Method for producing hydroxytyrosol

Abstract

To provide a method for producing hydroxytyrosol with improved productivity.SOLUTION: A method for producing hydroxytyrosol includes the step of reacting tyrosol with a microorganism, wherein the microorganism is a microorganism modified so that a gene encoding 4-hydroxyphenyl acetate-3-hydroxylase is incorporated into a chromosome in an expressible manner.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present disclosure relates to a method for producing hydroxytyrosol. [Background technology]

[0002] Hydroxytyrosol is a high-value compound and there is an increasing demand for stable and sustainable production of high-purity hydroxytyrosol. Hydroxytyrosol is one of the most powerful antioxidants with potential biological functions as an antitumor, antiatherogenic, anti-inflammatory and / or antiplatelet aggregation agent, and has a wide range of potential applications in industries such as functional foods, nutraceuticals, cosmetics and animal feed.

[0003] Hydroxytyrosol can be produced from olive extract, and its production by bioconversion using microorganisms and enzymes has also been proposed (Patent Documents 1 and 2, Non-Patent Documents 1 and 2). Methods for producing hydroxytyrosol from tyrosol as a raw material have been reported, including a method that utilizes Pseudomonas aeruginosa (Non-Patent Document 1) and a method that utilizes the tyrosinase enzyme of Ralstonia solanacreaum (Patent Document 1). As a method for producing hydroxytyrosol from L-3,4-dihydroxyphenylalanine (L-DOPA) as a raw material, a method using a modified Escherichia coli has been reported (Patent Document 2, Non-Patent Document 2). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Special Publication No. 2017-538432 [Patent Document 2] Special Publication No. 2019-524076 [Non-patent literature]

[0005] [Non-Patent Document 1] Z. Bouallagui and S. Sayadi, Bioconversion of p-Tyrosol into Hydroxytyrosol under Bench-Scale Fermentation, BioMed Research InternationalVolume 2018, Article ID 7390751 [Non-Patent Document 2] Chaozhi Li et al., Efficient Synthesis of Hydroxytyrosol from l-3,4-Dihydroxyphenylalanine Using Engineered Escherichia coli Whole Cells, J. Agric. Food Chem., 2019, 67, 24, 6867-6873 Summary of the Invention [Problem to be solved by the invention]

[0006] The method using Pseudomonas aeruginosa (Non-Patent Document 1) has problems such as the fact that Pseudomonas aeruginosa is a pathogenic bacterium, making it unsuitable for mass cultivation. To solve this problem, a method that utilizes enzymes instead of live bacteria (Patent Document 1) has been proposed. However, in order to prepare enzymes, it is necessary to grow the microorganisms that produce the enzymes and then purify the enzymes, which is time-consuming. In particular, the cost of purifying enzymes increases significantly. In addition, if the enzyme requires a coenzyme, it is necessary to add the coenzyme to the reaction solution or to create a coenzyme regeneration system, but coenzymes are generally expensive. In addition, in order to create a coenzyme regeneration system, another enzyme is required. In addition, a method using live bacteria with L-DOPA as a raw material has been proposed (Patent Document 2 and Non-Patent Document 2), but the raw material L-DOPA is very expensive. Even if a process of making bacteria produce L-DOPA is adopted, it is difficult to mass-produce L-DOPA with this method.

[0007] The present disclosure provides a method for producing hydroxytyrosol using live bacteria, which improves productivity. [Means for solving the problem]

[0008] The present disclosure relates to a method for producing hydroxytyrosol, comprising a step of reacting tyrosol with a microorganism, the microorganism being a microorganism that has been modified so that a gene encoding 4-hydroxyphenylacetate-3-hydroxylase is incorporated into the chromosome in an expressible manner. Effect of the Invention

[0009] According to the present disclosure, a method for producing hydroxytyrosol with improved productivity using live bacteria can be provided. [Brief description of the drawings]

[0010] [Figure 1] FIG. 1 is a graph showing the progress of hydroxytyrosol production by tyrosol fed-batch culture of a strain in which the hpaBC gene has been introduced into the E. coli chromosome. [Diagram 2] FIG. 2 is a graph showing the progress of hydroxytyrosol production by tyrosol fed-batch culture of E. coli MG1655(DE3) / pET21a-FRT-hpaBC strain carrying the hpaBC gene on a plasmid. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The present disclosure is based on the discovery that in a microorganism used to produce hydroxytyrosol from tyrosol, the productivity of hydroxytyrosol is significantly improved when the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is introduced into a chromosome as compared to when it is introduced as a plasmid.

