and a second miRNA hairpin targeting a second different CD3z transcript region. In one embodiment, the miRNA expression construct of the present invention comprises no more than two miRNA hairpins targeting CD3z, a first miRNA hairpin targeting a first CD3z transcript region and a second miRNA hairpin targeting a second different CD3z transcript region. In one embodiment, a miRNA expression construct targeting one or more different CD3z transcript regions provides higher silencing than an equivalent miRNA expression construct containing miRNA hairpins targeting only the same CD3z transcript sequence, for example, two miRNA hairpins.

[0115] In one embodiment, the miRNA expression construct of the present invention comprises a single miRNA hairpin targeting CIITA. In one embodiment, the miRNA expression construct of the present invention comprises two miRNA hairpins targeting CIITA. In one embodiment, the miRNA expression construct of the present invention comprises three miRNA hairpins targeting CIITA.

[0116] In one embodiment, the miRNA expression construct of the present invention comprises a first miRNA hairpin targeting a first CD3z transcript sequence and a second miRNA hairpin targeting a second different CD3z transcript sequence. In one embodiment, the miRNA expression construct further comprises a third miRNA hairpin targeting a B2M transcript sequence. In one embodiment, the miRNA expression construct further comprises a fourth miRNA hairpin targeting the same B2M transcript sequence. In one embodiment, the miRNA expression construct further comprises a sequence encoding a CAR. In one embodiment, the CAR is an anti-CD19 CAR. In one embodiment, the CAR is encoded by sequence number 17, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with that sequence. In one embodiment, the CAR includes the sequence of SEQ ID NO: 18, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with that sequence. In one embodiment, the CAR is expressed from a PGK promoter.

[0117] In one embodiment, the miRNA expression construct of the present invention includes a first miRNA hairpin targeting CD3z_T1 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto, and a second miRNA hairpin targeting CD3z_T2 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto. In the first embodiment, the miRNA expression construct further includes a third miRNA hairpin targeting B2M_T2 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto, or a third miRNA hairpin targeting B2M_T5 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto. In a second different embodiment, the miRNA expression construct includes third and fourth miRNA hairpins, each targeting the same sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto. In one embodiment, the miRNA expression construct further includes a sequence encoding a CAR. In one embodiment, the CAR is an anti-CD19 CAR. In one embodiment, the CAR is encoded by sequence number 17 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the CAR includes the sequence of sequence number 18 or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to that sequence. In one embodiment, the CAR is expressed from a PGK promoter.

[0118] DNA, plasmids, vectors, and related cells In a third aspect, the present invention provides a DNA molecule comprising the miRNA expression construct of the present invention.

[0119] In a fourth aspect, the present invention provides a plasmid comprising the miRNA expression construct or DNA molecule of the present invention.

[0120] In a fifth aspect, the present invention provides a vector comprising a miRNA expression construct, a DNA molecule, or a plasmid.

[0121] In one embodiment, the vector is an expression vector. In one embodiment, the expression vector is an adenovirus vector, an adeno-associated virus vector, a retrovirus vector, or a lentivirus vector. In one embodiment, the expression vector of the present invention further comprises at least one drug resistance marker.

[0122] In one embodiment, the DNA, plasmid, or vector of the present invention is isolated.

[0123] In a sixth aspect, the present invention provides engineered donor cells comprising the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention.

[0124] Manufacturing method In a seventh aspect, the present invention provides a method for downregulating polypeptides in cells, comprising expressing the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention in cells.

[0125] In one embodiment, the present invention provides a miRNA expression construct that inhibits B2M expression and a method for downregulating HLA-I by expressing the miRNA expression construct in cells, where the HLA-I expression level is reduced by approximately 50% to approximately 90% (including both extremes), and the reduction in the HLA-I expression level is a) To provide one, two, or three miRNA hairpins targeting B2M in a miRNA expression construct, b) To provide B2M hairpins that target different or the same region of the B2M transcript in a miRNA expression construct, c) To provide transduction efficiency of miRNA expression constructs resulting in one, two, or three copies of the miRNA expression construct in cells. This is determined in advance.

[0126] In an eighth aspect, the present invention provides a method for preparing engineered donor cells, comprising transfecting or transducing cells with the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention.

[0127] In the ninth aspect, the present invention relates to a method for preparing engineered donor cells from a patient donor or a healthy donor, the method being (a) Taking cells from the patient, (b) Transfecting or transducing cells using the miRNA expression construct, DNA molecule, plasmid, or vector of the present invention, (c) Expressing a miRNA expression construct Includes.

[0128] In one embodiment, the engineered donor cells are T cells. In one embodiment, a miRNA expression construct, DNA molecule, plasmid, or vector downregulates TCR polypeptides and upregulates CAR polypeptides, where the engineered donor cells are CAR T cells.

[0129] In one embodiment, the chimeric antigen receptor targets HIV-infected cells or tumor cells, and the chimeric antigen receptor is optionally an anti-CD19 chimeric antigen receptor, and optionally FMC63.

[0130] In one embodiment, the above method is an in vitro or ex vivo method.

[0131] In a tenth aspect, the present invention provides engineered effector cells that can be obtained or obtained by the method of the present invention.

[0132] Specific morphology of engineered donor cells The specific morphology of the engineered donor cells of the present invention is outlined herein.

[0133] In one embodiment, the engineered donor cells are eukaryotic cells. In another embodiment, the engineered donor cells are mammalian cells.

[0134] In one embodiment, the engineered donor cells are immune effector cells. In one embodiment, the immune effector cells are selected from the group including alpha-beta T cells, gamma-delta T cells, tumor-infiltrating lymphocytes (TILs), TCR engineered T cells, CAR T cells, NK cells, NK / T cells, regulatory T cells, monocytes, and macrophages. In one embodiment, the immune effector cells are CAR T cells. In particular, in embodiments where the expression of one or more TCR polypeptides is downregulated and the expression of CARs is upregulated, the engineered donor cells are CAR T cells.

[0135] In one embodiment, the engineered donor cells are stem cells or progenitor cells.

[0136] In one embodiment, the engineered donor cells are pluripotent stem cells, such as embryonic or induced pluripotent stem cells.

[0137] In one embodiment, the engineered donor cells are pluripotent stem cells such as hematopoietic stem cells, mesenchymal stem cells, neural stem cells, or muscle stem cells (satellite cells).

[0138] In one embodiment, the stem cells are not human embryonic stem cells. In one embodiment, the stem cells can be obtained without destroying human embryonic stem cells. In one embodiment, the stem cells are not animal embryonic stem cells. In one embodiment, the stem cells can be obtained without destroying animal embryonic stem cells.

[0139] In one embodiment, engineered donor cells are differentiated cells. In one embodiment, engineered donor cells are transplanted cells. In one embodiment, engineered donor cells are for use in transplantation or cell therapy. In one embodiment, engineered donor cells are cells from transplanted tissue or organs excised from a donor. In one embodiment, engineered donor cells are cells from ex vivo tissue or organs. In one embodiment, engineered donor cells are pancreatic cells, optionally islet cells or pancreatic β-cells.

[0140] In one embodiment, the engineered donor cells are in vitro cells. In one embodiment, the engineered donor cells are ex vivo cells. In one embodiment, the engineered donor cells are isolated engineered donor cells. In one embodiment, the engineered donor cells are not found in nature. In one embodiment, the engineered donor cells contain non-endogenous miRNA. In one embodiment, the engineered donor cells contain synthetic miRNA. In one embodiment, the engineered donor cells contain miRNA produced via recombinant technology.

[0141] Methods, uses, and treatments In an eleventh aspect, the present invention provides a composition comprising the engineered donor cells of the present invention.

[0142] In a twelfth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions for therapeutic use.

[0143] In a thirteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions for use in methods of treating cancer, infectious diseases, autoimmune diseases, or genetic disorders.

[0144] In a fourteenth aspect, the present invention provides a method for treating cancer, infectious diseases, autoimmune diseases or genetic disorders, comprising administering the engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors or compositions of the present invention.

[0145] In a fifteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions for use in the manufacture of pharmaceuticals for treating cancer, infectious diseases, autoimmune diseases, or genetic disorders.

[0146] In a sixteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions for use in stem cell therapy methods.

[0147] In a 17th aspect, the present invention provides a method of stem cell therapy comprising administering the engineered donor cells, miRNA expression construct, DNA molecule, plasmid, vector, or composition of the present invention.

[0148] In the eighteenth aspect, the present invention provides engineered donor cells, miRNA expression constructs, DNA molecules, plasmids, vectors, or compositions for use in the manufacture of pharmaceuticals for stem cell therapy.

[0149] RNA inhibition Inhibitory nucleic acids can inhibit gene transcripts or interfere with the translation of gene transcripts within cells. Inhibitory nucleic acids may be 16 to 1,000 nucleotides long, and in certain embodiments, 18 to 100 nucleotides long. In certain embodiments, the inhibitory nucleic acid is an isolated nucleic acid that binds to or hybridizes with the gene of interest. Inhibitory nucleic acids are well known in the art. For example, siRNA, shRNA, and double-stranded RNA are described in U.S. Patent Nos. 6,506,559 and 6,573,099, and U.S. Patent Publications 2003 / 0051263, 2003 / 0055020, 2004 / 0265839, 2002 / 0168707, 2003 / 0159161 and 2004 / 0064842, all of which are incorporated herein by reference in their entirety.

[0150] Since the discovery of RNAi by Fire and colleagues in 1998, the biochemical mechanisms have been rapidly characterized. Double-stranded RNA (dsRNA) is cleaved by Dicer, an RNAase III family ribonuclease. This process yields miRNAs approximately 21 nucleotides long. These miRNAs are incorporated into a multiprotein RNA-induced silencing complex (RISC) induced by the target mRNA. The RISC cleaves the target mRNA in the middle of its complementary region. In mammalian cells, related miRNAs are found as short RNA fragments (approximately 22 nucleotides). These miRNAs are generated after Dicer-mediated cleavage of a longer (approximately 70 nucleotides) precursor with an incomplete hairpin RNA structure. The miRNAs are incorporated into a miRNA-protein complex (miRNP), resulting in translational repression of the target mRNA.

[0151] Several factors can be considered when designing RNAi, including the properties of the siRNA, the duration of the silencing effect, and the choice of delivery system. The miRNAs introduced into an organism to produce an RNAi effect typically contain exon sequences. Furthermore, because the RNAi process is homology-dependent, sequences are often carefully selected to maximize gene specificity and minimize the possibility of cross-interference between homologous sequences rather than gene-specific ones. In particular, miRNAs often exhibit more than 80%, 85%, 90%, 95%, 98%, or even 100% identity between the miRNA sequence and a portion of the target gene's nucleotide sequence. Sequences with less than approximately 80% identity to the target gene may be substantially less effective. Therefore, greater identity between the miRNA and the target gene being inhibited will likely result in less impact on the expression of unrelated genes.

