Methods for generating hematopoietic stem cells

Abstract

In some aspects and embodiments, the present invention provides methods for generating hematopoietic stem cells, e.g., for HSCT, comprising providing a cell population comprising hemogenic endothelial (HE) cells or endothelial cells under conditions sufficient to stimulate the formation of HSCs, and increasing the activity or expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) and / or GTPase IMAP family member 6 (Gimap6) in the HE cells and / or endothelial cells.

Description

[Technical field]

[0001] Claiming priority This application claims the benefit of U.S. Provisional Patent Application No. 62 / 681,982, filed June 7, 2018, the entire contents of which are incorporated herein by reference.

[0002] Federally funded research This invention was made with government support under grant numbers HL131645, DK085217, and DK100672 awarded by the National Institutes of Health. The government has certain rights in this invention. [Background technology]

[0003] Hematopoietic stem cells (HSCs) arise in distinct regions during embryonic development where specific inductive events convert the mesoderm into blood stem and progenitor cells. HSCs can give rise to both myeloid and lymphoid blood cells in a process called hematopoiesis.

[0004] HSC transplantation (HSCT) is widely used to treat patients with hematological, bone marrow, metabolic, and immune disorders. Despite advances in cord blood and haploidentical stem cell transplantation, the therapeutic use of HSC transplantation is often limited by the difficulty of finding suitable human leukocyte antigen (HLA)-matched donors in a timely manner, especially in ethnic minority countries, and the lack of a national unrelated donor registry. Although mixed race individuals make up 1.6 percent (97 million) of the U.S. population, mixed race volunteers make up only 3 percent (21,000) of the 7 million registered volunteers, leaving 6,000 patients with bone marrow mismatches. Even when a suitable match is found, immunological complications such as graft-versus-host disease (GVHD), donor rejection, and high mortality rates associated with the procedure can jeopardize the patient's survival. However, these complications are eliminated by autologous transplantation. Although autologous HSCs are not a substitute for allogeneic HSCs, especially in the setting of hematological malignancies, autologous HSCs overcome significant hurdles in HSCT, including lack of donor availability and GVHD in patients with a wide range of malignant and non-malignant hematological, immune, and metabolic disorders. Summary of the Invention

[0005] Thus, there is a need to generate HSCs, including autologous HSCs, for HSCT.

[0006] The present disclosure is based at least in part on the discovery that biomechanical and / or pharmacological activation of mechanosensitive receptors (e.g., Piezo1) enhances the expression of Dnmt3b for the formation of hematopoietic stem cells (HSCs). As demonstrated herein, cdh5-morphant (cdh5-MO) embryos have cardiac pulsation-mediated pulsation in blood vessels without cardiac output and active blood flow. Stretching from pulsation activates Piezo1 mechanosensitive channels, which further enhance the expression of Dnmt3b in the aorta-gonad-mesonephros (AGM) region to stimulate the conversion of hemogenic endothelial cells to HSCs. Stimulation of pulsation or pharmacological activation of Piezo1 also produces a three-fold higher amount of HSCs, which reconstitute normal functional multicellular adult blood upon serial transplantation. In some embodiments, hematopoietic stem cells produced in accordance with the present disclosure include long-term hematopoietic stem cells (LT-HSCs), which exhibit excellent engraftment and reconstitute functional multicellular adult blood in the recipient.

[0007] In some embodiments, the present invention provides a method for generating HSCs, comprising providing a population comprising endothelial cells (e.g., hemogenic endothelial (HE) cells) under conditions sufficient to stimulate the formation of HSCs, and increasing the activity or expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) and / or GTPase IMAP family member 6 (Gimap6) in the cells. The HSCs can be harvested for administration to a patient.

[0008] In some embodiments, the endothelial cells are contacted with an effective amount of an agonist that increases the activity or expression of Dnmt3b. In some embodiments, the agonist is an agonist of a mechanosensitive receptor or a mechanosensitive channel. In some embodiments, the mechanosensitive receptor is Piezo1. An exemplary Piezo1 agonist is Yoda1. In some embodiments, the effective amount of the Yoda1 agonist ranges from about 5 μM to about 200 μM, or from about 5 μM to about 100 μM, or in some embodiments, from about 25 μM to about 100 μM, or from about 25 μM to about 50 μM.

[0009] Alternatively, the activity or expression of Dnmt3b can be directly increased in endothelial cells.For example, the mRNA expression of Dnmt3b can be increased by delivering mRNA transcript to cells, or by introducing Dnmt3b transgene and / or episome, which can have one or more modifications to increase or change activity.In some embodiments, gene editing is used to introduce genetic modification into Dnmt3b expression element in endothelial cells or HE cells, for example, to increase promoter strength, ribosome binding, or RNA stability.

[0010] In some embodiments, the present invention includes increasing the activity or expression of Gimap6 in endothelial cells, alone or in combination with Dnmt3b. To increase the activity or expression of Gimap6, the mRNA transcript of Gimap6, or alternatively, a Gimap6 transgene and / or episome, can be introduced into cells, and / or genetic modification of Gimap6 expression elements in cells (such as one or more modifications to increase promoter strength, ribosome binding, or RNA stability) can also be introduced.

[0011] In various embodiments, a cell population comprising endothelial cells (e.g., hematopoietic endothelial (HE) cells) is introduced into a bioreactor. In some embodiments, the bioreactor provides cyclic-strain biomechanical stretching. The cyclic-strain biomechanical stretching increases the activity or expression of Dnmt3b and / or Gimap6. For example, a computer-controlled vacuum pump system (e.g., FlexCell™ Tension System, Cytostretcher System, or similar) attached to the nylon membrane, PDMS membrane, or similar biocompatible biomimetic membrane of a soft-bottomed culture plate can be used to provide 2D or 3D circumferential stretch to HE cells ex vivo under defined and controlled cyclic strain conditions.

[0012] In various embodiments, HSC conversion is induced by one or more selected from: activation of Piezo1; mechanical stretch; introduction of mRNA for Dnmt3b, with or without transgenic modification (i.e., transgene-free), with or without episomal modification, or with or without genetic modification; and / or introduction of mRNA for Gimap6, with or without transgenic modification (i.e., transgene-free), with or without episomal modification, or with or without genetic modification.

[0013] In some embodiments, HE cells are obtained or derived from induced pluripotent stem cells (iPSCs), non-hematopoietic stem cells, or somatic cells such as fibroblasts or endothelial cells. In some embodiments, HE cells are obtained or derived from HLA-null cells, HLA-modified cells, and / or transgene-free cells, or from genetic induction of endothelial cells to HE cells. Hemopoietic endothelial cells (e.g., Flkl+CD45+ cells, Flkl+CD41+ cells, or CD31+CD43+ cells), including those derived from source cells of an allogeneic donor or from a subject to be treated with HSCs, can be obtained in any manner (i.e., chemical induction, genetic induction, mRNA induction, transgene-free induction, or episomal induction from autologous or allogeneic cells to hemogenic endothelial cells; in some embodiments, HE cells are generated from iPSCs made using the recipient's cells or universally matched donor's cells). In some embodiments, developmentally plastic endothelial cells are utilized.

[0014] In various embodiments, a pharmaceutical composition for cell therapy is prepared comprising a population of HSCs prepared by the methods described herein and a pharma- ceutical acceptable vehicle. The pharmaceutical composition is at least about 10 2 HSCs, or at least about 10 3 HSCs, or at least about 10 4 HSCs, or at least about 10 5 HSCs, or at least about 10 6 HSCs, or at least about 10 7 HSC or at least 10 8 For example, in some embodiments, a pharmaceutical composition is administered that contains about 100,000 to about 400,000 HSCs per kilogram of recipient body weight (e.g., about 200,000 cells / kg).

[0015] In some embodiments, a cell therapy is provided that includes a population of HSCs prepared by the methods described herein. In some embodiments, the cell therapy includes a pharma- ceutically acceptable vehicle. The cell therapy is provided at least about 10 2 HSCs, or at least about 10 3 HSCs, or at least about 10 4 HSCs, or at least about 10 5 HSCs, or at least about 10 6 HSCs, or at least about 10 7 HSC or at least 10 8 The pharmaceutical composition may contain about 100,000 to about 400,000 HSCs per kilogram of recipient body weight (e.g., about 200,000 cells / kg) of HSCs. The number of HSC cells may vary based on the age and weight of the patient.

[0016] HSCs for transplantation can be generated in some embodiments in a relatively short period of time, such as less than about 2 months, or less than about 1 month (e.g., about 4 weeks), or less than about 2 weeks, or less than about 1 week, or less than about 6 days, or less than about 5 days, or less than about 4 days, or less than about 3 days. In some embodiments, developmentally plastic endothelial or HE cells with increased Dnmt3b and / or Gimap6 activity or expression are cultured for 1 to 4 weeks.

[0017] The HSCs prepared by the methods described herein are administered to a subject (recipient), for example, by intravenous infusion or intra-bone marrow transplantation. The methods can be performed after myeloablative, non-myeloablative, or immunotoxin-based (e.g., anti-c-Kit, anti-CD45, etc.) conditioning regimens.

[0018] The method described herein can be used to generate a population of HSCs for use in transplantation protocols for treating, for example, blood disease (malignant and non-malignant), bone marrow disease, metabolic disease, and immune disease.In some embodiments, the HSC population is derived from autologous cells, for example, from iPSCs that are produced using recipient subject's cells.In some embodiments, the HSC population is derived from universally matched donor cells or HLA-null hematopoietic endothelial cells or similar cells that produce normal HSCs.