[0012] [Microorganisms] The microorganism used in the present disclosure, that is, the host microorganism to which the modification is made so that the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is integrated into the chromosome in an expressible manner, is not particularly limited. One or more embodiments of the microorganism include yeast and bacteria.

[0013] Examples of yeast include Saccharomyces cerevisiae, Pichia pastoris, and Schizosaccharomyces pombe. Examples of bacteria include Escherichia coli, Pseudomonas, and Corynebacterium. Examples of E. coli include E. coli K12 and B strains, and strains derived therefrom. Examples of strains derived from E. coli K12 include MG1655, W3110, W1330, JM109, HST02, HB101, DH5α, and DE3 strains in which the lambda DE3 gene has been integrated into the chromosome of these strains. Examples of strains derived from B strains include BL21, BL21(DE3), etc. The E. coli may be a naturally occurring mutant strain derived from these strains or an artificially genetically modified strain.

[0014] [4-Hydroxyphenylacetate-3-hydroxylase] In this disclosure, 4-hydroxyphenylacetate-3-hydroxylase refers to the enzyme also called 4-hydroxyphenylacetate-3-monooxygenase. The 4-hydroxyphenylacetate-3-hydroxylase of the present disclosure is capable of catalyzing the chemical reaction of tyrosol to hydroxytyrosol. The 4-hydroxyphenylacetate-3-hydroxylase is not limited as long as it has the above-mentioned catalytic function. In one or more embodiments, the 4-hydroxyphenylacetate-3-hydroxylase is a bicomponent enzyme, and in one or more embodiments, the bicomponent enzyme contains reduced flavin adenine nucleotide (FAD) as a coenzyme, i.e., FADH 2 It is a two-component FAD-dependent monooxygenase that uses

[0015] In one or a plurality of embodiments, 4-hydroxyphenylacetate-3-hydroxylase of the present disclosure is a gene product of the hpaBC gene of E. coli or a gene product of an orthologue thereof, or a two-component enzyme derived therefrom. In one or more embodiments, the amino acid sequence of the HpaB protein, the product of the hpaB gene of E. coli, is represented by SEQ ID NO:11. In one or more embodiments, the amino acid sequence of the HpaC protein, the product of the hpaC gene of E. coli, is represented by SEQ ID NO:12. In this disclosure, "ortholog" refers to related genes with homologous functions that exist in different organisms. In the present disclosure, a "derived enzyme" refers, in one or more embodiments, to an enzyme whose amino acid sequence is 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identical to the amino acid sequence of the original enzyme. In the present disclosure, the term "derived enzyme" refers to, in one or more embodiments, an enzyme that has the function of "catalyzing the chemical reaction that converts tyrosol to hydroxytyrosol" to the same extent as the original enzyme. In one or more embodiments, the same extent means that the difference in activity is within ±25%, ±20%, ±15%, ±10%, or ±5%.

[0016] [The gene encoding 4-hydroxyphenylacetate-3-hydroxylase] In the present disclosure, the gene to be introduced into the host microorganism can be the above-mentioned gene encoding 4-hydroxyphenylacetate-3-hydroxylase. When 4-hydroxyphenylacetate-3-hydroxylase is an enzyme composed of two or more components, in one or more embodiments, the "gene encoding 4-hydroxyphenylacetate-3-hydroxylase" in the present disclosure is composed of genes equal to the number of components. In this case, the "gene encoding 4-hydroxyphenylacetate-3-hydroxylase" can be considered to be composed of multiple genes, or can be considered to be one gene composed of multiple genes.