[0152] In addition, the size of the miRNA is an important consideration. In some embodiments, the present invention relates to a miRNA molecule comprising at least about 19 to 25 nucleotides that can regulate target gene expression. In the context of the present invention, the miRNA is, in particular, less than 500, 200, 100, 50, 25, 24, 23, or 22 nucleotides in length. In one embodiment, the miRNA is about 25 to about 35 nucleotides in length or about 19 to about 25 nucleotides in length.

[0153] To improve the effectiveness of miRNA-mediated gene silencing, guidelines for selecting target sites on mRNA have been developed for optimal miRNA design (Soutschek et al., 2004; Wadhwa et al., 2004). These strategies may enable a rational approach to selecting siRNA sequences to achieve maximum gene knockdown. To facilitate the entry of miRNAs into cells and tissues, various vectors, including plasmids and viral vectors such as adenoviruses, lentiviruses, and retroviruses, are used (Wadhwa et al., 2004).

[0154] Within an inhibitory nucleic acid, the components of the nucleic acid do not need to be of the same type, nor do they need to be homogeneous throughout (for example, an inhibitory nucleic acid may include nucleotides and nucleic acids or nucleotide analogs). Typically, inhibitory nucleic acids form a double-stranded structure, and this double-stranded structure may arise from two distinct nucleic acids that are partially or completely complementary. In certain embodiments of the present invention, an inhibitory nucleic acid may consist of only a single nucleic acid (polynucleotide) or nucleic acid analog, which may form a double-stranded structure by complementing itself (for example, by forming a hairpin loop). The double-stranded structure of an inhibitory nucleic acid may contain 16 to 500 or more consecutive nucleic acid bases, encompassing the entire range between them. Inhibitory nucleic acids may include 17 to 35 consecutive nucleic acid bases, more specifically 18 to 30 consecutive nucleic acid bases, more specifically 19 to 25 consecutive nucleic acid bases, more specifically 20 to 23 consecutive nucleic acid bases, or 20 to 22 consecutive nucleic acid bases, or 21 consecutive nucleic acid bases, which hybridize with complementary nucleic acids (which may be another part of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.

[0155] miRNAs can be obtained from commercial or natural sources, or synthesized using any of several techniques well known to those skilled in the art. For example, commercially available sources of pre-designed miRNAs include Invitrogen's Stealth Select technology (Carlsbad, CA), Ambion (Austin, TX), and Qiagen (Valencia, CA). The inhibitory nucleic acids applicable to the compositions and methods of the present invention may be any nucleic acid sequence found by any source to be an effective down-regulator of the target gene.

[0156] In some embodiments, the miRNA molecule is at least 75%, 80%, 85%, or 90% homologous to at least six consecutive nucleotides of any nucleic acid sequence contained in a transcript that may include a protein-coding region and a non-coding or untranslated region, and in particular at least 95%, 99%, or 100% similar or identical, or any percentage between the aforementioned (for example, the present invention intends 75% or more, 80% or more, 85% or more, etc., and the range is intended to include all integers between them).

[0157] miRNA may also include one or more nucleotide modifications. Such modifications may include the addition of non-nucleotide material to, for example, 19-25 nucleotides of the terminal(s) or internal(s) of the RNA (at one or more nucleotides of the RNA). In certain embodiments, the RNA molecule contains a 3'-hydroxyl group. The nucleotides in the RNA molecule of the present invention may also include non-standard nucleotides, including nucleotides or deoxyribonucleotides that do not exist in nature. The double-stranded oligonucleotide may contain a modified backbone, such as a phosphorothioate, phosphorodithioate, or other modified backbone known in the art, or it may contain non-natural nucleoside bonds. Further modifications of siRNA (e.g., incorporation of 2'-O-methylribonucleotides, 2'-deoxy-2'-fluororibonucleotides, "universal base" nucleotides, 5-C-methylnucleotides, one or more phosphorothioate internucleotide bonds, and reverse deoxybasic residues) can be found in U.S. Patent Application Publication No. 2004 / 0019001 and U.S. Patent No. 6,673,611 (each of which is incorporated in whole by reference). Collectively, all such modified nucleic acids or RNAs described above are referred to as modified miRNAs.

[0158] In the most preferred embodiment, the miRNA hairpin included in the multiplexed miRNA expression construct of the present invention is constructed in accordance with International Publication No. 2019186274, which is incorporated herein by reference in its entirety, with respect to the structure and design of the miRNA described therein. Those skilled in the art will understand how to apply the principles of miRNA design in the art and this reference in order to achieve optimal results using the multiplexed miRNA expression construct of the present invention.

[0159] Vectors for cloning, gene transfer, and expression In certain embodiments, expression vectors are used to express a target nucleic acid, such as a nucleic acid that inhibits the expression of a specific gene. Expression requires that the vector be supplied with appropriate signals, including various regulatory elements such as enhancers / promoters from both viral and mammalian sources, that drive the expression of the target gene in the host cell. Elements designed to optimize RNA stability in the host cell are also defined. Conditions for the use of multiple dominant drug selection markers are provided for establishing persistent and stable cell clones that express the product, and similarly, elements that link the expression of drug selection markers to the expression of polypeptides are also provided.

[0160] Adjustment element Throughout this application, the terms “expression construct” or “expression vector” include any type of gene construct comprising nucleic acids that encode a gene product, the nucleic acid coding sequence of which part or all of the nucleic acid coding sequence can be transcribed. The transcript may, but does not have to be, translated into a protein. In certain embodiments, expression comprises both the transcription of the gene and the translation of the mRNA into a protein product. In other embodiments, expression comprises only the transcription of the nucleic acid encoding the gene of interest, i.e., as in the case of the RNA molecule of the embodiment.

[0161] In certain embodiments, the nucleic acid encoding a gene product is under the transcriptional control of a promoter. “Promoter” refers to a DNA sequence recognized by a cellular or introduced synthetic mechanism necessary to initiate the specific transcription of the gene. “Transcriptionally controlled” means that the promoter is correctly positioned and oriented relative to the nucleic acid, controlling RNA polymerase initiation and gene expression.

[0162] The term promoter is used here to refer to a group of transcriptional regulatory modules concentrated around the start site of eukaryotic RNA polymerase (Pol) I, II, or III. Much of the thinking about how promoters are organized comes from the analysis of several viral Pol II promoters, including those for HSV thymidine kinase (tk) and the SV40 early transcription unit. These studies, enhanced by more recent research, show that promoters consist of distinct functional modules, each consisting of approximately 7–20 bp of DNA and containing one or more recognition sites for transcriptional activators or repressor proteins. At least one module in each promoter functions to position the start site for RNA synthesis. The best-known example of this is the TATA box, but in some promoters that lack a TATA box, such as the promoter of the mammalian terminal deoxynucleotidyltransferase gene and the promoter of the SV40 late gene, a distinct element covering the start site itself helps to fix the start location.

[0163] Further promoter elements regulate the frequency of transcription initiation. Typically, these are located 30–110 bp upstream of the initiation site, although some promoters have recently been shown to contain functional elements downstream of the initiation site as well. The spacing between promoter elements is often flexible, resulting in conserved promoter function if elements invert or move relative to each other. In the tk promoter, the spacing between promoter elements can be widened to 50 bp before activity begins to decline. Depending on the promoter, individual elements appear to function cooperatively or independently to activate transcription.

[0164] In some embodiments, the promoter includes an elongation factor 1 short (EF1s) promoter. In other embodiments, high levels of expression of the desired coding sequence can be obtained using a human cytomegalovirus (CMV) immediate early gene promoter, an SV40 early promoter, a Roussarcoma virus long-terminal repeat sequence, a rat insulin promoter, and a glyceraldehyde-3-phosphate dehydrogenase promoter. The use of other viral or mammalian cell or bacterial phage promoters known in the art to achieve expression of the desired coding sequence is also conceivable, as long as the expression level is sufficient for the given purpose.

[0165] By using promoters with known properties, the level and pattern of expression of the target protein after transfection or transformation can be optimized. Furthermore, the selection of promoters regulated in response to specific physiological signals can enable inducible expression of gene products. Tables 2 and 3 enumerate some regulatory elements that may be used to regulate the expression of the target gene in the context of the present invention. This list is not intended to cover all possible elements involved in promoting gene expression, but is merely illustrative. In some embodiments, the promoters for use according to these embodiments are non-tissue-specific promoters, such as constitutive promoters.

[0166] Enhancers are genetic elements that increase transcription from promoters located at distant positions on the same DNA molecule. Enhancers are organized in a manner very similar to promoters; that is, they consist of many individual elements, each binding to one or more transcription proteins.

[0167] The fundamental difference between enhancers and promoters lies in their operational nature. The enhancer region, as a whole, must be able to stimulate transcription at a distance. This does not necessarily apply to the promoter region or its constituent elements. On the other hand, a promoter must have one or more elements that direct the initiation of RNA synthesis at a specific site and orientation, whereas enhancers lack this specificity. Promoters and enhancers often overlap and are contiguous, and in many cases appear to have very similar modular structures.

[0168] The following is a list of viral promoters, cellular promoters / enhancers, and inducible promoters / enhancers that can be used in combination with nucleic acids encoding the gene or miRNA of interest in expression constructs (Tables 2 and 3). Furthermore, any combination of promoters / enhancers (according to the Eukaryotic Promoter Database EPDB) can be used to drive the expression of the gene or miRNA of interest. Truncate promoters can also be used to drive expression. Eukaryotic cells can support cytoplasmic transcription from specific bacterial promoters if the appropriate bacterial polymerase is provided as part of a delivery complex or as an additional gene expression construct. [Table 2-1] [Table 2-2] [Table 2-3] [Table 3-1] [Table 3-2]

[0169] When any cDNA insert is used, it typically includes a polyadenylation signal to result in appropriate polyadenylation of the gene transcript. The nature of the polyadenylation signal is not considered important for the successful implementation of the invention, and any such sequence, e.g., human growth hormone and SV40 polyadenylation signals, may be used. However, in some embodiments, the polyadenylation signal sequence is not included in the vector of the embodiment. For example, by incorporating such a signal sequence into a lentiviral vector (before the 3'LTR), the resulting lentiviral titer can be reduced.

[0170] Spacer sequences can be included in nucleic acid constructs. The presence of spacers is thought to enhance the knockdown efficiency of miRNAs (Stegmeier et al., 2005). Spacers can be any nucleotide sequence. In some embodiments, the spacer is GFP.

[0171] Terminators are also intended as elements of the expression cassette. These elements can enhance the message level and minimize reading from the cassette to other sequences.