[0019] These and other aspects and embodiments of the present invention are described in the following detailed description of the invention. [Brief description of the drawings]

[0020] [Figure 1-1] Figure 1A shows time-lapse confocal imaging of cd41:eGFP+ HSCs arising from flk1:mCherry+ endothelial cells in transgenic embryos between 26 and 42 hpf. The data demonstrate that silencing of Piezo1 attenuates endothelial-to-HSC conversion, whereas pharmacological activation of Piezo1 (Yoda1) stimulates HSC formation in control embryos and also restores HSC formation in sih-MO embryos. n=5 per group. *P<0.05 vs. control, $P<0.05 vs. sih-MO. [Figure 1-2] Figure 1B is a heatmap of differentially expressed genes in E11.5 AGM cells treated with repeated strain and Piezo1 activator (Yoda1), showing that repeated strain and Piezo1 activation have similar gene expression patterns in AGM during endothelial to hematopoietic cell conversion. n=3 per group. [Figure 1-3]FIG. 1C is a graph of hematopoietic colony forming unit (CFU) assay in E11.5 AGM cells demonstrating that Yoda1-mediated pharmacological activation of Piezo1 stimulates endothelial to hematopoietic cell conversion. n≧6 per group. *P<0.05 vs. control. Abbreviations: GEMM (granulocyte, erythroid, macrophage, megakaryocyte), GM (granulocyte macrophage), G (granulocyte), M (macrophage), E (erythroid). [Figure 1-4] FIG. 1D is a graph of hematopoietic CFU assay in E11.5 AGM cells demonstrating that GsMtX4-mediated pharmacological inhibition of Piezo1 attenuates the induced effect of repeated strain on endothelial to HSC conversion. n>6 per group. *P<0.05 vs. control. Abbreviations: GEMM (granulocyte, erythroid, macrophage, megakaryocyte), GM (granulocyte-macrophage), G (granulocyte), M (macrophage), E (erythroid). [Figure 2-1] Figure 2A shows an experimental overview (top) and line graphs (bottom). The experimental overview (top) shows a schematic depicting serial transplantation of HSCs derived from E11.5 mouse AGM followed by treatment with 10% repeat strain or Yoda1 into myeloablative immunodeficient mice. The line graph (bottom) shows the percentage of peripheral blood chimerism resulting from reconstitution of HSCs derived from E11.5 AGM (donor, 3 embryo equivalent) at 4-week intervals between weeks 8 and 16 in primary transplants (recipients), demonstrating that repeat strain or pharmacological activation of Piezo1 (Yoda1 treatment) on E11.5 AGM stimulates the formation of HSCs. n ≥ 5 primary recipients per group. * P < 0.05 vs control, $ P < 0.05 vs chimerism at week 8. 3 embryo equivalents (ee) of AGM donor cells were injected into each recipient. [Figure 2-2]Figure 2B is a graph showing the percentage of reconstitution of HSCs derived from E11.5 AGM (donor, 3 embryo equivalents) into Mac1+Gr1+ myeloid cells, Cd8+Cd3+ T cells, and B220+Cd19+ B cells in 16 week primary transplants (recipients), demonstrating that repeated strain on E11.5 AGM or pharmacological activation of Piezo1 (Yoda1) stimulates the formation of blood-reconstituting HSCs. n ≥ 5 primary recipients per group. [Figure 2-3] Figure 2C is a line graph showing the percentage of peripheral blood chimerism resulting from reconstitution of flow-sorted Lin-Sca1+c-Kit+ HSPCs (n=2000) derived from primary transplants (donors) at 4-week intervals between weeks 8 and 12 in secondary transplants (recipients), demonstrating that repeated straining or Yoda1 treatment of E11.5 AGM produces HSCs with continuous engraftment and self-renewal capacity. n≧5 secondary recipients per group. *P<0.05 vs. control. [Figure 2-4] FIG 2D is a graph showing the percentage of reconstitution of primary transplant (donor) derived HSCs into Mac1+Gr1+ myeloid cells, Cd8+Cd3+ T cells, and B220+Cd19+ B cells in secondary transplants (recipients) at week 12, demonstrating that repeated straining or Yoda1 treatment of E11.5 AGM produces HSCs that can continuously reconstitute into the blood. n>5 secondary recipients per group. [Figure 3-1]FIG. 3A shows an experimental overview (top) and graphs (bottom). The experimental overview (top) shows the strategy for functional and phenotypic analysis of donor-derived blood lineages in hematopoietic tissues of primary transplants (recipient mice). The graphs (bottom) show the percentage of expression of β-major (adult), εγ (embryonic), and β-H1 (embryonic) hemoglobin in sorted Cd71+Ter119+ (donor) erythroid cells derived from bone marrow. The data show that donor HSCs produced after biomechanical stretching or Yoda1 treatment of E11.5 AGM are reconstituted into erythrocytes containing adult hemoglobin. n≧6 per group. [Figure 3-2] FIG. 3B is a graph showing overnight culture (O / N) of bone marrow-derived sorted Gr1+Mac1+ (donor) neutrophils followed by ELISA-based quantification of myeloperoxidase (MPO) protein. The data demonstrate that following biomechanical stretch or Yoda1 treatment of E11.5 AGM, donor HSCs were produced that reconstituted into functional bone marrow cells that exhibited sufficient MPO levels. n≧5 per group. [Figure 3-3] Figure 3C is a graph showing ELISA analysis of immunoglobulin (Ig) isotypes pre-immunization in peripheral blood of primary transplant (recipient) mice. The data show that primary transplants produce B cells with a complete immunoglobulin repertoire. n > 6 per group. [Diagram 3-4] Figure 3D is an image of two gel photographs showing T cell receptor (TCRβ) locus analysis of spleen-sorted Cd3+ T cells (donor) (top) or Mac1+ bone marrow cells (donor, negative control) (bottom). The data show that following biomechanical stretching or Yoda1 treatment of E11.5 AGM, donor HSCs migrate to the spleen and produce T cells that reconstitute into T cells with sufficient functional recombination machinery to rearrange the TCRβ locus, demonstrating T cell receptor β (TCR β) rearrangement. [Figure 3-5]FIG. 3E is a dot plot showing delayed-type hypersensitivity assay demonstrating that primary transplant (recipient) mice reconstituted with donor HSCs derived from biomechanically stretched or Yoda1-treated E11.5 AGM have a T cell-mediated immune response. n≧6 per group. *P<0.05 vs. right footpad (negative control). [Figure 4] Venn diagram of genes upregulated in E11.5 AGM cells treated with repeated strain and / or Yoda1 where genes were upregulated during EC vs. HSC ((1)), EC vs. HEC ((2)), and HEC vs. HSC ((3)). Venn diagram comparison of commonly upregulated genes in the above analyses ((1) vs. (2) vs. (3)) demonstrates that both circumferential stretch and Piezo1 activation specifically stimulate Dnmt3b and Gimap6 transcript expression during endothelial to HSC conversion. [Figure 5-1] FIG. 5A shows two graphs of Dnmt3b and Dnmt3a protein levels in the nuclear fraction of AGM cells from E11.5 mice treated with cyclic strain or Yoda1. The data demonstrate that circumferential stretch or Piezo1 activation specifically stimulates Dnmt3b protein expression levels without affecting Dnmt3a expression. n≧3 per group. *P<0.05 vs. control. [Figure 5-2] Figure 5B is a graph of hematopoietic CFU assay of E11.5 mouse AGM cells treated with repeated strain or Yoda1 in the presence of nanaomycin (Nana). Data show that pharmacological inhibition of Dnmt3b attenuates endothelial to HSC conversion stimulated by circumferential stretch or Piezo1 activation. n ≥ 6 embryos per group. *P < 0.05 vs control. $P < 0.05 vs stretch. +P < 0.05 vs Yoda1. [Figure 5-3]Figure 5C is a graph showing the results of time-lapse confocal imaging of cd41:eGFP+ HSCs arising from flk1:mCherry+ endothelial cells in transgenic embryos between 26 and 42 hpf. The data demonstrate that silencing of dnmt3bb.1 attenuates endothelial-to-HSC conversion stimulated by Piezo1 activation and that nanaomycin is more specific for Dnmt3b than Dnmt3a. n ≥ 5 per group. *P < 0.05 vs. control. $P < 0.05 vs. Yoda1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] During fetal development, a subset of endothelial cells in the aorta-gonad-mesonephros (AGM) are hemogenic endothelial cells, which change their fate to become HSCs that ultimately colonize the fetal liver and bone marrow. However, the identity of factors that stimulate hemogenic endothelial cells remains unclear, limiting their utility as a potential source of functional HSCs. Blood flow-mediated shear stress against the intima stimulates the endothelial emergence of HSCs. However, using Cdh5 null zebrafish and mouse models, it was confirmed that functional HSCs arise despite premature circulatory arrest. Anderson H, et al., Hematopoietic stem cells develop in the absence of endothelial cadherin 5 expression. Blood 2015. These cdh5-silenced models were used in accordance with the present disclosure as a focal point for studying shear stress and / or nitric oxide synthase (NOS)-independent biomechanical forces that trigger the emergence of functional HSCs to investigate additional mechanisms by which pulse pressure-mediated circumferential stretch governs the emergence of HSCs.

[0022] Attempts to generate HSCs from hemogenic endothelial cells in the laboratory have been largely unsuccessful, due in part to a lack of knowledge of factors that stimulate the emergence of HSCs from hemogenic endothelial cells. It has now been determined that circumferential stretching of blood vessels due to pulsation from a beating heart triggers the emergence of functional HSCs from hemogenic endothelial cells, which can eventually engraft and differentiate into definitive cell lineages. In addition, activation of the stretch-sensitive transient receptor potential cation channel subfamily vanilloid member 4 (Trpv4) channel restored the formation of HSCs in silent heart (tnnt2, sih), i.e., silenced embryos in the absence of cardiac pulsation and blood flow. See WO 2017 / 096215, which is incorporated herein by reference in its entirety.

[0023] The present disclosure is based, at least in part, on the discovery that biomechanical and / or pharmacological activation of mechanosensitive receptors (e.g., Piezo1) enhances the expression of Dnmt3b for the formation of hematopoietic stem cells (HSCs). As demonstrated herein, cdh5-morphant (cdh5-MO) embryos have cardiac mediated pulsation in blood vessels without cardiac output and active blood flow. Stretching from pulsation activates Piezo1 mechanosensitive channels, which further enhances the expression of Dnmt3b in AGM to stimulate endothelial to HSC conversion. Stimulation of pulsation or pharmacological activation of Piezo1 also produces at least three times more LT-HSCs, which reconstitute normal functional multicellular adult blood upon serial transplantation.

[0024] Thus, the results of this disclosure demonstrate how the biomechanical force mediated by heartbeat stimulates cell fate conversion and stem cell formation by activating mechanosensitive channels and epigenetic mechanisms. The development, proliferation, and maintenance of stemness of LT-HSCs are the main goals in HSC transplantation and cell therapy for treating blood and bone marrow diseases. This disclosure provides genetic and pharmacological targets for developing LT-HSCs.

[0025] In some embodiments, the present invention provides a method for producing HSCs, comprising providing a population comprising endothelial cells (e.g., HE cells) under conditions sufficient to stimulate the formation of HSCs, and increasing the activity or expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) and / or GTPase IMAP family member 6 (Gimap6) in the endothelial cells. The HSCs can be harvested for administration to a patient.

[0026] Dnmt3b (DNA (cytosine-5-)-methyltransferase 3 beta) is a DNA methyltransferase. Dnmt3b is predominantly localized in the nucleus, and its expression is developmentally regulated. Gimap6 is a member of the immune-associated protein (GIMAP) family of GTPases. GIMAP proteins have a GTP-binding motif and a coiled-coil motif.