[0017] In one or a plurality of embodiments, the gene includes the hpaBC gene of E. coli or an orthologue thereof. The hpaBC gene of E. coli may be a wild-type gene or a gene registered in a database (such as NCBI GENBANK) at the time of filing the present application, and may have a different sequence to the extent that it performs the same function as the wild-type gene or encodes a protein equivalent to the wild-type gene, or may be an orthologous sequence as described above. In addition, the gene may be codon-optimized for expression in a host microorganism. The hpaBC gene of Escherichia coli is an operon formed by the hpaB gene and the hpaC gene, and in one or more embodiments, the hpaB gene is represented by SEQ ID NO: 9 in the sequence listing, and in one or more embodiments, the hpaC gene is represented by SEQ ID NO: 10 in the sequence listing. Thus, in one or more embodiments, the gene includes a gene comprising the two base sequences represented by SEQ ID NOs: 9 and 10 in the Sequence Listing, or a gene comprising two base sequences in which one or more of the base sequences represented by SEQ ID NOs: 9 and 10 in the Sequence Listing have been deleted, substituted, and / or added, and which encodes a protein that can function as 4-hydroxyphenylacetate-3-hydroxylase. In one or more embodiments, the number "plural" may be 2 to 100, 2 to 90, 2 to 60, 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 10, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3. When the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is composed of multiple genes, they may be introduced into the chromosome as an operon, or each of them may be introduced into the chromosome independently or separately.

[0018] [Chromosomal integration] The method for incorporating the gene encoding 4-hydroxyphenylacetate-3-hydroxylase into the chromosome of the host microorganism is not particularly limited, so long as it allows for introduction in an expressible manner. In one or more embodiments, integration into the chromosome occurs by site-specific recombination. In one or more embodiments, site-specific recombination can be achieved by using a CRIM plasmid, a Cre / LoxP system, a budding yeast recombination enzyme FLP and FRT sequences, or a CRISPR / Cas9 system. Methods for introducing a gene so as to be expressible include introducing the gene together with an expression regulatory sequence such as a promoter capable of inducing enhanced expression of the gene. In one or more embodiments, when the host microorganism is Escherichia coli, the promoter capable of inducing enhanced gene expression may be a T7 promoter. When the T7 promoter is used for expression induction, the host microorganism is preferably a strain having a T7 RNA polymerase gene. In one or more embodiments, the host microorganism may be a DE3 strain in which λDE3 phage has been lysogenized. In one or more other embodiments, examples of promoters capable of inducing increased gene expression include the PL promoter of λ phage (a promoter whose expression is induced by heat), the arabinose promoter of the arabinose operon (a promoter whose expression is induced by arabinose), the tet promoter (a promoter whose expression is induced by tetracycline), promoters of constitutive proteins such as tyrR, and constitutive artificial promoters. In the present disclosure, the method for introducing a gene together with an inducible promoter into a chromosome is not particularly limited, but in one or more embodiments, the method described in the Examples (the method described in Koma et al. 2012. Appl. Microbiol. Biotechnol. 93:815-829) may be mentioned.

[0019] [Reaction process between tyrosol and microorganisms] Hydroxytyrosol is produced by contacting a microorganism (hereinafter also referred to as the microorganism of the present disclosure) in which a gene encoding 4-hydroxyphenylacetate-3-hydroxylase has been integrated into the chromosome in an expressible manner with tyrosol and reacting it. This "reaction" in the present disclosure can also be called "fermentation." In one or more embodiments, the reaction between tyrosol and the microorganism of the present disclosure can be carried out by inducing the expression of 4-hydroxyphenylacetate-3-hydroxylase in the microorganism of the present disclosure that has been cultured to a predetermined amount, and then adding tyrosol. The microorganism of the present disclosure can be cultured under conditions for a normal culture method, and the reaction step can be performed under conditions for conventional fermentation or reaction. The culture or reaction medium is not particularly limited as long as it contains a carbon source, a nitrogen source, a phosphorus source, a sulfur source, minerals, vitamins, and other components and can grow the microorganism of the present disclosure. In order to improve the production amount of hydroxytyrosol, it is preferable to culture and react the microorganism of the present disclosure in an apparatus capable of mass culture, such as a jar fermentor or a bioreactor. In order to improve the production amount of hydroxytyrosol, the culture and reaction of the microorganism of the present disclosure is preferably a fed-batch culture in which the raw material tyrosol is added during the reaction.

[0020] For the method of producing hydroxytyrosol by fed-batch culture of tyrosol, see, for example, the method in the Examples. In brief, preculture is performed, and the bacteria is inoculated into a minimal medium at a concentration of 1% and cultured until the OD 660When the ratio reaches 0.5 to 20, expression is induced (for example, in the case of a T7 promoter, 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) is added) and the culture is continued for 2 to 5 hours, after which the raw material tyrosol solution is fed at a predetermined supply speed and reacted for 20 to 35 hours to obtain hydroxytyrosol in the reaction solution and / or bacteria.