[0172] Selectable Markers In certain embodiments of the present invention, cells comprise the nucleic acid construct of the present invention, and the cells can be identified in vitro, ex vivo, or in vivo by including a marker in the expression construct. Such markers would confer a identifiable change to the cells, enabling easy identification of cells containing the expression construct. Typically, including drug selection markers is helpful in cloning and transformant selection, and useful selectable markers include, for example, genes conferring resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeosin, and histidinol. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) can be used. Immunological markers can also be used. The selectable marker used is not considered critical as long as it can be expressed concurrently with the nucleic acid encoding the gene product. Further examples of selectable markers are well known to those skilled in the art. In one embodiment, the selectable marker is RQR8, tEGFR, or TCD20.

[0173] Delivery of nucleic acid molecules and expression vectors In certain embodiments, the vectors for delivering nucleic acids of the embodiments can be constructed to express these factors within cells. In certain embodiments, the following systems and methods may be used for delivering nucleic acids to a desired cell type.

[0174] Homologous recombination In certain embodiments of the embodiment, the vector encoding the nucleic acid molecule of the embodiment may be introduced into cells in a specific manner, for example, via homologous recombination. Current approaches to gene expression in stem cells involve the use of viral vectors (e.g., lentiviral vectors and gamma-retroviral vectors) or transgenes that are randomly incorporated into the genome. Some of these approaches, particularly the use of gamma-retroviral vectors, have been compromised, partly due to the random incorporation of the vector, which can activate or suppress endogenous gene expression, and / or silencing of transgene expression. The problems associated with random incorporation can be partially overcome by homologous recombination to a specific locus in the target genome.

[0175] Homologous recombination (HR), also known as general recombination, is a type of genetic modification used in all forms of life in which nucleotide sequences are exchanged between two similar or identical DNA strands. This technique has been the standard method for genome manipulation in mammalian cells since the mid-1980s. The process involves several steps of physical disruption and eventual recombination of DNA. It is most widely used in nature to repair potentially lethal double-strand breaks in DNA. Furthermore, homologous recombination generates new combinations of DNA sequences during meiosis, the process by which eukaryotes produce germ cells such as sperm and eggs. These new combinations of DNA represent genetic variation in offspring, allowing populations to evolutionarily adapt to environmental conditions that change over time. Homologous recombination is also used in horizontal gene transfer to exchange genetic material between different bacterial and viral strains as well as species. Homologous recombination is also used in molecular biology as a technique to introduce genetic alterations into target organisms.

[0176] Homologous recombination can be used as a targeted genome modification. The efficiency of standard HR in mammalian cells is only 10 times that of the treated cells. -6 ~10 -9(Capecchi, 1990). The use of meganucleases, or homing endonucleases such as I-SceI, has been used to enhance the efficiency of HR. Both natural meganucleases and engineered meganucleases with modified target specificity have been utilized to enhance HR efficiency (Pingoud and Silva, 2007; Chevalier et al., 2002). Another pathway to enhance HR efficiency is the engineering of chimeric endonucleases with programmable DNA specificity domains (Silva et al., 2011). Zinc finger nucleases (ZFNs) are an example of such chimeric molecules in which a zinc finger DNA-binding domain is fused with the catalytic domain of an IIS-type restriction endonuclease such as FokI (as outlined in Durai et al., 2005, patent specification PCT / US2004 / 030606). Another class of such specific molecules includes transcription activator-like effector (TALE) DNA-binding domains fused to the catalytic domain of IIS-type restriction endonucleases such as FokI (Miller et al., 2011:PCT / IB2010 / 000154).

[0177] Nucleic acid delivery system Those skilled in the art will be well prepared to construct vectors using standard recombinant techniques (see, for example, Sambrook et al., 2001 and Ausubel et al., 1996, both incorporated herein by reference). Examples of vectors include, but are not limited to, plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses) and artificial chromosomes (e.g., YAC), retroviral vectors (e.g., derived from Moloney's mouse leukemia virus vector (MoMLV), MSCV, SFFV, MPSV, SNV, etc.), lentiviral vectors (e.g., derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.), adenovirus (Ad) vectors including replication-eligible, replication-deficient, and gutless types, adeno-associated virus (AAV) vectors, Simian virus 40 (SV-40) vectors, bovine papillomavirus vectors, Epstein-Barr virus, herpesvirus vectors, vaccinia virus vectors, Harvey mouse sarcoma virus vectors, mouse mammary tumor virus vectors, and Rous sarcoma virus vectors.

[0178] Episomal Vectors The use of plasmid or liposome-based extrachromosomal (i.e., episomal) vectors may also be provided in certain aspects of the present invention, for example, for somatic cell reprogramming. Such episomal vectors may include, for example, oriP-based vectors and / or vectors encoding derivatives of the EBV-protein EBNA-1. These vectors may allow large fragments of DNA to be introduced into cells, maintained extrachromosomally, replicated once per cell cycle, efficiently distributed to daughter cells, and substantially avoid inducing an immune response.

[0179] In particular, EBNA-1, the only viral protein required for replication of oriP-based expression vectors, has developed an efficient mechanism to bypass the processing required for its antigen presentation on MHC class I molecules, thus avoiding the induction of a cellular immune response (Levitskaya et al., 1997). Furthermore, EBNA-1 acts in trans to enhance the expression of cloning genes, and can induce up to 100-fold cloning gene expression in some cell lines (Langle-Rouault et al., 1998; Evans et al., 1997). Finally, the production of such oriP-based expression vectors is inexpensive.

[0180] Other extrachromosomal vectors include other lymphocytropic herpesvirus-based vectors. Lymphotropic herpesviruses are herpesviruses that replicate in lymphoblasts (e.g., human B lymphoblasts) and become plasmids as part of their natural life cycle. Herpes simplex virus (HSV) is not a "lymphotropic" herpesvirus. Exemplary lymphocytropic herpesviruses include, but are not limited to, EBV, Kaposi's sarcoma herpesvirus (KSHV), herpesvirus thymiri (HS), and Marek's disease virus (MDV). Other sources of episome-based vectors such as yeast ARS, adenovirus, SV40, or BPV are also considered.

[0181] Those skilled in the art will be well prepared to construct vectors using standard recombinant techniques (see, for example, Maniatis et al., 1988 and Ausubel et al., 1994, both of which are incorporated herein by reference).

[0182] Vectors may also contain other components or functionalities that further modulate gene delivery and / or gene expression, or otherwise provide beneficial properties to target cells. Such other components include, for example, components that affect binding to or targeting of cells (including components that mediate cell-type binding or tissue-specific binding), components that affect the uptake of vector nucleic acids by cells, components that affect the localization of polynucleotides within cells after uptake (such as agents that mediate nuclear localization), and components that affect the expression of polynucleotides.

[0183] Such components may also include markers, such as detectable and / or selectable markers, which can be used to detect or select cells that have taken up and expressed nucleic acids delivered by the vector. Such components may be provided as intrinsic features of the vector (such as the use of a specific viral vector having a component or functionality that mediates binding and uptake), or the vector may be modified to provide such functionality. A wide variety of such vectors are known in the art and are generally available. If the vector is maintained within a host cell, the vector may be able to be stably replicated by the cell during mitosis as an autonomous structure, be incorporated into the genome of the host cell, or be maintained within the nucleus or cytoplasm of the host cell.

[0184] Transposon-based system According to certain embodiments, nucleic acid introduction may be carried out using a transposon-transposase system. The transposon-transposase system used may be the well-known Sleeping Beauty, Frog Prince transposon-transposase system (see, for example, European Patent No. 1507865 for a description of the latter), or the TTAA-specific transposon piggyBack system.

[0185] Transposons are sequences of DNA that can move to different locations within the genome of a single cell, a process called transposition. In this process, they can induce mutations and alter the amount of DNA in the genome. Transposons, formerly known as jumping genes, are an example of mobile genetic elements.

[0186] Various types of mobile genetic elements exist, and they can be grouped based on their transposition mechanisms. Class I mobile genetic elements, or retrotransposons, copy themselves by first transcribing into RNA, then reverse transcribing into DNA by reverse transcriptase, and then inserting into another location in the genome. Class II mobile genetic elements move directly from one location to another using transposases, essentially "cutting and pasting" them within the genome.

[0187] Viral vector In the construction of recombinant viral vectors, non-essential genes are typically replaced with genes or coding sequences of heterologous (or non-native) proteins or nucleic acids. Viral vectors are a type of expression construct that utilizes viral sequences to introduce nucleic acids and, in some cases, proteins into cells. The ability of certain viruses to infect or enter cells via pH-dependent or pH-independent mechanisms, integrate their gene cargo into the host cell genome, and stably and efficiently express viral genes has made them attractive candidates for the transfer of foreign nucleic acids into cells (e.g., mammalian cells). Non-limiting examples of viral vectors that may be used to deliver nucleic acids according to specific embodiments of the present invention are described below.

[0188] Retroviruses are promising as gene delivery vectors due to their ability to integrate their genes into the host genome, deliver large amounts of foreign genetic material, infect a wide range of species and cell types, and package into specific cell lines (Miller, 1992). To construct retroviral vectors, replication-deficient viruses are created by inserting nucleic acids into the viral genome in place of specific viral sequences. To create virions, a packaging cell line is constructed that contains the gag, pol, and env genes but does not contain the LTR and packaging components (Mann et al., 1983). When a recombinant plasmid containing cDNA is introduced into a specific cell line (e.g., by calcium phosphate precipitation) along with the retroviral LTR and packaging sequence, the packaging sequence allows the RNA transcript of the recombinant plasmid (i.e., the vector genome) to be packaged into viral particles, which are then secreted into the culture medium (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The medium containing the recombinant retrovirus is then collected, concentrated as needed, and used for gene transfer. Depending on the directionality of the envelope protein used to cover the vector particle surface, retroviral vectors can infect a variety of cell types. However, integration and stable expression require host cell division (Paskind et al., 1975).

[0189] Lentiviruses are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural functions. Lentiviral vectors are well known in the art (e.g., Naldini et al., 1996; Zufferey et al., 1997; Blomer et al., 1997; Giry-Laterriere et al., 2011; U.S. Patent Nos. 6,013,516 and 5,994,136).

[0190] Recombinant lentiviral vectors can infect non-dividing cells and can be used for both in vivo and ex vivo gene transfer and nucleic acid sequence expression. For example, a recombinant lentivirus that can infect non-dividing cells is transfected into a suitable host cell with two or more vectors responsible for packaging functions, namely gag, pol, and env, as well as rev and tat, as described in U.S. Patent No. 5,994,136, incorporated herein by reference.

