Genetically modified pig cells, genetically modified pigs, and methods for producing them.

Genetically modified pig cells expressing CD46 under a natural promoter through SCNT address the challenges of immune rejection and incompatibilities, providing efficient and reliable pigs for xenotransplantation.

JP2026518296APending Publication Date: 2026-06-04ヴォルフエクハルト

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
ヴォルフエクハルト
Filing Date
2024-05-24
Publication Date
2026-06-04

AI Technical Summary

Technical Problem

Creating genetically engineered pigs for xenotransplantation requires multiple genetic modifications to prevent immune rejection, overcome physiological incompatibilities, and eliminate risks such as porcine endogenous retrovirus (PERV), while existing animal models like rodents do not accurately reflect human diseases, leading to inefficiencies and high organ demand.

Method used

Genetically modified pig cells expressing CD46 under a portion of its natural promoter, produced through somatic cell nuclear transfer (SCNT) using a non-clonal population, achieve sustained and reliable transgene expression, increasing production success and reducing time.

Benefits of technology

The method results in genetically modified pigs suitable for xenotransplantation with improved expression of CD46, enhancing the efficiency and reliability of producing genetically modified pigs for biomedical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026518296000059
    Figure 2026518296000059
  • Figure 2026518296000060
    Figure 2026518296000060
  • Figure 2026518296000061
    Figure 2026518296000061
Patent Text Reader

Abstract

The present invention relates to genetically modified porcine cells, genetically modified porcine organs, and genetically modified pigs, including genomic insertions of CD46 expression sequences. The present invention also relates to methods for producing such genetically modified porcine cells, genetically modified porcine organs, and genetically modified pigs.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to the field of genetic engineering, particularly to the genetic engineering and genome editing of porcine cells and pigs. Such genetically modified porcine cells and pigs can be used for xenotransplantation, for example, xenotransplantation from pigs to humans. [Background technology]

[0002] Significant advances in genetic engineering and genome editing of livestock species are extending their use to biomedical applications, most notably the creation of tailor-made large animal models for translational medicine, porcine cells, tissues, and organs for xenotransplantation, and pharmaceutical proteins in transgenic large animals.

[0003] The transition from basic research to clinical application is a long, often inefficient, and costly process. Appropriate animal models are crucial for the success of translational research. While rodent models are widely used, they often do not accurately reflect human diseases. Therefore, additional animal models that more faithfully mimic human anatomy and physiology are needed. Several genetically engineered pig models have been developed, many of which more accurately reflect the mechanisms and phenotypes of human diseases than existing rodent models.

[0004] In addition, pigs are the most promising donor species for xenotransplantation into humans. Organ replacement remains a treatment option for terminally ill patients, but the demand for organs far exceeds the supply. In particular, the number of human hearts that can potentially save lives is far less than the population that could benefit from a new heart. As a result, the number of patients waiting for replacement of a failing heart is increasing, leading to higher mortality rates on the waiting list and greater reliance on temporary mechanical support.

[0005] Xenotransplantation offers an alternative to organ donation from the same species. In particular, xenotransplantation of hearts from genetically modified (GM) organ-source pigs is becoming a new option, demonstrated by the sustained long-term success of ectopic (not for life support) abdominal transplantation of pig hearts in baboons, and by the orthotopic transplantation for life support, as well as the recent "humanitarian use" of transplanting hearts from GM pigs with 10 modifications into terminally ill patients, resulting in two months of survival (review: Reichart et al., 2023). [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] However, multiple genetic modifications are needed to prevent immune rejection, overcome physiological incompatibility between different organs, and eliminate potential risk factors, such as porcine endogenous retrovirus (PERV). For example, the human membrane cofactor protein (CD46) regulates complement activation, and when sufficiently expressed as a transgene, it protects xenografts from complement-mediated rejection (see Loveland et al., 2004). Therefore, xenografting also depends on advances in the field of genome editing.

[0007] In summary, genetically engineered large animals are playing a crucial role in biomedicine. Creating such large animals with sustained and reliable transgene expression is essential for applications in all fields. [Means for solving the problem]

[0008] The present invention satisfies the above requirements in the art and solves the above problems by providing embodiments described below.

[0009] The inventors have surprisingly found that expressing CD46 under at least a portion of its natural promoter results in sustained and reliable transgene expression in porcine cells. Such genetically modified porcine cells can be used to produce genetically modified pigs by somatic cell nuclear transfer (SCNT). The inventors have further found that performing such SCNT using a non-clonal population of genetically modified cells increases the success rate of producing genetically modified pigs and reduces the time required for this production. The resulting genetically modified pigs can be used for xenotransplantation.