[0021] [Culture temperature] Examples of the temperature include a temperature at which the microorganism can grow. From the viewpoint of growth rate, the optimal culture temperature for the organism is preferable. For Escherichia coli, in one or a plurality of embodiments, the optimal culture temperature is 25°C to 40°C, or 30°C to 37°C. [Culture medium] There are no limitations as long as the medium can grow microorganisms. Examples include natural media such as LB medium, and synthetic media such as M9 and HCF medium described in the examples. When considering purification of compounds, synthetic media are preferable. [Culture pH] In one or more embodiments, the culture pH is in the range of 6.0 to 7.5, and in the case of Escherichia coli, in one or more embodiments, the culture pH is around 7.0, or 6.2 to 7.2.

[0022] [Reaction temperature] The culture temperature can be the same as that described above. [Reaction medium] The culture medium may be the same as that described above. [Amount of tyrosol added to reaction medium (flow rate)] The amount of tyrosol added is adjusted depending on the type of bacteria, the amount of bacteria, and the reaction conditions. In one or more embodiments, tyrosol is added at a rate such that the added tyrosol is rapidly converted to hydroxytyrosol. In the case of E. coli, the OD 660 When the concentration is about 40, the addition rate may be 5 to 100 mg / L / min or 10 to 80 mg / L / min. The total amount of tyrosol to be added varies depending on the type of bacteria, but it is preferable that the amount of tyrosol added is such that almost all of it is converted to hydroxytyrosol. In the case of Escherichia coli, in one or more embodiments, the amount is about 10 to 25 g / L. [Reaction pH] The culture pH can be the same as that described above. [Response time] In one or more embodiments, the reaction time is preferably such that the reaction is continued until the fed tyrosol is exhausted. However, the culture and reaction conditions are not limited to these.

[0023] The present disclosure further relates to one or more of the following non-limiting embodiments. [1] A method comprising the step of reacting tyrosol with a microorganism, The microorganism is a microorganism modified so that a gene encoding 4-hydroxyphenylacetate-3-hydroxylase is integrated into a chromosome in an expressible manner. Method for producing hydroxytyrosol. [2] The production method according to [1], wherein 4-hydroxyphenylacetate-3-hydroxylase is a two-component FAD-dependent monooxygenase. [3] The production method according to [1] or [2], wherein 4-hydroxyphenylacetate-3-hydroxylase is a gene product of the hpaBC gene of Escherichia coli or a gene product of an orthologue thereof. [4] The method according to any one of [1] to [3], wherein the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is the hpaBC gene of Escherichia coli or an orthologue thereof. [5] The production method according to any one of [1] to [4], wherein the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is a gene containing the two base sequences represented by SEQ ID NOs: 9 and 10 in the Sequence Listing, or a gene containing two base sequences in which one or more of the base sequences represented by SEQ ID NOs: 9 and 10 in the Sequence Listing have been deleted, substituted, and / or added, and which encodes a protein capable of functioning as 4-hydroxyphenylacetate-3-hydroxylase. [6] The method according to any one of [1] to [5], wherein the microorganism is Escherichia coli. [7] The method according to any one of [1] to [6], wherein the reaction is a fed-batch culture of tyrosol. EXAMPLES

[0024] The present disclosure will be described in more detail below with reference to examples, but these are merely illustrative and the present disclosure is not limited to these examples.