[0191] nucleic acid delivery The introduction of nucleic acids such as DNA or RNA into cells programmed in the present invention may be carried out using any suitable method for nucleic acid delivery for cell transformation, as described herein or as known to those skilled in the art. Such methods include, but are not limited to, direct delivery of DNA, including, for example, by ex vivotransfection (Wilson et al., 1989; Nabel et al., 1989), by injection (U.S. Patents No. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859 (all incorporated herein by reference)), and by microinjection (Harland and Weintraub, 1985; U.S. Patent No. 5,789,215 (incorporated herein by reference)); by electroporation (U.S. Patent No. 5,384,253 (incorporated herein by reference); Tur-Kaspa et al., 1986; Potter et al., 1984); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonication (Fechheimer et al., 1987); by liposome-mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); and by receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988); by microprojectile bombardment (PCT applications WO94 / 09699 and 95 / 06128; U.S. Patents 5,610,042, 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880 (all incorporated herein by reference)); by stirring with silicon carbide fibers (Kaeppler et al., 1990;U.S. Patents No. 5,302,523 and No. 5,464,765 (both incorporated herein by reference); transformation by Agrobacterium (U.S. Patents No. 5,591,616 and No. 5,563,055 (both incorporated herein by reference)); transformation by desiccation / inhibition-mediated DNA incorporation (Potrykus et al., 1985); and any combination of such methods. By the application of such techniques, one or more organelles, one or more cells, one or more tissues, or one or more organisms can be transformed stably or transiently.

[0192] Liposome-mediated transfection In certain embodiments of the present invention, nucleic acids can be captured in lipid complexes, such as liposomes. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. They form spontaneously when phospholipids are suspended in an excess aqueous solution. The lipid components undergo self-rearrangement before the formation of a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Nucleic acids complexed with lipofectamine (Gibco BRL) or Superfect (Qiagen) are also envisioned. The amount of liposomes used may vary depending on the properties of the liposomes and the cells used; for example, about 5 to about 20 μg of vector DNA per 1 million to 10 million cells may be considered. Liposome-mediated nucleic acid delivery and in vitro foreign DNA expression have been highly successful (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987). The feasibility of liposome-mediated delivery and foreign DNA expression in cultured chicken embryos, HeLa, and liver cancer cells has also been demonstrated (Wong et al., 1980).

[0193] In certain embodiments of the present invention, liposomes can be complexed with hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposomal-encapsulated DNA (Kaneda et al., 1989). In other embodiments, liposomes can be complexed with nuclear nonhistone chromosome protein (HMG-1) (Kato et al., 1991) or used in combination with it. In further embodiments, liposomes may be complexed with both HVJ and HMG-1, or used in combination with both HVJ and HMG-1. In other embodiments, the delivery vehicle may include a ligand and liposomes.

[0194] Electroporation In certain embodiments of the present invention, nucleic acids are introduced into organelles, cells, tissues, or organisms via electroporation. Electroporation involves exposing a suspension of cells and DNA to a high-voltage discharge. Recipient cells can be made more readily transformable by mechanical wounding. The amount of vector used may vary depending on the properties of the cells used; for example, about 5 to about 20 μg of vector DNA per 1 million to 10 million cells may be considered.

[0195] Transfection of eukaryotic cells using electroporation has been highly successful. In this way, mouse pre-B lymphocytes were transfected with the human κ immunoglobulin gene (Potter et al., 1984), and rat hepatocytes were transfected with the chloramphenicol acetyltransferase gene (Tur-Kaspa et al., 1986).

[0196] Calcium phosphate In another embodiment of the present invention, nucleic acids are introduced into cells using calcium phosphate precipitation. Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique. In this manner, mouse L(A9), mouse C127, CHO, CV-1, BHK, NIH3T3, and HeLa cells have also been transfected with neomycin marker genes (Chen and Okayama, 1987), and rat hepatocytes have been transfected with various marker genes (Rippe et al., 1990).

[0197] DEAE-Dextran In another embodiment, the nucleic acid is delivered into the cell using DEAE-dextran followed by polyethylene glycol. In this way, the reporter plasmid was introduced into mouse myeloma and erythroblastic leukemia cells (Gopal, 1985).

[0198] cell culture Generally, the cells of the present invention are cultured in a culture medium, which is a nutrient-rich buffer solution capable of sustaining cell growth.

[0199] Suitable culture media for isolating, expanding, and differentiating stem cells according to the methods described herein include, but are not limited to, high-glucose Dulbecco's modified Eagle medium (DMEM), DMEM / F-12, Liebovitz L-15, RPMI 1640, Iskov's modified Duberco medium (IMDM), and Opti-MEM SFM (Invitrogen Inc.). Chemically defined media include minimally essential media, such as Iskov's modified Dulbecco medium (IMDM) (Gibco), supplemented with human serum albumin, human Ex Cyte lipoprotein, transferrin, insulin, vitamins, essential and non-essential amino acids, sodium pyruvate, and glutamine, and mitogens are also suitable. As used herein, mitogen refers to an agonist that stimulates cell division. An agonist is a chemical substance, usually some form of protein, that causes cells to initiate cell division and induce mitosis. In one embodiment, serum-free media, such as those described in U.S. Patent No. 08 / 464,599 and International Publication No. 96 / 39487, and the “complete medium” described in U.S. Patent No. 5,486,359, are intended to be used in conjunction with the methods described herein. In some embodiments, the culture medium is supplemented with 10% fetal bovine serum (FBS), human autologous serum, human AB serum, or platelet-rich plasma supplemented with heparin (2 U / ml). Cell cultures may be maintained in a CO2 atmosphere, for example, 5% to 12%, to maintain the pH of the culture medium, incubated at 37°C in a humid atmosphere, and passaged to maintain a confluence of less than 85%.

[0200] As used herein and in the claims, “a” or “an” may mean one or more. As used herein and in the claims, when used in combination with the word “comprising,” the word “a” or “an” may mean one or more. As used herein and in the claims, “another” or “a further” may mean at least a second or more.

[0201] As used herein and in the claims, the term “about” is used to indicate that a value includes variations in errors inherent to the apparatus, variations resulting from the method employed to determine the value, or variations present among the subjects of study.

[0202] As used herein, “essentially free” with respect to a particular component is used herein to mean that none of the particular component is intentionally included in the composition and / or is present only as a contaminant or in trace amounts. The total amount of a particular component resulting from unintentional contamination of the composition is preferably less than 0.01%. Compositions in which the amount of a particular component cannot be detected by standard analytical methods are most preferred.

[0203] Other objects, features, and advantages of the present invention will become apparent from the examples. However, since the present invention is defined by the appended claims, please understand that the detailed description and specific examples, while illustrating specific embodiments of the present invention, are given merely as examples and not as limiting to the present invention. [Examples]

[0204] Example 1: Method In short, our approach to developing optimal gene silencing constructs includes (i) target sequence design, (ii) molecular cloning for the production of single hairpin miRNA constructs and lentiviral vectors, and (iii) gene modification of target cells and evaluation of gene / protein silencing using appropriate readout methods. Multi-hairpin miRNA constructs can then be constructed using one or more optimal target sequences and similarly evaluated for maximum gene silencing efficiency.

[0205] Target sequence design Target sequences for incorporation into the miRNA architecture were designed using software that rationally prioritizes the selection of optimal gene silencing target sequences based on known parameters. Sequence prioritization is based on identifying conserved regions in target transcripts, scoring each target sequence individually, and mitigating the risk of potential off-target gene silencing (based on sequence identity between the target sequence and the target cell transcriptome). The notation "target_name_T#" (e.g., TRAC_T1, B2M_T5) is used to refer to target sequences within genes and associated miRNAs that target those sequences.

[0206] Molecular cloning Prioritized target sequences were synthesized within the mirGE backbone by a third-party manufacturer. Single mirGE sequences were cloned using LR Clonase II. The mirGE pENTR plasmid, the elongation factor 1 short promoter (pENTR-L4-EFs-L1R) plasmid, and the lentivector destination cassette (pCWX-R4dESTR2-PC) containing the mCherry reporter gene were cloned into a single plasmid. The success of cloning all constructs was confirmed by restriction enzyme digestion patterns and DNA sequencing.

[0207] Lentiviral vectors and titration Lentiviral vectors were produced by transfecting HEK293 T cells with an import plasmid containing a gene silencing construct, as well as lentiviral packaging (PAX2) plasmid and envelope (VSVg) plasmid. Cell culture medium was replenished after 4–6 hours and subsequently collected at 24 hours for viral particle collection. The culture medium was collected, filtered to remove cell debris, and viral particles were concentrated using PEG-It virus precipitation solution (System Biosciences) according to the manufacturer's instructions. The final aliquots of the concentrated lentiviral vector were stored at -80°C. Functional viral vector titer was assessed by transducing primary T cells at a range of dilutions and measuring the percentage of cells expressing the mCherry reporter gene.

[0208] Cells and cell lines Silencing of HLA-I, HLA-II, and TCR cell surface expression was evaluated in Jurkat cells and primary T cells prepared from anonymized buffy-coated blood units procured from the Blood Transfusion Centre at the University Hospital of Geneva, Switzerland. Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll isolation, and T cells were subsequently isolated using Miltenyi CD4 / CD8 microbeads and cryopreserved in aliquots in liquid nitrogen. HEK293 T cells were also used to test several miRNA constructs.

[0209] lentiviral vector transduction Cryopreserved T cells were thawed and cultured overnight in T cell medium (Advanced RPMI, 10% FBS), and activated the following day using CD3 / CD28 Dynabeads in a 1:1 ratio. Activated T cells were transduced 48 hours later with a lentiviral vector carrying a miRNA gene silencing construct. Transduction was performed at high density volume (2 million cells / mL), and the medium was replenished 18–24 hours and then every other day to maintain T cells at a cell density of 1 million cells / mL. For testing with HEK293 T cells, derived cells with infection multiplicity (MOI) of 0.2 and 2.0, with HLA class I silencing ranges, were used. After transduction, HEK293 T cells were maintained in appropriate medium for at least 5 days before evaluating silencing of HLA-ABC cell surface expression. For evaluation in Jurkat cells, target cells were transduced and maintained in appropriate culture medium for at least 5 days before assessing the silencing of target gene expression.

[0210] Evaluation of flow cytometry and gene silencing Flow cytometry was performed 5–7 days after transduction of T cells. Cells were harvested, washed, resuspended in PBS solution, and stained with appropriate antibodies for 20–30 minutes to assess cell surface expression. After staining, cells were washed with PBS, resuspended in FACS buffer (Ca / Mg2+ free PBS, 2 mM EDTA, 0.5% BSA), and cell surface expression was assessed by flow cytometry. Captured data were exported to FlowJo for analysis. To calculate the level of gene silencing, changes in both the percentage of cells positive for the target and the median fluorescence intensity (MFI) were assessed. Normalization included expression levels within the sample (modified cells vs. unmodified cells), and then expression levels against control transduction cells were calculated.

[0211] Mixed lymphocyte reaction Primary T cells were transduced using miRNA constructs and tested for functional silencing in mixed lymphocyte responses (MLR) with mismatched PBMCs (stimulating cells). Unmodified T cells were expected to be alloreactive to stimulating cells, while TCR-silencing T cells were not expected to be activated when co-cultured with mismatched T cells. Stimulating cells were irradiated and labeled with PKH26 before co-culture. Responder cells (TCR-silencing cells) were generated by 12 days of cell culture and IL-2 depletion, and then quenched. The cells were then co-cultured in a 1:1 ratio, and T cell activation was assessed by flow cytometry for CD137 expression in CD8+ T cells. A positive control group activated with CD3 / CD28 microbeads (1:1) was also included. Responding cells were then quenched again and similarly restimulated.