[0010] Accordingly, the present invention is characterized in particular by the following preferred features. Item 1 Pig cells containing the following genetic modification (a): (a) A genomic insertion of a polynucleotide(i) comprising a CD46 expression sequence and a promoter element controlling the expression of the CD46 expression sequence, wherein the promoter element consists of at least a portion of a native CD46 promoter and / or achieves a CD46 expression level 0.1 to 10 times the CD46 expression level achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by Sequence ID No. 1. Section 2 The pig cell according to item 1, wherein the promoter element consists of a nucleotide sequence that is at least 50% identical to the nucleotide sequence represented by SEQ ID NO: 1. Section 3 The pig cell according to item 1 or item 2, wherein the promoter element consists of a nucleotide sequence that is at least 70% identical to the nucleotide sequence represented by SEQ ID NO: 1. Section 4 A pig cell according to any one of items 1 to 3, wherein the promoter element consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 1. Section 5 A pig cell according to any one of items 1 to 4, wherein the promoter element consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 1. Section 6 A pig cell according to any one of items 1 to 5, wherein the promoter element consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 1. Section 7 A pig cell according to any one of items 1 to 6, wherein the promoter element consists of a nucleotide sequence that is at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 1. Item 8 A pig cell according to any one of items 1 to 7, wherein the promoter element consists of a nucleotide sequence represented by Sequence ID No. 1. Section 9 Porcine cells as described in any one of items 1 to 8, wherein the promoter element is located upstream of the CD46 expression sequence. Item 10 The porcine cells described in any one of items 1 to 9, wherein the promoter element is located within a nucleotide sequence of -5000 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. Section 11 The porcine cells described in any one of items 1 to 10, wherein the promoter element is located within a nucleotide sequence of -2000 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. Item 12 The porcine cells described in any one of items 1 to 11, wherein the promoter element is located within a nucleotide sequence of -1000 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. Item 13 A porcine cell as described in any one of items 1 to 12, wherein the promoter element consists of a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. Item 14 The porcine cells according to any one of items 1 to 13, wherein the promoter element achieves a CD46 expression level that is 0.5 to 2 times the CD46 expression level achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1. Item 15 The porcine cells according to any one of items 1 to 14, wherein the promoter element achieves a CD46 expression level that is 0.8 to 1.2 times the CD46 expression level achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1. Item 16 The porcine cells according to any one of items 1 to 15, wherein the promoter element achieves a CD46 expression level approximately the same as the CD46 expression level achieved when the nucleotide sequence from -826 bp to -1 bp before the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1. Item 17 The porcine cells according to any one of items 1 to 16, wherein CD46 is human CD46 and the CD46 promoter is a human CD46 promoter. Item 18 The porcine cells according to any one of items 1 to 17, wherein the CD46 expression sequence is part of the CD46 minigene. Item 19 The porcine cells according to any one of items 1 to 18, wherein the nucleotide sequence of the CD46 expression sequence is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 2. Item 20 The porcine cells according to any one of items 1 to 19, wherein the nucleotide sequence of the CD46 expression sequence is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 2. Item 21 The porcine cells according to any one of items 1 to 20, wherein the nucleotide sequence of the CD46 expression sequence is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 2. Item 22 A porcine cell according to any one of items 1 to 21, wherein the nucleotide sequence of the CD46 expression sequence is at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 2. Section 23 A porcine cell according to any one of items 1 to 22, wherein the nucleotide sequence of the CD46 expression sequence is the nucleotide sequence represented by Sequence ID No. 2. Section 24 A porcine cell according to any one of items 1 to 23, wherein the polynucleotide(i) further comprises a polyadenylation signal. Section 25 The porcine cells described in item 24, wherein the polyadenylation signal is the Simian virus 40 (SV40) polyadenylation signal. Section 26 The porcine cell according to item 24 or 25, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 3. Section 27 A porcine cell according to any one of items 24 to 26, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 3. Section 28 A porcine cell according to any one of items 24 to 27, wherein the polyadenylation signal consists of a nucleotide sequence represented by Sequence ID No. 3. Section 29 Porcine cells according to any one of items 24-28, wherein the polyadenylation signal is located downstream of the promoter element and the CD46 expression sequence. Section 30 A porcine cell according to any one of items 1 to 29, wherein the polynucleotide(i) further comprises a ubiquita chromatin opening element (UCOE). Section 31 The porcine cell according to item 30, wherein UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 4. Section 32 The porcine cell according to item 30 or 31, wherein the UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 4. Item 33 A porcine cell according to any one of items 30 to 32, wherein UCOE consists of the nucleotide sequence represented by Sequence ID No. 4. Section 34 Porcine cells according to any one of items 30-33, wherein UCOE is located downstream of the promoter element, the CD46 expression sequence, and the polyadenylation signal. Section 35 A porcine cell according to any one of items 1 to 34, wherein the polynucleotide(i) further comprises a CAG promoter. Section 36 Porcine cells as described in item 35, wherein the CAG promoter does not regulate the expression of the CD46 expression sequence. Section 37 The porcine cell according to item 35 or 36, wherein the CAG promoter consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 5. Section 38 A porcine cell according to any one of items 35 to 37, wherein the CAG promoter consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 5. Section 39 A porcine cell according to any one of items 35 to 38, wherein the CAG promoter consists of the nucleotide sequence represented by SEQ ID NO: 5. Section 40 Porcine cells according to any one of items 35-39, wherein the CAG promoter is located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, and the UCOE. Section 41 A porcine cell according to any one of items 1 to 40, wherein the polynucleotide(i) further comprises a first chimeric intron (ChimI). Section 42 The porcine cell according to item 41, wherein the first ChimI consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by Sequence ID No. 6. Section 43 The porcine cell according to item 41 or 42, wherein the first ChimI consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by Sequence ID No. 6. Section 44 A pig cell as described in any one of items 41 to 43, wherein the first ChimI consists of the nucleotide sequence represented by Sequence ID No. 6. Section 45 Porcine cells as described in any one of sections 41-44, wherein the first ChimI is located downstream of a promoter element, a CD46 expression sequence, a polyadenylation signal, UCOE, and a CAG promoter. Section 46 A porcine cell according to any one of items 1 to 45, wherein polynucleotide(i) further comprises a portion of human thrombomodulin (hTBM) cDNA. Section 47 The porcine cell described in item 46, wherein a portion of the hTBM cDNA consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 7. Section 48 The porcine cell according to item 46 or 47, wherein a portion of the hTBM cDNA consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 7. Section 49 A porcine cell as described in any one of items 46 to 48, wherein a portion of the hTBM cDNA consists of the nucleotide sequence represented by Sequence ID No. 7. Section 50 Porcine cells as described in any one of sections 46-49, wherein a portion of the hTBM cDNA is located downstream of a promoter element, a CD46 expression sequence, a polyadenylation signal, UCOE, a CAG promoter, and a first ChimI. Section 51 A porcine cell according to any one of items 1 to 50, wherein polynucleotide(i) further comprises a second chimeric intron (ChimI). Section 52 The porcine cell according to item 51, wherein the second ChimI consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by Sequence ID No. 8. Section 53 The porcine cell according to item 51 or 52, wherein the second ChimI consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by Sequence ID No. 8. Section 54 A pig cell according to any one of items 51 to 53, wherein the second ChimI consists of the nucleotide sequence represented by Sequence ID No. 8. Section 55 A porcine cell according to any one of items 51-54, wherein the second ChimI is located upstream of the CD46 expression sequence and promoter element. Section 56 A porcine cell according to any one of items 1 to 55, wherein polynucleotide(i) further comprises a portion of an inverted ubiquitas chromatin opening element (UCOE). Section 57 A portion of the reversed UCOE consists of at least 95% of the nucleotide sequence represented by SEQ ID NO: 9, as described in item 56. Section 58 The porcine cell according to item 56 or 57, wherein a portion of the reversed UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 9. Section 59 A pig cell as described in any one of items 56 to 58, wherein a portion of the reversed UCOE consists of a nucleotide sequence represented by sequence number 9. Section 60 Porcine cells as described in any one of sections 56-59, wherein a portion of the inverted UCOE is located upstream of the CD46 expression sequence, promoter element, and second ChimI. Section 61 A porcine cell according to any one of items 1 to 60, wherein polynucleotide(i) further comprises an inverted CAG promoter. Section 62 The porcine cells described in item 61, wherein the inverted CAG promoter does not regulate the expression of the CD46 expression sequence. Section 63 The porcine cell according to claim 61 or 62, wherein the inverted CAG promoter consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 10. Section 64 A porcine cell according to any one of items 61 to 63, wherein the inverted CAG promoter consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 10. Section 65 A porcine cell according to any one of items 61 to 64, wherein the inverted CAG promoter consists of the nucleotide sequence represented by SEQ ID NO: 10. Section 66 Porcine cells according to any one of items 61-65, wherein the inverted CAG promoter is located upstream of the CD46 expression sequence, promoter elements, a second ChimI, and a portion of the inverted UCOE. Section 67 A porcine cell according to any one of items 1 to 66, wherein the polynucleotide(i) further comprises a reversed chimeric intron (ChimI). Section 68 The porcine cell according to item 67, wherein the reversed ChimI consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 11. Section 69 The porcine cell according to item 67 or 68, wherein the reversed ChimI consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 11. Section 70 A pig cell according to any one of items 67 to 69, wherein the reversed ChimI consists of the nucleotide sequence represented by SEQ ID NO: 11. Section 71 Porcine cells according to any one of items 67-70, wherein the inverted ChimI is located upstream of the CD46 expression sequence, promoter element, second ChimI, part of the inverted UCOE, and the inverted CAG promoter. Section 72 A porcine cell according to any one of items 1 to 71, wherein polynucleotide(i) further comprises an inverted native human CD46 promoter. Section 73 The porcine cells described in item 72, wherein the inverted natural human CD46 promoter does not regulate the expression of the CD46 expression sequence. Section 74 The porcine cell according to item 72 or 73, wherein the inverted natural human CD46 promoter consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 12. Section 75 A porcine cell according to any one of items 72 to 74, wherein the inverted natural human CD46 promoter consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 12. Section 76 A porcine cell according to any one of items 72 to 75, wherein the inverted natural human CD46 promoter consists of the nucleotide sequence represented by Sequence ID No. 12. Section 77 Porcine cells according to any one of items 72-76, wherein an inverted native human CD46 promoter is located upstream of the CD46 expression sequence, promoter elements, a second ChimI, a portion of an inverted UCOE, an inverted CAG promoter, and an inverted ChimI. Section 78 A porcine cell according to any one of items 1 to 77, wherein polynucleotide(i) further comprises a portion of the reversed CD46 minigene. Section 79 The porcine cell described in item 78, wherein a portion of the reversed CD46 minigene consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 13. Section 80 The porcine cell according to item 78 or 79, wherein a portion of the reversed CD46 minigene consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 13. Section 81 A porcine cell as described in any one of items 78-80, wherein a portion of the reversed CD46 minigene consists of the nucleotide sequence represented by Sequence ID No. 13. Section 82 Porcine cells as described in any one of sections 78-81, wherein a portion of the inverted CD46 minigene is located upstream of the CD46 expression sequence, promoter element, second ChimI, a portion of the inverted UCOE, the inverted CAG promoter, the inverted ChimI, and the inverted native human CD46 promoter. Section 83 A pig cell according to any one of items 1 to 82, wherein polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 14. Section 84 A pig cell according to any one of items 1 to 83, wherein polynucleotide(i) consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 14. Section 85 A pig cell according to any one of items 1 to 84, wherein polynucleotide(i) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 14. Section 86 A pig cell according to any one of items 1 to 85, wherein the polynucleotide(i) consists of a nucleotide sequence represented by sequence number 14. Section 87 A porcine cell as described in any one of items 1 to 86, wherein polynucleotide(i) is inserted into the endogenous GGTA1 gene. Section 88 A porcine cell according to any one of claims 1 to 87, wherein polynucleotide (i) is inserted into an exon of the endogenous GGTA1 gene, preferably in exon 8 of the endogenous GGTA1 gene. Section 89 Porcine cells as described in subsection 87 or 88, wherein the insertion of polynucleotide(i) induces disruption of the endogenous GGTA1 gene. Section 90 A porcine cell according to any one of items 1 to 89, wherein polynucleotide(i) is inserted into one or both alleles of the endogenous GGTA1 gene. Section 91 A porcine cell according to any one of items 1 to 90, wherein the porcine cell contains a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 15. Section 92 A porcine cell according to any one of items 1 to 91, wherein the porcine cell contains a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 15. Section 93 A porcine cell according to any one of items 1 to 92, wherein the porcine cell contains a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 15. Section 94 A porcine cell according to any one of items 1 to 93, wherein the porcine cell contains the nucleotide sequence represented by SEQ ID NO: 15. Section 95 Pig cells as described in any one of items 1 to 94, further comprising the following genetic modification (b): (b) Genomic insertion of a polynucleotide (ii) containing a thrombomodulin (TBM) expression sequence and a promoter element that controls the expression of the TBM expression sequence. Section 96 The porcine cell according to item 95, wherein polynucleotide(ii) is located upstream or downstream of polynucleotide(i). Section 97 Porcine cells as described in item 95 or 96, wherein TBM is human TBM. Section 98 A porcine cell as described in any one of sections 95 to 97, wherein the TBM expression sequence is TBM cDNA. Section 99 A porcine cell according to any one of items 95 to 98, wherein the TBM expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 16. Item 100 A porcine cell according to any one of items 95 to 99, wherein the TBM expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 16. Section 101 A porcine cell according to any one of items 95 to 100, wherein the TBM expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 16. Section 102 The porcine cell according to any one of items 95 to 101, wherein the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level 0.1 to 10 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5 or 17. Section 103 The porcine cell according to any one of items 95 to 102, wherein the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level of 0.5 to 2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5 or 17. Section 104 The porcine cells according to any one of items 95 to 103, wherein the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level 0.8 to 1.2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5 or 17. Section 105 The porcine cells according to any one of items 95 to 104, wherein a promoter element that controls the expression of a TBM expression sequence achieves a TBM expression level that is approximately the same as that achieved by the nucleotide sequence represented by SEQ ID NO: 5 or 17. Section 106 The porcine cell according to any one of items 95 to 105, wherein the promoter element controlling the expression of the TBM expression sequence is a CAG promoter or an EF1A promoter having a CMV enhancer. Section 107 The porcine cell according to any one of claims 95 to 106, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 17. Section 108 The porcine cell according to any one of claims 95 to 107, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 17. Section 109 A porcine cell according to any one of items 95 to 108, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence represented by SEQ ID NO: 5 or SEQ ID NO: 17. Section 110 Porcine cells as described in any one of items 95 to 109, wherein the promoter element controlling the expression of the TBM expression sequence is located upstream of the TBM expression sequence. Section 111 A porcine cell according to any one of claims 95 to 110, wherein the polynucleotide (ii) further comprises a chimeric intron (ChimI). Section 112 The porcine cell according to item 111, wherein ChimI consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18. Section 113 The porcine cell according to item 111 or 112, wherein ChimI consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18. Section 114 A porcine cell according to any one of items 111 to 113, wherein ChimI consists of a nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18. Section 115 Porcine cells as described in any one of items 111 to 114, wherein ChimI is located between the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. Section 116 The porcine cell according to any one of claims 95 to 101, wherein the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level of 0.1 to 10 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 48 or 50, preferably 0.5 to 2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 48 or 50, and most preferably 0.8 to 1.2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 48 or 50. Section 117 The porcine cells according to any one of claims 95-101 and 116, wherein a promoter element that controls the expression of a TBM expression sequence achieves a TBM expression level that is approximately the same as that achieved by the nucleotide sequence represented by SEQ ID NO: 48 or 50. Section 118 The porcine cell according to any one of claims 95-101, 116, and 117, wherein the promoter element controlling the expression of the TBM expression sequence is under the control of a non-ubiquitous promoter, preferably, the promoter element controlling the expression of the TBM expression sequence is under the control of a tissue-specific promoter, and most preferably, the promoter element controlling the expression of the TBM expression sequence is under the control of an epithelial-specific promoter. Section 119 Porcine cells according to any one of items 95-101 and 116-118, wherein the promoter element controlling the expression of the TBM expression sequence is the ICAM2 promoter or the epithelial-specific porcine TBM promoter. Section 120 The porcine cell according to any one of claims 95-101 and 116-119, wherein the promoter element controlling the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 48 or SEQ ID NO: 50, preferably the promoter element controlling the expression of the TBM expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 48 or SEQ ID NO: 50. Section 121 A porcine cell according to any one of items 95-101 and 116-120, wherein the promoter element that controls the expression of the TBM expression sequence consists of a nucleotide sequence represented by SEQ ID NO: 48 or SEQ ID NO: 50. Section 122 Porcine cells according to any one of items 95-101 and 116-121, wherein the promoter element that controls the expression of the TBM expression sequence is located upstream of the TBM expression sequence. Section 123 The porcine cell according to any one of claims 95-101 and 116-122, wherein the polynucleotide (ii) containing the ICAM2 promoter further contains an intron, preferably all or part of the first intron of the ICAM2 gene, and most preferably all or part of the first intron of the porcine ICAM2 gene. Section 124 The porcine cell according to item 123, wherein the first intron of the ICAM2 gene consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 47, preferably the first intron of the ICAM2 gene consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 47, and most preferably the first intron of the ICAM2 gene consists of the nucleotide sequence represented by SEQ ID NO: 47. Section 125 The porcine cell according to either item 123 or 124, wherein the first intron of the ICAM2 gene is located upstream of the ICAM2 promoter element and the TBM expression sequence. Section 126 A porcine cell according to any one of items 95 to 125, wherein the polynucleotide (ii) further comprises a polyadenylation signal. Section 127 The porcine cells according to item 126, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal or a Simian virus 40 (SV40) polyadenylation signal. Section 128 The porcine cell according to item 126 or 127, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20. Section 129 A porcine cell according to any one of items 126 to 128, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20. Section 130 A porcine cell according to any one of items 126 to 129, wherein the polyadenylation signal consists of a nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20. Section 131 Porcine cells according to any one of items 126-130, wherein the polyadenylation signal is located downstream of the promoter element and the TBM expression sequence. Section 132 A porcine cell according to any one of claims 95 to 131, wherein the polynucleotide(ii) further comprises a ubiquita chromatin opening element (UCOE). Section 133 The porcine cell according to item 132, wherein UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21. Section 134 The porcine cell according to item 132 or 133, wherein the UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21. Section 135 A porcine cell according to any one of items 132 to 134, wherein UCOE consists of a nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21. Section 136 Porcine cells according to any one of items 132 to 135, wherein the UCOE is located upstream of a TBM expression sequence and a promoter element that controls the expression of the TBM expression sequence. Section 137 A porcine cell according to any one of claims 95 to 136, wherein the polynucleotide(ii) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 46, or SEQ ID NO: 49. Section 138 A porcine cell according to any one of claims 95 to 137, wherein the polynucleotide(ii) consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 46, or SEQ ID NO: 49. Section 139 A porcine cell according to any one of claims 95 to 138, wherein the polynucleotide(ii) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 46, or SEQ ID NO: 49. Section 140 A porcine cell according to any one of claims 95 to 139, wherein the polynucleotide(ii) consists of a nucleotide sequence represented by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 46, or SEQ ID NO: 49. Section 141 A porcine cell as described in any one of items 95-140, wherein polynucleotide(ii) is inserted into the endogenous GGTA1 gene. Section 142 The porcine cell according to any one of claims 95 to 141, wherein polynucleotide (ii) is inserted into an exon of the endogenous GGTA1 gene, preferably exon 6 of the endogenous GGTA1 gene. Section 143 Porcine cells as described in any one of sections 95-142, wherein polynucleotide (ii) insertion induces disruption of the endogenous GGTA1 gene. Section 144 A porcine cell according to any one of items 95 to 143, wherein polynucleotide(ii) is inserted into one or both alleles of the endogenous GGTA1 gene. Section 145 A porcine cell as described in any one of items 95 to 144, wherein polynucleotide(i) and polynucleotide(ii) are inserted into different gene loci. Section 146 Pig cells as described in section 145, in which different gene loci are separated by at least 2000 bp. Section 147 Pig cells as described in section 145 or 146, wherein different gene loci are separated by at least 5000 bp. Section 148 Pig cells as described in any one of sections 145-147, wherein different gene loci are separated by at least 10,000 bp. Section 149 A porcine cell as described in any one of items 95 to 148, wherein polynucleotide(i) and polynucleotide(ii) are inserted into different loci of the endogenous GGTA1 gene. Section 150 A porcine cell as described in any one of items 95 to 149, wherein polynucleotide(i) and polynucleotide(ii) are inserted into different exons of the endogenous GGTA1 gene. Section 151 A porcine cell according to any one of items 95 to 150, wherein polynucleotide (i) is inserted into exon 8 of the endogenous GGTA1 gene, and polynucleotide (ii) is inserted into exon 6 of the endogenous GGTA1 gene. Section 152 A porcine cell according to item 151, comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25. Section 153 A porcine cell according to item 151 or 152, comprising a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25. Section 154 A porcine cell according to any one of items 151 to 153, wherein the porcine cell contains a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25. Section 155 A porcine cell according to any one of items 151 to 154, comprising a nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25. Section 156 A porcine cell according to any one of items 95 to 144, wherein polynucleotide(i) and polynucleotide(ii) are located on a single polynucleotide. Section 157 The porcine cell according to item 156, further comprising a ubiquita chromatin opening element (UCOE) in which a single polynucleotide is located between polynucleotide(i) and polynucleotide(ii). Section 158 The porcine cell according to item 157, wherein UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 4. Section 159 The porcine cell according to item 157 or 158, wherein the UCOE consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 4. Section 160 A porcine cell according to any one of items 157 to 159, wherein UCOE consists of a nucleotide sequence represented by Sequence ID No. 4. Section 161 A porcine cell according to any one of items 156 to 160, wherein the porcine cell contains a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 26. Section 162 A porcine cell according to any one of items 156 to 161, wherein the porcine cell contains a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 26. Section 163 A porcine cell according to any one of items 156 to 162, wherein the porcine cell contains a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 26. Section 164 A porcine cell according to any one of items 156 to 163, comprising the nucleotide sequence represented by SEQ ID NO: 26. Section 165 Porcine cells as described in any one of items 1 to 164, further comprising the following genetic modification (c): (c) Disruption of the endogenous α-1,3-galactosyltransferase (GGTA1) gene. Section 166 Pig cells as described in item 165, in which disruption of the endogenous GGTA1 gene results in biallelic disruption. Section 167 Pig cells as described in any one of items 1 to 166, further comprising the following genetic modification (d): (d) Disruption of the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene. Section 168 The porcine cells described in item 167, wherein the disruption of the endogenous CMAH gene is a disruption of one or both alleles. Section 169 Pig cells as described in any one of items 1 to 168, further comprising the following gene modification (e): (e) Disruption of the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene and the endogenous B4GALNT2-like (B4GALNT2L) gene. Section 170 The porcine cells described in subsection 169, wherein the disruption of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene results in the disruption of one or both alleles. Section 171 Pig cells as described in any one of items 1 to 170, further comprising the following genetic modification (f): (f) A genomic insertion of a polynucleotide (iii) containing a human β-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-G1) expression sequence and a promoter element that controls the expression of the B2M / HLA-G1 expression sequence. Section 172 The porcine cell according to item 171, wherein polynucleotide(iii) is located upstream or downstream of polynucleotide(ii). Section 173 Porcine cells as described in any one of items 171 to 172, wherein the hB2M / HLA-G1 expression sequence is hB2M / HLA-G1 cDNA. Section 174 A porcine cell according to any one of items 171 to 173, wherein the hB2M / HLA-G1 expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 56. Section 175 A porcine cell according to any one of items 171 to 174, wherein the hB2M / HLA-G1 expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 56. Section 176 A porcine cell according to any one of items 171 to 175, wherein the hB2M / HLA-G1 expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 56. Section 177 A porcine cell according to any one of items 171 to 176, wherein the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence achieves an hB2M / HLA-G1 expression level 0.1 to 10 times the hB2M / HLA-G1 expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5. Section 178 A porcine cell according to any one of items 171 to 177, wherein the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level 0.5 to 2 times the hB2M / HLA-G1 expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5. Section 179 A porcine cell according to any one of items 171 to 178, wherein the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence achieves an hB2M / HLA-G1 expression level that is 0.8 to 1.2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5. Section 180 A porcine cell according to any one of items 171 to 179, wherein the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence achieves an hB2M / HLA-G1 expression level that is approximately the same as that achieved by the nucleotide sequence represented by SEQ ID NO: 5. Section 181 Porcine cells as described in any one of items 171 to 180, wherein the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence is a CAG promoter. Section 182 A porcine cell according to any one of items 171 to 181, wherein the promoter element that controls the expression of the hB2M / HLA-G1 expression sequence consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 5. Section 183 A porcine cell according to any one of items 171 to 182, wherein the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 5. Section 184 A porcine cell according to any one of items 171 to 183, wherein the promoter element that controls the expression of the hB2M / HLA-G1 expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 5. Section 185 Porcine cells as described in any one of items 171 to 184, wherein the promoter element that controls the expression of the hB2M / HLA-G1 expression sequence is located upstream of the hB2M / HLA-G1 expression sequence. Section 186 A porcine cell according to any one of items 171 to 185, wherein polynucleotide(iii) further comprises chimeric introns (ChimI). Section 187 The porcine cell according to item 186, wherein ChimI consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 6. Section 188 The porcine cell according to item 186 or 187, wherein ChimI consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 6. Section 189 A porcine cell according to either item 186 or 188, wherein ChimI consists of the nucleotide sequence represented by SEQ ID NO: 6. Section 190 The porcine cell according to any one of claims 186 to 189, wherein ChimI is located upstream of the hB2M / HLA-G1 expression sequence, and preferably between the hB2M / HLA-G1 expression sequence and the promoter element that controls the expression of the TBM expression sequence. Section 191 A porcine cell according to any one of items 171 to 190, wherein the polynucleotide (iii) further comprises a polyadenylation signal. Section 192 The porcine cells described in item 191, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal. Section 193 The porcine cell according to item 191 or 192, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 19. Section 194 A porcine cell according to any one of items 191 to 193, wherein the polyadenylation signal consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 19. Section 195 A porcine cell according to any one of items 191 to 194, wherein the polyadenylation signal consists of a nucleotide sequence represented by SEQ ID NO: 19. Section 196 Porcine cells as described in any one of items 191 to 195, wherein the polyadenylation signal is located downstream of the promoter element and the hB2M / HLA-G1 expression sequence. Section 197 A porcine cell according to any one of items 171 to 196, wherein polynucleotide(iii) further comprises a ubiquita chromatin opening element (UCOE). Section 198 The porcine cell according to item 197, wherein UCOE consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 21. Section 199 A porcine cell according to any one of items 197 to 198, wherein UCOE consists of the nucleotide sequence represented by SEQ ID NO: 21. Section 200 Porcine cells as described in any one of items 197-199, wherein UCOE is located upstream of an hB2M / HLA-G1 expression sequence and a promoter element that controls the expression of the hB2M / HLA-G1 expression sequence. Section 201 A porcine cell according to any one of items 171 to 200, wherein the polynucleotide (iii) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 51. Section 202 A porcine cell according to any one of items 171 to 201, wherein the polynucleotide (iii) consists of a nucleotide sequence that is at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 51. Section 203 A porcine cell according to any one of items 171 to 202, wherein the polynucleotide (iii) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 51. Section 204 A pig cell according to any one of items 171 to 203, wherein the polynucleotide (iii) consists of a nucleotide sequence represented by sequence number 51. Section 205 A porcine cell as described in any one of items 171 to 204, wherein polynucleotide(iii) is inserted into the endogenous GGTA1 gene. Section 206 A porcine cell according to any one of claims 171 to 205, wherein polynucleotide (iii) is inserted into an exon of the endogenous GGTA1 gene, preferably in exon 6 of the endogenous GGTA1 gene. Section 207 Porcine cells as described in any one of items 171-206, wherein polynucleotide (iii) insertion induces disruption of the endogenous GGTA1 gene. Section 208 A porcine cell according to any one of items 171 to 207, wherein polynucleotide(iii) is inserted into one or both alleles of the endogenous GGTA1 gene. Section 209 A porcine cell according to any one of items 171 to 208, wherein polynucleotide(ii) and polynucleotide(iii) are inserted into the same gene locus. Section 210 A porcine cell according to any one of items 171 to 209, wherein polynucleotide(i) is inserted into exon 8 of the endogenous GGTA1 gene, and polynucleotide(ii) and polynucleotide(iii) are inserted into exon 6 of the endogenous GGTA1 gene. Section 211 Pig cells are primary cells, as described in any one of items 1 to 210. Section 212 The porcine cells described in any one of items 1 to 211, wherein the porcine cells are porcine kidney cells or porcine heart cells. Section 213 Pig cells as described in any one of items 1 to 212, wherein the pig cells are derived from Auckland Island pigs. Section 214 Pork cells are isolated pork cells, as described in any one of items 1 to 213. Section 215 A composition comprising porcine cells and cell culture medium as described in any one of items 1 to 214. Section 216 Pig organs containing one(s) of the genetic modifications described in items 1 through 210. Section 217 A pig organ containing pig cells as described in any one of items 1 to 213. Section 218 The pig organ described in paragraph 216 or 217, wherein the pig organ is a pig's heart. Section 219 The pig organ described in paragraph 216 or 217, wherein the pig organ is a pig kidney. Section 220 Pork organs as described in any one of sections 216 to 219, wherein the porcine organs are derived from Auckland Island pigs that have one or more genetic modifications as described in any one of sections 1 to 210. Section 221 A pig organ, which is an isolated pig organ, as described in any one of paragraphs 216 to 220. Section 222 A pig containing one(s) of the genetic modifications described in any one of items 1 through 210. Section 223 A pig containing porcine cells as described in any one of items 1 to 213 or porcine organs as described in any one of items 216 to 220. Section 224 The pig is the Auckland Island pig, as described in subsection 222 or 223. Section 225 Pig cells, compositions, pig organs, or pigs that are each free of specific pathogens (SPF), as described in any one of claims 1 to 214, the compositions described in claim 215, the pig organs described in any one of claims 216 to 221, or the pigs described in any one of claims 222 to 224. Section 226 Pig cells, compositions, porcine organs, or pigs, each of which is for xenotransplantation, as described in any one of claims 1 to 214 and 225, as described in claim 215 or 225, as described in any one of claims 216 to 221 and 225, or as described in any one of claims 222 to 225. Section 227 Porcine cells according to any one of claims 1 to 214, 225, and 226, compositions according to any one of claims 215, 225, and 226, porcine organs according to any one of claims 216 to 221, 225, and 226, or porcine according to any one of claims 222 to 226, for use in xenotransplantation methods. Section 228 Use of porcine cells as described in any one of claims 1 to 214, 225, and 226, a composition as described in any one of claims 215, 225, and 226, a porcine organ as described in any one of claims 216 to 221, 225, and 226, or a porcine as described in any one of claims 222 to 226 for xenotransplantation. Section 229 A xenotransplantation method comprising the step of transplanting porcine cells as described in any one of paragraphs 1 to 214, 225, and 226, or a porcine organ as described in any one of paragraphs 216 to 221, 225, and 226. Section 230 The xenotransplantation is a xenotransplantation from a pig to a baboon, using the porcine cells, composition, organ, or pig as described in subsection 226 or 227, the use as described in subsection 228, or the method as described in subsection 229. Section 231 The xenotransplantation is a xenotransplantation from a pig to a human, using the porcine cells, composition, organ, or pig as described in subsection 226 or 227, the use as described in subsection 228, or the method as described in subsection 229. Section 232 A method for producing porcine cells according to any one of items 1 to 214, 225, 226, 230, and 231, comprising the step of inserting a polynucleotide(i) into the genome of the porcine cells. Section 233 The method according to item 232, further comprising the step of inserting a polynucleotide (ii) into the genome of a pig cell. Section 234 The method according to item 232 or 233, further comprising the step of disrupting at least one allele of the endogenous GGTA1 gene in a porcine cell. Section 235 The method according to item 234, wherein the disruption step includes disrupting both alleles of the endogenous GGTA1 gene in porcine cells. Section 236 The method according to any one of claims 232 to 235, further comprising the step of disrupting the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene in porcine cells. Section 237 The method according to item 236, wherein the disruption step includes disrupting both alleles of the endogenous CMAH gene in a porcine cell. Section 238 The method according to any one of claims 232 to 237, further comprising the steps of disrupting the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene in porcine cells and disrupting the endogenous B4GALNT2-like (B4GALNT2L) gene. Section 239 The method according to item 238, comprising the step of disrupting both alleles of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene in a porcine cell. Section 240 The method according to any one of claims 232 to 239, wherein the insertion step comprises CRISPR-Cas9-based homologous recombination repair (HDR) and the destruction step comprises CRISPR-Cas9-based non-homologous end joining (NHEJ). Section 241 A method for producing a population of genetically modified porcine cells, wherein the genetically modified porcine cells are the porcine cells described in any one of the items 1 to 214, 225, 226, 230, and 231, and the method comprises the step of exposing the population of porcine cells to a genome modification treatment comprising the step of inserting polynucleotide(i) into the genome of the porcine cells. Section 242 The method according to item 241, further comprising the step of isolating a subpopulation of porcine cells expressing CD46. Section 243 The method according to section 241 or 242, wherein the genome modification treatment further comprises the step of inserting polynucleotide(ii) into the genome of a pig cell. Section 244 The method according to item 243, further comprising the step of isolating a subpopulation of porcine cells expressing thrombomodulin (TBM). Section 245 The method according to any one of claims 241 to 244, further comprising the step of disrupting at least one allele of the endogenous GGTA1 gene in a porcine cell. Section 246 The method according to item 245, wherein the disruption step includes disrupting both alleles of the endogenous GGTA1 gene in porcine cells. Section 247 The method according to any one of claims 241 to 246, further comprising the step of isolating a subpopulation of porcine cells that do not express or express α-1,3-galactosyltransferase (GGTA1) or have low expression thereof. Section 248 The method according to any one of claims 241 to 247, further comprising the step of disrupting the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene in porcine cells. Section 249 The method according to item 248, wherein the disruption step includes disrupting both alleles of the endogenous CMAH gene in a porcine cell. Section 250 The method according to any one of claims 241 to 249, further comprising the step of isolating a subpopulation of porcine cells that do not express or express CMAH at a low level. Section 251 The method according to any one of claims 241 to 250, further comprising the step of disrupting the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene and the endogenous B4GALNT2-like (B4GALNT2L) gene in porcine cells. Section 252 The method according to item 251, wherein the disruption step includes disrupting both alleles of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene in a porcine cell. Section 253 The method according to any one of claims 241 to 252, further comprising the step of isolating a subpopulation of porcine cells that do not express or express B4GALNT2 and B4GALNT2L at a low level. Section 254 The method according to any one of claims 241 to 253, wherein the genome modification procedure includes CRISPR-Cas9-based homologous recombination repair (HDR) and / or CRISPR-Cas9-based non-homologous end joining (NHEJ). Section 255 The method according to any one of items 232 to 254, wherein the method is an in vitro method. Section 256 A method for producing a pig as described in any one of paragraphs 222-227, 230, and 231. Section 257 The method according to paragraph 256, comprising a method for producing a population of genetically modified porcine cells as described in any one of paragraphs 241 to 255, and a method for producing a genetically modified porcine embryo by somatic cell nuclear transfer (SCNT) using the cell population. Section 258 A method for producing genetically modified pigs, the method comprising the following steps in order: A step of exposing a population of pig cells to genome modification treatment, A step of isolating a non-clonal subpopulation of porcine cells, including those with genome modifications. A step in somatic cell nuclear transfer (SCNT) that uses a non-clonal subpopulation of genetically modified pig cells. Section 259 The method described in paragraph 258, wherein SCNT is performed within 40 days after the exposure of a population of porcine cells to a genome modification treatment. Section 260 The method described in paragraph 258 or 259, wherein SCNT is performed within 30 days after the exposure of a population of porcine cells to a genome modification treatment. Section 261 The method according to any one of paragraphs 258-260, wherein SCNT is performed within 25 days after the population of porcine cells has been exposed to the genome modification treatment. Section 262 The method according to any one of paragraphs 258-261, wherein SCNT is performed within 20 days after the exposure of a population of porcine cells to a genome modification treatment. Section 263 The method according to any one of items 258 to 262, wherein a nonclonal subpopulation of genetically modified porcine cells is passaged 18 times or less before the SCNT. Section 264 The method according to any one of items 258-263, wherein a nonclonal subpopulation of genetically modified porcine cells is passaged 15 times or less before the SCNT. Section 265 The method according to any one of items 258-264, wherein a nonclonal subpopulation of genetically modified porcine cells is passaged 12 times or less before the SCNT. Section 266 The method according to any one of claims 258 to 265, wherein the genome modification procedure includes CRISPR-Cas9-based homologous recombination repair (HDR) and / or CRISPR-Cas9-based non-homologous end joining (NHEJ). Section 267 The method according to any one of items 258 to 266, wherein the porcine cells are primary porcine cells. Section 268 The method according to paragraph 267, wherein the primary porcine cells are derived from a pig less than three weeks old. Section 269 The method according to any one of items 258 to 268, wherein the porcine cells are porcine kidney cells or porcine heart cells. Section 270 The method according to any one of items 258 to 269, wherein the porcine cells are porcine kidney cells. Section 271 The method according to item 270, wherein the porcine kidney cells include porcine renal epithelial cells and porcine renal fibroblasts. Section 272 The method according to any one of items 258 to 271, wherein the nonclonal subpopulation of genetically modified porcine cells used for SCNT mainly comprises genetically modified porcine kidney fibroblasts. Section 273 The method according to any one of paragraphs 258 to 272, wherein the non-clonal subpopulation of genetically modified porcine cells used for SCNT comprises at least five different clonal subpopulations. Section 274 The method according to any one of claims 258 to 273, wherein the non-clonal subpopulation of genetically modified porcine cells used for SCNT comprises at least 10 different clonal subpopulations. Section 275 The method according to any one of claims 258 to 274, wherein the non-clonal subpopulation of genetically modified porcine cells used for SCNT comprises at least 20 different clonal subpopulations. Section 276 The method according to any one of sections 258 to 275, wherein the method does not include the step of isolating a single-cell clone. Section 277 The method according to any one of items 258-276, wherein the cell density of a (sub)population of porcine cells does not decrease to less than 200 cells / ml, or less than 100 cells / ml, or less than 50 cells / ml. Section 278 The cell density of a (sub)population of pig cells is 100 cells / cm³. 2 The culture surface area does not decrease to less than 50 cells / cm². 2 The culture surface area does not decrease to less than 20 cells / cm². 2 The method according to any one of items 258 to 277, wherein the culture surface area is not reduced to less than the specified area. Section 279 The non-clonal subpopulation of genetically modified pig cells used in SCNT is at least 1 x 10⁶ 6 , or at least 5 x 10 6 , or at least 1 x 10 7 , or at least 5 x 10 7 , or at least 1 x 10 8 The method according to any one of items 258 to 278, comprising genetically modified pig cells. Section 280 The method according to any one of sections 257 to 279, further comprising the step of transplanting 100 to 150 genetically modified pig embryos into a recipient pig. Section 281 The method according to any one of headings 258 to 280, wherein the genetically modified pig is a pig as described in any one of headings 222 to 227, 230, and 231. Section 282 The method according to paragraph 281, comprising a method for producing a population of genetically modified porcine cells as described in any one of paragraphs 241 to 255. Section 283 The method according to item 281 or 282, further comprising the step of crossing a first pig containing one or more genetic modifications described in any one of items 1 to 210 with a second pig containing one or more genetic modifications described in any one of items 1 to 210. Section 284 The method according to any one of items 281 to 283, further comprising the step of crossing a first pig containing porcine cells as described in any one of items 1 to 213 with a second pig containing porcine cells as described in any one of items 1 to 213. [Brief explanation of the drawing]