[0027] In some embodiments, the endothelial cells are contacted with an effective amount of an agonist of a mechanosensitive receptor or mechanosensitive channel that increases the activity or expression of Dnmt3b. In some embodiments, the mechanosensitive receptor is Piezo1. An exemplary Piezo1 agonist is Yoda1.

[0028] Yoda1 (2-[5-[[(2,6-dichlorophenyl)methyl]thio]-1,3,4-thiadiazol-2-yl]-pyrazine) is a small molecule agonist developed for the mechanosensitive ion channel Piezo1. Syeda R, Chemical activation of the mechanotransduction channel Piezo1. eLife (2015). Yoda1 has the following structure:

[0029] [ka]

[0030] Derivatives of Yoda1 can be used in various embodiments.For example, derivatives that contain 2,6-dichlorophenyl core are used in some embodiments.Exemplary agonists are disclosed in Evans EL, et al., Yoda1 analogue (Dooku1) which antagonizes Yoda1-evoked activation of Piezo1 and aortic relaxation, British J. of Pharmacology 175(1744-1759): 2018.

[0031] In some embodiments, an effective amount of a Yoda1 agonist or derivative ranges from about 5 μM to about 500 μM, or from about 5 μM to about 200 μM, or from about 5 μM to about 100 μM, or in some embodiments, from about 25 μM to about 150 μM, or from about 25 μM to about 100 μM, or from about 25 μM to about 50 μM.

[0032] Alternatively, the activity or expression of Dnmt3b can be directly increased in endothelial cells or HE cells.For example, the mRNA expression of Dnmt3b can be increased by delivering the transcript encoding Dnmt3b to cells, or by introducing the transgene encoding Dnmt3b, or by transgene-free methods that can have one or more nucleotide modifications (or encoded amino acid modifications) to increase or change activity, but are not limited to episomal introduction into cells.In some embodiments, gene editing is utilized to introduce genetic modifications into Dnmt3b expression elements in endothelial cells, for example, to increase promoter strength, ribosome binding, RNA stability, or affect RNA splicing.

[0033] In some embodiments, the present invention includes increasing the activity or expression of Gimap6 in endothelial cells, alone or in combination with Dnmt3b and / or other modified genes, upon repeated strain or activation of Piezo1. To increase the activity or expression of Gimap6, a transcript of mRNA encoding Gimap6 can be introduced into cells, transgene-free approaches can also be used, including but not limited to episomal introduction into cells, or alternatively, a transgene encoding Gimap6 can be used, which may have one or more nucleotide modifications (or encoded amino acid modifications) to increase or change activity. In some embodiments, gene editing is used to introduce genetic modifications into Gimap6 expression elements in endothelial cells (such as one or more modifications to increase promoter strength, ribosome binding, RNA stability, or affect RNA splicing).

[0034] In some embodiments, mRNA and / or episomes (e.g., encoding Dnmt3b or Gimap6) are synthetically produced, for example by direct chemical synthesis or in vitro transcription, and introduced into endothelial cells. Known chemical modifications can be used to avoid natural immune responses in cells. For example, synthetic RNAs containing only canonical nucleotides can bind to pattern recognition receptors and trigger strong immune responses in cells. This response can result in translation shutoff, secretion of inflammatory cytokines, and cell death. RNAs containing certain non-canonical nucleotides can avoid detection by the natural immune system and can be translated into proteins with high efficiency. In particular, see U.S. Pat. No. 9,181,319, which is incorporated herein by reference, for nucleotide modifications to avoid natural immune responses. mRNA can be introduced into cells once or periodically during HSC production by known methods.

[0035] In some embodiments, the expression of Dnmt3b and / or Gimap6 is increased by introducing a transgene into cells that can lead to a desired level of overexpression (with various promoter strengths or other selections of expression control elements). The transgene can be introduced using various viral vectors or transfection reagents known in the art. In some embodiments, the expression of Dnmt3b and / or Gimap6 is increased by transgene-free methods (e.g., episomal delivery).

[0036] In some embodiments, the expression or activity of Dnmt3b and / or Gimap6 is increased by using gene editing technology, for example, to introduce one or more modifications to increase promoter strength, ribosome binding, or RNA stability.Various editing techniques are known, and these techniques include CRISPR, zinc finger (ZF), and transcription activator-like effector (TALE).In some embodiments, the expression or activity of Dnmt3b and / or Gimap6 is increased by transgene-free methods (e.g., episomal delivery). Fusion proteins having one or more of these DNA binding domains and the cleavage domain of the Fokl endonuclease can be used to generate double-stranded breaks in desired regions of DNA within a cell (see, e.g., U.S. Patent Application Publication No. 2012 / 0064620, U.S. Patent Application Publication No. 2011 / 0239315, U.S. Patent No. 8,470,973, U.S. Patent Application Publication No. 2013 / 0217119, U.S. Patent No. 8,420,782, U.S. Patent Application Publication No. 2011 / 0301073, U.S. Patent Application Publication No. 2011 / 0145940, U.S. Patent No. 8,450,471, U.S. Patent No. 8,440,431, U.S. Patent No. 8,440,432, and U.S. Patent Application Publication No. 2013 / 0122581, the entire contents of which are incorporated herein by reference). In some embodiments, gene editing is carried out using CRISPR-linked Cas system known in the art.See, for example, U.S. Patent No. 8,697,359, U.S. Patent No. 8,906,616, and U.S. Patent No. 8,999,641, which are incorporated herein by reference in their entirety.

[0037] In various embodiments, a cell population comprising developmentally flexible endothelial cells or HE cells is introduced into a bioreactor. In some embodiments, the bioreactor provides biomechanical stretching by cyclic strain, as described in International Publication WO 2017 / 096215, the entirety of which is incorporated herein by reference. Biomechanical stretching by cyclic strain increases the activity or expression of Dnmt3b and / or Gimap6. In these embodiments, mechanical means applies stretching force to cells. For example, a computer-controlled vacuum pump system (e.g., FlexCell™ Tension System, Cytostretcher System, or similar) connected to the nylon membrane of a soft-bottom culture plate or similar biocompatible and biomimetic membrane can be used to apply 2D or 3D circumferential stretching to HE cells ex vivo under defined and controlled cyclic strain conditions.

[0038] In various embodiments, conversion of HSCs is induced by at least one means selected from activation of Piezo1, mechanical stretching, introduction of mRNA, introduction of an mRNA, transgene-based, transgene-free (e.g., episomal) or genetic modification to Dnmt3b, and / or introduction of an mRNA, transgene-based, transgene-free (e.g., episomal) or genetic modification to Gimap6.

[0039] HE cells can be obtained or derived from a subject with blood disease, bone marrow disease, metabolic disease, or immune disease. In some embodiments, the subject does not have a hematological malignancy. The population of HSCs can be administered to the recipient. In autologous HSC transplantation, HE cells are derived from the recipient.

[0040] In some embodiments, HE cells are obtained or derived from induced pluripotent stem cells (iPSCs), non-hematopoietic stem cells, or somatic cells, including but not limited to fibroblasts and endothelial cells. In some embodiments, HE cells are obtained or derived from HLA-null cells, HLA-modified cells, and / or transgene-free cells, or from genetic induction of endothelial cells into HE cells. Hematopoietic endothelial cells (e.g., Flkl + CD45 + cells, Flkl + CD41 + Cells, or CD31 + CD43 +The HE cells) can be obtained in any manner, for example from the source cells of an allogeneic donor or the subject to be treated with HSC. For example, the HE cells can be obtained by chemical induction, genetic induction, transgene-free induction, or episomal induction from autologous or allogeneic cells to hemogenic endothelial cells. In some embodiments, the HE cells arise from iPSCs made from the recipient's cells, or from cells that are HLA-modified, or from cells that are HLA-null cells. In some embodiments, the HE cells are obtained or derived from the cells of a subject that is a universally matched donor. Methods for preparing hemogenic endothelial cells are known in the art, including generation from human pluripotent stem cells. See WO2017 / 096215 and US2019 / 0119643, which are incorporated herein by reference in their entirety. Also, Ditadi et al., Nature Cell Biol. 17(5) 580-591 (2015); Sugimura et al., Nature 2017; 545(7655):432-438; Nakajima-Takagi et al, Blood. 2013; 121(3):447-458; Zambidis et al., Blood. 2008 Nov 1; 112(9):3601-14; and Park et al, Cytometry A. 2013 Jan; 83(1): 114-126 (human embryoid body (hEB)-based blood-endothelial differentiation method for efficient hiPSC differentiation); Choi et al., Cell Rep. 2012 Sep 27; 2(3): 553-567 (hPSC differentiation in co-culture with OP9); Sandler et al, 2014 July 17; 511(17509):312-318 (endothelial to hematopoietic cells); see also Sluvkin, Blood 2013 122:4035-4046. In some embodiments, the number of HE cells to initiate production of HSCs is at least about 10 6 cells, approximately 10 7 cells, or at least 10 8In some embodiments, hematopoietic stem cells produced according to the present disclosure comprise long-term hematopoietic stem cells (LT-HSCs), which exhibit excellent engraftment in recipients and reconstitute functional multicellular adult blood. In some embodiments, HSCs comprise Lin- / Sca1+ / c-kit+ cells.

[0041] In various embodiments, a pharmaceutical composition for cell therapy is prepared comprising a population of HSCs prepared by the methods described herein and a pharma- ceutical acceptable vehicle. The pharmaceutical composition is at least about 10 2 HSCs, or at least about 10 3 HSCs, or at least about 10 4 HSCs, or at least about 10 5 HSCs, or at least about 10 6 HSCs, or at least about 10 7 HSC or at least 10 8 For example, in some embodiments, a pharmaceutical composition is administered that contains about 100,000 to about 400,000 (CD34+) HSCs per kilogram of recipient body weight (e.g., about 200,000 cells / kg).

[0042] HSCs for treatment or transplantation can be generated in some embodiments in a relatively short period of time, such as less than 2 months, or less than 1 month, or less than about 2 weeks, or less than about 1 week, or less than about 6 days, or less than about 5 days, or less than about 4 days, or less than about 3 days. In some embodiments, endothelial cells with increased Dnmt3b and / or Gimap6 activity or expression are cultured for 1 to 4 weeks.