[0212] Example 2: HLA-I downregulation and B2M expression regulation by miRNA Major histocompatibility complexes (MHC), or human leukocyte antigen (HLA) class I receptors, namely HLA-A, HLA-B, and HLA-C, are expressed on the surface of all nucleated cells in the body. Along with HLA class II, they play a central role in the presentation of peptide antigens to the immune system, which are recognized by T cell receptors (TCRs) on T cells. Peptides presented by HLA class I and class II receptors are recognized by CD8+ and CD4+ T cells, respectively. β-2 microglobulin (B2M) is a common protein subunit of all HLA class I molecules.

[0213] In the context of allogeneic chimeric antigen receptor (CAR) T-cell therapy, in addition to the need to silence or knock out the TCR to prevent allogeneic reactivity of CAR T cells, it is also crucial to prevent these donor-derived CAR T cells from being rejected by the recipient's immune system. HLA class I expression is upregulated in activated CAR T cells and can lead to CD8+ T cell-mediated rejection. However, cells that do not express HLA class I can lead to NK cell-mediated rejection.

[0214] The inventors proposed a strategy using miRNAs to downregulate B2M, and therefore all HLA class I molecules. This strategy was proposed to improve the persistence of allogeneic CAR T cells by avoiding CD8+ T cell-mediated cytotoxicity. However, the inventors further, surprisingly, found that B2M expression can be "modulated" using their miRNA-based approaches, thereby maintaining beneficially low levels of HLA class I. Thus, this miRNA-based approach also improves the persistence of allogeneic CAR T cells by avoiding the possibility of NK cell-mediated cytotoxicity. Furthermore, the miRNA constructs used to silence HLA class I can also be used to generate universal donor cells from various sources, including induced pluripotent stem cells (iPSCs).

[0215] In typical gene editing approaches, HLA-I is completely deleted, and therefore donor cells are susceptible to depletion by NK cells. To prevent this, non-classical HLA-I molecules (HLA-E or HLA-G) may be added for co-expression and to improve persistence. However, the present invention's miRNA-based approach, which achieves configurable (e.g., 70-90%) silencing of HLA, actually provides sufficient or even superior persistence of allogeneic miCAR T cells without requiring co-expression of HLA-E / G.

[0216] Gene silencing in target cells Target sequences were screened based on the methodology previously described by Myburgh et al. (2014-PMID:25350582). The target sequences were related to human B2M (ENSEMBL:ENSG00000166710). From these, miRNAs named B2M_T5, B2M_T2, and B2M_T3 were obtained.

[0217] Sequences were tested based on the downregulation of HLA-ABC expression in genetically modified primary T cells. Cryopreserved T cells were thawed, activated using Thermo Fischer Scientific Dynabeads (bead-to-cell ratio 3:1), and resuspended in T cell medium. Activated T cells were transduced 24 hours later with a lentiviral vector carrying a miRNA gene silencing construct. Transduction was performed at high density volume (2 million cells / mL), and the medium was replenished 16–24 hours and then every other day to maintain T cells at a cell density of 1 million / mL. Flow cytometry was performed 5 days after T cell transduction. The results are shown in Figure 1 (downregulation of HLA-ABC expression from a range of silencing constructs) and Figure 2 (achievement of various HLA class I expressions).

[0218] To further evaluate the efficiency of B2M gene silencing, primary T cells were transduced with lentiviral vectors carrying each single hairpin miRNA construct (the data are shown in Figure 3). In these experiments, T cells from two donors were transduced. HLA class I gene silencing resulted in a 50–75% reduction in expression in the modified cells. 30–40% of all cells were transduced, and therefore the data reflect HLA class I silencing from 1–2 vector copies. Given the high efficiency of HLA class I silencing achieved, future construct development was pursued. A gating strategy for these evaluations using B2M_T5 as an example is shown in Figure 4.

[0219] Target multi-hairpin gene silencing in genetically modified cells B2M_T5 was identified as an efficient target sequence for silencing HLA class I expression, which was then incorporated into multi-hairpin miRNA constructs (1hp, 2hp and 3hp) to evaluate whether progressive improvement of HLA class I silencing could be achieved. As shown in Figure 5, an improvement in target silencing was observed when the 2hp construct was used, while beyond two hairpins, only marginal benefits exist.

[0220] In preparation for future functional studies of CAR T cell persistence, the ability to engineer HEK293 cells with various HLA class I expression using different B2M gene silencing constructs was explored. These included single and double hairpin miRNA constructs targeting either the B2M_T2 or T5 target sequences in 0.2 and 1.0 Mol lentiviral vector transduction. As shown in Figure 6, it was possible to genetically engineer HEK293 cells with HLA class I expression ranging from 50 - 95%. This demonstrates the ability to uniquely regulate the expression level of a selected target gene using this miRNA gene silencing technology.

[0221] Conclusion Efficient gene silencing of HLA class I molecules via miRNA constructs targeting B2M was determined. With single hairpin constructs and low copy number transduction, it was possible to silence HLA class I by 50 - 75%. When intending to silence HLA class I expression beyond 90%, a 2hp configuration targeting multiple transcript sequences and / or a higher transduction rate (60 - 70%) to increase the miRNA copy number can be used. This technology provides a unique solution to "tune" HLA class I silencing to an intended amount between 50% - 90%.

[0222] Example 3: TCR downregulation and TRAC / CD3z silencing by miRNA The inventors have developed a highly effective miRNA gene construct capable of highly efficient gene silencing. Using this approach, the inventors developed TCR-deficient T cells that exhibited alloreactive loss of function in both in vitro and in vivo models.

[0223] TRAC is the constant region of the T cell receptor (TCR) alpha chain (TCRa) (PubMed:24600447). The alpha-beta T cell receptor is an antigen-specific receptor, essential for the immune response, and is located on the cell surface of T lymphocytes. Together with CD3, the TCR-CD3 complex is the definitive receptor for T cells. The TCR complex is formed by the non-covalent association of eight subunits: one each of TCR, TCRb, CD3g, and CD3d, as well as two each of CD3e and CD3z. When antigen-presenting cells (APCs) activate the T cell receptor (TCR), TCR-mediated signals are transmitted across the cell membrane via the CD3 complex. This is a requirement for efficient T cell adaptive immunity against pathogens (PubMed:25493333).

[0224] The differentiation antigen group 3ζ (CD3z) or CD247 is one of the components of the CD3 complex. All CD3 chains contain an immune receptor tyrosine activation motif (ITAM) in their cytoplasmic domain. Upon TCR binding, these motifs are phosphorylated by Src family protein tyrosine kinases LCK and FYN, leading to activation of downstream signaling pathways (PubMed:2470098, PubMed:7509083). CD3z ITAM phosphorylation creates multiple docking sites for the protein kinase ZAP70, leading to ZAP70 phosphorylation and its conversion to a catalytically active enzyme (PubMed:7509083). CD3z also plays an important role in intrathymic T cell differentiation.

[0225] In the context of allogeneic CAR T cell therapy, limiting the allogeneic reactivity of donor-derived CAR T cells is advantageous due to the risk of GvHD. Allogeneic reactivity is mediated via the TCR, and therefore, gene silencing of the TCR has been considered for the provision of allogeneic CAR T cells. In this regard, we propose investigating the use of miRNA constructs against selected subunits of the TCR, including TRAC and CD3z.

[0226] TRAC silencing using miRNA Target sequences for human TRAC (ENSEMBL:ENSG00000277734) were screened, prioritizing sequences beginning with a thymidine (T) residue. From this, miRNAs for TRAC target sequences named TRAC_T1, TRAC_T4, and TRAC_T5 were obtained. To evaluate the efficiency of TRAC gene silencing, PBMCs were transduced using lentiviral vectors carrying single hairpin miRNA constructs, followed by flow cytometry analysis of TCRα / β and CD3ε expression.

[0227] As shown in Figure 7, the TRAC_T1, TRAC_T4, and TRAC_T5 target sequences all resulted in over 50% silencing of TCR expression (based on MFI readings normalized against the mCherry control). Furthermore, there was a reduction of over 70% in the percentage of cells expressing TCR. Notably, the trend in gene silencing from different TRAC targeting constructs remained consistent between both donor 1 and 2 samples, although efficiency was slightly higher in donor 2. All samples were equally transduced in the range of 55–65%, which reflects 2–3 vector copy numbers across the majority of genetically modified T cells. Gating strategies for evaluating TCR silencing are shown in Figure 8.

[0228] In conclusion, TRAC gene silencing was achieved using miRNA constructs. The three target sequences tested were shown to silence TCR expression by more than 50%, which also translated to a 70% reduction in TCR-expressing cells. Achieving more than 90% silencing of the TCR would be even more advantageous in the context of allogeneic T-cell therapy and the potential risks associated with graft-versus-host disease. This could be achieved by multiplexing miRNA hairpins against TRAC and / or other subunits of the TCR-CD3 complex. A miRNA construct against CD3z has also been developed, and TCR silencing data for it are reported below.

[0229] CD3z silencing using miRNA CAR T cells generally contain a chimeric antigen receptor designed to include a CD3z activation domain. Therefore, to prevent the miRNA construct from silencing CAR expression, we identified a CD3z target sequence outside this domain. The target sequence was based on the sequence encoding human CD247 (ENSEMBL:ENSG00000198821). In this way, three CD3z-targeting miRNAs were obtained, named CD3z_T1, CD3z_T2, and CD3z_T3.

[0230] To evaluate the efficiency of CD3z gene silencing, PBMCs were transduced with a lentiviral vector carrying a single hairpin miRNA construct, followed by flow cytometry analysis of TCRα / β and CD3ε expression. Data from experiments using PBMCs from two healthy donors are shown in Figure 9.

[0231] CD3z_T1, CD3z_T2, and CD3z_T3 all resulted in highly efficient silencing of TCR expression. The CD3z_T2 sequence appeared to be the most efficient, with silencing of over 95% of TCR expression and a similar reduction in the percentage of TCR-expressing cells. The trend in gene silencing was consistent between samples from both donor 1 and 2. Gating strategies for evaluating TCR silencing are shown in Figure 10.

[0232] Given the highly efficient TCR silencing achieved with CD3z miRNA, future construct development was pursued. As the next step, Jurkat cells were transduced to confirm the efficiency of TCR silencing. As shown in Figure 11, Jurkat cells modified with the CD3z_T2 construct at an MOI of 0.3 completely lost TCR a / b expression.

