Small molecule ligands and aptamers
Small molecules binding to aptamer sequences address the challenge of regulating therapeutic gene expression in eukaryotic systems by enhancing gene regulation and bioavailability, offering improved tissue distribution and reduced toxicity.
Patent Information
- Application Number
- JP2025572665
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-14
- Filing Date
- 2024-06-14
- Publication Date
- 2026-07-24
AI Technical Summary
Aptamers derived from prokaryotic sources or constructed using in vitro selection methods often fail to demonstrate the necessary function for regulating therapeutic target gene expression in eukaryotic systems, as the ligands may interfere with gene regulation or are unsuitable for cellular administration.
Development of small molecules that bind to aptamer sequences, modulating target gene expression through riboswitches and polynucleotide cassettes containing aptamers, which are designed to respond to the presence or absence of small molecule ligands, including structures according to formulas I to XIV, and are encoded by specific aptamer coding sequences.
The small molecules enhance gene expression regulation in eukaryotic systems, providing improved blood-brain barrier permeability, distribution to ocular tissue, low toxicity, and good bioavailability, and are applicable in therapeutic gene regulation.
Smart Images

Figure 2026524820000001_ABST
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 508,204, filed on 14 June 2023, which is incorporated herein by reference in its entirety.
[0002] Sequence List This application includes a sequence listing created and submitted electronically on June 13, 2023, as an XML file named SeqList-162027-54076.xml, with a file size of 9,477 bytes. This sequence listing is incorporated herein by reference.
[0003] This specification relates to small molecules that are modulators of target gene expression, having a riboswitch containing an aptamer described herein. Also disclosed are riboswitches and polynucleotide cassettes for regulating the expression of target genes, wherein the polynucleotide cassette contains an aptamer described herein. [Background technology]
[0004] Aptamers are oligonucleotides that bind to target ligands with high affinity and specificity. These nucleic acid sequences have demonstrated significant therapeutic and diagnostic value, as evidenced by the recent FDA approval of the first aptamer drugs and the addition of aptamer drugs to the clinical pipeline. Their high specificity and versatility have established RNA aptamers as a crucial tool in the emerging field of RNA nanotechnology in the fight against human diseases, including cancer, viral infections, and other ailments.
[0005] Furthermore, aptamers can be used as part of riboswitches that have specific effects in the presence or absence of aptamer ligands. For example, riboswitches may be used to regulate gene expression in response to the presence or absence of aptamer ligands.
[0006] However, aptamers / ligands derived from prokaryotic sources or constructed using in vitro selection methods often fail to demonstrate the necessary function for the expression of therapeutic target genes in eukaryotic systems. For example, the ligand for an aptamer may be an intracellular molecule unsuitable for use in systems for regulating therapeutic gene products, for instance, because the presence of the ligand interferes with the regulation of target gene expression, or because the ligand is otherwise unsuitable for administration to cells or tissues. Therefore, there is a need for novel aptamer sequences, small molecule ligands, and aptamer / ligand combinations that can modulate gene expression in response to the presence or absence of small molecule ligands. [Overview of the Initiative]
[0007] This specification provides small molecules of formula I, including those listed in Table A, that bind to aptamer sequences. These small molecules are modulators of target gene expression, the target gene having a riboswitch containing an aptamer, also described herein. Also disclosed are riboswitches and polynucleotide cassettes for regulating the expression of target genes, wherein the polynucleotide cassette contains an aptamer, the aptamer, which binds to one or more small molecules disclosed herein. Furthermore, methods are provided for using small molecules having an aptamer, riboswitch, and / or polynucleotide cassette to regulate target genes, such as therapeutic genes.
[0008] In embodiments, an aptamer (i.e., one or more compounds of formulas I-XIV) that binds to one or more small molecules disclosed herein is encoded by an aptamer coding sequence disclosed in PCT / IB2022 / 000762 (WO2023 / 111686), which is incorporated herein by reference in its entirety. In embodiments, the aptamer coding sequence includes a sequence that is at least 95% identical or at least 99% identical to the aptamer coding sequence disclosed in PCT / IB2022 / 000762. In embodiments, the aptamer coding sequence includes (i) a sequence that is at least 95% identical or at least 99% identical to SEQ ID NO: 1, or (ii) SEQ ID NO: 1 (referred to herein as the 12C6-1 aptamer). Sequence ID 1 (12C6-1 aptamer): CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG
[0009] In embodiments, the aptamer sequences disclosed herein further include additional sequences at the 5' and 3' ends that are complementary and can form part of the aptamer P1 stem. In embodiments, the P1 stem of this aptamer is, includes, or overlaps with the effector region of the riboswitch disclosed herein. In embodiments, the aptamer P1 stem includes a 5' splice site sequence of the 3' intron and a sequence complementary thereto. For example, the P1 stem may contain all of the following or its intron portion: AG || GGTGAGT;AAA || GTAAGC;GCA || GTAAGT;GAG || GTGTGG;A / CAG || GTA / GAGT;NAG || GTA / GAGT;NAG || GTAAGT;A / CA / TG || GTANGT; or NAG / A || GTAAGT (wherein N can be A, G, C, or T, and || represents an exon-intron boundary).
[0010] In embodiments, the aptamers disclosed herein (including those referenced) bind to one or more small molecules of formulas I to XIV, including those listed in Table A.
[0011] In one embodiment, the present disclosure provides an RNA aptamer encoded by an aptamer coding sequence disclosed herein.
[0012] In one embodiment, the disclosure provides nucleic acid sequences encoding recombinant riboswitches for regulating the expression of a target gene in response to a small molecule, wherein the riboswitch includes an aptamer disclosed herein.
[0013] In another aspect, the Disclosure provides a polynucleotide cassette for regulating the expression of a target gene, wherein the polynucleotide cassette comprises an aptamer coding sequence that binds to a small molecule, and the aptamer coding sequence comprises an aptamer coding sequence disclosed herein.
[0014] In this embodiment, the polynucleotide cassette includes a sequence encoding the following: (a) Riboswitch and, (b) Exons that are selectively spliced with adjacent 5' introns and 3' introns, Here, the riboswitch comprises (i) an effector region comprising a stem-forming sequence (and a sequence complementary to the 5' splice site sequence of the 3' intron), and (ii) an aptamer comprising the aptamer sequence disclosed herein. The selectively spliced exons, when spliced to form the mRNA of the target gene, include the stop codon located in-frame along with the target gene.
[0015] In an embodiment, the effector stem is, or includes, the P1 stem of the aptamer disclosed herein. In other words, the effector stem includes a first sequence linked to the 5' end of the aptamer disclosed herein and a second sequence linked to the 3' end of the aptamer disclosed herein, and the first and second sequences include sequences that are complementary and capable of forming a stem.
[0016] In an embodiment, the polynucleotide cassette is located within the protein coding sequence of the target gene. In an embodiment, the polynucleotide cassette is located within the untranslated region of the target gene or within an intron of the target gene.
[0017] In an embodiment, the small molecule has a structure according to Formula I:
Chemical formula
Chemical formula
[0018] In embodiments, the small molecules have structures according to formulas II to XIV, including, for example, the structures provided in Table A. The small molecule ligands of formulas I to XIV and Table A may provide one or more beneficial properties, including improved blood-brain barrier permeability, improved distribution to ocular tissue, low toxicity, and good bioavailability.
[0019] In one embodiment, the Disclosure provides a vector comprising a polynucleotide cassette, an aptamer coding sequence / aptamer sequence disclosed herein, and / or a riboswitch. In embodiments, the vector is a viral vector or a non-viral vector. In embodiments, the viral vector is an adenovirus vector, an adeno-associated virus vector, and a lentiviral vector.
[0020] In one embodiment, the present disclosure provides cells, polynucleotide cassettes, aptamer coding sequences / aptamer sequences, or riboswitches comprising the vectors disclosed herein.
[0021] This disclosure also provides a method for regulating the expression of a target gene by providing cells or tissues with small molecules of formulas I to XIV, including, for example, the small molecules shown in Table A, using the polynucleotide cassettes, aptamer coding sequences / aptamer sequences, or riboswitches disclosed herein. [Brief explanation of the drawing]
[0022] [Figure 1A] A is a schematic diagram of one embodiment of a synthetic riboswitch cassette, which includes a riboswitch in relation to an intron-selective exon-aptamer-intron. [Figure 1B] B: In the presence of an aptamer ligand, aptamer ligand binding promotes the formation of an effector stem that severs the accessibility of the splice site sequence on the 3' end of the alternative exon (e.g., the 5' splice site sequence of the 3' intron), resulting in the exclusion of the alternative exon containing the stop codon from the target gene mRNA, leading to the expression of the target gene. [Figure 2A] A and B represent the exposure levels in plasma (P), brain (B), and eye (E) of mice administered with the selected compound at 100 mg / kg PO. The induction multipliers of luciferase expression in response to the compound are also provided in HEK293 cells from the luciferase gene containing the 12C6-1 gene regulatory cassette (SEQ ID NO: 4). [Figure 2B] A and B represent the exposure levels in plasma (P), brain (B), and eye (E) of mice administered with the selected compound at 100 mg / kg PO. The induction multipliers of luciferase expression in response to the compound are also provided in HEK293 cells from the luciferase gene containing the 12C6-1 gene regulatory cassette (SEQ ID NO: 4). [Modes for carrying out the invention]
[0023] This specification provides aptamer sequences that bind to, or otherwise respond to, small molecules such as thiamine or TPP, and analogs or derivatives of thiamine or TPP. In some embodiments, the aptamer sequences provided herein are useful for regulating the expression of target genes in response to the presence or absence of small molecule ligands. Recombinant riboswitches containing the aptamer sequences disclosed herein, and recombinant polynucleotide cassettes for regulating the expression of target genes are also envisioned, the polynucleotide cassettes comprising sequences encoding the riboswitches disclosed herein. Methods for using aptamers, riboswitches, and / or polynucleotide cassettes for regulating target genes such as therapeutic genes, and for the treatment of subjects requiring such regulation are also provided herein.
[0024] Aptamer
[0025] Aptamers are single-stranded nucleic acid molecules that fold into a three-dimensional structure, allowing them to bind non-covalently to specific ligands with high affinity and specificity. Examples of aptamer ligands include ions, small molecules, proteins, viruses, and cells.
[0026] Aptamer ligands can be, for example, organic compounds, amino acids, steroids, carbohydrates, or nucleotides. Non-limiting examples of small molecule aptamer ligands include antibiotics, therapeutic agents, dyes, cofactors, metabolites, molecular markers, neurotransmitters, contaminants, toxins, food impurities, carcinogens, and drugs of abuse. Therefore, aptamers are useful for detecting small molecules. Applications of aptamer-based small molecule detection include environmental monitoring, food safety, medicine (including diagnostics), microbiology, analytical chemistry, forestry, agriculture, and basic biological research.
[0027] As used herein, the term “aptamer” refers to an RNA polynucleotide (or a DNA sequence encoding that RNA polynucleotide) that specifically binds to a ligand or a particular class of ligands. The term “ligand” refers to the molecule to which an aptamer specifically binds. An aptamer has a binding region that has the ability to form a complex with an intended target molecule (i.e., a ligand). Aptamers are typically about 15 to about 200 nucleotides long. More commonly, aptamers are about 30 to about 100 nucleotides long, for example, 70 to 90 nucleotides long. Aptamers typically include multiple pairing (P) regions that form a stem, and unpaired regions that form a binding (J) or loop (L) region. The pairing regions can be numbered sequentially starting from the 5' end (P1), with the numbering continuing for each stem (P2, P3, etc.). Loops (L1, L2, etc.) are numbered based on adjacent pair-forming regions, and connecting regions are numbered according to the pair-forming regions to which they are connected.
[0028] In embodiments, an aptamer (i.e., one or more compounds of formulas I-XIV) that binds to one or more small molecules disclosed herein is encoded by an aptamer coding sequence disclosed in PCT / IB2022 / 000762 (WO2023 / 111686), which is incorporated herein by reference in its entirety. In embodiments, the aptamer coding sequence includes a sequence that is at least 95% identical or at least 99% identical to the aptamer coding sequence disclosed in PCT / IB2022 / 000762. In embodiments, the aptamer coding sequence includes (i) a sequence that is at least 95% identical or at least 99% identical to SEQ ID NO: 1, or (ii) SEQ ID NO: 1 (referred to herein as the 12C6-1 aptamer).
[0029] In embodiments, the first and last nucleotides of the aptamer coding sequence disclosed herein may be any nucleotide or not. In embodiments, the first two and last two nucleotides of the aptamer coding sequence disclosed herein may be any nucleotide or not. In these embodiments, additional sequences, which are the 5' and 3' of the aptamer coding sequence, may be present to form part of the stem-forming sequence of the riboswitch.
[0030] In one embodiment, the present disclosure provides an aptamer encoded by an aptamer code sequence disclosed herein.
[0031] Those skilled in the art will understand that the aptamers described herein may be ribonucleic acid (RNA) molecules. In embodiments, the aptamers described herein are, for example, parts of longer RNA polynucleotides, including hnRNA, mRNA, siRNA, or miRNA.
[0032] Aptamer Ligand
[0033] In embodiments, the aptamers disclosed herein either bind to or otherwise respond to the presence or addition of small molecules (ligands) disclosed herein, which include small molecules having structures according to formulas I to XIV, including the small molecules in Table A.
[0034] In the embodiment, the small molecule has the structure of formula I: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR dSelected from , and N; In the formula, X 4 , X 6 , or X 7 N is either 0 or 1 among them; A is selected from the following group: [ka] X a It is selected from N and CH; X b It is selected from O, NH, and NCH3; Each R a1 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; Each R a The R atoms are independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom, or alternatively, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two R atoms bonded to the same carbon atom. a2 However, it forms an oxo group; Each R a3 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3However, they form an oxo group or a 3-5 membered carbon ring; or, two Ra groups bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1 These are C1-C3 alkyl or C3-C6 cycloalkyl groups, each optionally containing a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b2 The element is selected from H, C1-C3 alkyl groups, and optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b3 The C1-C3 alkyl group is optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b4 This is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2; R b5 It is selected from H and C1-C3 alkyl groups; m is 1 or 2; n is 1 or 2; p is 1 or 2; r is 1 or 2; s is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.
[0035] For the compound according to formula I, x may be selected such that x is 1, 2, or 3; x may be selected such that x is 1 or 2; or x may be selected such that x is 1. R a1 may be selected such that R is methyl, fluoro, or chloro; or R a1 may be selected such that R is methyl. Alternatively, x may be 0.
[0036] For the compound according to formula I, y may be selected such that y is 0 or 1. R a3 may be selected from halo or methyl; or R a3 may be selected such that R is methyl. Alternatively, y may be 0.
[0037] For the compound according to formula I, z may be selected such that z is 1, 2, or 3; z may be selected such that z is 1 or 2; or z may be selected such that z is 1. R a2 may be selected such that R is methyl, fluoro, or chloro; or R a2 may be selected such that R is methyl. Alternatively, z may be 0.
[0038] For the compound according to formula I, w may be selected from 0 or 1. R c may be selected from halo or methyl; or R c may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0039] For the compound according to formula I, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R dThey may combine to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0040] In the case of the compound according to formula I, m may be 1.
[0041] In the case of the compound according to formula I, n may be 1.
[0042] In the case of the compound according to formula I, p may be 1. Alternatively, p may be 2.
[0043] In the case of the compound according to formula I, r and s may independently be selected from 1 or 2. In an embodiment, one of r and s is selected to be 1 and the other is selected to be 2. In an embodiment, both r and s are 2. In another embodiment, both r and s are 1.
[0044] In the case of the compound according to formula I, X a may be N.
[0045] In the case of the compound according to formula I, X b may be O. Alternatively, X b may be NH. Alternatively, X b may be NCH3. [[ID=3,4]]
[0046] In the case of the compound according to formula I, R b1 may be C1-C3 alkyl, which may be unsubstituted or substituted with halo, OH, or O-C 1-3 alkyl. Alternatively, R b1 [[ID=4,2]]may be C3-C6 cycloalkyl, which may be unsubstituted or substituted with halo, OH, or O-C1-3 alkyl. For example, R b1 may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of the compound of formula I, R b1 may be methyl. <0,000923>
[0047] For compounds of formula I, R b2 may be C1-C3 alkyl, which may be unsubstituted, or substituted with halo, OH, or O-C 1-3 alkyl. Alternatively, R b2 may be C3-C6 cycloalkyl, which may be unsubstituted, or substituted with halo, OH, or O-C<000008This can also be -NH2, -NH(CH3), -NH(CH2CH3), -N(CH3)2, or N(CH2CH3)2.
[0051] In the case of the compound of formula I, R b5 This may be a C1-C3 alkyl group, for example, CH3-CH2CH3, CH2CH2CH3, CH(CH3)2. Alternatively, R b5 H may also be used.
[0052] In the case of the compound of formula I, the structure [ka] The following substructures may be selected: [ka] In the formula, R b4 and R b5 The above is true.
[0053] In this embodiment, the small molecule has the structure of formula IA: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is either 0 or 1 among them; A is selected from the following group: [ka] X a It is selected from N and CH; Xb is selected from O, NH, and NCH3; each R a1 is independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two Rs attached to the same carbon atom a1 form an oxo group or a 3- to 5-membered carbocyclic ring; or two Rs attached to different carbon atoms a form a 4- to 6-membered carbocyclic ring or a 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH; each R a is independently selected from C1-C3 alkyl, and both of these C1-C3 alkyl groups are attached to the same ring carbon atom, or alternatively, two Rs attached to the same ring carbon atom a form a 3- to 5-membered carbocyclic ring; each R a2 is independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two Rs attached to the same carbon atom a2 form an oxo group; each R a3 is independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two Rs attached to the same carbon atom a3 form an oxo group or a 3- to 5-membered carbocyclic ring; or two Ras attached to different carbon atoms form a 4- to 6-membered carbocyclic ring or a 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH; R b1 is C1-C3 alkyl; R b2 is selected from H and C1-C3 alkyl; R b3 is C1-C3 alkyl; m is 1 or 2; n is 1 or 2; p is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.
[0054] In the case of a compound according to formula IA, X 4 X may be CH, 6 X may be CH, 7 It can be CH.
[0055] In the case of a compound according to formula IA, x may be selected to be 1, 2, or 3; x may be selected to be 1 or 2; or x may be selected to be 1. a1 may be selected to be methyl, fluoro, or chloro; or R a1 x may be selected to be methyl. Alternatively, x may be 0.
[0056] In the case of compounds according to formula IA, y may be selected to be 0 or 1. a3 may be selected from halo or methyl; or R a3 y may be selected to be methyl. Alternatively, y may be 0.
[0057] In the case of a compound according to formula IA, z may be selected to be 1, 2, or 3; z may be selected to be 1 or 2; or z may be selected to be 1.a2 may be selected to be methyl, fluoro, or chloro; or R a2 z may be selected to be methyl. Alternatively, z may be 0.
[0058] For compounds according to formula IA, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0059] For compounds according to formula IA, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0060] In the case of compounds according to formula IA, m may be 1.
[0061] In the case of compounds according to formula IA, n may be 1.
[0062] In the case of a compound according to formula IA, p may be 1, or p may be 2.
[0063] In the case of a compound according to formula IA, X a It can also be N.
[0064] In the case of a compound according to formula IA, X b It may be O.
[0065] For compounds of formula IA, R b1 It may also be methyl.
[0066] For compounds of formula IA, R b3 It may also be methyl.
[0067] For compounds of formula IA, R b2 This can be H or methyl.
[0068] For compounds of formula IA, each R a Each R is independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom; or each R a However, it is methyl. Or, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; or two R a However, they may also form a spirocyclopropyl group together with the carbon atoms bonded to them.
[0069] In other embodiments, the small molecule has the structure of formula II: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, A is selected from the following group: [ka] X a It is selected from N and CH; X b It is selected from O, NH, and NCH3; Each R a1 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; Each R aThe R atoms are independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom, or alternatively, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two R atoms bonded to the same carbon atom. a2 However, it forms an oxo group; Each R a3 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, they form an oxo group or a 3-5 membered carbon ring; or, two Ra groups bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1 These are C1-C3 alkyl or C3-C6 cycloalkyl groups, each optionally containing a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b2 The element is selected from H, C1-C3 alkyl groups, and optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b3 The C1-C3 alkyl group is optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b4 This is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2; R b5 It is selected from H and C1-C3 alkyl groups; m is 1 or 2; n is 1 or 2; p is 1 or 2; r is 1 or 2; s is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0070] In the case of a compound according to formula II, x may be selected to be 1, 2, or 3; x may be selected to be 1 or 2; or x may be selected to be 1. a1 may be selected to be methyl, fluoro, or chloro; or R a1 x may be selected to be methyl. Alternatively, x may be 0.
[0071] In the case of the compound according to formula II, y may be selected to be either 0 or 1. a3 may be selected from halo or methyl; or R a3 However, it may be selected so that it becomes methyl. Alternatively, y may be 0.
[0072] In the case of the compound according to formula II, z may be selected to be 1, 2, or 3; z may be selected to be 1 or 2; or z may be selected to be 1. a2 may be selected to be methyl, fluoro, or chloro; or R a2 z may be selected to be methyl. Alternatively, z may be 0.
[0073] For compounds according to formula II, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0074] For compounds according to formula II, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0075] In the case of the compound according to formula II, m may be 1.
[0076] In the case of the compound according to formula II, n may be 1.
[0077] In the case of a compound according to formula II, p may be 1, or p may be 2.
[0078] In the case of a compound according to formula II, r and s may be independently selected from 1 or 2. In one embodiment, one of r and s is selected to be 1 and the other to be 2. In another embodiment, both r and s are 2. In yet another embodiment, both r and s are 1.
[0079] In the case of a compound according to formula II, X a It can also be N.
[0080] In the case of a compound according to formula II, X b It may be O. Or, X b It may also be NH.
[0081] In the case of compounds according to formula II, R b1 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Alternatively, R b1 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b1 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula II, b1 It may also be methyl.
[0082] In the case of compounds according to formula II, R b2 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Or, R b2 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b2 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula II, b2 It may be H or methyl. Or, R b2 H may also be used.
[0083] In the case of compounds according to formula II, R b3 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b3 R may be -CH3, -CH2CH3, -CH2CH2OH, -CH2CH2F, etc. In the case of the compound of formula II, b3 It may also be methyl.
[0084] For the compound of formula II, each R a Each R is independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom; or each R a However, it is methyl. Or, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; or two R a However, they may also form a spirocyclopropyl group together with the carbon atoms bonded to them.
[0085] For compounds of formula II, R b4 R is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2. In the embodiment, R b4 This can also be -NH2, -NH(CH3), -NH(CH2CH3), -N(CH3)2, or N(CH2CH3)2.
[0086] For compounds of formula II, R b5 This may be a C1-C3 alkyl group, for example, CH3-CH2CH3, CH2CH2CH3, CH(CH3)2. Alternatively, R b5 H may also be used.
[0087] In the case of the compound of formula II, the structure [ka] The following substructures may be selected: [ka] In the formula, R b4 and R b5 The above is true.
[0088] In other embodiments, the small molecule has the structure of formula III: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, A is selected from the following group: [ka] Each R a1 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; Each R a The R atoms are independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom, or alternatively, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two R atoms bonded to the same carbon atom. a2 However, it forms an oxo group; Each R a3 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1 These are C1-C3 alkyl or C3-C6 cycloalkyl groups, each optionally containing a halo, OH, or OC group. 1-3 It is substituted with alkyl; R b2 The element is selected from H, C1-C3 alkyl groups, and optionally a halo, OH, or OC group. 1-3It is substituted with alkyl; R b3 The C1-C3 alkyl group is optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; m is 1 or 2; n is 1 or 2; p is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0089] In the case of a compound according to formula III, x may be selected to be 1, 2, or 3; x may be selected to be 1 or 2; or x may be selected to be 1. a1 may be selected to be methyl, fluoro, or chloro; or R a1 x may be selected to be methyl. Alternatively, x may be 0.
[0090] In the case of compounds according to formula III, y may be selected to be either 0 or 1. a3 This may be selected from halo or methyl; or R a3 However, it may be selected so that it becomes methyl. Alternatively, y may be 0.
[0091] In the case of a compound according to formula III, z may be selected to be 1, 2, or 3; z may be selected to be 1 or 2; or z may be selected to be 1. a2 may be selected to be methyl, fluoro, or chloro; or R a2 z may be selected to be methyl. Alternatively, z may be 0.
[0092] For compounds according to formula III, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0093] For compounds according to formula III, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0094] In the case of compounds according to formula III, m may be 1.
[0095] In the case of compounds according to formula III, n may be 1.
[0096] In the case of a compound according to formula III, p may be 1, or p may be 2.
[0097] In the case of a compound according to formula III, X a It can also be N.
[0098] In the case of a compound according to formula III, X b It may be O. Or, Xb It may also be NH.
[0099] In the case of compounds according to formula III, R b1 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Alternatively, R b1 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b1 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula III, b1 It may also be methyl.
[0100] In the case of compounds according to formula III, R b2 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Or, R b2 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b2 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula III, b2 It may be H or methyl. Or, R b2 H may also be used.
[0101] In the case of compounds according to formula III, R b3 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b3 R may be -CH3, -CH2CH3, -CH2CH2OH, -CH2CH2F, etc. In the case of the compound of formula III, b3 It may also be methyl.
[0102] For the compound of formula III, each R a Each R is independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom; or each R a However, it is methyl. Or, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; or two R a However, they may also form a spirocyclopropyl group together with the carbon atoms bonded to them.
[0103] In other embodiments, the small molecule has the structure of formula IV: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is either 0 or 1 among them; X a It is selected from N and CH; Each R a1 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1These are C1-C3 alkyl or C3-C6 cycloalkyl groups, each optionally containing a halo, OH, or OC group. 1-3 It is substituted with alkyl; m is either 1 or 2; x is 0, 1, 2, or 3; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.
[0104] In the case of a compound according to formula IV, x may be selected to be 1, 2, or 3; x may be selected to be 1 or 2; or x may be selected to be 1. a1 may be selected to be methyl, fluoro, or chloro; or R a1 x may be selected to be methyl. Alternatively, x may be 0.
[0105] For compounds according to formula IV, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0106] For compounds according to formula IV, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R dThe elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0107] In the case of compounds according to formula IV, m may be 1.
[0108] In the case of a compound according to formula IV, X a It can also be N.
[0109] In the case of a compound according to formula IV, R b1 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Alternatively, R b1 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b1 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula IV, b1 It may also be methyl.
[0110] In other embodiments, the small molecule has a structure according to formula V: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, Each R a1 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. aHowever, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1 These are C1-C3 alkyl or C3-C6 cycloalkyl groups, each optionally containing a halo, OH, or OC group. 1-3 It is substituted with alkyl; x is 0, 1, 2, or 3; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0111] In the case of a compound according to formula V, x may be selected to be 1, 2, or 3; x may be selected to be 1 or 2; or x may be selected to be 1. a1 may be selected to be methyl, fluoro, or chloro; or R a1 x may be selected to be methyl. Alternatively, x may be 0.
[0112] In the case of a compound according to formula V, R b1 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Alternatively, R b1 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, Rb1 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula V, b1 It may also be methyl.
[0113] For compounds according to formula V, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0114] In the case of compounds according to formula V, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0115] In other embodiments, small molecules have a structure according to formula Va: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, Each R a1 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms. a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; x is 0, 1, 2, or 3; Each R cThese are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0116] In the case of compounds of formula Va, x may be selected to be 1, 2, or 3; x may be selected to be 1 or 2; or x may be selected to be 1. a1 may be selected to be methyl, fluoro, or chloro; or R a1 x may be selected to be methyl. Alternatively, x may be 0.
[0117] For compounds of formula Va, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0118] For compounds with formula Va, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0119] In other embodiments, the small molecule has the structure of formula VI: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is either 0 or 1 among them; X a It is selected from N and CH; Each R a The R atoms are independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom, or alternatively, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two R atoms bonded to the same carbon atom. a2 However, it forms an oxo group; R b2 The group is selected from H and C1-C3 alkyl groups, and optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; n is either 1 or 2; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R dThese are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.
[0120] In the case of the compound according to formula VI, z may be selected to be 1, 2, or 3; z may be selected to be 1 or 2; or z may be selected to be 1. a2 may be selected to be methyl, fluoro, or chloro; or R a2 z may be selected to be methyl. Alternatively, z may be 0.
[0121] For compounds according to formula VI, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0122] For compounds according to formula VI, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0123] In the case of the compound according to formula VI, n may be 1.
[0124] In the case of a compound according to formula VI, X a It can also be N.
[0125] In the case of a compound according to formula VI, R b2 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Or, R b2 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b2 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of the compound of formula VI, b2 It may be H or methyl. Or, R b2 H may also be used.
[0126] For the compound of formula VI, each R a Each R is independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom; or each R a However, it is methyl. Or, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; or two R a However, they may also form a spirocyclopropyl group together with the carbon atoms bonded to them.
[0127] In other embodiments, the small molecule has the structure of formula VII: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, Each R a The R atoms are independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom, or alternatively, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two R atoms bonded to the same carbon atom. a2 However, it forms an oxo group; R b2 The group is selected from H and C1-C3 alkyl groups, and optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; n is either 1 or 2; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0128] In the case of the compound according to formula VII, z may be selected to be 1, 2, or 3; z may be selected to be 1 or 2; or z may be selected to be 1. a2 may be selected to be methyl, fluoro, or chloro; or R a2 z may be selected to be methyl. Alternatively, z may be 0.
[0129] For compounds according to formula VII, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0130] For compounds according to formula VII, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0131] In the case of compounds according to formula VII, n may be 1.
[0132] In the case of a compound given by formula VII, R b2 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. Alternatively, R b2 The C3-C6 cycloalkyl group may be unsubstituted, or it may be a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b2 R may be -CH3, -CH2CH3, cyclopropyl, -CH2CH2OH, -CH2CH2F, etc. In the case of a compound of formula VII, b2 It may be H or methyl. Or, R b2 H may also be used.
[0133] For compounds of formula VII, each R a Each R is independently selected from C1-C3 alkyl groups, and both of these C1-C3 alkyl groups are bonded to the same ring carbon atom; or each R a However, it is methyl. Or, two R atoms bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; or two R a However, they may also form a spirocyclopropyl group together with the carbon atoms bonded to them.
[0134] In other embodiments, the small molecule has a structure according to formula VIIla or VIIIlb: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, Each R a2 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, and halo; or further, or alternatively, two R atoms bonded to the same carbon atom. a2 However, it forms an oxo group; z is 0, 1, or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0135] For compounds of formula VIIla or Vlllb, z may be selected to be 1 or 2; or z may be selected to be 1. a2 may be selected to be methyl, fluoro, or chloro; or R a2 z may be selected to be methyl. Alternatively, z may be 0.
[0136] For compounds of formula VIIla or Vlllb, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R cw may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0137] For compounds with formula VIIla or VIIIlb, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0138] In other embodiments, the small molecule has the structure of formula IX: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is either 0 or 1 among them; X b It is selected from O, NH, and NCH3; Each R a3 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3However, they form an oxo group or a 3-5 membered carbon ring; or, two Ra groups bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b3 The C1-C3 alkyl group is optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; p is either 1 or 2; y is 0, 1, 2, or 3; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.
[0139] In the case of compounds according to formula IX, y may be selected to be either 0 or 1. a3 This may be selected from halo or methyl; or R a3 However, it may be selected so that it becomes methyl. Alternatively, y may be 0.
[0140] For compounds according to formula IX, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0141] For compounds according to formula IX, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or Rd The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0142] In the case of compounds according to formula IX, p may be 2.
[0143] In the case of a compound according to formula IX, X b It may be O. Or, X b It may also be NH.
[0144] In the case of compounds according to formula IX, R b3 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b3 R may be -CH3, -CH2CH3, -CH2CH2OH, -CH2CH2F, etc. In the case of the compound of formula IX, b3 It may also be methyl.
[0145] In other embodiments, small molecules have a structure according to formula X: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, Each R a3 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, they form an oxo group or a 3-5 membered carbon ring; or, two Ra groups bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b3The C1-C3 alkyl group is optionally a halo, OH, or OC group. 1-3 It is substituted with alkyl; p is either 1 or 2; y is 0, 1, 2, or 3; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0146] For compounds according to formula X, y may be selected to be either 0 or 1. a3 may be selected from halo or methyl, or R a3 However, it may be selected so that it becomes methyl. Alternatively, y may be 0.
[0147] For compounds according to formula X, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0148] For compounds according to formula X, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. dThese may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0149] In the case of the compound according to formula X, p may be 2.
[0150] In the case of a compound according to formula X, R b3 The group may be a C1-C3 alkyl group, which may be unsubstituted, or a halo, OH, or OC group. 1-3 It may be substituted with alkyl. For example, R b3 R may be -CH3, -CH2CH3, -CH2CH2OH, -CH2CH2F, etc. In the case of the compound of formula IX, b3 It may also be methyl.
[0151] In other embodiments, the small molecule has a structure according to formula XIa or XIb: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, Each R a3 The R atoms are independently selected from C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, they form an oxo group or a 3-5 membered carbon ring; or, two Ra groups bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; y is 0, 1, 2, or 3; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions dThese may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0152] For compounds according to formula XIa or XIb, y may be selected to be 0 or 1. a3 This may be selected from halo or methyl; or R a3 y may be selected to be methyl. Alternatively, y may be 0.
[0153] For compounds according to formula XIa or XIb, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0154] For compounds with formula XIa or XIb, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0155] In other embodiments, small molecules have the structure of formula XII: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, X 4 CH, CR d Selected from , and N; X 6 CH, CR dSelected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is either 0 or 1 among them; R b4 This is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2; R b5 It is selected from H and C1-C3 alkyl groups; r is either 1 or 2; s is either 1 or 2; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2.
[0156] In the case of a compound according to formula XII, r and s may be independently selected from 1 or 2. In one embodiment, one of r and s is selected to be 1 and the other to be 2. In another embodiment, both r and s are 2. In yet another embodiment, both r and s are 1.
[0157] For compounds according to formula XII, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0158] For compounds according to formula XII, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0159] For the compound of formula XII, R b4 R is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2. In the embodiment, R b4 may be -NH2, -NH(CH3), -NH(CH2CH3), -N(CH3)2, or N(CH2CH3)2, or R b4 This can be -NH2 or -NH(CH3).
[0160] For the compound of formula XII, R b5 This may be a C1-C3 alkyl group, for example, CH3-CH2CH3, CH2CH2CH3, CH(CH3)2, or especially CH3. Alternatively, R b5 H may also be used.
[0161] In other embodiments, small molecules have a structure according to formula XIII: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, R b4 This is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2; R b5 It is selected from H and C1-C3 alkyl groups; r is either 1 or 2; s is either 1 or 2; Each R cThese are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0162] In the case of a compound according to formula XIII, r and s may be independently selected from 1 or 2. In one embodiment, one of r and s is selected to be 1 and the other to be 2. In another embodiment, both r and s are 2. In yet another embodiment, both r and s are 1.
[0163] For compounds according to formula XIII, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0164] For compounds according to formula XIII, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d The elements may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3. Alternatively, two R elements on adjacent ring positions may be selected. d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0165] For compounds of formula XIII, R b4R is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2. In the embodiment, R b4 may be -NH2, -NH(CH3), -NH(CH2CH3), -N(CH3)2, or N(CH2CH3)2, or R b4 This can be -NH2 or -NH(CH3).
[0166] For compounds of formula XIII, R b5 This may be a C1-C3 alkyl group, for example, CH3-CH2CH3, CH2CH2CH3, CH(CH3)2, or especially CH3. Alternatively, R b5 H may also be used.