[0043] The cell composition may further comprise a pharma- ceutically acceptable carrier or vehicle suitable for intravenous infusion or other administration routes, and may also comprise a suitable cryoprotectant. A typical carrier is DMSO (e.g., about 10% DMSO). The cell composition may be provided in a unit vial or bag, and may be stored in a frozen state until use. In certain embodiments, the volume of the composition is about 1 fluid ounce to 1 pint.

[0044] The HSCs generated using the methods described herein are administered to a subject (recipient), for example, by intravenous infusion or intra-bone marrow transplantation. The methods can be performed following a myeloablative, non-myeloablative, or immunotoxin-based (e.g., anti-c-Kit, anti-CD45, etc.) conditioning regimen.

[0045] The methods described herein can be used to generate a population of HSCs for use in transplantation protocols for treating, for example, blood diseases (malignant and non-malignant), bone marrow diseases, metabolic diseases, and immune diseases. In some embodiments, the HSC population is derived from autologous cells or universally matched donor cells or HLA-modified or HLA-null cells. That is, the HSC population is generated from HE cells derived from developmentally plastic endothelial cells or iPSCs prepared from recipient subject's cells or prepared from donor cells (e.g., universally matched donor cells, HLA-modified cells, or HLA-null cells). In some embodiments, autologous cells are used, and the recipient subject has a condition selected from multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's disease, acute myeloid leukemia, neuroblastoma, germ cell tumor, autoimmune disorders (systemic lupus erythematosus (SLE), systemic sclerosis), myelodysplastic syndrome, amyloidosis, or other conditions treatable using autologous HSC transplantation. In some embodiments, autologous cells are used (eg, HSCs generated from the recipient subject's cells), and the recipient subject does not have a hematological malignancy.

[0046] In some embodiments, the recipient subject has a condition selected from acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, myeloproliferative disorder, myelodysplastic syndrome, multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's disease, aplastic anemia, pure red cell aplasia, paroxysmal nocturnal hemoglobinuria, Fanconi anemia, thalassemia major, sickle cell anemia, severe combined immunodeficiency (SCID), Wiskott-Aldrich syndrome, hemophagocytic lymphohistiocytosis, inborn errors of metabolism, epidermolysis bullosa, severe congenital neutropenia, Shwachman-Diamond syndrome, Diamond-Blackfan anemia, and leukocyte adhesion deficiency. In some such embodiments, allogeneic derived cells or universally matched donor cells or HLA modified cells or HLA null cells are used to generate HE cells. For example, HSCs are generated from cells of a donor subject, i.e., a subject other than the recipient subject. In some embodiments, the donor subject is matched with the recipient subject based on blood type and human leukocyte antigen (HLA) typing.

[0047] As used herein, the term "about" means ±10% of the numerical value with which it is associated.

[0048] These and other aspects of the present invention will now be illustrated in the following non-limiting examples. EXAMPLES

[0049] During definitive hematopoiesis, the first set of HSCs arise from hemogenic endothelial cells in the AGM during fetal development. Thus, endothelial cells and / or hemogenic endothelial cells can be a source for generating or expanding HSCs for clinical use, provided that the repertoire of intrinsic and extrinsic factors present in the AGM microenvironment is established.

[0050] Induction of seven transcription factors (ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, and SPI1), as well as inhibition of TGFβ and CXCR7 or activation of BMP and CXCR4, enhances human endothelial-to-HSPC conversion. However, these approaches do not confer endothelial or hemogenic endothelial cells with the functions and properties of LT-HSCs. Blood flow-mediated shear stress and subsequent activation of NOS are the only known biomechanical factors involved in HSC formation. However, cdh5-MO embryos produce HSCs despite the lack of blood flow and L-NAME-mediated NOS inhibition. It is therefore important to identify biomechanical forces, mechanosensitive pathways, and epigenetic mechanisms that not only crosstalk in regulating HSC formation but also have utility in the development of long-term (LT) self-renewing HSCs.

[0051] Cardiac pulsation is a precursor to circulation, triggering circulation by producing pulsation within blood vessels. However, the direct role of biomechanical forces mediated by heart pulsation in HSC formation in the absence of circulation from the aortic intima of blood vessels remains unclear. Pulsation produces biomechanical stretching of blood vessels, activating mechanosensitive receptors such as transient receptor potential (TRP) channels, piezo channels, degenerin / epithelial sodium channels (DEG / ENaC), and K1-family members. However, it is unknown whether pulsation or activation of mechanosensitive receptors can stimulate HSC formation. Lis et al. (Lis R, et al. Conversion of adult endothelium to immunocompetent haematopoietic stem cells Nature 2017) and Sugimura et al. (Sugimura et al. Haematopoietic stem and progenitor cells from human pluripotent stem cells Nature 2017) demonstrated how to convert human hemogenic endothelial cells into HSPCs, but it is unknown what mechanisms could permanently erase their endothelial epigenetic landscape to become LT-HSCs.

[0052] As disclosed herein, the present disclosure demonstrates how cardiac and / or pulsation-mediated biomechanical stretch and / or pharmacological activation of the Piezo1 mechanosensitive pathway enhances the expression of Dnmt3b, thereby extinguishing the epigenetic landscape of the endothelium for the formation of HSCs (e.g., LT-HSCs).Furthermore, we developed a bioreactor that mimics pulsation-like conditions and defined Piezo1 as a pharmacological target for stimulating and scaling up LT-HSC formation.

[0053] Heartbeat-mediated pulsation stimulates endothelial-to-HSC conversion. An unbiased zebrafish ethylnitrosourea (ENU) mutagenesis screen identified the cadherin-5 (cdh5, ve-cdh) zebrafish mutant malbec(bw209 mlb ) were obtained. Malbec and cdh5-morphant (MO) embryos exhibit normal primary and definitive hematopoiesis despite circulatory failure.

[0054] To identify blood flow- and shear stress-independent biomechanical forces that stimulate endothelial-to-HSC conversion, we analyzed cardiac function and anatomy and vasculature in cdh5-deficient embryos.

[0055] Microangiography was performed by first injecting fluorescent dextran beads into the atria of the two-chambered hearts of zebrafish embryos, which were then tracked through the circulation. Fluorescent dextran beads entered the systemic circulation via the atrioventricular (AV) valves and ventricles in control embryos, but the beads were trapped in the atria of cdh5-morphant embryos.

[0056] To examine cardiac structure, hearts were isolated from control and cdh5-silenced embryos and immunohistochemistry was performed for endothelium (gfp) and cardiomyocytes (mf20). We found that the atrial (A), atrioventricular (AV) valves, ventricles (V), and outflow tract (OT) were formed in cdh5-morphants, but the AV valves were elongated and distorted.

[0057] To investigate why circulation was weakened in cdh5 -silenced embryos, we analyzed the vascular structure, as well as blood circulation, heart rate, cardiac output, and cardiac tamponade in cdh5 -silenced embryos.

[0058] We analyzed intima integrity in mlb × kdr:dsRED embryos and found that arterial and venous structures were intact in cdh5-deficient embryos.

[0059] The chronological development of the heart, heart beating, blood vessels, blood circulation, and HSC formation are conserved in zebrafish, mice, and humans. During zebrafish development, the heart begins to beat approximately 23 hours post fertilization (hpf), blood circulation is initiated at approximately 24–26 hpf, and definitive HSCs arise from hemogenic endothelial cells in the AGM region between 30–48 hpf.

[0060] To analyze circulation within the blood vessels before and after the heart starts beating, we performed time-lapse confocal imaging of control and cdh5-silenced lcr:eGFP×flk1:mCherry embryos.

[0061] Even after the heart starts beating, lcr:eGFP + Erythrocytes were found to accumulate within the blood vessels of cdh5-silenced embryos, demonstrating the absence of active circulation in cdh5-morphants, even though the heart had begun to beat and blood vessels had formed.

[0062] To investigate cardiac function in cdh5-silenced embryos, we performed electrophysiological and cardiac ultrasound assessments. Although the cardiac rate in cdh5-MO embryos was comparable to controls, stroke volume was almost nonexistent in cdh5-MO embryos. Thus, cardiac output (= stroke volume × heart rate) was confirmed to be reduced in cdh5-MO embryos.

[0063] Cdh5-MO embryos had pericardial fluid accumulation in the heart chambers, which may be due to backflow of blood from the heart. Fluid accumulation in the pericardial cavity reduces ventricular filling and subsequently leads to poor hemodynamics. To examine whether cardiac tamponade was a factor in the accumulation of fluid in the pericardial cavity, the heart chambers of cdh5-MO embryos were punctured as in pericardiocentesis, and then pericardial fluid was aspirated to reduce the fluid pressure exerted on the heart. However, the cardiac output deficiency of cdh5-morphant hearts could not be restored.

[0064] Although cardiac beating was normal in cdh5-morphants, cardiac output in cdh5-morphants was impaired due to a structural cardiac defect that resulted in accumulation of blood in the pericardial cavity. Because cdh5-MO embryos have normal hematopoiesis, it was hypothesized that biomechanical forces derived from cardiac beating affect HSC formation in the absence of active circulation.

[0065] Although cdh5-MO embryos have a beating heart and no active circulation, cdh5-MO embryos have HSC formation in the aortic endothelium of their blood vessels. Zooming in on the AGM of control zebrafish embryos confirmed distinct vascular pulsations. To distinguish the presence of vascular pulsations independent of circulating blood cells from what is likely blood flow, we compared the vascular pulsation frequency to the pulsation frequency of circulating blood cells and the movement due to blood flow. Specifically, flk1:mCherry + Circulating lcr:eGFP in blood vessels + We performed time-lapse confocal imaging of the double transgenic line with red blood cells and Fourier analysis of the signals from both blood vessels and circulating blood cells. The frequency spectrum of blood vessels was found to have distinct peaks. Thus, although pulsation and blood flow in blood vessels coexist, their presence and properties are independent of each other.

[0066] To investigate the temporal, spatial, and functional presence of pulsations in the AGM at 36 hpf, we performed light sheet microscopy of vascular regions in control zebrafish embryos, followed by Fourier analysis. Data show that the AGM expresses flk1:eGFP + runx1:mCherry arising from endothelial cells + This further supports the distinct pulsation frequency at 36 hpf, the time and location for endothelial to hematopoietic cell conversion seen in time-lapse confocal imaging of HSPCs. Taken together, the AGM region appears to be beating, and pulsation in the AGM occurs simultaneously with endothelial to hematopoietic cell conversion.

[0067] Blood vessels are under constant mechanical load from blood pressure and blood flow mediated by cardiac pulsation, which produce circumferential wall stress and endothelial shear stress. Blood flow exerts shear stress on the endothelium, inducing vasodilation, while cardiac pulsation produces circumferential stretching of both endothelial and smooth muscle cells, resulting in mechanical dilation.