[0233] Since an efficient target for silencing TCR expression was identified, CD3z miRNA was then incorporated into multi-hairpin miRNA constructs (1hp, 2hp, and 3hp) to evaluate whether a gradual improvement in TCR silencing could be achieved. As shown in Figure 12, an increase in TCR silencing was observed when the 2hp construct was used for the same CD3z_T2 sequence.

[0234] In addition to the multiple "hairpin dose" tests of 1–3 hp of CD3z_T2 in the experiments described above, two dual hairpin constructs targeting different transcript regions were also constructed. The first construct used a combination of miRNAs targeting CD3z_T2 and CD3z_T1. A second construct targeting CD3z_T2 and TRAC_T1 was also constructed. To evaluate the efficiency of these novel constructs, primary T cells were transduced and the expression of both TCR a / b and CD3e was assessed (Figure 13). This included 1–3 hp constructs targeting CD3z_T2. Based on the histograms and median fluorescence intensity (MFI) provided in Figure 13, it is clear that the dual hairpin constructs with two different CD3z sequence targets (CD3z_T2 / T1) were the most efficient in silencing the cell surface expression of the TCR-CD3 complex. Compared to the 3hp CD3z_T2 construct, a noticeable decrease in the expression of both TCR a / b and CD3e was observed. This indicates that a miRNA construct containing two miRNA hairpins targeting different sequences on CD3z can provide a greater level of gene silencing than a construct containing two miRNA hairpins targeting only a single (same) CD3z sequence. In particular, at a higher transduction rate of 46.5% (indicated by an asterisk), more than 95% of the transduced cells were completely negative for TCR expression. The CD3z_T2 / TRAC_T1 construct also performed better than 3hp CD3z_T2 when cells were transduced at 40.1%. These data demonstrate the success of TCR silencing with a range of miRNA constructs, including complete silencing of TCR expression using CD3z_T2 / T1. Remaining cells expressing residual TCRs are removed according to TCR-targeted depletion.

[0235] Next, mixed lymphocyte reactions were performed using two miRNA constructs to evaluate whether they exhibited loss of allogeneic reactivity when co-cultured with mismatched T cells. In the first case, PBMCs were transduced with miRNA targeting CD3z_T2. Secondly, miRNA targeting TRAC_T1 was used to achieve intermediate TCR silencing. During lentivector transduction, T cells were generated with 95% and 30% TCR silencing using the aforementioned constructs (Figure 14A). After these TCR-deficient T cells were quiescent (12 days after activation), the cells were co-cultured with irradiation-stimulated T cells in a 1:1 ratio. After 24 hours of co-culture, the cells were harvested, and genetically modified CD8+ T cells (mCherry-positive) were evaluated for the expression of the CD137 activation marker. A 60% reduction in CD137 was observed in T cells transduced with the construct targeting the TRAC_T1 target sequence. This was a notable decrease for these T cells with 30% TCR silencing. Furthermore, negligible CD137 expression was observed in CD8+ T cells with 95% TCR silencing (miRNA against CD3z_T2) (Figure 14B). This confirmed that TCR-deficient T cells, including those silenced with the CD3z_T2 construct, were not alloresponsive to genetically mismatched stimulated T cells.

[0236] In conclusion, the target sequence for CD3z was identified as efficient in TCR silencing. Several differences were observed when using two and three hairpin constructs containing this same sequence. Furthermore, CD8+ T cells modified with a single hairpin miRNA construct showed negligible alloreactivity in the mixed lymphocyte response.

[0237] Results, conclusions, and in vivo studies Novel gene silencing constructs for TRAC and CD3z were developed, determined to be high-performing based on TCR silencing efficiency, and selected for in-depth characterization. The constructs were delivered to primary T cells via lentiviral vector transduction and subsequently amplified in G-Rex cell culture plates. Genetically modified T cells were purified by depletion of TCR-expressing cells and evaluated for loss of allogeneic reactivity in mixed lymphocyte reactions (MLR). In summary, the successful functional silencing of TCRs and the development of non-allogeneic reactive T cells are demonstrated.

[0238] Example 4: HLA-II Downregulation by CIITA Silencing Class II transcription activators (CIITAs) are essential transcription factors for the transcriptional activity of the human leukocyte antigen (HLA) class II promoter. CIITAs act in a coactivator manner by collecting factors that bind to the proximal HLA class II promoter and transcription mechanism via protein-protein interactions. They can also activate HLA class II transcription by modifying promoter-binding proteins. The promoter element requirements for CIITA-mediated transcription differ from those for constitutive HLA class I transcription.

[0239] CIITA is expressed in human activated T cells and regulates the expression of HLA class II molecules, thereby controlling the maintenance of response to and tolerance to foreign antigens. CIITA expression is upregulated in response to inflammatory stimuli. In vitro, T cell malignancies exhibit a CIITA-dependent HLA class II deficiency phenotype, thus preventing cell death (PMID:11207239).

[0240] In the context of engineered allogeneic cell therapies, engineered T cell therapies, and particularly allogeneic chimeric antigen receptor (CAR) T cells, HLA class II expression is upregulated in activated CAR T cells and, therefore, there is a tendency for rejection by CD4+ T cells of the host immune system. Thus, gene silencing of HLA class II is an acceptable solution for limiting this rejection. Furthermore, constructs that silence HLA-I can be used to create universal donor cell therapies from various sources including induced pluripotent stem cells (iPSCs).

[0241] Gene silencing in target cells Target sequences were identified and prioritized for screening. Target sequences for human CIITA were identified (ENSEMBL: ENSG00000179583). If necessary with the identified target sequences, the first nucleotide of the guide strand can be changed, for example, from cytidine (C) to thymidine (T) to facilitate guide strand incorporation into the RISC (RNA-induced silencing complex).

[0242] Screening experiments using target sequences designed to silence CIITA were performed on primary T cells and data regarding this are shown in FIG. 15. From this second screening, three constructs (pATN498, pATN501 and pATN504) resulted in a clear downregulation of HLA class II. In particular, pATN504 achieved consistent HLA class II silencing in the range of 65 - 75% across three donor T cell products.

[0243] Conclusion Novel miRNA gene constructs capable of silencing CIITA were screened and successfully identified. This led to a highly efficient silencing of HLA class II cell surface expression. The target sequence CIITA_T19 (in construct pATN504) functioned most efficiently and consistently across three different T cell donor products.

[0244] Example 5: Bimodal structure for simultaneous downregulation of HLA-I and TCR The inventors have developed a novel bimodal gene construct for simultaneous CAR expression and microRNA-mediated gene silencing (miCAR), which not only facilitates highly efficient multiple gene silencing but also promotes "adjustable" silencing of target genes. Using this approach, the inventors developed allogeneic CAR T cells with CAR expression and functional silencing of TCR and HLA-I. More specifically, this approach was able to completely silence TCR expression while optimizing the level of HLA-I silencing to balance with immune rejection by both CD8+ T cells and NK cells.

[0245] Loss of HLA-I expression may protect graft CAR T cells from rejection by host CD8+ T cells, but conversely, it makes the cells more susceptible to rejection by NK cells. One solution to overcome this is to further co-express NK cell inhibitors, typically non-classical HLA-I molecules, such as HLA-E, HLA-G, or HLA-F. Co-expression of CD47 has also been shown to protect against NK cell-mediated rejection. An alternative solution is to silence HLA-I expression to a degree that not only protects graft cells from host CD8+ T cells but also provides sufficient protection against host NK cells without requiring co-expression of additional receptors to avoid NK cell-mediated rejection.

[0246] method Genetic constructs were initially created to silence HLA-I at various levels, and each was cloned into a pre-optimized miCAR construct expressing miRNAs (a first miRNA hairpin targeting CD3z_T1 and a second miRNA hairpin targeting CD3z_T2) that efficiently silence anti-CD19 CAR (CAR19) and TCR expression. Schematic diagrams of some of the constructed constructs are shown in Figure 16.

[0247] Primary T cells were modified via lentiviral vector transduction, proliferated in G-Rex cell culture plates, and purified by depletion of TCR-expressing cells. In vitro characterization included FACS immunophenotyping, cytotoxicity of CD19-expressing cells, and low immunogenicity testing with mismatched T cells and NK cells in mixed lymphocyte reaction (MLR). Figure 17 shows this process and its results.

[0248] For a mixed lymphocyte reaction with mismatched CD8+ T cells and NK cells using allogeneic and hypoimmunogenic miCAR19 T cells (as shown in Figure 20F), host PBMCs were primed with mitomycin-treated graft donor cells (CAR19 T cells), and then CD8-positive T cells were isolated and labeled with CellTrace Violet (CTV) dye. The primed CD8+ T cells (effector, E) were then co-cultured with graft miCAR19 T cells (target cells, T) in a 1:1 E:T ratio. Six days after plating the co-culture, the cells were analyzed by flow cytometry. Similarly, in the case of MLR and NK cells (Figure 20G), host NK cells (effector cells, E) were co-cultured with graft miCAR19 T cells (target cells, T) in a 5:1 E:T ratio. After 48 hours, the cells were analyzed by flow cytometry and used to assess the proportion of NK cells and T cells based on CD56 and CD5 expression, respectively.

[0249] result Multiple engineered allogeneic miCAR19 T cells were successfully generated, all of which were completely silenced for the TCR, and HLA-I silencing was controlled over a range of 70–90% (Figure 17). While CAR functionality was maintained in repeated cytotoxicity assays against tumor cells, the newly developed novel miCAR19 T cells were also protected from both CD8+ T cell-mediated and NK cell-mediated cytotoxicity in MLR assays, and rejection of CD19 CAR T cells by primed CD8 T cells or NK cells also correlated with HLA-ABC levels in vitro (Figures 18, 19, and 20). Thus, an efficient approach for multiple engineering of allogeneic and hypoimmunogenic CAR T cells with functional silencing of TCR and HLA-I has been demonstrated.

[0250] Furthermore, we investigated a complementary approach to efficient HLA-I knockdown to avoid CD8+ T cell killing, combined with the expression of a non-classical HLA-B2M fusion protein to avoid NK cell killing (construct shown in Figure 22). Approximately 60–90% silencing of HLA-ABC (classical HLA-I) was achieved using a miRNA construct targeting B2M, while HLA-E expression was maintained (Figure 22).

[0251] Example 6: Further characterization of cells with simultaneous downregulation of HLA-I and TCR Allogeneic CAR T cells with functional silencing of TCR and HLA-I were further characterized, considering their responses to CD3 stimulation and IL-3 or IL-15 cytokines separately.

[0252] method The same gene constructs as in Example 5 were used to silence HLA-I at various levels, each of which was cloned into a pre-optimized miCAR construct expressing miRNAs (a first miRNA hairpin targeting CD3z_T1 and a second miRNA hairpin targeting CD3z_T2) that efficiently silence anti-CD19 CAR (CAR19) and TCR expression.