[0167] In other embodiments, small molecules have a structure according to formula XIV: [ka] or having a pharmaceutically acceptable salt thereof, in the formula, R b4 This is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2; R b5 It is selected from H and C1-C3 alkyl groups; Each R c These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; Each R d These are independently selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, -CHF2, -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; v is 0, 1, or 2.
[0168] For compounds according to formula XIV, w may be selected from 0 or 1. c This may be selected from halo or methyl; or R c w may be selected from F, Cl, or methyl. Alternatively, w may be 0.
[0169] For compounds according to formula XIV, each R d may be selected from halo, C1-C3 alkyl, -OCH3, -CF3, -CH2F, and -CHF2; or R d R may be selected from CH3, CH2F, CHF2, CF3, F, Cl, Br, and OCH3, d v may be selected from F, Cl, and Br. Alternatively, v is 0. In other embodiments, two R on adjacent ring positions d These may come together to form a 5 or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH.
[0170] For compounds of formula XIV, R b4 R is selected from OH, -NH2, -NH(C1~C3 alkyl), and -N(C1~C3 alkyl)2. In the embodiment, R b4 may be -NH2, -NH(CH3), -NH(CH2CH3), -N(CH3)2, or N(CH2CH3)2, or R b4 This can be -NH2 or -NH(CH3). For compounds of formula XIV, R b5 This may be a C1-C3 alkyl group, for example, CH3-CH2CH3, CH2CH2CH3, CH(CH3)2. Alternatively, R b5 H may also be used.
[0171] In other embodiments, the small molecule has a structure comprising the compounds in Table A (or a pharmaceutically acceptable salt thereof): [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]
[0172] The small molecule ligands of formulas I-XIV and Table A may offer one or more beneficial properties, including improved blood-brain barrier permeability, improved distribution to ocular tissue, low toxicity, and good bioavailability.
[0173] The term "alkyl" refers to a radical of a saturated aliphatic group, including linear and branched alkyl groups. In preferred embodiments, linear or branched alkyl groups have six or fewer carbon atoms in their backbone (e.g., C1-C6 for linear groups, C3-C6 for branched groups). Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl, pentyl, isopentyl, and hexyl. The term "substituted alkyl" refers to an alkyl group having one to four substituents independently selected from halo, amino, amide, sulfonamide, OH, OCH3, nitro, and CN.
[0174] The term "cycloalkyl" refers to a saturated carbocyclic group having 3 to 6 carbon atoms in its ring. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.
[0175] The term "bisicryl" refers to a saturated carbocyclic group having two linking ring systems, which may be condensed or bridged. Examples of bicyclic groups include bisicle[2.1.1]hexane, bisicle[2.2.1]heptane, and decalin. The term "tricyclyl" refers to a saturated carbocyclic group having three linking ring systems, which may be condensed and / or bridged. Examples of tricyclic groups include adamantane.
[0176] A carbocyclic ring system refers to a ring system that contains only carbon atoms as ring atoms (i.e., the ring system does not have heteroatoms as ring atoms). Carbocyclic ring systems can be unsaturated, but preferred carbocyclic rings are not aromatic.
[0177] The term "alkenyl" refers to an unsaturated aliphatic group, and includes linear and branched alkenyl groups having at least one carbon-carbon double bond. In preferred embodiments, the alkenyl group has 2 to 6 carbon atoms (e.g., C2-C6 alkenyl).
[0178] As used herein, the term "halogen" or "halo" designates -F, -Cl, -Br, or -I, and preferably -F, -Cl, or -Br.
[0179] As used herein, the term "alkoxyl" or "alkoxy" refers to an alkyl group, as defined above, that is bonded via an oxygen atom. Typical alkoxyl groups include methoxy, ethoxy, propyloxy, and tert-butoxy.
[0180] The terms "amine" and "amino" refer to both unsubstituted and substituted amines, for example, the part that can be represented by the following general formula: [ka]
[0181] In the formula, R and R' are each independently selected from H and C1-C3 alkyl groups.
[0182] The term "amide" refers to both unsubstituted and substituted amide substituents, for example, the part that can be represented by the following general formula: [ka]
[0183] In the formula, R and R' are each independently selected from H and C1-C3 alkyl groups.
[0184] The term "sulfonamide" or "sulfonamido" refers to both unsubstituted and substituted sulfonamide substituents, for example, the part that can be represented by the following general formula: [ka]
[0185] In the formula, R and R' are each independently selected from H and C1-C3 alkyl groups.
[0186] As used herein, the term “aryl” includes five- and six-membered monocyclic aromatic groups that may contain 0 to 4 heteroatoms, such as benzene, pyrene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine, and pyrimidine. Aryl groups having heteroatoms in their ring structure are sometimes called “aryl heterocyclic” or “heteroaryl” groups. The term “aryl” also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjacent rings (the rings are “fused rings”), and at least one of the rings is aromatic. Thus, aryl includes eight- to ten-membered fused bicyclic aromatic groups that may contain 0 to 5 heteroatoms, in which one or both rings are aromatic, such as napethylene, quinolone, isoquinoline, benzo[b]thiophene, tetrahydronaptylene, etc. Each aryl group may be unsubstituted, or it may be halogen, hydroxyl, amino, cyano, amide, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, or C6-C 10 It may be substituted with 1 to 5 substituents selected from bisicryl, C1-C6 haloalkyl, C1-C6 perhaloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 perhaloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl, and heterocyclyl.
[0187] The term "heterocycline" refers to a non-aromatic heterocycle having 1 to 3 ring heteroatoms. Preferred heterocycles are 5-membered and 6-membered heterocyclic groups having 1 to 3 heteroatoms selected from the group consisting of O, N, and S.
[0188] As used herein, the term “heteroatom” means an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.
[0189] When used herein, the definitions of each expression, for example, alkyl, R 1 , R 2 If such terms appear two or more times in any given structure, it is intended that their definitions are independent of their definitions elsewhere in the same structure.
[0190] It will be understood that such substitutions implicitly include the conditions that they conform to the acceptable valencies of the atom being substituted and the substituent, and that they result in stable compounds, such as those that do not spontaneously undergo transformations such as rearrangement, cyclization, or elimination.
[0191] The aptamer ligands disclosed herein may exist in specific geometric or stereoisomeric forms, and as mixtures thereof. Such geometric or stereoisomeric forms include, but are not limited to, cis- and trans-isomers, R- and S-enantiomers, diastereomers, (D)-isomers, (L)-isomers, racemic mixtures thereof, and other mixtures thereof. Further chiral carbon atoms may be present in substituents such as alkyl groups.
[0192] Compounds according to formulas I to XIV may contain acidic or basic functional groups and therefore may exist in salt form. Preferably, the salt form is a pharmaceutically acceptable salt. In this regard, the term “pharmaceutically acceptable salt” refers to relatively non-toxic inorganic and organic acid and base addition salts of the compounds disclosed herein.
[0193] Compounds according to formulas I to XIV may contain one or more basic functional groups, such as amino or alkylamino compounds, and therefore have the ability to form pharmaceutically acceptable salts with pharmaceutically acceptable acids. These salts can be prepared in situ during the manufacturing process of the administration vehicle or dosage form, or by separately reacting the purified compounds disclosed herein in their free base form with a suitable organic or inorganic acid, and then isolating the salts thus formed during subsequent purification. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and lauryl sulfonate (see, for example, Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci. 66:1-19).
[0194] pharmaceutically acceptable salts of the target compound include conventional non-toxic salts or quaternary ammonium salts of the compound, for example, from non-toxic organic or inorganic acids. For example, such conventional non-toxic salts include those derived from inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, etc., and salts prepared from organic acids, such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid (salicyclic), sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isothionic acid, etc.
[0195] In other cases, compounds according to formulas I-XIV may contain one or more acidic functional groups and are therefore capable of forming pharmaceutically acceptable salts with pharmaceutically acceptable bases. These salts can similarly be prepared in situ during the administration vehicle or dosage form manufacturing process, or separately, by reacting a purified free acid form of the compound with a suitable base, such as a pharmaceutically acceptable metal cation hydroxide, carbonate, or bicarbonate, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine. Typical alkali salts or alkaline earth salts include lithium salts, sodium salts, potassium salts, calcium salts, magnesium salts, and aluminum salts. Typical organic amines useful for forming base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, and piperazine (see, for example, Berge et al. (cited above)).
[0196] In embodiments, the aptamers provided herein bind to or otherwise respond to the presence of one or more compounds of formulas I to XIV provided herein, and / or bind to or otherwise respond to metabolite analogs or derivatives of compounds of formulas I to XIV.
[0197] The specificity of an aptamer's binding to its own ligand can be defined in terms of the comparative dissociation constant (Kd) of the aptamer to its own ligand compared to the dissociation constant of the aptamer to an unrelated molecule. Thus, the ligand can be a molecule that binds to the aptamer with a higher affinity than to an unrelated substance. Typically, the Kd of the aptamer to its own ligand is at least about one-tenth of the Kd of the aptamer to an unrelated molecule. In other embodiments, the Kd is at least about one-twentieth, at least about one-fiftieth, at least about one-hundredth, and at least about one-two hundredth, at least about one-fiftyhm, at least about one-ten-hundredth, or at least about one-ten-ten-thousandth of the Kd of the aptamer to an unrelated molecule.
[0198] Aptamers and ligands for gene expression regulation
[0199] In some embodiments, the aptamers and small molecules intended by this disclosure are used for the regulation of gene expression. Regulation of the expression of target genes (e.g., therapeutic transgenes) is advantageous in a variety of situations. In relation to the therapeutic expression of genes, for example, techniques that enable regulated expression of transgenes in response to the presence of small molecules can enhance safety and efficacy by enabling the regulation of the level and timing of target gene expression. In research settings, regulation of gene expression allows for the systematic investigation of various experimental conditions.
[0200] In embodiments, the sequence encoding the aptamer is part of a gene regulation cassette that provides the ability to modulate the expression level of a target gene in response to the presence or absence of the small molecule described herein. In embodiments, the gene regulation cassette further includes a target gene. As used herein, “target gene” means a transgene that is expressed in response to the presence or absence of a small molecule ligand disclosed herein for a small molecule that binds to the aptamer disclosed herein. In embodiments, the target gene includes a sequence encoding a protein (e.g., a therapeutic protein), miRNA, or siRNA. The target gene is heterogeneous to the aptamer used to regulate target gene expression, heterogeneous to the polynucleotide cassette used to regulate the target gene, and / or heterogeneous to a portion of the polynucleotide cassette used to regulate the target gene.
[0201] The aptamers described herein may be part of a polynucleotide cassette encoding the aptamer as part of a riboswitch when used to modulate the expression of a target gene in response to the presence or absence of the small molecules disclosed herein. The terms “gene regulatory cassette,” “regulatory cassette,” or “polynucleotide cassette” are used herein to mean the same thing.
[0202] In embodiments, the presence of a small molecule disclosed herein that binds to an aptamer disclosed herein results in an increase in the expression of the target gene compared to the expression of the target gene in the absence of the small molecule. In such embodiments, the aptamer constitutes an "on" switch. In embodiments, the expression of the target gene increases by at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold, at least 1000-fold, or at least 10,000-fold in the presence of a small molecule that binds to an aptamer disclosed herein, compared to the absence of the small molecule. In embodiments, the expression of a target gene increases by 2 to 10 times, 5 to 10 times, 5 to 15 times, 5 to 20 times, 5 to 25 times, 5 to 30 times, 10 to 20 times, 10 to 30 times, 10 to 40 times, 10 to 50 times, 10 to 100 times, 10 to 500 times, 10 to 1,000 times, 50 to 100 times, 50 to 500 times, 50 to 100 times, 50 to 1,000 times, 100 to 1,000 times, or 100 to 10,000 times in the presence of a small molecule that binds to an aptamer disclosed herein, compared to the absence of such small molecule.
[0203] In embodiments, the presence of a small molecule that binds to the aptamer disclosed herein results in a decrease in the expression of the target gene compared to the expression of the target gene in the absence of the small molecule. In such embodiments, the aptamer constitutes an "off" switch. In embodiments, the expression of the target gene is reduced by at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold, at least 1000-fold, or at least 10,000-fold in the presence of a small molecule that binds to the aptamer disclosed herein, compared to the absence of such small molecule. In one embodiment, the expression of a target gene is reduced by 2 to 10 times, 5 to 10 times, 5 to 15 times, 5 to 20 times, 5 to 25 times, 5 to 30 times, 10 to 20 times, 10 to 30 times, 10 to 40 times, 10 to 50 times, 10 to 100 times, 10 to 500 times, 10 to 1,000 times, 50 to 100 times, 50 to 500 times, 50 to 100 times, 50 to 1,000 times, 100 to 1,000 times, or 100 to 10,000 times in the presence of a small molecule that binds to an aptamer disclosed herein, compared to the absence of such small molecule.
[0204] In embodiments, the aptamer is part of a riboswitch. A riboswitch is a regulatory segment of an RNA polynucleotide that modulates the stability of the RNA polynucleotide and / or the production of a protein from the RNA polynucleotide depending on the presence or absence of an aptamer-specific ligand molecule. In embodiments, the riboswitch includes a sensor region (e.g., an aptamer region) and an effector region that together sense the presence of a ligand (e.g., a small molecule) and cause an effect that results in an increase or decrease in the expression of a target gene. The riboswitch described herein is recombinant and utilizes polynucleotides derived from two or more sources. In embodiments, the sensor and effector regions are linked by a polynucleotide linker. In embodiments, the polynucleotide linker forms an RNA stem or paired region (i.e., a region of double-stranded RNA polynucleotide). In embodiments, the paired region linking the aptamer and effector region includes all or part of the aptamer stem (e.g., all or part of the aptamer P1 stem as an example).
[0205] Riboswitches containing aptamer sequences can be used to control, for example, the formation of rho-independent transcription termination hairpins, which can lead to premature transcription termination. Riboswitches containing aptamer sequences can also induce structural changes in RNA, resulting in ribosome binding site sequestration and translation inhibition. The alternative riboswitch structures containing aptamer sequences disclosed herein may further influence mRNA splicing in response to the presence of small molecule ligands.
[0206] Alternative splicing riboswitch
[0207] In one embodiment, the aptamers described herein are encoded as part of a gene regulatory cassette for regulating a target gene by aptamer / ligand-mediated alternative splicing of the resulting RNA (e.g., mRNA precursor). In this context, the gene regulatory cassette includes a riboswitch comprising a sensor region (e.g., the aptamers described herein) and an effector region, which together are involved in sensing the presence of a small molecule ligand and altering the splicing to alternative exons. Splicing refers to the process by which intron sequences are removed from a nascent messenger RNA precursor (mRNA precursor) and exons are joined together to form mRNA. A splice site is the junction between an exon and an intron and is defined by different consensus sequences at the 5' and 3' ends of an intron (i.e., the splice donor site and splice acceptor site, respectively). Splicing is carried out by a large, multicomponent structure called a spliceosome, which is a collection of nuclear small molecule ribonucleoproteins (snRNPs) and various accessory proteins. The spliceosome defines exon / intron boundaries by recognizing various cis-regulatory sequences, removes intron sequences, and splices exons together to form the final message (e.g., mRNA). In alternative splicing, the final coding message is altered by including or excluding specific exons, thereby changing the resulting expressed protein.
[0208] In one embodiment, control of target gene expression is achieved using one of the DNA constructs disclosed in WO2016 / 126747, which are incorporated herein by reference in their entirety. In embodiments of this disclosure, the riboswitch and polynucleotide cassette disclosed in WO2016 / 126747 include an aptamer coding sequence described herein instead of the aptamer sequence disclosed in WO2016 / 126747.
[0209] In one embodiment, the polynucleotide cassette comprises (a) a riboswitch and (b) an exon in which a 5' intron and a 3' intron are selectively spliced adjacent to each other, wherein the riboswitch comprises (i) an effector region comprising a stem-forming sequence containing a 5' splice site sequence (and a complementary sequence) of the 3' intron, and (ii) an aptamer disclosed herein. In the embodiment, the effector region is a stem-forming region that forms the P1 stem of the aptamer (see, for example, Figures 1a and 1b). Thus, in the embodiment, the effector stem is or comprises the P1 stem of the aptamer disclosed herein. In other words, the effector stem includes a first sequence (5' effector stem arm) attached to the 5' end of the aptamer disclosed herein and a second sequence (3' effector stem arm) attached to the 3' end of the aptamer disclosed herein, wherein the first or second sequence includes a 5' splice site sequence of the 3' intron, and the other includes a sequence complementary to the 5' splice site sequence of the 3' intron. In embodiments, the effector region stem includes an intron 5' splice site ("5'ss") sequence of the intron on the 3' side immediately following the selective exon, in addition to a sequence complementary to the 5'ss sequence of the 3' intron.
[0210] 5' splice site sequences are well known in the art. There is some degree of variability between different 5' splice site sequences, and this variability is also well understood in the art. For example, Shapiro and Senapathy (Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res. 1987 Sep 11;15(17):7155-74 or Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. 1998 May;7(5):919-32, the whole of which is incorporated herein) describe which positions of splice site sequences have some degree of variability and which positions are fixed for various eukaryotes. Similarly, Zhang (Zhang MQ. Statistical features of human exons and their flanking regions. Hum Mol Genet. 1998 May;7(5):919-32, the entire work of which is incorporated herein) also indicates which positions of the splice site sequence have some degree of variability and which positions are fixed. Thus, those skilled in the art can easily recognize the splice site sequence based on known consensus sequences and their position relative to exon / intron boundaries.Examples of splice site sequences include, but are not limited to, the following: AGG || GTGAGT;AAA || GTAAGC;GCA || G TA AGT;GAG || GTGTGG;A / CAG || GTA / GAGT;NAG || GTA / GAGT;NAG || GTAAGT;A / CA / TG || GTANGT; and NAG / A || GTAAGT (|| indicates an exon-intron boundary, and N represents A, G, C, or T).
[0211] When an aptamer binds to its ligand, the effector region forms a stem, thus preventing splicing of the alternative exon to the splice donor site at its 3' end. This prevents the incorporation of the alternative exon into the target gene mRNA, resulting in increased expression of the target gene in the presence of the ligand. Under certain conditions (e.g., when the aptamer is not bound to its ligand), the effector region provides access to the splice donor site at the 3' end of the alternative exon, resulting in the incorporation of the alternative exon into the target gene mRNA and suppression of target gene expression. In some embodiments, a polynucleotide cassette is placed within the target gene to regulate the expression of the target gene in response to the ligand. In one embodiment, the alternatively spliced exon includes a stop codon that is in-frame with the target gene when the alternatively spliced exon is spliced into the target gene mRNA.
[0212] In one embodiment, the gene regulatory cassette includes the sequences of SEQ ID NOs: 2 and 3, as shown below, where SEQ ID NO: 2 is located at 5' of the aptamer coding sequence disclosed herein, and SEQ ID NO: 3 is located at 3' of the aptamer coding sequence disclosed herein (-X- indicates the aptamer). Lowercase letters indicate paired stem sequences that ligate the aptamer to the remainder of the riboswitch. In one embodiment, a selective exon (underlined in SEQ ID NO: 2 below) is replaced with another selective exon sequence.
[0213] Sequence ID 2 (-X- 5') and Sequence ID 3 (-X- 3'):
[0214] [ka]
[0215] The selective exon is flanked by a 5' intron sequence and a 3' intron sequence. The 5' intron sequence and 3' intron sequence that can be used in the gene regulatory cassette disclosed herein may be any sequence that can be excised from a target gene to produce either the mRNA of the target gene or a target gene containing a selective exon in its mRNA, depending on the presence or absence of a ligand that binds to an aptamer. The 5' intron sequence and 3' intron sequence each have sequences necessary for splicing to occur, namely a splice donor sequence, a splice acceptor sequence, and a branching site sequence. In one embodiment, the 5' intron sequence and 3' intron sequence of the gene regulatory cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5' and 3' intron sequences are derived from truncated human β-globin intron 2 (IVS2Δ), intron 2 of the human O3 globin gene, the SV40 mRNA intron (used in the pCMV-LacZ vector from Clontech Laboratories, Inc.), intron 6 of the human triose phosphate isomerase (TPI) gene (Nott Ajit, et al. RNA. 2003, 9:6070617), an intron derived from human factor IX (Sumiko Kurachi, et al. J. Bio. Chem. 1995, 270(10), 5276), an endogenous intron of the target gene itself, or any genomic fragment or synthetic intron containing enough elements for regulated splicing (Thomas A. Cooper, Methods 2005(37):331) (Yi Lai, et al. Hum Gene Ther. 2006: 17(10):1036).
[0216] In one embodiment, the selective exon and riboswitch are engineered to reside within an endogenous intron of the target gene. That is, the intron (or substantially similar intron sequence) naturally arises at that location in the target gene. In this case, the intron sequence immediately upstream of the selective exon is called the 5' intron or 5' intron sequence, and the intron sequence immediately downstream of the selective exon is called the 3' intron or 3' intron sequence. In this case, the endogenous intron is modified to include splice acceptor and splice donor sequences adjacent to the 5' and 3' ends of the selective exon. In one embodiment, the 5' intron and / or 3' intron are exogenous to the target gene.
[0217] The splice donor and splice acceptor sites of alternative splicing gene regulatory cassettes can be modified to enhance or weaken them. That is, by standard cloning methods, site-directed mutagenesis, etc., splice sites can be altered to more closely resemble the consensus of splice donors or splice acceptors. Splice sites that are similar to the splice consensus tend to promote splicing and are therefore enhanced. Splice sites that are less similar to the splice consensus tend to hinder splicing and are therefore weakened. The consensus for the splice donor of the most common class of intron (U2) is A / CAG∥GTA / GAGT (∥ indicates an exon / intron boundary). The consensus for the splice acceptor is CAG∥G (∥ indicates an exon / intron boundary). The frequencies of specific nucleotides at splice donor and splice acceptor sites have been reported in the art (see, for example, Zhang, MQ, Hum Mol Genet. 1988. 7(5):919-932). The strength of the 5' and 3' splice sites can be adjusted to control alternative exon splicing.
[0218] Additional modifications to the 5' and 3' introns present in the alternative splicing gene regulatory cassette that can be performed to regulate splicing include modifying, removing, and / or adding intratron splicing enhancer elements, intratron splicing suppressor elements, and / or splice sites, and / or modifying branching site sequences.
[0219] In one embodiment, the 5' intron is modified to include a stop codon that is in-frame with the target gene. The 5' and 3' intron sequences may also be modified to remove latent slice regions, which can be identified using publicly available software (see, for example, Kapustin, Y. et al. Nucl. Acids Res. 2011.1-8).
[0220] For example, the lengths of the 5' and 3' intron sequences can be adjusted to meet size requirements for the viral expression construct. In one embodiment, the 5' and / or 3' intron sequences are about 50 to about 300 nucleotides long. In another embodiment, the 5' and / or 3' intron sequences are about 125 to about 240 nucleotides long.
[0221] The stem portion of the effector region must be long enough (and have sufficient GC content) to substantially prevent alternative splicing of alternative exons when the ligand binds to the aptamer, while also allowing access to the splice site when a sufficient amount of ligand is not present. In embodiments, the stem portion of the effector region includes a stem sequence in addition to the 5' splice site sequence of the 3' intron and its complementary sequence. In embodiments, this additional stem sequence includes a sequence derived from the aptamer stem. The length and sequence of the stem portion can be modified using known techniques to identify a stem that allows for acceptable background expression of the target gene when the ligand is absent and allows for acceptable expression levels of the target gene when the ligand is present. In one embodiment, the stem of the effector region of the riboswitch is about 7 to about 20 base pairs long. In one embodiment, the length of the effector region stem is 8 to 11 base pairs long. In addition to the length of the stem, the stability of the stem can be modified by changing the GC base pair content of the stem.
[0222] In one embodiment, an alternative exon, which is part of the alternative splicing gene regulatory cassette disclosed herein, is a polynucleotide sequence capable of being transcribed to an mRNA precursor and alternatively spliced to the mRNA of a target gene. In one embodiment, the alternative exon includes at least one sequence that inhibits translation such that, when the alternative exon is included in the mRNA of the target gene, the expression of the target gene from that mRNA is blocked or reduced. In a preferred embodiment, the alternative exon includes a stop codon (TGA, TAA, TAG) that is in-frame with the target gene when the alternative exon is included in the mRNA of the target gene by splicing. In an embodiment, the alternative exon includes, in addition to or as an alternative to the stop codon, another sequence that results in mRNA degradation, which reduces or substantially blocks translation when the alternative exon is incorporated into the mRNA of the target gene by splicing, for example, at a microRNA binding site. In one embodiment, the alternative exon includes a miRNA binding sequence that results in mRNA degradation. In one embodiment, the selective exon codes for a polypeptide sequence, which reduces the stability of the protein containing this polypeptide sequence. In another embodiment, the selective exon codes for a polypeptide sequence, which instructs the protein containing this polypeptide sequence to degrade.
[0223] The basic or background level of alternative exon splicing can be optimized by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences, and / or by introducing ESE or ESS sequences into alternative exons. Such alterations to alternative exon sequences can be achieved using methods well known in the art, including, but not limited to, site-directed mutagenesis. Alternatively, oligonucleotides of the desired sequence (e.g., including all or part of the alternative exon) can be obtained from commercial sources and cloned into gene regulation cassettes. Identification of ESS and ESE or ESS sequences can be achieved by methods well known in the art, including, for example, ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: A Web Source for Identifying Exon Splicing Enhancers, Nucleic Acid Research, 2003, 31(13): 3568-3571, and / or other available materials.
[0224] In one embodiment, the selective exon is a naturally occurring exon. In another embodiment, the selective exon is derived from all or part of a well-known exon. In this context, “derived” means a selective exon that is substantially homologous to a naturally occurring exon or part of it, but may contain mutations produced by altering various mutations, such as exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences, and / or by introducing an ESE or ESS sequence into the selective exon. As used herein, “homology” and “homology” mean the percentage identity of two polynucleotide sequences or two polypeptide sequences. The agreement between one sequence and another can be measured by techniques well known in the art. For example, homology can be measured by directly comparing two polypeptide molecules by aligning the sequences and using readily available computer programs. Alternatively, homology can be measured by hybridizing polynucleotides under conditions that form a stable duplex between homologous regions, then digesting them with a single-strand specific nuclease(s), and measuring the size of the digested fragments. Two polynucleotides or two polypeptide sequences are "substantially homologous" to each other if, after optimal alignment by appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of their nucleotides or amino acids, as determined using the methods described above, match over a defined length of the molecule.
[0225] In one embodiment, the alternative exon may be exogenous to the target gene but derived from a sequence originating from the organism in which the target gene is expressed. As used herein, “exogenous” means that the genotype originates from an entity different from the genotype of the rest of the entity being compared to or introduced or incorporated into. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and may encode a heterologous polypeptide when expressed). In one embodiment, the alternatively spliced exon originates from exon 2 of the human dihydrofolate reductase gene (DHFR), exon 5 of mutant human Wilms tumor 1, mouse calcium / calmodulin-dependent protein kinase IIΔ exon 16, or exon 6 of SIRT1. In an embodiment, the alternatively spliced exon is or includes modified DHFR exon 2 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAG) in SEQ ID NO: 5. In this embodiment, the exon that has undergone alternative splicing is or includes the modified DHFR exon 2 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAATCTTCAGTAGAAG) in SEQ ID NO: 6.
[0226] Aptamer-mediated cleavage by self-cleaving ribozymes
[0227] In one embodiment, aptamer-mediated expression of a target gene is regulated by aptamer-mediated regulation of a small endonuclease-like ribozyme. A ribozyme is an RNA enzyme that catalyzes a chemical reaction. In the nucleic acids and methods disclosed herein, the ribozyme can be any small endonuclease-like ribozyme that self-cleaves in a target cell type, including, but not limited to, Hammerhead, Hairpin, Hepatitis Delta Virus, Varkud Satellite, Twister, Twister Sister, Pistol, or Hatchet ribozyme. Accordingly, in one embodiment, a riboswitch and a gene expression cassette comprising a riboswitch containing a ribozyme linked to an aptamer disclosed herein are provided. WO2017 / 136608, which is incorporated herein by reference in its entirety, describes riboswitches that activate ribozyme autocleavage in the presence of an aptamer ligand ("off" switches), or riboswitches that inhibit ribozyme autocleavage in the presence of an aptamer ("on" switches).
[0228] In an "off" switch scenario, aptamer / ligand binding increases the ribonuclease function of the ribozyme, resulting in cleavage of the target gene RNA containing the polynucleotide cassette, thereby reducing target gene expression. An example of such an off switch is a polynucleotide cassette for regulating target gene expression, comprising a riboswitch containing a twister ribozyme linked to an aptamer by a stem, where the stem linking the twister ribozyme to the aptamer is bound to the ribozyme at the P3 stem position of the twister ribozyme, and the target gene is linked to the P1 stem of the twister ribozyme (see, for example, Figure 1a, Figure 1b, or Figure 3a of WO2017 / 136608, incorporated herein by reference, and related text).
[0229] In the "on" switch scenario, aptamer / ligand binding inhibits the ribonuclease function of the ribozyme, reducing the cleavage of target gene RNA containing polynucleotide cassettes, thereby increasing target gene expression in the presence of the ligand. An example of an on-switch is a riboswitch comprising a twister ribozyme coupled to an aptamer, where the aptamer is coupled to the 3' or 5' end of the P1 stem of the twister ribozyme, where, if the aptamer is coupled to the 3' end of the P1 stem of the twister ribozyme, a portion of the 3' arm of the P1 stem of the twister ribozyme is alternatively the 5' arm of the aptamer P1 stem, and where, if the aptamer is coupled to the 5' end of the P1 stem of the twister ribozyme, a portion of the 5' arm of the P1 stem of the twister ribozyme is alternatively the 3' arm of the aptamer P1 stem (see, for example, Figures 6a-6b and related text of WO2017 / 136608 incorporated herein by reference).
[0230] Aptamer regulation of polyadenylation
[0231] In this embodiment, the expression of a target gene is regulated by polyadenylation controlled by an aptamer. The 3' end of almost all eukaryotic mRNA contains a poly(A) tail—a homopolymer of 20 to 250 adenosine residues. Adding the poly(A) tail to mRNA prevents its degradation, and thus, by regulating the polyadenylation of the corresponding mRNA, gene expression can be affected.
[0232] In one embodiment, the expression of a target gene is regulated via the accessibility of a polyadenylated sequence, regulated by an aptamer, as described in WO2018 / 156658, which is incorporated herein by reference in its entirety. In such an embodiment, the riboswitch comprises an effector stem loop and an aptamer as described herein, wherein the effector stem loop comprises a polyadenylated signal, and the aptamer and the effector stem loop are connected by a selective covalent stem arm containing a non-covalent arm of the aptamer stem (e.g., the aptamer P1 stem) and a sequence complementary to the non-covalent arm of the effector stem loop (see, for example, Figures 1a, 1b, 2a, and 5a of WO2018 / 156658, incorporated herein by reference, and related text). In one embodiment, the effector stem loop is located on the 3' side of the aptamer such that a selective shared stem arm includes all or part of the 3' aptamer stem arm and all or part of the 5' arm of the effector stem. In one embodiment, the effector stem loop is located on the 5' side of the aptamer such that a selective shared stem arm includes all or part of the 5' aptamer stem arm and all or part of the 3' arm of the effector stem. In one embodiment, the polyadenylation signal includes AATAAA or ATTAA. In one embodiment, the polyadenylation signal is AATAAA or ATTAAA. In an embodiment, the polyadenylation signal is a downstream element (DSE). In one embodiment, the polyadenylation signal is an upstream array element (USE). In one embodiment, the polynucleotide cassette includes two riboswitches, the effector stem loop of the first riboswitch including all or part of the polyadenylation signal AATAAA or ATTAAA, and the effector stem loop of the second riboswitch including all or part of the downstream element (DSE). In one embodiment, each of the two riboswitches includes an aptamer that binds to the same ligand. In one embodiment, the two riboswitches include different aptamers that bind to different ligands.
[0233] In some embodiments, a riboswitch comprises a sensing region (e.g., an aptamer as described herein) and an effector region containing a binding site for the nuclear small molecule ribonucleoprotein (snRNP) U1, which is part of the spliceosome. WO2017 / 136591 describes a riboswitch in which the effector region comprises a U1 snRNP binding site (and a complementary sequence), the entirety of which is incorporated herein by reference. When the aptamer binds to its ligand, the effector region forms a stem, sequestering the U1 snRNP binding site so that it does not bind to U1 snRNP. Under certain conditions (e.g., when the aptamer does not bind to its ligand), the effector region is in the context of granting access to the U1 snRNP binding site, allowing U1 snRNP to bind to mRNA, inhibit polyadenylation, and result in the degradation of the message. The U1 snRNP binding site can be any polynucleotide sequence that has the ability to bind to U1 snRNP and thereby recruit U1 snRNP to the 3'UTR of the target gene, thereby repressing the polyadenylation of the target gene message. In one embodiment, the U1 snRNP binding site is CAGGTAAGTA (or CAGGUAAGUA if it is in mRNA). In some embodiments, the U1 snRNP binding site is a variation of the consensus sequence, including, for example, a sequence shorter than the consensus sequence or a sequence having one or more nucleotides modified from the consensus sequence. In one embodiment, the U1 snRNP binding site contains the sequence CAGGTAAG. In some embodiments, the binding site is encoded by a sequence selected from CAGGTAAGTA, CAGGTAAGT, and CAGGTAAG. The U1 snRNP binding site can be any 5' splice site sequence derived from a gene, for example, a 5' splice site derived from human DHFR exon 2.
[0234] Aptamer-mediated regulation of ribonuclease cleavage.
[0235] In one embodiment, the expression of a target gene is regulated via ribonuclease cleavage regulated by an aptamer. A ribonuclease (RNase) recognizes and cleaves a specific ribonuclease substrate sequence. This specification provides recombinant DNA constructs that, when incorporated into the DNA of the target gene, provide the ability to regulate the expression of the target gene by aptamer / ligand-mediated ribonuclease cleavage of the resulting RNA. In some embodiments, the aptamer coding sequence described herein is part of a construct that includes or codes for a riboswitch containing a ribonuclease substrate sequence, an effector region, and an aptamer (as described in WO2018 / 161053, which is incorporated herein by reference in its entirety) such that when the aptamer binds to a ligand, target gene expression occurs. In embodiments, the RNase P substrate sequence is linked to a riboswitch, the riboswitch containing an effector region and the aptamer described herein, the effector region containing a sequence complementary to a portion of the RNase P substrate sequence. Binding of a suitable ligand to the aptamer induces structural changes in the aptamer and effector regions, altering the accessibility of the ribonuclease substrate sequence to cleavage by ribonucleases.
[0236] In one embodiment, the aptamer sequence is located 5' to the RNase P substrate sequence, and the effector region includes all or part of the leader sequence and all or part of the 5' acceptor stem sequence of the RNase P substrate sequence. See, for example, Figures 1a, 1b, and 3b of WO2018 / 161053 incorporated herein by reference and related text. In further embodiments, the acceptor stem of the RNase P substrate and the riboswitch effector region are separated by 0, 1, 2, 3, or 4 nucleotides. In other embodiments, the effector region stem includes, in addition to the leader sequence (and its complement), one or more nucleotides of the acceptor stem of the RNase P substrate and sequences complementary to one or more nucleotides of said acceptor stem.