[0068] To analyze whether HSC derivation from cdh5-MO embryos is via or independent of blood flow- and shear stress-mediated NOS activation, the expression of HSPCs was analyzed in control and cdh5-MO embryos treated with the NOS inhibitor L-NAME. It was demonstrated that inhibition of NOS attenuates HSPC formation in control embryos but does not affect HSPC formation in cdh5-MO embryos. Thus, HSC derivation from cdh5-MO embryos is independent of NOS activation.

[0069] Taken together, heartbeat-mediated pulsation stimulates circulation-independent endothelial-to-HSC formation.

[0070] Stretch activates Piezo1 for HSC formation. Because biomechanical forces stimulate transformation of cell shape and fate, we hypothesized that pulsation-mediated cyclic stretching of hemogenic endothelial cells stimulates HSC formation.

[0071] To test the function of pulsation in the formation of HSCs from endothelium, we developed a bioreactor in which cyclic strain could be applied to AGM cells harvested from E11.5 mouse embryos (Figure 2A, top panel). Hematopoietic colony formation and flow analysis assays demonstrated that 10% cyclic strain enhanced the formation of multipotent hematopoietic progenitors, and this formation was attenuated by GdCl3-mediated all-pharmacological inhibition of stretch-activated receptors (SARs). GdCl3 also attenuated the expression of HSPCs in zebrafish embryos to the level of sih-MO embryos.

[0072] SAR family members have four sub-categories: K1-family members, as well as Piezo channels, TRP channels, and DEG / ENaC channels. Tissue expression and computational analysis showed Piezo1 and Trpv4 in endothelial and hematopoietic tissues, therefore their role in endothelial to HSC conversion was examined.

[0073] Loss-of-function analysis and pharmacological inhibition of trpv4 and Piezo1 abolished the expression of HSPC markers and endothelial-to-HSC conversion (Figure 1A). Conversely, pharmacological activation of trpv4 or Piezo1 enhanced the expression of HSPC markers in control embryos and restored the expression of HSPCs in sih embryos. Temporal and spatial analysis showed that trpv4 was undetectable in the AGM region of zebrafish embryos at 36 hpf, while Piezo1 was colocalized with Cd31 (endothelium) and c-Kit (hematopoietic) in the E11.5 AGM.

[0074] To confirm the molecular mechanisms underlying stretch-mediated HSC formation, we performed whole-transcriptome analysis of AGM treated with either repeated strain or a pharmacological activator of Piezo 1. We found that repeated strain and Piezo 1 activation gave rise to similar gene signatures ( Figure 1B ).

[0075] Pharmacological activation of Piezo1 further enhanced the formation of multipotent hematopoietic progenitors (Figure 1C), whereas pharmacological inhibition of Piezo1 attenuated cyclic strain-mediated induction of HSPC formation (Figure 1D). Taken together, cyclic strain-mediated biomechanical stretch activates Piezo1 to stimulate endothelial-to-HSC conversion.

[0076] Biomechanical stretch or Piezo1 activation produces LT-HSCs. To analyze whether repeated strain or Piezo1 activation produces long-term self-renewing HSCs (LT-HSCs), serial transplantation assays were performed. Primary transplants of AGM treated with repeated strain or Piezo1 activator showed higher engraftment and normal multilineage reconstitution (Figure 2A,B). In addition, bone marrow of primary recipients transplanted with AGM treated with repeated strain or Piezo1 activator contained two- to three-fold higher amounts of Lin. - Sca1 + c-Kit + Cd48 - Cd150 + HSCs were then transferred from primary recipients to immunodeficient secondary recipients. - Sca1 + c-Kit + Transplantation of HSPCs also resulted in higher engraftment and reconstitution of normal multicellular lineages (Figure 2C, Figure 2D). Therefore, it was expected that both repeated strain and / or Piezo1 activation would produce higher amounts of normal LT-HSCs. To test this hypothesis, limiting dilution assays were performed using serial amounts of Lin - Sca1 + c-Kit + The HSPCs were then transplanted into immunodeficient tertiary recipients. Analysis of the tertiary transplants demonstrated that the repeated strains produced two- to three-fold greater amounts of LT-HSCs.

[0077] To determine whether AGM-HSC (donor) would engraft and reconstitute normal adult blood, the molecular and functional characteristics of the reconstituted blood system were then analyzed in primary recipients transplanted with control, cyclic strain, or Piezo1 activator-treated AGM. Analysis of donor-derived erythroid cells in bone marrow demonstrated the upregulation of Cd71 in the presence of Bcl11a. + / Ter119 + Further analysis of donor-derived bone marrow cells in bone marrow and serum demonstrated sufficient expression of Gr1 + / Mac1 +We then demonstrated donor-derived chimerism in lymph nodes, thymus, and spleen, as well as Mac1 + Myeloid cells, Cd19 + B cells, and CD4 + / Cd8 + Analysis of T cells demonstrated that donor HSC-derived progenitors circulated and colonized hematopoietic niches to reconstitute the adult blood system. Analysis of serum from primary transplants also showed that they produced the normal repertoire of pre-immunization immunoglobulins (Igs), including IgG1, IgG2a, IgG2b, IgA, and IgM (Figure 3C). Splenic donor-derived Cd3 + Sorting of T cells from spleen donors using Mac1 + We demonstrated rearrangement of T cell receptor β (TCRβ) in primary grafts, which was absent in bone marrow cells (negative control) (Figure 3D). To analyze the functional properties of T cells in primary grafts, delayed-type hypersensitivity assays demonstrated successful recruitment of antigen-specific functional T cells in the footpad by sensitizing primary grafts with injection of sheep red blood cells (Figure 3E). Thus, repeated strain or Piezo1 activation of AGM or hemogenic endothelial cells produced HSCs that engrafted in the hematopoietic niche and reconstituted functional multicellular adult blood.

[0078] Biomechanical stretch and Piezo1 activation upregulate Dnmt3b for endothelial-to-HSC conversion. Since AGM is a heterogeneous tissue, it was unclear how stretch-mediated Piezo1 activation stimulates aortic endothelial cell fate conversion to HSC. Variable gene expression signatures from E10.5 AGM sorted endothelial cells, hemogenic endothelial cells, and HSC were obtained. Hierarchical clustering of AGM cyclic strain or Piezo1 activation-induced gene signatures in the context of AGM-derived endothelial cells, hemogenic endothelial cells, and HSC further provided a quantitative overview of overexpressed biological processes, molecular pathways, gene expression clusters, and their gene ontology (GO) terms. Venn diagram analysis of cyclic stretch- and / or Piezo1 activation-mediated genes upregulated during endothelial-to-HSC conversion identified Dnmt3b as a potential candidate mechanism involved in silencing endothelial machinery required for HSC formation (Figure 4). In addition, Gimap6 was also identified as a potential candidate mechanism involved in silencing endothelial machinery required for HSC formation.

[0079] To validate the bioinformatics and computational analyses, we analyzed the temporal and spatial protein expression of Dnmt3b in the E11.5 AGM. Immunohistochemistry assays demonstrated that Dnmt3b regulates Cd31 + Endothelium and c-Kit + We demonstrated that Dnmt3b colocalizes with hematopoietic cells, and therefore hypothesized that Dnmt3b may stimulate endothelial-to-HSC conversion.

[0080] Although Dnmt3b and Dnmt3a are highly homologous and have distinct functions in HSC maintenance or differentiation, their potential roles in endothelial to HSC conversion in the AGM were unknown. Gene signature and tissue expression analysis ruled out any involvement of Dnmt3a in HSC formation in the AGM. To distinguish between separate or overlapping hematopoietic roles of Dnmt3b and Dnmt3a, Dnmt3b and Dnmt3a protein levels were analyzed in nuclear fractions of repeated strain- or Yoda1-treated AGM cells, which revealed that repeated strain or Piezo1 activation stimulated Dnmt3b, but not Dnmt3a, protein expression in E11.5 AGM cells (Figure 5A).

[0081] To analyze whether vascular pulsation in the absence of blood flow stimulated HSC formation through activation of Dnmt3b, the expression of HSPC markers was measured in cdh5-MO embryos treated with the Dnmt3b inhibitor nanaomycin. Pharmacological inhibition of Dnmt3b attenuated the expression of HSPC markers in control and cdh5-MO embryos.

[0082] Next, the experiments in this example analyzed whether biomechanical stretch or Piezo1 activation stimulated endothelial cell-to-hematopoietic cell conversion via Dnmt3b activation. It was found that inhibition of Dnmt3b attenuated biomechanical stretch- or Piezo1 activation-mediated induction of multipotent hematopoietic progenitor cell formation (FIG. 5B), and endothelial cell-to-hematopoietic cell conversion (FIG. 5B). Nanaomycin treatment reverted hematopoietic cells to phenotypic endothelial cells, but such endothelial cells were not functional. Whole-mount in situ hybridization of HSPC markers and time-lapse imaging of endothelial-to-HSC conversion in nanaomycin-treated or dnmt3b-MO-injected zebrafish embryos treated simultaneously with or without Yoda1 further confirmed that inhibition or loss of dnmt3b attenuated the increased HSC formation mediated by Piezo1 activation (Figure 5C). Taken together, pulsation-mediated Piezo1 activation enhanced Dnmt3b expression in the AGM to stimulate endothelial-to-HSC conversion.

[0083] Production of HSCs from HE cells generated from human iPSCs Embryoid body and hemogenic endothelial cell differentiation was performed as described in (Sugimura et al. 2017, Ditadi et al. 2015). Briefly, hiPSC colonies were dissociated with 0.05% trypsin for 5 min at 37°C, washed with PBS+2% FBS, and resuspended in StemPro-34 (Invitrogen, 10639-011) supplemented with L-glutamine (2 mM), penicillin / streptomycin (10 ng / ml), ascorbic acid (1 mM), human holo-transferrin (150 μg / ml, Sigma T0665), monothioglycerol (MTG, 0.4 mM), BMP4 (10 ng / ml), and Y-27632 (10 μM). Five million cells were seeded in a 10 cm dish (Ezsphere, Asahi Glass Co., Ltd.) to form spheroids. On day 1, bFGF (5 ng / ml) and BMP4 (10 ng / ml) were added to the medium. On day 2, the medium was replaced with StemPro-34 supplemented with SB431542 (6 μM), CHIR99021 (3 μM), bFGF (5 ng / ml), and BMP4 (10 ng / ml). On day 3, the medium was replaced with StemPro-34 supplemented with VEGF (15 ng / ml) and bFGF (10 ng / ml). On day 6, the medium was replaced with StemPro-34 supplemented with bFGF (5ng / ml), VEGF (15ng / ml), interleukin (IL)-6 (10ng / ml), IGF-1 (25ng / ml), IL-11 (5ng / ml), SCF (50ng / ml), and EPO (2IU). Cells were maintained in an incubator with 5% CO2, 5% O2, and 95% humidity. All cytokines were purchased from Peprotech.