[0011] [Figure 1] Figure 1: A breeding scheme for producing pigs with multiple genetically modified organ sources. [Figure 2] Figures 2A-B: A. Schematic diagram of the porcine GGTA1 gene. The porcine GGTA1 gene has eight exons, and exon 8 was targeted for transgene integration. E = exon; sgRNA = single guide RNA. B. Schematic diagram of a homology arm (HA) that fits either the 5' or 3' side of the GGTA1 E8 cleavage site. [Figure 3] Figures 3A-B: A. Schematic diagram of the hCD46 expression cassette. CAG = CAG promoter; ChimI = chimeric intron; A2UCOE = ubiquitous chromatin opening element. B. Schematic diagram of the hTBM expression cassette. [Figure 4A] Figures 4A-B: A. Step 1 of dual-cut donor plasmid construction. The hCD46 expression cassette was inserted between the 5' E8 HA and 3' E8 HA using restriction digestion and ligation. B. Second step of dual-cut donor plasmid construction. The hTBM expression cassette was inserted downstream of the hCD46 expression cassette using restriction digestion and ligation. In this final dual-cut donor plasmid, the expression cassettes of the two transgenes are located between the 5' E8 HA and 3' E8 HA. [Figure 4B]Figures 4A-B: A. Step 1 of dual-cut donor plasmid construction. The hCD46 expression cassette was inserted between the 5' E8 HA and 3' E8 HA using restriction digestion and ligation. B. Second step of dual-cut donor plasmid construction. The hTBM expression cassette was inserted downstream of the hCD46 expression cassette using restriction digestion and ligation. In this final dual-cut donor plasmid, the expression cassettes of the two transgenes are located between the 5' E8 HA and 3' E8 HA. [Figure 5] Figure 5: Schematic diagram showing the development of new genotypes after the integration of the introduced gene. [Figure 6] Figure 6: Workflow for generating single-cell clones for SCNTs. [Figure 7] Figures 7A-B: A. Schematic diagram of the genotype of SCC with both alleles incorporated into the transgene cassette. B. Schematic diagram of the genotype of SCC with one allele incorporated into the transgene cassette. [Figure 8] Figures 8A-B: A. Exemplary SCC used in SCNT. B. Results. [Figure 9A] Figures 9A-B: A. MACS sorting of cells used to create single-cell clones from male and female Auckland Island kidney cells. Gal-negative and CD46-positive cells were used to create single-cell clones. B. Elongated conceptuses recovered from recipients that received embryos produced by SCNT of SCC. [Figure 9B] Figures 9A-B: A. MACS sorting of cells used to create single-cell clones from male and female Auckland Island kidney cells. Gal-negative and CD46-positive cells were used to create single-cell clones. B. Elongated conceptuses recovered from recipients that received embryos produced by SCNT of SCC. [Figure 10] Figure 10: Workflow for preparing bulk cell samples for SCNTs. [Figure 11A]Figure 11 A-B: A. Superselection of cells for SCNT using bulk cells (Auckland Island male kidney cells). B. Western blot analysis for immunodetection of transgenes. [Figure 11B] Figure 11 A-B: A. Superselection of cells for SCNT using bulk cells (Auckland Island male kidney cells). B. Western blot analysis for immunodetection of transgenes. [Figure 12] Figure 12: Lactation offspring derived from SCNT using bulk cell samples. [Figure 13] Figure 13: Gal-IHC analysis of piglet tail samples. All piglets were negative for the Gal epitope. [Figure 14] Figure 14: hCD46-IHC analysis of piglet tail samples. All piglets born alive exhibited strong hCD46 expression. [Figure 15] Figure 15: hTBM-IHC analysis of piglet tail samples. None of the piglets that were born alive exhibited hTBM expression. [Figure 16] Figure 16: IGV alignment of target region sequences derived from each live-born piglet to the reference sequence. [Figure 17] Figure 17: Sanger sequencing of PCR products generated using primers spanning the GGTA1 E8-sgRNA target site. This data indicates that all live animals had mutations similar to E8 in GGTA1 allele 2 (the sequences shown are represented by SEQ ID NOs. 38-45). [Figure 18] Figure 18: Schematic diagram showing the genotypes of four piglets born alive. [Figure 19] Figure 19A-B: A. All sequences inserted into the genetically modified piglet. B. All sequences inserted into the genetically modified piglet and the genomic regions on both sides. [Figure 20] Figure 20: IHC analysis showing hCD46 expression in different tissues of a single live piglet. [Figure 21-1]Figures 21A-E: A. Expression cassette containing hTBM under the CAG promoter. B. Expression cassette containing hTBM under the EF1A promoter. C. Outline of hTBM integration into the exon 6 locus of GGTA1. D. Superselection of cells with CAG-hTBM integration at the exon 6 locus of GGTA1. E. Superselection of cells with EF1A-hTBM integration at the exon 6 locus of GGTA1. [Figure 21-2] Figures 21A-E: A. Expression cassette containing hTBM under the CAG promoter. B. Expression cassette containing hTBM under the EF1A promoter. C. Outline of hTBM integration into the exon 6 locus of GGTA1. D. Superselection of cells with CAG-hTBM integration at the exon 6 locus of GGTA1. E. Superselection of cells with EF1A-hTBM integration at the exon 6 locus of GGTA1. [Figure 21-3] Figures 21A-E: A. Expression cassette containing hTBM under the CAG promoter. B. Expression cassette containing hTBM under the EF1A promoter. C. Outline of hTBM integration into the exon 6 locus of GGTA1. D. Superselection of cells with CAG-hTBM integration at the exon 6 locus of GGTA1. E. Superselection of cells with EF1A-hTBM integration at the exon 6 locus of GGTA1. [Figure 21-4] Figures 21A-E: A. Expression cassette containing hTBM under the CAG promoter. B. Expression cassette containing hTBM under the EF1A promoter. C. Outline of hTBM integration into the exon 6 locus of GGTA1. D. Superselection of cells with CAG-hTBM integration at the exon 6 locus of GGTA1. E. Superselection of cells with EF1A-hTBM integration at the exon 6 locus of GGTA1. [Figure 22] Figures 22A-B: A. Schematic diagram showing the expected genotypes of cells with hTBM under the CAG promoter. B. Schematic diagram showing the expected genotypes of cells with hTBM under the EF1A promoter. [Figure 23]Figure 23: Schematic diagram showing the expected genotypes of cells transfected with the novel targeting vector. [Figure 24-1]Figure 24A-E: A. Expression cassette containing hTBM under the epithelial-specific ICAM2 promoter. B. Expression cassette containing hTBM under the epithelial-specific porcine TBM promoter. C. Selection of cells with hTBM integration under the porcine TBM promoter (left) or cells with hTBM integration under the ICAM2 promoter (right) at the GGTA1 exon 6 locus. D. PCR of single-cell clones to confirm targeted integration of hTBM under the ICAM2 promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined in the first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, cells 7, 16, 18, 21, 25, 27, 29, 30, 36, 38, and 42 of SCC were selected. In the second PCR (right), the target site was confirmed by two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCCs 7, 16, 27, and 38 used for SCNTs. E. PCR of single-cell clones to confirm targeted incorporation of hTBM under the porcine TBM promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined by a first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, SCCs 11, 16, 25, 26, 35, 38, 41, 46, and 54 were selected.In the second PCR (right), the target site was confirmed using two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCC 25 used for SCNT. [Figure 24-2]Figure 24A-E: A. Expression cassette containing hTBM under the epithelial-specific ICAM2 promoter. B. Expression cassette containing hTBM under the epithelial-specific porcine TBM promoter. C. Selection of cells with hTBM integration under the porcine TBM promoter (left) or cells with hTBM integration under the ICAM2 promoter (right) at the GGTA1 exon 6 locus. D. PCR of single-cell clones to confirm targeted integration of hTBM under the ICAM2 promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined in the first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, cells 7, 16, 18, 21, 25, 27, 29, 30, 36, 38, and 42 of SCC were selected. In the second PCR (right), the target site was confirmed by two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCCs 7, 16, 27, and 38 used for SCNTs. E. PCR of single-cell clones to confirm targeted incorporation of hTBM under the porcine TBM promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined by a first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, SCCs 11, 16, 25, 26, 35, 38, 41, 46, and 54 were selected.In the second PCR (right), the target site was confirmed using two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCC 25 used for SCNT. [Figure 24-3]Figure 24A-E: A. Expression cassette containing hTBM under the epithelial-specific ICAM2 promoter. B. Expression cassette containing hTBM under the epithelial-specific porcine TBM promoter. C. Selection of cells with hTBM integration under the porcine TBM promoter (left) or cells with hTBM integration under the ICAM2 promoter (right) at the GGTA1 exon 6 locus. D. PCR of single-cell clones to confirm targeted integration of hTBM under the ICAM2 promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined in the first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, cells 7, 16, 18, 21, 25, 27, 29, 30, 36, 38, and 42 of SCC were selected. In the second PCR (right), the target site was confirmed by two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCCs 7, 16, 27, and 38 used for SCNTs. E. PCR of single-cell clones to confirm targeted incorporation of hTBM under the porcine TBM promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined by a first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, SCCs 11, 16, 25, 26, 35, 38, 41, 46, and 54 were selected.In the second PCR (right), the target site was confirmed using two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCC 25 used for SCNT. [Figure 24-4]Figure 24A-E: A. Expression cassette containing hTBM under the epithelial-specific ICAM2 promoter. B. Expression cassette containing hTBM under the epithelial-specific porcine TBM promoter. C. Selection of cells with hTBM integration under the porcine TBM promoter (left) or cells with hTBM integration under the ICAM2 promoter (right) at the GGTA1 exon 6 locus. D. PCR of single-cell clones to confirm targeted integration of hTBM under the ICAM2 promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined in the first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, cells 7, 16, 18, 21, 25, 27, 29, 30, 36, 38, and 42 of SCC were selected. In the second PCR (right), the target site was confirmed by two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCCs 7, 16, 27, and 38 used for SCNTs. E. PCR of single-cell clones to confirm targeted incorporation of hTBM under the porcine TBM promoter at the GGTA1 exon 6 locus. The presence of the transgene was determined by a first PCR (left) using FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: GATGTCCGTGCAGATGAAAC (SEQ ID NO: 58). For the second PCR, SCCs 11, 16, 25, 26, 35, 38, 41, 46, and 54 were selected.In the second PCR (right), the target site was confirmed using two PCRs: the first used FW primer: GTGGCCCTACAGTCCATTCT (SEQ ID NO: 59) and REV primer: GGTTTCCGACTGGGCGTC (SEQ ID NO: 60), and the second PCR used FW primer: GGACGTGGATGACTGCATAC (SEQ ID NO: 57) and REV primer: TCTCTTGAAGGGAGCTTGGT (SEQ ID NO: 62), with SCC 25 used for SCNT. [Figure 25] Figure 25A-C: A. Expression cassette containing hB2M / HLA-G1 under the CAG promoter. B. Expression cassette containing hTBM under the ICAM2 promoter and hB2M / HLA-G1 under the CAG promoter. C. Expression cassette containing hTBM under the endogenous porcine TBM promoter and hB2M / HLA-G1 under the CAG promoter. [Figure 26] Figure 26: Strategy for developing TKO pigs (the sequences shown are represented by sequence numbers 28-37). [Modes for carrying out the invention]

[0012] Detailed description of the invention Unless otherwise defined below, terms used in this invention should be understood in accordance with their general meanings known to those skilled in the art.

[0013] In this invention, the terms "comprise" and "consist of" have meanings known in the art. Optionally, in each instance, the term "comprise" as used in this invention may be replaced with the term "consist of".

[0014] All publications, patents, and patent applications referenced herein are incorporated herein by reference in their entirety for all purposes.

[0015] definition As used herein, the term "expression sequence" refers to a nucleotide sequence that codes for the target protein and is suitable for expression in a mammalian system, such as porcine cells. For example, an expression sequence may be a cDNA and / or part of a minigene. Preferred target proteins according to the present invention are CD46 and thrombomodulin (TBM). Therefore, preferred expression sequences according to the present invention are CD46 expression sequences and TBM expression sequences.

[0016] The term “promoter element” is used in accordance with its general meaning known in the art. A promoter element refers to a nucleotide sequence that controls the expression of the corresponding coding sequence (CDS) that encodes the protein of interest. In particular, the promoter elements according to the present invention control the expression level of the protein of interest. Promoter elements can control the tissue-specific expression of the corresponding CDS. When “promoter element” is referred to herein in accordance with the present invention, this does not preclude the existence of further nucleotide sequences other than promoters that may affect the expression of the corresponding CDS. Such further nucleotide sequences that may affect expression may include, for example, regulatory elements, such as enhancers, silencers, and / or insulators.

[0017] The terms “identity” or “sequence identity” are used herein in accordance with their general meanings known in the art. This refers to the similarity between two (or more) sequences, for example, nucleotide sequences or amino acid sequences. To determine sequence identity, first, the nucleotide residues or amino acid residues of two (or more) biological sequences are aligned to maximize the level of identity. This is called alignment. Next, the degree to which the two (or more) nucleotide sequences or amino acid sequences have the same residues at the same positions in the alignment is calculated. This result is usually expressed as a percentage. Therefore, when the present invention refers to a nucleotide sequence being, for example, “at least 50% identical” to another nucleotide sequence, this refers to 50% “identity” or “sequence identity” as described above. To determine the "identity" percentage or "sequence identity" percentage of two (or more) sequences, all residues (e.g., all nucleotides) of the two (or more) sequences are considered, i.e., all residues are included in the alignment or at least in the calculation of the "identity" percentage or "sequence identity" percentage. For example, if sequence A consists of 10 nucleotides and sequence B consists of the same 10 nucleotides in the same order, but sequence B contains an additional 10 nucleotides, then the alignment will consist of a total of 20 nucleotides, and sequences A and B will have 10 nucleotides at the same position in the alignment. Therefore, the sequence identity percentage between sequences A and B will be 50%.

[0018] The term “xenogeneic” is used in accordance with its common meaning known in the art. For example, “xenogeneic transplantation” (also referred to herein as “xenotransplantation”) is a transplant in which the graft originates from a donor organism of a different species from the recipient organism.

[0019] As used herein, the term “overgrowth” generally refers to any increase in the mass or volume of an organ or tissue that is detrimental to the function of the organ or tissue, particularly due to extrinsic factors (e.g., compression due to spatial constraints) or endogenous factors (e.g., hypoxia due to insufficient microvascular circulation). For example, if a heart or kidney is transplanted within the physiological range of each organ of the recipient organism, the term “overgrowth” may mean that the weight of the organ has increased to 50% above its physiological weight. If a lung is transplanted within the physiological range of the lung volume of the recipient organism, the term “overgrowth” may mean that the volume of the lung has increased to 50% above its physiological volume. As used herein, "physiological range of weight or volume" means a weight or volume that does not deviate by more than + / - 20%, preferably more than + / - 10%, from the physiological weight or volume of each organ of each recipient organism. The physiological weight or volume of an organ can be determined for a given recipient by those skilled in the art based on broad general knowledge. Exemplary physiological weights and volumes of organs are described in Konus et al. (1998) and Rao & Wagner (1972). In one embodiment of the present invention, the term “overgrowth” as used herein means that the volume and weight of the transplanted organ (e.g., heart) triple or quadruple within approximately one month after transplantation.

[0020] Where this specification refers to an organ or animal containing genetic modification(s), the cells of the organ or animal each contain a genome with genetic modification(s).

[0021] As used herein, the term "natural promoter" refers to a promoter that naturally controls the expression of a particular gene in a given organism. For example, the natural human CD46 promoter is the promoter that controls the expression of human CD46 in the human genome.

[0022] In this specification, when base pairs (bp) are numbered with reference to the ATG start codon of the reference sequence, the A of the ATG start codon is +1 bp, the T of the ATG start codon is +2 bp, the G of the ATG start codon is +3 bp, and so on. The nucleotide immediately preceding the A of the ATG start codon is -1 bp, the nucleotide immediately preceding -1 bp is -2 bp, and so on. There is no bp 0.

[0023] The terms “upstream” and “downstream” are used herein in accordance with their general meanings known in the art. When used to identify the relative positions of two nucleotide sequences within a single polynucleotide, the term upstream refers to the 5' position and the term downstream refers to the 3' position. Thus, if sequence A is located upstream of sequence B, then sequence A is located at 5' of sequence B.

[0024] Where a numerical range is provided herein in the form "X~Y" (where X and Y are integers), the range includes the integers X and Y. Therefore, for example, "a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon" includes a nucleotide of -826 bp and a nucleotide of -1 bp, resulting in a nucleotide sequence of 826 bp in total.

[0025] The terms “clone” and “clonal” are used herein in accordance with their common meanings known in the art. Thus, a clonal population of cells means a group of genetically identical cells that share a common ancestor and originate from the same cell.

[0026] The term “primary cell” is used herein in accordance with its common meaning known in the art. Primary cells are cells taken directly from living tissue (e.g., biopsy material) and established for in vitro growth. Primary cells generally undergo only a few cell divisions in vitro.

[0027] The terms “endogenous” and “intrinsic” are used herein in accordance with their common meanings known in the art. For example, endogenous genes are genes that are naturally present in the genome of each cell.

[0028] The term "ubiquitous promoter" is used herein in accordance with its general meaning known in the art. Generally, a ubiquitous promoter is a potent promoter that is active across a wide range of cells, tissues, and cell cycles.

[0029] The term “Specific Pathogen-Free (SPF)” is used herein in accordance with its general meaning known in the art. SPF generally means, for example, that laboratory animals are guaranteed to be free of specific pathogens. The use of SPF laboratory animals ensures that a particular disease does not interfere with a particular use. Those skilled in the art can recognize any specific use, such as pathogens associated with xenotransplantation.

[0030] The term "CAG promoter" is used herein in accordance with its common meaning known in the art. The CAG promoter includes the cytomegalovirus (CMV) early enhancer and a portion of the chicken β-actin gene.

[0031] Embodiment Embodiments of the present invention are described below. All of these embodiments can be combined with each other unless otherwise specified.

[0032] Genetically modified pig cells This invention is based on a surprising and unexpected gene rearrangement that occurred when the inventors created Auckland Island (AI) pigs for xenotransplantation from pigs to humans. Specifically, the inventors transfected kidney cells derived from AI pigs with a transgene expression cassette containing human CD46 (hCD46) and human thrombomodulin (hTBM) in the donor plasmid. In the expression cassette, both human CD46 and hTBM were under the control of the CAG promoter. The expression cassette also included a native human CD46 promoter before the CD46 CDS. The expression cassette was designed to be incorporated into the endogenous α-1,3-galactosyltransferase (GGTA1) gene by homologous recombination repair (HDR) based on CRISPR-Cas9. After transfection, cells that were GGTA1-negative and hCD46-positive were selected and further proliferated, but no single-cell clones were isolated. The resulting non-clonal population of cells was used for somatic cell nuclear transfer (SCNT). Using two recipient hybrid pigs, 100-150 embryos were transplanted into each recipient, resulting in four piglets being born alive.