[0237] In one embodiment, the aptamer sequence of the polynucleotide cassette is located 3' to the RNase P substrate sequence, and the effector region contains a sequence complementary to all or part of the 3' acceptor stem of the RNase P substrate sequence. See, for example, Figure 3a of WO2018 / 161053, incorporated herein by reference, and related text. In further embodiments, the effector region sequence complementary to the 3' acceptor stem of the RNase P substrate consists of 1 to 7 nucleotides. In other words, the effector region stem contains 1 to 7 nucleotides of the acceptor stem and a sequence complementary to these 1 to 7 nucleotides of the acceptor stem. In embodiments, the riboswitch is located 3' to the substrate of RNase P, so the effector region stem does not overlap with the acceptor stem of the RNase P substrate. In embodiments, the effector region and the acceptor stem of the RNase P substrate are directly adjacent (i.e., do not overlap). In other embodiments, the effector region and acceptor stem of the RNase P substrate are separated by one, two, three, four, five, or more nucleotides.
[0238] target genes
[0239] The aptamers and gene regulatory cassettes disclosed herein can be used to regulate the expression of any target gene that may be expressed in a target cell, tissue, or organism. The term “target gene” refers to a polynucleotide that is introduced into a cell and has the ability to be transcribed into RNA and translated and / or expressed under appropriate conditions. Alternatively, the target gene may be endogenous to the target cell, and the gene regulatory cassette may be placed within the target gene (e.g., within an existing untranslated region or intron of the endogenous target gene).
[0240] An example of a target gene is a polynucleotide encoding a therapeutic polypeptide. In one embodiment, the target gene is exogenous to the cell that transcribes the recombinant DNA construct. In another embodiment, the target gene is endogenous to the cell that transcribes the recombinant DNA construct. The target gene may be a protein-coding gene or a sequence encoding non-protein-coding RNA. The target gene may be, for example, a gene encoding a structural protein, enzyme, cell signaling protein, mitochondrial protein, zinc finger protein, hormone, transport protein, growth factor, cytokine, intracellular protein, extracellular protein, transmembrane protein, cytoplasmic protein, nucleoprotein, receptor molecule, RNA-binding protein, DNA-binding protein, transcription factor, translation mechanism, channel protein, motor protein, cell adhesion molecule, mitochondrial protein, metabolic enzyme, kinase, phosphatase, exchange factor, chaperone protein, and a modulator of any of these. In this embodiment, the target gene encodes erythropoietin (Epo), human growth hormone (hGH), activator-like effector nuclease (TALEN), human insulin, CRISPR-related protein 9 (Cas9), or immunoglobulin (or a portion thereof), such as a therapeutic antibody.
[0241] In this embodiment, the target gene is Cas9 or CasRx, and the expression construct further comprises a guide RNA (gRNA), for example, a gRNA targeting PCSK9, which may be used to modulate the expression of the gRNA target.
[0242] In one embodiment, the target gene is PTH. In another embodiment, the target gene is insulin (e.g., a sequence including A chain, B chain, and C peptide) for use in regulating insulin levels in response to a small molecule for treating diabetes.
[0243] In embodiments, the target gene is a therapeutic antibody comprising an anti-PCSK9 antibody, an anti-VEGFR2 antibody (e.g., for ophthalmic use), an anti-amyloid Aβp3-42 antibody, an anti-IL-17 antibody, an anti-PD1 antibody, and an anti-HER2 antibody. In embodiments where the target gene is an antibody, the heavy and light chains may be expressed from a single message separated by a protein cleavage site (e.g., furan) or a peptide autoelimination site (e.g., a 2A peptide such as T2A or P2A).
[0244] In the embodiment, the target gene encodes an antibody against the SARS-CoV-2 viral protein or antigen (such as the spike protein) (e.g., casirivimab and / or imudemab (Regeneron), or bacranivimab and / or etesevimab (Eli Lilly)). In the embodiment, the target gene encodes all or part of the SARS-CoV-2 spike protein, and induction of its expression produces mRNA, thus functioning like an inducible mRNA vaccine (mRNA-1273, Moderna or Comirnaty, Pfizer-BioNTech).
[0245] In embodiments, the aptamers and gene regulatory cassettes disclosed herein are used to regulate the expression of target genes in eukaryotic cells, such as mammalian cells, and more specifically, human cells. In embodiments, the aptamers and gene regulatory cassettes disclosed herein are used to regulate the expression of target genes in the eye (including the cornea and retina), the central nervous system (including the brain), the liver, kidney, pancreas, heart, airway, muscle, skin, lung, cartilage, testes, arteries, thymus, bone marrow, or tumors.
[0246] In one embodiment, recombinant vectors and their use for introducing polynucleotides comprising a target gene and a gene regulatory cassette are provided, the gene regulatory cassette comprising an aptamer disclosed herein. In some embodiments, the recombinant DNA construct includes additional DNA elements, which include a DNA segment that results in DNA replication in a host cell and expression of the target gene at an appropriate level in the target cell. Those skilled in the art will understand that expression regulatory sequences (promoters, enhancers, etc.) are selected based on their ability to promote the expression of the target gene in the target cell. "Vector" means a recombinant plasmid, yeast artificial chromosome (YAC), minichromosome, DNA minicircle, or virus (including a virus-derived sequence) containing polynucleotides to be delivered into a host cell in vitro or in vivo. In one embodiment, the recombinant vector is a viral vector or a combination of multiple viral vectors.
[0247] Viral vectors for the expression of target genes in target cells, tissues, or organisms are known in the art and include adenovirus (AV) vectors, adeno-associated virus (AAV) vectors, retrovirus and lentivirus vectors, and herpes simplex virus type 1 (HSV1) vectors.
[0248] Adenovirus vectors include those based on human adenovirus type 2 and human adenovirus type 5, for example, those that have been rendered replication-deficient via deletions in the E1 and E3 regions. An E1 / E3 deletion recombinant AV vector can be obtained by inserting a transcription cassette into the E1 region. Adenovirus vectors also include helper-dependent high-capacity adenovirus vectors (also known as high-capacity "gutless" or "gutted" vectors) that do not contain a viral coding sequence. These vectors contain cis-acting elements necessary for viral DNA replication and packaging, primarily terminal inverted repeats (ITRs) and packaging signals (CYs). The genomes of these helper-dependent AV vectors can carry foreign DNA ranging from several hundred base pairs to approximately 36 kb.
[0249] Recombinant adeno-associated virus (rAAV) vectors include any vector derived from any adeno-associated virus serotype, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, and AAV-8, AAV-9, and AAV-10. The rAAV vector may have one or more AAV wild-type genes, preferably the Rep and / or Cap genes, deleted in whole or in part, but retain functional adjacent ITR sequences. These functional ITR sequences are retained for the rescue, replication, packaging, and potential chromosomal integration of the AAV genome. The ITRs do not need to be wild-type nucleotide sequences and may be altered (e.g., by nucleotide insertion, deletion, or substitution) as long as the sequence enables functional rescue, replication, and packaging.
[0250] Alternatively, other systems such as lentiviral vectors can be used. Lentiviral-based systems can transduce both non-dividing and dividing cells, making them useful for applications targeting non-dividing cells in the CNS, for example. Lentiviral vectors are derived from human immunodeficiency virus and, like the virus itself, are integrated into the host genome, offering the potential for very long-term gene expression.
[0251] Polynucleotides, such as plasmids, YACs, minichromosomes, and minicircles, which hold target genes containing gene regulatory cassettes, can also be introduced into cells or organisms by non-viral vector systems, for example, using cationic lipids, polymers, or both as carriers. Binding poly-L-lysine (PLL) polymer systems and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors to cells. Other methods for delivering vectors to cells include hydrodynamic injection, electroporation, and the use of ultrasound, for both cell cultures and organisms. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012;1:27), incorporated herein by reference.
[0252] In one embodiment, the Disclosure provides a method for regulating the expression of a target gene (e.g., a therapeutic gene), comprising: (a) inserting a polynucleotide cassette containing an aptamer disclosed herein into the target gene; (b) introducing the target gene containing the polynucleotide cassette into a cell; and (c) exposing the cell to a small molecule ligand that specifically binds to the aptamer in an effective amount for inducing the expression of the target gene. In this embodiment, the expression of the target gene in the target cell confers a desired characteristic to the cell into which the target gene has been introduced, or otherwise produces a desired therapeutic outcome.
[0253] In one embodiment, a gene regulation cassette containing the aptamer disclosed herein is inserted into the protein-coding sequence of a target gene (rather than within the 5' or 3' untranslated region). In one embodiment, a single gene regulation cassette containing the aptamer disclosed herein is inserted into the target gene. In other embodiments, two, three, four, or more gene regulation cassettes are inserted into the target gene, and one or more gene regulation cassettes contain the aptamer disclosed herein. In one embodiment, two gene regulation cassettes are inserted into the target gene, and one or both gene regulation cassettes contain the aptamer disclosed herein. When multiple gene regulation cassettes are inserted into the target gene, each of them may contain the same aptamer so that target gene expression can be regulated using a single ligand. In other embodiments, multiple gene regulation cassettes are inserted into the target gene, and each may contain a different aptamer so that target gene expression is regulated by exposure to multiple different small molecule ligands.
[0254] Treatment method and pharmaceutical composition
[0255] In one embodiment, a method is provided for regulating the level of a therapeutic protein delivered by gene therapy. A therapeutic gene sequence containing a regulatory cassette comprising an aptamer disclosed herein is delivered to target cells in the body, for example, by a vector. The cell specificity of target gene expression may be controlled by the promoter and / or other elements within the vector and / or by the capsid of the viral vector. Delivery of the vector construct containing the target gene and transfection of the target tissue resulting in stable transfection of the regulated target gene are the first steps in generating the therapeutic protein. However, due to the aptamer within the target gene sequence, the target gene is not expressed at a significant level; that is, in the absence of a specific ligand that binds to the aptamer contained within the regulatory cassette riboswitch, the target gene is in an "off state." Target gene expression is activated only when an aptamer-specific ligand is administered.
[0256] There is generally a time lag between the delivery of the vector construct containing the target gene and the delivery of the activating ligand. The delivery of the activating ligand controls when the target gene is expressed and the level of protein expression. Ligands can be delivered by numerous pathways, including, but are not limited to, intravitreous, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intrafocal, topical, intraperitoneal, intravenous (IV), intraarterial, perivascular, intracerebral, intraventricular, oral, sublingual, sublabial, oral cavity, nasal, intrathoracic, intracardiac, intramedullary, epidural, intraosseous, or intraarticular.
[0257] The timing of ligand delivery depends on the requirements for activation of the target gene. For example, if the therapeutic protein encoded by the target gene is always needed, the oral small molecule ligand may be delivered daily or multiple times a day to ensure continuous activation of the target gene and, consequently, continuous expression of the therapeutic protein. If the target gene has a long-lasting effect, the inducing ligand may be administered less frequently, for example, once a week, once every two weeks, or once a month.
[0258] The aptamers described herein in relation to gene regulatory cassettes, including riboswitches, enable the temporal control of therapeutic transgene expression in a manner determined by the temporal administration of an aptamer-specific ligand. Restricted expression of therapeutic transgenes only upon ligand administration enhances the safety of gene therapy procedures by allowing the target gene to be turned off in the absence of the ligand.
[0259] Different aptamers can be used in multiple riboswitches to upregulate or downregulate the expression of target genes with different ligands. In certain embodiments, each therapeutic gene containing a regulatory cassette has a specific aptamer within the cassette that is activated by a specific small molecule. This means that each therapeutic gene can only be activated by a ligand specific to the aptamer contained within it. In these embodiments, each ligand activates only one therapeutic gene. This allows for the possibility of delivering several different “target genes” to a single individual, with each target gene being activated upon delivery of a specific ligand to the aptamer contained within its respective regulatory cassette.
[0260] In relation to riboswitches, the aptamers disclosed herein enable the body to produce any therapeutic protein (such as erythropoietin (EPO) or a therapeutic antibody) that can be delivered to the body when an activating ligand is delivered. This therapeutic protein delivery method can replace the production of such therapeutic proteins (e.g., antibodies used to inhibit cancer, inflammatory diseases, or autoimmune diseases) in vitro, which are later injected or infused. A body containing a regulated target gene becomes a biopharmaceutical manufacturing plant that is switched on when a gene-specific ligand is administered.
[0261] In one embodiment, the target protein may be a nuclease capable of targeting and editing a specific DNA sequence. Examples of such nucleases include CasRx, Cas9, zinc finger-containing nucleases, or TALENs. In the case of these nucleases, the nuclease protein may only be needed for a short period sufficient to edit the target endogenous gene. However, if an unregulated nuclease gene is delivered to the body, this protein may persist for the remainder of the cell's life. For nucleases, the longer the nuclease persists, the higher the risk of off-target editing. Regulating the expression of such proteins offers significant safety advantages. In this case, a vector containing a nuclease target gene with a regulatory cassette could be delivered to the appropriate cells in the body. Since the target gene is in an "off" state in the absence of a cassette-specific ligand, no nuclease is produced. The nuclease is produced only when an activating ligand is administered. Once sufficient time has elapsed for adequate editing to occur, the ligand is removed and not administered again. Therefore, the nuclease gene is subsequently turned "off," no further nuclease is produced, and editing stops. This technique can be used to correct genetic conditions, including many hereditary retinopathy conditions such as LCA10, caused by mutations in CEP290, and Stargardt disease, caused by mutations in ABCA4.
[0262] The administration of regulated target genes encoding therapeutic proteins that are activated only upon administration of a specific ligand may be used to modulate therapeutic genes to treat many different types of diseases, such as cancer induced by therapeutic antibodies, immune disorders induced by immunomodulatory proteins or antibodies, metabolic diseases induced by anti-C5 antibodies or antibody fragments as regulated genes, rare diseases such as PNH, or ocular angiogenesis induced by therapeutic antibodies, and atrophic AMD induced by immunomodulatory proteins.
[0263] A wide variety of specific target genes, enabling the treatment of a wide range of specific diseases and conditions, are suitable for use as target genes whose expression can be regulated using the aptamers / ligands described herein. For example, insulin or an insulin analog (preferably human insulin or an analog of human insulin) may be used as a target gene to treat type 1 diabetes, type 2 diabetes, or metabolic syndrome; human growth hormone may be used as a target gene to treat children with growth disorders or adults with growth hormone deficiency; and erythropoietin (preferably human erythropoietin) may be used as a target gene to treat anemia due to chronic kidney disease, anemia due to myelodysplasia, or anemia due to cancer chemotherapy. Additional target genes compatible with the aptamers and gene expression cassettes disclosed herein include, but are not limited to, cyclic nucleotide-dependent cation channel alpha-3 (CNGA3) and cyclic nucleotide-dependent cation channel beta-3 (CNGB3) for the treatment of color blindness; retinoid isomerohydrolase (RPE65) for the treatment of retinitis pigmentosa or Leber congenital amaurosis; X-linked retinitis pigmentosa GTPase regulator (RPGR) for the treatment of X-linked retinitis pigmentosa; glutamate decarboxylase (GAD) for the treatment of Parkinson's disease, etc.; nonsense transcript regulator 1 (UPF1) for the treatment of amyotrophic lateral sclerosis; and aquaporins for the treatment of radiation-induced xerostomia and Sjögren's syndrome. Additional target genes include ArchT (archaerodopsin from Halorubrum strain TP009), Jaws (crux halorhodopsin from Haloarcula (Halobacterium) salinarum (Shark strain)), iC1C2 (a variant of the chimeric C1C2 between channelrhodopsins ChR1 and ChR2 from Chlamydomonas reinhardtii), or Rgs9-anchored proteins (R9AP), which are key components of the GTPase complex that mediates the deactivation of the phototransduction cascade.
[0264] Expression constructs comprising aptamers disclosed herein may be particularly suitable for the treatment of diseases resulting from single gene deficiencies, such as cystic fibrosis, hemophilia, muscular dystrophy, thalassemia, or sickle cell anemia. Therefore, human β-, γ-, δ-, or ζ-globin may be used as the target gene to treat β-thalassemia or sickle cell anemia, and human factor VIII or factor IX may be used as the target gene to treat hemophilia A or hemophilia B.
[0265] In embodiments, the expression constructs / small molecules disclosed herein may be used to treat, prevent, or mitigate the severity of viral diseases. In embodiments, the disclosure provides a method for treating, preventing, or mitigating the severity of COVID-19 by expressing an antibody against a SARS-CoV-2 viral protein or antigen (e.g., spike protein) in response to the administration of a small molecule ligand. In embodiments, the disclosure provides a method for preventing infection by SARS-CoV-2 (or mitigating its severity) by expressing a spike protein (or a plurality of serotype spike proteins) or a portion thereof using a gene regulatory cassette described herein and administering a ligand. In embodiments, the target gene is an antibody against a SARS-CoV-2 viral protein or antigen (e.g., spike protein). In other embodiments, the target gene encodes all or part of one or more SARS-CoV-2 spike proteins, and the induction of expression produces mRNA, thus functioning like an inducible mRNA vaccine. In this embodiment, the expression construct is a part of the AAV virus genome, and the AAV vector containing the expression construct is administered, for example, to the target muscle, followed by the administration of a ligand.
[0266] In embodiments, the Disclosure provides a method for restoring hemocrit and a method for treating anemia by expression of Epo from a gene regulatory construct described herein, wherein a vector containing the Epo gene regulatory construct is administered to a subject in need, followed by administration of a small molecule ligand described herein. In embodiments, the anemia is due to chronic kidney disease in the subject.
[0267] In embodiments, the present disclosure provides a method for restoring hemocrit and a method for treating chronic kidney disease by expression of Epo from a gene regulatory construct described herein, wherein a vector containing the Epo gene regulatory construct is administered to a subject in need, followed by administration of a small molecule ligand described herein.
[0268] The small molecules described herein are generally combined with one or more pharmaceutically acceptable carriers to form a pharmaceutical composition suitable for administration to a patient. Examples of pharmaceutically acceptable carriers include solvents, binders, diluents, disintegrants, lubricants, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents and absorption retarders, etc., commonly used in the pharmaceutical field. The pharmaceutical composition may be in the form of tablets, pills, capsules, lozenges, eye drops, etc., and is formulated to suit the intended route of administration. Examples of routes of administration include parenteral administration, such as intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (topical), transmucosal, and ocular administration.
[0269] The pharmaceutical composition containing compounds I to XVI is administered to the patient in a dosing schedule such that a sufficient amount of the compound is delivered to the patient to desirablely regulate the target gene. When the dosage form is a tablet, pill, etc., the pharmaceutical composition preferably contains 0.1 mg to 10 g of the compound, 0.5 mg to 5 g of the compound, 1 mg to 1 g of the compound, 2 mg to 750 mg of the compound, 5 mg to 500 mg of the compound, 10 mg to 250 mg of the compound, or 150 mg to 300 mg of the compound.
[0270] The pharmaceutical composition may be administered once a day or multiple times a day (for example, two, three, four, five, or more times a day). Alternatively, the pharmaceutical composition may be administered less frequently than once a day, for example, once every two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen days, or once a month or once every few months. In some embodiments, the pharmaceutical composition may be administered to the patient only a few times, for example, once, twice, three times, etc.
[0271] This specification provides a method for treating a patient who requires increased expression of a therapeutic protein encoded by a target gene, the method comprising administering to the patient a pharmaceutical composition comprising a ligand to which an aptamer disclosed herein binds or otherwise responds, wherein the patient has been previously administered recombinant DNA containing the target gene, and the target gene contains a gene-modulating cassette disclosed herein, which provides the ability to modulate the expression of the target gene by the ligand of the aptamer. This specification provides a pharmaceutical composition comprising a ligand to which an aptamer disclosed herein binds or otherwise responds, for use in a method for treating a patient who requires increased expression of a therapeutic protein encoded by a target gene, wherein the patient has been previously administered recombinant DNA containing the target gene, and the target gene contains a gene-modulating cassette disclosed herein, which provides the ability to modulate the expression of the target gene by the ligand of the aptamer.
[0272] Aptamers for use in detection and / or diagnosis
[0273] A wide range of detection and diagnostic agents can be linked to aptamers via chimeric or physical conjugation. Furthermore, aptamers can be incorporated into biosensors, microfluidic devices, and other detection platforms. In some embodiments, aptamers are linked to polyalkylene glycol moieties, including but not limited to polyethylene glycol (PEG), polypropylene glycol (PPG), polyoxyethylated glycerol (POG) and other polyoxyethylated polyols, polyvinyl alcohol (PVA) and other polyalkylene oxides, polyoxyethylated sorbitol, or polyoxyethylated glucose.
[0274] In some embodiments, the aptamer is conjugated to a detectable moiety, including but not limited to fluorescent moieties or labels, contrast agents, radioisotope moieties, radiopaque moieties, etc., such as biotin, fluorophores, chromophores, spin resonance probes, nanoparticles (including but not limited to gold, magnetic, and superparamagnetic nanoparticles), quantum dots, and radioactive labels. Exemplary fluorophores include fluorescent dyes (e.g., fluorescein, rhodamine, etc.) and other luminescent molecules (e.g., luminescence). Fluorophores may be environmentally sensitive and their fluorescence may change if located near one or more residues of a modified protein that undergoes a structural change upon binding to a substrate (e.g., dansyl probes). Exemplary radioactive labels include small molecules containing one or more atoms with low-sensitivity nuclei (e.g., 13C, 15N, 2H, 125I, 123I, 99Tc, 43K, 52Fe, 67Ga, 68Ga, 111In, etc.). Other useful parts are publicly known in the relevant technical field.
[0275] In some embodiments, the aptamer is conjugated to a therapeutic portion, which includes, but is not limited to, anti-inflammatory agents, anticancer agents, antineurodegenerative agents, anti-infective agents, or generally therapeutic agents.
[0276] Methods for identifying aptamers that bind to compounds
[0277] This specification discloses a method for identifying aptamers that modulate target gene expression, either by binding to compounds of formulas I-XIV, or otherwise in response to addition of formulas I-XIV, or exposure to them, if they are part of a riboswitch. In one embodiment, the method includes the following steps: (i) Step of selecting the parent aptamer sequence, (ii) To generate an aptamer library containing sequences encoding the aptamers selected in (i), wherein one or more nucleotides in the aptamer encoding sequences are randomly mutated at one or more positions corresponding to one or more unpaired regions in the aptamers, and the mutated aptamer sequences are associated with riboswitches that control the expression of a reporter gene. (iii)(ii) to screen the library for aptamers in which the regulation of target gene expression in response to the compounds disclosed herein is increased compared to the parental aptamer sequence (e.g., a higher agonist or agonist ratio), (iv) Repeat steps (ii) and (iii) at will with the aptamer identified in step (iii) instead of the aptamer selected in step (i).
[0278] The parent aptamer sequence may be a TPP aptamer such as a known TPP aptamer sequence, or a putative TPP aptamer identified by a homologous sequence search in an available database. The parent aptamer sequence may be an aptamer sequence disclosed herein, for example, CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG(12C6-1; Sequence ID 1).
[0279] The step of selecting a parent aptamer sequence may involve, for example, (i) identifying a putative TPP aptamer, (ii) inserting the aptamer into a riboswitch that modulates the expression of a target gene (e.g., a reporter gene), and (iii) exposing the riboswitch / target gene construct to an analog or derivative of thiamine or TPP (e.g., a compound described herein).
[0280] The putative TPP aptamer can be identified from a suitable sequence database, such as the Rfam database, which is a collection of RNA families, each represented by multiple sequence alignment, consensus secondary structure, and covariance model (CM). In one embodiment, the putative TPP aptamer is identified from the Rfam TPP riboswitch family RF00059. In one embodiment, the putative TPP aptamer has a sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the following: thiC (GUAAUGUGUCGGAGUGCCUUAGGGAUUAUUCCCCUAAAGCUGAGACCGCAUUGCGGGAUCCGUUGAACCUGAUCAGGCUAAUACCUGCGAAGGGAACACAUUAC, Sequence ID 7) or thiM (GUAAUGUCUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGACAUUAC, Sequence ID 8).
[0281] The presumed TPP aptamer can be inserted into a riboswitch using techniques known to those skilled in the art. The reactivity of the aptamer to the presence of TPP and one or more thiamines or TPP analogs or derivatives (e.g., compounds described herein) can be tested in cell cultures and / or cell-free systems. In particular, the cell culture systems are eukaryotic cell cultures and include, for example, mammalian, plant, or insect cell cultures.
[0282] To identify aptamers that respond to the compounds described herein, one or more nucleotide positions in the sequence encoding the aptamer (i.e., the parent aptamer) are randomized. Regions of the sequence that can be randomized include J2-4, L3a, P4 / J4-5~J5-4, and L5.
[0283] Nucleotide positions for randomization can be selected based on the structure of the parent aptamer sequence. The predicted secondary structure can be obtained using available programs such as RNAfold (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and / or by comparison with the crystal structure of the associated aptamer (e.g., E. coli thiM riboswitch, Edwards, TE & Ferre-D'Amare, AR, Structure. 2006 Sep;14(9):1459-68). For example, unpaired regions of aptamers such as loop (L) regions (e.g., L3 and / or L5) and ligation (J) regions (e.g., J3-2 (ligating paired regions P3 and P2), J2-4, and / or J4-5) can be identified, and one or more nucleotides from one or more unpaired regions can be randomized to generate a library of aptamers. In embodiments, one or more nucleotides adjacent to one or more unpaired regions are randomized. Furthermore, one or more nucleotides in the paired (P) region can be randomized. Additionally, one or more nucleotides in the unpaired or paired region can be added or removed. The mutagenerated aptamer sequences may be provided as a library of aptamer sequences in association with a riboswitch. In embodiments, the aptamer library is provided in association with a riboswitch as part of a gene expression cassette disclosed herein.
[0284] Aptamer coding sequences containing one or more mutations can be tested for reactivity to one or more compounds described herein as described above.
[0285] Aptamers that are responsive to a desired compound can be further mutagenicized by randomizing nucleotides. A library can be constructed as described above by randomizing nucleotides at selected locations, for example, in unpaired regions.
[0286] The reporter proteins encoded by the reporter genes used in the methods disclosed herein are proteins that can be assayed by detecting properties of the reporter protein, such as enzyme activity or spectrophotometric characteristics, or indirectly, as in antibody-based assays. Examples of readily detectable reporter gene products include, but are not limited to, puromycin resistance markers (pac), 3-galactosidase, luciferase, orotidine 5'-phosphate decarboxylase (URA3), arginine permease CAN1, galactokinase (GAL1), beta-galactosidase (LacZ), or chloramphenicol acetyltransferase (CAT). Other examples of detectable signals include, but are not limited to, cell surface markers, such as CD4. Reporter genes suitable for use in the methods for identifying aptamers disclosed herein also include fluorescent proteins (e.g., green fluorescent protein (GFP) and its derivatives) or proteins fused to fluorescent tags. Examples of fluorescent tags and proteins include (3-F)Tyr-EGFP, A44-KR, aacuGFP1, aacuGFP2, aceGFP, aceGFP-G222E-Y220L, aceGFP-h, AcGFP1, AdRed, AdRed-C148S, aeurGFP, afraGFP, alajGFP1, alajGFP2, alajGFP3, amCyan1, amFP486, amFP495, amFP506, amFP515, amilFP484, amilFP490, amilFP497, amilFP504, am ilFP512, amilFP513, amilFP593, amilFP597, anm1GFP1, anm1GFP2, anm2CP, anobCFP1, anobCFP2, anobGFP, apulFP483, AQ14, AQ143, Aquamarine, asCP562, asFP499, AsRed2, asulCP, atenFP, avGFP, avGFP454, avGFP480, avGFP509, avGFP510, avGFP514, avGFP523, AzamiGreen, Azurite, BDFP1.6, bfloGFPa1, bfloGFPc1, BFP, BFP.A5, BFP5, bsDronpa(On), ccalGFP1, ccalGFP3, ccalOFP1, ccalRFP1, ccalYFP1, cEGFP, ce rFP505, Cerulean, CFP, cFP484, cfSGFP2, cgfmKate2, CGFP, cgfTagRFP, cgigGFP, cgreGFP, CheGFP1, CheGFP2, CheGFP4, Citr ine, Citrine2, Clomeleon, Clover, cp-mKate, cpCitrine, cpT-Sapphire174-173, CyOFP1, CyPet, CyRFP1 (CyRFP1), d-RFP618, D10, d1EosFP (green), d1EosFP (red), d2EosFP (green), d2EosFP (red), deGFP1, deGFP2, deGFP3, deGFP4, dendFP (green), dendFP (red), Dendra (Green), Dendra (Red), Dendra2 (Green), Dendra2 (Red), Dendra2-M159A (Green), Dendra2-M159A (Orange), Dendra2-T69A (Green), Dendra2-T69A (Orange), dfGFP, dimer1, dimer2, dis2RFP, dis3GFP, dKeima, dKeima570, dLanYFP, DrCBD, Dreiklang (On), Dronpa (On), Dronpa-2 (On), Dronpa-3(On), dsFP483, DspR1, DsRed, DsRed-Express, DsRed-Express2, DsRed-Max, DsRed.M1, DsRed.T3, DsRed.T4, DsRed2, DstC1, dTFP0.1, dTFP0.2, dTG, dTomato, dVFP, E2-Crimson, E2-Orange, E2-Red / Green, EaGFP, EBFP, EBFP1.2, EBFP1.5, EBFP2, ECFP, ECFPH148D, ECGFP, eechGFP1, eechGFP2, eechGFP3, eechRFP, efasCFP, efasGFP, eforCP, EGFP, eGFP203C, eGFP205C, Emerald, Enhanced Cyan-Emitting GFP, EosFP (green), EosFP (red), eqFP578, eqFP611, eqFP611V124T, eqFP650, eqFP670, EYFP, EYFP-Q69K, fabdGFP, ffDronpa (On), FoldingReporterGFP, FP586, FPrfl2.3, FR-1, FusionRed, FusionRed-M, G1, G2, G3, Gamillus (On), Gamillus0.1, Gamillus0.2, Gamillus0.3, Gamillus0.4, GCaMP2, gfasGFP, GFP (S65T), GFP-151pyTyrCu, GFP-Tyr151pyz, GFPmut2, GFPmut3, GFPxm16, GFPxm161, GFPxm162, GFPxm163, GFPxm18, GFPxm181uv, GFPxm18uv, GFPxm19, GFPxm191uv, GFPxm19uv, H9, HcRed, HcRed-Tandem, HcRed7, hcriGFP, hmGFP, HriCFP, HriGFP, iFP1.4, iFP2.0, iLov, iq-EBFP2, iq-mApple, iq-mCerulean3, iq-mEmerald, iq-mKate2, iq-mVenus, iRFP670, iRFP682, iRFP702, iRFP713, iRFP720, IrisFP (green), IrisFP (orange), IrisFP-M159A (green), Jred, Kaede (green), Kaede (red), Katushka, Katushka-9-5, Katushka2S, KCY, KCY-G4219, KCY-G4219-38L, KCY-R1, KCY-R1-158A, KCY-R1-38H, KCY-R1-38L, KFP1(On), KikGR1(green), KikGR1(red), KillerOrange, KillerRed, KO, Kohinoor(On), laesGFP, laGFP, LanFP1, LanFP2, lanRFP-ΔS83l, LanYFP, laRFP, LSS-mKate1, LSS-mKate2, LSSmOrange, M355NA, mAmetrine, mApple, Maroon0.1, mAzam iGreen, mBanana, mBeRFP, mBlueberry1, mBlueberry2, mc1, mc2, mc3, mc4, mc5, mc6, McaG1, McaG1ea, McaG2, mCardinal, mCarmine, mcavFP, m cavGFP, mcavRFP, mcCFP, mCerulean, mCerulean.B, mCerulean.B2, mCerulean.B24, mCerulean2, mCerulean2.D3, mCerulean2.N, mCerulean2 .N(T65S), mCerulean3, mCherry, mCherry2, mCitrine, mClavGR2(green), mClavGR2(red), mClover3, mCyRFP1, mECFP, meffCFP, meffGFP, meffRFP, mEGFP, meleCFP, meleRFP, mEmerald, mEos2(green), mEos2(red), mEos2-A69T(green), mEos2-A69T(orange), mEos3.1(green), mEos3.1(red), mEos3.2(green), mEos3.2 (red), mEos4a (green), mEos4a (red), mEos4b (green), mEos4b (red), mEosFP (green), mEosFP (red), mEosFP-F173S (green), mEosFP-F173S (red), mEosFP-M159A (green), mEYFP, MfaG1, mGarnet, mGarnet2, mGeos-C (On), mGeos-E (On), mGeos-F (On), mGeos-L (On), mGeos-M (On), mGeos-S (On), mGinger1, mGinger2, mGrape1, mGrape2, mGrape3, mHoneydew, MiCy, mIFP, miniSOG, miniSOGQ103V, miniSOG2, miRFP, miRFP670, miRFP670nano, miRFP670v1, miRFP703, miRFP709, miRFP720, mIrisFP (green), mIrisFP (red), mK-GO (early), mK-GO (late), mKalama1, mKate, mKateM41GS158C, mKateS158A, mKateS158C, mKate2, mKeima, mKelly1, mKelly2, m KG, mKikGR (green), mKikGR (red), mKillerOrange, mKO, mKO2, mKOκ, mLumin, mMaple (green), mMaple (red), mMaple2 (green), mMaple2 (red), mMaple3 (green), mMaple3 (red), mMaroon1, mmGFP, mMiCy, mmilCFP, mNectarine, mNeonGreen, mNeptune, mNeptune2, mNeptune2.5, mNeptune681, mNeptune684, Montiporasp.#20-9115 mOrange, mOrange2, moxBFP, moxCerulean3, moxDendra2(green), moxDendra2(red), moxGFP, moxMaple3(green), moxMaple3(red), moxNeonGreen, moxVenus, mPapaya, mPapaya0.7, mPlum, mPlum-E16P, mRaspberry, mRed7, mRed7Q1, mRed7Q1S1, mRed7Q1S1BM, mRFP1, mRFP1-Q66C, mRFP1-Q66S, mRFP1-Q66T, mRFP1.1, mRFP1.2, mRojoA, mRojoB, mRouge, mRtms5, mRuby, mRuby2, mRuby3, mScarlet, mScarlet-H, mScarlet-I, mStable , mStrawberry, mT-Sapphire, mTagBFP2, mTangerine, mTFP0.3, mTFP0.7(On), mTFP1, mTFP1-Y67W, mTurquoise, mTur quoise2, muGFP, mUkG, mVenus, mVenus-Q69M, mVFP, mVFP1, mWasabi, Neptune, NijiFP (green), NijiFP (orange), NowGFP, ob eCFP, obeGFP, obeYFP, OFP, OFPxm, oxBFP, oxCerulean, oxGFP, oxVenus, P11, P4, P4-1, P4-3E, P9, PA-GFP(On), Padro n(On), Padron(star)(On), Padron0.9(On), PAmCherry1(On), PAmCherry2(On), PAmCherry3(On), PAmKate(On), PATagRFP(On), PATagRFP1297(On), PATagRFP1314(On), pcDronpa(Green), pcDronpa(Red), pcDronpa2(Green), pcDronpa2(Red), PdaC1, pdae1GFP, phiYFP, phiYFPv, pHluorin, ecliptic, pHluorin, ecliptic(acidic), pHluorin, rational(acidic), pHluorin, rational(alkaline), pHluorin2(acidic), pHluorin2(alkaline), pHuji, PlamGFP, pmeaGFP1, pmeaGFP2, pmimGFP1, . pmimGFP2, Pp2FbFP, Pp2FbFPL30M, ppluGFP1, ppluGFP2, pporGFP, pporRFP, PS-CFP (Cyan), PS-CFP (Green), PS-CFP2 (Cyan), PS-CFP2 (Green), psamCFP, PSmOrange (Far-red), PSmOrange (Orange), PSmOrange2 (Far-red), PSmOrange2 (Orange), ptilGFP, R3-2+P CB, RCaMP, RDSmCherry0.1, RDSmCherry0.2, RDSmCherry0.5, RDSmCherry1, rfloGFP, rfloRFP, RFP611, RFP618, RFP630, R FP637, RFP639, roGFP1, roGFP1-R1, roGFP1-R8, roGFP2, rrenGFP, RRvT, rsCherry(On), rsCherryRev(On), rsCherryRev1.4(On), rsEGFP(On), rsEGFP2(On), rsFastLime(On), rsFolder(Green), rsFolder2(Green), rsFusionRed1(On), rsFusionRed2(On), rsFusionRed3(On), rsTagRFP(ON), Sandercyanin, Sapphire, sarcGFP, SBFP1, SBFP2, SCFP1, SCFP2, SCFP3A, SCFP3B, scubGFP1, scubGFP2, scubRFP, secBFP2, SEYFP, sg11, sg12, sg25, sg42, sg50, SGFP1, SGFP2, SGFP2(206A), SGFP2(E222Q), SGFP2(T65G), SHardonnay, shBFP, shBFP-N158S / L173I, ShG24, Sirius, SiriusGFP, Skylan-NS(On), Skylan-S(On), smURFP, SNIFP, SOPP, SOPP2, SOPP3, SPOON(on), stylGFP, SuperfolderGFP, SuperfoldermTurquoise2, SuperfoldermTurquoise2ox, SuperNovaGreen, SuperNovaRed, SYFP2, T-Sapphire, TagBFP, TagCFP, TagGFP, TagGFP2, TagRFP, TagRFP-T, TagRFP657, TagRFP675, TagYFP, td-RFP611, td-RFP639, tdimer2(12), tdKatushka2, TDsmURFP, tdTomato, tKeima, Topaz, TurboGFP, TurboGFP-V197L, TurboRFP, Turquoise-GL, Ultramarine, UnaG, usGFP, Venus, VFP, vsfGFP-0, vsfGFP-9, W1C, W2, W7, WasCFP, Wi-Phy, YPet, zFP538, zoan2RFP, ZsGreen, ZsYellow1, αGFP, 10B, 22G, 5B, 6C, A1a, aacuCP, acanFP, ahyaCP, amilCP, amilCP580, amilCP586, amilCP604, apulCP584, BFPsol, Blue102, CFP4, cgigCP, CheGFP, Clover1.5, cpasCP, Cy11.5, dClavGR1.6, dClover2, dClover2A206K, dhorGFP, dhorRFP, dPapaya0.1, Dronpa-C62S, DsRed-Timer, echF P, echiFP, EYFP-F46L, fcFP, fcomFP, Fpaagar, Fpag_frag, Fpcondchrom, FPmann, FPmcavgr7.7, Gamillus0.5, gdjiCP, gfasCP , GFPhal, gtenCP, hcriCP, hfriFP, KikG, LEA, mcFP497, mcFP503, mcFP506, mCherry1.5, mClavGR1, mClavGR1.1, mClavGR1.8, m Clover1.5, mcRFP, meffCP, mEos2-NA, meruFP, mKate2.5, mOFP.T.12, mOFP.T.8, montFP, moxEos3.2, mPA-GFP, mPapaya0.3, mP apaya0.6, mRFP1.3, mRFP1.4, mRFP1.5, mTFP0.4, mTFP0.5, mTFP0.6, mTFP0.8, mTFP0.9, mTFP1-Y67H, mTurquoise-146G, mTurq uoise-146S, mTurquoise-DR, mTurquoise-GL, mTurquoise-GV, mTurquoise-RA, mTurquoise2-G, NpR3784g, PDM1-4, psupFP, Q Examples include, but are not limited to, 80R, rfloGFP2, RpBphP1, RpBphP2, RpBphP6, rrGFP, RSGFP1, RSGFP2, RSGFP3, RSGFP4, RSGFP6, RSGFP7, Rtms5, scleFP1, scleFP2, spisCP, stylCP, sympFP, TeAPCα, tPapaya0.01, Trp-lessGFP, vsGFP, Xpa, yEGFP, YFP3, zGFP, and zRFP.