[0084] CD34 + To isolate cells, embryoid bodies (obtained on day 8) were dissociated with 0.05% trypsin, filtered through a 70 μm strainer, and purified using CD34 +Cells were isolated by CD34 magnetic bead staining and then passed through an LS column (Miltenyi). Every batch of samples was tested by FACS to verify its purity with a panel. The following antibodies were utilized: CD34-PEcy7 (Clone 581, Biolegend), FLK1-PE (CLONE#89106, BD), and 4',6-diamidino-2-phenylindole (DAPI).

[0085] Isolated CD34 + Cells were resuspended in StemPro-34 medium containing Y-27632 (10 μM), TPO (30 ng / ml), IL-3 (10 ng / ml), SCF (50 ng / ml), IL-6 (10 ng / ml), IL-11 (5 ng / ml), IGF-1 (25 ng / ml), VEGF (5 ng / ml), bFGF (5 ng / ml), BMP4 (10 ng / ml), and FLT3 (10 ng / ml) (Ferrel et al., 2015). Cells were seeded into thin-layer Matrigel-coated 24-well plates at a density of 50,000 cells per well. One day after seeding, Yoda1 (between 6.25 and 100 μM) was added to the cultures. After 7 days, floating cells were harvested and FACS analysis was performed. For FACS analysis, cells were stained with CD34-PEcy7 (Clone 581, Biolegend) and CD45-APC (Clone 2D1, Biolegend). All cytokines were purchased from Peprotech.

[0086] Yoda1 induced endothelial-to-hematopoietic conversion in human iPSC-derived HE cells (data not shown), and this effect was dose-dependent.

[0087] conclusion The generation, proliferation, and maintenance of long-term HSCs have been highly sought after in stem cell biology and hematopoiesis. Based on time-lapse confocal, light sheet, and Fourier transform analysis in zebrafish, not only was a scalable bioreactor that stimulates intravascular pulsation established, but activation of Piezo1 was also identified as a pharmacological target for converting endothelial cells into LT-HSCs. This study provides a novel transgene-free approach to develop LT-HSCs that can engraft upon serial transplantation, self-renew, and reconstitute into multicellular functional adult blood.

[0088] Heartbeat-mediated pulsation caused circumferential stretching of both endothelial and smooth muscle cells, resulting in mechanical dilation. However, Piezo1 was co-expressed between endothelial and hematopoietic cells in E11.5 AGM but not in vascular smooth muscle cells of blood vessels, suggesting that the hematopoietic role of biomechanical stretching and Piezo1 activation is specific to AGM-endothelial cells.

[0089] Biomechanical stretch of blood vessels could activate Piezo1, Trpv4, K1-family members, and DEG / ENaC channels. Activation of both Piezo1 and Trpv4 stimulated the conversion of endothelial cells to hematopoietic cells. However, only Piezo1 inhibition attenuated the stretch-mediated hematopoietic effect, suggesting that Piezo1 and Trpv4 may have partially redundant roles.

[0090] Activation of Dmnt3b abolished the endothelial mechanism that endows HSCs with self-renewal and multilineage reconstitution capabilities. Although inhibition of Dnmt3b reverted hematopoietic cells to phenotypic endothelial cells, these cells lacked functional endothelial properties, suggesting that the temporal and spatial role of Dnmt3b in endothelial-to-hematopoietic conversion was irreversible. Biomechanical stretch or Piezo1 activation enhanced the temporal and spatial expression of Dnmt3b without affecting the expression of Dnmt3a. The data demonstrated a distinction between the hematopoietic role of Dnmt3b and the leukemic role of Dnmt3a during HSC development and differentiation.

[0091] The findings disclosed herein demonstrate how biomechanical forces stimulate cell fate conversion and endow stem cells with self-renewal capabilities by triggering epigenetic mechanisms. This study also provides a platform for deriving LT-HSCs from endothelial or hemogenic endothelial cells derived from pluripotent stem cells (PSCs) or donor cells. While the goal is to develop universally compatible HSCs, the bioinspired bioreactor disclosed herein is a stepping stone for universally compatible transgene-free source cells to be available to treat patients with benign and malignant hematological, metabolic, immune, and bone marrow diseases.

[0092] material and method All procedures were approved by the Animal Care and Use Committees at Brigham and Women's Hospital and Boston Children's Hospital.

[0093] Mouse Cd45.2 (C57BL6 / J) and Cd45.1 (SJL) were purchased from Jackson Laboratory, and zebrafish morpholinos were purchased from GeneTools. Microangiography was performed by injecting fluorescently labeled dextran dye into the atria of zebrafish hearts, and their passage was recorded using live imaging. Immunostaining of zebrafish hearts and mouse AGM was analyzed using an inverted fluorescent microscope. Cardiac tamponade, cardiac rate, and pulsation frequency in zebrafish embryos were analyzed using bright-field imaging or time-lapse confocal microscopy. Red blood cell movement within blood vessels and endothelial-to-HSC conversion in zebrafish transgenic embryos were analyzed using time-lapse confocal imaging.

[0094] Pulsating vascular-like conditions were stimulated in vitro using a Flexcell FX-4000 machine. To analyze the role of pharmacological targets in regulating endothelial-to-HSC conversion, AGM derived from mouse embryos or whole mouse embryos were exposed to biomechanical stretch, chemicals, or drugs ex vivo. Hematopoietic colony formation assays were then performed by incubating cells derived from mouse AGM in StemCell M3434 medium for 7 days. Serial transplants of AGM-derived HSCs were performed in lethally irradiated SJL mice. Stem cell frequency upon biomechanical stretch was analyzed using limiting dilution assays. To characterize the properties of AGM-HSC-derived blood cells in primary transplants, the percentage of chimerism and reconstitution was measured using FACS, globin transcripts were analyzed using quantitative reverse transcriptase PCR, the amount of myeloperoxidase was measured using a PicoKine ELISA kit, TCR-β rearrangement was analyzed using PCR for the TCR-β locus, detection of preimmune IG was analyzed using a Thermo-Fisher Mouse Ig Isotyping kit, and delayed-type hypersensitivity reactions were analyzed by injecting sheep RBCs (Rockland Immunochemicals) into the footpads of presensitized mice.

[0095] RNA sequencing analysis was performed to measure gene expression patterns in mouse AGM treated with repetitive strain or pharmacological modulators. A computer algorithm was used to perform hierarchical clustering of differentially expressed genes to measure their overrepresented biological processes and pathways. Gene expression clusters of differentially expressed genes were analyzed and their average expression levels per cell population were compared. Venn diagram comparisons of up and down genes were then constructed to analyze candidates important for repetitive strain or pharmacological modulator-mediated endothelial to HSC conversion. Furthermore, the expression of Dnmt3b and Dnmt3a proteins was analyzed in the nuclear fraction of mouse AGM cells using the EqiQuick assay kit. Data are presented as mean ± sd unless otherwise stated. Statistical analysis was performed by paired or unpaired Student's t-test. Significance was set at P<0.05.

[0096] animal Wild-type AB, Casper, and transgenic zebrafish lines lcr:eGFP, flk1:mCherry, flk1:eGFP, cd41:eGFP were used in the experiments. Embryos were used up to 4 days after fertilization. Cd45.2 (C57BL6 / J) and Cd45.1 (SJL) mice from the Jackson Laboratory were used in the experiments.

[0097] Morpholino Morpholino antisense oligos were obtained (Gene Tools, sequences below) and injected into one-cell stage casper zebrafish embryos. Injected and non-injected embryos were incubated in E3 medium at 28°C until fixation. cdh5-MO (5'-TACAAGACCGTCTACCTTTCCAATC-3', SEQ ID NO: 1) sih-MO (5'-CATGTTTGCTCTGATCTGACACGCA-3', SEQ ID NO: 2) Piezo1-MO (5'-CAAAGTTCAGTTCAGCTCACCTCAT-3', SEQ ID NO:3) dnmt3bb.1-MO1 (5'-TTATTTCTTCCTTCCTCATCCTGTC-3', SEQ ID NO: 4) dnmt3bb.1-MO2 (5'-CTCTCATCTGAAAGAATAGCAGAGT-3', SEQ ID NO:5)

[0098] Chemical treatment of embryos Zebrafish embryos were treated with the following chemical modulators in E3 fish medium: 100 uM L-NAME (Fisher Scientific), 50 uM digitoxigenin (Sigma), 25–50 uM Yoda1 (Cayman Chemical), 1 uM nanaomycin (Nana, Fisher Scientific), 100 uM gadolinium chloride (GdCl3, Sigma), 5–10 uM 4α-phorbol 12,13-didecanoate (4Αpdd, Sigma), or GSK205 (10 uM).

[0099] Microangiography Fluorescent dye-labeled dextran beads were injected into the atria of control and cdh5-MO embryos, and real-time bright-field videos were captured using a Nikkon SMZ1500 stereomicroscope.

[0100] Heart rate and cardiac output Images of live zebrafish hearts were acquired with an Axioplan (Zeiss) upright microscope with a 5× objective using built-in incandescent illumination, and a FastCam-PCI high-speed digital camera (Photron) with a 512×480 pixel grayscale image sensor. Images were acquired at 250 frames per second, with 1088 frames (8 cardiac cycles) acquired per condition. Custom software (implemented in MATLAB®) was used to determine cardiac rate from sequential image files. The long and short axes of the ventricles were measured manually using ImageJ, both in diastole and systole for each video, and used to estimate heart chamber volumes using standard geometric assumptions. For at least 10 embryos per morpholino dose, cardiac output was measured as the ventricular volume in diastole minus the ventricular volume in systole multiplied by the heart rate (Shin et al., 2010).

[0101] Periodicity Analysis Zebrafish Casper embryos were embedded in 0.8% low melting agarose with tricaine (Sigma) and mounted on a petri dish. A Nikon SMZ1500 stereomicroscope with NIS Elements (Nikon Corporation) software was then used to capture real-time bright-field videos of beating blood vessels in the AGM region. The videos were used to quantify the pulsation frequency in blood vessels.