[0025] 1. Construction of Plasmid pET21a-FRT-hpaBC The hpaBC operon was amplified by PCR using the primer set hpaBC-F (GTTTAACTTTAAGAAGGAGATATACATATGAAACCAGAAGATTTCCGC: SEQ ID NO: 1) and hpaBC-R (GTGGTGGTGGTGCTCGAGTTAAATCGCAGCTTCCATTTC: SEQ ID NO: 2) with the chromosomal DNA of E. coli BL21 strain as a template. The PCR enzyme used was Phusion Hot Start 2 DNA Polymerase (Thermo Fisher Scientific), and the reaction was carried out according to the attached instructions. The PCR amplified product was purified using QIAquick PCR Purification Kit (Qiagen), and then reacted with pET21a-FRT vector (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93:815-829) digested with restriction enzymes NdeI and XhoI and Gibson Assembly Master Mix (New England Biolabs). The reaction solution was mixed with E. coli DH5α competent cells (GMbiolab) and left to stand on ice for 40 minutes, then heat-shocked at 42°C for 45 seconds, and again left to stand on ice for 2 minutes, after which 900μL of LB liquid medium (10g / L hypopeptone, 5g / L powdered yeast extract D3-H, 10g / L sodium chloride, pH7.0) was added and incubated at 37°C for 30 minutes. An appropriate amount of the bacterial solution was spread on LB agar medium (LB liquid medium with agar added to make 2%) containing 50μg / mL kanamycin, and cultured at 37°C overnight. From the colonies after cultivation, those having the desired plasmid were selected by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio), a specified amount of T7 promoter primer (TAATACGACTCACTATAGGG: sequence number 3) and T7 terminator primer (ATGCTAGTTATTGCTCAGCGG: sequence number 4) were added to the reaction solution, and PCR was performed by adding the colonies as template DNA. After the reaction, electrophoresis was performed using a 1% agarose gel, and those in which the hpaBC insert was confirmed were selected as candidate strains. The candidate strain was cultured overnight at 37°C in LB liquid medium containing 50 μg / mL kanamycin, and plasmid extraction was performed using NucleoSpin Plasmid QuickPure (Machler-Nagel) to obtain pET21a-FRT-hpaBC.

[0026] 2. Preparation of the plasmid MG1655(DE3) / pET21a-FRT-hpaBC strain The E. coli MG1655(DE3) strain was cultured in 5 mL of LB liquid medium at 37°C, and the OD 660 When the value reached about 0.5, the mixture was cooled on ice. 1 mL of the bacterial solution was centrifuged at 10,000 rpm for 3 minutes, the supernatant was discarded, and the bacterial cells were collected. The bacterial cells were then resuspended in 90 μL of TSS solution (LB liquid medium containing 100 g / L PEG4000, 5% DMSO, and MgCl 2 The cells were suspended in 10 μL of KCM solution (1 M KCl, 0.3 M CaCl 2 , 0.5M MgCl 2 ) and 1 μL of plasmid solution were added and allowed to stand on ice for 40 minutes. After a heat shock at 42°C for 90 seconds, the mixture was again allowed to stand on ice for 2 minutes, and 900 μL of LB liquid medium was added and incubated at 37°C for 30 minutes. An appropriate amount of the bacterial solution was spread on LB agar medium containing 50 μg / mL kanamycin and cultured overnight at 37°C. The emerged colonies were again spread on LB agar medium containing 50 μg / mL kanamycin and cultured overnight at 37°C, and the emerged colonies were used as MG1655(DE3) / pET21a-FRT-hpaBC.