[0287] Methods for screening the aptamer libraries disclosed herein may include measuring the activity of a reporter gene under aptamer control, and / or comparing the activity of the reporter gene in the presence of a thiamine or TPP analog used for screening with the activity of the reporter gene in the absence of the thiamine or TPP analog used for screening.
[0288] Manufactured goods and kits
[0289] Kits or manufactured articles for use in the manner described herein are also provided. In some embodiments, the kit comprises a composition described herein (e.g., a composition for delivering a vector containing a target gene with a gene regulation cassette) in suitable packaging. Suitable packaging for the compositions described herein (e.g., ophthalmic injection compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, wide-mouthed bottles, flexible packaging (e.g., sealed Mylar or sealed plastic bags), etc. These manufactured articles may further be sterile and / or sealed.
[0290] Kits containing the compositions described herein are also provided. These kits may further include instructions(s) on how to use the compositions, such as the uses described herein. The kits described herein may further include other materials that are commercially and user-desirable, such as buffers, diluents, filters, needles, syringes, and accompanying documents containing instructions for administering the compositions or any method described herein. For example, in some embodiments, a kit includes a gene-modulating cassette containing the aptamer sequence described herein, an rAAV for the expression of a target gene, a pharmaceutically acceptable carrier suitable for injection, and one or more of the buffers, diluents, filters, needles, syringes, and accompanying documents containing instructions for administering the injection. In some embodiments, the kit is suitable for intraocular injection, intramuscular injection, intravenous injection, etc.
[0291] It can be understood and anticipated that variations of the compositions and methods of the substances disclosed herein can be made by those skilled in the art, and such modifications are intended to be within the scope of this disclosure. The present invention will be further illustrated in the following examples, but should not be construed as limiting the scope of the invention.
[0292] All references cited herein are incorporated herein by reference in their entirety. All nucleotide sequences provided herein are shown in 5' to 3' orientation unless otherwise indicated. [Examples]
[0293] Example 1: Regulation of target gene expression in response to small molecule ligands disclosed herein.
[0294] Experimental procedure:
[0295] The riboswitch construct: aptamer was synthesized by Integrated DNA Technologies, Inc. The synthesized aptamer sequence, referred to as aptamer sequence 12C6-1, has a C at its 5' end and a complementary G at its 3' end adjacent to the aptamer sequence: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (Sequence ID 1). Using the Golden Gate cloning strategy (New England Biolabs, NEB), the synthesized aptamer sequence was cloned into an intron-exon-intron cassette to replace the guanine aptamer in the G17 riboswitch cassette (see SEQ ID NO: 15, enumerated in WO2016 / 126747, which is incorporated herein), generating the riboswitch construct Luci-12C6-1 containing the 12C6-1 alternative splicing gene regulatory cassette (SEQ ID NO: 4). Sequence ID No. 4 (12C6-1 alternative splicing gene regulatory cassette) [ka] Capital letters: 12C6-1 aptamer; bold: selective exon; underline: riboswitch stem-forming sequence; italics: 5' intron and 3' intron
[0296] Transfection: The day before transfection, human fetal kidney (HEK) 293 cells were seeded in a 96-well flat-bottom plate. Plasmid DNA (500 ng) was added in a tube or to a 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus; 1.4 μL) was added to 50 μL of Optimum I medium (Life Technologies) and allowed to stand at room temperature (RT) for 5 minutes. Next, 50 μL of this diluted transfection reagent was added to the DNA, mixed, and incubated at RT for 20 minutes. Finally, 7 μL of this solution was added to the wells of the cells in the 96-well plate. Four hours after transfection, the medium containing the transfection solution was replaced with medium containing either TPP or fursultiamine as the aptamer ligand.
[0297] Firefly luciferase assay of cultured cells: 24 hours after medium change, the plate was removed from the incubator, equilibrated to RT on the bench for several minutes, and then aspirated. Glo-lysis buffer (Promega, 100 μL, RT) was added, and the plate was left at room temperature for at least 5 minutes. Then, the contents of the wells were mixed with 50 μL of trituration, and 20 μL of each sample was mixed with 20 μL of bright-glo reagent (Promega) diluted to 10% with glo-lysis buffer. 96 wells were placed spaced apart in an opaque white 384-well plate. After 5 minutes of incubation at RT, luminescence was measured using a Tecan instrument with a readout time of 500 ms. Luciferase activity was expressed as mean arbitrary light units (ALU) ± SD, and the induction factor was calculated as the quotient obtained by dividing the luciferase activity obtained from cells treated with the T compound by the luciferase activity obtained from cells not treated with the compound.
[0298] result:
[0299] The compounds were tested against a 12C6-1 riboswitch to induce luciferase expression in HEK293 cells. The structures of these compounds are shown in Table B, and their synthesis is described herein. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15]
[0300] Comparative compound A
[0301] The structure of compound A is shown below: [ka]
[0302] Compound A may be prepared as disclosed in PCT / US2020 / 045022.
[0303] Examples 2-47.
[0304] experiment
[0305] All solvents and reagents were commercially sourced and used as received. ¹H NMR spectra were recorded using a Bruker apparatus (300 MHz or 400 MHz) with the deuterated solvents mentioned. Chemical shifts are expressed in ppm, and binding constants are expressed in Hertz. All final compounds were purified by flash chromatography using 220–400 mesh silica gel or by reversed-phase HPLC using CH3CN / water as the solvent. Thin-layer chromatography was performed on silica gel 60 F-254 (0.25 nm thick) plates. Visualization was achieved using UV light and / or ethanol containing 10% phosphomolybdic acid. Nominal (low-resolution) mass spectra were acquired using either a Waters LCT or an Applied Biosystems API 3000 mass spectrometer. All other LC-MS experiments were performed using an Agilent 1100 HPLC combined with an Agilent single quadrupole mass spectrometer. The purity of the compounds was determined by LC-MS at wavelengths of 230 nM and 254 nM. All final compounds reported here have a purity of 95% or higher.
[0306] Example 2
[0307] 4-(2,2-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 001) [ka]
[0308] Step 1. tert-butyl 3,3-dimethyl-4-(3-nitropyridine-4-yl)piperazine-1-carboxylate [ka]
[0309] A mixture of 4-chloro-3-nitropyridine (3.00 g, 18.9 mmol, 1.00 equivalent) and tert-butyl 3,3-dimethylpiperazine-1-carboxylate (12.2 g, 56.8 mmol, 3.00 equivalent) was stirred at 130°C for 6 hours under an N2 atmosphere. The crude product was purified by reverse-phase HPLC to obtain the title compound (1.30 g, 20.4%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.88(s,1H), 8.54(d,J=6.0Hz,1H), 7.52(d,J=5.6Hz,1H), 3.43-3.39(m,2H), 3.27(s,2H), 3.09-2.98(m,2H), 1.42(s,9H), 1.23-1.16(m,6H). MS(ES+)m / e 337(M+H) + .
[0310] Step 2. tert-butyl 4-(3-aminopyridine-4-yl)-3,3-dimethylpiperazine-1-carboxylate [ka]
[0311] To a solution of tert-butyl 3,3-dimethyl-4-(3-nitropyridine-4-yl)piperazine-1-carboxylate (1.30 g, 3.86 mmol, 1.00 equivalent) in MeOH (15.0 mL), Pt-V / C (1.01 g, 3.86 mmol, 1.00 equivalent) was added under N2 conditions. The suspension was degassed under vacuum and purged several times with H2. The mixture was stirred under H2 (15 psi) at 15°C for 16 hours, filtered, and concentrated to obtain the title compound (1.20 g, crude) as a yellow oil. 1H NMR (400MHz, DMSO-d6) δ 7.99(s,1H), 7.68(d,J=5.2Hz,1H), 6.98(d,J=5.2Hz,1H), 5.16(s,2H), 1.42(s,9H), 1.00(br s,6H). MS(ES+)m / e 307(M+H) + .
[0312] Step 3. tert-butyl (E)-3,3-dimethyl-4-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)piperazine-1-carboxylate [ka]
[0313] A mixture of tert-butyl 4-(3-aminopyridine-4-yl)-3,3-dimethylpiperazine-1-carboxylate (1.20 g, 3.92 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (929 mg, 5.87 mmol, 1.50 equivalent), and AcOH (118 mg, 1.96 mmol, 112 uL, 0.50 equivalent) in MeOH (20.0 mL) was degassed and purged three times with N2. The mixture was stirred at 50°C for 12 hours under an N2 atmosphere. The reaction mixture was used directly in the next step. MS(ES+)m / e 447(M+H) + .
[0314] Step 4. tert-butyl 3,3-dimethyl-4-(3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)piperazine-1-carboxylate [ka]
[0315] To a solution of tert-butyl (E)-3,3-dimethyl-4-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)piperazine-1-carboxylate (1.50 g, 3.36 mmol, 1.00 equivalent) in MeOH (20.0 mL), NaBH3CN (528 mg, 8.40 mmol, 2.50 equivalent) was added. The mixture was stirred at 25°C for 2 hours, diluted with ethyl acetate (40.0 mL), washed with brine (50.0 mL × 3), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC to obtain the title compound (1.30 g, 86.3%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.90(d,J=1.2Hz,2H), 8.08(d,J=8.4Hz,1H), 7.99(s,1H), 7.89(s,1H),7.79(s,1H), 7.73(d,J=5.2Hz,1H),7.07(d,J=4.8Hz,1H),6.45(br t,J=6.0Hz,1H), 4.69(br d,J=1.6Hz,2H), 4.13-3.87(m,1H), 3.81-3.62(m,1H), 3.31-2.95(m,4H), 1.44(s,9H), 1.24-0.91(m,6H). MS(ES+)m / e 449(M+H) + .
[0316] Step 5. 4-(2,2-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0317] To a solution of tert-butyl 3,3-dimethyl-4-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)piperazine-1-carboxylate (1.30 g, 2.90 mmol, 1.00 equivalent) in ethyl acetate (5.00 mL), 4 M HCl in ethyl ethyl acetate (0.724 mL, 1.00 equivalent) was added. The mixture was stirred at 15°C for 2 hours and filtered. The filtered cake was dried under vacuum to obtain the title compound (172 mg, 15.0%, HCl salt) as a green solid. 1H NMR(400MHz,DMSO-d6)δ 8.82(s,2H), 8.04(dd,J1=1.2Hz,J2=8.8Hz,1H),7.92(s,1H),7.87(dd,J1=1.2Hz),J2=6.0Hz,1H),7.83(dd ,J1=2.0Hz,J2=8.8Hz,1H), 7.72-7.61(m,2H), 4.76-4.72(m,4H), 3.41(brs,2H), 3.32-3.26(m,2H), 1.31(br s,6H). MS(ES+)m / e 349(M+H) + .
[0318] Example 3
[0319] 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 002) [ka]
[0320] Step 1. 4-Chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0321] To a solution of 4-chloropyridine-3-amine (15.0 g, 117 mmol, 1.00 equivalent) and quinoxaline-6-carbaldehyde (18.5 g, 117 mmol, 1.00 equivalent) in THF (150 mL), Ti(i-PrO)4 (66.3 g, 233 mmol, 68.9 mL, 2.00 equivalent) was added. The mixture was stirred at 50°C for 12 hours and then diluted with EtOH (150 mL). NaBH4 (4.38 g, 116 mmol, 1.00 equivalent) was added in several portions at 25°C. The resulting mixture was stirred at 25°C for 1 hour, then quenched with saturated NH4Cl aqueous solution (150 mL), and extracted with ethyl acetate (150 mL × 3). The combined organic layers were washed with brine (500 ml), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain a residue. This residue was triturated with ethyl acetate (50.0 mL) at 25°C for 30 minutes and filtered. The resulting cake was dried under vacuum to obtain the title compound (20.0 g, 57.9%) as a yellow solid. MS(ES+)m / e 271(M+H) + .
[0322] Step 2. 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0323] DIEA (955 mg, 4.00 equivalents) was added to a solution of 4-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (500 mg, 1.85 mmol, 1.00 equivalent) and 1-methylpiperazine (370 mg, 3.69 mmol, 2.00 equivalent) in NMP (5.00 mL). The resulting mixture was heated at 180 °C for 8 hours under microwave irradiation. The reaction mixture was filtered, and the filtrate was purified by preparative HPLC (column: Waters Xbridge C18 150 × 50 mm × 10 μm; mobile phase: A-water (NH4HCO3) and B-CH3CN; B%: 15%~45%, 10 min) to obtain the title compound (198 mg, 26.7%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.90(s,2H), 8.08(d,J=8.4Hz,1H), 7.99(s,1H), 7.88(d,J=8.4Hz,1H), 7.77(d,J=5.2Hz,1H), 7.70(s,1H), 6.87(d,J=5.2Hz,1H), 5.65(br t,J=6.0Hz,1H), 4.68(br d,J=6.0Hz,2H), 2.98(br s,4H), 2.58(br s,4H), 2.26(s,3H). MS(ES+)m / e 335(M+H) + .
[0324] Example 4
[0325] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (Compound 003) [ka]
[0326] Step 1. tert-butyl 7-(3-nitropyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0327] A mixture of tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (3.50 g, 16.5 mmol, 1.00 equivalent) and 4-chloro-3-nitropyridine (2.61 g, 16.5 mmol, 1.00 equivalent) in i-PrOH (35.0 mL) was mixed with DIEA (10.1 mL, 3.50 equivalent) at 25 °C. The reaction mixture was stirred at 80 °C for 5 hours and concentrated under reduced pressure to obtain the title compound (5.00 g, 90.7%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.76(s,1H), 8.35(d,J=6.0Hz,1H), 7.21(d,J=6.0Hz,1H), 3.58-3.55(m,2H), 3. 28-3.25(m,2H), 3.08(s,2H), 1.38(s,9H), 0.96-0.90(m,2H), 0.84-0.79(m,2H). MS(ES+)m / e 335(M+H) + .
[0328] Step 2. tert-butyl 7-(3-aminopyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0329] To a solution of tert-butyl 7-(3-nitropyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (5.50 g, 16.0 mmol, 1.00 equivalent) in MeOH (55.0 mL), Pt-V / C (3.00 g) was added under Ar gas. The suspension was degassed under vacuum, purged several times with H2 gas, and stirred at 25°C for 12 hours under H2 (50 psi). The mixture was filtered, and the filtrate was concentrated under reduced pressure to obtain the title compound (5.00 g, crude) as an off-white solid. 1H NMR(400MHz,DMSO-d6)δ 7.93(s,1H), 7.78(d,J=5.2Hz,1H), 6.86(d,J=5.2Hz,1H), 4.90(br s,2H), 3.12(q,J=7.2Hz,2H), 2.94(br s,2H), 2.81(s,2H), 1.41(s,9H), 0.92(br s,2H), 0.82(s,2H). MS(ES+)m / e 305(M+H) + .
[0330] Step 3. tert-butyl (E)-7-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0331] To a mixture of quinoxaline-6-carbaldehyde (2.60 g, 16.4 mmol, 1.00 equivalent) and tert-butyl 7-(3-aminopyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (5.00 g, 16.4 mmol, 1.00 equivalent) in THF (50.0 mL), Ti(i-PrO)4 (9.34 g, 32.9 mmol, 2.00 equivalent) was added. This reaction mixture was stirred at 50°C for 12 hours and used in the next step without workup or purification. MS(ES+)m / e 445(M+H) + .
[0332] Step 4. tert-butyl 7-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0333] To the reaction mixture obtained from the previous step, MeOH (70.0 mL) and then NaBH4 (715 mg, 18.9 mmol, 1.20 equivalents) were added in small amounts at 25°C. The mixture was stirred at 25°C for 2 hours, quenched with NH4Cl aqueous solution (100 mL), concentrated under reduced pressure to remove MeOH, and extracted with ethyl acetate (100 mL × 3). The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated to obtain the crude product, which was purified by preparative HPLC (column: Phenomenex luna C18 150 × 40 mm × 15 μm; mobile phase: A-water (trifluoroacetic acid), B-ACN; B%: 15%~45%, 10 min) to obtain the title compound (5.00 g, 71.1%, 2 steps) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 8.91(d,J=1.6Hz,2H), 8.08(d,J=8.8Hz,1H), 8.00(s,1H), 7.88(dd,J1=1.6Hz,J2=8.8Hz,1H), 7.79-7.73(m,2H), 6.87(d,J=5.2Hz,1H), 5.61(br t,J=6.0Hz,1H), 4.69(br d,J=6.0Hz,2H), 3.69(br s,2H), 2.95(br s,2H), 2.82(br s,2H), 1.43(s,9H), 0.95(br s,2H), 0.86(br s,2H). MS(ES+)m / e 447(M+H) + .
[0334] Step 5. N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine [ka]
[0335] To a solution of tert-butyl 7-(3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (400 mg, 0.896 mmol, 1.00 equivalent) in DCM (2.60 mL), TFA (1.30 mL, 17.6 mmol, 19.6 equivalents) was added. The mixture was stirred at 20°C for 2 hours, concentrated under reduced pressure, and the solvent was removed. The crude product was triturated with MTBE (5.00 mL) at 20°C for 2 hours to obtain the title compound (174 mg, 42.3%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 8.88-8.77(m,2H), 8.20(s,1H), 8.06(s,1H), 8.01(d,J=5.20Hz,1H), 7.92(s,1H), 6.98(d,J=5.20Hz,1H), 5.46(br t,J=6.40Hz,1H), 4.73(t,J=6.40Hz,2H), 3.30-3.22(m,1H), 3.19(br dd,J=2.40,12.40Hz,1H), 3.16-3.08(m,2H), 3.07-3.00(m,1H), 2.72(br dd,J=9.20,11.20Hz,2H),0.94(d,J=6.00Hz,3H). MS(ES+)m / e 369(M+H) + .
[0336] Example 5
[0337] 4-(3,3-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 004) [ka]
[0338] Step 1. tert-butyl 2,2-dimethyl-4-(3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)piperazine-1-carboxylate [ka]
[0339] To a solution of 4-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (595 mg, 2.78 mmol, 1.50 equivalents) in NMP (5.00 mL), DIEA (717 mg, 5.55 mmol, 967 μL, 3.00 equivalents) and tert-butyl 2,2-dimethylpiperazine-1-carboxylate (500 mg, 1.85 mmol, 1.00 equivalent) were added. The mixture was heated under microwave at 180°C for 16 hours and purified by reverse-phase HPLC to obtain the title compound (320 mg, 38.6%) as brown oil. 1H NMR(400MHz,DMSO-d6)δ 9.57(br s,1H), 8.93(s,2H), 8.16-7.98(m,3H), 7.94-7.89(m,H), 7.84-7.59(m,1H), 7.43-7.11(m,1H), 6. 87-6.21(m,1H), 4.89-4.58(m,2H), 3.79-3.55(m,4H), 1.52-1.34(m,13H), 1.05(t,J=7.2Hz,2H). MS(ES+)m / e 449(M+H) + .
[0340] Step 2.4-(3,3-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0341] To a solution of tert-butyl 2,2-dimethyl-4-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)piperazine-1-carboxylate (220 mg, 0.490 mmol, 1.00 equivalent) in ethyl acetate (1.10 mL), 4 M HCl in ethyl acetate (1.23 mL, 10.0 equivalent) was added. The mixture was stirred at 25°C for 2 hours, then concentrated under reduced pressure, and the solvent was removed. The crude product was purified by reverse-phase HPLC to obtain the title compound (52.9 mg, 52.9%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 8.91(s,2H), 8.09(d,J=8.4Hz,1H), 8.02(s,1H), 7.89(dd,J1=1.6Hz,J2=8. 8Hz,1H), 7.79(d,J=5.2Hz,1H), 7.75(s,1H), 6.82(d,J=4.8Hz,1H), 5.43(br t,J=6.0Hz,1H), 4.69(br d,J=6.0Hz,2H), 2.98(br s,2H), 2.81(br s,2H), 2.64(s,2H), 1.15(s,6H). MS(ES+)m / e 349(M+H) + .
[0342] Example 6
[0343] 2-Methyl-N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (Compound 005) [ka]
[0344] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. ¹H NMR (400MHz, DMSO-d6)δ 8.86(q,J=2.0Hz,2H), 7.96(d,J=8.4Hz,1H), 7.86(d,J=1.2Hz,1H), 7.78(dd,J=2.0,8.4Hz,1H), 7.68(d,J=5.6Hz,1H), 6.63(d,J=5.2Hz,1H), 5.12(t,J=7.6Hz,1H), 4.69(d,J=7.2Hz,2H), 3.05-2.90(m,4H), 2.84(s,2H), 2.28(s,3H), 0.54(s,4H). MS(ES+)m / e 361(M+H) + .
[0345] Example 7
[0346] N-(Quinoxaline-6-ylmethyl)-5-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-4-amine (Compound 006) [ka]
[0347] Step 1. tert-butyl 7-(5-aminopyridazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0348] A mixture of 5-chloropyridazine-4-amine (1.00 g, 7.72 mmol, 1.00 equivalent) and tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (4.92 g, 23.1 mmol, 3.00 equivalent) was stirred at 120°C for 10 hours. The crude product was purified by reverse-phase HPLC to obtain the title compound (0.700 g, 29.7%) as a yellow oil. MS(ES+)m / e 306(M+H) + .
[0349] Step 2. tert-butyl (E)-7-(5-((quinoxaline-6-ylmethylene)amino)pyridazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0350] AcOH (177 mg, 2.95 mmol, 168 μL, 3.00 equivalent) was added to a solution of tert-butyl 7-(5-aminopyridazin-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (0.300 g, 982 μmol, 1.00 equivalent) and quinoxaline-6-carbaldehyde (466 mg, 2.95 mmol, 3.00 equivalent) in toluene (10.0 mL). The mixture was stirred at 130 °C for 16 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound (0.500 g, crude) as a brown oil, which was used directly in the next step without further purification. MS(ES+)m / e 446(M+H) + .
[0351] Step 3. tert-butyl 7-(5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0352] A solution of tert-butyl (E)-7-(5-((quinoxaline-6-ylmethylene)amino)pyridazin-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (0.400 g, 897 μmol, 1.00 equivalent) in MeOH (4.00 mL), NaBH3CN (56.4 mg, 0.897 mmol, 1.00 equivalent), and AcOH (53.9 mg, 0.897 mmol, 51.4 μL, 1.00 equivalent) were added. The mixture was stirred at 25°C for 10 hours. The reaction mixture was quenched with saturated NH4Cl solution (50.0 mL), neutralized to pH 8-9 with NaHCO3, and extracted with DCM (30.0 mL × 3). The combined organic layers were washed with brine (30.0 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC to obtain the title compound (0.141 g, 35.1%) as a yellow oil. ¹H NMR (400 MHz, DMSO-d6) δ MS(ES+) m / e 448(M+H) + .
[0353] Step 4. N-(Quinoxaline-6-ylmethyl)-5-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-4-amine [ka]
[0354] To a solution of tert-butyl 7-(5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (0.141 g, 0.315 mmol, 1.00 equivalent) in MeOH (2.00 mL), 4 M HCl in MeOH (28.2 mL, 358 equivalents) was added. The mixture was stirred at 25°C for 2 hours and concentrated under reduced pressure to obtain a residue. The residue was purified by preparative HPLC to obtain the title compound (0.009 g, 8.1%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ ppm 9.98(br s,2H), 8.95(s,2H), 8.81(s,1H), 8.78(s,1H), 8.14(d,J=8.8Hz,1H), 8.09 (d,J=1.2Hz,1H), 7.93(dd,J=8.8,1.88Hz,1H), 5.16-5.27(m,1H), 5.08(br d,J=6.4Hz,2H), 3.31(br s,2H), 3.24(br s,2H), 2.52(br s,1H), 2.51-2.53(m,1H), 1.16-1.27(m,2H), 0.83-0.93(m,2H). MS(ES+)m / e 348(M+H) + .
[0355] Example 8
[0356] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridazine-3-amine (compound 007) [ka]
[0357] Step 1. tert-butyl 7-(3-amino-6-chloropyridazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0358] A solution of 4-bromo-6-chloropyridazine-3-amine (1.50 g, 7.20 mmol, 1.00 equivalent) and tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (1.60 g, 7.56 mmol, 1.05 equivalent) in DMA (2.00 mL) was mixed with K2CO3 (2.98 g, 21.5 mmol, 3.00 equivalent). The mixture was stirred at 100°C for 16 hours. The reaction mixture was filtered, the filtrate was diluted with water (20.0 mL), and extracted with DCM (50.0 mL × 3). The combined organic layers were washed with brine (20.0 mL × 2), dried over Na2SO4, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 3 / 1) to obtain the title compound (2.14 g, 87.4%) as a white solid. ¹H NMR (400 MHz, DMSO-d6) δ 6.72 (s, ¹H), 5.01 (br s, ²H), 3.05 (br t, J=4.8 Hz, ²H), 3.02 (s, ²H), 2.94 (s, ²H), 1.07-1.14 (m, ²H), 0.84 (s, ²H). MS(ES+) m / e 340 (M+H) + .
[0359] Step 2. tert-butyl 7-(3-aminopyridazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0360] To a solution of tert-butyl 7-(3-amino-6-chloropyridazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (2.00 g, 5.89 mmol, 1.00 equivalent) in MeOH (20.0 mL), 10% Pd / C (1.00 g) was added under N2. The suspension was degassed under vacuum and purged several times with H2. The mixture was stirred under H2 (50 psi) at 25°C for 10 hours, filtered, and concentrated under reduced pressure to obtain the title compound (1.50 g, 83.4%) as a white solid, which was used directly in the next step without further purification. MS(ES+)m / e 306(M+H) + .
[0361] Step 3. tert-butyl (E)-7-(3-((quinoxaline-6-ylmethylene)amino)pyridazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0362] A mixture of tert-butyl 7-(3-aminopyridazin-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (1.50 g, 4.91 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (815 mg, 5.16 mmol, 1.05 equivalent), and AcOH (589 mg, 9.82 mmol, 562 μL, 2.00 equivalent) in toluene (15.0 mL) was stirred at 130 °C for 10 hours. This reaction mixture was concentrated under reduced pressure to obtain the title compound (2.00 g, crude) as a black solid, which was used directly in the next step without further purification. MS(ES+)m / e 446(M+H) + .
[0363] Step 4. tert-butyl 7-(3-((quinoxaline-6-ylmethyl)amino)pyridazin-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0364] To a solution of tert-butyl (E)-7-(3-((quinoxaline-6-ylmethylene)amino)pyridazin-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (2.00 g, 4.49 mmol, 1.00 equivalent) and AcOH (134 mg, 2.24 mmol, 128 μL, 0.50 equivalent), NaBH3CN (282 mg, 4.49 mmol, 1.00 equivalent) was added in small amounts at 25°C. The mixture was stirred at 40°C for 10 hours, quenched by adding saturated NH4Cl solution (50.0 mL), neutralized to pH=8~9 with NaHCO3, and extracted with DCM (30.0 mL × 3). The combined organic layers were washed with brine (30.0 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC to obtain the title compound (1.30 g, 64.7%) as a yellow solid. ¹H NMR (400 MHz, DMSO-d6) δ MS(ES+) m / e 448(M+H) + .
[0365] Step 5. N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridazine-3-amine hydrochloride [ka]
[0366] To a solution of tert-butyl 7-(3-((quinoxaline-6-ylmethyl)amino)pyridazin-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (1.20 g, 2.68 mmol, 1.00 equivalent) in MeOH (13.0 mL), 4 M HCl in MeOH (12.0 mL, 17.9 equivalents) was added. The mixture was stirred at 25°C for 0.5 hours and concentrated under reduced pressure to obtain a residue. The residue was purified by preparative HPLC to obtain the title compound (0.655 g, 70.1%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 10.40(br s,2H), 8.92(s,2H), 8.74(d,J=6.0Hz,1H) 8.16(br s,1H), 8.08(d,J=8.8Hz,1H), 8.00(s,1H), 7.91(dd,J=8.8,1.6Hz,1H), 7.40(d,J=6.4Hz,1H), 4.84(br d,J=5.6Hz,2H), 3.76(br s,2H), 3.50-3.65(m,4H), 1.18-1.25(m,2H), 0.84-0.91(m,2H). MS(ES+)m / e 348(M+H) + .
[0367] Example 9
[0368] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-5-amine (Compound 008) [ka]
[0369] Step 1. tert-butyl 7-(5-aminopyrimidine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0370] To a solution of 4-chloropyrimidine-5-amine (3.00 g, 23.1 mmol, 1.00 equivalent) and tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (4.92 g, 23.2 mol, 1.00 equivalent) in ACN (10.0 mL), DIEA (8.98 g, 69.5 mmol, 12.1 mL, 3.00 equivalent) was added. The mixture was stirred at 100°C for 16 hours and concentrated under reduced pressure to obtain a residue. The residue was diluted with water (20.0 mL) and extracted with DCM (20.0 mL × 3). The combined organic layers were washed with brine (10.0 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain the crude product. This was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1) to obtain the title compound (6.00 g, 84.8%) as a yellow oily substance. MS(ES+)m / e 306(M+H) + .
[0371] Step 2. tert-butyl (E)-7-(5-((quinoxaline-6-ylmethylene)amino)pyrimidine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0372] A mixture of tert-butyl 7-(5-aminopyrimidine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (2.00 g, 6.55 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (1.09 g, 6.88 mmol, 1.05 equivalent), and AcOH (786 mg, 13.1 mmol, 749 μL, 2.00 equivalent) in toluene (20.0 mL) was stirred at 130 °C for 12 hours, then concentrated under reduced pressure to obtain the title compound (2.90 g, 99.4%) as a yellow oily substance, which was used directly in the next step without further purification. MS(ES+)m / e 446(M+H) + .
[0373] Step 3. tert-butyl 7-(5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0374] To a solution of tert-butyl (E)-7-(5-((quinoxaline-6-ylmethylene)amino)pyrimidine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (2.90 g, 6.51 mmol, 1.00 equivalent) and AcOH (195 mg, 3.25 mmol, 186 μL, 0.500 equivalents) in MeOH (30.0 mL), NaBH3CN (818 mg, 13.0 mmol, 2.00 equivalents) was added in small amounts at 25°C. The mixture was stirred at 40°C for 12 hours. Na2CO3 was added to adjust the pH to 8-9. The mixture was extracted using DCM (30.0 mL × 3). The combined organic layers were washed with brine (30.0 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by reverse-phase HPLC to obtain the title compound (2.03 g, 69.7%) as a yellow solid. MS(ES+)m / e 448(M+H) + .
[0375] Step 4. N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyrimidine-5-amine [ka]
[0376] To a solution of tert-butyl 7-(5-((quinoxaline-6-ylmethyl)amino)pyrimidazine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (1.50 g, 3.35 mmol, 1.00 equivalent) in MeOH (5.0 mL), HCl / MeOH (4.00 M, 18.8 mL, 22.4 equivalents) was added. The mixture was stirred at 25°C for 2 hours and concentrated under reduced pressure to obtain a residue. The residue was purified by preparative HPLC to obtain the title compound (0.956 g, 82.1%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 10.41(br s,2H), 8.93(q,J=2.0Hz,2H), 8.54(d,J=1.2Hz,1H), 8.05-8.13(m,2H), 7.92(dd,J=8.8,1.75Hz,1H), 7.73(s,1H) 6.88(br s,1H), 4.66(br s,2H), 4.20(br s,2H), 4.00(s,2H), 3.43(br s,2H), 2.07(s,1H), 1.11-1.22(m,2H), 0.85-0.96(m,2H). MS(ES+)m / e 348(M+H) + .
