Redirecting tropism of AAV capsids

Abstract

The present disclosure relates to compositions, methods, and processes for preparing adeno-associated virus capsid proteins, their uses, and / or formulations, wherein the capsid proteins contain targeting peptide inserts to enhance tropism for target tissues.

Description

[Technical Field]

[0001] The present disclosure relates to compositions, methods, and processes for preparing adeno-associated virus capsid proteins, their uses, and / or formulations, wherein the capsid proteins contain targeting peptide inserts to enhance tropism for target tissues. [Background technology]

[0002] Gene delivery to the adult central nervous system (CNS) remains a major challenge in gene therapy, and engineered AAV capsids with improved brain tropism are an attractive solution. Adeno-associated virus (AAV)-derived vectors are promising tools for clinical gene transfer due to their nonpathogenic nature, low immunogenicity profile, low integration rate into the host genome, and long-lasting transgene expression in non-dividing cells. However, the transduction efficiency of natural AAV variants in certain organs is too low to be clinically applicable, and capsid neutralization by pre-existing neutralizing antibodies may prevent treatment for most patients. For these reasons, significant efforts have been devoted to obtaining novel capsid variants with enhanced properties. Among the many approaches tested to date, the most significant advances have come from directed evolution of AAV capsids using in vitro or in vivo selection of capsid variants generated by capsid sequence randomization using either error-prone PCR, shuffling of various parent serotypes, or insertion of fully randomized short peptides at defined positions.

[0003] To achieve directed evolution of AAV capsids, the viral capsid-encoding sequence is flanked by inverted terminal repeats (ITRs) so that it can be packaged into its own capsid shell. After infecting cultured cells or animals with a mixed population of capsids, DNA encoding capsid variants that successfully target the tissue of interest is recovered by PCR and subjected to further rounds of selection. This approach recovers all viral DNA species present in a given tissue and does not distinguish between specific cell types or vectors capable of complete transduction (cell surface binding, endocytosis, transport, nuclear translocation, uncoating, double-strand synthesis, and transcription). For example, in highly complex tissues containing multiple cell types, such as the central nervous system (CNS), it is expected that applying more stringent selective pressure to recover capsid variants capable of transducing neurons and / or astrocytes rather than microglia or vascular endothelial cells would be highly favorable.

[0004] Attempts to improve the CNS tropism of AAV capsids upon systemic administration have met with limited success. Two previous approaches have been used to address this issue. The first strategy involved co-infection of cultured cells (Non-Patent Document 1) or in situ animal tissues (Non-Patent Document 2) with adenovirus to trigger exponential replication of infectious AAV DNA. Another successful approach involved the use of cell-specific CRE transgenic mice (Non-Patent Document 3) to specifically enable viral DNA recombination in astrocytes, followed by recovery of CRE-recombined capsid variants. Both approaches proved successful, allowing the isolation of several capsid variants with enhanced transduction of target cell populations.

[0005] This finding suggested that cell-type-specific library selection could improve directed evolution results. However, the transgenic CRE system used by Deverman et al. was cumbersome in other animal species, and AAV variants selected by directed evolution in mouse tissues did not exhibit similar properties in larger animals. Therefore, to increase the probability of translatability in human subjects, it is anticipated that the entire directed evolution process will need to be performed directly in nonhuman primates. None of the previously described transduction-specific approaches are suitable for large animal studies for the following reasons: 1) many tissues of interest (e.g., CNS) are not readily accessible for adenoviral co-infection; 2) specific Ad tropism itself biases library distribution; and 3) large animals are typically not amenable to transgenesis and cannot be genetically engineered to express CRE recombinase in defined cell types.

[0006] To address this issue, we developed a broadly applicable functional AAV capsid library screening platform for cell-type-specific biopanning in non-transgenic animals. In the TRACER (Tropism Redirection of AAV by Cell Type-Specific Expression of RNA) platform system, the capsid gene is placed under the control of a cell-type-specific promoter to drive capsid mRNA expression in the absence of helper virus co-infection. This RNA-driven screening increases the selection pressure to favor capsid variants that transduce specific cell types.

[0007] The TRACER platform enables the generation of AAV capsid libraries, and the specific recovery and subcloning of capsid mRNA expressed in transduced cells is achieved without the need for transgenic animals or helper virus co-infection. Because mRNA transcription is a critical feature of successful transduction, this method allows the identification of fully infectious AAV capsid mutants. In addition to its higher stringency, this method also allows the identification of capsids with high tropism for specific cell types using libraries designed to express CAP mRNA under the control of any cell-specific promoter, including, but not limited to, the synapsin-1 promoter (neurons), the GFAP promoter (astrocytes), the TBG promoter (liver), the CAMK promoter (skeletal muscle), and the MYH6 promoter (cardiomyocytes). [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Grimm et al., 2008 [Non-patent document 2] Lisowski et al., 2014 [Non-patent document 3] Deverman et al., 2016 Summary of the Invention

[0009] The present disclosure provides compositions and methods for genetically manipulating and / or redirecting the tropism of AAV capsids. Also provided herein are peptides that can be inserted into the AAV capsid sequence to increase the tropism of the capsid for specific tissues. In one embodiment, such peptides can be used to target the capsid to the brain or brain regions or spinal cord.

[0010] The present disclosure provides methods for generating one or more variant AAV capsid polypeptides. In certain embodiments, the variant AAV capsid polypeptides exhibit at least one of improved transduction or increased cell or tissue specificity compared to the parent AAV capsid polypeptide. In certain embodiments, the method includes: (a) generating a library of variant AAV capsid polypeptides, the library comprising (i) a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids, or (ii) a plurality of capsid polypeptides derived from more than one parent AAV capsid polypeptide; (b) generating an AAV vector library by cloning the capsid polypeptides of library (a)(i) or (a)(ii) into an AAV vector, the AAV vector comprising a first promoter and a second promoter, the second promoter driving capsid mRNA expression in the absence of helper virus co-infection.

[0011] In certain embodiments, the first promoter is AAV2 P40. In certain embodiments, the second promoter is a ubiquitous promoter. In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a ubiquitous promoter.

[0012] In certain embodiments, the first promoter is AAV2 P40.In certain embodiments, the second promoter is a cell type specific promoter.In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a cell type specific promoter.

[0013] In certain embodiments, the promoter is selected from any of the promoters listed in Table 3. In certain embodiments, a ubiquitous promoter or a cell-specific promoter allows for expression of an RNA encoding a capsid polypeptide.

[0014] In certain embodiments, the method includes recovering RNA encoding the capsid polypeptide. In certain embodiments, the method includes determining the sequence of the capsid polypeptide. In certain embodiments, the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide.

[0015] In certain embodiments, the target cell is a neuron, neural stem cell, astrocyte, oligodendrocyte, microglial cell, retinal cell, tumor cell, hematopoietic stem cell, insulin-producing beta cell, lung epithelial cell, endothelial cell, liver cell, skeletal muscle cell, muscle stem cell, muscle satellite cell, or cardiomyocyte.

[0016] In certain embodiments, the AAV vector comprises a first promoter and a second promoter, the second promoter being located downstream of the capsid gene and driving its antisense RNA expression in the absence of helper virus co-infection.

[0017] In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a ubiquitous promoter. In certain embodiments, the first promoter is AAV2 P40, and the second promoter is a cell-specific promoter. In certain embodiments, the ubiquitous promoter or the cell-specific promoter allows the expression of a gene encoding a variant AAV capsid polypeptide in antisense direction, resulting in antisense RNA. In certain embodiments, the method includes recovering the antisense RNA, which can be converted into RNA encoding the variant AAV capsid polypeptide, and used to determine the sequence of the variant AAV capsid polypeptide.

[0018] In certain embodiments, the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. The above and other objects, features, and advantages will become apparent from the following description of specific embodiments of the present disclosure, as illustrated in the accompanying drawings. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the present disclosure. [Brief explanation of the drawings]