[0027] 3. Preparation of chromosome-introduced strain (A strain) The introduction of the hpaBC gene into the E. coli chromosome was performed as previously reported (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93:815-829). First, a solution containing the DNA fragment to be introduced into the chromosome was prepared. Using pET21a-FRT-hpaBC as template DNA, the primer set delta-pflBA-F (CGAAGTACGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGTGTTACATGATTCCGGGGATCCGTCGACC: sequence number 5) and delta-pflBA-FRT-R (CTCAATAAAGTTGCCGCTTTACGGGAAATTAGAACATTACCTTATGACCATTCGCCAATCCGGATATAG: sequence number 6) was used to amplify the hpaBC gene (FRT-Km-FRT-P) containing two flipase recognition sequences (FRT) and a kanamycin resistance gene sequence (Km). T7 -hpaBC-T T7 ) was amplified by PCR. PrimeStar GXL (Takara Bio) was used as the PCR enzyme, and the reaction was carried out according to the attached instructions. The PCR amplified product was purified using a QIAquick PCR Purification Kit (Qiagen), then digested overnight with the restriction enzyme DpnI, and purified again using a QIAquick PCR Purification Kit (Qiagen), to prepare a DNA solution for chromosome introduction. Next, electroporation cells of E. coli were prepared. The E. coli MG1655(DE3) / pKD46 strain was grown in LB liquid medium containing 10 mM L-arabinose and 100 μg / mL carbenicillin at OD 660The cells were cultured at 30°C until the pH reached about 0.5. Next, 2 mL of the bacterial solution was centrifuged at 5,000 rpm and 4°C for 5 minutes, the supernatant was discarded, and the bacterial cells were collected. The bacterial cells were suspended in 1 mL of ice-cooled sterile distilled water, centrifuged at 5,000 rpm and 4°C for 5 minutes, the supernatant was discarded, and the bacterial cells were collected. The bacterial cells were again suspended in 1 mL of ice-cooled sterile distilled water, centrifuged at 5,000 rpm and 4°C for 5 minutes, the supernatant was discarded, and the bacterial cells were collected. The bacterial cells were suspended in 50 μL of ice-cooled sterile distilled water to prepare an electroporation cell. Next, 100-200 ng (about 1 μL) of DNA fragment was added to the electroporation cell, the solution was transferred to an electroporation cuvette, and electroporation was performed using a MicroPulser electroporator (manufactured by Bio-Rad). After adding 1 mL of LB liquid medium to the electroporation cuvette, the bacterial suspension was transferred to a 1.5 mL tube and shaken at 37 ° C for about 2 hours. The bacterial liquid was applied to an LB agar medium containing 50 μg / mL kanamycin and cultured overnight at 37 ° C. From the colonies that appeared, E. coli having the hpaBC gene at the pflBA locus was selected by colony direct PCR. According to the instructions attached to EmeraldAmp PCR Master Mix (manufactured by Takara Bio Inc.), a primer set of K2 (CGGTGCCCTGAATGAACTGC: sequence number 7) and Down-pflBA (CGTTATTCTCCAGAGGTTCATCAGC: sequence number 8) was added to the reaction solution, and PCR was performed by adding the colony as a template DNA. After the reaction, electrophoresis was performed using a 1% agarose gel to confirm the strain (strain A) in which the hpaBC gene was inserted at the pflBA locus.

[0028] 4. Tyrosol Fed-batch Cultivation MG1655(DE3) / pET21a-FRT-hpaBC or A strain was inoculated into LB liquid medium and cultured overnight at 30°C. The culture liquid was inoculated at 1% into a 3L jar fermenter containing 1.5L of HCF medium to start the culture. When culturing the MG1655(DE3) / pET21a-FRT-hpaBC strain, kanamycin was added to the LB liquid medium and HCF medium to a concentration of 50 μg / mL. The jar fermentor used was a Bioneer series MDL-8C manufactured by Marubishi Bioengineering Co., Ltd. The composition of HCF medium was 1268 mL of distilled water, 150 mL of 10x phosphate / citrate buffer, 3.6 mL of 50% aqueous magnesium sulfate heptahydrate, 15 mL of 100x trace metals solution, 63.4 mL of 70% glucose solution, and 340 μL of 2% thiamine hydrochloride solution. Distilled water and 10x phosphate / citrate buffer were placed in a jar fermenter vessel and sterilized by autoclaving. After the sterilized solution returned to room temperature, a magnesium sulfate solution and a glucose solution that had been separately sterilized by autoclaving, as well as a thiamine hydrochloride solution and a trace metal solution that had been sterilized by filtration, were added. The 10x phosphate / citrate buffer solution was composed of 133 g / L potassium dihydrogen phosphate, 40 g / L diammonium hydrogen phosphate, 17 g / L citric acid, and the pH was adjusted to 6.3 with 5 M NaOH. The 100x trace metals solution was composed of 10 g / L iron(III) citrate, 0.25 g / L cobalt chloride hexahydrate, 1.5 g / L manganese chloride tetrahydrate, 0.15 g / L copper chloride dihydrate, 0.3 g / L boric acid, 0.25 g / L sodium molybdate dihydrate, 1.3 g / L zinc acetate dihydrate, and 0.84 g / L ethylenediaminetetraacetic acid disodium salt dihydrate. The culture was carried out at 30°C, the aeration rate was 3 L / min, and the rotation speed was automatically adjusted so that the dissolved oxygen value was 30%. The pH was initially controlled at 6.8, and after the start of fed-batch culture of tyrosol, it was controlled at 6.5. 28% ammonia water was used to control the pH. After the start of cultivation, the OD 660 When the value reached 15-20, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to 1 mM, and the culture was continued for another 3-4 hours, after which 300 mL of tyrosol solution (100 g / L) was fed at a rate of 0.4 mL / min. If glucose was depleted or was about to be depleted during the culture, a feed solution was added at an appropriate time so that the glucose concentration was about 10 g / L. The feed solution was prepared by adding 280 g of glucose to 186 mL of distilled water and sterilizing it in an autoclave. After the solution had cooled to room temperature, 16 mL of a separately sterilized 50% aqueous magnesium sulfate heptahydrate solution, 4 mL of a 100x trace metals solution that had been filtered and sterilized, and 900 μL of a 2% thiamine hydrochloride solution that had been filtered and sterilized were added. The reaction mixture was sampled at appropriate times and the OD was measured using a spectrophotometer. 660 The values ​​of tyrosol and hydroxytyrosol were measured, and tyrosol and hydroxytyrosol were quantified by HPLC. Quantification by HPLC was performed using a method for quantifying aromatic compounds previously reported (Koma et al. 2012. Appl. Microbiol. Biotechnol. 93:815-829), and standard samples of hydroxytyrosol and tyrosol (Tokyo Chemical Industry Co., Ltd.) were used to prepare a calibration curve.