[0033] Remarkably, all liveborn piglets showed outwardly identical rearrangements in the expression cassette transfected into pig cells. At the beginning of the expression cassette, the donor plasmid fragment containing the CAG promoter was reversed. However, the chimeric intron, native hCD46 promoter, and hCD46 sequence were oriented correctly. The final portion of the transgene expression cassette (belonging to the hTBM cDNA) was missing. The transgene expression cassette was inserted into the GGTA1 E8 locus in accordance with the experimental design. All liveborn piglets contained these genetic modifications (i.e., transgene rearrangements) and showed potent human CD46 expression. Analysis of a single liveborn piglet showed hCD46 expression in all tested tissues. None of the liveborn piglets showed expression of GGTA1 or hTBM.

[0034] While we do not wish to dwell on theory, we suggest that potent expression of human CD46 in live-born piglets is driven by the natural human CD46 promoter. Promoters significantly potent than the natural CD46 promoter are unfavorable and may contribute to cell death during SCNT and premature resorption of the conception product / fetus. Promoters significantly weaker than the natural CD46 promoter may be unsuitable for providing sufficient expression. Therefore, according to the present invention, the expression level achieved by the natural CD46 promoter is particularly favorable for CD46 expression in pigs. This effect is illustrated by the CD46 expression level achieved by the rearranged expression cassette.

[0035] Based on the foregoing, this specification provides porcine cells comprising a genomic insertion of a polynucleotide (hereinafter referred to as polynucleotide(i)), wherein polynucleotide(i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, the promoter element comprising at least a portion of a native CD46 promoter and / or achieving a CD46 expression level of 0.1 to 10 times the CD46 expression level achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by Sequence ID No. 1. The nucleotide sequence represented by Sequence ID No. 1 is a native hCD46 promoter identified in the genome of a living AI piglet and mediates high hCD46 expression. In a preferred embodiment, the promoter element achieves a CD46 expression level that is 0.2 to 5 times, 0.3 to 3 times, 0.5 to 2 times, or 0.8 to 1.2 times the CD46 expression level achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1. Most preferably, the promoter element achieves a CD46 expression level that is approximately the same as the level achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1.

[0036] Following the above description, in a preferred embodiment of the present invention, the promoter element controlling the expression of the CD46 expression sequence consists of at least a portion of the natural CD46 promoter and / or achieves a CD46 expression level 0.1 to 10 times higher than the CD46 expression level achieved by the porcine cells of the living piglets of the present invention. These living piglets contain a sequence in which the nucleotide sequence represented by SEQ ID NO: 14 is inserted into exon 8 of the endogenous GGTA1 gene. Thus, the living piglets also contain a nucleotide sequence represented by SEQ ID NO: 15, which consists of the sequence in which SEQ ID NO: 14 is inserted and the genomic sequence of GGTA1 exon 8 flanking the 5' and 3' ends of the insert. In a preferred embodiment of the present invention, the promoter element controlling the expression of the CD46 expression sequence consists of at least a portion of the natural CD46 promoter and / or achieves a CD46 expression level 0.1 to 10 times higher than the CD46 expression level achieved by the porcine cells containing the nucleotide sequence represented by SEQ ID NO: 15. In preferred embodiments, the promoter element achieves a CD46 expression level 0.2 to 5 times, 0.3 to 3 times, 0.5 to 2 times, or 0.8 to 1.2 times higher than that achieved by porcine cells containing the nucleotide sequence represented by SEQ ID NO: 15. Most preferably, the promoter element achieves a CD46 expression level approximately identical to that achieved by porcine cells containing the nucleotide sequence represented by SEQ ID NO: 15.

[0037] Those skilled in the art are well aware of methods for determining and comparing CD46 expression levels achieved by different nucleotide sequences containing different promoters. For example, the strength of different promoters can be determined by determining the expression level of a reporter gene controlled by the nucleotide sequence / promoter under analysis. In such an analysis, the expression level of the reporter gene correlates with the strength of the promoter being tested. The strengths determined for different promoters are expected to achieve the corresponding CD46 expression levels. Alternatively, when CD46 expression is controlled by different nucleotide sequences containing different promoters, the achieved expression level can be assessed by directly determining CD46 expression. CD46 expression can be determined, for example, by quantitative reverse transcription polymerase chain reaction (qRT-PCR), Western blotting, immunohistochemistry, immunofluorescence, or other detection techniques known to those skilled in the art. As will be apparent to those skilled in the art, when comparing the relative CD46 expression levels achieved by a particular nucleotide sequence / promoter with those achieved by other nucleotide sequences / promoters, it is necessary to at least minimize or completely eliminate the influence of other factors, such as other nucleotide sequences, in the comparison. Other nucleotide sequences that may influence the comparison may be, for example, regulatory elements, such as enhancers, silencers, and / or insulators. The influence of other factors may be minimized or eliminated, for example, by excluding these factors from both the nucleotide sequences / promoters being compared, or by including them in both.

[0038] As described above, this specification provides porcine cells comprising a genomic insertion of a polynucleotide(i) containing a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, wherein the promoter element consists of at least a portion of the innate CD46 promoter and / or achieves a CD46 expression level of 0.1 to 10 times the CD46 expression level achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1. Preferably, the promoter element consists of a nucleotide sequence that is at least 50%, at least 70%, at least 90%, at least 95%, at least 98%, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 1. Most preferably, the promoter element consists of the nucleotide sequence represented by SEQ ID NO: 1.

[0039] The definitions of “identity” or “sequence identity” are given above. Such “identity” or “sequence identity” can be determined using known tools, such as online tools, whether or not they are expressed in this invention. Exemplary tools for creating sequence alignments and determining “identity” or “sequence identity” based thereon include the BLAST® tool provided by the NIH National Library of Medicine (https: / / blast.ncbi.nlm.nih.gov / ) and the Clustal Omega tool provided by EMBL-EBI (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ). In either case, all nucleotides of two (or more) nucleotide sequences are considered in order to determine the “identity” or “sequence identity” of two (or more) nucleotide sequences. Therefore, even if the tool for creating sequence alignments does not include all nucleotides in the alignment, all nucleotides must be considered in order to calculate the percentage of “identity” or “sequence identity.”

[0040] In the polynucleotide(i) according to the present invention, the promoter element that controls the expression of the CD46 expression sequence is preferably located upstream of the CD46 expression sequence so as to control the expression of the CD46 expression sequence. In a preferred embodiment, the promoter element is located within a nucleotide sequence of -5000 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence, or within a nucleotide sequence of -2000 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence, or within a nucleotide sequence of -1000 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. In a preferred embodiment, the promoter element consists of a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence.

[0041] The CD46 expression sequence according to the present invention is preferably a CD46 minigene, for example, a part of the CD46 minigene contained in the live-born piglet of the present invention. Furthermore, the CD46 expression sequence according to the present invention is preferably similar to the CD46 expression sequence contained in the live-born piglet of the present invention represented by SEQ ID NO: 2. Accordingly, the nucleotide sequence of the CD46 expression sequence according to the present invention is preferably at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 2, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 2, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 2, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 2. Most preferably, the nucleotide sequence of the CD46 expression sequence according to the present invention is the nucleotide sequence represented by SEQ ID NO: 2.

[0042] In one embodiment, the polynucleotide(i) according to the present invention further comprises a polyadenylation signal that mediates the polyadenylation of CD46 mRNA. Those skilled in the art will be able to recognize a variety of polyadenylation signals suitable for the present purpose. However, in the live-born piglets of the present invention, the polyadenylation signal was the Simian virus 40 (SV40) polyadenylation signal consisting of the nucleotide sequence represented by SEQ ID NO: 3. Therefore, in a preferred embodiment of the present invention, the polyadenylation signal of polynucleotide(i) is the Simian virus 40 (SV40) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 3, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 3, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 3, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 3. Most preferably, the polyadenylation signal consists of the nucleotide sequence represented by SEQ ID NO: 3. The polyadenylation signal is preferably located downstream of the promoter element and the CD46 expression sequence so that it can mediate the polyadenylation of CD46 mRNA.

[0043] In one embodiment, the polynucleotide(i) according to the present invention further comprises a ubiquita chromatin opening element (UCOE). Those skilled in the art will be able to recognize various suitable UCOEs. However, in the live-born piglets of the present invention, the UCOE consisted of the nucleotide sequence represented by SEQ ID NO: 4. Therefore, in a preferred embodiment of the present invention, the UCOE of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 4, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 4, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 4, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 4. Most preferably, the UCOE consists of the nucleotide sequence represented by SEQ ID NO: 4. The UCOE may be located upstream or downstream of the promoter element, the CD46 expression sequence, and the polyadenylation signal. However, in the live-born piglets of the present invention, the UCOE was located downstream of the promoter element, the CD46 expression sequence, and the polyadenylation signal. Therefore, in the polynucleotide (i) according to the present invention, the UCOE is preferably located downstream of the promoter element, the CD46 expression sequence, and the polyadenylation signal.

[0044] In the live-born piglets of the present invention, the CAG promoter was located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, and the UCOE. While we do not wish to dwell on theory, at this location, the CAG promoter may not control the expression of the CD46 expression sequence. Therefore, in one embodiment, the polynucleotide(i) according to the present invention further comprises a CAG promoter. Those skilled in the art will be able to recognize a suitable CAG promoter. However, in the live-born piglets of the present invention, the CAG promoter consisted of the nucleotide sequence represented by SEQ ID NO: 5. Therefore, in a preferred embodiment of the present invention, the CAG promoter of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 5, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 5, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 5, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 5. Most preferably, the CAG promoter consists of the nucleotide sequence represented by SEQ ID NO: 5. In the polynucleotide (i) according to the present invention, the CAG promoter is preferably located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, and the UCOE. The CAG promoter does not need to control the expression of the CD46 expression sequence.

[0045] Chimeric introns can be incorporated into gene therapy to enhance gene expression, increase mRNA stability, and facilitate the expression of introduced genes. Chimeric introns can be incorporated downstream of the promoter (between the promoter and the ORF) or upstream of the promoter. Chimeric introns are thought to function similarly when located upstream of the promoter. For example, Godwin et al., 2006 showed that the first intron of the ICAM2 gene, incorporated upstream of the ICAM2 promoter sequence, significantly increased gene expression. Without dwelling on theory, intact chimeric introns (originally belonging to the CAG promoter) may support robust and stable hCD46 expression in modified pigs. Partial or reversed chimeric introns can also influence gene expression.

[0046] In the live-born piglets of the present invention, the first chimeric intron (ChimI) was located downstream of the promoter element, the CD46 expression sequence, the polyadenylation signal, the UCOE, and the CAG promoter. Without adhering to theory, at this position, the first ChimI may, or may have only a very small effect on, the expression of the CD46 expression sequence, or have no effect at all. Therefore, in one embodiment, the polynucleotide(i) according to the present invention further comprises the first ChimI. Those skilled in the art will be able to recognize a preferred ChimI. However, in the live-born piglets of the present invention, the first ChimI consisted of the nucleotide sequence represented by SEQ ID NO: 6. Therefore, in a preferred embodiment of the present invention, the first ChimI of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 6, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 6, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 6, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 6. Most preferably, the first ChimI consists of the nucleotide sequence represented by Sequence ID No. 6. In the polynucleotide(i) according to the present invention, the first ChimI is preferably located downstream of a promoter element, a CD46 expression sequence, a polyadenylation signal, a UCOE, and a CAG promoter.

[0047] In the live-born piglets of the present invention, a portion of the human thrombomodulin (hTBM) cDNA was located downstream of the promoter element, CD46 expression sequence, polyadenylation signal, UCOE, CAG promoter, and first ChimI. While we do not wish to dwell on theory, since hTBM was not detected in the live-born piglets of the present invention, a portion of the hTBM cDNA may not be expressed in the live-born piglets, possibly due to its truncation. Therefore, in one embodiment, polynucleotide(i) according to the present invention further comprises a portion of the hTBM cDNA. In the live-born piglets of the present invention, a portion of the hTBM cDNA consisted of the nucleotide sequence represented by SEQ ID NO: 7. Therefore, in a preferred embodiment of the present invention, a portion of the hTBM cDNA of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 7, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 7, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 7, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 7. Most preferably, a portion of the hTBM cDNA consists of the nucleotide sequence represented by Sequence ID No. 7. In the polynucleotide(i) according to the present invention, a portion of the hTBM cDNA is preferably located downstream of a promoter element, a CD46 expression sequence, a polyadenylation signal, UCOE, a CAG promoter, and a first ChimI. A portion of the hTBM cDNA may not be expressed.

[0048] In the live-born piglets of the present invention, the second chimeric intron (ChimI) was located upstream of the CD46 expression sequence and promoter element. Therefore, in one embodiment, the polynucleotide(i) according to the present invention further comprises the second ChimI. Those skilled in the art will be able to recognize a suitable ChimI. However, in the live-born piglets of the present invention, the second ChimI consisted of the nucleotide sequence represented by SEQ ID NO: 8. Therefore, in a preferred embodiment of the present invention, the second ChimI of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 8, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 8, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 8, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 8. Most preferably, the second ChimI consists of the nucleotide sequence represented by SEQ ID NO: 8. In the polynucleotide(i) according to the present invention, the second ChimI is preferably located upstream of the CD46 expression sequence and promoter element.

[0049] In the live-born piglets of the present invention, a portion of the inverted ubiquita chromatin opening element (UCOE) was located upstream of the CD46 expression sequence, promoter element, and second ChimI. While we do not wish to dwell on theory, in live-born piglets, the UCOE was inverted and truncated, and therefore, the UCOE may not fully perform its function of opening chromatin. Accordingly, in one embodiment, the polynucleotide(i) according to the present invention further comprises a portion of the inverted UCOE. In the live-born piglets of the present invention, a portion of the inverted UCOE consisted of the nucleotide sequence represented by SEQ ID NO: 9. Therefore, in a preferred embodiment of the present invention, a portion of the inverted UCOE of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 9, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 9, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 9, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 9. Most preferably, a portion of the inverted UCOE consists of the nucleotide sequence represented by SEQ ID NO: 9. In the polynucleotide (i) according to the present invention, a portion of the reversed UCOE is preferably located upstream of the CD46 expression sequence, promoter element, and second ChimI.

[0050] In the live-born piglets of the present invention, the inverted CAG promoter was located upstream of the CD46 expression sequence, promoter elements, a second ChimI, and a portion of the inverted UCOE. While we do not wish to dwell on theory, this CAG promoter, being inverted, may not control the expression of the CD46 expression sequence. Therefore, in one embodiment, the polynucleotide(i) of the present invention further comprises an inverted CAG promoter. In the live-born piglets of the present invention, the inverted CAG promoter consisted of the nucleotide sequence represented by SEQ ID NO: 10. Therefore, in a preferred embodiment of the present invention, the inverted CAG promoter of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 10, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 10, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 10, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 10. Most preferably, the inverted CAG promoter consists of the nucleotide sequence represented by SEQ ID NO: 10. In the polynucleotide (i) according to the present invention, the inverted CAG promoter is preferably located upstream of the CD46 expression sequence, the promoter element, the second ChimI, and a portion of the inverted UCOE. The inverted CAG promoter may not control the expression of the CD46 expression sequence.

[0051] In the live-born piglets of the present invention, the inverted chimeric intron (ChimI) was located upstream of the CD46 expression sequence, promoter element, second ChimI, part of the inverted UCOE, and the inverted CAG promoter. Without adhering to theory, at this location, the inverted ChimI may have only a very small effect on the expression of the CD46 expression sequence, or no effect at all. Therefore, in one embodiment, the polynucleotide(i) of the present invention further comprises the inverted ChimI. In the live-born piglets of the present invention, the inverted ChimI consisted of the nucleotide sequence represented by SEQ ID NO: 11. Therefore, in a preferred embodiment of the present invention, the inverted ChimI of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 11, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 11, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 11, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 11. Most preferably, the reversed ChimI consists of the nucleotide sequence represented by SEQ ID NO: 11. In the polynucleotide(i) according to the present invention, the reversed ChimI is preferably located upstream of the CD46 expression sequence, promoter element, second ChimI, part of the reversed UCOE, and the reversed CAG promoter.

[0052] In the live-born piglets of the present invention, the inverted natural human CD46 promoter was located upstream of the CD46 expression sequence, promoter element, second ChimI, part of the inverted UCOE, the inverted CAG promoter, and the inverted ChimI. While we do not wish to be bound by theory, the inverted natural human CD46 promoter, due to its inversion and location, may not control the expression of the CD46 expression sequence. Therefore, in one embodiment, polynucleotide(i) according to the present invention further comprises an inverted natural human CD46 promoter. In the live-born piglets of the present invention, the inverted natural human CD46 promoter consisted of the nucleotide sequence represented by SEQ ID NO: 12. Therefore, in a preferred embodiment of the present invention, the inverted natural human CD46 promoter of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 12, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 12, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 12, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 12. Most preferably, the inverted natural human CD46 promoter consists of the nucleotide sequence represented by Sequence ID No. 12. In the polynucleotide(i) of the present invention, the inverted natural human CD46 promoter is preferably located upstream of the CD46 expression sequence, promoter element, second ChimI, part of the inverted UCOE, the inverted CAG promoter, and the inverted ChimI. The inverted natural human CD46 promoter may not control the expression of the CD46 expression sequence.

[0053] In the live-born piglets of the present invention, a portion of the inverted CD46 minigene was located upstream of the CD46 expression sequence, promoter element, second ChimI, a portion of the inverted UCOE, the inverted CAG promoter, the inverted ChimI, and the inverted native human CD46 promoter. While we do not wish to dwell on theory, this portion of the CD46 minigene was truncated and inverted, and therefore may not be expressed in live-born piglets. Accordingly, in one embodiment, the polynucleotide(i) of the present invention further comprises a portion of the inverted CD46 minigene. In the live-born piglets of the present invention, the portion of the inverted CD46 minigene consisted of the nucleotide sequence represented by Sequence ID No. 13. Accordingly, in a preferred embodiment of the present invention, a portion of the inverted CD46 minigene of polynucleotide(i) consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 13, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 13, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 13, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 13. Most preferably, a portion of the inverted CD46 minigene consists of the nucleotide sequence represented by SEQ ID NO: 13. In the polynucleotide(i) according to the present invention, a portion of the inverted CD46 minigene is preferably located upstream of the CD46 expression sequence, promoter element, second ChimI, a portion of the inverted UCOE, an inverted CAG promoter, an inverted ChimI, and an inverted native human CD46 promoter. A portion of the inverted CD46 minigene may not be expressed.

[0054] As is clear from the above description, not all elements of the genomic insert contained in the living piglets of the present invention contribute equally to CD46 expression, and some may not contribute at all. Therefore, in a preferred embodiment, the porcine cell of the present invention includes a genomic insertion of polynucleotide(i), where polynucleotide(i) includes a human CD46 expression sequence and a promoter element that controls the expression of the human CD46 expression sequence, and the promoter element consists of the nucleotide sequence represented by SEQ ID NO: 1. In this embodiment, the promoter element preferably consists of a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. In another preferred embodiment, the porcine cell of the present invention includes a genomic insertion of polynucleotide(i), where polynucleotide(i) includes a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, the promoter element consists of the nucleotide sequence represented by SEQ ID NO: 1, and the nucleotide sequence of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 2. In this embodiment, the promoter element preferably consists of a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence. In another preferred embodiment, the porcine cell of the present invention comprises a polynucleotide(i) genomic insertion, where polynucleotide(i) comprises a CD46 expression sequence, a promoter element controlling the expression of the CD46 expression sequence, and a chimeric intron (ChimI), where the promoter element consists of the nucleotide sequence represented by SEQ ID NO: 1, the nucleotide sequence of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 2, and ChimI consists of the nucleotide sequence represented by SEQ ID NO: 8. In this embodiment, the promoter element preferably consists of a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence.In another preferred embodiment, the porcine cell of the present invention comprises a polynucleotide(i) genomic insertion, wherein the polynucleotide(i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, and the promoter element achieves a CD46 expression level approximately the same as that achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO: 1. In another preferred embodiment, the porcine cell of the present invention comprises a polynucleotide(i) genomic insertion, wherein the polynucleotide(i) comprises a CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, and the promoter element achieves a CD46 expression level approximately the same as that achieved by a porcine cell comprising the nucleotide sequence represented by SEQ ID NO: 15.

[0055] The nucleotide sequence of the entire rearranged expression cassette (also referred to herein as the entire “insert”) contained in the genome of a live-born piglet is represented by SEQ ID NO: 14. A schematic diagram of the nucleotide sequence of SEQ ID NO: 14 is shown in Figure 19A. Piglets containing this nucleotide sequence survived and showed particularly good human CD46 expression. Therefore, in one embodiment, the porcine cell according to the present invention includes a genomic insertion of polynucleotide(i), where polynucleotide(i) is a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 14, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 14, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 14, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 14. Most preferably, polynucleotide(i) is a nucleotide sequence represented by SEQ ID NO: 14.