[0019] [Figure 1A] Diagram showing wild-type AAV capsid gene transcription and a map of the CMV-CAP vector. Figure 1A shows transcription of VP1, VP2, and VP3 AAV from the wild-type AAV genome. The transcription start site for each viral promoter is indicated. SD, splice donor; SA, splice acceptor. The sequence of the start codon for each reading frame is indicated. Translation of AAV and VP3 is carried out by leaky scanning of the primary mRNA. [Figure 1B] Figure 1B shows the map of wild-type AAV capsid gene transcription and the CMV-CAP vector. Figure 1B shows the structure of the CMV-p40 dual promoter vector used to determine the minimal regulatory sequences required for efficient virus production. The pREP2ΔCAP vector shown at the bottom was obtained by deleting most of the CAP reading frame and is used to provide the REP protein in trans. [Figure 2A]Figure 2A shows the effect of CMV promoter position on viral yield and CAP mRNA splicing. Figure 2A shows the average yield of AAV9 produced in HEK-293T cells co-transfected with Ad helper vectors using the constructs described in Figure 1. Wild-type AAV9 plasmid (pAV9) is used as a positive control. Y-axis values ​​show the number of AAV DNA copies per 1 ul from each 15 cm plate (approximately 1000 ul total, left panel) or the percentage of wtAAV9 (right panel). [Figure 2B] Figure 2B shows a histogram representation of data demonstrating the effect of CMV promoter position on viral yield and CAP mRNA splicing. Figure 2B shows evidence of CAP transcript expression in transfected cells. mRNA from transfected 293T cells was subjected to RT-PCR using primers specific for the predominantly spliced ​​CAP transcript. Note the absence of p40-driven transcription in the absence of Ad helper vector (lane 2). [Figure 3A] Figure 3A shows the effect of REP helper plasmid optimization on virus yield. Figure 3A shows the design of the improved pREP helper vector. Deletion of the MscI fragment removes the C-terminal portion of the VP protein, which is required for encapsidation. The asterisk represents a premature stop codon introduced to disrupt the possibility of encoding the VP1, VP2, and VP3 reading frames. [Figure 3B] Figure 3B shows the effect of REP helper plasmid optimization on viral yield. Figure 3B shows the yield of synapsin-p40-CAP9 AAV produced using various REP plasmid architectures. Values ​​on the Y axis represent the percentage of VG relative to wild-type AAV9. [Figure 3C]Figure 3C shows the effect of REP helper plasmid optimization on virus yield. Figure 3D shows quantification of recombination and / or illegitimate packaging of full-length REP from pREP plasmids. Produced virus stocks were subjected to qPCR using a Taqman probe located in the N-terminal portion of REP, which is not present in the ITR-containing vector. [Figure 4A] Figure 4A depicts the in vivo analysis of second-generation vectors. Figure 4A shows the design of the Pro9 vector. The architecture of all three vectors is based on the BstEII construct. The AAV9 capsid RNA is under the control of the P40 promoter and the CMV, hSyn1, or GFAP promoter, respectively. [Figure 4B] Figure 4B depicts the in vivo analysis of second generation vectors. Figure 4B shows a silver stained SDS-PAGE gel obtained by running 1e10VG of each vector after double iodixanol purification. [Figure 4C] Figure 4C depicts the in vivo analysis of second-generation vectors. Figure 4C shows the biodistribution of viral DNA in the mouse brain (cortex), liver, and heart after tail vein injection of 1e12 VG per mouse. AAV9 VP3 DNA was quantified by Taqman PCR and normalized to the mouse transferrin receptor gene. [Figure 4D] Figure 4D depicts in vivo analysis of second-generation vectors. Capsid RNA recovery from mouse tissues is shown. Total RNA was reverse transcribed and TaqMan PCR was performed using capsid-specific TaqMan primers and probes. Values ​​represent VP3c DNA copy numbers normalized to the TBP housekeeping gene. [Figure 5A]Figure 5A depicts in vitro analysis of intronic second-generation vectors. Figure 5A shows the design of the Intron Pro9 vector, which harbors a hybrid CMV / globin intron. The AAV9 capsid RNA is placed under the control of the P40 promoter and the CBA, hSyn1, or GFAP promoter in a tandem (top) or inverted (bottom) configuration. The inverted promoter vectors contain an additional SV40 polyadenylation site (orange) at the 3' end to allow polyadenylation of the antisense CAP9 transcript. [Figure 5B] Figure 5B depicts in vitro analysis of intronic second-generation vectors. Figure 5B shows AAV9 CAP cDNA amplification. Triple transfection with pHelper and pREP-3stops was used to produce all vectors shown, and the resulting virus was used to infect HEK-293T cells at an MOI of 1e4VG per cell. Forty-eight hours post-infection, RNA was extracted and subjected to RT-PCR using primers amplifying the complete capsid (top) or the C-terminal fragment (bottom). [Figure 5C] Figure 5C depicts in vitro analysis of intronic second-generation vectors. Figure 5C shows AAV9 VP3 cDNA from cells infected with an intronless or intronic virus carrying a forward tandem promoter was quantified by Taqman PCR and normalized to the GAPDH housekeeping gene. Values ​​represent the ratio of VP3 to GAPDH cDNA. [Figure 5D] Figure 5D depicts in vitro analysis of intronic second-generation vectors. Figure 5D shows mapping of capsid RNA recovery from cells infected with tandem or inverted constructs. Total RNA was reverse transcribed and PCR was performed using primers flanking the entire capsid gene. The white arrow indicates a VP3 size variant resulting from aberrant splicing of the antisense CAP mRNA. [Figure 5E]Figure 5A depicts an in vitro analysis of intron second-generation vectors. Figure 5E depicts an analysis of globin intron splicing. cDNA from HEK-293T cells transduced with CAG9 plasmid (left) or CAG9 virus was subjected to PCR using forward primers located before (Glo ex1) or within (GloSpliceF4 (SEQ ID NO: 26) and GloSpliceF6 (SEQ ID NO: 13)) the globin inter-exon junction. Primers spanning the junction between exon 1 (not underlined) and exon 2 (underlined) are listed at the bottom. [Figure 6] Figure 1 provides in vitro evidence that the presence of the P40 promoter downstream of the synapsin or Gfabc1D promoter does not derepress either promoter in HEK-293T cells. [Figure 7] A diagram illustrating the basic structure of the TRACER platform. [Figure 8] Diagram illustrating features of the TRACER platform, including the use of tissue-specific promoters and RNA recovery. [Figure 9] FIG. 1 provides one embodiment of a TRACER production architecture. [Figure 10] Figure providing a comparison between conventional vDNA recovery and second-generation vRNA recovery. [Figure 11] Diagram providing an overview of the use of cell-specific RNA expression for targeted evolution. [Figure 12A] Figure 12 provides a diagram depicting capsid gene transcription of native AAV (Figure 12A) and the TRACER library (Figure 12B). [Figure 12B] Figure 12 provides a diagram depicting capsid gene transcription of native AAV (Figure 12A) and the TRACER library (Figure 12B). [Figure 13] FIG. 1 is a diagram of the AAV6, AAV5, and AAV-DJ capsid peptide display libraries used for in vivo evolution (SEQ ID NOS: 27-32, respectively, in order of appearance). [Figure 14]FIG. 1 is a diagram of the AAV9 capsid peptide display library used for in vivo evolution (SEQ ID NOS: 33-42, respectively, in order of appearance). [Figure 15A] Figure 15A shows the sequences of the insertion sites used to introduce the random library (SEQ ID NOS: 43-46, respectively, in order of appearance). [Figure 15B] Diagram presenting the method used for library construction. Figure 15B provides a description of the assembly procedure. [Figure 16] FIG. 1 provides a representative diagram of the cloning-free rolling circle procedure used for library amplification (SEQ ID NO: 47; NNK7). [Figure 17] A diagram providing the sequences of codon mutant AAV9 library shuttles designed to minimize wild-type contamination (SEQ ID NOS: 33-34 and 48-52, respectively, in order of appearance). [Figure 18] Diagram providing an illustration of AAV9 peptide library biopanning. [Figure 19] Diagram showing the recovery process with 50% recovery from the initial pool. [Figure 20] Diagram providing examples of cDNA recovery and amplification from GFAP-driven libraries (groups B and F). [Figure 21] Diagram showing the progression of AAV9 peptide library diversity throughout the biopanning process. Figure 21A describes the RNA library evolution. Figures 21B and 21C show the amino acid distribution of NNK machine mix preparations for P0 and P1 viruses. [Figure 22] Diagram providing neuron (SYN)-AAV9 peptide library composition at P2. [Figure 23] Diagram providing astrocyte (GFAP)-AAV9 peptide library composition at P2. [Figure 24]Diagram providing an estimate of brain / liver specificity in GFAP-AAV9 peptide library candidates. [Figure 25] Diagram providing an estimate of brain / liver specificity in GFAP-AAV9 peptide library candidates. [Figure 26] Figure providing examples of subpopulation selection of variants. [Figure 27] Diagram providing a representative design of the library generation and cloning procedure. [Figure 28] Diagram providing the NNK / NNM codon distribution (covariance of codon mutants) of AAV produced with a synthetic library of 666 sequence variants (GFAP promoter). [Figure 29] Diagram providing the NNK / NNM codon distribution (covariance of codon mutants) of AAV produced with a synthetic library of 666 sequence variants (SYN9 promoter). [Figure 30] Figure providing data derived from tissue recovery from brain and liver punches 1 month after injection. [Figure 31A] Figure 31A provides control capsid results from Syn-driven synthetic library NGS analysis. Figure 31A shows enrichment analysis of internal AAV9, PHP.B, and PHP.eB controls (SEQ ID NOS: 53-58 and 53-58, respectively, in order of appearance). [Figure 31B] Figure 31B, Figure 31C, and Figure 31D provide control capsid results from Syn-driven synthetic library NGS analysis. Figure 31B, Figure 31C, and Figure 31D show NNK / NNM codon distribution in mRNA derived from mouse brain tissue. [Figure 31C] Figure 31B, Figure 31C, and Figure 31D provide control capsid results from Syn-driven synthetic library NGS analysis. Figure 31B, Figure 31C, and Figure 31D show NNK / NNM codon distribution in mRNA derived from mouse brain tissue. [Figure 31D] Figure 31B, Figure 31C, and Figure 31D provide control capsid results from Syn-driven synthetic library NGS analysis. Figure 31B, Figure 31C, and Figure 31D show NNK / NNM codon distribution in mRNA derived from mouse brain tissue. [Figure 32A]Figure providing the results of neuron synthetic library NGS analysis (SEQ ID NOs: 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71, and 70-74, respectively, in order of appearance). [Figure 32B] Figure providing the results of neuron synthetic library NGS analysis (SEQ ID NOs: 59-60, 59-61, 61-63, 62, 64, 64, 63, 65-67, 67, 65, 68, 66, 69, 70-71, and 70-74, respectively, in order of appearance). [Figure 33] Figure providing the results of astrocyte synthetic library NGS analysis (SEQ ID NOs: 53-58, 53-58, and 53-58, respectively, in order of appearance). [Figure 34A] Diagram providing astrocyte synthetic library codon mutant covariances. [Figure 34B] Diagram providing astrocyte synthetic library codon mutant covariances. [Figure 35]Figure providing the results of astrocyte synthetic library NGS analysis (respectively in order of appearance, SEQ ID NOs: 75, 75–78, 76–77, 79–83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88–90, 87, 91, 83, 88, 63, 89–90, 92–93, 91, 94–97, 93, 95, 98, 98, 97, 63, 92, 94, 99–101, 75, 75 ~78, 76~77, 79~83, 65, 78, 84, 80, 85, 70, 86, 82, 81, 79, 87, 65, 85, 84, 70, 86, 88~90, 87, 91, 83, 88, 63, 89~90, 92~93, 91, 94~97, 93, 95, 98, 98, 97, 63, 92, 94, 99~102, 99, 103, 103~104, 96, 105~106, 101, 100, 102, 107, 104~105, 108~ 113, 106, 60, 66, 114-117, 109, 113, 72, 108, 110, 67, 118-119, 116, 120, 120, 107, 112, 121-123, 66, 124-125, 115, 118, 126, 121, 127-128, 60, 129, 119, 130-132, 72, 133, 123, 125, 69, 134-139, 62, 124, 67, 111, 114, 126, 140-141, 1 22, 142, 128–129, 143, 138, 144, 134, 62, 136, 145, 141, 146–153, 127, 154, 69, 144, 155, 71, 156, 133, 132, 137, 147, 157–158, 135, 159, 140, 117, 160, 139, 161–162, 130, 163, 143, 164, 152, 151, 165–167, 155, 168, 71, 169, and 146). [Figure 36] Figure providing GFAP synthetic library NGS analysis. [Figure 37A]Figure 37A provides the top 38 variants from the synthetic library screening. Figure 37A shows a phylogenetic analysis of the 9-mer peptide sequences, along with the sequences of the peptide variants (SEQ ID NOs: 67, 59, 64, 61, 77, 84, 96, 60, 80, 82, 66, 62, 83, 85, 106, 131, 94, 90, 76, 68-69, 79, 75, 81, 88, 139, 78, 155, 102, 63, 140, 87, 70, 105, 120, 89, 65, and 109, respectively, in order of appearance). Highlighted sequences represent peptides selected for individual transduction assays. [Figure 37B] Figure 37A provides the top 38 variants from the synthetic library screen. Figure 37B shows a graphical representation of the neuronal and astrocyte tropism of each peptide, with both axes showing the reversed ranking in the synapsin and GFAP screens. [Figure 38] A diagram providing the top consensus sequences compared with PHP.N and PHP.B (SEQ ID NOs: 168 and 71, respectively, in order of appearance). [Figure 39] FIG. 1 is a diagram of the Gibson assembly library cloning procedure. [Figure 40] Diagram providing examples of TRIM / NNK peptide occurrence (SEQ ID NOS: 170-171, respectively, in order of appearance). [Figure 41] Figure providing peptide diversity statistics for a study using Illumina adapters with 42 million bacterial transformants, 81 million sequence reads, and 12 million sequence variants (SEQ ID NOs: 172-173, 48-49, and 174-175, respectively, in order of appearance). [Figure 42] Figure 1 provides a representative diagram of cloning-free DNA amplification by rolling circle amplification. [Figure 43] Figure providing a diagram of protelomerase monomer processing (SEQ ID NOS: 176-178, respectively, in order of appearance). [Figure 44] Figure 1 provides a diagram comparing conventional and cloning-free methods. [Figure 45A]Figure 45A provides a complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and heart tissues. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The ranking of the internal control capsids PHP.B, PHP.eB, and AAV9 is shown (Figure 45A and Figure 45B). A comparison of the combined Syn-driven and GFAP-driven results is provided (Figure 45C). Two of the six mice showed very different ranking profiles and were considered outliers; therefore, only four animals represented the GFAP-driven library. [Figure 45B] Figure 45A provides a complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and heart tissues. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The ranking of the internal control capsids PHP.B, PHP.eB, and AAV9 is shown (Figure 45A and Figure 45B). A comparison of the combined Syn-driven and GFAP-driven results is provided (Figure 45C). Two of the six mice showed very different ranking profiles and were considered outliers; therefore, only four animals represented the GFAP-driven library. [Figure 45C] Figure 45A provides a complete ranking of 333 Syn-driven (Figure 45A) and GFAP-driven (Figure 45B) variants in brain, spinal cord, liver, and heart tissues. Capsid variants are ranked by their average brain RNA enrichment score (average of NNK and NNM codons). The ranking of the internal control capsids PHP.B, PHP.eB, and AAV9 is shown (Figure 45A and Figure 45B). A comparison of the combined Syn-driven and GFAP-driven results is provided (Figure 45C). Two of the six mice showed very different ranking profiles and were considered outliers; therefore, only four animals represented the GFAP-driven library. [Figure 46A]Figure 46A provides a comparison of the results of neuron and astrocyte synthetic library NGS analysis. Figure 46B shows the ranking of capsids using the SYN promoter or the GFAP promoter. [Figure 46B] Figure 46A provides a comparison of the results of neuron and astrocyte synthetic library NGS analysis. Figure 46B shows a scatter plot demonstrating the correlation of Syn-driven libraries versus GFAP-driven libraries. [Figure 47] FIG. 1 illustrates one embodiment of a multi-species (e.g., rodent) study followed by next generation sequencing (NGS). [Figure 48A] Figure 48A provides the results of a multi-strain / species comparison of 333 capsid variants. Figure 48A shows the ranking of 333 capsids by brain RNA enrichment score in C57BL / 6 mice, BALB / C mice, and rats. Capsids are ranked according to Syn-driven brain enrichment score in C57BL / 6 mice. [Figure 48B] Figure 48A provides the results of a multi-strain / species comparison of 333 capsid variants. Figure 48B shows a scatter plot illustrating the correlation between C57BL / 6 and BALB / C enrichment scores from Syn- and GFAP-driven pools. [Figure 48C] Figure 48A provides the results of a multi-strain / species comparison of 333 capsid variants. Figure 48C shows a Venn diagram showing the crossover and consensus sequences of capsids with brain enrichment scores >10-fold higher than AAV9 (either Syn-driven or GFAP-driven) in C57BL / 6 and BALB / C strains. In rats, no capsids showed a >10-fold enrichment score relative to AAV9. [Figure 49A] A diagram providing transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in Figure 49A (SEQ ID NOS: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. [Figure 49B]A diagram providing transduction (RNA) and biodistribution (DNA) analysis of the 10 capsid variants shown in Figure 49A (SEQ ID NOS: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. [Figure 49C] Figure 49A provides transduction (RNA) and biodistribution (DNA) analyses of the 10 capsid variants shown in Figure 49A (SEQ ID NOS: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. Figure 49C shows RNA expression in brain and spinal cord samples. [Figure 49D] Figure 49A provides transduction (RNA) and biodistribution (DNA) analyses of the 10 capsid variants shown in Figure 49A (SEQ ID NOS: 179-188, respectively, in order of appearance). Individual capsids were used to package a self-complementary CBA-EGFP genome (Figure 49B) and injected intravenously into C57BL / 6 mice. Figure 49D shows DNA distribution in brain and spinal cord samples. [Figure 50A] Figure 50 provides the results of testing individual capsids and their mRNA expression in the brain, spinal cord, and liver. EGFP mRNA expression results are shown for the brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 50B] Figure 50 provides the results of testing individual capsids and their mRNA expression in the brain, spinal cord, and liver. EGFP mRNA expression results are shown for the brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 50C] Figure 50 provides the results of testing individual capsids and their mRNA expression in the brain, spinal cord, and liver. EGFP mRNA expression results are shown for the brain (Figure 50A), spinal cord (Figure 50B), and liver (Figure 50C). [Figure 51]Figure 51 provides the results of NGS screening using the neuronal NeuN marker for both the GFAP and SYN screens. [Figure 52] Figure providing results of testing individual capsids in whole brain. [Figure 53] Figure providing results of testing additional individual capsids in whole brain. [Figure 54] Figure providing results of testing individual capsids in the cerebellum. [Figure 55] Figure providing the results of testing individual capsids in the cortex. [Figure 56] Figure providing results of testing individual capsids in the hippocampus. [Figure 57A] Figure 57A provides transduction data of 10 capsid variants in mouse liver analyzed by EGFP RNA expression (Figure 57B) and whole tissue fluorescence (Figure 57A). [Figure 57B] Figure 57A provides transduction data of 10 capsid variants in mouse liver analyzed by EGFP RNA expression (Figure 57B) and whole tissue fluorescence (Figure 57A). [Figure 58A] Figure 58A provides the results of a comparative study of the CNS transduction efficacy of 333 capsid variants on C57BL / 6 mouse BMVECs (Figure 58A) and human BMVECs (Figure 58B). [Figure 58B] Figure 58A provides the results of a comparative study of the CNS transduction efficacy of 333 capsid variants on C57BL / 6 mouse BMVECs (Figure 58A) and human BMVECs (Figure 58B). [Figure 59A]