[0253] CD3 Stimulation Assay: Engineered CAR T cells were stimulated with anti-CD3 antibody (OKT3) over a concentration range of 0–17.5 ug / mL, and the expression levels of the CD137 / CD69 activation marker were evaluated after 24 hours.

[0254] Cytokine proliferation assay: Engineered CAR T cells were cultured for 13 days with or without IL-7 and IL-15. Cells were counted every 3-4 days, and dead cells were removed using trypan blue.

[0255] result CD3 stimulation assay: Transduced T cells and control CAR T cells (278) were activated by OKT3 from a concentration of 0.54 ug / mL and showed similar increases, as shown in Figures 21A and 21B. Notably, the expression of the activation marker remained unchanged over this same concentration range for the TCR-silencing CAR T cell population, confirming the loss of TCR function during receptor silencing.

[0256] Cytokine proliferation assay: In the presence of cytokines, cell survival was observed in all cell populations, as shown in Figure 21C; however, in their absence, no cell proliferation was reported.

[0257] Example 7: Preclinical-scale production of TCR silencing T cells method Primary T cells were activated with TransAct (Miltenyi Biotec) according to the manufacturer's instructions and transduced two days later with a lentiviral vector carrying a miRNA gene construct for silencing CD3z expression. Following transduction, the T cells were seeded on G-Rex cell culture plates and grown for 7 days in TexMACS medium with IL-7 and IL-15. The cells were then harvested and analyzed by flow cytometry.

[0258] As shown in Figure 25A, three constructs were used in this experiment: (i) a single hairpin (1hp) miRNA targeting CD3z(T2), (ii) a dual hairpin (2hp) miRNA targeting two different regions of the CD3z transcript (T1_T2), and (iii) an untargeted miRNA (with a scrambled guide chain sequence).

[0259] result As shown in Figure 25B, for each construct, cells from n=3 donors were transduced by more than 65% (assessed by mCherry positivity). Following the depletion of the remaining TCR-positive cells in the state where the construct had been transduced to silence the TCR, a pure population of TCR-mCh+ cells remained.

[0260] As shown in Figure 25C, on average, a 40-50-fold amplification of T cells was observed over 9 days of production, and no statistically significant differences in proliferation ratios were reported between batches (Kruskal-Wallis ANOVA, p=0.975). D. Notably, despite equivalent numbers of cells being collected for each condition, the yield of TCR-silencing T cells (engineered from dual miRNA CD3z_T1_T2) was nearly twice as high as that of TCR-silencing cells engineered from a single miRNA gene construct targeting CD3z_T2 (unpaired t-test, p=0.0136). Thus, the miRNA constructs of the present invention, comprising two miRNA hairpins that downregulate the TCR, and cells containing these constructs, can provide an improved yield of TCR-silencing cells.

[0261] Example 8: Production of universal donor cells Induced pluripotent stem cells (iPSCs) can be used to generate universal donor cells (UDCs). Therefore, UDC constructs were used, and in iPSCs, each target was silenced and overexpressed, as shown in Table 4. Subsequently, further validation regarding cells expressing the HLA-II molecule was performed using T cells transduced with UDC constructs. [Table 4]

[0262] method iPSCs transduced with a UDC construct were plated into mTeSR complete medium containing CloneR2 (StemCell technologies). On the same day, the cells were transduced by adding a lentivirus directly to the medium after attachment (MOI 5). After 24 hours, the medium was replaced with fresh medium. FACS was performed 6 days after transduction to evaluate the overexpression and silencing of the target protein of interest.

[0263] Transduced T cells with UDC constructs: Cryopreserved T cells were thawed and activated using CD3 / CD28 Dynabeads in a 3:1 ratio. Activated T cells were transduced 24 hours later with a lentiviral vector carrying a miRNA gene silencing construct. Transduction was performed at high density volume (2 million cells / mL), and the culture medium was replenished 18–24 hours and then every other day thereafter to maintain T cells at a cell density of 1 million cells / mL.

[0264] result All iPSCs used showed expression of over 90% of OCT4, which is associated with the undifferentiated phenotype, confirming that the cells used exhibited a stem cell phenotype (Figure 26A). It is possible to transduce iPSCs with UDC constructs that result in the overexpression of CD47, PD-L1, HLA-E, and CD34 (Figure 26B). Furthermore, iPSCs can be transduced with UDC constructs that enable the silencing of HLA-ABC and the simultaneous overexpression of CD47, PD-L1, HLA-E, and CD34 (Figure 26C). Since the overexpression of HLA-E may not be essential for the creation of universal donor cells, it is also shown that iPSCs can be transduced with UDC constructs that enable the overexpression of CD47, PD-L1, and CD34, as well as the silencing of HLA-ABC (Figure 26D).

[0265] Since iPSCs do not express the HLA-II molecule, the UDC construct was transduced into T cells, a more differentiated cell type that expresses HLA-II, confirming that the construct leads to the silencing of both HLA-I and HLA-II, as well as the simultaneous overexpression of CD47, PD-L1, and CD34 (Figure 27).

[0266] Therefore, in preferred embodiments of the universal donor cell configuration of the present invention, β2M and CIITA are downregulated, preferably by miRNA, preferably by β2M_T5, CIITA_T19, or a miRNA sequence as defined herein. In more preferred embodiments, CD47, PDL1, and RQR8 are upregulated or overexpressed. In even more preferred embodiments, β2M-HLAE is upregulated or overexpressed.

[0267] Example 9: In vivo study of TCR silencing cells in immunodeficient mice For in vivo studies, immunodeficient mice were irradiated before injection of 20 million TCR-silencing cells and evaluated for GvHD development over 100 days. Novel miRNAs resulting in over 50% TCR silencing were identified and multiplexed in various combinations for optimal construct selection. Depletion of TCR-expressing cells resulted in a pure population of over 99% genetically modified TCR-negative T cells, as supported by co-expression of the mCherry reporter gene. In MLR assays, negligible activation of TCR-silencing cells was observed. When injected into immunodeficient mice, control transdextrins resulted in substantial weight loss and GvHD development, with less than 50% of mice surviving by day 58. However, mice administered with TCR-silencing cells all survived to day 100 and remained healthy (data not shown). In summary, this demonstrates the successful development of functional TCR silencing and non-allogeneic reactive T cells.

[0268] method NOD SCID gamma (NSG) mice were injected with TCR silencing T cells and used to evaluate whether these cells remained non-allogeneically reactive in vivo and therefore did not lead to the development of graft-versus-host disease (GvHD). Figure 28A shows the overall study design, including the pilot and main studies. Figure 28B shows the main study design, in which NSG mice were irradiated with a dose of 1 Gy, injected with 20 million T cells 24 hours later, and then followed up for 100 days.

[0269] result As shown in Figure 28C, on day 15, blood was collected for flow cytometry analysis to confirm the engraftment of modified cells (based on mCherry reporter gene expression). As shown, more than 5% of the circulating cells were genetically modified, confirming T cell engraftment. Furthermore, sustained TCR / CD3 silencing was demonstrated in mice administered with T cells genetically modified with miRNA targeting CD3z. As shown in Figure 28D, the survival curve illustrates complete survival over 100 days in mice administered with TCR-silencing T cells (regardless of whether the cells were genetically modified with 1 hp or 2 hp of miRNA against CD3z). Notably, all mice administered with control transduction or proliferating T cells died by day 58 due to the development of GvHD. As shown in Figure 28E, correspondingly, the relative body weight percentage of the latter mice began to decline from around day 14, while mice treated with vehicle alone or TCR silencing T cells continued to gain weight throughout the 100-day study period.

[0270] Example 10: In vivo study of "modified" HLA-I and TCR / CD3 silencing cell persistence in immunodeficient mice Immunodeficient mice were irradiated before injection of host T cells and Raji-luc cells, and then injected with "modified" HLA-I and TCR / CD3 silencing cells at one of three levels (no HLA-I silencing, 80% and 90% silencing). Detectable "modified" HLA-I silencing was evaluated over 32 days. "Modified" HLA-I silencing was clearly detectable via flow cytometry after injection, and the different silencing levels were clearly distinguishable. This varying level of detectable HLA-I silencing persisted throughout the entire 32 days of the experiment and in both blood and other sampled tissues. In summary, sustained and "modified" silencing of TCR / CD3 and HLA-I is demonstrated.

[0271] method NOD SCID gamma (NSG) mice were injected with "modified" HLA-I and TCR / CD3 silencing T cells and used to evaluate whether modified HLA-I silencing persisted in vivo. Figure 29A shows the study design in which NSG mice were irradiated with a dose of 1 Gy, injected with host T cells and Raji-luc cells 24 hours later, injected with miCAR19 T cells (allogeneic graft) on day 3, and blood and tissue samples were taken on days 4, 11, 18, 25, and finally day 32.

[0272] result As shown in Figure 29, blood was collected for flow cytometry analysis on day 4 (one day after CAR T cell infusion) to confirm HLA-I expression. As shown, "modified" silencing of HLA-I was clearly detectable at various levels. This expression persisted until the end of blood collection on day 32. Furthermore, the HLA-I expression levels in the blood on day 32 were also reflected in spleen and bone marrow tissue samples collected at the end of the experiment. Figure 29B provides a representative histogram showing sustained HLA-I expression based on sampling on day 4 and day 32.

Claims

1. Engineered donor cells in which one or more cell surface-expressed polypeptides involved in immune signaling are functionally regulated, resulting in reduced rejection by the host immune system.

2. The engineered donor cell according to claim 1, wherein one or more cell surface-expressed polypeptides involved in immune signaling are functionally downregulated.

3. The engineered donor cell according to claim 2, wherein the one or more downregulated surface-expressed polypeptides are selected from the group consisting of HLA class I polypeptides and HLA class II polypeptides.

4. The engineered donor cell according to claim 3, wherein the downregulation of the HLA class I polypeptide is achieved by a miRNA that inhibits the expression of one or more of B2M, NLRC5, TAP1, TAP2, TAPBP, RFX5, RFXANK, and / or RFXAP.

5. The engineered donor cell according to claim 3 or 4, wherein the downregulation of the HLA class II polypeptide is achieved by a miRNA that inhibits the expression of one or more of CIITA, RFX5, RFXANK, and / or RFXAP.

6. The engineered donor cell according to any one of claims 2 to 5, wherein one or more of the downregulated surface-expressed polypeptides are T cell receptor (TCR) polypeptides.

7. The engineered donor cell according to claim 6, wherein the downregulation of the TCR polypeptide is achieved by miRNAs that inhibit the expression of TCRa, TCRb, CD3d, CD3g, CD3e and / or CD3z.

8. An engineered donor cell according to any one of claims 2 to 7, wherein one or more of the downregulated surface-expressed polypeptides are CD58 polypeptides, and the downregulation is optionally achieved by a miRNA that targets CD58 expression.

9. An engineered donor cell according to any one of claims 1 to 8, wherein one or more cell surface-expressed polypeptides involved in immune signaling are upregulated.