[0102] Brightfield live imaging For live brightfield imaging, zebrafish Casper embryos were embedded in 0.8% low-melting agarose with tricaine (Sigma) and mounted in a Petri dish. Real-time brightfield video and still images were captured using a Nikon SMZ1500 stereomicroscope equipped with NIS Elements (Nikon Corporation) software.

[0103] Confocal microscopy We crossed cd41:eGFP with flk1:mCherry zebrafish and flk1:mCherry with lcr:eGFP zebrafish and injected morpholinos into these transgenic embryos. Transgenic embryos were mounted in low melting agarose and analyzed using a spinning disk confocal microscope for flk1 expression at 30 to 42 hpf. + Endothelium-derived cd41:eGFP + Time-lapse confocal imaging of HSCs was performed. + The relative movement of red blood cells was monitored using flk1:mCherry + The endothelium was analyzed in a cellular context. We performed image analysis using Imaris (Bitplane) software.

[0104] Whole-mount in situ hybridization Whole-mount in situ hybridization was performed as previously described.

[0105] Cardiac tamponade A microinjection needle was used to puncture the pericardium to release the fluid that constitutes the periphery of the heart in 48 hpf cdh5-MO-injected zebrafish embryos.

[0106] immunostaining E10.5 chimeric mouse embryos were harvested, embedded in paraffin blocks, cross-sectioned, and immunostained with primary antibodies Piezo1 (rabbit anti-mouse IgG, Abcam), Cd31 (donkey anti-mouse IgG, R&D Systems), c-Kit (rabbit anti-mouse IgG, R&D Systems), or Dnmt3b (donkey anti-mouse IgG, Abcam), and 4,6 diamidino-2-phenylindole (DAPI) antibodies, and secondary antibodies Alexa Fluor 488 (donkey anti-rabbit IgG, Fisher Scientific) and Alexa Fluor 647 (donkey anti-goat IgG, Abcam) to detect their expression in the E10.5 AGM region.

[0107] Expression of flk1 (GFP), mf2 (mCherry), and DAPI (violet) was measured in hearts isolated from control and cdh5-MO-silenced zebrafish embryos.

[0108] AGM explant E11.5 AGM were harvested from C57BL6 / J Cd45.2 mouse embryos and single cell suspensions of 3 embryo equivalents of cells were seeded into each well of a BioFlex 6-well culture plate (FlexCell). We cultured the cells overnight applying repeated strain (Flexcell® FX-4000™ Tension System) and / or treatment with chemical modulators (25-50 μM Yoda1, 1 μM Nanaomycin, 100 μM Gdcl3, 1 uM GsMTx4, 5-20 μM 4αPDD, 10 uM GSK205). The harvested cells were then used to perform transplantation, fluorescence-activated cell sorting (FACS) analysis, and colony-forming unit (CFU) assays.

[0109] Ex vivo incubation of embryos with drugs E11.5 mouse embryos were collected from the uterus of time-mated pregnant females and placed into sterile glass vials containing FBS, 1 mM glucose, 1% penicillin-streptomycin, and / or selected chemical modulators (25-50 μM Yoda1, 1 μM nanaomycin, 5-20 μM 4αPDD, or 10 uM GSK205). We placed the glass vials in an ex vivo incubator (BTC Engineering, Cambridge, UK) consisting of a roller apparatus (rotating at ≈30 rpm), a constant gas supply (21% O2, 5% CO2, balance N2), and a constant temperature of 37°C. After 24 hours, AGMs were harvested and analyzed for hematopoietic cell formation by FACS and CFU assays.

[0110] transplant For primary transplants, 3 embryonic equivalents of untreated or treated (repeated strain or 25 μM Yoda1) AGM and splenic helper cells (≈0.5 million per mouse) were injected by retroorbital injection into lethally irradiated (fractionated dose 10.5 cGy) Cd45.1 (SJL) mice. For secondary and tertiary transplants, bone marrow was isolated from transplanted mice (legs, arms, pelvic bones, spine, sternum). Bone marrow was loaded onto a Ficoll gradient (Histopaque®-1083, Sigma-Aldrich) and cells from the buffy coat were incubated with biotin-conjugated lineage antibodies and streptavidin microbeads (Miltenyi Biotec). Next, cell line-negative (Lin - ) Cells were separated using a MACS LS column (Miltenyi Biotec) and the Lin - Sca1 + c-Kit + (LSK) cells were sorted on a MoFlo Beckman Coulter sorter. Sorted Cd45.2 LSK cells were then mixed with Cd45.1 splenic helper cells (≈0.5 million per mouse) and transplanted into irradiated (fractionated dose 10.5 cGy) Cd45.1 SJL mice by retroorbital injection.

[0111] Surviving recipients were counted as responses to limiting dilution assays: confidence intervals 1 / (stem cell frequency) were calculated by ELDA according to the Poisson distribution.

[0112] CFU assay and FACS assay For CFU assays, AGM explants or ex vivo cells were plated in MethoCult GF M3434 medium (StemCell Technologies). Seven days after seeding, we analyzed their ability to generate granulocytic, erythroid, macrophage, megakaryocyte (GEMM), granulocyte macrophage (GM), granulocytic (G), macrophage (M), and erythroid (E) colonies.

[0113] Explant and ex vivo AGM cells were stained with Sca1-Pacific-Blue (E13-161.7, Biolegend) and Flk1-APC-Cy7 (Avas 12α1, BD). Blood of transplanted mice was stained with the following antibody cocktail: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Cd3-PE (145-2C11, Biolegend), Cd8-PE (53-6.7, Biolegend), Mac1-APC (M1 / 70, Biolegend), Gr1-APC (108412, Biolegend), Cd19-APC-CY7 (6D5, Biolegend), B220-APC-CY7 (RA3-6B2, Biolegend).

[0114] Bone marrow, spleen, thymus, and lymph node cells from mice transplanted with E11.5 AGM cells were stained with the following antibody panel: bone marrow LT-HSC: Cd45.2-FITC (104, Biolegend), Ter119-biotin (TER-119 (BD), Gr1-biotin (RB6-8C5, BD), Cd5-biotin (53-7.3, BD), Cd8a-biotin (53-6.7, BD), B220-biotin (RA3-6B2, BD), streptavidin-Pacific Blue (eBioscience), Sca1-PE-CY7 (D7, eBioscience), cKit-APC (2B8, eBioscience), Cd48-APC-CY7 (HM48-1, BD), Cd150-PE-CY5 (TC15-12F12.2, Biolegend). Bone marrow erythroid differentiation RI-RV: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Ter119-APC (TER-119, Biolegend), Cd71-PE (R17217, eBioscience). Bone marrow granulocytes: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Gr1-PE (RB6-8C5, BD), Mac1-APC (M1 / 70, Biolegend). Spleen, thymus, and lymph node T cells: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Cd8-PE (53-6.7, Biolegend), Cd4-APC (RM4-5, eBioscience). Spleen, thymus, and lymph node bone marrow and B cells: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Cd19-APC-CY7 (6D5, Biolegend), Mac1-APC (M1 / 70, Biolegend). We performed all FACS analyses on a BD Fortessa cytometer. We performed hematopoietic organ analyses 16 weeks after transplantation.

[0115] Quantitative reverse transcriptase-polymerase chain reaction analysis (qRT-PCR) Using FACS, erythroid precursors (Cd45.2) obtained from unlysed bone marrow isolated from AGM-implanted mice were analyzed. + , Ter119 + , Cd71 + ) were selected. Total RNA was isolated using RNAeasy Minikit (QIAGEN) and cDNA synthesis was performed using Superscript III (Invitrogen). Quantitative real-time PCR was performed on an MX3000P machine using SYBR Green (QuantaBio) with the indicated primers (Sankaran et al., 2009). We normalized expression to that of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) (Ochida et al., 2010).

[0116] Myeloperoxidase (MPO) expression Neutrophil (Cd45.2 + ,Gr1 + , Mac1 + ) were FACS sorted from isolated bone marrow of 16-week-old primary transplanted mice and cultured in 24-well plates overnight (0.5 million cells / mL) in IMDM with 10% FBS. Supernatants were collected and MPO concentrations were measured using a Mouse MPO / Myeloperoxidase PicoKine™ ELISA kit (Boster). MPO concentrations were also measured in serum.

[0117] PCR assay for TCR-β rearrangements T cells (Cd45.2 + , Cd3 + ) and bone marrow cells (Cd45.2 + , Mac1 +) were FACS sorted from splenocytes of 16-week-old primary transplanted mice. Genomic DNA was then extracted and PCR was performed for DH β2.1-JH β2.7 rearrangement within the TCR-β locus. Our samples were denatured (94°C, 1 min), annealed (63°C, 2 min), and extended (72°C, 2 min) for 35 cycles. The primer sequences are as follows: DH β2.1 5': 5'-GTAGGCACCTGTGGGGAAGAAACT-3'; SEQ ID NO: 6, and JH β2.7 3': 5'TGAGAGCTGTCTCCTACTATCGATT; SEQ ID NO: 7 (Lu et al., 2017).

[0118] Detection of preimmune Ig Serum was isolated from 16-week-old primary engrafted mice, and preimmune Ig isotypes were quantified by mouse Ig isotyping kit (Thermo Fisher).

[0119] Delayed hypersensitivity reactions The recipient mice were injected with sheep red blood cells (sRBCs, 10 9 Six days after sensitization, mice were sensitized with 2 × 10 cells / mL, 50 μL per site, Rockland Immunochemicals. 9 RBCs / mL in the right footpad and an equal volume of PBS in the left footpad (as a control). 48 hours after challenge, footpad thickness was measured with a microcaliper. We normalized the percent change on day 6 to the pre-challenge thickness of each footpad.

[0120] Expression of DNA methyltransferases Nuclear extracts from AGM explants were harvested using the EpiQuik Nuclear Extraction kit (Epigentek Group Inc.). Dnmt3b and Dnmt3a protein levels were analyzed using a colorimetric EpiQuik assay kit (Epigentek Group Inc.) according to the manufacturer's instructions. Dnmt3b and Dnmt3a concentrations are relative to 1 μg of nuclear extract protein.