[0049] Figure 59 provides a diagram of external barcoding for NGS analysis and full-length capsid variant recovery. A typical barcode pair is shown (Figure 59C). The complete ITR-to-ITR construct is shown with a barcode pair 5' to the CAP sequence (Figure 59A) and 3' to the CAP sequence (Figure 59B). [Figure 59B]

[0049] Figure 59 provides a diagram of external barcoding for NGS analysis and full-length capsid variant recovery. A typical barcode pair is shown (Figure 59C). The complete ITR-to-ITR construct is shown with a barcode pair 5' to the CAP sequence (Figure 59A) and 3' to the CAP sequence (Figure 59B). [Figure 59C]

[0049] Figure 59 provides a diagram of external barcoding for NGS analysis and full-length capsid variant recovery. A typical barcode pair is shown (Figure 59C). The complete ITR-to-ITR construct is shown with a barcode pair 5' to the CAP sequence (Figure 59A) and 3' to the CAP sequence (Figure 59B). [Figure 60A] Figure 60 provides a detailed analysis of virus production and RNA splicing using several configurations of the intron barcoding platform. Common ITR-to-ITR constructs are shown in Figure 60A (SEQ ID NOS: 189-193, respectively, in order of appearance), along with intron barcoding yields (Figure 60B) and gel columns showing the results of AAV intron splicing and globin intron splicing (Figure 60C). [Figure 60B] Figure 60 provides a detailed analysis of virus production and RNA splicing using several configurations of the intron barcoding platform. Common ITR-to-ITR constructs are shown in Figure 60A (SEQ ID NOS: 189-193, respectively, in order of appearance), along with intron barcoding yields (Figure 60B) and gel columns showing the results of AAV intron splicing and globin intron splicing (Figure 60C). [Figure 60C] Figure 60 provides a detailed analysis of virus production and RNA splicing using several configurations of the intron barcoding platform. Common ITR-to-ITR constructs are shown in Figure 60A (SEQ ID NOS: 189-193, respectively, in order of appearance), along with intron barcoding yields (Figure 60B) and gel columns showing the results of AAV intron splicing and globin intron splicing (Figure 60C). DETAILED DESCRIPTION OF THE INVENTION

[0020] Details of one or more embodiments of the present disclosure are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in practicing or testing the present disclosure, the preferred materials and methods are described herein. Other features, objects, and advantages of the present disclosure will be apparent from the present description. In this description, the singular also includes the plural unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. In the event of a conflict, the present description shall control.

[0021] According to the present disclosure, AAV particles with enhanced tropism for target tissues (e.g., CNS) are provided, as well as related processes for targeting, preparing, formulating, and using them. Targeting peptides and nucleic acid sequences encoding the targeting peptides are provided. These targeting peptides can be inserted into the AAV capsid protein sequence to alter tropism for specific cell types, tissues, organs, or organisms in vivo, ex vivo, or in vitro.

[0022] As used herein, an "AAV particle" or "AAV vector" comprises capsid proteins and a viral genome, the viral genome comprising at least one payload region and at least one inverted terminal repeat (ITR). The AAV particle and / or its component capsid and viral genome may be genetically engineered to alter tropism for specific cell types, tissues, organs, or organisms.

[0023] As used herein, "viral genome" or "vector genome" refers to a nucleic acid sequence encapsulated in an AAV particle. The viral genome includes a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.

[0024] As used herein, a "payload region" is any nucleic acid molecule that encodes one or more "payloads" of the present disclosure. As a non-limiting example, the payload region may be a nucleic acid sequence that encodes a payload comprising an RNAi agent or a polypeptide.

[0025] As used herein, a "targeting peptide" refers to a peptide of 3 to 20 amino acids in length. Such targeting peptides can be inserted into or attached to a parent amino acid sequence to alter the properties (e.g., tropism) of the parent protein. As a non-limiting example, a targeting peptide can be inserted into an AAV capsid sequence to enhance targeting to a desired cell type, tissue, organ, or organism.

[0026] The AAV particles and payloads of the present disclosure can be delivered to one or more target cells, tissues, organs, or organisms.In a preferred embodiment, the AAV particles of the present disclosure demonstrate enhanced tropism for target cell types, tissues, or organs.As a non-limiting example, the AAV particles can exhibit enhanced tropism for cells and tissues of the central nervous system or peripheral nervous system (CNS and PNS, respectively).In addition to or instead of this, the AAV particles of the present disclosure can exhibit reduced tropism for undesirable target cell types, tissues, or organs.

[0027] Adeno-associated viruses (AAVs) are small, non-enveloped, icosahedral-capsid viruses of the Parvoviridae family, characterized by a single-stranded DNA genome. The Parvoviridae family consists of two subfamilies: the Parvovirinae, which infect vertebrates, and the Densovirinae, which infect invertebrates. The Parvoviridae family includes the Dependovirus genus, which contains AAVs that can replicate in vertebrate hosts, including, but not limited to, humans, primates, bovine, canine, equine, and ovine species.

[0028] Parvoviruses and other members of the Parvoviridae family are reviewed in Kenneth I. Berns, "The Parvoviridae: The Viruses and Their Replication," Chapter 69 of FIELDS VIROLOGY (3rd Ed. 1996), the contents of which are incorporated by reference in their entirety.

[0029] AAVs have proven useful as biological tools because of their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integrating into the host genome and replicating, and their relatively benign immunogenicity profile. The viral genome can be engineered to contain the minimum components required to assemble functional recombinant viruses or viral particles that are loaded with a desired payload or engineered to target specific tissues and express or deliver a desired payload.

[0030] The wild-type AAV viral genome is a linear single-stranded DNA (ssDNA) molecule approximately 5,000 nucleotides (nt) long. Inverted terminal repeats (ITRs) traditionally cap the viral genome at both the 5' and 3' ends and provide origins of replication for the viral genome. Without wishing to be bound by theory, AAV viral genomes typically contain two ITR sequences. These ITRs have a characteristic T-shaped hairpin structure defined by self-complementary regions (145 nt in the wild-type) at the 5' and 3' ends of the ssDNA that form energetically stable double-stranded regions. The double-stranded hairpin structure has multiple functions, including, but not limited to, acting as a primer for the endogenous DNA polymerase complex of host viral replicating cells, thereby acting as an origin of DNA replication.

[0031] The wild-type AAV viral genome contains two open reading frames: one for four nonstructural Rep proteins (Rep78, Rep68, Rep52, and Rep40, encoded by the Rep genes) and one for three additional capsid or structural proteins (VP1, VP2, and VP3, encoded by the capsid or Cap genes). The Rep proteins are important for replication and packaging, and the capsid proteins assemble to create the protein coat of AAV, i.e., the AAV capsid. Alternative splicing and alternative start codons and promoters result in the production of four different Rep proteins from a single open reading frame, and the production of three capsid proteins from a single open reading frame. While this varies depending on the AAV serotype, as a non-limiting example, in the case of AAV9 / hu.14 (U.S. Pat. No. 7,906,111, SEQ ID NO: 123, the contents of which are incorporated herein by reference in their entirety), VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. In other words, VP1 is the full-length capsid sequence, while VP2 and VP3 are shorter components of the whole. As a result, although sequence changes in the VP3 region are also present in VP1 and VP2, the percent difference compared to the parent sequence is greatest in VP3, as it is the shortest of the three. While described herein in terms of amino acid sequence, the nucleic acid sequences encoding these proteins can be similarly described. The three capsid proteins assemble together to create the AAV capsid protein. Without wishing to be bound by theory, AAV capsid proteins typically comprise a 1:1:10 molar ratio of VP1:VP2:VP3. As used herein, "AAV serotype" is primarily defined by the AAV capsid. In some cases, the ITRs are also specifically described by the AAV serotype (e.g., AAV2 / 9).

[0032] The AAV vectors of the present disclosure may be recombinantly produced or may be based on an adeno-associated virus (AAV) parent or reference sequence. As used herein, a "vector" is any molecule or moiety that transports, transduces, or otherwise acts as a carrier for heterologous molecules, such as the nucleic acids described herein.

[0033] In addition to single-stranded AAV viral genomes (e.g., ssAAV), the present disclosure also provides self-complementary AAV (scAAV) viral genomes. The scAAV vector genome contains DNA strands that anneal together to form double-stranded DNA. By skipping second-strand synthesis, scAAV allows for rapid expression in transduced cells.

[0034] In one embodiment, the AAV particles of the present disclosure are scAAV. In one embodiment, the AAV particles of the present disclosure are ssAAV. Methods for producing and / or modifying AAV particles, such as pseudotyped AAV vectors, have been disclosed in the art (WO200028004; WO200123001; WO2004112727; WO2005005610, and WO2005072364, the contents of each of which are incorporated herein by reference in their entirety).

[0035] In one embodiment, AAV particles of the present disclosure comprising a capsid and viral genome with a targeting peptide inserted therein can exhibit enhanced tropism for a cell type or tissue of the human CNS.

[0036] AAV capsid The AAV particles of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype.AAV serotypes can differ in characteristics such as, but not limited to, packaging, tropism, transduction, and immunogenicity profile.Without wishing to be bound by theory, AAV capsid protein is often considered to be what drives the tropism of AAV particles to specific tissues.

[0037] In one embodiment, the AAV particles may have capsid proteins and ITR sequences derived from the same parent serotype (e.g., AAV2 capsid and AAV2 ITRs). In another embodiment, the AAV particles may be pseudotyped AAV particles, in which the capsid proteins and ITR sequences are derived from different parent serotypes (e.g., AAV9 capsid and AAV2 ITRs; AAV2 / 9).

[0038] The AAV particles of the present disclosure may comprise an AAV capsid protein into which a targeting peptide has been inserted. The parent capsid or serotype may comprise or be derived from any natural or recombinant AAV serotype. As used herein, a "parent" sequence is a nucleotide or amino acid sequence into which a targeting sequence is inserted (i.e., a nucleotide insertion into a nucleic acid sequence or an amino acid sequence insertion into an amino acid sequence).

[0039] In a preferred embodiment, the parent AAV capsid nucleotide sequence is as shown in SEQ ID NO:1. In another embodiment, the parent AAV capsid nucleotide sequence is the K449R variant of SEQ ID NO: 1, in which the codon encoding lysine (e.g., AAA or AAG) at position 449 of the amino acid sequence (nucleotides 1345-1347) is replaced with one encoding arginine (CGT, CGC, CGA, CGG, AGA, AGG). The K449R variant has the same functionality as wild-type AAV9.

[0040] In one embodiment, the parent AAV capsid amino acid sequence is as shown in SEQ ID NO:2. In another embodiment, the parent AAV capsid amino acid sequence is as shown in SEQ ID NO:3.

[0041] In one embodiment, the parent AAV capsid sequence is any of those shown in Table 1.