[0377] Example 10
[0378] 5-(3,3-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridazine-4-amine (compound 009) [ka]
[0379] The title compound was synthesized using the same procedure as described for the preparation of compound 006 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 9.55 (br s, 2H), 8.98-9.06 (m, 1H), 8.95 (s, 2H), 8.85 (s, 1H), 8.79 (s, 1H), 8.10-8.16 (m, 2H), 7.97 (br d, J=8.4 Hz, 1H), 5.10 (br d, J=5.6 Hz, 2H), 3.56-3.68 (m, 2H), 3.20 (br s, 2H), 3.07 (br d, J=4.0 Hz, 2H), 1.49 (s, 6H). MS (ES+) m / e 350 (M+H) + .
[0380] Example 11
[0381] 4-(3,3-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridazine-3-amine (compound 010) [ka]
[0382] The title compound was synthesized following the same procedure as described for the preparation of compound 007 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 9.97 (br s, 2H), 8.92 (s, 2H), 8.75 (d, J=6.0 Hz, 1H), 8.34 (br s, 1H), 8.08 (d, J=8.8 Hz, 1H), 8.02 (s, 1H), 7.94 (d, J=8.8 Hz, 1H), 7.44 (d, J=6.0 Hz, 1H), 4.87 (br d, J=5.6 Hz, 2H), 3.62 (br s, 4H), 3.44 (s, 2H), 1.48 (s, 6H). MS(ES+) m / e 350 (M+H) + .
[0383] Example 12
[0384] 4-(3,3-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyrimidine-5-amine (compound 011) [ka]
[0385] The title compound was synthesized following the same procedure as described for the preparation of compound 008 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 9.97 (br s, 2H), 8.93 (q, J=2.0 Hz, 2H), 8.53 (s, 1H), 8.08-8.14 (m, 2H), 7.94 (dd, J=8.8, 1.6 Hz, 1H), 7.71-7.71 (m, 1H), 7.71 (s, 1H), 6.92 (br s, 1H), 4.67 (br s, 2H), 4.11 (br s, 2H), 3.86 (s, 2H), 3.46 (br s, 2H), 1.41 (s, 6H). MS (ES+) m / e 350 (M+H) + .
[0386] Example 13
[0387] 5-Fluoro-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (compound 012) [ka]
[0388] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 10.25 (br s, 2H), 8.93 (s, 2H), 8.32 (d, J=4.8 Hz, ¹H), 8.13-8.05 (m, 2H), 7.91 (br d, J=8.8 Hz, ¹H), 7.83 (s, 1H), 7.12-6.91 (m, 1H), 4.82 (br s, 2H), 3.64-3.41 (m, 6H), 1.21 (br s, 2H), 0.87 (s, 2H). MS (ES+) m / e 365 (M+H). + .
[0389] Example 14
[0390] 5-Chloro-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (compound 013) [ka]
[0391] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. ¹H NMR (400MHz, DMSO-d6) δ: 10.0 (d, J=1.6Hz, 2H), 8.92 (q, J=2.0Hz, 2H), 8.24 (s, 1H), 8.08 (d, J=8.8Hz, 2H), 7.98 (dd, J=2.0, 8.8Hz, 1H), 7.92 (s, 1H), 4.88 (s, 2H), 3.58 (br t, J=5.6Hz, 2H), 3.46-3.18 (m, 6H), 2.38-2.04 (m, 2H). MS(ES+) m / e 381 (M+H) + .
[0392] Example 15
[0393] 5-Bromo-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (compound 014) [ka]
[0394] The title compound was synthesized using the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 10.08 (br s, 2H), 8.93 (q, J=2.0 Hz, 2H), 8.17 (s, 1H), 8.11-8.06 (m, 2H), 7.93-7.89 (m, 2H), 6.88 (br s, 1H), 4.81 (s, 2H), 3.87-3.10 (m, 6H), 1.23 (br s, 2H), 0.86 (s, 2H). MS (ES+) m / e 425 (M+H)+ .
[0395] Example 16
[0396] 5-Methyl-N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (Compound 015) [ka]
[0397] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 15.57-15.07(m,1H), 10.06(br s,2H), 8.93(s,2H), 8.11(d,J=8.4Hz,1H), 8.05(s,1H), 7.98(s,1H), 7.90(dd,J=1.6,8.8Hz,1H), 7.85(s,1H), 6.74(br t,J=6.0Hz,1H), 4.81(br d,J=5.6Hz,2H), 3.77-3.28(m,6H), 2.40(s,3H), 1.22(br s,2H), 0.86(s,2H). MS(ES+)m / e 361(M+H) + .
[0398] Example 17
[0399] 5-(difluoromethyl)-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (compound 016) [ka]
[0400] Step 1. 5-Bromo-4-chloronicotinaldehyde [ka]
[0401] To a solution of 3,5-dibromo-4-chloropyridine (18.0 g, 66.3 mmol, 1.00 equivalent) in tetrahydrofuran (180 mL), i-PrMgCl (2.00 M, 36.5 mL, 1.10 equivalent) was added. The mixture was stirred at 0°C for 1 hour. DMF (9.70 g, 132 mmol, 10.2 mL, 2.00 equivalent) was added to the mixture at 0°C, and the reaction mixture was stirred at 20°C for 3 hours. The mixture was quenched with saturated NH4Cl aqueous solution (100 mL) and extracted with ethyl acetate (200 mL × 3). The combined organic layers were washed with brine (150 mL), concentrated under reduced pressure to obtain a residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 20 / 1~5 / 1) to obtain the title compound (12.5 g, 85.4%) as a yellow solid. 1H NMR (400MHz, CDCl3) δ 10.48 (s, 1H), 8.94 (d, J = 3.2Hz, 2H).
[0402] Step 2. tert-butyl 7-(3-bromo-5-formylpyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0403] To a solution of 5-bromo-4-chloronicotinaldehyde (3.00 g, 13.6 mmol, 1.00 equivalent) and tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (3.09 g, 14.5 mol, 1.07 equivalents) in CH3CN (30.0 mL), DIEA (4.40 g, 34.0 mmol, 5.93 mL, 2.50 equivalents) was added. The mixture was stirred at 80°C for 16 hours, diluted with H2O (30.0 mL), and extracted with ethyl acetate (50.0 mL × 3). The combined organic layer was washed with brine (50.0 mL × 3), dried on Na2SO4, and concentrated under reduced pressure to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 1 / 1) to obtain the title compound (3.70 g, 53.1%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 10.10(s,1H), 8.64(s,2H), 3.84-3.66(m,2H), 3.52-3.24(m,2H), 3.11(s,2H), 1.44(s,9H), 1.03-0.95(m,2H), 0.73-0.64(m,2H). MS(ES+)m / e 398(M+H) + .
[0404] Step 3. tert-butyl 7-(3-bromo-5-(difluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0405] To a solution of tert-butyl 7-(3-bromo-5-formylpyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (5.22 g, 13.1 mmol, 1.00 equivalent) in dichloromethane (50.0 mL), DAST (10.6 g, 65.8 mmol, 8.70 mL, 5.00 equivalent) was added at -70°C. The mixture was stirred at 25°C for 12 hours. Saturated NaHCO3 aqueous solution was added to adjust the pH to approximately 7. The mixture was extracted with ethyl acetate (50.0 mL × 3). The combined organic layers were dried over Na2SO4 and concentrated under reduced pressure to obtain a residue, which was purified by column chromatography (SiO2, dichloromethane / methanol = 10 / 1 to 2 / 1) to obtain the title compound (4.20 g, 75.9%) as a yellow solid. 1H NMR (400MHz, CDCl3) δ 8.66(dd,J=2.8,12.8Hz,2H), 7.16-6.83(m,1H), 3.97-2.27(m,6H), 1.44(d,J=2.4Hz,9H), 0.99(s,2H), 0.74(s,2H). MS(ES+)m / e 432(M+H) + .
[0406] Step 4. tert-butyl 7-(3-(difluoromethyl)-5-((diphenylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0407] To a solution of tert-butyl 7-(3-bromo-5-(difluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (4.20 g, 10.0 mmol, 1.00 equivalent) in toluene (40.0 mL), diphenylmethaneimine (2.18 g, 12.1 mmol, 2.02 mL, 1.20 equivalent), (1E,4E)-1,5-diphenylpenta-1,4-dien-3-one-palladium (288 mg, 502 μmol, 0.05 equivalent), BINAP (625 mg, 1.00 mmol, 0.10 equivalent), and t-BuONa (2.00 M, 10.0 mL, 2.00 equivalent) were added. The mixture was stirred at 100°C for 12 hours, then concentrated under reduced pressure to obtain the title compound as a brown oily substance, which was used in the next step without purification. MS(ES+)m / e 519(M+H) + .
[0408] Step 5. 5-(difluoromethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine [ka]
[0409] A solution of tert-butyl 7-(3-(difluoromethyl)-5-((diphenylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (5.20 g, 10.0 mmol, 1.00 equivalent) in THF (50.0 mL) was mixed with aqueous HCl (12 M, 8.36 mL, 10.0 equivalent). The mixture was stirred at 25°C for 2 hours, and saturated aqueous Na2CO3 solution was added to adjust the pH to 9. The mixture was extracted with ethyl acetate, and the combined organic layers were dried over Na2SO4 and concentrated to obtain the title compound (2.55 g, crude) as a brown oily substance. MS(ES+)m / e 255(M+H) + .
[0410] Step 6. tert-butyl 7-(3-amino-5-(difluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0411] A solution of 5-(difluoromethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (2.55 g, 10.03 mmol, 1.00 equivalent) in THF (30.0 mL) was mixed with Boc2O (2.19 g, 10.0 mmol, 2.30 mL, 1.00 equivalent). The mixture was stirred at 20°C for 2 hours and filtered. The filtrate was concentrated under reduced pressure to obtain a residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 5 / 1~1 / 2) to obtain the title compound (2.30 g, 63.0%). MS(ES+)m / e 355(M+H) + .
[0412] Step 7. tert-butyl (E)-7-(3-(difluoromethyl)-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0413] To a solution of tert-butyl 7-(3-amino-5-(difluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (2.16 g, 6.09 mmol, 1.00 equivalent) in toluene (20.0 mL), quinoxaline-6-carbaldehyde (963 mg, 6.09 mmol, 1.00 equivalent) and AcOH (366 mg, 6.09 mmol, 348 μL, 1.00 equivalent) were added. The mixture was stirred at 130 °C for 12 hours, then concentrated under reduced pressure to obtain the title compound as a yellow oily substance, which was used in the next step without purification.
[0414] Step 8. tert-butyl 7-(3-(difluoromethyl)-5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0415] To a solution of tert-butyl (E)-7-(3-(difluoromethyl)-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (1.00 g, 2.02 mmol, 1.00 equivalent) in MeOH (10.0 mL), AcOH (121 mg, 2.02 mmol, 115 μL, 1.00 equivalent) and NaBH3CN (254 mg, 4.04 mmol, 2.00 equivalent) were added. The mixture was stirred at 25°C for 2 hours and concentrated under reduced pressure to obtain a residue. This residue was purified by reverse-phase HPLC to obtain the title compound (380 mg, 37.8%) as a yellow solid. MS(ES+)m / e 497(M+H) + .
[0416] Step 9.5-(difluoromethyl)-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine [ka]
[0417] A mixture of tert-butyl 7-(3-(difluoromethyl)-5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (380 mg, 0.765 mmol, 1.00 equivalent), MeOH (2.00 mL), and HCl / MeOH (12.0 M, 2.00 mL, 31.3 equivalents) was stirred at 20°C for 15 minutes. The mixture was concentrated under reduced pressure to obtain a residue, which was purified by reverse-phase HPLC to obtain the title compound (204 mg, 56.1%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.99(dd,J=1.9,7.6Hz,2H), 8.30(s,1H), 8.21(d,J=8.8Hz,1H), 8.12(d,J=15.9Hz,2H), 8.03(dd,J=1.6,8.8Hz,1H) , 7.34(t,J=54.1Hz,1H), 4.96(s,2H), 3.77(s,2H), 3.66(s,2H), 3.54(s,2H), 1.30-1.19(m,2H), 1.14-1.03(m,2H). MS(ES+)m / e 397(M+H) + .
[0418] Example 18
[0419] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)-5-(trifluoromethyl)pyridine-3-amine (compound 017) [ka]
[0420] Step 1. tert-butyl 7-(3-bromo-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0421] A mixture of 3-bromo-4-chloro-5-(trifluoromethyl)pyridine (1.00 g, 3.84 mmol, 1.00 equivalent) and tert-butyl 4,7-diazaspiro[2.5]octane-4-carboxylate (1.06 g, 4.99 mmol, 1.30 equivalent) was stirred at 80°C for 12 hours. The crude product was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 100 / 1~0 / 1) to obtain the title compound (800 mg, yield 46.5%). MS(ES+)m / e 437(M+H) + .
[0422] Step 2. tert-butyl 7-(3-((diphenylmethylene)amino)-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0423] To a solution of tert-butyl 7-(3-bromo-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (800 mg, 1.83 mmol, 1.00 equivalent) in toluene (8.00 mL), diphenylmethaneimine (498 mg, 2.75 mmol, 461 μL, 1.50 equivalent), BINAP (114 mg, 183 μmol, 0.10 equivalent), Pd2(dba)3 (167 mg, 183 μmol, 0.10 equivalent), and t-BuONa (352 mg, 3.67 mmol, 2.00 equivalent) were added. The mixture was stirred at 100°C for 2 hours and concentrated under reduced pressure to obtain the title compound (880 mg, 89.4%) as a brown oily substance, which was used directly in the next step without purification. MS(ES+)m / e 537(M+H) + .
[0424] Step 3.4-(4,7-diazaspiro[2.5]octan-7-yl)-5-(trifluoromethyl)pyridine-3-amine [ka]
[0425] To a solution of tert-butyl 7-(3-((diphenylmethylene)amino)-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (800 mg, 1.64 mmol, 1.00 equivalent) in tetrahydrofuran (8.00 mL), HCl (12 M, 2.00 mL, 14.6 equivalents) was added. The mixture was stirred at 25°C for 12 hours, diluted with ethyl acetate, and washed with H2O (50.0 mL × 3). The combined aqueous layer was concentrated to obtain the title compound (400 mg, crude) as a brown oily substance. MS(ES+)m / e 273(M+H) + .
[0426] Step 4. tert-butyl 7-(3-amino-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0427] To a solution of 4-(4,7-diazaspiro[2.5]octan-7-yl)-5-(trifluoromethyl)pyridine-3-amine (400 mg, 1.47 mmol, 1.00 equivalent) in H2O (10.0 mL), Na2CO3 (155 mg, 1.47 mmol, 1.00 equivalent) and (Boc)2O (320 mg, 1.47 mmol, 337 μL, 1.00 equivalent) were added. The mixture was stirred at 25°C for 2 hours and then extracted with ethyl acetate (50.0 mL × 3). The combined organic layer was washed with brine (50.0 mL × 3), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. The residue was purified by preparative TLC (SiO2, petroleum ether / ethyl acetate = 1 / 1, Rf = 0.30) to obtain the title compound (400 mg, 70.8%) as a yellow oil. 1H NMR(400MHz,DMSO-d6)δ MS(ES+)m / e 373(M+H) + .
[0428] Step 5. tert-butyl (E)-7-(3-((quinoxaline-6-ylmethylene)amino)-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0429] To a solution of tert-butyl 7-(3-amino-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (400 mg, 1.07 mmol, 1.00 equivalent) in toluene (4.00 mL), quinoxaline-6-carbaldehyde (254 mg, 1.61 mmol, 1.50 equivalent) and AcOH (64.5 mg, 1.07 mmol, 61.4 μL, 1.00 equivalent) were added. The mixture was stirred at 130°C for 12 hours and concentrated under reduced pressure to obtain the title compound (640 mg, crude) as a brown oily substance. MS(ES+)m / e 513(M+H) + .
[0430] Step 6. tert-butyl 7-(3-((quinoxaline-6-ylmethyl)amino)-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate [ka]
[0431] To a solution of tert-butyl (E)-7-(3-((quinoxaline-6-ylmethylene)amino)-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (640 mg, 1.25 mmol, 1.00 equivalent) in methanol (6.00 mL), NaBH3CN (154 mg, 2.50 mmol, 2.00 equivalent) and AcOH (74.9 mg, 1.25 mmol, 71.4 μL, 1.00 equivalent) were added. The mixture was stirred at 25°C for 12 hours and concentrated under reduced pressure to obtain the residue. The crude product was purified by reverse-phase HPLC to obtain the title compound (210 mg, 32.1%) as a yellow solid. MS(ES+)m / e 512(M+H) + .
[0432] Step 7. N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)-5-(trifluoromethyl)pyridine-3-amine [ka]
[0433] To a solution of tert-butyl 7-(3-((quinoxaline-6-ylmethyl)amino)-5-(trifluoromethyl)pyridine-4-yl)-4,7-diazaspiro[2.5]octane-4-carboxylate (200 mg, 388 μmol, 1.00 equivalent) in methanol (20.0 mL), HCl / MeOH (4 M, 10.0 mL, 102 equivalents) was added. The mixture was stirred at 25°C for 2 hours and concentrated under reduced pressure to obtain a residue, which was purified by reverse-phase HPLC to obtain the title compound (144 mg, 75.5%) as a yellow solid. 1H NMR(400MHz,MeOD-d4)δ 8.93(q,J=2.0Hz,1H), 8.47(s,1H), 8.24(s,1H), 8.19(d,J=8.8Hz,1H), 8.10(d,J =0.8Hz,1H), 8.00(dd,J=8.8,2.0Hz,1H), 4.99(s,2H), 3.65-3.84(m,4H), 3.57(br s,2H), 1.28-1.20(m,2H), 1.13-1.05(m,2H). MS(ES+)m / e 415(M+H) + .
[0434] Example 19
[0435] 5-Methyl-N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (Compound 018) [ka]
[0436] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 9.93 (br s, 2H), 8.95-8.91 (m, 2H), 8.10 (d, J=8.6 Hz, 1H), 8.03 (s, 1H), 7.97 (s, 1H), 7.89 (dd, J=1.9, 8.8 Hz, 1H), 7.76 (s, 1H), 6.91 (br s, 1H), 4.80 (br d, J=4.3 Hz, 2H), 3.93 (s, 3H), 3.52 (br s, 2H), 3.36 (br s, 4H), 1.18 (s, 2H), 0.84 (s, 2H). MS(ES+)m / e 377(M+H) + .
[0437] Example 20
[0438] 6-Methyl-N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (Compound 019) [ka]
[0439] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 15.03(br s,1H), 10.34(br s,2H), 8.94(s,2H), 8.10(d,J=8.8Hz,1H), 8.03(s,1H), 7.91(dd,J=1.6,8.8Hz,1H), 7.55(br d,J=2.8Hz,1H), 7.26(s,1H), 6.54(br d,J=0.8Hz,1H), 4.74(s,2H), 3.66-3.53(m,4H), 3.50(s,2H), 2.48(s,3H), 1.26-1.20(m,2H), 0.90-0.84(m,2H). MS(ES+)m / e 361(M+H) + .
[0440] Example 21
[0441] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)-6-(trifluoromethyl)pyridine-3-amine (compound 020) [ka]
[0442] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 10.00 (br s, 2H), 9.04-8.83 (m, 2H), 8.10 (d, J=8.8 Hz, 1H), 8.03 (s, 1H), 7.91 (dd, J=2.0, 8.8 Hz, 1H), 7.87 (s, 1H), 7.23 (s, 1H), 6.73-6.29 (m, 1H), 4.79 (s, 2H), 3.53 (br s, 2H), 3.33-3.13 (m, 4H), 1.29-1.14 (m, 2H), 0.98-0.84 (m, 2H). MS(ES+)m / e 415(M+H) + .
[0443] Example 22
[0444] N-((7-chloroquinoxaline-6-yl)methyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (compound 021) [ka]
[0445] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 15.21-14.83(m,1H), 10.20(br s,2H), 8.96(dd,J=1.6,11.6Hz,2H), 8.31(s,1H), 8.13(d,J=6.0Hz,1H), 7.90(d,J=16.4Hz,2H), 7.40(d,J=6.4Hz,1H), 6.64(br t,J=5.6Hz,1H), 4.75(br d,J=5.2Hz,2H), 3.71-3.41(m,6H), 1.27-1.14(m,2H), 0.93-0.79(m,2H). MS(ES+)m / e 381(M+H) + .
[0446] Example 23
[0447] N-((8-fluoroquinoxaline-6-yl)methyl)-4-(4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-amine (compound 022) [ka]
[0448] The title compound was synthesized following the same procedure as described for the preparation of compound 003 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.97-14.64(m,1H), 10.10(br s,2H), 9.00(dd,J=1.6,14.6Hz,2H), 8.09(d,J=6.4Hz,1H), 7.91(s,1H), 7.83-7.75(m,2H), 7.35(d,J=6.4Hz,1H), 6.71(br t,J=6.0Hz,1H), 4.74(br d,J=5.6Hz,2H), 3.58(br s,4H), 3.49(s,2H), 1.23-1.17(m,2H), 0.92-0.86(m,2H). MS(ES+)m / e 365(M+H) + .
[0449] Example 24
[0450] 5-Chloro-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (compound 023) [ka]
[0451] The title compound was synthesized using the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, methanol-d4) δ 8.98 (s, 2H), 8.24-8.10 (m, 3H), 8.00 (d, J=8.8 Hz, 1H), 7.84 (s, 1H), 4.88 (br s, 2H), 4.12 (ddd, J=2.8, 7.2, 13.2 Hz, 1H), 3.94 (ddd, J=2.4, 7.2, 13.2 Hz, 1H), 3.70 (br d, J=12.8 Hz, 1H), 3.68-3.62 (m, 1H), 3.56 (br d,J=12.8Hz,1H), 3.48-3.38(m,1H), 1.24-1.06(m,3H), 1.04-0.96(m,1H). MS(ES+)m / e 381(M+H) + .
[0452] Example 25
[0453] 5-Bromo-N-(quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (compound 024) [ka]
[0454] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. ¹H NMR (400MHz, DMSO-d6) δ 9.99 (br s, ¹H), 9.50 (br d, J=6.0Hz, ¹H), 8.93 (q, J=2.0Hz, ²H), 8.21 (s, ¹H), 8.14-8.04 (m, ²H), 7.99-7.71 (m, ²H), 6.71-6.47 (m, ¹H), 4.91-4.62 (m, ²H), 4.06-3.84 (m, ²H), 3.68-3.56 (m, ¹H), 3.53-3.38 (m, ¹H), 3.32-3.19 (m, ¹H), 3.13 (br d,J=12.4Hz,1H), 1.04-0.88(m,2H), 0.78-0.67(m,2H). MS(ES+)m / e 425(M+H) + .
[0455] Example 26
[0456] 6-Methyl-N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (Compound 025) [ka]
[0457] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.94-14.82(m,1H), 10.55-9.34(m,2H), 8.92(d,J=0.8Hz,2H), 8.08(d,J=8.4Hz,1H) , 8.03(s,1H), 7.89(dd,J=2.0,8.8Hz,1H), 7.49(d,J=6.0Hz,1H), 7.35(s,1H), 6.48(br s,1H), 4.62(br s,2H), 4.00(br s,2H), 3.22-2.84(m,2H), 2.52-2.50(m,3H), 1.13(br s,2H), 1.03-0.53(m,2H). MS(ES+)m / e 361(M+H) + .
[0458] Example 27
[0459] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)-6-(trifluoromethyl)pyridine-3-amine (compound 026) [ka]
[0460] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 9.50-9.26(m,2H), 8.95-8.88(m,2H), 8.09(d,J=8.4Hz,1H), 8.04(s,1H), 7.90(dd,J=1.6,8.8Hz,1H), 7.84(s,1H), 7.26(s,1H), 6.46(br s,1H), 4.71(br s,2H), 3.59(br s,2H), 3.37(br s,2H), 3.15(br s,2H), 0.94(br s,2H), 0.56(br s,2H). MS(ES+)m / e 415(M+H) + .
[0461] Example 28
[0462] 6-Methoxy-N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (Compound 027) [ka]
[0463] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 9.62(br d,J=2.4Hz,2H), 8.94(q,J=2.0Hz,2H), 8.08(d,J=8.4Hz,1H), 8.04(s,1H), 7.88(dd,J=2.4,8. 4Hz,1H), 7.18(s,1H), 6.66(s,1H), 6.22-5.42(m,1H), 4.54(s,2H), 4.04-3.85(m,5H), 3.13(br d,J=5.2Hz,2H), 2.54(br s,2H), 1.12(br s,2H), 0.84(br s,2H). MS(ES+)m / e 377(M+H) + .
[0464] Example 29
[0465] N-((7-fluoroquinoxaline-6-yl)methyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (compound 028) [ka]
[0466] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.87-14.54(m,1H), 9.82-9.44(m,2H), 8.94(dd,J=2.0,14.6Hz,2H), 8.07(d,J=6.4Hz,1H) , 8.01(d,J=8.0Hz,1H), 7.96(d,J=10.8Hz,1H), 7.85(s,1H), 7.50(d,J=6.4Hz,1H), 6.50(br t,J=5.6Hz,1H), 4.66(br d,J=4.4Hz,2H), 4.08-3.83(m,2H), 3.54-3.52(m,2H), 3.10(br dd,J=2.4,5.3Hz,2H), 1.14(br s,2H), 0.99-0.73(m,2H). MS(ES+)m / e 365(M+H) + .
[0467] Example 30
[0468] N-((7-chloroquinoxaline-6-yl)methyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (compound 029) [ka]
[0469] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.71-14.44(m,1H), 9.81-9.24(m,2H), 8.97(dd,J=1.8,9.6Hz,2H), 8.31(s,1H), 8.09(d,J =6.4Hz,1H), 7.99(s,1H), 7.80(s,1H), 7.52(d,J=6.4Hz,1H), 6.51(t,J=5.4Hz,1H), 4.64(br d,J=3.2Hz,2H), 4.09-3.81(m,2H), 3.43-2.93(m,4H), 1.14(br s,2H), 1.04-0.65(m,2H). MS(ES+)m / e 381(M+H) + .
[0470] Example 31
[0471] N-((8-fluoroquinoxaline-6-yl)methyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (compound 030) [ka]
[0472] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.73(br d,J=2.4Hz,1H), 9.70(br d,J=4.0Hz,2H), 9.00(dd,J=1.6,16.0Hz,2H), 8.03(d,J=6.4Hz,1H), 7.93(s,1H), 7.81-7.71(m,2H), 7.47(d,J=6.4Hz,1H), 6.65(br t,J=5.6Hz,1H), 4.64(br d,J=4.4Hz,2H), 4.00(br d,J=4.0Hz,2H), 3.65(br s,2H), 3.18-2.96(m,2H), 1.14(br s,2H), 1.01-0.62(m,2H). MS(ES+)m / e 365(M+H) + .
[0473] Example 32
[0474] N-(Quinoxaline-6-ylmethyl)-4-(4,7-diazaspiro[2.5]octan-4-yl)pyridine-3-amine (Compound 031) [ka]
[0475] The title compound was synthesized following the same procedure as described for the preparation of compound 001 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.82(br d,J=2.4Hz,1H), 10.13-9.41(m,2H), 8.93(s,2H), 8.13-7.98(m,3H), 7.90(dd,J=1.6,8.8Hz,1H), 7.72(s,1H), 7.47(d,J=6.4Hz,1H), 6.66(br s,1H), 4.65(br s,2H), 4.06-3.84(m,2H), 3.58-2.73(m,4H), 1.14(br s,2H), 1.00-0.58(m,2H). MS(ES+)m / e 347(M+H) + .
[0476] Example 33
[0477] 5-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridazine-4-amine (compound 032) [ka]
[0478] Step 1.5-(4-methylpiperazine-1-yl)pyridazine-4-amine [ka]
[0479] A mixture of 5-(4-methylpiperazin-1-yl)pyridazin-4-amine (1.28 g, 12.7 mmol, 1.41 mL, 1.10 equivalents), 5-chloropyridazin-4-amine (1.50 g, 11.58 mmol, 1.00 equivalent), and DIEA (14.9 g, 115 mmol, 20.1 mL, 10.0 equivalents) was stirred at 130°C for 16 hours. The reaction mixture was filtered. The filtrate was diluted with water (20.0 mL) and extracted with DCM (50.0 mL × 3). The combined organic layers were washed with brine (20.0 mL × 2), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by reverse-phase HPLC to obtain the title compound (1.50 g, 67.0%) as a yellow oil. MS(ES+)m / e 194(M+H) + .
[0480] Step 2. (E)-N-(5-(4-methylpiperazine-1-yl)pyridazin-4-yl)-1-(quinoxaline-6-yl)methanymine [ka]
[0481] 5-(4-methylpiperazin-1-yl)pyridazin-4-amine (0.827 g, 4.28 mmol, 1.00 equivalent), (E)-N-(5-(4-methylpiperazin-1-yl)pyridazin-4-yl)-1-(quinoxaline-6-yl)methanymine (744 mg, 4.71 mmol, 1.10 equivalent), and AcOH (514 mg, 8.56 mmol, 490 μL, 2.00 equivalent) were stirred at 130°C for 10 hours and concentrated under reduced pressure to obtain the title compound (1.50 g, crude) as a black solid, which was used directly in the next step without purification. MS(ES+)m / e 334(M+H) + .
[0482] Step 3.5-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-4-amine [ka]
[0483] To a solution of (E)-N-(5-(4-methylpiperazin-1-yl)pyridazin-4-yl)-1-(quinoxaline-6-yl)methanymine (1.30 g, 3.90 mmol, 1.00 equivalent) and AcOH (234 mg, 3.90 mmol, 223 μL, 1.00 equivalent) in MeOH (13.0 mL), NaBH3CN (367 mg, 5.85 mmol, 1.50 equivalent) was added in small amounts at 25°C. The mixture was stirred at 40°C for 12 hours and quenched by adding saturated NH4Cl solution (50.0 mL). NaHCO3 was added to adjust the pH to 8-9. The mixture was extracted using DCM (30.0 mL × 3). The combined organic layers were washed with brine (30.0 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by preparative HPLC to obtain the title compound (0.156 g, 31.2%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 11.59(br d,J=1.2Hz,1H), 9.15(br s,1H), 8.94(s,2H), 8.84(s,1H), 8.77(s,1H), 8.08-8.16(m,2H), 7.98(dd,J=8.8,2.0Hz,1H), 5.09(br d,J=6.4Hz,2H), 3.42-3.61(m,6H), 3.23-3.38(m,2H), 2.81(d,J=4.4Hz,3H). MS(ES+)m / e 336(M+H) + .
[0484] Example 34
[0485] 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridazine-3-amine (compound 033) [ka]
[0486] Step 1. 6-Chloro-4-(4-methylpiperazin-1-yl)pyridazine-3-amine [ka]
[0487] 4-bromo-6-chloropyridazine-3-amine (1.50 g, 7.20 mmol, 1.00 equivalent) and 6-chloro-4-(4-methylpiperazin-1-yl)pyridazine-3-amine (792 mg, 7.92 mmol, 878 μL, 1.10 equivalents) were added to DMA (2.00 mL) with K2CO3 (2.98 g, 21.6 mmol, 3.00 equivalent). The mixture was stirred at 100 °C for 16 hours and filtered. The filtrate was diluted with water (20.0 mL) and extracted with DCM (50.0 mL × 3). The combined organic layers were washed with brine (20.0 mL × 2), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue, which was purified by reverse-phase HPLC to obtain the title compound (1.00 g, 61.0%) as a yellow oil. MS(ES+)m / e 228(M+H) + .
[0488] Step 2. 4-(4-methylpiperazine-1-yl)pyridazine-3-amine [ka]
[0489] To a solution of 6-chloro-4-(4-methylpiperazin-1-yl)pyridazin-3-amine (0.50 g, 2.20 mmol, 1.00 equivalent) in MeOH (100 mL), 10% Pd / C (0.250 g) was added under N2 conditions. The suspension was degassed under vacuum and purged several times with H2. The mixture was stirred under H2 (50.0 psi) at 25°C for 10 hours and filtered. The filtrate was concentrated under reduced pressure to obtain the title compound (0.400 g, 94.3%) as a white solid. ¹H NMR (400 MHz, DMSO-d6) δ 6.74 (s, 1H), 5.05 (br s, 2H), 3.10 (br s, 4H), 2.59 (br s, 4H), 2.37 (s, 3H). MS(ES+)m / e 194(M+H) + .
[0490] Step 3. (E)-N-(4-(4-methyl-4,7-diazaspiro[2.5]octan-7-yl)pyridine-3-yl)-1-(quinoxaline-6-yl)methanymine [ka]
[0491] 4-(4-methylpiperazin-1-yl)pyridazin-3-amine (0.400 g, 2.07 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (360 mg, 2.28 mmol, 1.10 equivalent), and AcOH (248 mg, 4.14 mmol, 236 μL, 2.00 equivalent) were stirred in toluene (15.0 mL) at 130 °C for 10 hours, and then concentrated under reduced pressure to obtain the title compound (0.600 g, crude) as a black solid. This was used directly in the next step without further purification. MS(ES+)m / e 334(M+H) + .
[0492] Step 4. 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridazine-3-amine [ka]
[0493] To a solution of (E)-N-(4-(4-methylpiperazin-1-yl)pyridazin-3-yl)-1-(quinoxaline-6-yl)methanymine (0.60 g, 1.80 mmol, 1.00 equivalent) and AcOH (108 mg, 1.80 mmol, 103 μL, 1.00 equivalent) in MeOH (8.00 mL), NaBH3CN (113 mg, 1.80 mmol, 1.00 equivalent) was added in small amounts at 25°C. The mixture was stirred at 40°C for 12 hours and quenched by adding saturated NH4Cl solution (50.0 mL). NaHCO3 was added to adjust the pH to 8-9, and the mixture was extracted using DCM (30.0 mL × 3). The combined organic layers were washed with brine (30.0 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by preparative HPLC to obtain the title compound (0.049 g, 24.5%). 1H NMR(400MHz,DMSO-d6)δ 11.82(br d,J=4.0Hz,1H), 8.92(s,2H), 8.78(d,J=6.0Hz,1H), 8.27(br s,1H), 8.08(d,J=8.8Hz,1H), 8.02(s,1H), 7.92(dd,J=8.8,2.0Hz,1H), 7.48(d,J=6.0Hz,1H), 4.84(br s,2H), 4.69-4.71(m,1H), 3.96-3.97(m,1H), 3.95(br d,J=12.4Hz,1H), 3.50-3.62(m,4H), 3.34-3.47(m,2H), 2.81(br d,J=4.0Hz,3H). MS(ES+)m / e 336(M+H) + .
[0494] Example 35
[0495] 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyrimidine-5-amine (compound 034) [ka]
[0496] Step 1. 4-(4-methylpiperazine-1-yl)pyrimidine-5-amine [ka]
[0497] To a solution of 4-chloropyrimidine-5-amine (1.00 g, 7.72 mmol, 1.00 equivalent) and 1-methylpiperazine (773 mg, 7.72 mmol, 856 μL, 1.00 equivalent) in ACN (2.00 mL), DIEA (2.99 g, 23.1 mmol, 4.03 mL, 3.00 equivalent) was added. The mixture was stirred at 100 °C for 16 hours, concentrated under reduced pressure, diluted with H₂O (20.0 mL), and extracted with DCM (20.0 mL × 3). The combined organic layer was washed with brine (10.0 mL), dried on Na₂SO₄, concentrated under reduced pressure to obtain a residue, which was purified by column chromatography (SiO₂, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1) to obtain the title compound (0.50 g, 33.5%) as a yellow solid. MS(ES+)m / e 192(M+H) + .