[0056] In live-born piglets, the entire insert represented by Sequence ID No. 14 was incorporated into exon 8 of the endogenous (N-acetyllactosaminide) α-1,3-galactosyltransferase (GGTA1) gene. This insertion site provided the additional benefit of disrupting the porcine GGTA1 gene. The porcine GGTA1 gene encodes porcine GGTA1, which synthesizes galactose-α1,3-galactose (αGal). GGTA1 is deficient in humans and old-world monkeys, resulting in the absence of αGal. Immunogenic contact with bacterial αGal epitopes in the intestinal tract induces the production of anti-αGal antibodies early in life in humans and old-world monkeys. Consequently, αGal is a major xenoantigen that causes hyperacute xenograft rejection of porcine organs by humans or non-human primates after xenografting. The binding of pre-formed antibodies to αGal induces hyperacute rejection of xenografts from pigs to primates. Subsequent complement system activation is uncontrollable due to species incompatibility between regulators on the xenograft and effector molecules in the recipient (review: Kourtzelis et al., 2015). Therefore, disruption of the porcine GGTA1 gene, resulting in the loss of GGTA1 expression, is advantageous for xenografts from pigs to primates.

[0057] Accordingly, in one embodiment, the polynucleotide(i) of the present invention is inserted into the endogenous GGTA1 gene of a porcine cell. Preferably, the polynucleotide(i) of the present invention is inserted into an exon of the endogenous GGTA1 gene of a porcine cell, more preferably into exon 8 of the endogenous GGTA1 gene of a porcine cell. Preferably, insertion of the polynucleotide(i) of the present invention induces disruption of the endogenous GGTA1 gene, thereby causing loss of expression of porcine GGTA1.

[0058] When the polynucleotide(i) of the present invention is inserted into the genome of a pig cell, the polynucleotide(i) is flanked at its 5' and 3' ends by genomic sequences. In live piglets of the present invention, the entire insert represented by SEQ ID NO: 14 was integrated into a specific site in exon 8 of the GGTA1 gene. Therefore, in these piglets, the insert represented by SEQ ID NO: 14 was flanked by a specific genomic sequence in exon 8 of the GGTA1 gene. The nucleotide sequence represented by SEQ ID NO: 15 consists of the insert sequence of SEQ ID NO: 14 and a specific genomic sequence in exon 8 of GGTA1 flanking the 5' and 3' ends of the insert in live piglets. A schematic diagram of the nucleotide sequence of SEQ ID NO: 15 is shown in Figure 19B. Piglets containing this nucleotide sequence survived and showed particularly good human CD46 expression. Accordingly, in one embodiment, the porcine cells according to the present invention contain a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 15, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 15, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 15, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 15. Most preferably, the porcine cells according to the present invention contain the nucleotide sequence represented by SEQ ID NO: 15.

[0059] As is well known to those skilled in the art, cells have two alleles located on two chromosomes for most genes. Therefore, the polynucleotide(i) of the present invention can be inserted into one or both alleles of the endogenous GGTA1 gene. In the living piglets of the present invention, polynucleotide(i) was inserted into only one allele of the GGTA1 gene. Therefore, in a preferred embodiment, the polynucleotide(i) of the present invention is inserted into one allele of the endogenous GGTA1 gene.

[0060] The porcine cells of the present invention can be used to produce pigs that are suitable donors for xenotransplantation, for example, for xenotransplantation of porcine organs into humans. One aspect of the pathobiology of xenotransplantation of porcine organs is abnormalities in the coagulation pathway (reviews: Cowan & Robson, 2015, and Pierson et al., 2020). Mechanisms contributing to this include inflammatory immune responses, vascular damage, procoagulant surfaces on porcine epithelium, and molecular incompatibility between porcine and human / NHP coagulation regulators. While systemic, life-threatening consumptive coagulopathy can be avoided by means used to prevent hyperacute graft rejection, porcine hearts transplanted ectopically into the abdomen of baboons exhibited microvascular thrombosis, or thrombotic microangiopathy (TM), despite the recipient receiving anticoagulant therapy (see Mohiuddin et al., 2012, and Shimizu et al., 2008). TM can be avoided by transgenically expressing human thrombomodulin (hTBM) in donor pigs (e.g., Mohiuddin et al., 2016, and Iwase et al., 2015), overcoming the inability of porcine TBM, complexed with human thrombin, to promote the activation of human protein C in the anticoagulant pathway.

[0061] Accordingly, in one embodiment, the porcine cell according to the present invention further comprises a genomic insertion of polynucleotide(ii), where polynucleotide(ii) comprises a thrombomodulin (TBM) expression sequence and a promoter element that controls the expression of the TBM expression sequence. Polynucleotide(ii) may be located upstream or downstream of polynucleotide(i). Optionally, the TBM expression sequence is a TBM cDNA.

[0062] The TBM expression sequence according to the present invention may consist of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 16, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 16, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 16, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 16. Preferably, the nucleotide sequence of the TBM expression sequence according to the present invention consists of the nucleotide sequence represented by SEQ ID NO: 16.

[0063] In Examples 2.7 and 2.8, hTBM expression was controlled using an EF1A promoter having a CAG promoter consisting of the nucleotide sequence represented by SEQ ID NO: 5, or a CMV enhancer consisting of the nucleotide sequence represented by SEQ ID NO: 17. Therefore, in a preferred embodiment, the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level of 0.1 to 10 times, 0.2 to 5 times, 0.3 to 3 times, 0.5 to 2 times, or 0.8 to 1.2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5 or 17. Most preferably, the promoter element achieves a TBM expression level approximately identical to that achieved by the nucleotide sequence represented by SEQ ID NO: 5 or 17. Those skilled in the art are familiar with methods for determining and comparing TBM expression levels, such as the method described above for CD46 expression levels.

[0064] In other embodiments, the promoter element controlling the expression of the TBM expression sequence is a CAG promoter or an EF1A promoter having a CMV enhancer. Preferably, the promoter element consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 5 or 17, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 5 or 17, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 5 or 17, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 5 or 17. Most preferably, the promoter element controlling the expression of the TBM expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 5 or 17. In the polynucleotide(ii) according to the present invention, the promoter element controlling the expression of the TBM expression sequence is preferably located upstream of the TBM expression sequence so as to be able to control the expression of the TBM expression sequence.

[0065] In the polynucleotide(ii) of Examples 2.7 and 2.8, the chimeric intron (ChimI), consisting of the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18, was located between the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. Therefore, in one embodiment, the polynucleotide(ii) according to the present invention further comprises ChimI. In a preferred embodiment of the present invention, ChimI consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18. Most preferably, ChimI consists of the nucleotide sequence represented by SEQ ID NO: 6 or SEQ ID NO: 18. In the polynucleotide(ii) according to the present invention, ChimI is preferably located between the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence.

[0066] In the polynucleotide(ii) of Examples 2.7 and 2.8, the bGH or SV40 polyadenylation signal, consisting of the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20, was located downstream of the promoter element and the TBM expression sequence, respectively. Therefore, in one embodiment, the polynucleotide(ii) according to the present invention further comprises a polyadenylation signal. In a preferred embodiment, the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal or a Simian virus 40 (SV40) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20. Most preferably, the polyadenylation signal consists of the nucleotide sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20. In the polynucleotide (ii) according to the present invention, the polyadenylation signal is preferably located downstream of the promoter element and the TBM expression sequence so as to be able to mediate the polyadenylation of TBM mRNA.

[0067] In the polynucleotide(ii) of Examples 2.7 and 2.8, the ubiquita chromatin opening element (UCOE), which consists of the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21, was located upstream of the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence. Therefore, in one embodiment, the polynucleotide(ii) according to the present invention further comprises a UCOE. Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21. Most preferably, the UCOE consists of the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 21. In the polynucleotide(ii) according to the present invention, the UCOE is preferably located upstream of the TBM expression sequence and the promoter element that controls the expression of the TBM expression sequence.

[0068] In Example 2.7, the expression cassette containing hTBM under the control of the CAG promoter consisted of the nucleotide sequence represented by SEQ ID NO: 22. The expression cassette containing hTBM under the control of the EF1A promoter consisted of the nucleotide sequence represented by SEQ ID NO: 23. Therefore, in one embodiment, the polynucleotide(ii) of the present invention consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 22 or SEQ ID NO: 23, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 22 or SEQ ID NO: 23, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 22 or SEQ ID NO: 23, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 22 or SEQ ID NO: 23. Preferably, the polynucleotide(ii) consists of the nucleotide sequence represented by SEQ ID NO: 22 or SEQ ID NO: 23.

[0069] In Example 2.7, an expression cassette containing hTBM was targeted to exon 6 of the endogenous porcine GGTA1 gene under the control of a CAG promoter. This insertion site provided the further advantage of disrupting the porcine GGTA1 gene. Disruption of the porcine GGTA1 gene is advantageous for the reasons presented above with respect to the polynucleotide(i) of the present invention by causing loss of GGTA1 expression. Accordingly, in one embodiment, the polynucleotide(ii) of the present invention is inserted into the endogenous GGTA1 gene of a porcine cell. Preferably, the polynucleotide(ii) of the present invention is inserted into an exon of the endogenous GGTA1 gene of a porcine cell, more preferably into exon 6 of the endogenous GGTA1 gene of a porcine cell. Preferably, insertion of the polynucleotide(ii) of the present invention induces disruption of the endogenous GGTA1 gene, thereby causing loss of porcine GGTA1 expression.

[0070] As is known to those skilled in the art, cells have two alleles located on two chromosomes for most genes. Accordingly, the polynucleotide(ii) of the present invention can be inserted into one or both alleles of the endogenous GGTA1 gene.

[0071] In Example 2.7, polynucleotide(ii) (encoding hTBM) was targeted to a different locus than polynucleotide(i) (encoding CD46). While we do not wish to dwell on theory, sufficient distance between polynucleotides may lead to enhanced stability of genomic DNA. Therefore, in one embodiment, polynucleotide(i) and polynucleotide(ii) of the present invention are inserted into different loci. Preferably, the different loci are at least 2000 bp apart, or at least 5000 bp apart, or at least 10000 bp apart.

[0072] In one embodiment, the polynucleotide (i) and polynucleotide (ii) of the present invention are inserted into different loci of the endogenous GGTA1 gene, preferably into different exons of the endogenous GGTA1 gene. More preferably, polynucleotide (i) is inserted into exon 8 of the endogenous GGTA1 gene and polynucleotide (ii) is inserted into exon 6 of the endogenous GGTA1 gene.

[0073] In Example 2.7, when the nucleotide sequence of SEQ ID NO: 22 (sketched schematically in Figure 21A) is inserted into exon 6 of the GGTA1 gene, the resulting predicted genomic nucleotide sequence is represented by SEQ ID NO: 24 (sketched schematically in Figure 22A). When the nucleotide sequence of SEQ ID NO: 23 (sketched schematically in Figure 21B) is inserted into exon 6 of the GGTA1 gene, the resulting predicted genomic nucleotide sequence is represented by SEQ ID NO: 25 (sketched schematically in Figure 22B). Thus, in a preferred embodiment, the porcine cells of the present invention are at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25, and include a nucleotide sequence. Most preferably, the porcine cells include the nucleotide sequence represented by SEQ ID NO: 24 or SEQ ID NO: 25.

[0074] In Example 2.8, the polynucleotide (i) (encoding hCD46) and the polynucleotide (ii) (encoding hTBM) were located on a single polynucleotide. This provides the advantage that the polynucleotides (i) and (ii) are less likely to separate during cell division. If the polynucleotides (i) and (ii) are located on different polynucleotides, for example, on different chromosomes, the polynucleotides (i) and (ii) are quite likely to separate during cell division. Thus, in one embodiment, the polynucleotides (i) and (ii) of the present invention are located on a single polynucleotide.

[0075] The single polynucleotide of Example 2.8 further comprised a ubiquitous chromatin opening element (UCOE) consisting of the nucleotide sequence of SEQ ID NO: 4 between the polynucleotide (i) and the polynucleotide (ii). Thus, in one embodiment, the single polynucleotide described above further comprises a ubiquitous chromatin opening element (UCOE) located between the polynucleotide (i) and the polynucleotide (ii). Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 4, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 4, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 4, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 4. More preferably, the UCOE consists of the nucleotide sequence represented by SEQ ID NO: 4.

[0076] In Example 2.8, a novel targeting vector was targeted to exon 8 of the endogenous GGTA1 gene. The resulting expected genomic nucleotide sequence is represented by Sequence ID No. 26 (Schematically depicted in Figure 23). Therefore, in one embodiment, the porcine cells of the present invention contain a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by Sequence ID No. 26, or at least 95% identical to the nucleotide sequence represented by Sequence ID No. 26, or at least 98% identical to the nucleotide sequence represented by Sequence ID No. 26, or at least 99% identical to the nucleotide sequence represented by Sequence ID No. 26. Preferably, the porcine cells contain the nucleotide sequence represented by Sequence ID No. 26.

[0077] Disruption of the porcine GGTA1 gene is advantageous for the reasons presented above by causing loss of GGTA1 expression. Accordingly, in one embodiment, the porcine cells of the present invention further include disruption of the endogenous α-1,3-galactosyltransferase (GGTA1) gene. Disruption may be induced by insertion of polynucleotide (i) and / or (ii) of the present invention, or by other mutations. Disruption of the endogenous GGTA1 gene is preferably biallelel disruption. In this case, one allele may be disrupted by insertion of polynucleotide (i) and / or (ii) of the present invention, and the other allele may be disrupted by a different mutation. Alternatively, biallelel disruption may be induced by insertion of polynucleotide (i) and / or (ii) of the present invention. In the porcine cells of the present invention described in Example 2.6, one allele was disrupted by insertion of polynucleotide (i), and the other allele was disrupted by a different mutation. Therefore, in a preferred embodiment, in the porcine cells of the present invention, one allele is disrupted by the insertion of polynucleotide(i), and the other allele is disrupted by a different mutation.

[0078] The polynucleotides of Examples 2.7 and 2.8 are schematically depicted in Figures 21 and 23. Thus, these polynucleotides represent preferred embodiments of the present invention. In particular, in preferred embodiments, the porcine cells of the present invention include a genomic insertion of polynucleotide(i) in addition to a genomic insertion of polynucleotide(ii), where polynucleotide(ii) includes a human thrombomodulin (hTBM) expression sequence, a promoter element located upstream of the TBM expression sequence to control the expression of the human TBM expression sequence, and a chimeric intron (ChimI) located between the human TBM expression sequence and the promoter element. In this embodiment, it is preferable that the promoter element controlling the expression of the human TBM expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 5 and ChimI consists of the nucleotide sequence represented by SEQ ID NO: 6, or that the promoter element controlling the expression of the human TBM expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 17 and ChimI consists of the nucleotide sequence represented by SEQ ID NO: 18. In another preferred embodiment, the porcine cell of the present invention comprises genomic insertions of polynucleotides (i) and (ii) located on a single polynucleotide, wherein polynucleotide (i) comprises a human CD46 expression sequence and a promoter element that controls the expression of the CD46 expression sequence, the promoter element consisting of the nucleotide sequence represented by SEQ ID NO: 1, and polynucleotide (ii) comprises a human thrombomodulin (TBM) expression sequence located upstream of polynucleotide (i), a promoter element located upstream of the human TBM expression sequence that controls the expression of the human TBM expression sequence, and a chimeric intron (ChimI) located between the human TBM expression sequence and the promoter element. In this embodiment, it is preferable that the promoter element that controls the expression of the human TBM expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 5, and ChimI consists of the nucleotide sequence represented by SEQ ID NO: 6.

[0079] In Example 2.9, hTBM expression was controlled using an epithelial-specific ICAM2 promoter consisting of the nucleotide sequence represented by SEQ ID NO: 48, or an epithelial-specific porcine TBM promoter consisting of the nucleotide sequence represented by SEQ ID NO: 50. Epithelial-specific expression of hTBM may be preferred for the production of SCNTs and genetically modified pigs. Therefore, in a preferred embodiment, the promoter element controlling the expression of the TBM expression sequence achieves a TBM expression level of 0.1 to 10 times, 0.2 to 5 times, 0.3 to 3 times, 0.5 to 2 times, or 0.8 to 1.2 times the TBM expression level achieved by the nucleotide sequence represented by SEQ ID NO: 48 or 50. Most preferably, the promoter element achieves a TBM expression level that is approximately the same as the level achieved by the nucleotide sequence represented by SEQ ID NO: 48 or 50. Those skilled in the art are familiar with methods for determining and comparing TBM expression levels, such as the method described above for CD46 expression levels.

[0080] In other embodiments, the promoter element controlling the expression of the TBM expression sequence is an epithelial-specific ICAM2 promoter or an epithelial-specific porcine TBM promoter. Preferably, the promoter element consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 48 or 50, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 48 or 50, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 48 or 50, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 48 or 50. Most preferably, the promoter element controlling the expression of the TBM expression sequence consists of the nucleotide sequence represented by SEQ ID NO: 48 or 50. In the polynucleotide(ii) according to the present invention, the promoter element controlling the expression of the TBM expression sequence is preferably located upstream of the TBM expression sequence so as to be able to control the expression of the TBM expression sequence.

[0081] In the polynucleotide(ii) of Example 2.9, the first intron or a portion of ICAM2 intron 1 of the ICAM2 gene, consisting of the nucleotide sequence represented by SEQ ID NO: 47, was located upstream of the ICAM2 promoter element and the TBM expression sequence. Therefore, in one embodiment, the polynucleotide(ii) containing the ICAM2 promoter according to the present invention further comprises an intron. In a preferred embodiment, the intron is a chimeric intron. Preferably, the intron is all or part of the first intron of the ICAM2 gene, most preferably, the intron is all or part of the first intron of the porcine ICAM2 gene. Preferably, the first intron of the ICAM2 gene consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 47, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 47, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 47, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 47. Most preferably, the polyadenylation signal consists of the nucleotide sequence represented by SEQ ID NO: 47. In the polynucleotide (ii) containing the ICAM2 promoter according to the present invention, the first intron of the ICAM2 gene is preferably located upstream of the promoter element and the TBM expression sequence so as to be able to regulate TBM expression.

[0082] In the polynucleotide(ii) of Example 2.9, the bGH polyadenylation signal, consisting of the nucleotide sequence represented by SEQ ID NO: 19, was located downstream of the promoter element and the TBM expression sequence. Therefore, in one embodiment, the polynucleotide(ii) according to the present invention further comprises a polyadenylation signal. In a preferred embodiment, the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 19, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 19, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 19, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 19. Most preferably, the polyadenylation signal consists of the nucleotide sequence represented by SEQ ID NO: 19. In the polynucleotide(ii) according to the present invention, the polyadenylation signal is preferably located downstream of the promoter element and the TBM expression sequence so as to mediate the polyadenylation of TBM mRNA.

[0083] In Example 2.9, the expression cassette containing hTBM under the control of the ICAM2 promoter consisted of the nucleotide sequence represented by SEQ ID NO: 46. The expression cassette containing hTBM under the control of the epithelial-specific porcine TBM promoter consisted of the nucleotide sequence represented by SEQ ID NO: 49. Therefore, in one embodiment, the polynucleotide(ii) of the present invention consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 46 or SEQ ID NO: 49, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 46 or SEQ ID NO: 49, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 46 or SEQ ID NO: 49, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 46 or SEQ ID NO: 49. Preferably, the polynucleotide(ii) consists of the nucleotide sequence represented by SEQ ID NO: 46 or SEQ ID NO: 49. The polynucleotide of Example 2.9 is schematically shown in Figures 24A and B.

[0084] In Example 2.9, an expression cassette containing hTBM was targeted to exon 6 of the endogenous porcine GGTA1 gene under the control of a CAG promoter. This insertion site provided the further advantage of disrupting the porcine GGTA1 gene. Disruption of the porcine GGTA1 gene is advantageous for the reasons presented above with respect to the polynucleotide(i) of the present invention, by causing loss of GGTA1 expression. Accordingly, in one embodiment, the polynucleotide(ii) of the present invention is inserted into the endogenous GGTA1 gene of a porcine cell. Preferably, the polynucleotide(ii) of the present invention is inserted into an exon of the endogenous GGTA1 gene of a porcine cell, more preferably into exon 6 of the endogenous GGTA1 gene of a porcine cell. Preferably, insertion of the polynucleotide(ii) of the present invention induces disruption of the endogenous GGTA1 gene, thereby causing loss of porcine GGTA1 expression.

[0085] As is known to those skilled in the art, cells have two alleles located on two chromosomes for most genes. Accordingly, the polynucleotide(ii) of the present invention can be inserted into one or both alleles of the endogenous GGTA1 gene.

[0086] In Example 2.9, polynucleotide(ii) (encoding hTBM) targets a different locus than polynucleotide(i) (encoding CD46). While we do not wish to dwell on theory, sufficient distance between polynucleotides can lead to enhanced stability of genomic DNA. Therefore, in one embodiment, polynucleotide(i) and polynucleotide(ii) of the present invention are inserted into different loci. Preferably, the different loci are at least 2000 bp apart, or at least 5000 bp apart, or at least 10000 bp apart.