[0042] [Table 1]

[0043] Each of the patents, applications, and / or publications listed in Table 1 is incorporated herein by reference in its entirety. The parent AAV serotype and associated capsid sequence may be any known in the art. Non-limiting examples of such AAV serotypes include: AAV9, AAV9 K449R (or K449R AAV9), AAV1, AAVrhlO, AAV-DJ, AAV-DJ8, AAV5, AAVPHP.B (PHP.B), AAVPHP.A (PHP.A), AAVG2B-26, AAVG2B-13, AAVTH1.1-32, AAVTH1.1-35, AAVPHP.B2 (PHP.B2), AAVPHP.B3 (PHP.B3), AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, and AAVPHP.B-GGT. , AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP , AAVPHP.B-SNP(3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN, AAVPHP.B-EGT, AAV PHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B-PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B- TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3(G2A3), AAVG2B4(G2B4), AAVG2B5(G2B5), PHP.S, AAV2, AAV2G9, AAV3, AAV3a, AA V3b, AAV3-3, AAV4, AAV4-4, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9.11, AAV9.13, AAV9.16, AAV9. 24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12、AAV42-1b、AAV42-2、AAV42-3a、AAV42-3b、AAV42-4、AAV42-5a、AAV42-5b、AAV42-6b、AAV42-8、AAV42-10、AAV42-11、AAV42-12、AAV42-13、AAV42-1 5、AAV42-aa、AAV43-1、AAV43-12、AAV43-20、AAV43-21、AAV43-23、AAV43-25、AAV43-5、AAV44.1、AAV44.2、AAV44.5、AAV223.1、AAV223.2、AAV223.4 AV223.5、AAV223.6、AAV223.7、AAV1-7 / rh.48、AAV1-8 / rh.49、AAV2-15 / rh.62、AAV2-3 / rh.61、AAV2-4 / rh.50、AAV2-5 / rh.51、AAV3.1 / rh.6、AAV3.1 / rh.61 hu.9、AAV3-9 / rh.52、AAV3-11 / rh.53、AAV4-8 / r11.64、AAV4-9 / rh.54、AAV4-19 / rh.55、AAV5-3 / rh.57、AAV5-22 / rh.58、AAV7.3 / rh.7、AAV16.8 / hu.1 0、AAV16.12 / hu.11、AAV29.3 / bb.1、AAV29.5 / bb.2、AAV106.1 / hu.37、AAV114.3 / hu.40、AAV127.2 / hu.41、AAV127.5 / hu.42、AAV128.3 / hu.44、AAV130.4 / hu.48、AAV145.1 / hu.53、AAV145.5 / hu.54、AAV145.6 / hu.55、AAV161.10 / hu.60、AAV161.6 / hu.61、AAV33.12 / hu.17、AAV33.4 / hu.15、AAV33.8 / hu .16、AAV52 / hu.19、AAV52.1 / hu.20、AAV58.2 / hu.25、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAVC1、AAVC2、AAVC5、AAVF3、AAVF5、AAVH2、AAVrh.72、AAV hu.8、AAVrh.68、AAVrh.70、AAVpi.1、AAVpi.3、AAVpi.2、AAVrh.60、AAVrh.44、AAVrh.65、AAVrh.55、AAVrh.47、AAVrh.69、AAVrh.45、AAVrh.59、AAVhu.12、AAVH6、AAVH-1 / hu.1、AAVH-5 / hu.3、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVN721-8 / rh.43、AA VCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy. 6、AAVhu.1、AAVhu.2、AAVhu.3、AAVhu.4、AAVhu.5、AAVhu.6、AAVhu.7、AAVhu.9、AAVhu.10、AAVhu.11、AAVhu.13、AAVhu. AVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu.24、AAVhu.25、AAVhu. u.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4 0、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu. 47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.51、AAVhu.52、AAVhu.54、AAVhu.55、AAVhu. u.56、AAVhu.57、AAVhu.58、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.14 / 9、AAVhu.t 19、AAVrh.2、AAVrh.2R、AAVrh.8、AAVrh.8R、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.20、AAVrh. rh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37、AAVrh.37、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.46、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2、AAVrh.48.2、AAVrh.49、AAVrh.51、AAVrh.52、AAVrh.53、AAVrh. h.54、AAVrh.56、AAVrh.57、AAVrh.58、AAVrh.61、AAVrh.64、AAVrh.64R1、AAVrh.64R2、AAVrh.67、AAVrh.73、AAVrh.74、AAVrh.8R、AAVrh.8R. A586R mutation、AAVrh8R R533A mutation、AAAV、BAAV、ヤギAAV、ウシAAV、AAVhE1.1、AAVhEr1.5、AAVhEr1.14、AAVhEr1.8、AAVhEr1.16、AAVhEr1.18、AAVhEr1.35、AAVhEr1.7、AAVhEr1.36、AAV hEr2.29、AAVhEr2.4、AAVhEr2.16、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AAVhER1.23、AAVhEr3.1、AAV2.5T、AAV-PAEC、AAV-LK01、AAV-LK02、AAV-LK03、AAV-LK03 LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK16、AAV-LK17、AAV-LK18 、AAV-LK19、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAV-PAEC11、AAV-PAEC12、AAV-2-pre-miRNA-101、AAV-8h、AAV-8b、AAV-h、AAV-b、AAV SM 10-2、AAVシャッフル(AAV Shuffle)100-1、AAVシャッフル100-3、AAVシャッフル100-7、AAVシャッフル10-6、AAVシャッフル10-8、AAV SM 10-8、AAV SM 100-3、AAV SM 10-8 100-10、BNP61 AAV、BNP62 AAV、BNP63 AAV、AAVrh.50、AAVrh.43、AAVrh.62、AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, True type AAV (ttAAV), UPENN AAV10, Japanese AAV10 serotype, AAV CBr-7.1, AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5、AAV CBr-7.7、AAV CBr-7.8、AAV CBr-B7.3、AAV CBr-B7.4、AAV CBr-E1、AAV CBr-E2、AAV CBr-E3、AAV CBr-E4、AAV CBr-E5、AAV CBr-e5、AAV CBr-E6、AAV CBr-E7、AAV CBr-E8、AAV CHt-1、AAV CHt-2、AAV CHt-3、AAV CHt-6.1、AAV CHt-6.10、AAV CHt-6.5、AAV CHt-6.6、AAV CHt-6.7、AAV CHt-6.8、AAV CHt-P1、AAV CHt-P2、AAV CHt-P5、AAV CHt-P6、AAV CHt-P8、AAV CHt-P9、AAV CKd-1、AAV CKd-10、AAV CKd-2、AAV CKd-3、AAV CKd-4、AAV CKd-6、AAV CKd-7、AAV CKd-8、AAV CKd-B1、AAV CKd-B2、AAV CKd-B3、AAV CKd-B4、AAV CKd-B5、AAV CKd-B6、AAV CKd-B7、AAV CKd-B8、AAV CKd-H1、AAV CKd-H2、AAV CKd-H3、AAV CKd-H4、AAV CKd-H5、AAV CKd-H6、AAV CKd-N3、AAV CKd-N4、AAV CKd-N9、AAV CLg-F1、AAV CLg-F2、AAV CLg-F3、AAV CLg-F4、AAV CLg-F5、AAV CLg-F6、AAV CLg-F7、AAV CLg-F8、AAV CLv-1、AAV CLv1-1、AAV CLv1-10、AAV CLv1-2、AAV CLv-12、AAV CLv1-3、AAV CLv-13、AAV CLv1-4、AAV Clv1-7、AAV Clv1-8、AAV Clv1-9、AAV CLv-2、AAV CLv-3、AAV CLv-4、AAV CLv-6、AAV CLv-8、AAV CLv-D1、AAV CLv-D2、AAV CLv-D3、AAV CLv-D4、AAV CLv-D5、AAV CLv-D6、AA. V CLv-D7, AAV CLv-D8, AAV CLv-E1, AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-AAV1 CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-RAV3 CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3 CSp-4、AAV CSp-6、AAV CSp-7、AAV CSp-8、AAV CSp-8.10、AAV CSp-8.2、AAV CSp-8.4、AAV CSp-8.5、AAV CSp-8.6、AAV CSp-8. CSp-8.8、AAV CSp-8.9、AAV CSp-9、AAV.hu.48R3、AAV.VR-355、AAV3B、AAV4、AAV5、AAVF1 / HSC1、AAVF11 / H SC11、AAVF12 / HSC12、AAVF13 / HSC13、AAVF14 / HSC14、AAVF15 / HSC15、AAVF16 / HSC16、AAVF17 / HSC17、AAVF2 / HSC2、AAVF3 / HSC3、AAVF4 / HSC4、AAVF5 / HSC5、A AVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9

[0044] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12):5887-5911 (2008), U.S. Patent Application Publication No. 20140359799, and U.S. Patent No. 7,588,772, each of which is incorporated herein by reference in its entirety). The amino acid sequence of AAVDJ8 may include two or more mutations to remove the heparin-binding domain (HBD). As a non-limiting example, an AAV-DJ sequence may be as set forth in SEQ ID NO:1 of U.S. Pat. No. 7,588,772 (the contents of which are incorporated herein by reference in their entirety), and the AAV-DJ8 sequence may contain two mutations: (1) R587Q, in which arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln), and (2) R590T, in which arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As another non-limiting example, the AAV-DJ8 sequence may contain three mutations: (1) K406R, which changes lysine (K; Lys) at amino acid 406 to arginine (R; Arg), (2) R587Q, which changes arginine (R; Arg) at amino acid 587 to glutamine (Q; Gln), and (3) R590T, which changes arginine (R; Arg) at amino acid 590 to threonine (T; Thr).

[0045] In one embodiment, the parent AAV capsid sequence comprises an AAV9 sequence. In one embodiment, the parent AAV capsid sequence comprises a K449R AAV9 sequence. In one embodiment, the parent AAV capsid sequence comprises an AAVDJ sequence.

[0046] In one embodiment, the parent AAV capsid sequence comprises the AAVDJ8 sequence. In one embodiment, the parent AAV capsid sequence comprises an AAVrhlO sequence. In one embodiment, the parent AAV capsid sequence comprises an AAV1 sequence.

[0047] In one embodiment, the parent AAV capsid sequence comprises an AAV5 sequence. Without wishing to be bound by theory, it is understood that the parent AAV capsid sequence comprises the VP1 region. In one embodiment, the parent AAV capsid sequence comprises the VP1, VP2, and / or VP3 region, or any combination thereof. The parent VP1 sequence can be considered synonymous with the parent AAV capsid sequence.

[0048] This disclosure refers to structural capsid proteins (including VP1, VP2, and VP3) encoded by capsid (Cap) genes. These capsid proteins form the outer protein structural coat (i.e., capsid) of viral vectors, such as AAV. VP capsid proteins synthesized from Cap polynucleotides generally contain a methionine (Met1) as the first amino acid in the peptide sequence, which is associated with the start codon (AUG or ATG) of the corresponding Cap nucleotide sequence. However, the first methionine (Met1) residue, or generally any first amino acid (AA1), is typically cleaved by a protein processing enzyme, such as Met-aminopeptidase, after or during polypeptide synthesis. This "Met / AA clipping" process often correlates with the corresponding acetylation of the second amino acid in the polypeptide sequence (e.g., alanine, valine, serine, threonine, etc.). Met clipping typically occurs in VP1 and VP3 capsid proteins, but can also occur in VP2 capsid proteins.

[0049] Incomplete Met / AA clipping may result in the production of a mixture of one or more (1, 2, or 3) VP capsid proteins that make up the viral capsid, some of which contain the Met1 / AA1 amino acid (Met+ / AA+) and some of which may lack the Met1 / AA1 amino acid as a result of Met / AA clipping (Met- / AA-). For further discussion of Met / AA clipping of capsid proteins, see the following references: Jin, et al., "Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno-Associated Virus Capsid Proteins." Hum Gene Ther Methods. 2017 Oct. 28(5):255-267; and Hwang, et al., "N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals." Science. 2010 February 19, 327(5968):973-977, the contents of each of which are incorporated herein by reference in their entirety.

[0050] According to the present disclosure, reference to a capsid protein is not limited to whether it is clipped (Met- / AA-) or unclipped (Met+ / AA+), and can refer, depending on the context, to an individual capsid protein, a viral capsid comprised of a mixture of capsid proteins, and / or a polynucleotide sequence (or fragment thereof) that encodes, describes, produces, or results in a capsid protein of the present disclosure. Also, a direct reference to a "capsid protein" or "capsid polypeptide" (such as VP1, VP2, or VP2) can include a VP capsid protein that includes the Met1 / AA1 amino acids (Met+ / AA+) as well as the corresponding VP capsid protein that lacks the Met1 / AA1 amino acids as a result of Met / AA clipping (Met- / AA-).

[0051] Furthermore, according to the present disclosure, reference to specific SEQ ID NOs (whether protein or nucleic acid) that each contain or encode one or more capsid proteins (Met+ / AA+) that contain Met1 / AA1 amino acids should be understood to teach VP capsid proteins that lack the Met1 / AA1 amino acids, and any sequence that merely lacks the first-listed amino acid (whether Met1 / AA1 or not) is immediately apparent upon inspection of the sequence.

[0052] As a non-limiting example, a reference to a (Met+)VP1 polypeptide sequence that is 736 amino acids in length and that includes the "Met1" amino acid encoded by an AUG / ATG start codon can be understood to also teach a (Met-)VP1 polypeptide sequence that is 735 amino acids in length and that does not include the "Met1" amino acid of the 736 amino acid Met+ sequence. As a second non-limiting example, a reference to a (AA+)VP1 polypeptide sequence that is 736 amino acids in length and that includes the "AA1" amino acid encoded by an optional NNN start codon can be understood to also teach a (AA-)VP1 polypeptide sequence that is 735 amino acids in length and that does not include the "AA1" amino acid of the 736 amino acid AA+ sequence.

[0053] Reference to a viral capsid formed from VP capsid proteins (such as a reference to a specific AAV capsid serotype) may incorporate VP capsid proteins that include the Met1 / AA1 amino acids (Met+ / AA1+), the corresponding VP capsid proteins that lack the Met1 / AA1 amino acids as a result of Met / AA1 clipping (Met- / AA1-), and combinations thereof (Met+ / AA1+ and Met- / AA1-).

[0054] As non-limiting examples, AAV capsid serotypes may include VP1(Met+ / AA1+), VP1(Met- / AA1-), or a combination of VP1(Met+ / AA1+) and VP1(Met- / AA1-). AAV capsid serotypes may also include VP3(Met+ / AA1+), VP3(Met- / AA1-), or a combination of VP3(Met+ / AA1+) and VP3(Met- / AA1-), as well as similar optional combinations of VP2(Met+ / AA1) and VP2(Met- / AA1-).

[0055] In one embodiment, the parent AAV capsid sequence may comprise an amino acid sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of those set forth below.

[0056] In one embodiment, the parent AAV capsid sequence may be encoded by a nucleotide sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of those set forth below.

[0057] In one embodiment, the parent sequence is not an AAV capsid sequence, but instead is a different vector (e.g., a lentivirus, a plasmid, etc.) In another embodiment, the parent sequence is a delivery vehicle (e.g., a nanoparticle) to which the targeting peptide is attached.

[0058] Targeting Peptides Disclosed herein are targeting peptides for enhancing or improving transduction of target tissues (e.g., cells of the CNS or PNS), and related AAV particles comprising capsid proteins with one or more targeting peptide inserts.