[0498] Step 2. (E)-N-(4-(4-methylpiperazine-1-yl)pyrimidine-5-yl)-1-(quinoxaline-6-yl)methanymine [ka]
[0499] 4-(4-methylpiperazin-1-yl)pyrimidine-5-amine (0.500 g, 2.59 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (450 mg, 2.85 mmol, 1.10 equivalent), and AcOH (155 mg, 2.59 mmol, 148 μL, 1.00 equivalent) in toluene (15.0 mL) were stirred at 130 °C for 9 hours and concentrated under reduced pressure to obtain the title compound (0.50 g, crude) as a black oily substance, which was used directly in the next reaction without purification. MS(ES+)m / e 334(M+H) + .
[0500] Step 3: 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyrimidine-5-amine [ka]
[0501] To a solution of (E)-N-(4-(4-methylpiperazin-1-yl)pyrimidine-5-yl)-1-(quinoxaline-6-yl)methanymine (0.50 g, 1.50 mmol, 1.00 equivalent) and NaBH3CN (188 mg, 3.00 mmol, 2.00 equivalent) in MeOH (5.00 mL), AcOH (90.0 mg, 749 μmol, 85.8 μL, 1.00 equivalent) was added in small amounts at 25°C. The mixture was stirred at 40°C for 12 hours and quenched with saturated NH4Cl solution (50.0 mL). NaHCO3 was added to adjust the pH to 8-9. The mixture was extracted using DCM (30.0 mL × 3). The combined organic layers were washed with brine (30.0 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by preparative HPLC to obtain the title compound (0.20 g, 39.6%) as a white solid. 1H NMR(400MHz,DMSO-d6)δ 8.91(d,J=1.2Hz,2H), 8.12(s,1H), 8.08(d,J=8.8Hz,1H), 8.01(s,1H), 7.88(dd,J=8.8,1.6Hz,1H), 7.68 (s,1H), 5.77(t,J=6.0Hz,1H), 4.63(d,J=6.0Hz,2H), 3.32-3.35(m,2H), 2.51-2.56(m,4H), 2.24(s,3H). MS(ES+)m / e 336(M+H) + .
[0502] Example 36
[0503] 5-Fluoro-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 035) [ka]
[0504] The title compound was synthesized using the same procedure as described for the preparation of compound 036 using appropriate starting materials and intermediates. ¹H NMR (400MHz, DMSO-d6) δ: 8.89 (s, 2H), 8.23 (dd, J=0.8Hz, J2=5.2Hz, 1H), 8.13 (d, J=8.8Hz, 1H), 8.07 (d, J=1.2Hz, 1H), 7.96 (dd, J1=2.0Hz, J2=8.8Hz, 1H), 7.82 (d, J=0.8Hz, 1H), 4.89 (s, 2H), 3.78-3.60 (m, 8H), 3.02 (s, 3H). MS(ES+) m / e: 353 (M+H). + .
[0505] Example 37
[0506] 5-Chloro-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 036) [ka]
[0507] Step 1. 1-(3-chloro-5-nitropyridine-4-yl)-4-methylpiperazine [ka]
[0508] To a solution of 3,4-dichloro-5-nitropyridine (2.00 g, 10.36 mmol, 1.00 equivalent) in ACN (20 mL), K2CO3 (3.58 g, 25.9 mmol, 2.50 equivalent) and 1-methylpiperazi (1.04 g, 10.3 mmol, 1.15 mL, 1.00 equivalent) were added. The mixture was stirred at 80°C for 4 hours, poured into H2O (20 mL), and extracted with ethyl acetate (20 mL × 3). The combined organic phase was dried over anhydrous Na2SO4 and concentrated under reduced pressure to obtain the title compound (2.77 g, crude) as a yellow solid. MS(ES+)m / e 257(M+H) + .
[0509] Step 2: 5-Chloro-4-(4-methylpiperazine-1-yl)pyridine-3-amine [ka]
[0510] To a solution of 1-(3-chloro-5-nitropyridine-4-yl)-4-methylpiperazine (1.00 g, 3.90 mmol, 1.00 equivalent) in THF (10 mL), Pt-V / C (1.02 g, 3.90 mmol, 1.00 equivalent) and NH3·H2O (1.46 g, 11.6 mmol, 1.61 mL, 28.0% purity, 3.00 equivalent) were added. The mixture was stirred under H2 (50 psi) at 50°C for 12 hours, filtered, and concentrated to obtain the title compound (0.93 g, crude) as a brown solid. MS(ES+)m / e227 (M+H) + .
[0511] Step 3. (Z)-N-(5-chloro-4-(4-methylpiperazine-1-yl)pyridine-3-yl)-1-(quinoxaline-6-yl)methanymine [ka]
[0512] To a solution of 5-chloro-4-(4-methylpiperazin-1-yl)pyridine-3-amine (0.93 g, 4.13 mmol, 1.00 equivalent) in toluene (10.0 mL), AcOH (347 mg, 5.78 mmol, 330 μL, 1.40 equivalent) and quinoxaline-6-carbaldehyde (652 mg, 4.13 mmol, 1.00 equivalent) were added. The mixture was stirred at 130°C for 12 hours and concentrated to obtain the title compound (1.64 g, crude) as a yellow solid. MS(ES+)m / e 367(M+H) + .
[0513] Step 4. 5-Chloro-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0514] To a solution of (Z)-N-(5-chloro-4-(4-methylpiperazine-1-yl)pyridine-3-yl)-1-(quinoxaline-6-yl)methanymine (1.64 g, 4.47 mmol, 1.00 equivalent) in MeOH (15 mL), NaBH3CN (309 mg, 4.92 mmol, 1.10 equivalent) and AcOH (268 mg, 4.47 mmol, 255 μL, 1.00 equivalent) were added. The mixture was stirred at 25°C for 4 hours, quenched with NaHCO3 (1 mL), and concentrated to obtain a residue. The residue was purified by preparative HPLC to obtain the title compound (0.59 g, 39.2%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 11.42(br d,J=1.2Hz,1H), 8.94(d,J=1.2Hz,2H), 8.16(s,1H),8.16-8.06(m,2H), 7.98(dd,J=1. 6,8.8Hz,1H), 7.80(s,1H), 7.56-7.26(m,1H), 4.80(s,2H), 3.80-3.68(m,4H), 3.48(br d,J=8.4Hz,2H), 3.30(br d,J=9.6Hz,2H), 2.80(br d,J=4.4Hz,3H), 2.08(s,1H). MS(ES+)m / e 369(M+H) + .
[0515] Example 38
[0516] 5-Bromo-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 037) [ka]
[0517] The title compound was synthesized following the same procedure as described for the preparation of compound 036 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 11.08 (br s, ¹H), 8.92 (q, J=1.6 Hz, ²H), 8.08 (dd, J=4.4, 13.2 Hz, ³H), 7.92 (dd, J=2.0, 8.4 Hz, ¹H), 7.86 (s, ¹H), 7.45-7.08 (m, ¹H), 4.80 (s, ²H), 3.89-3.63 (m, ⁴H), 3.57-3.40 (m, ²H), 3.38-3.15 (m, ²H), 2.84 (d, J=4.4 Hz, ³H). MS(ES+) m / e 415 (M+H) + .
[0518] Example 39 5-Methyl-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 038) [ka]
[0519] The title compound was synthesized using the same procedure as described for the preparation of compound 036 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 8.90 (q, J=2.0 Hz, 2H), 8.07 (d, J=8.4 Hz, 1H), 7.98 (s, 1H), 7.86 (dd, J=1.6, 8.8 Hz, 1H), 7.66 (s, 1H), 7.55 (s, 1H), 5.92 (t, J=6.4 Hz, 1H), 4.69 (d, J=6.4 Hz, 2H), 3.32 (s, 4H), 2.26 (s, 3H), 2.24 (s, 3H). MS(ES+) m / e: 349 (M+H). + .
[0520] Example 40
[0521] 5-(difluoromethyl)-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 039) [ka]
[0522] Step 1. 5-Bromo-4-(4-methylpiperazine-1-yl)nicotinaldehyde [ka]
[0523] To a solution of 5-bromo-4-chloronicotinaldehyde (3.00 g, 13.6 mmol, 1.00 equivalent) and 1-methylpiperazine (1.46 g, 14.5 mmol, 1.62 mL, 1.07 equivalents) in CH3CN (30.0 mL), DIEA (4.40 g, 34.0 mmol, 5.93 mL, 2.50 equivalents) was added. The mixture was stirred at 80°C for 16 hours, diluted with H2O (30.0 mL), and extracted with ethyl acetate (50.0 mL × 3). The combined organic layer was washed with brine (50.0 mL × 3), dried on Na2SO4, and concentrated under reduced pressure to obtain a residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 1 / 1) to obtain the title compound (3.70 g, 95.6%) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ 10.11(s,1H), 8.65(d,J=4.6Hz,2H), 3.48(s,4H), 2.66(s,4H), 2.40(s,3H). MS(ES+)m / e 286(M+H) + .
[0524] Step 2.1-(3-bromo-5-(difluoromethyl)pyridine-4-yl)-4-methylpiperazine [ka]
[0525] To a solution of 5-bromo-4-(4-methylpiperazin-1-yl)nicotinaldehyde (3.69 g, 12.9 mmol, 1.00 equivalent) in DCM (35.0 mL), DAST (10.4 g, 64.9 mmol, 8.58 mL, 5.00 equivalent) was added dropwise at -70°C. The reaction mixture was stirred at 25°C for 16 hours and neutralized to approximately pH 7 with saturated NaHCO3 solution. The mixture was extracted with Âi (50 mL × 3), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by column chromatography (SiO2, dichloromethane / methanol = 10 / 1 to 2 / 1) to obtain the title compound (0.88 g, 18.4%) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ 8.72 (d, J = 14.3 Hz, 2H), 7.15-6.81 (m, 1H), 3.57-3.03 (m, 4H), 2.58 (s, 4H), 2.38 (s, 3H). MS(ES+)m / e 306(M+H) + .
[0526] Step 2. N-(5-(difluoromethyl)-4-(4-methylpiperazine-1-yl)pyridine-3-yl)-1,1-diphenylmethanymine [ka]
[0527] To a solution of 1-(3-bromo-5-(difluoromethyl)pyridine-4-yl)-4-methylpiperazine (800 mg, 2.61 mmol, 1.00 equivalent) and diphenylmethaneamine (568 mg, 3.14 mmol, 526 μL, 1.20 equivalents) in toluene (8.00 mL), Pd(dba)2 (75.1 mg, 130 μmol, 0.05 equivalents), t-BuONa (2.00 M, 2.61 mL, 2.00 equivalents), and BINAP (162 mg, 261 μmol, 0.10 equivalents) were added under an N2 atmosphere. The suspension was degassed and purged three times with N2. The mixture was stirred under N2 at 100°C for 12 hours and concentrated under reduced pressure to obtain the title compound (1.06 g, crude) as a brown oily substance, which was used in the next step without purification. MS(ES+)m / e 407(M+H) + .
[0528] Step 3. 5-Difluoromethyl-4-(4-methylpiperazine-1-yl)pyridine-3-amine [ka]
[0529] To a solution of N-(5-(difluoromethyl)-4-(4-methylpiperazin-1-yl)pyridine-3-yl)-1,1-diphenylmethaneimine (1.00 g, 2.46 mmol, 1.00 equivalent) in THF (10.0 mL), HCl (12.0 M, 2.05 mL, 10.0 equivalent) was added at 25°C. The mixture was stirred at 25°C for 2 hours and concentrated under reduced pressure to remove THF. The mixture was extracted with siRNA (20.0 mL × 2). The combined organic layers were washed with brine (20.0 mL), dried over Na₂SO₄, and concentrated under reduced pressure to obtain a residue. This residue was purified by reverse-phase HPLC to obtain the title compound (350 mg, 58.7%) as a brown solid. MS(ES+)m / e 243(M+H) + .
[0530] Step 4. (E)-N-(5-difluoromethyl)-4-(4-methylpiperazine-1-yl)pyridine-3-yl)-1-(quinoxaline-6-yl)methanymine [ka]
[0531] AcOH (86.7 mg, 1.44 mmol, 82.7 μL, 1.00 equivalent) was added to a solution of 5-(difluoromethyl)-4-(4-methylpiperazin-1-yl)pyridine-3-amine (350 mg, 1.44 mmol, 1.00 equivalent) and quinoxaline-6-carbaldehyde (228 mg, 1.44 mmol, 1.00 equivalent) in toluene (5.00 mL). The mixture was stirred at 130 °C for 2 hours and concentrated under reduced pressure to obtain the title compound (552 mg, crude) as a brown oily substance.
[0532] Step 5. 5-(difluoromethyl)-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0533] To a solution of (E)-N-(5-(difluoromethyl)-4-(4-methylpiperazin-1-yl)pyridine-3-yl)-1-(quinoxaline-6-yl)methanymine (552 mg, 1.44 mmol, 1.00 equivalent) in MeOH (5.00 mL), NaBH3CN (90.7 mg, 1.44 mmol, 1.00 equivalent) and AcOH (86.6 mg, 1.44 mmol, 82.6 μL, 1.00 equivalent) were added. The mixture was stirred at 25°C for 1.5 hours and concentrated under reduced pressure to obtain a residue. The residue was purified by reverse-phase HPLC to obtain the title compound (106 mg, 19.0%) as a green solid. 1H NMR(400MHz,DMSO-d6)δ 9.20-8.85(m,2H), 8.31(s,1H), 8.26-8.18(m,2H), 8.15-8.02(m,2H), 7.36(t, J=54.0Hz,1H), 4.99(s,3H), 3.96-3.79(m,2H), 3.76-3.52(m,6H), 3.06(s,3H). MS(ES+)m / e 385(M+H) + .
[0534] Example 41
[0535] 4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)-5-(trifluoromethyl)pyridine-3-amine (compound 040) [ka]
[0536] The title compound was synthesized using the same procedure as described for the preparation of compound 036 using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 8.96–8.87 (m, 2H), 8.45 (s, 1H), 8.20–8.15 (m, 2H), 8.11 (d, J=1.2 Hz, 1H), 8.00 (dd, J=8.8, 2.0 Hz, 1H), 4.99 (s, 2H), 3.92–3.60 (m, 8H), 3.06 (s, 3H). MS(ES+) m / e 403 (M+H) + .
[0537] Example 42
[0538] 5-Methyl-4-(4-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 041) [ka]
[0539] The title compound was synthesized using the same procedure as described for the preparation of compound 036 using appropriate starting materials and intermediates. ¹H NMR (400MHz, DMSO-d6) δ: 8.90 (q, J=2.0Hz, 2H), 8.07 (d, J=8.4Hz, 1H), 7.96 (s, 1H), 7.85 (dd, J=1.6, 8.4Hz, 1H), 7.62 (s, 1H), 7.55 (s, 1H), 6.09 (t, J=6.4Hz, 1H), 4.70 (d, J=6.4Hz, 2H), 3.81 (s, 3H), 3.31 (s, 8H), 2.24 (s, 3H). MS(ES+) m / e 365 (M+H). + .
[0540] Example 43
[0541] N-((7-chloroquinoxaline-6-yl),methyl)-4-(4-methylpiperazine-1-yl)pyridine-3-amine (compound 042) [ka]
[0542] The title compound was synthesized following the same procedure as described for the preparation of compound 036 using appropriate starting materials and intermediates. ¹H NMR (400MHz, DMSO-d6) δ 15.21-14.80 (m, ¹H), 11.73-1.44 (m, ¹H), 8.96 (dd, J=1.6, 13.2Hz, ²H), 8.32 (s, ¹H), 8.14 (d, J=6.4Hz, ¹H), 7.95-7.83 (m, ²H), 7.46 (d, J=6.4Hz, ¹H), 6.78 (br t, J=5.6Hz, ¹H), 4.76 (br d, J=5.2Hz, ²H), 3.93-3.77 (m, ²H), 3.57 (br d,J=8.0Hz,2H), 3.48-3.32(m,4H), 2.82(d,J=4.0Hz,3H). MS(ES+)m / e 369(M+H) + .
[0543] Example 44
[0544] N-((8-fluoroquinoxaline-6-yl)methyl)-4-(4-methylpiperazine-1-yl)pyridine-3-amine (compound 043) [ka]
[0545] The title compound was synthesized using the same procedure as described for the preparation of compound 036 with appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 8.99(dd,J=1.6,14.6Hz,2H), 8.09(d,J=6.0Hz,1H), 7.93(s,1H), 7.87-7.73(m,2H), 7.41(d,J=6.4Hz,1H), 6.86(br t,J=5.6Hz,1H), 4.75(br d,J=5.6Hz,2H), 4.06-3.90(m,4H), 3.88-3.77(m,2H), 3.64-3.52(m,2H), 3.49-3.35(m,4H), 2.83(br s,3H). MS(ES+)m / e 353(M+H) + .
[0546] Example 45
[0547] (R)-4-((1-methylpyrrolidine-3-yl)oxy)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 044) [ka]
[0548] Step 1. tert-butyl (R)-3-((3-nitropyridine-4-yl)oxy)pyrrolidine-1-carboxylate [ka]
[0549] To a solution of tert-butyl (R)-3-hydroxypyrrolidine-1-carboxylate (6.50 g, 34.7 mmol, 1.10 equivalents) in THF (30.0 mL), t-BuOK (1 M, 37.8 mL, 1.20 equivalents) was added at 25°C. The mixture was stirred at 25°C for 1 hour, and then 4-chloro-3-nitropyridine (5.00 g, 31.5 mmol, 1.00 equivalent) in THF (25.0 mL) was added. The mixture was stirred at 25°C for 2 hours, quenched with NH4Cl (saturated solution, 500 mL), and extracted with  (250 mL × 3). The combined organic layers were washed with brine (450 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain a residue. This residue was purified by column chromatography (SiO2, petroleum ether: etOAc = 10:1~2:1) to obtain the title compound (5.09 g, 52.2%) as a brown oily substance. MS(ES+)m / e 310(M+H) + .
[0550] Step 2. tert-butyl (R)-3-((3-aminopyridine-4-yl)oxy)pyrrolidine-1-carboxylate [ka]
[0551] To a solution of tert-butyl (R)-3-((3-nitropyridine-4-yl)oxy)pyrrolidine-1-carboxylate (5.00 g, 16.2 mmol, 1.00 equivalent) in MeOH (50.0 mL), Pt-V / C (4.22 g, 16.2 mmol, 1.00 equivalent) was added under an N2 atmosphere. The mixture was degassed, purged three times with H2, stirred at 25°C for 12 hours, and filtered. The filtrate was concentrated to obtain the title compound (4.6 g, crude) as a brown oily substance. MS(ES+)m / e 280(M+H) + .
[0552] Step 3. tert-butyl(R)-3-((3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)oxy)pyrrolidine-1-carboxylate [ka]
[0553] A mixture of tert-butyl (R)-3-((3-aminopyridine-4-yl)oxy)pyrrolidine-1-carboxylate (2.00 g, 7.16 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (2.26 g, 14.3 mmol, 2.00 equivalent), and AcOH (0.50 mL) in MeOH (10.0 mL) was mixed with borane-2-methylpyridine (1.53 g, 14.3 mmol, 2.00 equivalent). The mixture was stirred at 25°C for 12 hours and concentrated. The crude product was purified by reverse-phase HPLC to obtain the title compound (0.422 g, 14.0%) as a yellow oil. MS(ES+)m / e 422(M+H) + .
[0554] Step 4. (R)-4-(pyrrolidine-3-yloxy)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0555] To a solution of HCl / siRNA (4M, 3.00 mL, 12.6 equivalents) in siRNA (3.00 mL), tert-butyl (R)-3-((3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)oxy)pyrrolidine-1-carboxylate (0.40 g, 949 umol, 1.00 equivalent) in siRNA (2.00 mL) was added. The mixture was stirred at 25°C for 0.5 hours and concentrated under reduced pressure to obtain the title compound (259 mg, 84.9%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 8.81(s,2H), 8.03-7.91(m,3H), 7.83(d,J=8.8Hz,1H), 7.59(s,1H), 7.33(d,J=6.4Hz,1H), 5.61(br d,J=2.4Hz,1H), 4.71(s,1H), 3.85-3.77(m,1H), 3.75-3.66(m,1H), 3.59(t,J=7.6Hz,2H), 2.52-2.43(m,2H). MS(ES+)m / e 322(M+H) + .
[0556] Step 5. (R)-4-((1-methylpyrrolidine-3-yl)oxy)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0557] To a solution of (R)-4-(pyrrolidine-3-yloxy)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (0.30 g, 933 μmol, 1.00 equivalent) and (CHO)n (318 mg, 9.33 mmol, 10.0 equivalent) in MeOH (5.00 mL), NaBH3CN (176 mg, 2.80 mmol, 3.00 equivalent) was added. The mixture was stirred at 25°C for 1 hour, concentrated, and purified by preparative HPLC to obtain the title compound (151.62 mg, 47.8%) as a brown solid. 1H NMR (400MHz, DMSO-d6) δ 15.12 (br s, 1H), 11.90 (br s,1H), 8.92(s,2H), 8.16-8.05(m,3H), 8.04-7.89(m,2H), 7.83(s,1H), 7.59-7.44(m,1H), 5.70(br s,1H), 4.87-4.59(m,2H), 4.12-3.89(m,1H), 3.85-3.64(m,1H), 3.63-3.39(m,1H), 3.28-3.24(m 1H), 3.05-2.82(m,3H), 2.71-2.57(m,1H), 2.44-2.04(m,1H). MS(ES+)m / e 336(M+H) + .
[0558] Example 46
[0559] (R)-5-fluoro-4-((1-methylpyrrolidine-3-yl)oxy)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 045) [ka]
[0560] The title compound was synthesized following the same procedure as described for the preparation of compound 044 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 8.96-8.85(m,2H), 8.14-8.10(m,2H), 8.02(br s,1H), 7.89(br d,J=8.4Hz,1H), 7.66(br s,1H), 5.98-5.83(m,1H), 4.85-4.80(m,2H), 4.34-4.14(m,1H), 4.05-3.87(m,1H), 3.78- 3.53(m,1H), 3.46-3.29(m,1H), 3.12-3.03(m,3H), 2.90-2.78(m,1H), 2.64-2.46(m,1H). MS(ES+)m / e 354(M+H) + .
[0561] Example 47
[0562] (R)-5-chloro-4-((1-methylpyrrolidine-3-yl)oxy)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 046) [ka]
[0563] The title compound was synthesized following the same procedure as described for the preparation of compound 044 using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 12.4(br s,1H), 8.92(d,J=2.4Hz,2H), 8.14(s,1H), 8.10-8.04(m,2H), 8.02(s,1H), 7.94(s,1H), 5.62(br s,1H), 4.78(s,2H), 3.92(br d,J=11.2Hz,2H), 3.42(br d,J=5.2Hz,1H), 3.22(br d,J=4.4Hz,1H), 3.02-2.84(m,3H), 2.64(br dd,J=8.8,14.8Hz,1H), 2.46-2.22(m,1H). MS(ES+)m / e 370(M+H) + .
[0564] Example 48
[0565] (R)-4-(3-aminopyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 047) [ka]
[0566] Step 1. tert-butyl (R,E)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0567] AcOH (202 mg, 3.37 mmol, 193 μL, 2.00 equivalent) was added to a solution of tert-butyl (R)-(1-(3-amino-5-fluoropyridine-4-yl)pyrrolidine-3-yl)carboxylate (500 mg, 1.69 mmol, 1.00 equivalent) and quinoxaline-6-carbaldehyde (266 mg, 1.69 mmol, 1.00 equivalent) in toluene (10.0 mL). The reaction mixture was concentrated under reduced pressure to obtain a yellow solid, which was used in the next step without further purification. MS(ES+)m / e 437.2(M+H) + .
[0568] Step 2. tert-butyl (R)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0569] To a solution of tert-butyl (R,E)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate (736 mg, 1.69 mmol, 1.00 equivalent) in methanol (6.00 mL), NaBH3CN (211 mg, 3.37 mmol, 2.00 equivalent) and AcOH (50.6 mg, 844 μmol, 48.2 μL, 0.500 equivalent) were added. The mixture was stirred at 25°C for 12 hours, concentrated under reduced pressure to remove methanol, diluted with H2O (20.0 mL), and extracted with ethyl acetate (20.0 mL × 2). The combined organic layers were washed with brine (50.0 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. This residue was purified by preparative HPLC (column: Waters Xbridge 150*25mm*5um; mobile phase: [water (ammonia hydroxide v / v)-ACN]; gradient: 25%~55% B, 10 minutes) to obtain the title compound (280 mg, 37.5%) as a yellow solid, which was confirmed by HPLC (EW49030-20-P1H3) and NMR (EW49030-20-P1C1). 1H NMR(400MHz,DMSO-d6)δ 8.95(s,2H), 8.19-8.02(m,2H), 7.93(dd,J=1.2,8.6Hz,1H), 7.75-7.59(m,2H), 7.49-7.21(m,1H), 6.55-6.38(m,1H), 4.75(br d,J=6.4Hz,2H), 4.33-4.15(m,1H), 3.50-3.46(m,2H), 3.17-3.04(m,2H), 2.35-2.22(m,1H), 1.89-1.80(m,1H), 1.44(s,9H). MS(ES+)m / e 439.1(M+H) + .
[0570] Step 3. (R)-4-(3-aminopyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0571] A mixture of tert-butyl (R)-(1-(3-fluoro-5-((quinoxaline-6-ylmethyl)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (250 mg, 570 μmol, 1.00 equivalent) and HCl / MeOH (2 M, 3.00 mL, 10.5 equivalents) in methanol (3.00 mL) was degassed, purged three times with N2, and then stirred under an N2 atmosphere at 25°C for 12 hours. The reaction mixture was concentrated to obtain a residue, which was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (HCl)-ACN]; gradient: 1%~15% B, 10 minutes) to obtain the title compound (143 mg, 50.6%) as a yellow solid. 1H NMR(400MHz,MeOD)δ 8.93(s,2H), 8.24-8.10(m,3H), 8.01(dd,J=2.0,8.8Hz,1H), 7.71(s,1H), 4.84(d,J=6.0Hz,2H) , 4.30-4.08(m,3H), 3.91-3.81(m,1H), 3.67-3.55(m,1H), 2.66-2.50(m,1H), 2.37-2.23(m,1H). MS(ES+)m / e 339.0(M+H) + .
[0572] Example 49
[0573] (R)-4-(3-aminopyrrolidine-1-yl)-5-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 048) [ka]
[0574] Step 1. tert-butyl (R)-(1-(3-chloro-5-nitropyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0575] To a solution of tert-butyl (R)-pyrrolidine-3-ylcarbamate (965 mg, 5.18 mmol, 1.00 equivalent) in ACN (10.0 mL), K2CO3 (1.79 g, 13.0 mmol, 2.50 equivalent) and 3,4-dichloro-5-nitropyridine (1.00 g, 5.18 mmol, 1.00 equivalent) were added. The mixture was stirred at 60°C for 5 hours, diluted with water (100 mL), and extracted with ethyl acetate (100 mL × 3). The combined organic phase was dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound (1.70 g, crude) as a yellow oil, which was used directly in the next step without further purification. ¹H NMR (400 MHz, DMSO-d6) δ. MS (ES+) m / e 343.1 (M+H) + .
[0576] Step 2. tert-butyl (R)-(1-(3-amino-5-chloropyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0577] The reaction was carried out via flow chemistry. A mixture of tert-butyl (R)-(1-(3-chloro-5-nitropyridine-4-yl)pyrrolidine-3-yl)carbamate (1.80 g, 5.25 mmol, 1.00 equivalent) in THF (18.0 mL) was stirred at 20°C until a clear solution was obtained. The following conditions were used for flow chemistry: H2 back pressure - 1.5 MPa, H2 flow rate - 30 ml / min, fixed bed (1% Pt / C, 3 g), temperature 55°C. The solution was pumped into the reactor at a flow rate of 0.4 mL / min. After 0.75 hours, the reaction was complete. The reaction mixture was concentrated under reduced pressure to obtain the title compound (1.60 g, crude) as a brown oil, which was used directly in the next step without further purification. MS(ES+)m / e 313.0(M+H) + .
[0578] Step 3. tert-butyl (R)-(1-(3-amino-5-chloropyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0579] Quinoxaline-6-carbaldehyde (1.21 g, 7.67 mmol, 1.50 equivalents), tert-butyl (R)-(1-(3-amino-5-chloropyridine-4-yl)pyrrolidine-3-yl)carbamate (1.60 g, 5.12 mmol, 1.00 equivalent), and AcOH (768 mg, 12.8 mmol, 732 μL, 2.50 equivalents) were stirred at 120°C for 12 hours. The mixture was then concentrated under reduced pressure to obtain the title compound (2.40 g, crude) as a yellow oily substance, which was used directly in the next step without further purification. MS(ES+)m / e 453.2(M+H) + .
[0580] Step 4. tert-butyl (R)-(1-(3-chloro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0581] To a solution of tert-butyl (R,E)-(1-(3-chloro-5-((quinoxaline-6-ylmethylene)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (2.40 g, 5.30 mmol, 1.00 equivalent) and NaBH3CN (499 mg, 7.95 mmol, 1.50 equivalent), AcOH (636 mg, 10.6 mmol, 607 μL, 2.00 equivalent) was added in small amounts at 25°C. The mixture was stirred at 25°C for 12 hours, quenched with saturated Na2CO3 (100 mL) aqueous solution, and extracted with ethyl acetate (100 mL × 3). The combined organic phase was dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the crude product. This was purified by reverse-phase HPLC (0.1% FA conditions), freeze-dried, and the title compound (200 mg, 8.30%) was obtained as a yellow solid. MS(ES+)m / e 455.1(M+H) + .
[0582] Step 5. (R)-4-(3-aminopyrrolidine-1-yl)-5-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0583] Tert-butyl (R)-(1-(3-chloro-5-((quinoxaline-6-ylmethyl)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (300 mg, 659 μmol, 1.00 equivalent) was stirred in HCl / MeOH (2 M, 7.50 mL, 22.8 equivalents) at 25°C for 2 hours. The mixture was concentrated under reduced pressure to obtain the crude product, which was purified by preparative HPLC (column: Phenomenex luna C18 150 × 25 mm × 10 μm; mobile phase: [water (HCl)-ACN]; gradient: 1%~20% B, 10 minutes), and lyophilized to obtain the title compound (52.8 mg, 22.3%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.90(s,2H), 8.18-8.12(m,2H), 8.08(s,1H), 7.97(d,J=8.8Hz,1H), 7.81(s,1H), 4.91(br s,1H), 4.84(br s,1H), 4.24-4.08(m,2H), 4.00-3.88(m,1H), 3.74-3.57(m,2H), 2.69-2.58(m,1H), 2.35-2.23(m,1H). MS(ES+)m / e 355.0(M+H) + .
[0584] Example 50
[0585] (R)-4-(3-aminopyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 049) [ka]
[0586] Step 1. tert-butyl (S,E)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0587] AcOH (202 mg, 3.37 mmol, 193 μL, 2.00 equivalent) was added to a solution of tert-butyl (S)-(1-(3-amino-5-fluoropyridine-4-yl)pyrrolidine-3-yl)carbamate (500.00 mg, 1.69 mmol, 1 equivalent) and quinoxaline-6-carbaldehyde (266 mg, 1.69 mmol, 1.00 equivalent) in toluene (10.0 mL). The mixture was stirred at 130 °C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain a residue (736 mg, crude), which was used in the next step without purification. MS(ES+)m / e 437.2(M+H) + .
[0588] Step 2. tert-butyl (S)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0589] To a solution of tert-butyl (S,E)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate (736 mg, 1.69 mmol, 1.00 equivalent) in methanol (7.00 mL), NaBH3CN (211 mg, 3.37 mmol, 2.00 equivalent) and AcOH (50.6 mg, 843 μmol, 48.2 μL, 0.500 equivalent) were added. The mixture was stirred at 25°C for 12 hours. The reaction mixture was concentrated under reduced pressure to remove methanol, diluted with H2O (20.0 mL), and extracted with ethyl acetate (20.0 mL × 2). The combined organic layers were washed with brine (50.0 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Waters Xbridge 150*25mm*5um; mobile phase: [water (ammonia hydroxide v / v)-ACN]; gradient: 25%-55% B, 10 minutes) to obtain the title compound (260 mg, 34.9%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.95(d,J=1.2Hz,2H), 8.17-8.02(m,2H), 7.93(dd,J=1.6,8.8Hz,1H), 7.75-7.60(m,2H), 7.43-7.23(m,1H), 6.54-6.42(m,1H), 4.75(br d,J=6.4Hz,2H), 4.33-4.16(m,1H), 3.52-3.46(m,2H), 3.19-3.04(m,2H), 2.29(dt,J=7.8,13.2Hz,1H), 1.91-1.76(m,1H), 1.44(s,9H). MS(ES+)m / e 439.1(M+H) + .
[0590] Step 3. (S)-4-(3-aminopyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0591] A mixture of tert-butyl (S)-(1-(3-fluoro-5-((quinoxaline-6-ylmethyl)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (260 mg, 592.93 μmol, 1 equivalent), HCl / MeOH (2 M, 3 mL, 10.12 equivalents), and MeOH (3 mL) was degassed and purged three times with N2. The reaction mixture was stirred at 25°C for 12 hours under an N2 atmosphere, then concentrated under reduced pressure to obtain a residue, which was purified by preparative HPLC (column: Phenomenex luna C18 150*25 mm*10 μm; mobile phase: [water (HCl)-ACN]; gradient: 1%~15% B, 10 minutes) to obtain the title compound (76.0 mg, 37.8%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.94(s,2H), 8.20-8.12(m,3H), 8.02(dd,J=2.0,8.6Hz,1H), 7.72-7.68(m,1H), 4.84(d,J=6.8Hz,2H), 4.28- 4.20(m,1H), 4.19-4.10(m,2H), 3.92-3.81(m,1H), 3.64-3.53(m,1H), 2.65-2.49(m,1H), 2.36-2.24(m,1H). MS(ES+)m / e 339.0(M+H) + .
[0592] Example 51
[0593] (S)-4-(3-aminopyrrolidine-1-yl)-5-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 050) [ka]
[0594] Step 1. tert-butyl (S)-(1-(3-chloro-5-nitropyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0595] To a solution of 3,4-dichloro-5-nitropyridine (1.50 g, 7.77 mmol, 1.00 equivalent) in ACN (20.0 mL), K2CO3 (2.15 g, 15.6 mmol, 2.00 equivalent) and tert-butyl (S)-pyrrolidine-3-ylcarbamate (1.45 g, 7.77 mmol, 1.00 equivalent) were added. The mixture was stirred at 60°C for 5 hours, cooled to room temperature, diluted with water (100 mL), and extracted with DCM (200 mL × 3). The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound (3.10 g, crude) as a yellow solid. 1H NMR(400MHz,CDCl3)δ 8.56(s,1H), 8.37(s,1H), 4.93(br d,J=6.4Hz,1H), 3.83(br d,J=4.8Hz,1H), 3.73-3.62(m,1H), 3.61-3.48(m,1H), 3.39(br dd,J=4.0,10.8Hz,1H), 1.47-1.43(m,9H).
[0596] Step 2. tert-butyl (S)-(1-(3-amino-5-chloropyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0597] The reaction was carried out via flow chemistry. A mixture of tert-butyl (S)-(1-(3-chloro-5-nitropyridine-4-yl)pyrrolidine-3-yl)carbamate (3.10 g, 9.04 mmol, 1.00 equivalent) in THF (18.0 mL) was stirred at 20°C until a clear solution was obtained. The following conditions were used for flow chemistry: H2 back pressure - 1.5 MPa, H2 flow rate - 30 ml / min, fixed bed (1% Pt / C, 3 g), temperature 55°C. The solution was pumped into the reactor at a flow rate of 0.4 mL / min. After 1.3 hours, the reaction was complete. The reaction mixture was concentrated under reduced pressure to obtain the title compound (2.50 g, 88.4%) as a brown oil, which was used directly in the next step without purification. 1H NMR(400MHz,DMSO-d6)δ.MS(ES+)m / e 313.0(M+H) + .