[0087] In one embodiment, polynucleotide(i) and polynucleotide(ii) of the present invention are inserted into different loci of the endogenous GGTA1 gene, preferably into different exons of the endogenous GGTA1 gene. More preferably, polynucleotide(i) is inserted into exon 8 of the endogenous GGTA1 gene, and polynucleotide(ii) is inserted into exon 6 of the endogenous GGTA1 gene.

[0088] Non-classical human leukocyte antigens (HLA)-G play an immunomodulatory role by binding to inhibitory receptors: Ig-like transcript 2 (ILT2) on dendritic cells, B cells, NK cells, and T cells; ILT4 on bone marrow-derived cells; and killer cell immunoglobulin-like receptor 2DL4 (KIR2DL4) on NK cells. HLA-G expression is beneficial and promotes graft tolerance in solid organ transplantation, as evidenced by the correlation between increased HLA-G expression in allografts and / or plasma and improved graft tolerance. HLA-G forms a complex with β2-microglobulin (B2M), and this complex formation is crucial for the recognition of specific inhibitory receptors. Therefore, the fusion of HLA-G and β2-microglobulin (B2M) is considered beneficial. For example, the immune tolerance function of the B2M-HLA-G fusion protein, that is, its ability to significantly delay allograft rejection, has been demonstrated.

[0089] Accordingly, in one embodiment, the porcine cells according to the present invention further include a genomic insertion of polynucleotide(iii), where polynucleotide(iii) includes a human β-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-G1) expression sequence and a promoter element that controls the expression of the hB2M / HLA-G1 expression sequence. Polynucleotide(iii) may be located upstream or downstream of polynucleotide(i) or polynucleotide(ii). Optionally, the hB2M / HLA-G1 expression sequence is an hB2M / HLA-G1 cDNA.

[0090] The hB2M / HLA-G1 expression sequence according to the present invention may consist of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 56, at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 56, at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 56, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 56. Preferably, the nucleotide sequence of the hB2M / HLA-G1 expression sequence according to the present invention consists of the nucleotide sequence represented by SEQ ID NO: 56.

[0091] In Example 2.10, hB2M-HLA-G1 expression was controlled using a CAG promoter consisting of the nucleotide sequence represented by SEQ ID NO: 5. Therefore, in a preferred embodiment, the promoter element controlling the expression of the hB2M-HLA-G1 expression sequence achieves an hB2M-HLA-G1 expression level that is 0.1 to 10 times, 0.2 to 5 times, 0.3 to 3 times, 0.5 to 2 times, or 0.8 to 1.2 times the hB2M-HLA-G1 expression level achieved by the nucleotide sequence represented by SEQ ID NO: 5. Most preferably, the promoter element achieves an hB2M / HLA-G1 expression level that is approximately the same as the level achieved by the nucleotide sequence represented by SEQ ID NO: 5. Those skilled in the art are familiar with methods for determining and comparing hB2M / HLA-G1 expression levels, such as the method described above for CD46 expression levels.

[0092] In the polynucleotide (iii) of Example 2.10, the chimeric intron (ChimI), consisting of the nucleotide sequence represented by SEQ ID NO: 6, was located between the hB2M / HLA-G1 expression sequence and the promoter element that controls the expression of the hB2M / HLA-G1 expression sequence. Therefore, in one embodiment, the polynucleotide (iii) according to the present invention further comprises ChimI. In a preferred embodiment of the present invention, ChimI consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 6, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 6, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 6, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 6. Most preferably, ChimI consists of the nucleotide sequence represented by SEQ ID NO: 6. In the polynucleotide (iii) according to the present invention, ChimI is preferably located between the hB2M / HLA-G1 expression sequence and the promoter element that controls the expression of the hB2M / HLA-G1 expression sequence.

[0093] In the polynucleotide (iii) of Example 2.10, the bGH signal consisting of the nucleotide sequence represented by SEQ ID NO: 19 was located downstream of the promoter element and the hB2M / HLA-G1 expression sequence. Therefore, in one embodiment, the polynucleotide (iii) according to the present invention further comprises a polyadenylation signal. In a preferred embodiment, the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal. Preferably, the polyadenylation signal consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 19, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 19, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 19, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 19. Most preferably, the polyadenylation signal consists of the nucleotide sequence represented by SEQ ID NO: 19. In the polynucleotide (iii) according to the present invention, the polyadenylation signal is preferably located downstream of the promoter element and the HB2M / HLA-G1 expression sequence so as to be able to mediate the polyadenylation of hB2M / HLA-G1 mRNA.

[0094] In the polynucleotide (iii) of Example 2.10, the ubiquita chromatin opening element (UCOE), consisting of the nucleotide sequence represented by SEQ ID NO: 21, was located upstream of the hB2M / HLA-G1 expression sequence and the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence. Therefore, in one embodiment, the polynucleotide (iii) according to the present invention further comprises a UCOE. Preferably, the UCOE consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 21, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 21, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 21, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 21. Most preferably, the UCOE consists of the nucleotide sequence represented by SEQ ID NO: 21. In the polynucleotide (iii) according to the present invention, the UCOE is preferably located upstream of the hB2M / HLA-G1 expression sequence and the promoter element controlling the expression of the hB2M / HLA-G1 expression sequence.

[0095] In Example 2.10, the expression cassette containing hB2M / HLA-G1 under the control of the CAG promoter consisted of the nucleotide sequence represented by SEQ ID NO: 51. Therefore, in one embodiment, the polynucleotide (iii) of the present invention consists of a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 51, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 51, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 51, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 51. Preferably, the polynucleotide (iii) consists of the nucleotide sequence represented by SEQ ID NO: 51.

[0096] In Example 2.10, an expression cassette containing hB2M / HLA-G1 is targeted to exon 6 of the endogenous porcine GGTA1 gene under the control of the CAG promoter. This insertion site provided the additional advantage of disruption of the porcine GGTA1 gene. Disruption of the porcine GGTA1 gene is advantageous for the reasons presented above with respect to the polynucleotide (i) of the present invention by causing loss of GGTA1 expression. Thus, in one embodiment, the polynucleotide (iii) of the present invention is inserted into the endogenous GGTA1 gene of a porcine cell. Preferably, the polynucleotide (iii) of the present invention is inserted into an exon of the endogenous GGTA1 gene of a porcine cell, more preferably into exon 6 of the endogenous GGTA1 gene of a porcine cell. Preferably, insertion of the polynucleotide (iii) of the present invention induces disruption of the endogenous GGTA1 gene, thereby causing loss of expression of porcine GGTA1.

[0097] As is known to those skilled in the art, cells have two alleles located on two chromosomes for most genes. Thus, the polynucleotide (iii) of the present invention can be inserted into one or both alleles of the endogenous GGTA1 gene.

[0098] The polynucleotides of Example 2.10 are schematically depicted in FIG. 25. Thus, these polynucleotides represent preferred embodiments of the present invention. In particular, in a preferred embodiment, the porcine cells of the present invention comprise genomic insertion of the polynucleotide (i) and genomic insertion of the polynucleotide (ii) in addition to genomic insertion of the polynucleotide (iii), where the polynucleotide (iii) comprises a human β-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-G1) expression sequence and a promoter element located upstream of the hB2M / HLA-G1 expression sequence that controls expression of the hB2M / HLA-G1 expression sequence.

[0099] Polynucleotide(ii) (encoding hTBM) and polynucleotide(iii) (encoding hB2M / HLA-G1) may be located on a single polynucleotide. This offers the advantage that polynucleotides(ii) and(iii) are less likely to separate during cell division. If polynucleotides(ii) and(iii) are located on different polynucleotides, for example, on different chromosomes, there is a considerably higher chance that polynucleotides(ii) and(iii) will separate during cell division. Therefore, in one embodiment, polynucleotides(ii) and(iii) of the present invention are located on a single polynucleotide. Polynucleotide(iii) may be located upstream or downstream of polynucleotide(ii), but preferably, polynucleotide(iii) is located downstream of polynucleotide(ii).

[0100] The single polynucleotide of Example 2.10 further comprises a ubiquitasch chromatin opening element (UCOE) between polynucleotide(iii) and polynucleotide(ii), the nucleotide sequence of SEQ ID NO: 21. Thus, in one embodiment, the single polynucleotide described above further comprises a ubiquitasch chromatin opening element (UCOE) located between polynucleotide(iii) and polynucleotide(ii). Preferably, the UCOE comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence represented by SEQ ID NO: 21, or at least 95% identical to the nucleotide sequence represented by SEQ ID NO: 21, or at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 21, or at least 99% identical to the nucleotide sequence represented by SEQ ID NO: 21. More preferably, the UCOE comprises the nucleotide sequence represented by SEQ ID NO: 21.

[0101] Accordingly, in another preferred embodiment, the porcine cell of the present invention comprises genomic insertions of polynucleotide(ii) and (iii) located on a single polynucleotide, where polynucleotide(ii) comprises a human thrombomodulin expression sequence and a promoter element that controls the expression of the thrombomodulin expression sequence, and polynucleotide(iii) comprises a promoter element located downstream of polynucleotide(ii) and upstream of the human β-2-microglobulin / human leukocyte antigen G1 (hB2M / HLA-G1) expression sequence and the human TBM expression sequence, which controls the expression of the human TBM expression sequence and is comprised of a nucleotide sequence represented by SEQ ID NO: 48 or 50, and a promoter element located upstream of the human hB2M / HLA-G1 expression sequence, which controls the expression of the human hB2M / HLA-G1 expression sequence and is comprised of a nucleotide sequence represented by SEQ ID NO: 5.

[0102] The porcine cells of the present invention may be used for xenotransplantation, for example, to produce pigs that are suitable donors for xenotransplantation of porcine organs into humans. Humans and non-human primates (NHPs) all develop antibodies during infancy that cross-react with antigens present on the cell surface of wild-type porcine cells (i.e., genetically unmodified cells derived from pigs). Therefore, when a wild-type porcine organ is transplanted into a human or baboon, these antibodies immediately bind to the vascular endothelial cells of the graft. Some of the bound antibodies activate the complement cascade, while others attract leukocytes that adhere and infiltrate via Fc receptor-dependent and Fc-independent mechanisms, and the graft is usually rejected within minutes to hours (Lexer et al., 1986). Hyperacute xenograft rejection of pig organs by humans or non-human primates is primarily caused by antibodies against galactose-α(1,3)-galactose (αGal), as described above. In addition, humans possess neutralizing antibodies against N-glycolylneuraminic acid (Neu5Gc) and glycans, which correspond to the human Sd(a) blood group antigen (often also called β4Gal). In contrast, NHPs possess only anti-αGal and anti-Sd(a) antibodies (reviews: Byrne et al., 2018, and Sykes & Sachs, 2019). To remove the αGal, Neu5Gc, and Sd(a) epitopes, which are target antigens of anti-xenografts, pigs in which the genes for α-1,3-galactosyltransferase (GGTA1), cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH), and β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) / B4GALNT2L) were inactivated, so-called triple knockout (TKO) pigs, were created as candidate pig organ donors for humans (review article: Reichart et al., 2023).

[0103] Accordingly, in one embodiment, the porcine cells of the present invention further include disruption of the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene. The disruption of the endogenous CMAH gene may be monoallele or biallele disruption. Pigs with monoallele disruption of the endogenous CMAH gene are suitable source pigs for preclinical xenotransplantation experiments, and biallele CMAH knockout has been proven to be harmful (Mohiuddin et al. 2022; Estrada et al. 2015; Yamamoto et al. 2020 a; Yamamoto et al. 2020 b; Cui et al. 2020; Iwase et al. 2021 a), but pigs with biallele disruption of the endogenous CMAH gene can be used for xenotransplantation from pig to human.

[0104] In other experiments, the porcine cells of the present invention further include disruption of the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene and disruption of the endogenous B4GALNT2-like (B4GALNT2L) gene (when "B4GALNT2 / B4GALNT2L" disruption is referred to herein, it refers to disruption of the B4GALNT2 gene and the B4GALNT2L gene). The disruption of the endogenous B4GALNT2 gene and the endogenous B4GALNT2L gene may be monoallelic or biallelic disruption. Pigs with monoallelic disruption of the endogenous B4GALNT2 gene and endogenous B4GALNT2L gene are suitable sources for xenotransplantation from pigs to baboons, and pigs with biallelic disruption of both the endogenous B4GALNT2 gene and endogenous B4GALNT2L gene are suitable sources for xenotransplantation from pigs to humans.

[0105] Complement can also be activated through pathways that do not involve antibody binding, such as the result of ischemia-reperfusion injury. For this reason, and to minimize the consequences of any anti-porcine antibodies that are pre-produced in the recipient or manifest after transplantation, additional protection of porcine organs from complement-mediated injury may prove beneficial in reducing xenograft injury. Protection of porcine organs from complement-mediated injury has been achieved by transgenic expression of human complement pathway regulatory proteins (CPRPs), namely CD46, CD55, and CD59, which inhibit the activation of the complement cascade. Pig-derived organs transgenic with one or more human CPRPs exhibit a high degree of protection against human complement-mediated injury (see Cozzi & White, 1995 and White et al., 1995). CD46 is a preferred CPRP in this invention. Accordingly, the porcine cells of this invention include a genomic insertion of a CD46 expression sequence, as described in detail above. Furthermore, since the present invention describes an approach to producing organ donor pigs having a minimal set of genetic modifications, the porcine cells of the present invention are preferably not genetically modified to express any other human CPRPs. For the same reason, in other preferred embodiments, the porcine cells of the present invention include only the genetic modifications described herein (in particular, inactivation of the porcine genes GGTA1, CMAH, and B4GALNT2 / B4GALNT2L, as well as transgenic expression of hCD46 and hTBM) and do not include further genetic modifications.

[0106] Nevertheless, in addition to hCD46, the combination of GGTA1, CMAH, and B4GALNT2 / B4GALNT2L TKO and human CPRP expression may further reduce damage to porcine cells (Yamamoto et al., 2021). Therefore, in other embodiments, the porcine cells of the present invention may be further genetically modified to express CPRP, particularly human CD55 and / or human CD59. Similarly, activation of human protein C in the anticoagulation pathway is enhanced by the additional expression of epithelial protein C receptor (EPCR), and although porcine EPCR has been shown to be functionally compatible with the human protein C pathway (Salvaris et al., 2020), transgenic pigs expressing human EPCR have been created and are expected to express EPCR at high levels, thereby enhancing protective thrombotic regulation. Therefore, in other embodiments, the porcine cells of the present invention may be further genetically modified to express human epithelial protein C receptor. Further genetic modifications that can be combined with the present invention are described in WO 2019 / 185936 (which is incorporated herein in its entirety for all purposes).

[0107] In a preferred embodiment of the present invention, the porcine cells of the present invention are primary cells. Primary cells were used in the examples of the present invention. Furthermore, since primary cells generally undergo only a few cell divisions in vitro, primary cells generally represent the in vivo state better than, for example, (tumor or artificially immortalized) cell lines.

[0108] In embodiments of the present invention, the porcine cells of the present invention may be porcine kidney cells, porcine heart cells, porcine lung cells, or porcine liver cells. Preferably, the porcine cells of the present invention are primary porcine kidney cells, primary porcine heart cells, primary porcine lung cells, or primary porcine liver cells. Primary porcine kidney cells were used in Example 2.2. Therefore, in preferred embodiments, the porcine cells of the present invention are porcine kidney cells, preferably primary porcine kidney cells. Details of primary porcine kidney cells and their genetic manipulation are described in the book by Richter et al. (2012) (the whole of which is incorporated herein). In particular, the genetic modification(s) of primary porcine kidney cells according to the present invention are preferably introduced as described in Richter et al. (2012). As will be apparent to those skilled in the art, (primary) porcine kidney cells may be, for example, (primary) porcine renal epithelial cells or (primary) porcine renal fibroblasts. In other embodiments of the present invention, the porcine cells of the present invention may be stem cells, for example, embryonic stem cells, adult stem cells, or induced pluripotent stem cells.

[0109] The porcine cells of the present invention may be derived from various pigs, such as pigs with a genetic background of German Landrace / Large White crosses, Duroc pigs, Schwaebisch-Haellische pigs, black mini pigs, or Auckland Island pigs. However, what has been consistently observed in preclinical studies of xenotransplantation of the heart is the harmful overgrowth of the xenogeneic heart (e.g., Langin et al., 2018). One idea to address this challenge is to create donor pigs with loss-of-function mutations in the growth hormone receptor (GHR) gene, which reduced their body and organ weight by up to approximately 50% without causing major metabolic disorders (see discussion in Hinrichs et al., 2018, Riedel et al., 2020, and Iwase et al., 2021b; also see WO 2019 / 185936). Holistic proteome analysis of GHR-deficient porcine hearts showed no signs of major molecular abnormalities (Hinrichs et al., 2021). Recent studies have demonstrated that GHR deficiency facilitates the survival of orthotopic porcine heart xenografts beyond 6 months, among other genetic modifications (see Goerlich et al., 2021 and Mohiuddin et al., 2022). Therefore, in one embodiment, the porcine cells and the pigs according to the present invention may have disruption of the endogenous GHR gene. Preferably, the disruption of the endogenous GHR gene is biallele disruption.

[0110] In an alternative and preferred approach according to the present invention, the genetic modification is based on Auckland Island (AI) pigs adapted to human size. Morphologically, Auckland Island pigs are smaller in body size compared to many domestic pig bloodlines, and their organ size is highly suitable for transplantation into humans. Furthermore, echocardiography of Auckland Island pig hearts showed normal structure and function across various age groups throughout the study. Single nucleotide polymorphism (SNP) analysis revealed that Auckland Island pigs have a higher number of runs of homozygosity (ROH) compared to other domestic pig bloodlines, and demonstrated that the entire locus encoding porcine leukocyte antigen (SLA) is homozygous. High ROH levels indicate a high degree of inbreeding. However, surprisingly, no signs of inbreeding depression were found. In addition, AI pigs have blood type O, naturally overcoming a major barrier in xenotransplantation; that is, AI pigs are less likely to elicit a robust immune response in humans. Based on these findings, Auckland Island pigs are considered a promising genetic background for organ xenotransplantation (Lange et al., 2024). Compared to other pig bloodlines, AI pigs are extremely difficult to clone. Consequently, to date, there have been no reports of genetically modified AI pigs.

[0111] AI pig cells and AI pigs were also used in the embodiments of the present invention. Therefore, in preferred embodiments, the pig cells of the present invention are derived from AI pigs, that is, the pig cells of the present invention are preferably AI pig cells.

[0112] The porcine cells of the present invention may be isolated porcine cells.

[0113] The composition of the present invention, pig organs, and pig The present invention also provides a composition comprising the porcine cells and cell culture medium of the present invention.

[0114] The present invention also provides a porcine organ comprising the genetic modification(s) described above with respect to the porcine cells of the present invention, and a porcine organ comprising the porcine cells of the present invention. The porcine organ may be a porcine heart, porcine kidney, porcine lung, or porcine liver. Preferably, the porcine organ is a porcine heart. The porcine organ may be derived from an Auckland Island pig comprising the genetic modification(s) described above with respect to the porcine cells of the present invention. As described above, the Auckland Island pig is suitable for human size. The porcine organ of the present invention may be an isolated porcine organ.

[0115] The present invention also provides pigs comprising the genetic modifications(s) described above with respect to the porcine cells of the present invention, and pigs comprising the porcine cells or porcine organs of the present invention. The pigs are preferably Auckland Island pigs.

[0116] The porcine cells, composition, organs, and pigs of the present invention are preferably free from specific pathogens (SPF). In particularly preferred embodiments, the porcine cells, composition, organs, and pigs of the present invention are free from porcine endogenous retrovirus type C (PERV-C).

[0117] Suitability and use in xenotransplantation For the reasons presented in detail above, the porcine cells, compositions, organs, and pigs of the present invention can be used for xenotransplantation. Accordingly, the present invention also provides the porcine cells, compositions, organs, and pigs of the present invention, where the porcine cells, compositions, organs, or pigs are each intended for use in xenotransplantation or in xenotransplantation methods. The use of the porcine cells, compositions, organs, and pigs of the present invention for xenotransplantation, and a xenotransplantation method comprising the step of transplanting the porcine cells or organs of the present invention are also provided. The xenotransplantation may be a xenotransplantation from a pig to a baboon, or a xenotransplantation from a pig to a human.

[0118] Human transgenes in porcine xenografts are generally suitable for both xenografting from pigs to baboons and xenografting from pigs to humans. Therefore, in particularly preferred embodiments of the present invention, the transgene is a human transgene. In particular, in the porcine cells, compositions, organs, and pigs of the present invention, the genomic insertion of a CD46 transgene is preferably a genomic insertion of a human CD46 transgene, i.e., the CD46 expression sequence is preferably a human CD46 expression sequence, and the promoter element controlling the expression of the CD46 expression sequence is preferably at least a portion of a human native CD46 promoter. Similarly, in the porcine cells, compositions, organs, and pigs of the present invention, the genomic insertion of a thrombomodulin (TBM) transgene is preferably a genomic insertion of a human TBM transgene, i.e., the TBM expression sequence is preferably a human TBM expression sequence.