[0059] In one embodiment, the targeting peptide can direct the AAV particle to a cell or tissue of the CNS. The cell of the CNS may be a brain support cell, such as, but not limited to, a neuron (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), a glial cell (e.g., microglia, astrocytes, oligodendroglia), and / or an immune cell (e.g., T cell). The tissue of the CNS may be, but is not limited to, the cortex (e.g., frontal, parietal, occipital, temporal), thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, or deep cerebellar nuclei.

[0060] In one embodiment, the targeting peptide can direct the AAV particle to a cell or tissue of the PNS, which may be, but is not limited to, the dorsal root ganglion (DRG).

[0061] The targeting peptide can direct AAV particles to the CNS (e.g., the cortex) after intravenous administration. The targeting peptide can direct AAV particles to the PNS (e.g., DRG) after intravenous administration.

[0062] The targeting peptide may vary in length. In one embodiment, the targeting peptide is 3 to 20 amino acids in length. By way of non-limiting example, the targeting peptide may be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 3 to 5, 3 to 8, 3 to 10, 3 to 12, 3 to 15, 3 to 18, 3 to 20, 5 to 10, 5 to 15, 5 to 20, 10 to 12, 10 to 15, 10 to 20, 12 to 20, or 15 to 20 amino acids in length.

[0063] The targeting peptides of the present disclosure can be identified and / or designed by any method known in the art. As a non-limiting example, the CREATE system described in Deverman et al. (Nature Biotechnology 34(2):204-209(2016)), Chan et al. (Nature Neuroscience 20(8):1172-1179)(2017)), and WO 2015038958 and WO 2017100671 can be used as a means to identify targeting peptides in mice or other research animals, such as, but not limited to, non-human primates. The contents of each of these documents are incorporated herein by reference in their entirety.

[0064] Targeting peptides and related AAV particles can be identified from libraries of AAV capsids containing targeting peptide variants. In one embodiment, the targeting peptide may be a sequence of seven amino acids (a 7-mer). In another embodiment, the targeting peptide may be a sequence of nine amino acids (a 9-mer). Targeting peptides may also vary in the methods used to create or design them, including, by way of non-limiting example, random peptide selection, site-saturation mutagenesis, and / or optimization of specific regions of the peptide (e.g., flanking regions or the central core).

[0065] In one embodiment, the targeting peptide library comprises targeting peptides seven amino acids in length (7-mers) randomly generated by PCR. In one embodiment, the targeting peptide library comprises targeting peptides having three mutated amino acids. In one embodiment, the three mutated amino acids are consecutive amino acids. In another embodiment, the three mutated amino acids are non-consecutive amino acids. In one embodiment, the parent targeting peptide is a 7-mer. In another embodiment, the parent peptide is a 9-mer.

[0066] In one embodiment, the targeting peptide library comprises 7-mer targeting peptides, and amino acids in the targeting peptides and / or flanking sequences have been evolved by site-saturation mutagenesis of three consecutive amino acids. In one embodiment, the site-saturation mutant sequences are generated using NNK (N = any base; K = G or T) codons.

[0067] AAV particles are generated that contain capsid protein with targeting peptide insertion, and the viral genome that encodes reporter (e.g., GFP) is encapsulated therein.Then, these AAV particles (or AAV capsid library) are administered to transgenic mice by intravenous delivery to tail vein.When these capsid libraries are administered to cre-expressing mice, Cre is expressed, which leads to the expression of reporter payload in target tissue.

[0068] AAV particles and / or viral genomes may be recovered from the target tissue to identify enrichment of targeting peptides and associated AAV particles, indicating enhanced transduction of the target tissue. Enrichment can be determined using standard methods in the art, including, but not limited to, next-generation sequencing (NGS), viral genome quantification, biochemical assays, immunohistochemistry, and / or imaging of target tissue samples.

[0069] The target tissue may be any cell, tissue, or organ of interest. By way of non-limiting example, the sample may be selected from the brain, spinal cord, dorsal root ganglion and associated roots, liver, heart, gastrocnemius muscle, soleus muscle, pancreas, kidney, spleen, lung, adrenal gland, stomach, sciatic nerve, saphenous nerve, thyroid gland, eye (with or without optic nerve), pituitary gland, skeletal muscle (rectus femoris), colon, duodenum, ileum, jejunum, leg skin, superior cervical ganglion, bladder, ovaries, uterus, prostate, testes, and / or any site identified as having a lesion or site of interest.

[0070] Targeting peptide sequence In one embodiment, the targeting peptide may comprise a sequence as shown in Table 2. In Table 2, "_1" refers to an NNM codon with A or C at the third position, and "_2" refers to an NNK codon with G or T at the third position. In addition, because Met or Trp can only be encoded by the codons ATG and TGG, respectively, the NNM codons cannot encompass the entire repertoire of amino acids. Therefore, some "NNM" sequences also contain some codons that end in G.

[0071] [Table 2-1]

[0072] [Table 2-2]

[0073] [Table 2-3]

[0074] [Table 2-4]

[0075] [Table 2-5]

[0076] [Table 2-6]

[0077] [Table 2-7]

[0078] In one embodiment, the targeting peptide sequence may comprise an amino acid sequence having 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any of the sequences shown in Table 2.

[0079] In one embodiment, the targeting peptide may comprise four or more consecutive amino acids of any of the targeting peptides disclosed herein. In one embodiment, the targeting peptide may comprise four consecutive amino acids of any of the sequences as shown in Table 2. In one embodiment, the targeting peptide may comprise five consecutive amino acids of any of the sequences as shown in Table 2. In one embodiment, the targeting peptide may comprise six consecutive amino acids of any of the sequences as shown in Table 2.

[0080] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence as shown in any of Table 2.

[0081] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence comprising at least four consecutive amino acids of any of the sequences as shown in any of Table 2.

[0082] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid having a targeting peptide insert, wherein the targeting peptide has an amino acid sequence substantially comprising any of the sequences as set forth in any of Table 2.

[0083] In one embodiment, an AAV particle of the present disclosure comprises an AAV capsid polynucleotide having a targeting nucleic acid insert, the targeting nucleic acid insert having a nucleotide sequence substantially comprising any of those shown as Table 2.

[0084] AAV particles of the present disclosure containing a targeting nucleic acid insert may have a polynucleotide sequence that has 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity to the parent capsid sequence.

[0085] AAV particles of the present disclosure that include a targeting peptide insert may have an amino acid sequence that is 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to the parent capsid sequence.

[0086] In any of the DNA and RNA sequences referenced and / or described herein, the single letter symbols have the following explanations: A is adenine; C is cytosine; G is guanine; T is thymine; U is uracil; W is a weak base such as adenine or thymine; S is a strong nucleotide such as cytosine and guanine; M is an amino nucleotide such as adenine and cytosine; K is a keto nucleotide such as guanine and thymine; R is the purines adenine and guanine; Y is the pyrimidines cytosine and thymine; B is any base that is not A (e.g., cytosine, guanine, and thymine); D is any base that is not C (e.g., adenine, guanine, and thymine); H is any base that is not G (e.g., adenine, cytosine, and thymine); V is any base that is not T (e.g., adenine, cytosine, and guanine); N is any nucleotide (not a gap); and Z is zero.

[0087] In any of the amino acid sequences referenced and / or described herein, the single letter symbols have the following explanations: G (Gly) is glycine; A (Ala) is alanine; L (Leu) is leucine; M (Met) is methionine; F (Phe) is phenylalanine; W (Trp) is tryptophan; K (Lys) is lysine; Q (Gln) is glutamine; E (Glu) is glutamic acid; S (Ser) is serine; P (Pro) is proline; V (Val) is valine; I (Ile) is isoform Leucine; C (Cys) is cysteine; Y (Tyr) is tyrosine; H (His) is histidine; R (Arg) is arginine; N (Asn) is asparagine; D (Asp) is aspartic acid; T (Thr) is threonine; B (Asx) is aspartic acid or asparagine; J (Xle) is leucine or isoleucine; O (Pyl) is pyrrolysine; U (Sec) is selenocysteine; X (Xaa) is any amino acid; and Z (Glx) is glutamine or glutamic acid.

[0088] Use of targeting peptides in AAV particles The targeting peptide may be a free-standing peptide or may be inserted or conjugated to a parent sequence, hi one embodiment, the targeting peptide is inserted into the capsid protein of the AAV particle.

[0089] One or more targeting peptides may be inserted into the parent AAV capsid sequence to generate the AAV particles of the present disclosure. The targeting peptide may be inserted into the parent AAV capsid sequence at any position that results in a complete functional AAV particle. The targeting peptide may be inserted into VP1, VP2, and / or VP3. Because the numbering of amino acid residues varies across AAV serotypes, the exact amino acid position of the targeting peptide insertion may not be important. As used herein, the amino acid positions of the parent AAV capsid sequence are described using AAV9 (SEQ ID NO: 2) as a reference.

[0090] In one embodiment, the targeting peptide is inserted into the hypervariable region of the AAV capsid sequence. Non-limiting examples of such hypervariable regions include loop IV and loop VIII of the parent AAV capsid. Without wishing to be bound by theory, these surface-exposed loops are unstructured and poorly conserved, making them ideal regions for inserting targeting peptides.

[0091] In one embodiment, the targeting peptide is inserted into loop IV. In another embodiment, the targeting peptide is used to replace part or all of loop IV. As a non-limiting example, the addition of a targeting peptide to a parent AAV capsid sequence may result in the substitution or mutation of at least one amino acid in the parent AAV capsid.

[0092] In one embodiment, the targeting peptide is inserted into loop VIII. In another embodiment, the targeting peptide is used to replace part or all of loop VIII. As a non-limiting example, the addition of a targeting peptide to a parent AAV capsid sequence may result in the substitution or mutation of at least one amino acid in the parent AAV capsid.

[0093] In one embodiment, more than one targeting peptide is inserted into the parent AAV capsid sequence. As a non-limiting example, a targeting peptide may be inserted into both loop IV and loop VIII of the same parent AAV capsid sequence.

[0094] The targeting peptide may be inserted at any amino acid position in the parent AAV capsid sequence, including, but not limited to, between amino acids 586-592, 588-589, 586-589, 452-458, 262-269, 464-473, 491-495, 546-557, and / or 659-668.

[0095] In a preferred embodiment, the targeting peptide is inserted into the parent AAV capsid sequence between amino acids 588 and 589 (loop VIII). In one embodiment, the parent AAV capsid is AAV9 (SEQ ID NO: 2). In a second embodiment, the parent AAV capsid is K449R AAV9 (SEQ ID NO: 3).

[0096] The targeting peptides described herein can increase transduction of the AAV particles of the present disclosure into a target tissue compared to a parent AAV particle lacking a targeting peptide insert. In one embodiment, the targeting peptide increases transduction of the AAV particles into a target tissue by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500%, or more compared to a parent AAV particle lacking a targeting peptide insert.

[0097] In one embodiment, the targeting peptide increases transduction of the AAV particle into cells or tissues of the CNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to the parent AAV particle lacking the targeting peptide insert.

[0098] In one embodiment, the targeting peptide increases transduction of the AAV particle into cells or tissues of the PNS by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to the parent AAV particle lacking the targeting peptide insert.

[0099] In one embodiment, the targeting peptide increases transduction of AAV particles into DRG cells or tissues by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 200%, 300%, 400%, 500% or more compared to parent AAV particles lacking the targeting peptide insert.

[0100] AAV production The virus production disclosed herein describes processes and methods for producing AAV particles (with enhanced, improved, and / or increased tropism for target tissues) that can be used to contact target cells and deliver a payload.

[0101] The present disclosure provides a method for producing AAV particles containing targeting peptides.In one embodiment, AAV particles are prepared by viral genome replication in viral replicating cells.Any method known in the art can be used to prepare AAV particles.In one embodiment, AAV particles are produced in mammalian cells (e.g., HEK293).In another embodiment, AAV particles are produced in insect cells (e.g., Sf9).

[0102] Methods for producing AAV particles are well known in the art and are described, for example, in U.S. Patent Nos. 6,204,059, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498, and 749,150. Nos. 8, 5064764, 6194191, 6566118, 8137948; or WO 1996039530, WO 1998010088, WO 1999014354, WO 1999015685, WO 1999047691, WO 2000055342, WO 2000075353, and WO 2001023597; Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford University Press (1994); Samulski et al., J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir. 219:37-44 (1996); Zhao et al. al.), Vir. 272:382-93 (2000). The contents of each of these references are incorporated herein by reference in their entirety. In one embodiment, the AAV particles are fabricated using the methods described in WO2015191508.The contents of this document are incorporated herein by reference in their entirety.

[0103] Therapeutic Applications The present disclosure provides methods for treating a disease, disorder, and / or condition in a mammalian subject, including a human subject, comprising administering to the subject an AAV particle described herein, including a novel capsid defined by the present disclosure (a "TRACER AAV particle"), or any of the compositions described herein, including the pharmaceutical compositions described herein.

[0104] In one embodiment, the TRACER AAV particles of the present disclosure are administered to a subject prophylactically to prevent the onset of a disease. In another embodiment, the TRACER AAV particles of the present disclosure are administered to treat (reduce the effects of) a disease or its symptoms. In yet another embodiment, the TRACER AAV particles of the present disclosure are administered to cure (eliminate) a disease. In another embodiment, the TRACER AAV particles of the present disclosure are administered to prevent or slow the progression of a disease. In yet another embodiment, the TRACER AAV particles of the present disclosure are used to reverse the deleterious effects of a disease. Disease state and / or progression can be determined or monitored by standard methods known in the art.

[0105] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating neurological diseases and / or disorders. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating tauopathies.