10. The engineered donor cell according to claim 9, wherein upregulation is achieved by the expressed transcript.

11. The engineered donor cell according to claim 9 or 10, wherein the upregulated surface-expressed polypeptide involved in immune signaling is selected from the group consisting of non-classical HLA class I polypeptides, CD47, PD-L1, and chimeric antigen receptors (CARs).

12. Engineered donor cells according to any one of claims 9 to 11, wherein surface-expressed non-classical HLA class I is upregulated and surface-expressed HLA class I is downregulated.

13. The engineered donor cell according to claim 11 or 12, wherein the non-classical HLA class I polypeptide is a genetically modified HLA-E, HLA-G, or HLA-F polypeptide.

14. Engineered donor cells according to any one of claims 9 to 13, wherein surface-expressed chimeric antigen receptors (CARs) are upregulated and surface-expressed T cell receptors (TCRs) are downregulated.

15. An engineered donor cell according to any one of claims 1 to 14, further expressing a safety switch gene or a suicide gene.

16. A miRNA expression construct comprising one or more miRNA hairpins targeting B2M, NLRC5, RFX5, RFXANK, RFXAP, CIITA, TCRa, TCRb, CD3d, CD3g, CD3e and / or CD3z, further comprising an expressed transcript as an option.

17. The miRNA expression construct according to claim 16, comprising at least a first and a second miRNA hairpin, wherein the first miRNA hairpin and the second miRNA hairpin target a combination of two sequences independently selected from sequences having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NOs: 1 to 16.

18. The miRNA expression construct according to claim 16 or 17, wherein the expressed transcript comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NOs: 17, 19, or 21, and / or the expressed transcript encodes a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NOs: 18, 20, or 22.

19. The miRNA expression construct according to any one of claims 17 to 18, wherein there are two copies of the first miRNA hairpin and / or two copies of the second miRNA hairpin.

20. The miRNA expression construct according to any one of claims 17 to 19, wherein there are three copies of the first miRNA hairpin and / or three copies of the second miRNA hairpin.

21. The miRNA expression construct according to any one of claims 16 to 20, wherein the construct comprises at least two different miRNA hairpins that target different regions of the same transcript.

22. A miRNA expression construct according to any one of claims 16 to 21, comprising at least two different miRNA hairpins that target different transcripts of the same gene.

23. A miRNA expression construct according to any one of claims 16 to 22, comprising at least two different miRNA hairpins that target different splice variants of the same gene.

24. A miRNA expression construct according to any one of claims 16 to 23, further comprising a promoter element.

25. The miRNA expression construct according to claim 24, wherein the promoter element is a promoter.

26. The miRNA expression construct according to claim 25, wherein the promoter is a eukaryotic promoter.

27. The miRNA expression construct according to claim 26, wherein the eukaryotic promoter is a Pol II or Pol III promoter.

28. The miRNA expression construct according to claim 25, wherein the promoter is an inducible promoter, a tissue-specific promoter, a cell lineage-specific promoter, or a synthetic promoter.

29. The miRNA expression construct according to claim 24, wherein the promoter element is selected from the promoter elements in Table 2.

30. The miRNA expression construct according to claim 25, wherein the promoter is a UBI promoter.

31. The miRNA expression construct according to claim 25, wherein the promoter is an EF1α promoter, a derivative of the EF1α promoter, or an EF1 short promoter.

32. A miRNA expression construct according to any one of claims 16 to 24, further comprising a spacer, wherein the spacer optionally comprises an enhancer, and further optionally the spacer is an enhancer.

33. The miRNA expression construct according to claim 32, wherein the spacer is at least 50 nucleotides long.

34. The miRNA expression construct according to claim 32, wherein the spacer is between 50 nucleotides in length and 1,000 nucleotides in length.

35. The miRNA expression construct according to claim 32, wherein the spacer is between a nucleotide length of 50 and 900, between a nucleotide length of 50 and 800, between a nucleotide length of 100 and 800, or between a nucleotide length of 50 and 800.

36. The miRNA expression construct according to claim 32, wherein the spacer is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, or 200 nucleotides long.

37. The miRNA expression construct according to claim 32, wherein the spacer is a GFP sequence.

38. The miRNA expression construct according to any one of claims 32 to 37, wherein the spacer is located between the promoter and the miRNA hairpin.

39. The miRNA expression construct according to any one of claims 32 to 38, wherein the spacer is heterogeneous with respect to the promoter element.

40. The miRNA expression construct according to any one of claims 32 to 39, wherein the spacer comprises an open reading frame on which the spacer is encoded.

41. The miRNA expression construct according to any one of claims 16 to 40, wherein at least two of the miRNA hairpins are separated by an intervening sequence.

42. The miRNA expression construct according to any one of claims 16 to 41, wherein the expressed transcript is at least one gene selected from the group consisting of non-classical HLA class I, CD47, PD-L1, and chimeric antigen receptors.

43. The miRNA expression construct according to claim 42, wherein the expressed transcript has at least 80%, 85%, 90%, 95%, or 100% sequence identity with respect to the sequences shown in Table 1.

44. A miRNA expression construct according to any one of claims 16 to 43, comprising a sequence encoding a portion for redirecting the function of immune effector cells.

45. A miRNA expression construct according to any one of claims 16 to 44, comprising a sequence encoding an engineered T cell receptor.

46. A miRNA expression construct according to any one of claims 16 to 45, comprising a sequence encoding a chimeric antigen receptor.

47. The miRNA expression construct according to claim 45 or 46, wherein the miRNA hairpin is under the control of a first promoter and the sequence encoding the T cell receptor or chimeric antigen receptor is under the control of a second promoter, or the miRNA hairpin and the sequence encoding the T cell receptor or chimeric antigen receptor are under the control of a single promoter.

48. A miRNA expression construct according to any one of claims 16 to 47, further comprising a T cell receptor sequence.

49. A miRNA expression construct according to any one of claims 16 to 48, further comprising a selected gene.

50. The miRNA expression construct according to claim 49, wherein the selected gene is LNGFR, truncated endothelial growth factor receptor (tEGFR), tCD19, CD20 or truncated CD20 (tCD20), tCD34 or derivatives thereof.

51. A miRNA expression construct according to any one of claims 16 to 50, further comprising a sequence encoding a suicide gene or a safety switch gene.

52. The miRNA expression construct according to claim 51, wherein the suicide gene or safety switch gene is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), CD20 or truncated CD20 (tCD20), and thymidylate synthase (TYMS).

53. A miRNA expression construct according to any one of claims 16 to 52, further comprising an internal ribosome entry site (IRES).

54. A DNA molecule comprising a miRNA expression construct according to any one of claims 16 to 53.

55. A plasmid comprising a miRNA expression construct or DNA molecule according to any one of claims 16 to 54.

56. A vector comprising a miRNA expression construct, DNA molecule, or plasmid according to any one of claims 16 to 55.

57. The vector according to claim 56, which is an expression vector.

58. The expression vector according to claim 57, wherein the expression vector is an adenovirus, adeno-associated virus, retrovirus, or lentiviral vector.

59. An expression vector according to claim 57 or claim 58, further comprising at least one drug resistance marker.

60. Engineered donor cells comprising a miRNA expression construct, DNA molecule, plasmid, or vector according to any one of claims 16 to 59.

61. A method for downregulating polypeptides in cells, comprising expressing a miRNA expression construct, DNA molecule, plasmid, or vector described in any one of claims 16 to 59 in the cells.

62. A method for preparing engineered donor cells, comprising transfecting or transducing cells with a miRNA expression construct, DNA molecule, plasmid, or vector according to any one of claims 16 to 59.

63. A method for preparing engineered donor cells from patient donors or healthy donors, (a) Collecting cells from the patient, (b) Transfecting or transfecting the cells with the miRNA expression construct, DNA molecule, plasmid, or vector described in any one of claims 16 to 59, (c) Expressing the miRNA expression construct Methods that include...

64. The method according to claim 62 or 63, wherein the engineered donor cells are T cells.

65. The method according to any one of claims 62 to 64, wherein the miRNA expression construct, DNA molecule, plasmid, or vector downregulates a TCR polypeptide and upregulates a CAR polypeptide, wherein the engineered donor cell is a CAR T cell.

66. The method according to claim 65, wherein the chimeric antigen receptor targets HIV-infected cells or tumor cells, the chimeric antigen receptor is optionally an anti-CD19 chimeric antigen receptor, and the chimeric antigen receptor is optionally FMC63.

67. Engineered donor cells that can be obtained or obtained by the method of any one of claims 62 to 66.

68. An engineered donor cell according to any one of claims 1 to 15, 60, or 67, which is a eukaryotic cell and optionally a mammalian cell.

69. An engineered donor cell according to any one of claims 1 to 15, 60, 67, or 68, which is an engineered donor cell in an immunoeffector cell.

70. The engineered donor cells according to claim 69, wherein the immune effector cells are selected from the group comprising alpha-beta T cells, gamma-delta T cells, tumor-infiltrating lymphocytes (TILs), TCR engineered T cells, CAR T cells, NK cells, NK / T cells, regulatory T cells, monocytes, and macrophages.

71. The engineered donor cell according to claim 70, wherein the immune effector cell is a CAR T cell.

72. An engineered donor cell according to any one of claims 1 to 15, 60, 67, or 68, which is a stem cell or progenitor cell.

73. The engineered donor cells according to claim 72, wherein the engineered donor cells are pluripotent stem cells such as embryonic and / or induced pluripotent stem cells.

74. The engineered donor cells according to claim 72, wherein the engineered donor cells are multipotent stem cells such as hematopoietic stem cells, mesenchymal stem cells, neural stem cells, or muscle stem cells (satellite cells).

75. The engineered donor cell according to any one of claims 1 to 15, 60, 67, or 68, wherein the engineered donor cell is a differentiated cell.

76. The engineering donor cells according to claim 75, which are pancreatic cells, and optionally islet cells or pancreatic β-cells.

77. A composition comprising engineered donor cells according to any one of claims 1 to 15, 60, or 67 to 76.

78. An engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, for use in therapeutic purposes.

79. An engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, for use in a method of treating cancer, infectious disease, autoimmune disease, or genetic disorder.

80. A method for treating cancer, infectious disease, autoimmune disease or genetic disorder, comprising administering an engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector or composition according to any one of claims 1 to 60 or 67 to 77.

81. An engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, for use in the manufacture of a pharmaceutical product for treating cancer, infectious disease, autoimmune disease, or genetic disorder.

82. An engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, for use in a stem cell therapy method.

83. A method of stem cell therapy comprising administering an engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77.

84. An engineered donor cell, miRNA expression construct, DNA molecule, plasmid, vector, or composition according to any one of claims 1 to 60 or 67 to 77, for use in the manufacture of a pharmaceutical product for stem cell therapy.

Images