[0598] Step 3. tert-butyl (S,E)-(1-(3-chloro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0599] To a solution of tert-butyl (S)-(1-(3-amino-5-chloropyridine-4-yl)pyrrolidine-3-yl)carbamate (2.50 g, 7.99 mmol, 1.00 equivalent) in toluene (25 mL), AcOH (1.20 g, 20.0 mmol, 1.14 mL, 2.50 equivalent) and quinoxaline-6-carbaldehyde (1.26 g, 7.99 mmol, 1.00 equivalent) were added. The mixture was stirred at 130 °C for 12 hours and concentrated to obtain the title compound (3.61 g, crude) as a brown oily substance, which was used directly in the next step without purification. ¹H NMR (400 MHz, DMSO-d6) δ. MS (ES+) m / e 451.2 (M+H) + .
[0600] Step 4. tert-butyl (S)-(1-(3-chloro-5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0601] To a solution of tert-butyl (S,E)-(1-(3-chloro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate (3.60 g, 7.95 mmol, 1.00 equivalent) in MeOH (40.0 mL), NaBH3CN (1.25 g, 19.9 mmol, 2.50 equivalent) and AcOH (1.19 g, 19.9 mmol, 1.14 mL, 2.50 equivalent) were added. The mixture was stirred at 25°C for 2 hours, quenched with NaHCO3, concentrated under reduced pressure to remove MeOH, and extracted with 150 mL (50.0 mL × 3) of ethyl acetate. The combined organic layers were washed with brine (50.0 mL × 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by reverse-phase HPLC (0.1% FA conditions), freeze-dried, and the title compound (0.60 g, 16.6%) was obtained as a brown oily substance. ¹H NMR (400 MHz, DMSO-d6) δ. MS(ES+) m / e 455.1(M+H) + .
[0602] Step 5. (S)-4-(3-aminopyrrolidine-1-yl)-5-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0603] To a solution of tert-butyl (S)-(1-(3-chloro-5-((quinoxaline-6-ylmethyl)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (0.50 g, 1.10 mmol, 1.00 equivalent), HCl / MeOH (2.00 M, 550 μL, 1.00 equivalent) was added. The mixture was stirred at 25°C for 1 hour and concentrated under reduced pressure to obtain MeOH. The crude product was purified by reverse-phase HPLC (column: Phenomenex luna C18 150 × 25 mm × 10 μm; mobile phase: [water (HCl)-ACN]; gradient: 1%~20% B, 10 minutes), and lyophilized to obtain the title compound (120 mg, 30.8%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.92(s,2H), 8.71(br s,3H), 8.16(s,1H), 8.12-8.06(m,2H), 7.97(d,J=9.2Hz,1H), 7.80(s,1H), 4.80(s,2H), 4.02(br s,1H), 3.95-3.85(m,2H), 3.55(br d,J=10.4Hz,1H), 3.35(dt,J=5.6,9.2Hz,1H), 2.45-2.32(m,1H), 2.28-2.16(m,1H). MS(ES+)m / e 355.0(M+H) + .
[0604] Example 52
[0605] (R)-4-(3-(methylamino)pyrrolidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 051) [ka]
[0606] Step 1. tert-butyl(R)-methyl(1-(3-nitropyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0607] A solution of 4-chloro-3-nitropyridine (1.58 g, 9.99 mmol, 1.00 equivalent) and tert-butyl (R)-methyl(pyrrolidine-3-yl)carbamate (2.00 g, 9.99 mmol, 1.00 equivalent) in ACN (15.0 mL) was mixed with K2CO3 (2.76 g, 20.0 mmol, 2.00 equivalent). The mixture was stirred at 60°C for 5 hours and concentrated under reduced pressure to obtain a residue. Water (100 mL) was added to the residue, and the resulting solution was extracted with DCM (200 mL × 3). The combined organic layers were washed with brine (100 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound (2.00 g, crude) as a yellow oil. MS(ES+)m / e 323.1(M+H) + .
[0608] Step 2. tert-butyl (R)-(1-(3-aminopyridine-4-yl)pyrrolidine-3-yl)(methyl)carbamate [ka]
[0609] The reaction was carried out via flow chemistry. A mixture of tert-butyl (R)-methyl(1-(3-nitropyridine-4-yl)pyrrolidine-3-yl)carbamate (2.00 g, 6.20 mmol, 1.00 equivalent) in MeOH (20 mL) was stirred at 20°C until a clear solution was obtained. The following conditions were used for flow chemistry: H2 back pressure - 1.5 MPa, H2 flow rate - 30 ml / min, fixed bed (1% Pt / C, 3 g), temperature 55°C. The solution was pumped into the reactor at a flow rate of 0.4 mL / min. After 0.83 hours, the reaction was complete. The reaction mixture was concentrated under reduced pressure to obtain the title compound (1.80 g, 99.2%) as a brown oil, which was used directly in the next step without purification. MS(ES+)m / e 293.1(M+H) + .
[0610] Step 2. tert-butyl (R,E)-methyl(1-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0611] To a solution of tert-butyl (R)-(1-(3-aminopyridine-4-yl)pyrrolidine-3-yl)(methyl)carbamate (600 mg, 2.05 mmol, 1.00 equivalent) in toluene (10.0 mL), AcOH (308 mg, 5.13 mmol, 294 μL, 2.50 equivalent) and quinoxaline-6-carbaldehyde (325 mg, 2.05 mmol, 1.00 equivalent) were added. The mixture was stirred at 130°C for 12 hours and concentrated under reduced pressure to obtain the title compound (880 mg, 99.1%) as a brown oily substance, which was used directly in the next step without purification. MS(ES+)m / e 433.3(M+H) + .
[0612] Step 3. tert-butyl(R)-methyl(1-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)pyrrolidine-3-yl)carbamate [ka]
[0613] To a solution of tert-butyl (R,E)-methyl(1-(3-((quinoxaline-6-ylmethylene)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (850 mg, 1.97 mmol, 1.00 equivalent) in MeOH (10.0 mL), NaBH3CN (309 mg, 4.91 mmol, 2.50 equivalent) and AcOH (295 mg, 4.91 mmol, 281 μL, 2.50 equivalent) were added. The mixture was stirred at 25°C for 12 hours, quenched with saturated NaHCO3 (50.0 mL), adjusted to pH 7, concentrated under reduced pressure to remove MeOH, and extracted with 150 mL (50.0 mL × 3) of ethyl acetate. The combined organic layers were washed with brine (50.0 mL × 2), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by reverse-phase HPLC (column: Phenomenex luna C18 150 × 40 mm × 15 μm; mobile phase: [water (FA)-ACN]; gradient: 13%~43% B, 15 minutes), and lyophilized to obtain the title compound (330 mg, 36.7%) as brown oil. MS(ES+)m / e 435.1(M+H) + .
[0614] Step 4. (R)-4-(3-(methylamino)pyrrolidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0615] A solution of tert-butyl (R)-methyl(1-(3-((quinoxaline-6-ylmethyl)amino)pyrrolidine-4-yl)pyrrolidine-3-yl)carbamate (330 mg, 759 μmol, 1.00 equivalent) in HCl / MeOH (3 mL) was stirred at 25°C for 12 hours. The reaction mixture was concentrated under reduced pressure to obtain the title compound (280 mg, 99.4%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 14.15(br s,1H), 9.82-9.60(m,2H), 8.93(s,2H), 8.17-8.05(m,2H), 8.03-7.92(m,2H), 7.58(br d,J=4.4Hz,1H), 7.00(d,J=6.4Hz,1H), 6.87-6.65(m,1H), 4.32-4.19(m,1H) , 3.98-3.86(m,3H), 3.42(td,J=6.8,10.2Hz,1H), 2.65-2.57(m,3H), 2.33(br d,J=4.0Hz,2H). MS(ES+)m / e 335.1(M+H) + .
[0616] Example 53
[0617] (S)-4-(3-(methylamino)pyrrolidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 052) [ka]
[0618] The title compound was synthesized following the same procedure as described for the preparation of Example 52 (Compound 051) using appropriate starting materials and intermediates. 1H NMR(400MHz,DMSO-d6)δ 14.21-13.48(m,1H), 9.23-9.01(m,2H), 8.93(s,2H), 8.13-8.07(m,2H), 8.00(d,J= 6.4Hz,1H), 7.93(dd,J=1.6,8.8Hz,1H), 7.62(s,1H), 6.95(d,J=6.8Hz,1H), 6.20(br s,1H), 4.63(br s,2H), 4.14-4.04(m,1H), 4.01-3.85(m,3H), 3.72-3.62(m,1H), 2.69(br s,3H), 2.43-2.31(m,1H), 2.30-2.18(m,1H). MS(ES+)m / e 335.1(M+H) + .
[0619] Example 54
[0620] (R)-N-((8-fluoroquinoxaline-6-yl)methyl)-4-(3-(methylamino)pyrrolidine-1-yl)pyridine-3-amine (compound 053) [ka]
[0621] The title compound was synthesized following the same procedure as described for the preparation of Example 52 (Compound 051) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 13.98 (br s, ¹H), 9.57 (br s, ²H), 9.00 (dd, J=1.6, 16.0 Hz, ²H), 8.02-7.94 (m, ²H), 7.87 (dd, J=1.2, 11.2 Hz, ¹H), 7.60 (s, ¹H), 7.00 (d, J=6.4 Hz, ¹H), 6.75 (br s, ¹H), 4.64 (br d,J=2.4Hz,2H), 4.29-4.19(m,1H), 3.97-3.88(m,3H), 3.44(td,J=6.8,10.4Hz,1H), 2.63(t,J=5.2Hz,3H), 2.33(br d,J=4.4Hz,2H). MS(ES+)m / e 353.0(M+H) + .
[0622] Example 55
[0623] (S)-N-((8-fluoroquinoxaline-6-yl)methyl)-4-(3-(methylamino)pyrrolidine-1-yl)pyridine-3-amine (compound 054) [ka]
[0624] The title compound was synthesized following the same procedure as described for the preparation of Example 52 (Compound 051) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 14.28-13.02 (m, ¹H), 9.11 (br d, J=2.0 Hz, ¹H), 9.00 (dd, J=1.6, 15.2 Hz, ¹H), 8.04-7.98 (m, ¹H), 7.97 (s, ¹H), 7.79 (dd, J=1.2, 11.0 Hz, ¹H), 7.61 (s, ¹H), 6.95 (d, J=6.4 Hz, ¹H), 6.21 (br s, ¹H), 4.61 (br d,J=3.6Hz,2H), 4.18-4.02(m,1H), 4.01-3.87(m,3H), 3.68(ddd,J=5.6,8.0,10.4Hz,1H), 2.69(br s,3H), 2.42-2.31(m,1H), 2.25(td,J=6.0,12.0Hz,1H). MS(ES+)m / e 353.0(M+H) + .
[0625] Example 56
[0626] (R)-4-(3-amino-3-methylpyrrolidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 055) [ka]
[0627] The title compound was synthesized following the same procedure as described for the preparation of Example 52 (Compound 051) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 13.89 (br s, ¹H), 8.99-8.85 (m, ²H), 8.68 (br s, ³H), 8.14-8.07 (m, ²H), 8.01-7.93 (m, ²H), 7.57 (br d, J=3.2 Hz, ¹H), 6.97 (d, J=6.8 Hz, ¹H), 6.71 (br s,1H), 4.72-4.54(m,2H), 4.43-4.29(m,1H), 3.85-3.79(m,1H), 3.76-3.71( m,1H), 3.38-3.29(m,1H), 2.35-2.26(m,1H), 2.20-2.10(m,1H), 1.53(s,3H). MS(ES+)m / e 335.1(M+H) + .
[0628] Example 57
[0629] (S)-4-(3-amino-3-methylpyrrolidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 056) [ka]
[0630] The title compound was synthesized following the same procedure as described for the preparation of Example 52 (Compound 051) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 13.96 (br s, ¹H), 8.93 (s, ²H), 8.71 (br s, ³H), 8.15-8.08 (m, ²H), 8.02-7.94 (m, ²H), 7.57 (br d, J=4.0 Hz, ¹H), 6.97 (d, J=6.4 Hz, ¹H), 6.75 (br d,J=2.4Hz,1H), 4.74-4.58(m,2H), 4.46-4.34(m,1H), 3.85-3.80(m,1H), 3.74(s,1H), 3 .50(dt,J=3.2,9.6Hz,1H), 2.36-2.26(m,1H), 2.14(td,J=8.8,13.2Hz,1H), 1.54(s,3H). MS(ES+)m / e 374.2(M+H) + .
[0631] Example 58
[0632] (R)-4-(3-amino-3-methylpyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 057) [ka]
[0633] The title compound was synthesized following the same procedure as described for the preparation of Example 52 (Compound 051) using appropriate starting materials and intermediates. 1H NMR (400MHz, DMSO-d6) δ 8.93 (s, 2H), 8.24-8.09 (m, 3H), 8.02 (dd, J=2.0, 8.8Hz, 1H), 7.68 (d, J=0.8Hz, 1H), 4.83 (d, J=12.0Hz, 2H), 4.38-4.32 (m, 1H), 3.94 (d, J=4.0Hz, 2H), 3.60-3.53 (m, 1H), 2.48-2.37 (m, 1H), 2.37-2.24 (m, 1H), 1.64 (s, 3H). MS(ES+)m / e 353.0(M+H) + .
[0634] Example 59
[0635] (S)-4-(3-amino-3-methylpyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 058) [ka]
[0636] Step 1. tert-butyl (S)-(1-(3-cyano-5-fluoropyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate [ka]
[0637] To a solution of 4-chloro-5-fluoronicotinonitrile (750 mg, 4.79 mmol, 1.00 equivalent) and tert-butyl (S)-(3-methylpyrrolidine-3-yl)carbamate (959 mg, 4.79 mmol, 1.00 equivalent) in MeCN (7.5 mL), DIEA (1.86 g, 14.3 mmol, 2.50 mL, 3.00 equivalent) was added, and the mixture was stirred at 80°C for 12 hours. The reaction mixture was purified by preparative HPLC (column: Waters Xbridge BEH C18 250*50 mm*10 μm; mobile phase: [water (NH4HCO3)-ACN]; gradient: 20%~50% B, 20 minutes) to obtain the title compound (900 mg, 58.6%) as a yellow solid. (ES+)m / e 321.3(M+H) + .
[0638] Step 2. tert-butyl (S)-(1-(3-carbamoyl-5-fluoropyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate [ka]
[0639] A solution of tert-butyl (S)-(1-(3-cyano-5-fluoropyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate (800 mg, 2.50 mmol, 1.00 equivalent) in MeOH (9 mL) was mixed with a solution of Na2CO3 (540 mg, 5.09 mmol, 2.04 equivalents) in H2O (9 mL) at 25°C. H2O2 (3.00 g, 26.46 mmol, 2.54 mL, 30% purity, 10.6 equivalents) was added at 0°C, and the mixture was stirred at 25°C for 60 hours. The reaction mixture was quenched at 0°C by adding an aqueous solution of Na2SO3 (50 mL), stirred for 30 minutes, diluted with H2O (50 mL), and extracted with ELISA (50 mL × 2). The organic layer was collected and concentrated to obtain a residue, which was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 1 to 1 / 1, TLC: PE / EA = 1 / 1, Rf = 0.79 and 0.1) to obtain the title compound (500 mg, 59.1%) as a white solid. MS(ES+)m / e 321.2(M+H) + .
[0640] Step 3. tert-butyl (S)-(1-(3-amino-5-fluoropyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate [ka]
[0641] To a solution of tert-butyl (S)-(1-(3-carbamoyl-5-fluoropyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate (450 mg, 1.33 mmol, 1.00 equivalent) in ACN (2 mL) and H2O (2 mL), NaOH (159 mg, 3.99 mmol, 3.00 equivalent) and NaClO (1.98 g, 2.66 mmol, 1.64 mL, 10% purity, 2.00 equivalent) were added. The mixture was stirred at 60°C for 2 hours, then poured into ice water (w / w=1 / 1) (50 mL) and stirred for a further 20 minutes. The reaction mixture was extracted with ethyl acetate (50 mL x 2). The combined organic phases were washed with brine (50 mL x 2), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound (430 mg, crude) as a yellow oily substance. This was used in the next step without purification. MS(ES+)m / e 311.2(M+H) + .
[0642] Step 4. tert-butyl (S,E)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate [ka]
[0643] To a solution of tert-butyl (S)-(1-(3-amino-5-fluoropyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate (400 mg, 1.29 mmol, 1.00 equivalent) and quinoxaline-6-carbaldehyde (203 mg, 1.29 mmol, 1.00 equivalent) in toluene (5 mL), AcOH (154 mg, 2.58 mmol, 147 μL, 2.00 equivalent) was added, and the mixture was stirred at 130 °C for 12 hours under an N2 atmosphere. The reaction mixture was then concentrated under reduced pressure to obtain the title compound (580 g, crude) as a brown oily substance, which was used in the next step without purification.
[0644] Step 5. tert-butyl (S)-(1-(3-fluoro-5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate [ka]
[0645] To a solution of tert-butyl (S,E)-(1-(3-fluoro-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate (580 mg, 1.29 mmol, 1.00 equivalent) in MeOH (6 mL), NaBH3CN (161 mg, 2.57 mmol, 2.00 equivalent) and AcOH (38.6 mg, 643.7 μmol, 36.8 μL, 0.50 equivalent) were added. The mixture was stirred at 25°C for 12 hours, concentrated under reduced pressure to remove methanol, diluted with H2O (10 mL), and extracted with ethyl acetate (10 mL × 2). The combined organic layers were washed with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure to obtain the residue. This residue was purified by preparative HPLC (column: Phenomenex luna C18 150 * 40 mm x 15 μm; mobile phase: [water (FA)-ACN]; gradient: 12%~42% B, 15 minutes) to obtain the title compound (140 mg, 24.0%) as a yellow solid. MS(ES+)m / e 453.4(M+H) + .
[0646] Step 6. (S)-4-(3-amino-3-methylpyrrolidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0647] To a solution of tert-butyl (S)-(1-(3-fluoro-5-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)-3-methylpyrrolidine-3-yl)carbamate (140 mg, 309 μmol, 1.00 equivalent) in MeOH (1.00 mL), HCl / MeOH (2 M, 1.65 mL, 10.6 equivalents) was added. The reaction was stirred at 25°C for 12 hours, and the mixture was concentrated under reduced pressure to obtain a residue. This residue was purified by preparative HPLC (column: Phenomenex luna C18 150 x 25 mm x 10 μm; mobile phase: [water (HCl)-ACN]; gradient: 1%~20% B, 10 minutes) to obtain the title compound (80.0 mg, 73.2%) as a yellow solid. 1H NMR(400MHz,MeOD-d6)δ 8.92(s,2H), 8.18-8.11(m,3H), 8.00(dd,J=2.0,8.8Hz,1H), 7.68(s,1H), 4.82(br d,J=12.0Hz,2H), 4.37-4.30(m,1H), 3.99-3.86(m,2H), 3.60-3.54(m,1H), 2.48-2.36(m,1H), 2.36-2.23(m,1H), 1.64(s,3H). MS(ES+)m / e 351.3(M+H) + .
[0648] Example 60
[0649] (S)-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine (compound 059) [ka]
[0650] Step 1. (S)-N-(1-methylpyrrolidine-3-yl)-3-nitropyridine-4-amine [ka]
[0651] A solution of 4-chloro-3-nitropyridine (0.80 g, 5.05 mmol, 1.00 equivalent) and (S)-1-methylpyrrolidine-3-amine (505 mg, 5.05 mmol, 1.00 equivalent) in ACN (10.0 mL) was mixed with K2CO3 (1.05 g, 7.57 mmol, 1.50 equivalent). The mixture was stirred at 60°C for 2 hours, diluted with DCM (200 mL), and filtered. The mother liquor was concentrated under reduced pressure to obtain the title compound (650 mg, 58.0%) as a yellow oily substance. MS(ES+)m / e 223.3(M+H) + .
[0652] Step 2. (S)-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine [ka]
[0653] To a solution of (S)-N-(1-methylpyrrolidine-3-yl)-3-nitropyridine-4-amine (0.60 g, 2.70 mmol, 1.00 equivalent) in THF (10.0 mL), 10% Pd / C (287 mg, 270 μmol, 0.10 equivalent) was added under N2. The suspension was degassed under vacuum and purged several times with H2. The mixture was stirred under H2 (50 psi) at 40°C for 12 hours and filtered. The filtrate was concentrated under reduced pressure to obtain the title compound (0.6 g, crude) as a yellow oil, which was used directly in the next reaction without purification. 1H NMR(400MHz,DMSO-d6)δ 7.61(s,1H), 7.56(d,J=5.2Hz,1H), 6.29(d,J=5.2Hz,1H), 5.28(br d,J=6.8Hz,1H), 4.64(s,2H), 3.97-3.87(m,1H), 2.70(dd,J=6.8,9.2Hz,1H), 2.6 0(dt,J=5.2,8.0Hz,1H), 2.43-2.32(m,2H), 2.29-2.17(m,4H), 1.67-1.56(m,1H).
[0654] Step 3. (S,E)-N-(1-methylpyrrolidine-3-yl)-3-((quinoxaline-6-ylmethylene)amino)pyridine-4-amine [ka]
[0655] A solution of (S)-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine (0.30 g, 1.56 mmol, 1.00 equivalent), quinoxaline-6-carbaldehyde (292 mg, 1.87 mmol, 1.20 equivalents), and AcOH (234 mg, 3.90 mmol, 223 μL, 2.50 equivalents) in toluene (10.0 mL) was stirred at 120 °C for 12 hours using a Dean-Stark water trap. The mixture was then concentrated under reduced pressure to obtain the title compound (0.52 mg, crude) as a yellow oil, which was used directly in the next step without purification. MS(ES+)m / e 333.3(M+H) + .
[0656] Step 4. (S)-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine [ka]
[0657] (S,E)-N-(1-methylpyrrolidine-3-yl)-3-((quinoxaline-6-ylmethylene)amino)pyridine-4-amine (0.52 g, 1.56 mmol, 1.00 equivalent) and AcOH (141 mg, 2.35 mmol, 134 μL, 1.50 equivalent) were dissolved in MeOH (10.0 mL), to which NaBH3CN (197 mg, 3.13 mmol, 2.00 equivalent) was added in small amounts at 25°C. The mixture was stirred at 25°C for 3 hours. The mixture was then quenched with saturated Na2CO3 (100 mL), filtered, and concentrated under vacuum to obtain the crude product. This crude product was purified by reverse-phase HPLC (0.1% FA conditions), lyophilized, and the title compound (300 mg, 57.3%) was obtained as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.94-8.89(m,2H), 8.09(d,J=8.8Hz,1H), 8.04(s,1H), 7.88(dd,J=2.0,8.8H z,1H), 7.60(d,J=5.2Hz,1H), 7.48(s,1H), 6.35(d,J=5.2Hz,1H), 5.69(t,J=5 .6Hz,1H), 5.57(d,J=6.4Hz,1H), 4.61(d,J=5.6Hz,2H), 4.05-3.87(m,1H), 2. 75-2.61(m,2H), 2.46(d,J=4.4Hz,1H), 2.40-2.23(m,5H), 1.72-1.61(m,1H). MS(ES+)m / e 335.2(M+H) + .
[0658] Example 61
[0659] (R)-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine (compound 060) [ka]
[0660] The title compound was synthesized following the same procedure as described for the preparation of Example 60 (Compound 059) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 13.47 (br s, ¹H), 10.32 (br s, ¹H), 8.94 (s, ²H), 8.13 (d, J=8.8 Hz, ¹H), 8.08 (s, ¹H), 7.96 (br d, J=6.4 Hz, ¹H), 7.88 (dd, J=1.6, 8.8 Hz, ¹H), 7.67-7.29 (m, ²H), 6.89 (d, J=6.8 Hz, ¹H), 6.70-6.43 (m, ¹H), 4.73 (br d,J=4.4Hz,2H), 4.66-4.41(m,1H), 4.18-3.72(m,2H), 3.28-3.07(m,2H), 2.92(br s,3H), 2.48-2.36(m,1H), 2.24-1.98(m,1H). MS(ES+)m / e 335.2(M+H) + .
[0661] Example 62
[0662] (S)-5-Fluoro-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine (compound 061) [ka]
[0663] Step 1. (S)-3-bromo-5-fluoro-N-(pyrrolidine-3-yl)pyridine-4-amine [ka]
[0664] To a solution of tert-butyl (S)-3-((3-bromo-5-fluoropyridine-4-yl)amino)pyrrolidine-1-carboxylate (4.00 g, 11.1 mmol, 1.00 equivalent) in MeOH (5 mL), HCl / MeOH (2 M, 50 mL, 9.01 equivalents) was added. The reaction mixture was stirred at 25°C for 12 hours, then concentrated under reduced pressure to obtain the title compound (3.29 g, crude) as a yellow solid. MS(ES+)m / e 260(M+H) + .
[0665] Step 2. (S)-3-bromo-5-fluoro-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine [ka]
[0666] A solution of (S)-3-bromo-5-fluoro-N-(pyrrolidine-3-yl)pyridine-4-amine (3.29 g, 12.6 mmol, 1.00 equivalent), HCHO (3.08 g, 37.9 mmol, 2.83 mL, 3.00 equivalent), and AcOH (7.60 g, 126 mmol, 7.24 mL, 10.0 equivalent) in MeOH (50 mL) was added to a solution of 2-methylpyridineborane complex (1.49 g, 13.9 mmol, 1.10 equivalent) in MeOH (50 mL). The reaction was stirred at 25°C for 20 minutes, concentrated under reduced pressure, and the solvent was removed. The crude product was purified by reverse-phase HPLC (0.1% FA conditions) to obtain the title compound (2.50 g, 72.1%) as a colorless oil. MS(ES+)m / e 274(M+H) + .
[0667] Step 3. (S)-5-fluoro-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine [ka]
[0668] To a solution of (S)-3-bromo-5-fluoro-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine (200 mg, 729 μmol, 1.00 equivalent) and quinoxaline-6-ylmethaneamine (232 mg, 1.46 mmol, 2.00 equivalent) in dioxane (5 mL), Cs2CO3 (594 mg, 1.82 mmol, 2.50 equivalent) and BrettPhos Pd G3 (66.1 mg, 72.9 μmol, 0.10 equivalent) were added. The mixture was stirred under N2 at 100°C for 1 hour and partitioned between H2O (20 mL) and siRNA (20 mL). The organic phase was separated, washed with brine (30 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150 x 25 mm x 10 μm; mobile phase: [water (TFA)-ACN]; gradient: 5%~25% B, 18 minutes) to obtain the title compound (31.2 mg, 9.14%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.88(s,2H), 8.13-8.06(m,3H), 7.92(dd,J=2.0,8.8Hz,1H), 7.51(d,J=0.8Hz,1H), 5.06(br s,1H), 4.76(s,2H), 3.79(br s,4H), 3.02(s,3H), 2.70(br s,1H), 2.41-2.37(m,1H). MS(ES+)m / e 353.2(M+H) + .
[0669] Example 63
[0670] (R)-5-Fluoro-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine (compound 062) [ka]
[0671] Step 1. (R)-3-bromo-5-fluoro-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine [ka]
[0672] To a solution of 3-bromo-4-chloro-5-fluoropyridine (4.20 g, 19.9 mmol, 1.00 equivalent) and (R)-1-methylpyrrolidine-3-amine (2.00 g, 19.9 mmol, 1.00 equivalent) in DMSO (50 mL), DIEA (5.16 g, 39.9 mmol, 6.95 mL, 2.00 equivalent) and CsF (6.06 g, 39.9 mmol, 2.00 equivalent) were added. The mixture was stirred at 140°C for 12 hours, poured into ice water (w / w=1 / 1) (500 mL), stirred for a further 20 minutes, and extracted with ethyl acetate (500 mL x 2). The combined organic layers were washed with brine (500 mL x 2), dried over anhydrous Na2SO4, filtered, and concentrated to obtain the residue. The residue was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 10 / 1 to 1 / 1, TLC: petroleum ether / ethyl acetate = 1 / 1, product Rf = 0.43) to obtain the title compound (1.30 g, 23.7%) as a yellow oily substance. MS(ES+)m / e 274.1(M+H) + .
[0673] Step 2. (R)-3-((diphenylmethylene)amino)-5-fluoro-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine [ka]
[0674] To a solution of (R)-3-bromo-5-fluoro-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine (1.25 g, 4.56 mmol, 1.00 equivalent) and diphenylmethaneimine (991 mg, 5.47 mmol, 918 μL, 1.20 equivalents) in toluene (10 mL), Pd2(dba)3 (208 mg, 227 μmol, 0.05 equivalents), BINAP (283 mg, 455 μmol, 0.1 paint), and t-BuONa (1.10 g, 11.4 mmol, 2.50 equivalents) were added. The mixture was stirred at 110°C for 12 hours, poured into water (100 mL), and extracted with ethyl acetate (100 mL x 2). The combined organic layers were washed with brine (100 mL), dried over anhydrous Na₂SO₄, filtered, and concentrated under reduced pressure to obtain a residue. This residue was purified by reverse-phase HPLC (0.1% FA conditions) to obtain the title compound (0.24 g, 14.0%) as a yellow oil. MS(ES+)m / e 375.1(M+H) + .
[0675] Step 3. (R)-5-fluoro-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine [ka]
[0676] To a solution of (R)-3-((diphenylmethylene)amino)-5-fluoro-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine (195 mg, 521 μmol, 1.00 equivalent) in MeOH (5 mL), NH2OH ·HCl (54.3 mg, 781 μmol, 1.50 equivalent) and AcONa (128 mg, 1.56 mmol, 3.00 equivalent) were added. The reaction was stirred at 25°C for 2 hours, then concentrated under reduced pressure, and the solvent was removed. The residue was purified by preparative HPLC (column: Waters Atlantis T3 150 x 30 mm x 5 μm; mobile phase: [water (FA)-ACN]; gradient: 1%~10% B, 9 minutes) to obtain the title compound (109 mg, 441 μmol, 84.8% yield, HCl) as a yellow oil. MS(ES+)m / e 211.1(M+H) + .
[0677] Step 4. (R,E)-3-fluoro-N-(1-methylpyrrolidine-3-yl)-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-amine [ka]
[0678] To a solution of (R)-5-fluoro-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine (100 mg, 475 μmol, 1.00 equivalent) and quinoxaline-6-carbaldehyde (75.2 mg, 475.6 μmol, 1.00 equivalent) in toluene (5 mL), AcOH (57.1 mg, 951.2 μmol, 54.4 μL, 2.00 equivalent) was added. The mixture was stirred at 110 °C for 12 hours, concentrated under reduced pressure, and the solvent was removed to obtain the title compound (166 mg, 99.6%) as a yellow oily substance. MS(ES+)m / e 351.2(M+H) + .
[0679] Step 5. (R)-5-fluoro-N4-(1-methylpyrrolidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine [ka]
[0680] (R,E)-3-fluoro-N-(1-methylpyrrolidine-3-yl)-5-((quinoxaline-6-ylmethylene)amino)pyridine-4-amine (166 mg, 473 μmol, 1.00 equivalent) and AcOH (14.2 mg, 236 μmol, 13.5 μL, 0.50 equivalent) were dissolved in MeOH (5 mL), to which NaBH3CN (59.5 mg, 947 μmol, 2.00 equivalent) was added. The reaction was stirred at 25 °C for 5 hours, concentrated under reduced pressure, and the solvent was removed. The residue was purified by preparative HPLC (column: Phenomenex luna C18 150 x 25 mm x 10 μm; mobile phase: [water (TFA)-ACN]; gradient: 0%~25% B, 18 minutes) to obtain the title compound (25.5 mg, 11.5%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.89(s,2H), 8.16-8.06(m,3H), 7.93(dd,J=2.0,8.8Hz,1H), 7.53(s,1H), 5.05(br s,1H), 4.77(s,2H), 3.92(br s,2H), 3.60-3.43(m,2H), 3.02(s,3H), 2.76(br s,1H), 2.38(br s,1H). MS(ES+)m / e 353.1(M+H) + .
[0681] Example 64
[0682] (S)-N3-((8-fluoroquinoxaline-6-yl)methyl)-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine (compound 063) [ka]
[0683] Step 1. (S,E)-3-(((8-fluoroquinoxaline-6-yl)methylene)amino)-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine [ka]
[0684] A solution of (S)-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine (560 mg, 2.91 mmol, 1.00 equivalent), 8-fluoroquinoxaline-6-carbaldehyde (616 mg, 3.50 mmol, 1.20 equivalent), and AcOH (262 mg, 4.37 mmol, 250 μL, 1.50 equivalent) in toluene (10.0 mL) was stirred at 120 °C for 2 hours using a Dean-Stark water trap. The mixture was concentrated under reduced pressure to obtain the title compound (1.10 g, crude) as a yellow oil, which was used directly in the next reaction without purification. MS(ES+)m / e 351.2(M+H) + .
[0685] Step 2. (S)-N3-((8-fluoroquinoxaline-6-yl)methyl)-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine [ka]
[0686] AcOH (270 mg, 4.49 mmol, 257 μL, 1.50 equivalents) was added in small amounts at 25°C to a mixture of (S,E)-3-(((8-fluoroquinoxalin-6-yl)methylene)amino)-N-(1-methylpyrrolidine-3-yl)pyridine-4-amine (1.05 g, 3.00 mmol, 1.00 equivalent) and NaBH3CN (377 mg, 5.99 mmol, 2.00 equivalent) in MeOH (15.0 mL). The mixture was stirred at 25°C for 18 hours, quenched with saturated Na2CO3 (100 mL), filtered, and concentrated under reduced pressure to obtain the residue. This residue was purified by reverse-phase HPLC (0.1% FA conditions), lyophilized, and a yellow solid was obtained. This was further purified by preparative HPLC (column: Phenomenex luna C18 150 × 40 mm × 15 um; mobile phase: [water (TFA) - ACN]; gradient: 0%~22% B, 15 minutes) to obtain the title compound (174.93 mg, yield 12.34%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 13.50(br s,1H), 10.40(br s,1H), 9.02(d,J=1.6Hz,1H), 8.99(d,J=1.6Hz,1H), 7.97(br d,J=6.4Hz,1H), 7.94(s,1H), 7.77-7.70(m,1H), 7.67-7.32(m,2H), 6.90(d,J=6.4Hz,1H), 6.62(br s,1H), 4.82-4.42(m,3H), 4.22-4.01(m,1H), 3.88-3.58(m,2H), 3.25-3.07(m,2H), 2.92(br s,3H), 2.78-2.53(m,1H), 2.29-2.04(m,1H). MS(ES+)m / e 353.0(M+H) + .