[0106] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Alzheimer's disease. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Friedreich's ataxia or any disease that is rooted in loss or partial loss of the frataxin protein.

[0107] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Parkinson's disease. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating amyotrophic lateral sclerosis.

[0108] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating Huntington's disease. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating neuropathic pain.

[0109] In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating diseases associated with the central nervous system. In some embodiments, the TRACER AAV particles of the present disclosure are useful in medicine for treating, preventing, alleviating, or ameliorating diseases associated with the peripheral nervous system.

[0110] In one embodiment, the TRACER AAV particles of the present disclosure are administered to a subject having at least one of the diseases or conditions described herein. As used herein, any disease associated with the central or peripheral nervous system and its components (eg, neurons) can be considered a "neurological disease."

[0111] Any neurological disease can be treated with the TRACER AAV particles of the present disclosure or pharmaceutical compositions thereof, including, but not limited to, septum pellucidum defect, acid lipase disease, acid maltase deficiency, acquired epileptiform aphasia, acute disseminated encephalomyelitis, attention deficit hyperactivity disorder (ADHD), Adie pupil, Adie syndrome, adrenoleukodystrophy, agenesis of the corpus callosum, agnosia, Aicardi syndrome, Aicardi-Goutieres syndrome disorder, AIDS-neurological complications, Alexander disease, Alpers disease, alternating hemiplegia, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), anencephaly, aneurysm, Angel's disease, Mann's syndrome, angiomatosis, anoxia, antiphospholipid syndrome, aphasia, apraxia, arachnoid cyst, arachnoiditis, Arnold-Chiari malformation, arteriovenous malformation, Asperger's syndrome, ataxia, ataxia-telangiectasia, ataxia and cerebellar or spinocerebellar degeneration, atrial fibrillation and stroke, attention deficit hyperactivity disorder, autism spectrum disorder, autonomic dysfunction, back pain, Barth syndrome, Batten disease, Becker's myotonia, Behçet's disease, Bell's palsy, benign idiopathic blepharospasm, benign focal muscular atrophy, benign intracranial hypertension, Bernhard-Roth syndrome, Vince's syndrome Wanger's disease, blepharospasm, Bloch-Sulzberger syndrome, brachial plexus birth trauma, brachial plexus injury, Bradbury-Eggleston syndrome, cerebrospinal tumor, cerebral aneurysm, brain injury, Brown-Séquard syndrome, bulbar palsy, spinal-bulbar muscular atrophy, cerebral autosomal dominant arteriopathy with subcortical infarction and leukoencephalopathy (CADASIL), Canavan disease, carpal tunnel syndrome, burning pain, cavernoma, cavernous hemangioma, cavernous malformation, central cervical spinal cord syndrome, central spinal cord syndrome, central pain syndrome, central pontine myelinolysis, head injury, ceramidase deficiency, cerebellar degeneration, cerebellar hypoplasia, cerebral aneurysm, cerebral arteriosclerosis, Cerebral atrophy, cerebral beriberi, cerebral cavernous malformation, cerebral gigantism, cerebral hypoxia, cerebral palsy, cerebro-oculo-facial-skeletal syndrome (COFS), Charcot-Marie-Tooth disease, Chiari malformation, cholesterol ester storage disease, chorea, choreoacanthocytosis, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic orthostatic intolerance, chronic pain, Cockayne syndrome type II, Coffin-Lowry syndrome, colpocephaly, coma, complex regional pain syndrome, concentric sclerosis (Barrow's disease), congenital bilateral facial nerve palsy, congenital myasthenia gravis,Congenital myopathy, congenital vascular cavernous malformation, corticobasal degeneration, cranial arteritis, craniosynostosis, Cree encephalitis, Creutzfeldt-Jakob disease, chronic progressive external ophthalmoplegia, cumulative traumatic injury, Cushing's syndrome, cytomegalic inclusion disease, cytomegalovirus infection, dancing eyes-dancing feet syndrome, Dandy-Walker syndrome, Dawson's disease, Demorsia syndrome, Dejerine-Klumpke palsy, dementia, multi-infarct dementia, semantic dementia, subcortical dementia, dementia with Lewy bodies, demyelinating diseases, dentatocerebellar ataxia, dentatorubral atrophy, dermatomyositis, developmental dyspraxia, Devic's syndrome, diabetic neuropathy, diffuse sclerosis, distal hereditary motor neuropathy, Dravet syndrome, dysautonomia, dysgraphia, dyslexia , dysphagia, dyspraxia, myoclonic cerebellar dyssynergia, progressive cerebellar dyssynergia, dystonia, early infantile epileptic encephalopathy, empty sella syndrome, encephalitis, encephalitis lethargica, encephalopathy (familial infantile), trigeminal region hemangioma, epilepsy, epileptic hemiplegia, paroxysmal ataxia, Erb's palsy, Erb's-Duchenne and Degerines-Klumpke palsy, essential tremor, extrapontine myelinolysis Myelinolysis, Faber's disease, Fahr's syndrome, familial dysautonomia, familial hemangioma, familial idiopathic basal ganglia calcification, familial periodic paralysis, familial spastic paralysis, Faber's disease, febrile convulsions, fibromuscular dysplasia, Fisher's syndrome, hypotonic infantile syndrome, foot drop, Friedreich's ataxia, frontotemporal dementia, Gaucher's disease, systemic gangliosidosis (GM1, GM2), Gerstmann's syndrome, Gerstmann-Straussler-Scheinker disease, giant axonal neuropathy, giant cell arteritis, giant cell inclusion body disease, globoid cell leukodystrophy, glossopharyngeal neuralgia, glycogen storage disease, Guillain-Barré syndrome, Hallervorden-Spatz disease, head trauma, headache, persistent migraine, hemifacial spasm, alternating hemiplegia Alterans), hereditary neuropathies, hereditary spastic paraplegia, hereditary polyneuropathies, shingles, otic shingles, Hirayama syndrome, Holmes-Adie syndrome, holoprosencephaly,HTLV-1-associated myelopathy, Hughes syndrome, Huntington's disease, Hurler syndrome, hydrocephalus, hydrocephalus, normal pressure hydrocephalus, hydromyelopathy, hypercortisolism, hypersomnia, hypertonia, hypotonia, hypoxia, immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, infantile hypotonia, infantile neuroaxonal dystrophy, infantile phytanic acid storage disease, infantile Refsum's disease, infantile spasms, inflammatory myopathy, foramen occipitalis, intestinal lipodystrophy, intracranial cyst, increased intracranial pressure, Isaacs syndrome, Joubert syndrome Lew's syndrome, Kearns-Sayre syndrome, Kennedy's disease, Kinsbourne syndrome, Kleine-Levin syndrome, Klippel-Feil syndrome, Klippel-Trenaunay syndrome (KTS), Klüver-Bucy syndrome, Korsakoff amnesic syndrome, Krabbe's disease, Kugelberg-Welander's disease, kuru, Lambert-Eaton myasthenic syndrome, Landau-Kleffner syndrome, lateral femoral cutaneous nerve entrapment, lateral cord syndrome, learning disability, Leigh's disease, Lennox-Gastaut syndrome, Lessi Nyhan syndrome, leukodystrophy, Levine-Critchley syndrome, dementia with Lewy bodies, Lichtheim disease, lipid storage diseases, lipoid proteinosis, lisencephaly, locked-in syndrome, Lou Gehrig's disease, lupus - neurological sequelae, Lyme disease - neurological complications, lysosomal storage disorders, Machado-Joseph disease, megaencephalopathy, megalencephaly, Melkerson-Rosenthal syndrome, meningitis, meningitis and encephalitis, Menkes disease, dysesthesias, metachromatic leukodystrophy, microcephaly, ectopic head Pain, Miller Fisher syndrome, mild stroke, mitochondrial myopathy, mitochondrial DNA depletion syndrome, Moebius syndrome, monolimb muscular atrophy, Morvan syndrome, motor neuron disease, moyamoya disease, mucolipidosis, mucopolysaccharidosis, multi-infarct dementia, multifocal motor neuropathy, multiple sclerosis, multiple system atrophy, multiple system atrophy with orthostatic hypotension, muscular dystrophy, congenital myasthenia, myasthenia gravis, diffuse myelinoclastic sclerosis Diffuse Sclerosis), myelitis, myoclonic encephalopathy of infancy, myoclonus, myoclonic epilepsy, myopathy, congenital myopathy, thyrotoxic myopathy, myotonia, myotonia congenita, narcolepsy, NARP (neuropathy, ataxia, and retinitis pigmentosa), neuroacanthocytosis, neurodegeneration with cerebral iron accumulation,Neurodegenerative diseases, neurofibromatosis, neuroleptic malignant syndrome, neurological complications of AIDS, neurological complications of Lyme disease, neurological consequences of cytomegalovirus infection, neurological findings in Pompe disease, neurological sequelae of lupus, neuromyelitis optica, neuromyotonia, neuronal ceroid lipofuscinosis, neuronal migration disorders, neuropathic pain, hereditary neuropathies, neuropathy, neurosarcoidosis, neurosyphilis, neurotoxicity, cavernous nevus, Niemann-Pick disease, O'Sullivan-McLeod syndrome, occipital neuralgia, Otahara syndrome, Olivopontocerebellar atrophy, opsoclonus-myoclonus, orthostatic hypotension, abuse syndrome, chronic pain, pantothenate kinase-associated neurodegeneration, paraneoplastic syndromes, paresthesia, Parkinson's disease, paroxysmal choreoathetosis, paroxysmal migraine, Parry-Romberg disease, Pelizaeus-Merzbacher disease, Penner-Shocker II syndrome, perineural cysts, peroneal muscular atrophy, periodic paralysis, peripheral neuropathy, periventricular leukomalacia, persistent vegetative state, pervasive developmental disorder, phytanic acid storage disease, Pick's disease, pinched nerve compression Nerve, piriformis syndrome, pituitary tumor, polymyositis, Pompe disease, porencephaly, post-polio syndrome, postherpetic neuralgia, post-infectious encephalomyelitis, postural hypotension, postural orthostatic tachycardia syndrome, postural orthostatic tachycardia syndrome, primary dentate atrophy, primary lateral sclerosis, primary progressive aphasia, prion disease, progressive bulbar palsy, progressive facial hemiatrophy, progressive gait ataxia, progressive multifocal leukoencephalopathy, progressive muscular atrophy, progressive sclerosing poliodystrophy, progressive supranuclear palsy, prosopagnosia, pseudobulbar palsy, pseudo-Torch syndrome, pseudotoxoplasmosis syndrome), pseudotumor cerebri, psychogenic movement disorder, Ramsay Hunt syndrome I, Ramsay Hunt syndrome II, Rasmussen's encephalitis, reflex sympathetic dystrophy syndrome, Refsum's disease, infantile Refsum's disease, repetitive movement disorder, motor repetitive strain injury, restless legs syndrome, retroviral-associated myelopathy, Rett's syndrome, Reie's syndrome, rheumatoid encephalitis, Riley-Day syndrome, sacral nerve root cyst, chorea, salivary gland disease, Sandhoff's disease, Schilder's disease, schizophrenia, Seitelberger's disease, seizure disorder, semantic dementia, septo-optic dysplasia,Severe Myoclonic Epilepsy of Infancy (SMEI), Shaken Baby Syndrome, Herpes Zoster, Shy-Drager Syndrome, Sjögren's Syndrome, Sleep Apnea, Sleeping Sickness, Sotos Syndrome, Spasticity, Spina Bifida, Spinal Cord Infarction, Spinal Cord Injury, Spinal Cord Tumor, Spinal Muscular Atrophy, Spinocerebellar Ataxia, Spinocerebellar Atrophy, Spinocerebellar Degeneration, Sporadic Ataxia, Steele-Richardson-Olszewski Syndrome, Stiff Personality Syndrome, Striatonigral Degeneration, Stroke, Sturge-Weber Syndrome, Subacute Sclerosing Panencephalitis, Subcortical Arteriosclerotic Encephalopathy, Short-Lasting Unilateral Neuralgiform Encephalopathy (SUNCT) Neuralgiform headache, dysphagia, Sydenham's chorea, syncope, syphilitic spinal sclerosis, syringomyelia, syringomyelia, systemic lupus erythematosus, spinal fistula, tardive dyskinesia, Tay-Sachs disease, temporal arteritis, tethered spinal cord syndrome, Thomsen myotonia, thoracic outlet syndrome, thyrotoxic myopathy, painful chek, Todd's palsy, Tourette's syndrome, transient ischemic attack, transmissible spongiform encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraparesis, Treuer's syndrome, tuberous sclerosis, vascular erectile dysfunction Tumor), vasculitis syndromes of the central and peripheral nervous system, vitamin B12 deficiency, von Echonomo disease, von Hippel-Lindau disease (VHL), von Recklinghausen disease, Wallenberg syndrome, Werdnig-Hoffmann disease, Wernicke-Korsakoff syndrome, West syndrome, whiplash injury, Whipple disease, Williams syndrome, Wilson disease, Wolman disease, and X-linked spinal and bulbar muscular atrophy.

[0112] Treatment of neurological disorders TRACER AAV particles encoding protein payloads The present disclosure provides a method for introducing a TRACER AAV particle of the present disclosure into a cell, comprising introducing any of the vectors into the cell in an amount sufficient to result in increased production of target mRNA and protein. In some embodiments, the cell may be a neuron, such as, but not limited to, a motor neuron, a hippocampal neuron, an entorhinal neuron, a thalamic neuron, a cortical neuron, a sensory neuron, a sympathetic neuron, or a parasympathetic neuron, or a glial cell, such as an astrocyte, a microglia, and / or an oligodendrocyte.