[0029] 5.Results The results of hydroxytyrosol production by tyrosol fed-batch culture of strain A, in which the hpaBC gene was introduced into the E. coli chromosome, are shown in Figure 1. The results of hydroxytyrosol production by tyrosol fed-batch culture of E. coli MG1655(DE3) / pET21a-FRT-hpaBC strain carrying the hpaBC gene on a plasmid are shown in FIG. 2. The horizontal axis in Figures 1 and 2 is the time (h) from the start of cultivation in the jar fermenter. The left vertical axis is the absorbance (OD 660 ) and the right vertical axis indicates the concentration (g / L) of tyrosol and hydroxytyrosol (HTY). Although both strain A, in which the hpaBC gene had been introduced into the E. coli chromosome, and E. coli harboring the hpaBC gene on a plasmid, were induced to express from the same promoter (T7 promoter), there was a significant difference in the production of hydroxytyrosol (Figures 1 and 2). The strain A, in which the hpaBC gene was introduced into the E. coli chromosome, converted tyrosol to hydroxytyrosol so efficiently that no added tyrosol remained (Fig. 1), whereas E. coli carrying the hpaBC gene on a plasmid retained tyrosol (Fig. 2). Furthermore, strain A, in which the hpaBC gene had been introduced into the E. coli chromosome, showed twice the amount of hydroxytyrosol produced compared to E. coli harboring the hpaBC gene on a plasmid (Figures 1 and 2). In the production method of hydroxytyrosol using live bacteria, the highest concentration produced so far was 5.8 g / L from tyrosol using the pathogenic bacteria Pseudomonas aeruginosa (Non-Patent Document 1). In addition, with non-pathogenic bacteria (Escherichia coli), only 5.6 g / L of hydroxytyrosol was produced even when using L-DOPA, a very expensive raw material (Non-Patent Document 2). In contrast, in this example, as shown in FIG. 1, an exceptionally remarkable productivity of 16 g / L was observed.

Claims

1. The method includes reacting tyrosol with a microorganism, The microorganism is a microorganism which has been modified so that a gene encoding 4-hydroxyphenylacetate-3-hydroxylase is integrated into a chromosome in an expressible manner, the microorganism is Escherichia coli; The reaction is a fed-batch culture of tyrosol; Method for producing hydroxytyrosol.

2. The method according to claim 1, wherein the 4-hydroxyphenylacetate-3-hydroxylase is a two-component FAD-dependent monooxygenase.

3. 3. The method according to claim 1, wherein 4-hydroxyphenylacetate-3-hydroxylase is a gene product of the hpaBC gene of Escherichia coli or a gene product of an orthologue thereof.

4. The method according to any one of claims 1 to 3, wherein the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is the hpaBC gene of Escherichia coli or an orthologue thereof.

5. The production method according to any one of claims 1 to 4, wherein the gene encoding 4-hydroxyphenylacetate-3-hydroxylase is a gene comprising the two base sequences shown in SEQ ID NOs:9 and 10 in the Sequence Listing, or a gene comprising two base sequences in which one or more of the base sequences shown in SEQ ID NOs:9 and 10 in the Sequence Listing have been deleted, substituted, and / or added, and which encodes a protein capable of functioning as 4-hydroxyphenylacetate-3-hydroxylase.

Images