[0687] Example 65
[0688] (R)-N3-((8-fluoroquinoxaline-6-yl)methyl)-N4-(1-methylpyrrolidine-3-yl)pyridine-3,4-diamine (compound 064) [ka]
[0689] The title compound was synthesized following the same procedure as described for the preparation of Example 64 (Compound 063) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 13.87-13.21 (m, ¹H), 10.72-10.15 (m, ¹H), 9.02 (d, J=1.2 Hz, ¹H), 8.99 (d, J=1.6 Hz, ¹H), 7.97 (br d, J=6.4 Hz, ¹H), 7.94 (s, ¹H), 7.74 (br d, J=10.4 Hz, ¹H), 7.67-7.38 (m, ¹H), 6.90 (d, J=6.8 Hz, ¹H), 6.63 (br d, J=2.8 Hz, ¹H), 4.71 (br d,J=3.6Hz,2H), 4.67-4.40(m,1H), 4.23-3.76(m,2H), 3.32-3.12(m,2H), 2.92(br s,3H), 2.79-2.60(m,1H), 2.30-2.08(m,1H). MS(ES+)m / e 353.1(M+H) + .
[0690] Example 66
[0691] N4-(1-methylazetidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine (compound 065) [ka]
[0692] Step 1. tert-butyl 3-((3-nitropyridine-4-yl)amino)azetidine-1-carboxylate [ka]
[0693] To a solution of 4-chloro-3-nitropyridine (920 mg, 5.81 mmol, 1.00 equivalent) and tert-butyl 3-aminoazetidine-1-carboxylate (1.00 g, 5.81 mmol, 1.00 equivalent) in ACN (20.0 mL), K2CO3 (1.61 g, 11.6 mmol, 2.00 equivalent) was added. The mixture was stirred at 60°C for 5 hours, diluted with water (100 mL), and extracted with DCM (200 mL × 3). The combined organic layer was washed with brine (100 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound (1.5 g, crude) as a brown oil, which was used directly in the next step without further purification.
[0694] Step 2. N-(azetidine-3-yl)-3-nitropyridine-4-amine [ka]
[0695] To a solution of tert-butyl 3-((3-nitropyridine-4-yl)amino)azetidine-1-carboxylate (1.10 g, 3.74 mmol, 1.00 equivalent) in DCM (10.0 mL), TFA (7.68 g, 67.3 mmol, 5.00 mL, 18.0 equivalent) was added at 20°C. The mixture was stirred at 20°C for 1 hour and concentrated under vacuum to obtain a yellow oily substance. This was made basic by treatment with a basic resin (10 g) and filtered. The filtrate was concentrated under reduced pressure to obtain the title compound (0.7 g, 96.4%) as a yellow oily substance, which was used directly in the next reaction. MS(ES+)m / e 195.2(M+H) + .
[0696] Step 3. N-(1-methylazetidine-3-yl)-3-nitropyridine-4-amine [ka]
[0697] To a solution of N-(azetidine-3-yl)-3-nitropyridine-4-amine (1.00 g, 5.15 mmol, 1.00 equivalent) in MeOH (10.0 mL), NaBH3CN (647 mg, 10.3 mmol, 2.00 equivalent) and HCHO (1.55 g, 51.5 mmol, 1.42 mL, 10.0 equivalent) were added. The mixture was stirred at 25°C for 2 hours and filtered. The filtrate was concentrated under reduced pressure to obtain the title compound (400 mg, 37.3%) as a brown oily substance, which was used directly in the next step without purification. 1H NMR(400MHz,DMSO-d6)δ 9.05-9.01(m,1H), 8.32-8.25(m,2H), 6.84(d,J=6.0Hz,1H), 4.29-4.22(m,1H), 3.70-3.64(m,2H), 3.02(t,J=6.8Hz,2H), 2.26(s,3H).
[0698] Step 4. N4-(1-methylazetidine-3-yl)pyridine-3,4-diamine [ka]
[0699] To a solution of N-(1-methylazetidine-3-yl)-3-nitropyridine-4-amine (0.40 g, 1.92 mmol, 1.00 equivalent) in MeOH (5.00 mL) and THF (5.00 mL), 28% NH3.H2O (481 mg, 3.84 mmol, 528 μL, 2.00 equivalent) and 10% Pd / C (204 mg, 192 μmol, 0.10 equivalent) were added under N2 conditions. The suspension was degassed under vacuum and purged several times with H2. The mixture was stirred under H2 (50 psi) at 40°C for 12 hours and filtered. The filtrate was concentrated under reduced pressure to obtain the title compound (0.35 g, crude) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 7.64(s,1H), 7.55(d,J=5.2Hz,1H), 6.18(d,J=5.2Hz,1H), 5.63(br d,J=6.4Hz,1H), 4.62(s,2H), 3.99-3.89(m,1H), 3.69-3.60(m,2H), 2.86-2.77(m,2H), 2.25(s,3H).
[0700] Step 5. N4-(1-methylazetidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine [ka]
[0701] To a solution of quinoxaline-6-carbaldehyde (244 mg, 1.54 mmol, 1.10 equivalents) and N4-(1-methylazetidine-3-yl)pyridine-3,4-diamine (0.25 g, 1.40 mmol, 1.00 equivalent) in THF (10 mL), Ti(i-PrO)4 (797 mg, 2.81 mmol, 828 μL, 2.00 equivalents) was added. The mixture was stirred at 50°C for 2 hours and then cooled to 20°C. NaBH4 (0.07 g, 1.85 mmol, 1.32 equivalents) was added in small amounts, and the resulting mixture was stirred at 20°C for 2 hours. The reaction mixture was quenched at 20°C by adding saturated NH4Cl (5.00 mL), diluted with H2O (20.0 mL), and extracted with DCM / MeOH (5:1, 25 mL × 4). The combined organic layer was dried over Na2SO4, filtered, and concentrated under reduced pressure to obtain the residue. This residue was purified by preparative HPLC (column: Waters Xbridge 150 × 25 mm × 5 μm; mobile phase: [water (ammonium hydroxide v / v) - ACN]; gradient: 13%~43% B, 10 minutes), lyophilized, and the title compound (77.82 mg, 17.3%) was obtained as a yellow solid. ¹H NMR (400 MHz, DMSO-d6)δ 8.93-8.89(m,2H), 8.09(d,J=8.8Hz,1H), 8.05(s,1H), 7.89(dd,J=2.0,8.8Hz,1H), 7.59(d,J=5.2Hz,1H), 7.51(s,1H), 6.24(d,J=5.2Hz,1H), 5.92(d,J=6.0Hz,1H), 5.60(t,J=5.6Hz,1H), 4.62(d,J=5.6Hz,2H), 4.06-3.91(m,1H), 3.68(t,J=7.2Hz,2H), 2.97-2.78(m,2H), 2.27(s,3H). MS(ES+)m / e 351.1(M+H) + .
[0702] Example 67
[0703] 5-Fluoro-N4-(1-methylazetidine-3-yl)-N3-(quinoxaline-6-ylmethyl)pyridine-3,4-diamine (compound 066) [ka]
[0704] The title compound was synthesized following the same procedure as described for the preparation of Example 66 (Compound 065) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 10.41 (s, ¹H), 8.93 (s, ²H), 8.22-8.04 (m, ²H), 7.97-7.83 (m, ¹H), 7.34 (s, ¹H), 6.87 (s, ¹H), 5.00-4.71 (m, ³H), 4.63-4.13 (m, ⁴H), 2.93 (s, ³H). MS(ES+) m / e: 339.1 (M+H). + .
[0705] Example 68
[0706] 4-(3-amino-3-methylazetidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 067) [ka]
[0707] The title compound was synthesized following the same procedure as described for the preparation of Example 49 (Compound 048) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 13.80 (br d, J=5.6 Hz, 1H), 8.93 (s, 2H), 8.73 (br s, 2H), 8.13-8.06 (m, 2H), 7.97 (d, J=6.4 Hz, 1H), 7.90 (dd, J=1.6, 8.8 Hz, 1H), 7.57 (s, 1H), 6.70 (d, J=6.4 Hz, 1H), 6.06 (br s, 1H), 4.61 (br d, J=3.6 Hz, 2H), 4.54-4.45 (m, 4H), 1.66 (s, 3H). MS(ES+)m / e 321.1(M+H) + .
[0708] Example 69
[0709] 4-(3-amino-3-methylazetidine-1-yl)-5-fluoro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 068) [ka]
[0710] The title compound was synthesized following the same procedure as described for the preparation of Example 59 (Compound 058) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 8.91-8.87 (m, 2H), 8.15-8.08 (m, 3H), 7.93 (dd, J=2.0, 8.8 Hz, ¹H), 7.59 (s, 1H), 4.88-4.86 (m, 2H), 4.81-4.75 (m, 2H), 4.63 (s, 3H), 1.74 (s, 3H). MS(ES+) m / e: 339.2 (M+H). + .
[0711] Example 70
[0712] 4-(3-amino-3-methylazetidine-1-yl)-5-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 069) [ka]
[0713] The title compound was synthesized following the same procedure as described for the preparation of Example 49 (Compound 048) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 8.90 (s, 2H), 8.16-8.05 (m, 3H), 7.92 (dd, J=2.0, 8.8 Hz, ¹H), 7.60 (s, 1H), 5.05-4.97 (m, 2H), 4.97-4.92 (m, 2H), 4.60 (s, 2H), 1.72 (s, 3H). MS (ES+) m / e: 355.0 (M+H) + .
[0714] Example 71
[0715] 4-(3-aminoazetidine-1-yl)-5-chloro-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 070) [ka]
[0716] The title compound was synthesized following the same procedure as described for the preparation of Example 49 (Compound 048) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 8.94 (s, 2H), 8.72 (br s, 2H), 8.17 (s, 1H), 8.13-8.06 (m, 2H), 7.91 (dd, J=2.0, 8.4 Hz, 1H), 7.52 (s, 1H), 6.31 (br t, J=5.2 Hz, 1H), 5.19-5.06 (m, 2H), 4.87 (dd, J=4.8, 10.4 Hz, 2H), 4.58 (br d, J=4.8 Hz, 2H), 4.05 (br s, 1H). MS(ES+)m / e 341.1(M+H) + .
[0717] Example 72
[0718] 4-(3-(methylamino)azetidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 071) [ka]
[0719] The title compound was synthesized following the same procedure as described for the preparation of Example 49 (Compound 048) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6)δ 9.53-9.26(m,1H), 8.94(s,2H), 8.11(d,J=8.8Hz,1H), 8.07(d,J=1.2Hz,1 H), 7.99-7.95(m,1H), 7.90(dd,J=2.0,8.7Hz,1H), 7.53(s,1H), 6.67(d,J= 6.8Hz,1H), 6.06(t,J=5.6Hz,1H), 4.76(dd,J=8.4,10.4Hz,2H), 4.62(d,J =5.2Hz,2H), 4.52(dd,J=4.8,10.6Hz,2H), 4.26-4.16(m,1H), 2.66(s,3H). MS(ES+)m / e 321.2(M+H) + .
[0720] Example 73
[0721] 5-Fluoro-4-(3-(methylamino)azetidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 072) [ka]
[0722] The title compound was synthesized following the same procedure as described for the preparation of Example 59 (Compound 058) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 8.91-8.86 (m, 2H), 8.15-8.08 (m, 3H), 7.93 (dd, J=2.0, 8.8 Hz, ¹H), 7.58 (s, 1H), 5.11-5.07 (m, 2H), 4.89-4.82 (m, 2H), 4.63 (s, 2H), 4.29-4.18 (m, 1H), 2.80 (s, 3H). MS(ES+) m / e: 339.1 (M+H). + .
[0723] Example 74
[0724] 5-Chloro-4-(3-(methylamino)azetidine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 073) [ka]
[0725] The title compound was synthesized following the same procedure as described for the preparation of Example 49 (Compound 048) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ: 9.42-9.04 (m, 2H), 8.94 (s, 2H), 8.15-8.00 (m, 3H), 7.89 (dd, J=1.6, 8.8 Hz, 1H), 7.57 (s, 1H), 6.02 (br s, 1H), 5.12-4.90 (m, 2H), 4.85-4.72 (m, 2H), 4.57 (br d, J=4.4 Hz, 2H), 4.04 (br s, 1H), 2.65 (s, 3H). MS (ES+) m / e: 355.0 (M+H) + .
[0726] Example 75
[0727] 4-(4-(2-fluoroethyl)piperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 074) [ka]
[0728] The title compound was synthesized following the same procedure as described for the preparation of Example 60 (Compound 059) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, D2O)δ 9.08(s,2H), 8.31(d,J=8.6Hz,1H), 8.15-8.23(m,2H), 8.11(dd,J=8.8,1 .6Hz,1H), 7.88(s,1H), 7.60(d,J=6.4Hz,1H), 5.15-5.20(m,1H), 5.03-5 .09(m,2H), 4.99-5.02(m,2H), 4.17-4.33(m,2H), 4.00-4.14(m,2H), 3.8 9-3.95(m,1H), 3.83-3.88(m,1H), 3.68-3.81(m,2H), 3.47-3.65(m,2H). MS(ES+)m / e 367.3(M+H) + .
[0729] Example 76
[0730] 4-(4-cyclopropylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 075) [ka]
[0731] Step 1: tert-butyl 4-(3-nitropyrimidine-4-yl)piperazine-1-carboxylate [ka]
[0732] To a mixture of 4-chloro-3-nitropyridine (500 g, 3.15 mol, 1.00 equivalent) and tert-butylpiperazine-1-carboxylate (587.4 g, 3.15 mol, 1.00 equivalent) in i-PrOH (4.00 L), DIEA (1.02 kg, 7.88 mol, 1.37 L, 2.50 equivalent) was added dropwise over 30 minutes at 10°C. The reaction mixture was heated to 85°C, stirred for 8 hours, diluted with MTBE (4.00 L), and stirred for another 30 minutes. The suspension was filtered, and the solid was washed with MTBE (2.00 L × 2) to obtain the title compound (3.00 kg, 77.13%) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ 8.79(s,1H), 8.38(d,J=6.4Hz,1H), 7.17(d,J=6.4Hz,1H), 3.55-3.39(m,4H), 3.32-3.19(m,4H), 1.42(s,9H). MS(ES+)m / e 309.1(M+H) + . Step 2. tert-butyl 4-(3-aminopyridine-4-yl)piperazine-1-carboxylate [ka]
[0733] To a solution of tert-butyl 4-(3-nitropyridine-4-yl)piperazine-1-carboxylate (400 g, 1.30 mol, 1.00 equivalent) in MeOH (7.00 L), Pt-V / C (80.0 g) was added in small amounts at 25°C. The mixture was stirred under H2 (150 Psi) at 25°C for 16 hours and filtered. The filtrate was concentrated under reduced pressure to obtain the crude product, which was tritulated with EtOH / H2O (1 / 10, 5.00 L) at 25°C for 1 hour to obtain the title compound (2.00 kg, 74.1%) as a white solid. 1H NMR(400MHz,DMSO-d6)δ 7.94(s,1H), 7.74(d,J=5.2Hz,1H), 6.76(d,J=5.2Hz,1H), 4.84(s,2H), 3.59-3.41(m,4H), 2.92-2.73(m,4H), 1.42(s,9H). MS(ES+)m / e 279.1(M+H) + .
[0734] Step 3. tert-butyl (E)-4-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)piperazine-1-carboxylate [ka]
[0735] To a mixture of tert-butyl 4-(3-aminopyridine-4-yl)piperazine-1-carboxylate (500 g, 1.80 mol, 1.00 equivalent) in MeOH (3.00 L), AcOH (53.9 g, 898 mmol, 51.4 mL, 0.50 equivalent) was added dropwise over 30 minutes. The mixture was stirred at 25°C for 1 hour, followed by the addition of quinoxaline-6-carbaldehyde (284 g, 1.80 mol, 1.00 equivalent). The reaction mixture was heated to 45°C and stirred for 7 hours. The mixture was filtered at 45°C, washed with MeOH (1.00 L × 2), and the filtered cake was dried under vacuum to obtain the title compound (2.00 kg, 66.5%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 9.03(dd,J=2.0,8.4Hz,2H), 8.89(s,1H), 8.58(d,J=1.6Hz,1H), 8.47(dd,J=2 .0,8.8Hz,1H), 8.29-8.19(m,2H), 8.14(s,1H), 6.93(d,J=5.6Hz,1H), 3.46(br d,J=5.2Hz,4H), 3.33-3.29(m,4H), 1.40(s,9H). MS(ES+)m / e 419.2(M+H) + .
[0736] Step 4. tert-butyl 4-(3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)piperazine-1-carboxylate [ka]
[0737] To a mixture of tert-butyl (E)-4-(3-((quinoxaline-6-ylmethylene)amino)pyridine-4-yl)piperazine-1-carboxylate (350 g, 836.3 mmol, 1.00 equivalent) in MeOH (300 mL) and EtOH (1500 mL), NaBH4 (32.3 g, 853.2 mmol, 1.02 equivalent) was added in small amounts at 30°C. The mixture was stirred at 30°C for 4 hours, quenched with NH4Cl aqueous solution (10.0 L), and filtered. The solid was washed with water (2.00 L × 2), dried in an oven under an N2 atmosphere, and triturated with siRNA (2.00 L) at 25°C for 1 hour to obtain the title compound (700 g, 38.0%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.91(s,2H), 8.09(d,J=8.8Hz,1H), 8.02(s,1H), 7.90(dd,J=0.8,8.8Hz,1H), 7.79(d,J=5.2Hz,1H), 7.73(s,1H), 6.88(d,J=5.2Hz,1H), 5.86(br t,J=6.0Hz,1H), 4.70(br d,J=5.6Hz,2H), 3.59(br s,4H), 2.93(br s,4H), 1.44(s,9H). MS(ES+)m / e 421.1(M+H) + .
[0738] Step 5. 4-(piperazin-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine HCl salt [ka]
[0739] To a mixture of tert-butyl 4-(3-((quinoxaline-6-ylmethyl)amino)pyridine-4-yl)piperazine-1-carboxylate (175 g, 416.2 mmol, 1.00 equivalent) in MeOH (1.00 L), HCl / MeOH (4 M, 1.04 L, 10.0 equivalent) was added at 25°C. The mixture was stirred at 25°C for 0.5 hours, filtered, and washed with MeOH (1.00 L × 2). The cake was dried in vacuum to obtain the product. The product was then dissolved in H2O (2.00 L), the mixture was stirred at 45°C for 1 hour, and freeze-dried to obtain the title compound (603.85 g, 84.4%, 3HCl) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 15.21(br s,1H), 9.88(br s,2H), 8.92(s,2H), 8.16-8.00(m,3H), 7.92(br d,J=8.8Hz,1H), 7.77(s,1H), 7.39(d,J=6.4Hz,1H), 6.94(br s,1H), 4.77(br s,2H), 3.50(br s,4H), 3.41(br s,4H). MS(ES+)m / e 321.1(M+H) + .
[0740] Step 6.4-(piperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0741] A mixture of 4-(piperazin-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine HCl salt (26.2 g, 60.9 mmol, 1.00 equivalent, 3HCl) in H2O (200 mL) was mixed with Na2CO3 (12.9 g, 121.9 mmol, 2.00 equivalent) at 15°C. The mixture was stirred at 15°C for 0.5 hours and extracted with DCM / MeOH (10 / 1, 500 mL × 3). The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to obtain the title compound (18.97 g, 95.86%) as a pale yellow solid. 1H NMR(400MHz,DMSO-d6)δ 15.21(s,1H), 9.89(s,2H), 8.92(s,2H), 8.19-8.00(m,3H), 7.92(dd,J1=1.6Hz,J2=8.8Hz,1H), 7.77( s,1H), 7.39(d,J=6.4Hz,1H), 6.95(s,1H), 4.77(s,2H), 3.51(t,J=4.4Hz,4H), 3.41(t,J=4.4Hz,4H). MS(ES+)m / e 321.1(M+H) + .
[0742] Step 7. 4-(4-cyclopropylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0743] To a solution of 4-(piperazin-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (400 mg, 1.25 mmol, 1.00 equivalent) in THF (2.00 mL) and MeOH (2.00 mL), (1-ethoxycyclopropoxy)trimethylsilane (870 mg, 4.99 mmol, 1.00 mL, 4.00 equivalent), NaBH3CN (235 mg, 3.75 mmol, 3.00 equivalent), and AcOH (239 mg, 4.00 mmol, 228 μL, 3.20 equivalent) were added. The mixture was stirred at 50°C for 12 hours and concentrated under reduced pressure to obtain the residue. The crude product was purified by reverse-phase HPLC (column: Phenomenex luna C18 (250 x 70 mm, 10 μm); mobile phase: [water (HCl)-ACN]; gradient: 1%~15% B, 20 minutes) to obtain the title compound (100 mg, 22.2%) as a brown solid. 1H NMR(400MHz,DMSO-d6)δ 12.58(s,1H), 9.74(s,2H), 8.92-8.87(m,3H), 8.76-8.74(dd,J=1.60.8.40,1H), 8.60(s,2H), 8.21-8.19(d,J=6.60,2H), 7.76(s,1H), 5 .59(s,1H), 4.67-4.64(m,1H), 5.59(s,1H), 4.44(s,4H), 4.33-4.30(m,2H), 3.72(s,1H), 2.09-2.06(m,2H), 1.66-1.64(d,J=8.20,2H). MS(ES+)m / e 361.2(M+H) + .
[0744] Example 77
[0745] 2-(4-(3-((Quinoxaline-6-ylmethyl)amino)pyridine-4-yl)piperazine-1-yl)ethane-1-ol (Compound 076) [ka]
[0746] To a solution of 4-(piperazin-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (250 mg, 780 μmol, 1.00 equivalent) and 1,4-dioxane-2,5-diol (93.7 mg, 780 μmol, 1.00 equivalent) in MeOH (4.00 mL), NaBH3CN (98.1 mg, 1.56 mmol, 2.00 equivalent) was added. The mixture was stirred at 25°C for 2 hours and concentrated under reduced pressure to remove the MeOH. The crude product was purified by reverse-phase HPLC (column: Waters Xbridge 150 × 25 mm × 5 μm; mobile phase: [water (ammonium hydroxide v / v)-ACN]; gradient: 3%~33% B, 10 minutes), and lyophilized to obtain the title compound (150 mg, 52.8%) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ 8.90(s,2H), 8.08(d,J=8.4Hz,1H), 8.00(s,1H), 7.88(dd,J=1.8,8.4Hz,1H), 7.77(d,J=5.2Hz,1H), 7.69(s,1H), 6.8 7(d,J=5.2Hz,1H), 5.66(t,J=6.0Hz,1H), 4.68(d,J=6.0Hz,2H), 4.44(t,J=5.2Hz,1H), 3.55(q,J=6.0Hz,2H), 2.98(br s,4H), 2.68(br s,4H), 2.49-2.46(m,2H). MS(ES+)m / e 365.1(M+H) + .
[0747] Example 78
[0748] (R)-4-(2,4-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 077) [ka]
[0749] Step 1. (R)-4-(2-methylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0750] The title compound was synthesized following the same procedure as described for the preparation of Example 76 (Compound 075) using appropriate starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d6) δ 8.89 (s, 2H), 8.07 (d, J=8.4 Hz, 1H), 7.97 (s, 1H), 7.86 (dd, J=1.6, 8.4 Hz, 1H), 7.80-7.73 (m, 2H), 6.95 (d, J=5.2 Hz, 1H), 6.01 (br t, J=6.0 Hz, 1H), 4.83-4.59 (m, 2H), 3.20 (br s, 1H), 3.05-2.91 (m, 3H), 2.91-2.81 (m, 1H), 0.82 (d, J=6.4 Hz, 3H). MS(ES+)m / e 335.2(M+H) + .
[0751] Step 2. (R)-4-(2,4-dimethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine [ka]
[0752] The reaction was carried out via flow chemistry. Meanwhile, (R)-4-(2-methylpiperazin-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (1.00 g, 2.99 mmol, 1.00 equivalent), TEA (907 mg, 8.97 mmol, 1.25 mL, 3.00 equivalent), AcOH (1.80 g, 29.9 mmol, 1.71 mL, 10.0 equivalent), and formaldehyde (269 mg, 8.97 mmol, 247 μL, 3.00 equivalent) in MeOH (10.0 mL) were introduced into a flow chemistry apparatus at a flow rate of 18.5 mL / min, and a solution of 2-methylpyridineborane complex (3.20 g, 29.9 mmol, 10.0 equivalent) in MeOH (10.0 mL) was simultaneously introduced at the same flow rate. This reaction was carried out at 25°C for 3 hours, then the reaction solution was collected, quenched by adding 10.0 mL of NH4Cl aqueous solution, and concentrated under reduced pressure to obtain the residue. The residue was purified by preparative HPLC (HCl conditions) to obtain the title compound (83.1 mg, 7.98%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ 8.87-8.93 (m, 2H), 8.07 (d, J=8.6 Hz, 1H), 7.97 (d, J=1.2 Hz, 2.0 H), 7.86 (dd, J=8.6, 2.0 Hz, 1H), 7.74-7.81 (m, 2H), 6.99 (d, J=4.8 Hz, 1H), 5.95 (br s,1H), 4.58-4.80(m,2H), 2.99-3.10(m,1H), 2.75-2.84(m,1H), 2.56-2.68(m, 2H), 2.37-2.47(m,1H), 2.24(s,3H), 2.01-2.14(m,1H), 0.86(d,J=6.4Hz,3H). MS(ES+)m / e 349.1(M+H) + .
[0753] Example 79
[0754] 4-(4-ethylpiperazine-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (compound 078) [ka]
[0755] To a solution of 4-(piperazin-1-yl)-N-(quinoxaline-6-ylmethyl)pyridine-3-amine (250 mg, 780 μmol, 1.00 equivalent) in MeOH (2.00 mL), acetaldehyde (85.9 mg, 780 μmol, 109 μL, 1.00 equivalent) and NaBH3CN (98.1...
Claims
1. Structure according to formula I: 【Chemistry 1】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; wherein, X 4 , X 6 , or X 7 of which 0 or 1 is N; A is selected from the following group: 【Chemistry 2】 X a is selected from N and CH; X b These are O, NH, and NCH 3 Selected from; Each R a1 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; Each R a C 1 ~C 3 Selected from alkyl, this C 1 ~C 3 Both alkyl groups are bonded to the same ring carbon atom, or alternatively, two R groups are bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , and halo; or further, or alternatively, two R bonded to the same carbon atom a2 However, it forms an oxo group; Each R a3 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Two R atoms, selected from halo, hydroxyl, and amino, or further or alternatively, bonded to the same carbon atom. a3 However, they form an oxo group or a 3-5 membered carbon ring; or two Ras bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heteroring having one or two heteroatoms selected from O and NH; R b1 C 1 ~C 3 Alkyl, or C 3 ~C 6 It is a cycloalkyl group, each optionally consisting of a halo, OH, or O-C group. 1-3 Substituted with alkyl; R b2 H, C 1 ~C 3 Selected from alkyl groups, optionally halo, OH, or O-C. 1-3 Substituted with alkyl; R b3 C 1 ~C 3 It is alkyl, and optionally has a halo, OH, or O-C group. 1-3 Substituted with alkyl; R b4 OH, -NH 2 ,-NH(C 1 ~C 3 Alkyl), and -N(C 1 ~C 3 Alkyl) 2 Selected from; R b5 H and C 1 ~C 3 Selected from alkyl groups; m is 1 or 2; n is 1 or 2; p is 1 or 2; r is 1 or 2; s is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; The compound wherein w is 0, 1, or 2.
2. Structure according to Equation II 【Transformation 3】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is A is selected from the following group: 【Chemistry 4】 X a is selected from N and CH; X b These are O, NH, and NCH 3 Selected from; Each R a1 is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl, and amino; or further, or alternatively, two R a1 bonded to the same carbon atom form an oxo group or a 3- to 5-membered carbocyclic ring; or two R a bonded to different carbon atoms form a 4- to 6-membered carbocyclic ring or a 4- to 6-membered heterocyclic ring having one or two heteroatoms selected from O and NH; Each R a is independently selected from C 1 to C 3 alkyl, and both of these C 1 to C 3 alkyl groups are attached to the same ring carbon atom, or alternatively, two R a attached to the same ring carbon atom form a 3- to 5-membered carbocyclic ring; Each R a2 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , and halo; or further, or alternatively, two R bonded to the same carbon atom a2 However, it forms an oxo group; Each R a3 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, they form an oxo group or a 3-5 membered carbon ring; or two Ras bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heteroring having one or two heteroatoms selected from O and NH; R b1 C 1 ~C 3 Alkyl, or C 3 ~C 6 It is a cycloalkyl group, each optionally consisting of a halo, OH, or O-C group. 1-3 Substituted with alkyl; R b2 H, C 1 ~C 3 Selected from alkyl groups, optionally halo, OH, or O-C. 1-3 Substituted with alkyl; R b3 C 1 ~C 3 It is alkyl, and optionally has a halo, OH, or O-C group. 1-3 Substituted with alkyl; R b4 OH, -NH 2 ,-NH(C 1 ~C 3 Alkyl), and -N(C 1 ~C 3 Alkyl) 2 Selected from; R b5 H and C 1 ~C 3 Selected from alkyl groups; m is 1 or 2; n is 1 or 2; p is 1 or 2; r is 1 or 2; s is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
3. Structure according to formula III: 【Transformation 5】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is A is selected from the following group: 【Transformation 6】 Each R a1 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; Each R a C 1 ~C 3 Selected from alkyl, this C 1 ~C 3 Both alkyl groups are bonded to the same ring carbon atom, or alternatively, two R groups are bonded to the same ring carbon atom. a However, it forms a 3-5 membered carbon ring; Each R a2 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , and halo; or further, or alternatively, two R bonded to the same carbon atom a2 However, it forms an oxo group; Each R a3 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, they form an oxo group or a 3-5 membered carbon ring; or two Ras bonded to different carbon atoms form a 4-6 membered carbon ring or a 4-6 membered heteroring having one or two heteroatoms selected from O and NH; R b1 C 1 ~C 3 Alkyl, or C 3 ~C 6 It is a cycloalkyl group, each optionally consisting of a halo, OH, or O-C group. 1-3 Substituted with alkyl; R b2 It is selected from H, C1-C3 alkyl groups, and optionally substituted with halo, OH, or O-C1-3 alkyl groups; R b3 C 1 ~C 3 It is alkyl, and optionally has a halo, OH, or O-C group. 1-3 Substituted with alkyl; m is 1 or 2; n is 1 or 2; p is 1 or 2; x is 0, 1, 2, or 3; y is 0, 1, 2, or 3; z is 0, 1, or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 54, wherein v is 0, 1, or 2.
4. Structure according to formula IV: 【Transformation 7】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is one of 0 or 1; X a is selected from N and CH; Each R a1 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1 C 1 ~C 3 Alkyl, or C 3 ~C 6 It is a cycloalkyl group, each optionally consisting of a halo, OH, or O-C group. 1-3 Substituted with alkyl; m is either 1 or 2; x is 0, 1, 2, or 3; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; The compound according to claim 1, wherein w is 0, 1, or 2.
5. Structure according to formula V: 【Transformation 8】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is Each R a1 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a1 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b1 C 1 ~C 3 Alkyl, or C 3 ~C 6 It is a cycloalkyl group, each optionally consisting of a halo, OH, or O-C group. 1-3 Substituted with alkyl; x is 0, 1, 2, or 3; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
6. Structure according to formula VI: 【Chemistry 9】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is one of 0 or 1; X a is selected from N and CH; Each R a C 1 ~C 3 Selected from alkyl, this C 1 ~C 3 Both alkyl groups are bonded to the same ring carbon atom, or alternatively, two Ra groups bonded to the same ring carbon atom form a 3- to 5-membered carbon ring; Each R a2 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , and halo; or further, or alternatively, two R bonded to the same carbon atom a2 However, it forms an oxo group; R b2 H and C 1 ~C 3 Selected from alkyl groups, optionally halo, OH, or O-C. 1-3 Substituted with alkyl; n is either 1 or 2; z is 0, 1, or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; The compound according to claim 1, wherein w is 0, 1, or 2.
7. Structure according to formula VII: 【Chemistry 10】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is Each R a C 1 ~C 3 Selected from alkyl, this C 1 ~C 3 Both alkyl groups are bonded to the same ring carbon atom, or alternatively, two Ra groups bonded to the same ring carbon atom form a 3- to 5-membered carbon ring; Each R a2 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , and halo; or further, or alternatively, two R bonded to the same carbon atom a2 However, it forms an oxo group; R b2 H and C 1 ~C 3 Selected from alkyl groups, optionally halo, OH, or O-C. 1-3 Substituted with alkyl; n is either 1 or 2; z is 0, 1, or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
8. Structure according to formula VIIIa or VIIIb: 【Chemistry 11】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is Each R a2 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , and halo; or further, or alternatively, two R bonded to the same carbon atom a2 However, it forms an oxo group; z is 0, 1, or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
9. Structure according to formula IX: 【Chemistry 12】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is one of 0 or 1; X b These are O, NH, and NCH 3 Selected from; Each R a3 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b3 C 1 ~C 3 It is alkyl, and optionally has a halo, OH, or O-C group. 1-3 Substituted with alkyl; p is either 1 or 2; y is 0, 1, 2, or 3; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; The compound according to claim 1, wherein w is 0, 1, or 2.
10. Structure according to formula X: 【Chemistry 13】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is Each R a3 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; R b3 C 1 ~C 3 It is alkyl, and optionally has a halo, OH, or O-C group. 1-3 Substituted with alkyl; p is either 1 or 2; y is 0, 1, 2, or 3; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
11. Structure according to formula XIa or XIb: 【Chemistry 14】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is Each R a3 C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from halo, hydroxyl, and amino; or further, or alternatively, two R atoms bonded to the same carbon atom. a3 However, it forms an oxo group or a 3-5 membered carbon ring; or two R groups bonded to different carbon atoms a However, it forms a 4-6 membered carbon ring or a 4-6 membered heterocycle having one or two heteroatoms selected from O and NH; y is 0, 1, 2, or 3; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
12. Structure according to formula XII: 【Chemistry 15】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is X 4 CH, CR d Selected from , and N; X 6 CH, CR d Selected from , and N; X 7 CH, CR d Selected from , and N; In the formula, X 4 , X 6 , or X 7 N is one of 0 or 1; R b4 OH, -NH 2 ,-NH(C 1 ~C 3 Alkyl), and -N(C 1 ~C 3 Alkyl) 2 Selected from; R b5 H and C 1 ~C 3 Selected from alkyl groups; r is either 1 or 2; s is either 1 or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; The compound according to claim 1, wherein w is 0, 1, or 2.
13. Structure according to formula XIII: 【Chemistry 16】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is R b4 OH, -NH 2 ,-NH(C 1 ~C 3 Alkyl), and -N(C 1 ~C 3 Alkyl) 2 Selected from; R b5 H and C 1 ~C 3 Selected from alkyl groups; r is either 1 or 2; s is either 1 or 2; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
14. Structure according to formula XIV: 【Chemistry 17】 or a compound having a pharmaceutically acceptable salt thereof, wherein the formula is R b4 OH, -NH 2 ,-NH(C 1 ~C 3 Alkyl), and -N(C 1 ~C 3 Alkyl) 2 Selected from; R b5 H and C 1 ~C 3 Selected from alkyl groups; Each R c They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from -CN, hydroxyl, and amino; Each R d They became independent, Hello, C 1 ~C 3 Alkyl, -OCH 3 , -CF 3 ien-CH 2 F, -CHF 2 Selected from , -CN, hydroxyl, and amino; or two R on adjacent ring positions d These may come together to form a 5- or 6-membered aromatic ring having 0 to 2 heteroatoms selected from O, S, N, and NH; w is 0, 1, or 2; The compound according to claim 1, wherein v is 0, 1, or 2.
15. The compound according to claim 1, having a structure comprising one of the compounds in Table A, or a pharmaceutically acceptable salt thereof: Table 1-1 Table 1-2 Table 1-3 Table 1-4 Table 1-5 Table 1-6 Table 1-7