[0113] The present disclosure discloses a method for treating a neurological disease associated with insufficient function / presence of a target protein (e.g., ApoE, FXN) in a subject in need of treatment. The method optionally comprises administering to the subject a therapeutically effective amount of a composition comprising the TRACER AAV particles of the present disclosure. As a non-limiting example, the TRACER AAV particles can increase target gene expression and increase target protein production, thus reducing one or more symptoms of the neurological disease in the subject, and the subject is therapeutically treated.

[0114] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered to the central nervous system of a subject by systemic administration, hi one embodiment, the systemic administration is intravenous injection. In some embodiments, compositions comprising the TRACER AAV particles of the present disclosure are administered to the central nervous system of a subject, hi other embodiments, compositions comprising the TRACER AAV particles of the present disclosure are administered to a CNS tissue of a subject (e.g., the putamen, thalamus, or cortex of a subject).

[0115] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered to the central nervous system of a subject by intraparenchymal injection, including, but not limited to, intraputamen, intracortex, intrathalamus, intrastriatum, intrahippocampus, or intraentorhinal cortex.

[0116] In one embodiment, a composition comprising the TRACER AAV particles of the present disclosure is administered into the central nervous system of a subject by intraparenchymal and intravenous injection. In one embodiment, the TRACER AAV particles of the present disclosure can be delivered to specific types of targeted cells, including, but not limited to, thalamic neurons, hippocampal neurons, entorhinal neurons, cortical neurons, motor neurons, sensory neurons, excitatory neurons, inhibitory neurons, sympathetic neurons, or parasympathetic neurons; glial cells, including oligodendrocytes, astrocytes, and microglia; and / or other cells that surround neurons, such as T cells.

[0117] In one embodiment, the TRACER AAV particles of the present disclosure can be delivered to neurons in the putamen, thalamus, and / or cortex. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for neurological diseases.

[0118] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for tauopathy. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Alzheimer's disease.

[0119] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for amyotrophic lateral sclerosis. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Huntington's disease.

[0120] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Parkinson's disease. In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for Friedreich's ataxia.

[0121] In some embodiments, the TRACER AAV particles of the present disclosure can be used as a therapy for chronic pain or neuropathic pain. In one embodiment, administration of the TRACER AAV particles described herein to a subject can increase target protein levels in the subject, including, but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, The increase can be 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase protein levels of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can increase protein levels of a target protein by at least 40%. As a non-limiting example, a subject can exhibit a 10% increase in target protein. As a non-limiting example, TRACER AAV particles can increase protein levels of a target protein by a factor of two from baseline. In one embodiment, TRACER AAV particles bind to 5-6-fold higher levels of a target protein.

[0122] In one embodiment, administration of the TRACER AAV particles described herein to a subject can increase expression of a target protein in the subject, including, but not limited to, about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, The increase can be 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100%. As a non-limiting example, TRACER AAV particles can increase target protein expression by at least 50%. As a non-limiting example, TRACER AAV particles can increase target protein expression by at least 40%.

[0123] In one embodiment, intravenous administration of the TRACER AAV particles described herein to a subject can increase CNS expression of a target protein in the subject, including, but not limited to, about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-10 ... By way of non-limiting example, TRACER AAV particles can increase target protein expression in the CNS by at least 50%. As a non-limiting example, TRACER AAV particles can increase target protein expression in the CNS by at least 40%.

[0124] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target protein expression in astrocytes to treat neurological diseases. Target protein expression in astrocytes can be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20%, 10-30%, 10-40%, 10-50%, 10-50%, 10-6 ...15%, 10-20%, %, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20- 50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 3 0~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%,50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~85%, 60~ It can be increased by 90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0125] In some embodiments, TRACER AAV particles can be used to increase target proteins in microglia. The increase in target proteins in microglia can be independently greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 10-15%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 10-15%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10- 30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~ 95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0126] In some embodiments, TRACER AAV particles can be used to increase target proteins in cortical neurons. Increases in target proteins in cortical neurons can be independently increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 10-15%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-60%, 10-70%, 10-80%, 10-90%, 10-90%, 10-15%, 10-20%, 10-25%, 10-20%, 10-30%, 10-30%, 10-40%, 10-40%, 10-50%, 10-50%, 10-60%, 10-60%, 10-70%, 10-70%, 10-80%, 10-80%, 10-90%, 10- ~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50% , 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~ 95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0127] In some embodiments, TRACER AAV particles can be used to increase target proteins in hippocampal neurons. Increases in target proteins in hippocampal neurons can be independently increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-60%, 10-70%, 10-80%, 10-85%, 10-90%, 10-15%, 10-20%, 10-25%, 10-20%, 10-30%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-60%, 10-70%, 10-70%, 10-80%, 10-85%, 10-90%, 10-15%, 10-20%, ~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50% , 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~ 95%, 35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%,It can be increased by 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0128] In some embodiments, TRACER AAV particles can be used to increase target proteins in DRGs and / or sympathetic neurons. The increase in target proteins in DRGs and / or sympathetic neurons can be independently greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, or greater than 95%. 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%,45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~ It can be increased by 85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0129] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target proteins in sensory neurons to treat neurological diseases. Target protein levels in sensory neurons can be increased by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ...50%, 10-60%, 10-70%, 10-80%, 10-80%, 10-90%, 10-15%, 10-20%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-60%, 10-70%, 10-15%, 10-20%, 10- %, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20- 50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75%, 30-80%, 30-85%, 3 0~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%,50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80%, 60~85%, 60~ It can be increased by 90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%.

[0130] In some embodiments, the TRACER AAV particles of the present disclosure can be used to increase target protein and reduce symptoms of a neurological disease in a subject. The increase in target protein and / or reduction in symptoms of a neurological disease can independently be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 11-20%, 12-20%, 13-20%, 14-20%, 15-20%, 16-20%, 17-20%, 18-20%, 19-20%, 21-20%, 22-22%, 23-23%, 24-24%, 25-26%, 26-27%, 27-28%, 28-30%, 29-31%, 30-35%, 31-32%, 32-33%, 33-34%, 34-35%, 35-40%, 36-40%, 37-45%, 38-41%, 39-50%, 41-42%, 42-43%, 43-44%, 44-45%, 45-50%, 45-55%, 46-47%, 47-48%, 48-50%, 49-51%, %, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40% , 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80% , 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%,50-60%, 50-65%, 50-70%, 50-75%, 50-80%, 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75 %, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% alteration (increase in the case of target protein production or decrease in the case of neurological disease symptoms).

[0131] In one embodiment, the TRACER AAV particles of the present disclosure can be used to reduce decline in functional capacity and activities of daily living as measured by standard assessment methods, such as, but not limited to, the total functional capacity (TFC) scale.

[0132] In one embodiment, the TRACER AAV particles of the present disclosure can be used to improve the performance of any assay used to measure symptoms of neurological disease. Such assessments include, but are not limited to, ADAS-cog (Alzheimer's Disease Assessment Scale-cognition), MMSE (Mini-Mental State Examination), GDS (Geriatric Depression Scale), FAQ (Functional Activities Questionnaire), ADL (Activities of Daily Living), GPCOG (General Practitioner Cognitive Assessment), Mini-Cog, AMTS (Abridged Mental Test Score), Clock Drawing Test, 6-CIT (6-item Cognitive Impairment Inventory), TYM (Test Your Memory), MoCa (Montreal Cognitive Assessment), ACE-R (Addenbrooke's Cognitive Assessment), MIS (Memory Impairment Screening), BADLS (Bristol Activities of Daily Living Scale), Barthel Index, Functional Independence Assessment, Instrumental Activities of Daily Living, IQCODE (Informant Questionnaire on Cognitive Decline in the Elderly), neuropsychiatric symptom assessment, The Cohen-Mansfield Agitation Scale Examples of such tests include the BEHAVE-AD Inventory, BEHAVE-AD, EuroQol, Short Form-36, and / or the MBR Caregiver Strain Instrument, or any of the other tests described in Sheehan B (Ther Adv Neurol Disord. 5(6):349-358 (2012)), the contents of which are incorporated herein by reference in their entirety.

[0133] In some embodiments, the composition is administered as a monotherapy or combination therapy to treat a neurological disease. TRACER AAV particles encoding a target protein may be used in combination with one or more other therapeutic agents. "In combination with" does not imply that the agents must be administered at the same time and / or formulated for delivery together, although such delivery methods are within the scope of this disclosure. The composition can be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. Generally, each agent will be administered at a dose and / or on a time schedule determined for that agent.

[0134] Therapeutic agents that can be used in combination with the TRACER AAV particles of the present disclosure may be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, antiglutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation. As a non-limiting example, the combination therapy may be a combination with one or more neuroprotective agents, such as small molecule compounds, growth factors, and hormones, that have been tested for their neuroprotective effects against motor neuron degeneration.

[0135] Compounds that have been tested to treat neurological diseases that can be used in combination with the TRACER AAV particles described herein include, but are not limited to, the following: cholinesterase inhibitors (donepezil, rivastigmine, galantamine); NMDA receptor antagonists such as memantine; antipsychotics; antidepressants; anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus); secretase inhibitors; amyloid aggregation inhibitors; copper or zinc modulators; BACE inhibitors; methylene blue, phenothiazines, etc. inhibitors of tau aggregation, such as azines, anthraquinones, n-phenylamines, or rhodamines; microtubule stabilizers, such as NAP, taxol, or paclitaxel; kinase or phosphatase inhibitors, such as those targeting GSK3β (lithium) or PP2A; immunization with Aβ peptides or tau phosphoepitopes; anti-tau or anti-amyloid antibodies; dopamine-depleting agents (e.g., tetrabenazine for chorea), benzodiazepines (e.g., clonazepam for myoclonus, chorea, dystonia, stiffness, and / or spasticity), muscular relaxants (e.g., baclofen, tizanidine for stiffness and / or spasticity); inhibitors of acetylcholine release at the neuromuscular junction that cause muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia); atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or irritability; risperidone, sulpiride, and haloperidol for psychosis, chorea, and / or irritability; treatment resistance). clozapine for sexual psychosis, aripiprazole for psychosis with prominent negative symptoms; selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, obsessive-compulsive behavior, and / or irritability); hypnotics (e.g., xopiclone and / or zolpidem for alterations in the sleep-wake cycle); anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania);as well as mood stabilizers (e.g., lithium for mania or hypomania);

[0136] Neurotrophic factors can be used in combination therapy with the TRACER AAV particles of the present disclosure to treat neurological diseases. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation, and / or maturation of neurons, or stimulate increased neuronal activity. In some embodiments, the method further comprises delivering one or more trophic factors to a subject in need of treatment. Trophic factors can include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, colivelin, xaliproden, thyrotropin-releasing hormone, and ADNF, and variants thereof.

[0137] In one embodiment, the TRACER AAV particles described herein can be co-administered with TRACER AAV particles expressing neurotrophic factors, such as AAV-IGF-I (see, e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the contents of which are incorporated herein by reference in their entirety) and AAV-GDNF (see, e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the contents of which are incorporated herein by reference in their entirety).

[0138] In one embodiment, administration of TRACER AAV particles to a subject results in increased expression of a target protein in the subject, and increased expression of the target protein results in a reduction in the effects and / or symptoms of a neurological disease in the subject.

[0139] As a non-limiting example, the target protein may be an antibody or a fragment thereof. TRACER AAV particles containing RNAi agents or regulatory polynucleotides The present disclosure provides a method for introducing into a cell a TRACER AAV particle of the present disclosure, the AAV particle comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, the method comprising introducing into the cell any of the vectors in an amount sufficient to cause degradation of the target mRNA, thereby activating target-specific RNAi in the cell. In some embodiments, the cell may be a neuron, such as, but not limited to, a motor neuron, a hippocampal neuron, an entorhinal neuron, a thalamic neuron, a cortical neuron, a sensory neuron, a sympathetic neuron, or a parasympathetic neuron, as well as a glial cell, such as an astrocyte, a microglia, and / or an oligodendrocyte.

[0140] The present disclosure provides a method for treating a neurological disease associated with the dysfunction of a target protein in a subject in need of treatment.The method optionally comprises administering to the subject a therapeutically effective amount of a composition comprising a TRACER AAV particle comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules.As a non-limiting example, the siRNA molecule can silence target gene expression, inhibit target protein production, and reduce one or more symptoms of the subject's neurological disease, thereby therapeutically treating the subject.

[0141] In some embodiments, compositions comprising the TRACER AAV particles of the present disclosure, which comprise a viral genome encoding one or more siRNA molecules, comprise AAV capsids that enable enhanced transduction of CNS and / or PNS cells following intravenous administration.

[0142] In some embodiments, a composition comprising a TRACER AAV particle of the present disclosure having a viral genome encoding at least one siRNA molecule is administered to the central nervous system of a subject, hi other embodiments, a composition comprising a TRACER AAV particle of the present disclosure is administered to a tissue of a subject (e.g., the putamen, thalamus, or cortex of a subject).

[0143] In one embodiment, a composition comprising a TRACER AAV particle of the present disclosure, which comprises a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, is administered to the central nervous system of a subject by systemic administration. In one embodiment, the systemic administration is intravenous injection.

[0144] In one embodiment, a composition comprising a TRACER AAV particle of the present disclosure, which comprises a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, is administered to a subject's central nervous system by intraparenchymal injection, including, but not limited to, intraputamen, intracortex, intrathalamus, striatum, intrahippocampus, or intraentorhinal cortex.