[0121] RNAseq and computational analyses Total RNA of E11.5 mouse AGM explant cultures was isolated with RNAeasy MiniKit (QIAGEN) (control, stretch, Yoda1, and 4αPDD conditions). Our cDNA libraries were generated by BGI Americas Corporation and sequenced on a HiSeq4000 instrument (Illumina) with 8 samples per lane. We mapped our sequenced reads against the mouse reference genome GRCm38 (ENSEMBL release 69) using the Genomic Short-Read Nucleotide Alignment program (version 2012-07-20). DESeq2 and DEXSeq were used to test for expression variation (FDR=0.1) and exon usage variation, respectively. Gene expression clusters of differentially expressed genes were analyzed and their average expression levels per cell population were compared. Next, a Venn diagram comparison of up and down genes was performed to analyze candidates important for repeated strain or pharmacological modulator-mediated endothelial to HSC conversion. Specifically, we performed hierarchical clustering with bootstrap analysis using the gplots package (Warners et al., 2017) in R (R Development Core Team, 2012). For GO analysis, we tested for over-representation of our differentially expressed genes in GO categories or pathways using Fisher's exact test and corrected for multiple testing using the Bonferroni method. We performed GO term enrichment analysis as previously described, using a P value of 0.001 as the minimum for statistically significant enrichment.

[0122] statistical analysis Data are expressed as mean ± standard error of the mean (mean ± SEM) unless otherwise stated. Statistical analysis was performed by paired or unpaired Student's t-test. Significance was set at P<0.05. The present invention may provide the following aspects. [1] 1. A method for preparing a population of hematopoietic stem cells (HSCs), comprising: Under conditions sufficient to stimulate the formation of HSCs A method comprising providing a population comprising endothelial cells and / or hematopoietic endothelial (HE) cells, and increasing the activity or expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) and / or GTPase IMAP family member 6 (Gimap6) in the cells. [2] The method according to [1] above, further comprising recovering the HSCs. [3] The method according to [2] above, comprising contacting the endothelial cells and / or HE cells with an effective amount of an agonist that increases the activity or expression of Dnmt3b. [4] The method according to [3] above, wherein the agonist is an agonist of a mechanosensitive receptor or a mechanosensitive channel. [5] The method according to [4] above, wherein the mechanosensitive receptor is Piezo1. [6] The method according to [5] above, wherein the Piezo1 agonist is Yoda1. [7] The method according to [6] above, wherein the effective amount of the Yoda1 agonist is in the range of 5 to 500 uM, or in the range of 5 to 100 μM. [8] The method according to any of [1] to [7] above, wherein the increasing of Dnmt3b activity or expression comprises increasing Dnmt3b mRNA expression in the endothelial cells and / or HE cells, introducing a Dnmt3b transgene and / or episome, and / or introducing a genetic modification of a Dnmt3b expression element. [9] The method according to [1] above, wherein the endothelial cells and / or HE cells are derived from HLA-modified or HLA-null cells, and / or transgene-free cells, and optionally are derived by genetic or chemical induction of iPS cells or somatic cells.

[10] The method according to any one of [1] to [9] above, wherein the source cells are obtained or derived from a subject, said subject being optionally a universally matched donor.

[11] The method according to

[10] above, wherein the source cells are obtained or derived from a subject having a blood disease, bone marrow disease, metabolic disease, or immune disease.

[12] The method according to

[11] above, wherein the subject does not have a hematological malignancy.

[13] The method of claim 10, wherein the population of HSCs is administered to a recipient.

[14] The method according to

[13] above, wherein the source cells were derived from the recipient.

[15] The method according to any one of the above [1] to

[14] , wherein the hematopoietic stem cells comprise long-term hematopoietic stem cells (LT-HSCs).

[16] The method according to

[15] above, comprising providing a biomechanical stimulus to increase said activity or expression of Dnmt3b.

[17] The method according to any of the above [1] to

[16] , further comprising increasing the activity or expression of Gimap6 in the endothelial cells.

[18] The method described in

[17] above, wherein the increasing of Gimap6 activity or expression comprises increasing Gimap6 mRNA expression in the HE cells, introducing a Gimap6 transgene and / or an episome, and / or introducing a genetic modification of a Gimap6 expression element.

[19] The method according to [1] above, comprising providing a population containing hemogenic endothelial (HE) cells to a bioreactor.

[20] The method according to

[19] above, wherein the bioreactor provides biomechanical extension through cyclic strain.

[21] The method according to

[20] above, wherein the biomechanical stretching by cyclic strain increases the activity or expression of Dnmt3b.

[22] The method according to

[20] above, wherein the biomechanical stretching by cyclic strain increases the activity or expression of Gimap6.

[23] The method according to any one of the above [1] to

[22] , wherein the HSCs engraft in the hematopoietic niche and reconstitute functional multicellular adult blood.

[24] The method according to any one of the above [1] to

[23] , wherein the HE cells are obtained from induced pluripotent stem cells (iPSCs), non-hematopoietic stem cells, somatic cells, or endothelial cells.

[25] A pharmaceutical composition comprising a population of HSCs prepared by the method according to any one of [1] to

[24] above, and a pharma- ceutically acceptable vehicle.

[26] At least 10 2 The pharmaceutical composition according to

[25] above, comprising cells.

[27] A method for treating a subject in need of hematopoietic stem cell therapy or transplantation, comprising administering to the subject a therapeutically effective amount of hematopoietic stem cells (HSCs) prepared by the method described in any one of [1] to

[24] above, or the pharmaceutical composition described in

[25] or

[26] above.

[28] The method according to

[27] above, wherein the subject has a malignant or non-malignant form of a blood, bone marrow, metabolic, or immune disease.

[29] The method according to

[27] or

[28] above, wherein the subject has multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's disease, acute myeloid leukemia, neuroblastoma, germ cell tumor, an autoimmune disorder (systemic lupus erythematosus (SLE) or systemic sclerosis), myelodysplastic syndrome, or amyloidosis.

[30] Hematopoietic stem cells (HSCs) prepared by the method described in any of [1] to

[24] above, or the pharmaceutical composition described in

[25] or

[26] above, for use in hematopoietic stem cell therapy or treatment of a subject in need of transplantation.

[31] The HSC or pharmaceutical composition for use according to

[30] above, wherein the subject has a malignant or non-malignant form of a blood, bone marrow, metabolic or immune disease.

[32] The HSC or pharmaceutical composition for use according to

[30] or

[31] above, wherein the subject has multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's disease, acute myeloid leukemia, neuroblastoma, germ cell tumor, an autoimmune disorder (systemic lupus erythematosus (SLE) or systemic sclerosis), myelodysplastic syndrome, or amyloidosis.

Claims

1. 1. A method for preparing a population of hematopoietic stem cells (HSCs), comprising: Under conditions sufficient to stimulate the formation of HSCs, providing a population comprising hemogenic endothelial (HE) cells and increasing expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) in said HE cells ex vivo; Increasing the expression of Dnmt3b introducing mRNA encoding Dnmt3b into said HE cells; introducing a Dnmt3b transgene or episome into said HE cells; or Introducing a genetic modification of the Dnmt3b expression element in said HE cells. or said increasing expression of Dnmt3b is by contacting said HE cells with an agonist of Piezo1; The method.

2. The method of claim 1, further comprising recovering the HSCs.

3. The method of claim 2, comprising contacting said HE cells with an effective amount of said agonist of Piezo1.

4. The method of claim 3, wherein the agonist of Piezo1 is Yoda1.

5. The method of claim 4, wherein the effective amount of Yoda1 is in the range of 5 to 500 μM, or in the range of 5 to 100 μM.

6. 3. The method of claim 1 or 2, wherein said increasing expression of Dnmt3b comprises introducing mRNA encoding Dnmt3b into said HE cells, or introducing a Dnmt3b transgene or episome into said HE cells.

7. The method of claim 1, wherein the HE cells are derived from HLA-modified or HLA-null cells, and / or transgene-free cells.

8. 8. The method of any one of claims 1 to 7, wherein the source cells are obtained or derived from a subject.

9. 9. The method of claim 8, wherein the source cells are obtained or derived from a subject having a blood disorder, bone marrow disorder, metabolic disorder, or immune disorder.

10. 10. The method of claim 9, wherein the subject does not have a hematological malignancy.

11. The method of any one of claims 1 to 7, wherein the HE cells are derived from induced pluripotent stem cells (iPSCs).

12. The method of any one of claims 1 to 11, wherein the hematopoietic stem cells comprise long-term hematopoietic stem cells (LT-HSCs).

13. 13. A pharmaceutical composition comprising a population of HSCs prepared by the method of any one of claims 1 to 12, and a pharma- ceutically acceptable vehicle.

14. At least 10 ２ The pharmaceutical composition of claim 13 comprising cells.

15. At least 10 ３ The pharmaceutical composition of claim 13 comprising cells.

16. At least 10 ４ The pharmaceutical composition of claim 13 comprising cells.

17. At least 10 ５ The pharmaceutical composition of claim 13 comprising cells.

18. 18. The pharmaceutical composition of any one of claims 13 to 17, for use in treating a subject in need of hematopoietic stem cell therapy or transplantation.

19. 20. The pharmaceutical composition of claim 18, wherein the subject has a malignant or non-malignant form of a hematological, bone marrow, metabolic, or immune disorder.

20. The pharmaceutical composition of claim 18, wherein the subject has a myeloproliferative disorder.

21. 20. The pharmaceutical composition of claim 18, wherein the subject has multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's disease, acute myeloid leukemia, neuroblastoma, germ cell tumor, or myelodysplastic syndrome.

22. 20. The pharmaceutical composition of claim 18, wherein the subject has a condition selected from acute myeloid leukemia, acute lymphoblastic leukemia, and chronic lymphocytic leukemia.

23. 20. The pharmaceutical composition of claim 18, wherein the subject has pure red cell aplasia, paroxysmal nocturnal hemoglobinuria, Fanconi anemia, thalassemia major, or sickle cell anemia.

24. 19. The pharmaceutical composition of claim 18, wherein the subject has severe combined immunodeficiency (SCID), Wiskott-Aldrich syndrome, or hemophagocytic lymphohistiocytosis.

25. 20. The pharmaceutical composition of claim 18, wherein the subject has severe congenital neutropenia, Shwachman-Diamond syndrome, Diamond-Blackfan anemia, or leukocyte adhesion deficiency.

26. (a) a population of hemogenic endothelial (HE) cells; and (b) an agent that increases expression of DNA (cytosine-5-)-methyltransferase 3 beta (Dnmt3b) in the HE cells; (a) a pharmaceutical composition comprising a population of HE cells, (b) in combination with an agent that increases expression of Dnmt3b in HE cells; or (b) a pharmaceutical composition comprising an agent that increases expression of Dnmt3b in HE cells, for use in combination with (a) a population of HE cells, The agent is an agonist of Piezo1, an mRNA of Dnmt3b, or a transgene or episome of Dnmt3b; The pharmaceutical composition.

27. 27. The pharmaceutical composition of claim 26, wherein the pharmaceutical composition is for treating a subject in need of hematopoietic stem cell therapy or transplantation.

Images