[0119] Method for producing porcine cells, porcine cell populations, or pigs. The present invention also provides a method for producing porcine cells, the method comprising the step of inserting a polynucleotide (i) into the genome of the porcine cells. The method may further comprise the step of inserting a polynucleotide (ii) into the genome of the porcine cells. The method may further comprise the step of disrupting at least one allele of the endogenous GGTA1 gene of the porcine cells. The disruption step may comprise the step of disrupting both alleles of the endogenous GGTA1 gene of the porcine cells. The method may further comprise the step of disrupting the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene of the porcine cells. The disruption step may comprise the step of disrupting both alleles of the endogenous CMAH gene of the porcine cells. The method may further comprise the step of disrupting the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene and the endogenous B4GALNT2-like (B4GALNT2L) gene of the porcine cells. The disruption step may include disrupting both alleles of the endogenous B4GALNT2 / B4GALNT2L gene in porcine cells. Those skilled in the art are well aware of methods for genetically modifying porcine cells, such as methods for inserting transgenes or disrupting endogenous genes. For example, as described in the embodiments of the present invention, the insertion step preferably includes homologous recombination repair (HDR) based on CRISPR-Cas9, and the disruption step preferably includes non-homologous end joining (NHEJ) based on CRISPR-Cas9. The method for producing porcine cells of the present invention may be an in vitro method.

[0120] The present invention also provides a method for producing a population of genetically modified porcine cells, wherein the genetically modified porcine cells are the porcine cells of the present invention, and the method comprises the step of exposing the porcine cell population to a genome modification treatment comprising the step of inserting a polynucleotide(i) into the genome of the porcine cells. The method may further comprise the step of isolating a subpopulation of porcine cells expressing CD46 (encoded by polynucleotide(i)). The genome modification treatment may further comprise the step of inserting a polynucleotide(ii) into the genome of the porcine cells. The method may further comprise the step of isolating a subpopulation of porcine cells expressing thrombomodulin (TBM, encoded by polynucleotide(ii)). The genome modification treatment may further comprise the step of disrupting at least one allele of the endogenous GGTA1 gene of the porcine cells. The disruption step may comprise the step of disrupting both alleles of the endogenous GGTA1 gene of the porcine cells. This method may further include the step of isolating a subpopulation of porcine cells that do not express or express α-1,3-galactosyltransferase (GGTA1) or have low expression. The genome modification treatment may further include the step of disrupting the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene in porcine cells. The disruption step may include the disruption of both alleles of the endogenous CMAH gene in porcine cells. This method may further include the step of isolating a subpopulation of porcine cells that do not express or express CMAH or have low expression. The genome modification treatment may further include the steps of disrupting the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene in porcine cells and the B4GALNT2-like (B4GALNT2L) gene. The disruption step may include the disruption of both alleles of the endogenous B4GALNT2 / B4GALNT2L gene in porcine cells. This method may further include the step of isolating a subpopulation of porcine cells that do not express or express B4GALNT2 / B4GALNT2L at a low level. Genomic modification treatments may include CRISPR-Cas9-based homologous recombination repair (HDR) and / or CRISPR-Cas9-based non-homologous end joining (NHEJ).Those skilled in the art are well aware of methods for isolating genetically modified porcine cells, for example, subpopulations of genetically modified porcine cells that express a transgene or do not express an endogenous gene. This can be carried out, for example, as described in the examples of the present invention. The method for producing a population of genetically modified porcine cells may be an in vitro method.

[0121] The present invention also provides a method for producing pigs according to the present invention. The method may include producing a population of genetically modified pig cells as described above, and using the cell population to produce genetically modified pig embryos by somatic cell nuclear transfer (SCNT). SCNT is preferably carried out according to the standard protocol described in Kurome et al., 2015 (which is incorporated herein in its entirety).

[0122] Methods for creating genetically modified pigs When the inventors created a clonal population of genetically modified pig cells and used them for SCNTs, full-term development of the cloned embryos was not achieved. It was concluded that the selection of single-cell clones causes stress on the cells that may be detrimental to the effectiveness of the cells in SCNTs (see Example 2.3). To avoid this stress, the inventors developed an alternative approach that relies on bulk cell samples (see Example 2.4). The bulk cell sample approach has the additional advantage of reducing the time required to prepare cell samples for SCNTs and to produce genetically modified pigs.

[0123] Accordingly, the present invention also provides a method for producing genetically modified pigs, the method comprising, in order: (1) exposing a population of pig cells to a genome modification treatment; (2) isolating a non-clonal subpopulation of pig cells containing the genome modification; and (3) using the non-clonal subpopulation of genetically modified pig cells obtained in step (2) for somatic cell nuclear transfer (SCNT). The SCNT is preferably carried out according to the standard protocol described in Kurome et al., 2015 (which is incorporated herein in its entirety).

[0124] The method for producing genetically modified pigs according to the present invention has the advantage that the step of producing bulk cell samples requires less time than the step of producing single-cell clones (compare Figures 6 and 10), and as a result, the time required to produce cells for SCNT is significantly reduced. Accordingly, in one embodiment, in the method for producing genetically modified pigs according to the present invention, SCNT is performed within 40 days from the step of exposing the pig cell population to the genome modification treatment, or within 30 days from the step of exposing the pig cell population to the genome modification treatment, or within 25 days from the step of exposing the pig cell population to the genome modification treatment. In a preferred embodiment, SCNT is performed within 20 days from the step of exposing the pig cell population to the genome modification treatment. In another preferred embodiment, SCNT is performed within 18 days from the step of exposing the pig cell population to the genome modification treatment.

[0125] Furthermore, the number of cell passages required to produce a sample of genetically modified cells that can be used for SCNT is significantly less with the bulk cell sample approach than with the single-cell cloning approach (compare Figures 6 and 10). Accordingly, in one embodiment, in the method for producing genetically modified pigs of the present invention, the non-clonal subpopulation of genetically modified pig cells is passaged 18 times or less, or 15 times or less, before SCNT. In a preferred embodiment, the non-clonal subpopulation of genetically modified pig cells is passaged 12 times or less before SCNT.

[0126] In the method for producing genetically modified pigs of the present invention, the genome modification treatment preferably includes CRISPR-Cas9-based homologous recombination repair (HDR) and / or CRISPR-Cas9-based non-homologous end joining (NHEJ), as used in the examples of the present invention.

[0127] In the method for producing genetically modified pigs according to the present invention, the pig cells are preferably primary pig cells. Primary cells generally undergo only a few cell divisions in vitro, and therefore generally represent the in vivo state better than, for example, (tumor or artificially immortalized) cell lines. Primary pig cells may be derived from pigs less than three weeks old.

[0128] In the method for producing genetically modified pigs according to the present invention, the porcine cells may be porcine kidney cells, porcine heart cells, porcine lung cells, or porcine liver cells. Preferably, the porcine cells are primary porcine kidney cells, primary porcine heart cells, primary porcine lung cells, or primary porcine liver cells. Primary porcine kidney cells were used in Example 2.2. Therefore, in a preferred embodiment, the porcine cells are porcine kidney cells, and preferably primary porcine kidney cells. Details of primary porcine kidney cells and their genetic manipulation are described in the book by Richter et al. (2012) (the whole book is incorporated herein). In particular, the genomic modification treatment of primary porcine kidney cells according to the present invention is preferably carried out as described in Richter et al. (2012).

[0129] As will be apparent to those skilled in the art, (primary) porcine kidney cells include (primary) porcine kidney epithelial cells and (primary) porcine kidney fibroblasts. In the embodiments of the present invention, the proportion of primary porcine kidney fibroblasts increased during the preparation of cell samples for SCNTs. Thus, in one embodiment of the method for producing genetically modified pigs according to the present invention, porcine kidney cells include porcine kidney epithelial cells and porcine kidney fibroblasts. In other embodiments, the non-clonal subpopulation of genetically modified porcine cells used for SCNTs mainly consists of genetically modified porcine kidney fibroblasts, i.e., more than 50% of the cells in the non-clonal subpopulation of genetically modified porcine cells are genetically modified porcine kidney fibroblasts.

[0130] As described in Example 2.4 of the present invention, the bulk cell sample approach does not include the step of isolating single-cell clones (SCCs). For this reason, the non-clonal subpopulation of genetically modified pig cells in Example 2.4 contained a very large number of different clonal subpopulations. Accordingly, in one embodiment of the method for producing genetically modified pigs of the present invention, the method does not include the step of isolating single-cell clones. In a preferred embodiment, the non-clonal subpopulation of genetically modified pig cells used for SCNTs contains at least 5 different clonal subpopulations, or at least 10 different clonal subpopulations. In a preferred embodiment, the non-clonal subpopulation of genetically modified pig cells used for SCNTs contains at least 20 different clonal subpopulations.

[0131] The method for producing a genetically modified pig of the present invention does not include the step of isolating single cell clones (SCC), so through this method, the cell density is maintained relatively high. Without wishing to be bound by theory, the inventors believe that maintaining such a relatively high cell density reduces stress on the cells and thus contributes to the success of SCNT. Therefore, in one embodiment of the method for producing a genetically modified pig of the present invention, the cell density of the (sub)population of pig cells does not decrease below 200 cells / ml, or does not decrease below 100 cells / ml. Preferably, the cell density of the (sub)population of pig cells does not decrease below 50 cells / ml. In other embodiments, the cell density of the (sub)population of pig cells does not decrease below 100 cells / cm 2 culture surface area, or does not decrease below 50 cells / cm 2 culture surface area. Preferably, the cell density of the (sub)population of pig cells does not decrease below 20 cells / cm 2 culture surface area. In other embodiments, the non-cloned subpopulation of genetically modified pig cells used for SCNT contains at least 1 x 10 6 , or at least 5 x 10 6 , or at least 1 x 10 7 , or at least 5 x 10 7 genetically modified pig cells. Preferably, the non-cloned subpopulation of genetically modified pig cells used for SCNT contains at least 1 x 10 8 genetically modified pig cells.

[0132] The method for producing a genetically modified pig of the present invention may further include the step of transplanting 100 - 150 embryos of genetically modified pigs into recipient pigs after SCNT.

[0133] In the method for producing genetically modified pigs of the present invention, the genetically modified pigs are preferably the pigs of the present invention as described above. Therefore, the genetically modified pigs may contain one or more of the gene modifications described above, and / or the genetically modified pigs may contain the (genetically modified) pig cells of the present invention. Furthermore, the method for producing genetically modified pigs of the present invention may include a method for producing a population of genetically modified pig cells of the present invention as described above. In one embodiment, the method for producing a population of genetically modified pig cells of the present invention produces pig cells containing disruption of the endogenous GGTA1 gene, disruption of the endogenous CMAH gene, disruption of the endogenous B4GALNT2 / B4GALNT2L gene, genomic insertion of a CD46 (preferably human CD46) expression sequence, and genomic insertion of a TBM (preferably human TBM) expression sequence.

[0134] A method for producing genetically modified pigs according to the present invention may further include the step of crossing a first pig containing one or more genetically modified pig cells and / or (genetically modified) pig cells of the present invention with a second pig containing one or more genetically modified pig cells and / or (genetically modified) pig cells of the present invention. For example, in Example 1 of the present invention, strain A has biallele knockout of the endogenous GGTA1 gene and genomic insertions of hCD46 and hTBM into the GGTA1 locus. Strain B has biallele knockout (TKO) of the endogenous GGTA1, CMAH, and B4GALNT2 / B4GALNT2L genes. Crossing (i.e., mating) the two strains results in a pig that is αGal deficient and expresses hCD46 and hTBM, and is heterozygous for the CMAH and B4GALNT2 / B4GALNT2L mutations. Accordingly, in a preferred embodiment of the method for producing genetically modified pigs of the present invention, the method further comprises the step of crossing a first pig containing porcine cells containing a genomic insertion of a CD46 (preferably human CD46) expression sequence, a genomic insertion of a TBM (preferably human TBM) expression sequence, and biallele disruption of the endogenous GGTA1 gene with a second pig containing porcine cells containing biallele disruption of the endogenous GGTA1 gene, biallele disruption of the endogenous CMAH gene, and biallele disruption of the endogenous B4GALNT2 / B4GALNT2L gene.

[0135] The present invention will be described below by examples, but will not be limited thereto. [Examples]

[0136] (Example 1) Strategy To enable the breeding of genetically modified donor pigs for preclinical and clinical xenotransplantation studies, we designed the gene modification strategy shown in Figure 1.

[0137] Two strains of founder pigs are created: one (Strain A) has both allele knockouts of GGTA1 and expression cassettes for hCD46 and hTBM inserted into the GGTA1 locus. The other (Strain B) is deficient in GGTA1, CMAH, and B4GALNT2 / B4GALNT2L (TKO). Crossing the two strains yields F1 pigs that are deficient in αGal and express hCD46 and hTBM, but are simply heterozygous for the CMAH and B4GALNT2 / B4GALNT2L mutations. These pigs are suitable sources for preclinical xenotransplantation experiments because both allele knockouts of CMAH have been proven to be harmful (Mohiuddin et al. 2022; Estrada et al. 2015; Yamamoto et al. 2020 a; Yamamoto et al. 2020 b; Cui et al. 2020; Iwase et al. 2021 a). In the F2 generation, TKO pigs expressing hCD46 and hTBM were obtained as organ sources for preliminary clinical studies.

[0138] (Example 2) Development of System A Example 2 describes the development of line A according to Figure 1.

[0139] (Example 2.1) Plasmid preparation Experimental Design The objective was to incorporate two transgenes into the GGTA1 locus using CRISPR-Cas9-based homologous recombination repair (HDR). Insertion of the transgene cassette into the GGTA1 locus generates GGTA1 knockout and hCD46 / hTBM knock-in in a single step.

[0140] The porcine GGTA1 gene has eight exons, and exon 8 was targeted for introduction of the transgene. The CRISPR-Cas9 system was used as a ribonucleoprotein (RNP) complex. A highly efficient gRNA targeting exon 8 (E8) of porcine GGTA1 was designed and synthesized using Synthego. (Figure 2A) CTGACGAGTTCACCTACGAG AGG (AGG is a PAM sequence) (Sequence ID 37) For HDR-based targeted integration of the transgene, a 751-base pair homology arm was designed and fitted to the GGTA1 sequence on either side of the target site of the sgRNA. (Figure 2B) The GGTA1-E8 gRNA is also incorporated into the 5' and 3' ends of HA, acting as internal cleavage sites, and this donor plasmid is referred to as a "dual-cut donor plasmid." In this method, only one sgRNA targets GGTA1 E8, creating double-strand breaks (DSBs) and cleaving the donor plasmid, thereby inducing its internal linearization.

[0141] Expression cassette for human transgenes Two human transgenes were integrated into the GGTA1 locus via CRISPR-Cas9-based HDR. Human complement regulatory protein (hCD46), also known as the cluster of differentiation antigens. Human thrombomodulin (hTBM) Expression cassettes for hCD46 and hTBM were prepared separately and then cloned into GGTA1 E8 HA. The hCD46 expression cassette contained a ubiquitous chromatin opening element (A2UCOE) for stable expression, a CAG promoter with a chimeric intron (ChimI), and an hCD46 minigene. The hCD46 minigene contained the CD46 promoter 826 bp upstream of the transcription start site of exon 1, followed by exon 1, intron 1, exon 2, intron 2, exons 3-13, and the SV40 poly(A) signal. (Figure 3A) The hTBM expression cassette included a ubiquitous chromatin opening element (A2UCOE) for stable expression, a CAG promoter with a chimeric intron (ChimI), an hTBM cDNA sequence, and a bovine growth hormone (bGH) poly(A) signaling pathway. (Figure 3B)

[0142] Synthesis of dual-cut donor plasmids To obtain a dual-cut donor plasmid (E8-HAs / hCD46 / hTBM), cloning was performed in two steps: restriction digestion and ligation. In the first step, the expression cassette for hCD46 was cloned into GGTA1 E8 HA to construct the E8-HAs / hCD46 plasmid (Figure 4A). In the second step, the hTBM expression cassette was cloned downstream of the hCD46 expression cassette to construct the E8-HAs / hCD46 / hTBM plasmid (Figure 4B). This final dual-cut donor plasmid (E8-HAs / hCD46 / hTBM) contained two internal cleavage sites (target sequence for E8 sgRNA + PAM) upstream of the 5'-HA and downstream of the 3'-HA (Figure 4B).

[0143] (Example 2.2) Transfection and selection (screening) of porcine cells Nucleofection for the integration of the transgene into porcine GGTA1 E8 1) Oakland pig-derived porcine kidney cells (pKC-AUCK) for GGTA1 knockout and human transgene knock-in. 2) As described above, the CRISPR-Cas9 system was used as the RNP complex. 3) The RNP complex and donor plasmid were transfected to pKC-AUCK by nucleofection (an electroporation-based transfection method) using Amaxa-biosystems' Nucleofector I. Note: The sgRNA sequence used to target GGTA1 exon 8 is: TIFF2026518296000001.tif6139 (AGG is a PAM sequence) (Sequence ID 37). 4) Briefly, 37.5 picomoles of sgRNA targeting GGTA1 E8 and 37.5 picomoles of Cas9 protein (Thermo Scientific's True-cut Cas9 V2) were mixed in 100 μL of nucleofection solution. This mixture was incubated at room temperature for at least 10 minutes to form the RNP complex. 5) During the incubation period, one million pKC-AUCK cells were pelletized in a tube by centrifugation. 6) After incubation, 4 μg of dual-cut donor plasmid (E8-HAs / hCD46 / hTBM) was added to the RNP mixture. 7) The cell pellet was resuspended in the RNP donor plasmid mixture, transferred to an electroporation cuvette, and the cells were nucleofected using Nucleofector I. 8) Immediately after nucleofection, the cells were seeded in a suitable cell medium containing additives on 10 cm collagen-coated plates. 9) After 72 hours of culture, cells were harvested and selected for the absence of Gal epitopes (confirmation of GGTA1 knockout) and the presence of hCD46. 10) Both negative and positive selection were performed using the Magnetic Activated Cell Sorting (MACS) system from Miltenyi Biotec.

[0144] Predicted gene assembly of animals produced by sorted cells or SCNTs 1) The RNP complex targets two target sites integrated into GGTA1 E8 and the donor plasmid (E8-HAs / hCD46 / hTBM). The RNP complex creates double-strand breaks (DSBs) in genomic DNA and linearizes the donor plasmid. 2) The linearized donor plasmid is incorporated into the DSB by homologous recombination repair (HDR). 3) Figure 5 shows a schematic diagram illustrating the expected development of new genotypes after the integration of the introduced gene.

[0145] Selection of Gal-negative cells The following protocol was used to select Gal-negative cells: 1) Collect cells from the 10cm plate and pelletize them in a tube by centrifugation at 300×g for 5 minutes. 2) Resuspend the cell pellet in 100 μl of MACS buffer and incubate the cells with biotin-labeled isolectin GS-IB4 (Thermo Scientific - 121414) at 4°C for 15 minutes. Isolectin IB4 binds to Gal epitopes on the cells. 3) Wash the cells with MACS buffer, resuspend them in 90 μl of MACS buffer, add 10 μl of streptavidin microbeads (Miltenyi Biotec - 130-048-102), and incubate at 4°C for 15 minutes. 4) Wash the cells with 2 mL of MACS buffer and resuspend them in 500 μl of MACS buffer. 5) Place the LS-MACS column in a suitable MACS separator. 6) Rinse with 3 mL of MACS buffer to prepare the column. 7) Apply the cell suspension to the column. 8) Collect the unlabeled cells that pass through. This is the unlabeled cell fraction, which contains no Gal epitopes whatsoever.

[0146] Selection of hCD46-positive cells The following protocol was used to select hCD46-positive cells: 1) Using cells derived from the negative sorting step described above, pellet them in a tube by centrifugation at 300×g for 5 minutes. 2) Resuspend the cell pellet in 100 μl of MACS buffer and incubate the cells with biotin-labeled hCD46 antibody (Miltenyi Biotec - 130-105-585) at 4°C for 15 minutes. 3) Wash the cells with MACS buffer, resuspend them in 90 μl of MACS buffer, add 10 μl of streptavidin microbeads (Miltenyi Biotec - 130-048-102), and incubate at 4°C for 15 minutes. 4) Wash the cells with 2 mL of MACS buffer and resuspend them in 500 μl of MACS buffer. 5) Place the LS-MACS column in a suitable MACS separator. 6) Rinse with 3 mL of MACS buffer to prepare the column. 7) Apply the cell suspension onto the column. hCD46-positive cells (adhering to the microbeads) will not pass through. 8) Wash the column twice with 3 ml of MACS buffer. 9) Collect the column from the MACS separator and flush the cells out of the column using 5 ml of MACS buffer. 10) This cell fraction contains GGTA1 KO (Gal-negative) and hCD46-positive cells (see Figure 9A). 11) From this point onward, cells were used to produce single-cell clones (SCCs) for SCNT, or (in the development approach described below) were cultured and further selected to produce bulk cell samples, as described in Examples 2.3 and 2.4 respectively.

[0147] Example 2.3: Single-cell cloning approach After initial negative and positive sorting of cells (see Example 2.2 above), single-cell clones (SCCs) were generated for SCNTs. The targeted construct was transfected into primary kidney cells derived from Auckland Island (AI) pigs, and single-cell clones were selected for targeted construct incorporation by PCR. The following protocol was used for single-cell clone generation: 1) All plates used in this protocol were collagen-coated. 2) Cells collected after negative and positive sorting were seeded into 96-well plates, and single-cell clones were created. 3) After counting the cells, a total of 3 cells were seeded in 150 μl of culture medium in each well of a 96-well plate. 4) The culture medium on these cells was regularly replaced every three days. 5) On approximately day 12-14, the plates were examined and wells containing only single, healthy clones were marked. 6) The selected clones were subcultured into new 96-well cells and incubated for an additional 2-3 days until they reached 80-90% confluence. 7) Once confluence was reached, the single-cell clone was passaged into 1-3 wells. 8) At confluence, genomic DNA was extracted using cells from one well, while cells from the other two wells were cryopreserved for SCNT. 9) The successful integration of the introduced gene was confirmed by multiple overlapping PCRs and broad-spectrum PCRs. 10) Only clones in which the entire transgene expression cassette was inserted into one or both alleles of the GGTA1 locus were used as SCNTs.

[0148] The workflow described above for generating single-cell clones is illustrated in Figure 6. Properly targeted cell clones were used for somatic cell nuclear transfer (SCNT) according to standard protocols (Kurome et al., 2015).

[0149] Key points about single-cell clones 1) In SCC, integration of the entire transgene cassette (including both hCD46 and hTBM) at the targeted GGTA1-E8 locus was confirmed. 2) SCC may have an introduced gene insertion in one or both alleles. 3) This is a one-step knockout / knock-in model. If the transgene is integrated into the GGTA1-E8 locus, GGTA1 is automatically knocked out. 4) Therefore, when both alleles of the transgene are inserted into the GGTA1-E8 locus, both GGTA1 loci are knocked out (Figure 7A). On the other hand, in the case of a single allele insertion, knockout of the second GGTA1 locus was confirmed by Sanger sequencing (Figure 7B). 5) Both types of SCCs, with the transgene insertion in either one allele or both alleles, were used in SCNT (Figure 8A). At each time point, the recipients were pregnant, but fetal / conception product resorption occurred between 5 and 7 weeks (Figure 8B). 6) Two recipients were necropsied at either the 6th or 7th week, and elongated conception products were recovered, but fetal tissue development could not be detected (Figure 9B). 7) Analysis of the recovered tissue showed that it had complete integration of the transgene (as observed in SCCs prior to SCNT) and expressed hCD46 and hTBM.

[0150] Therefore, overall, although some early pregnancies were achieved, full-term development of cloned embryos was not obtained. It was concluded that the selection of single-cell clones may be detrimental to the effectiveness of SCNTs of cells. Based on the results of different SCNTs and observations during SCC production, early resorption of the conception product / fetus may be due to stress on the cells during SCC production and the simultaneous, potent expression of two human transgenes, particularly hCD46.

[0151] Example 2.4: Bulk cell sample approach Given the failures of the single-cell cloning approach described above, a selection procedure was established to obtain bulk cell samples by selecting cells lacking αGal and expressing hCD46. After initial negative and positive sorting of cells (see above in Example 2.2), bulk cell samples were prepared by superscreening using the following protocol: 1) All plates used in this protocol were collagen-coated. 2) To prepare bulk cell samples, cells were further cultured after initial negative sorting and positive sorting. 3) Based on the number of cells recovered after MACS sorting, the cells were seeded into plates of appropriate size (6-well or 10 cm). 4) Once confluence was reached, the cells were subjected to both negative and positive sorting using biotin-labeled isolectin IB4 or biotin-labeled hCD46 antibody, respectively. 5) Similarly, the cells were treated through a third negative sorting and a third positive sorting. 6) In the final step, the cells were sorted using only the hCD46 antibody and cryopreserved for SCNT. 7) Multiple selections ensure the removal of both false-negative and false-positive cells from the bulk cell population.

[0152] The above workflow for preparing bulk cell samples for SCNT is illustrated in Figure 10.

[0153] Example 2.5: Somatic cell nuclear transfer using bulk cell samples Key points about bulk samples 1) Bulk cells were a mixture of cell populations and were sorted multiple times only for isolectin IB4 and hCD46 antibodies, i.e., sorted for the absence of Gal epitopes and the presence of hCD46, but not for hTBM (Figure 11A). A superselected population of cells was used for SCNT. 2) Western blotting using protein samples derived from these bulk cells confirmed the expression of both hCD46 and hTBM transgenes in these cells (Figure 11B). However, this does not confirm whether all cells express both proteins. 3) These cells expressed the transgene, but the integration site of the transgene in each cell of this population could not be determined. However, when animals were born through SCNT using these cells, the integration site of the transgene was confirmed by nanopore sequencing, and this data is shown below.

[0154] somatic cell nuclear transfer 1) This experiment used a male pKC-AUCK cell line. 2) Embryos were prepared using cells derived from bulk samples, and 100-150 embryos were transplanted into each of two recipients. • Embryo transfer date - Friday, May 20, 2022 • Date of birth - September 12, 2022 3) A total of four animals (#13225, 13227, 13228, 13229) were born alive without any obvious abnormalities, but one animal (#13226) was stillborn (Figure 12). 4) Tail samples were collected from the animals and used for immunohistochemical analysis. 5) Genomic DNA was extracted from the tail sample, and the transgene was detected and nanopore sequenced based on PCR.

[0155] Example 2.6: Analysis of piglets Immunohistochemical analysis of newly born piglets IHC was performed for immunodetection of three different molecules (Gal epitope, hCD46, and hTBM). None of the piglets had the Gal epitope (Figure 13), demonstrating successful GGTA1 knockout. All live piglets had potent hCD46 expression (Figure 14). None of the live piglets expressed hTBM, but the stillborn piglets had potent hTBM expression (Figure 15).

[0156] Confirmation of integration sites in DNA from live piglets using nanopore sequencing. Nanopore sequencing was performed using genomic DNA derived from each live piglet. The sequencing results for one piglet for all inserted sequences are shown in Sequence ID No. 27. Sequences derived from the target region were aligned to an transgene expression cassette with extended homology arms. Integrative Genomics Viewer (IGV) was used for alignment. The following conclusions were drawn from the nanopore sequencing data. 1) The transgene expression cassette was inserted into the GGTA1 E8 locus, which is in accordance with the experimental design. 2) At the start of the expression cassette, the donor plasmid fragment was oriented in the opposite direction compared to the remaining correctly integrated DNA (marked with a blue circle in Figure 16). However, the chimeric intron, hCD46 promoter, and hCD46 minigene sequences were oriented correctly. This suggests that the strong expression of hCD46 in these live piglets is driven by the hCD46 promoter. 3) The last portion of the transgene expression cassette (belonging to the hTBM cDNA) was missing (marked with a red circle in Figure 16). This explains why the piglets born alive did not express hTBM. 4) Sanger sequencing data further suggested that there was no off-target or random integration of the transgene cassette in any of the live-born piglets. 5) The transgene cassette was inserted into only one GGTA1 allele (hereinafter referred to as allele 1), but GGTA1 allele 2 had only a mutation at the E8-sgRNA target site (Figure 17). 6) All of the characteristics described above (including mutations in GGTA1 allele 2) were similar in all piglets born alive. The cells used for these SCNTs were derived from bulk samples cultured for more than two weeks, so each cell divided multiple times, resulting in the presence of identical cells during culture. The remarkable similarity among the piglets born alive suggests that they may have originated from SCNTs of the same cells present in the bulk cell sample.

[0157] Figure 18 shows a schematic diagram illustrating the genotypes of the four piglets that were born alive. All of the piglets born alive were GGTA1 knockouts and had a single allele insertion of the transgene at the GGTA1 locus.

[0158] Figure 19A shows a more detailed depiction of all the inserted sequences. Figure 19B depicts all the inserted sequences and the genomic regions on both sides.

[0159] The nucleotide sequence of the insert, which is presumed to be present in all piglets born alive, is shown in SEQ ID NO: 14. This sequence was constructed based on nanopore sequencing results, but any suspected sequencing errors were corrected as far as possible based on known sequences of the transfected plasmid. The nucleotide sequences of the insert and the bilateral genomic regions are shown in SEQ ID NO: 15.

[0160] Tissue expression profile of hCD46 in a single live piglet The striking similarities among all the piglets born alive strongly suggest that they are the same piglet. To determine hCD46 expression in different tissues, one piglet (#13227) was dissected, and tissue samples were collected for immunohistochemical detection of hCD46 by IHC.

[0161] IHC results showed robust hCD46 expression in all tissues, including the heart (both ventricles and atria), kidneys, lungs, pancreas, and liver (Figure 20). These data indicate that an hCD46 promoter sequence of approximately 800 bp is sufficient to produce good hCD46 expression.

[0162] Conclusion about piglets 1) DNA analysis of stillborn piglets by PCR and Oxford nanopore sequencing showed that the targeted construct was fully incorporated, but immunohistochemical analysis of tissue samples revealed low / deficient hCD46 expression and high hTBM expression, although this was not the case in epithelium (data not shown). 2) The four piglets that were born alive had strong hCD46 expression. 3) In one of these four living animals, potent hCD46 expression was observed in all of the tissues tested. 4) Since live piglets are remarkably similar and may originate from the same cells, the tissue expression profiles of hCD46 in these animals should also be similar. 5) pKC cell lines were created from dissected live-born animal #13227. These cells were used for the incorporation of other transgenes into different exons of the GGTA1 locus, e.g., hTBM (see Example 2.7 below). A list of additional modifications is also available from WO 2019 / 185936 (which is incorporated herein in its entirety).

[0163] Example 2.7: Insertion of hTBM into GGTA1 exon 6 under ubiquitous promoter Using the existing hCD46 transgenic background-derived pKC cell lines described above, we targeted exon 6 of the GGTA1 locus with a different expression cassette for hTBM. In one approach, the expression cassette contained hTBM under the control of the CAG promoter (Figure 21A). The nucleotide sequence of the expression cassette containing hTBM under the control of the CAG promoter is shown in SEQ ID NO: 22. In the other approach, the expression cassette contained hTBM under the control of the EF1A promoter (Figure 21B). The nucleotide sequence of the expression cassette containing hTBM under the control of the EF1A promoter is shown in SEQ ID NO: 23. An overview of the two approaches is shown in Figure 21C. For both approaches, cells were transfected and selected for successful expression of hCD46 and hTBM. In particular, nucleofected cells were MACS sorted twice using an hTBM antibody (Figures 21D and E), and the resulting bulk cell population was used for SCNT.

[0164] A schematic diagram showing the expected genotypes for cells with hTBM under the CAG promoter is shown in Figure 22A. The expected genomic nucleotide sequence is shown in SEQ ID NO: 24. A schematic diagram showing the expected genotypes for cells with hTBM under the EF1A promoter is shown in Figure 22B. The expected genomic nucleotide sequence is shown in SEQ ID NO: 25.

[0165] Example 2.8: Novel targeted vector having an expression cassette linked with hCD46 and hTBM In other approaches independent of existing hCD46 transgenic backgrounds as described above, a novel targeted vector containing an expression cassette linked to hCD46 and hTBM was transfected into unmodified AI porcine kidney cells, where hCD46 was under the control of the native hCD46 promoter. Cells were selected for successful expression of hCD46 and hTBM. A schematic diagram of the expected genotypes of cells transfected with the novel targeted vector is shown in Figure 23. The expected genomic nucleotide sequences are shown in SEQ ID NO: 26.

[0166] Example 2.9: Insertion of hTBM into GGTA1 exon 6 under the influence of an epithelial promoter Ubiquitous hTBM expression can be detrimental to the creation of SCNTs and genetically modified pigs. Therefore, in other approaches, a separate expression cassette for hTBM was targeted to exon 6 of the GGTA1 locus, placing human thrombomodulin (hTBM) under a non-ubiquitous epithelium-specific promoter. In one approach, the expression cassette contained hTBM under the control of the epithelium-specific ICAM2 promoter (Figure 24A). The nucleotide sequence of the expression cassette containing hTBM under the epithelium-specific ICAM2 promoter is shown in SEQ ID NO: 46. In another approach, the expression cassette contained hTBM under the control of the epithelium-specific porcine TBM promoter (Figure 24B). The nucleotide sequence of the expression cassette containing hTBM under the control of the epithelium-specific porcine TBM promoter is shown in SEQ ID NO: 49. These expression cassettes were introduced into unmodified porcine kidney cells derived from Auckland pigs before being introduced into genetically modified porcine kidney cells (GGTA1KO / hCD46) derived from Auckland pigs. Both expression cassettes, along with the RNP complex and donor plasmid, were transfected into unmodified porcine kidney cells (pKC-AUCK) derived from Auckland pigs by nucleofection. Cells were selected for the absence of αGal using IB-4 lectin via a magnetically activated cell sorting (MACS) system from Miltenyi Biotec. Single-cell clones were generated using negatively selected cells (Figure 24C). Further selection of single-cell clones was performed by PCR to confirm the presence of transgene integration at the target site (see Figures 24D and E). Either single-cell clones or bulk cell samples were used for SCNTs.

[0167] Example 2.10: Insertion of hB2M / HLA-G1 under the CAG promoter into the GGTA1 exon 6 locus. The B2M / HLA-G fusion protein can significantly delay allograft rejection. Therefore, we created a separate expression cassette for hB2M / HLA-G1 under the CAG promoter, targeting exon 6 of the GGTA1 locus (Figure 25A). The nucleotide sequence of the expression cassette containing hB2M / HLA-G1 expression under the CAG promoter is shown in SEQ ID NO: 51.

[0168] In other approaches, hTBM under the endogenous porcine TBM promoter and hB2M / HLA-G1 under the CAG promoter are cloned into the same expression cassette / donor plasmid. In one approach, the novel targeting vector may contain an expression cassette in which hTBM under the ICAM2 promoter and hB2M / HLA under CAG are ligated (Figure 25B). In other approaches, the novel targeting vector may contain an expression cassette in which hTBM under the epithelial-specific porcine TBM promoter and hB2M / HLA under CAG are ligated (Figure 25C).

[0169] The hB2M / HLA-G1 / hTBM expression cassette is integrated into the exon 6 locus of GGTA-1 by CRISPR-Cas9-based HDR. A dual-cut donor plasmid containing an RNP complex targeting GGTA1 exon 6, along with hTBM under the endogenous porcine TBM promoter and hB2M / HLA-G1 under the CAG promoter, is electroporated into wild-type Auckland Island kidney cells (male or female). Three to four days after nucleofection, cells are selected for the absence of the αGal epitope using IB-4 lectin and for the presence of hB2M / HLA-G1 using an anti-HLA-G1 antibody. The twice-selected cells are used as bulk samples for SCNT or to generate single-cell clones (SCCs). Single-cell clones are verified by multiple PCRs to ensure successful targeted integration of the transgene expression cassette. SCCs with the correct genetic modifications are used for SCNT.

[0170] Example 3: Development of System B To develop TKO pigs, guide RNAs specific to the Cas9 protein, GGTA1, CMAH, and B4GALNT2 / B4GALNT2L genes were electroporated into primary kidney cells derived from AI pigs (Figure 26). Subsequently, the cells were seeded and selected for the absence of αGal, Neu5Gc, and Sd(a). Bulk cells were used as SCNTs to obtain the first piglets with frameshift mutations.

[0171] [Table 1] TIFF2026518296000003.tif254169TIFF2026518296000004.tif251169TIFF2026518296000005.tif255169TIFF2026518296000006.tif254169TIFF2026518296000007.tif253169TIFF2026518296000008.tif253169TIFF2026518296000009.tif253168TIFF2026518296000010.tif254169TIFF2026518296000011.tif254169TIFF2026518296000012.tif255169TIFF2026518296000013.tif253169TIFF2026518296000014.tif255169TIFF2026518296000015.tif255170TIFF2026518296000016.tif253169TIFF2026518296000017.tif254169TIFF2026518296000018.tif254169TIFF2026518296000019.tif254169TIFF2026518296000020.tif255169TIFF2026518296000021.tif254168TIFF2026518296000022.tif255170TIFF2026518296000023.tif254169TIFF2026518296000024.tif254170TIFF2026518296000025.tif255169TIFF2026518296000026.tif255169TIFF2026518296000027.tif255169TIFF2026518296000028.tif253168TIFF2026518296000029.tif254168TIFF2026518296000030.tif255169TIFF2026518296000031.tif253169TIFF2026518296000032.tif255169TIFF2026518296000033.tif255169TIFF2026518296000034.tif254168TIFF2026518296000035.tif255169TIFF2026518296000036.tif255169TIFF2026518296000037.tif255169TIF F2026518296000038.tif255170TIFF2026518296000039.tif254170TIFF202651829600 0040.tif254170TIFF2026518296000041.tif255169TIFF2026518296000042.tif2541 70TIFF2026518296000043.tif255170TIFF2026518296000044.tif255169TIFF2026518 296000045.tif254168TIFF2026518296000046.tif255169TIFF2026518296000047.ti f254170TIFF2026518296000048.tif255170TIFF2026518296000049.tif254169TIFF20 26518296000050.tif255170TIFF2026518296000051.tif254170TIFF20265182960000 52.tif255170TIFF2026518296000053.tif254170TIFF2026518296000054.tif143169. [Industrial applicability]

[0172] The genetically modified pig cells, genetically modified pig organs, and genetically modified pigs of the present invention are useful for research and pharmaceutical applications, such as xenotransplantation. The methods of the present invention are useful for producing the genetically modified pig cells, genetically modified pig organs, and genetically modified pigs of the present invention. Accordingly, the products and methods of the present invention are industrially applicable.

[0173] References TIFF2026518296000055.tif33170TIFF2026518296000056.tif252170TIFF2026518296000057.tif238170TIFF2026518296000058.tif154170

Claims

1. Pig cells containing the following genetic modification (a): (a) A genomic insertion of a polynucleotide(i) comprising a CD46 expression sequence and a promoter element controlling the expression of the CD46 expression sequence, wherein the promoter element consists of at least a portion of a native CD46 promoter and / or achieves a CD46 expression level of 0.1 to 10 times the CD46 expression level achieved when the nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by SEQ ID NO:

1.

2. The pig cell according to claim 1, wherein the promoter element consists of a nucleotide sequence represented by Sequence ID No. 1, and the promoter element consists of a nucleotide sequence of -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence.

3. The porcine cell according to claim 1 or 2, wherein the promoter element achieves a CD46 expression level that is approximately the same as the CD46 expression level achieved when the nucleotide sequence from -826 bp to -1 bp prior to the ATG start codon of the CD46 expression sequence is the nucleotide sequence represented by Sequence ID No.

1.

4. The porcine cell according to any one of claims 1 to 3, wherein the CD46 is human CD46 and the CD46 promoter is a human CD46 promoter.

5. The pig cell according to any one of claims 1 to 4, wherein the polynucleotide (i) consists of a nucleotide sequence that is at least 98% identical to the nucleotide sequence represented by SEQ ID NO: 14, and preferably the polynucleotide (i) consists of the nucleotide sequence represented by SEQ ID NO:

14.

6. The porcine cell according to any one of claims 1 to 5, wherein the polynucleotide (i) is inserted into an exon of the endogenous GGTA1 gene, preferably in exon 8 of the endogenous GGTA1 gene.

7. The porcine cell according to any one of claims 1 to 6, further comprising the following gene modification (b): (b) A genomic insertion of a polynucleotide (ii) comprising a thrombomodulin (TBM) expression sequence and a promoter element that controls the expression of the TBM expression sequence, wherein the TBM is human TBM.

8. The porcine cells according to any one of claims 1 to 7, further comprising the following gene modifications (c), (d), and (e): (c) Disruption of the endogenous α-1,3-galactosyltransferase (GGTA1) gene, (d) Disruption of the endogenous cytidine monophosphate-N-acetylneuraminate hydroxylase (CMAH) gene, and (e) Disruption of the endogenous β-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) gene and the endogenous B4GALNT2-like (B4GALNT2L) gene.

9. The porcine cell according to any one of claims 1 to 8, wherein the porcine cell is a primary porcine kidney cell and / or the porcine cell is derived from an Auckland Island pig.

10. A pig organ containing pig cells according to any one of claims 1 to 9.

11. A pig comprising porcine cells according to any one of claims 1 to 9 or porcine organs according to claim 10.

12. A pig cell according to any one of claims 1 to 9, a pig organ according to claim 10, or a pig according to claim 11, for use in a xenotransplantation method.

13. A method for producing a genetically modified pig, the method comprising the following steps in order: Steps include exposing a population of pig cells to genome modification treatment. A step of isolating a non-clonal subpopulation of porcine cells, including those with genome modifications. A step involving the use of a non-clonal subpopulation of genetically modified pig cells for somatic cell nuclear transfer (SCNT).

14. The method according to claim 13, wherein the non-clonal subpopulation of genetically modified porcine cells used in SCNT comprises at least 10 different clonal subpopulations.

15. The method according to claim 13 or claim 14, wherein the genetically modified pig is the pig described in claim 11.