[0145] In one embodiment, a composition comprising TRACER AAV particles, which contain a viral genome having a nucleic acid sequence encoding one or more siRNA molecules, is administered into the central nervous system of a subject by intraparenchymal and intravenous injection.

[0146] In one embodiment, TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be delivered to specific types or targeted cells, including, but not limited to, thalamic neurons, hippocampal neurons, entorhinal neurons, cortical neurons, motor neurons, sensory neurons, excitatory neurons, inhibitory neurons, sympathetic neurons, or parasympathetic neurons; glial cells, including oligodendrocytes, astrocytes, and microglia; and / or other cells that surround neurons, such as T cells.

[0147] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be delivered to neurons in the putamen, thalamus, and / or cortex.

[0148] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for neurological diseases.

[0149] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for tauopathy.

[0150] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Alzheimer's disease.

[0151] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used as a therapy for amyotrophic lateral sclerosis.

[0152] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Huntington's disease.

[0153] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Parkinson's disease.

[0154] In one embodiment, TRACER AAV particles, which contain a viral genome with a nucleic acid sequence encoding one or more siRNA molecules, can be used as a therapy for Friedreich's ataxia.

[0155] In one embodiment, administration of TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules to a subject can reduce target protein levels in the subject, including, but not limited to, in the subject's CNS, region of the CNS, or specific cells of the CNS, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or by at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, A reduction of 30-100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100%, or 95-100% can be achieved. As a non-limiting example, TRACER AAV particles can reduce protein levels of a target protein by at least 50%. As a non-limiting example, TRACER AAV particles can reduce protein levels of a target protein by at least 40%.

[0156] In one embodiment, administration of TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules to a subject can reduce target protein expression in the subject, including, but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95 ...100%, 30-100%, 30-20%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30 By way of non-limiting example, the TRACER AAV particles can reduce target protein expression by at least 50%. As a non-limiting example, TRACER AAV particles can reduce target protein expression by at least 40%.

[0157] In one embodiment, administration of TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules to a subject can reduce target protein expression in the subject's CNS, including, but not limited to, by about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, and 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95 ...100%, 30-100%, 30-20%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 30-100%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90 By way of non-limiting example, the TRACER AAV particles can reduce target protein expression by at least 50%. As a non-limiting example, TRACER AAV particles can reduce target protein expression by at least 40%.

[0158] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to silence target proteins in astrocytes to treat neurological diseases. Target protein silence in astrocytes can be suppressed by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or by greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ...25%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20%, 10-25%, 10-30%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10 %, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20- 40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 3 0~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ It can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. Target protein expression in astrocytes was significantly greater than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 95%. %, 5~75%, 5~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~ 40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%,35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80% , 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% reduction.

[0159] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to suppress target protein expression in microglia. Target protein suppression in microglia can be independently measured by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20%, 10-20%, 10-30%, 10-40%, 10-5 ... 0-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20- 40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 30-75 %, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%,45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~80% , 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% inhibition. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, such as 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 5-100%, 5-110%, 5-120%, 5-130%, 5-140%, 5-150%, 5-160%, 5-170%, 5-180%, 5-190%, 5-200%, 5-250%, 5-300%, 5-350%, 5-400%, 5-450%, 5-500%, 5-550%, 5-600%, 5-190%, 5-200%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-300%, 5-350%, 5-400%, 5-450%, 5-500%, 5-550%, 5-600%, 5-650%, 5-700%, 5-750%, 5-800%, 5-190%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-300%, 5-350%, 5-400 0%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55% %, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25 ~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%,35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85 %, 50 to 90%, 50 to 95%, 55 to 65%, 55 to 70%, 55 to 75%, 55 to 80%, 55 to 85%, 55 to 90%, 55 to 95%, 60 to 70%, 60 to 75%, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95%.

[0160] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to silence a target protein in cortical neurons. The silence of the target protein in cortical neurons can be independently 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, or greater than 95%. , 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35% , 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70% , 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ It can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, including 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 5-100%, 5-110%, 5-120%, 5-130%, 5-140%, 5-150%, 5-160%, 5-170%, 5-180%, 5-190%, 5-200%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-260%, 5-270%, 5-280%, 5-290%, 5-300%, 5-310%, 5-320%, 5-330%, 5-340%, 5-350%, 5-360%, 5-370%, 5-380%, 5-390%, 5-410%, 5-420%, 5-430%, 5-440%, 5-450%, 5-450%, 5-460%, 5-470%, 5-480%, 5-490%, 5-510%, 5-520%, 5-530%, 5-540%, 5-550%, 5-550%, ~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 1 5-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45% 5%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%,35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 5 It may be 0 to 85%, 50 to 90%, 50 to 95%, 55 to 65%, 55 to 70%, 55 to 75%, 55 to 80%, 55 to 85%, 55 to 90%, 55 to 95%, 60 to 70%, 60 to 75%, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95%.

[0161] In one embodiment, TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to silence a target protein in hippocampal neurons. The silence of the target protein in hippocampal neurons can be independently 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, or greater than 95%. , 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35% , 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70% , 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ It can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, including 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 5-100%, 5-110%, 5-120%, 5-130%, 5-140%, 5-150%, 5-160%, 5-170%, 5-180%, 5-190%, 5-200%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-260%, 5-270%, 5-280%, 5-290%, 5-300%, 5-310%, 5-320%, 5-330%, 5-340%, 5-350%, 5-360%, 5-370%, 5-380%, 5-390%, 5-410%, 5-420%, 5-430%, 5-440%, 5-450%, 5-450%, 5-460%, 5-470%, 5-480%, 5-490%, 5-510%, 5-520%, 5-530%, 5-540%, 5-550%, 5-550%, ~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 1 5-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45% 5%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%,35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 5 It may be 0 to 85%, 50 to 90%, 50 to 95%, 55 to 65%, 55 to 70%, 55 to 75%, 55 to 80%, 55 to 85%, 55 to 90%, 55 to 95%, 60 to 70%, 60 to 75%, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95%.

[0162] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to inhibit target proteins in DRGs and / or sympathetic neurons. Inhibition of target proteins in DRGs and / or sympathetic neurons can be independently measured by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, or greater than 95%. %, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95% 5%, 20-30%, 20-35%, 20-40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30 ~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%,45~70%, 45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70% , 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% inhibition. The reduction may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, and may be 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5- 75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45 %, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25 ~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%,35-45%, 35-50%, 35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75 %, 50 to 80%, 50 to 85%, 50 to 90%, 50 to 95%, 55 to 65%, 55 to 70%, 55 to 75%, 55 to 80%, 55 to 85%, 55 to 90%, 55 to 95%, 60 to 70%, 60 to 75%, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95%.

[0163] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to silence target proteins in sensory neurons to treat neurological diseases. Target proteins in sensory neurons can be silenced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or by greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 10-20%, 10-25%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-15%, 10-20 ...25%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-70%, 10-20%, 10-30%, 10-40%, 10-50%, 10-50%, 10-60%, 10-70%, 10-20%, 10-30%, 10-40%, 10-50%, 10-50 %, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20-30%, 20-35%, 20- 40%, 20-45%, 20-50%, 20-55%, 20-60%, 20-65%, 20-70%, 20-75%, 20-80%, 20-85%, 20-90%, 20-95%, 25-35%, 25-40%, 25-45%, 25-50%, 25-55%, 25-60%, 25-65%, 25-70%, 25-75%, 25-80%, 25-85%, 25-90%, 25-95%, 30-40%, 30-45%, 30-50%, 30-55%, 30-60%, 30-65%, 30-70%, 3 0~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%, 45~75%, 45~80%,45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75%, 60~ It can be inhibited by 80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95%. Target proteins in sensory neurons are expressed at 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or significantly greater than 95% of the time, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-95%, 5-100%, 5-110%, 5-120%, 5-130%, 5-140%, 5-150%, 5-160%, 5-170%, 5-180%, 5-190%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-300%, 5-350%, 5-400%, 5-450%, 5-500%, 5-550%, 5-600%, 5-650%, 5-70 ...260%, 5-270%, 5-280%, 5-300%, 5-350%, 5-40 %, 5~75%, 5~80%, 5~85%, 5~90%, 5~95%, 10~20%, 10~25%, 10~30%, 10~35%, 10~40%, 10~45%, 10~50%, 10~55%, 10~60%, 10~65%, 10~70%, 10~75%, 10~80%, 10~85%, 10~90%, 10~95%, 15~25%, 15~30%, 15~35%, 15~40%, 15~45%, 15~50%, 15~55%, 15~60%, 15~65%, 15~70%, 15~75%, 15~80%, 15~85%, 15~90%, 15~95%, 20~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~ 40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 30~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%,35-55%, 35-60%, 35-65%, 35-70%, 35-75%, 35-80%, 35-85%, 35-90%, 35-95%, 40-50%, 40-55%, 40-60%, 40-65%, 40-70%, 40-75%, 40-80%, 40-85%, 40-90%, 40-95%, 45-55%, 45-60%, 45-65%, 45-70%, 45-75%, 45-80%, 45-85%, 45-90%, 45-95%, 50-60%, 50-65%, 50-70%, 50-75%, 50-80% , 50-85%, 50-90%, 50-95%, 55-65%, 55-70%, 55-75%, 55-80%, 55-85%, 55-90%, 55-95%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 70-80%, 70-85%, 70-90%, 70-95%, 75-85%, 75-90%, 75-95%, 80-90%, 80-95%, or 90-95% inhibition.

[0164] In one embodiment, TRACER AAV particles comprising a viral genome having a nucleic acid sequence encoding one or more siRNA molecules can be used to silence a target protein and reduce symptoms of a neurological disease in a subject. The silence of the target protein and / or the reduction of symptoms of a neurological disease can independently be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or greater than 95%, 5-15%, 5-20%, 5-25%, 5-30%, 5-35%, 5-40%, 5-45%, 5-50%, 5-55%, 5-60%, 5-65%, 5-70%, 5-75%, 5-80%, 5-85%, 5-90%, 5-100%, 5-110%, 5-120%, 5-130%, 5-140%, 5-150%, 5-150%, 5-160%, 5-170%, 5-180%, 5-190%, 5-210%, 5-220%, 5-230%, 5-240%, 5-250%, 5-260%, 5-270%, 5-280%, 5-290%, 5-310%, 5-320%, 5-330%, 5-340%, 5-350%, 5-450%, 5-460%, 5-470%, 5-480%, 5-510%, 5-320%, 5-330%, 5-350%, 5-400%, 5-450%, 5-510%, 5-520%, 5-530%, 95%, 10-20%, 10-25%, 10-30%, 10-35%, 10-40%, 10-45%, 10-50%, 10-55%, 10-60%, 10-65%, 10-70%, 10-75%, 10-80%, 10-85%, 10-90%, 10-95%, 15-25%, 15-30%, 15-35%, 15-40%, 15-45%, 15-50%, 15-55%, 15-60%, 15-65%, 15-70%, 15-75%, 15-80%, 15-85%, 15-90%, 15-95%, 20 ~30%, 20~35%, 20~40%, 20~45%, 20~50%, 20~55%, 20~60%, 20~65%, 20~70%, 20~75%, 20~80%, 20~85%, 20~90%, 20~95%, 25~35%, 25~40%, 25~45%, 25~50%, 25~55%, 25~60%, 25~65%, 25~70%, 25~75%, 25~80%, 25~85%, 25~90%, 25~95%, 30~40%, 30~45%, 30~50%, 30~55%, 30~60%, 3 0~65%, 30~70%, 30~75%, 30~80%, 30~85%, 30~90%, 30~95%, 35~45%, 35~50%, 35~55%, 35~60%, 35~65%, 35~70%, 35~75%, 35~80%, 35~85%, 35~90%, 35~95%, 40~50%, 40~55%, 40~60%, 40~65%, 40~70%, 40~75%, 40~80%, 40~85%, 40~90%, 40~95%, 45~55%, 45~60%, 45~65%, 45~70%,45~75%, 45~80%, 45~85%, 45~90%, 45~95%, 50~60%, 50~65%, 50~70%, 50~75%, 50~80%, 50~85%, 50~90%, 50~95%, 55~65%, 55~70%, 55~75%, 55~80%, 55~85%, 55~90%, 55~95%, 60~70%, 60~75 %, 60 to 80%, 60 to 85%, 60 to 90%, 60 to 95%, 65 to 75%, 65 to 80%, 65 to 85%, 65 to 90%, 65 to 95%, 70 to 80%, 70 to 85%, 70 to 90%, 70 to 95%, 75 to 85%, 75 to 90%, 75 to 95%, 80 to 90%, 80 to 95%, or 90 to 95% reduction or inhibition.

[0165] In one embodiment, TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used to reduce decline in functional capacity and activities of daily living as measured by standard assessment methods, such as, but not limited to, the Total Functional Capacity (TFC) scale.

[0166] In some embodiments, the composition is administered as a monotherapy or combination therapy to treat a neurological disease. TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules can be used in combination with one or more other therapeutic agents. "In combination with" does not imply that the agents must be administered at the same time and / or formulated for delivery together, although such delivery methods are within the scope of this disclosure. The composition can be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. Generally, each agent will be administered at a dose and / or at a time schedule determined for that agent.

[0167] Therapeutic agents that can be used in combination with TRACER AAV particles containing a viral genome having a nucleic acid sequence encoding one or more siRNA molecules may be small molecule compounds that are antioxidants, anti-inflammatory agents, anti-apoptotic agents, calcium regulators, anti-glutamatergic agents, structural protein inhibitors, compounds involved in muscle function, and compounds involved in metal ion regulation.

[0168] Compounds that have been tested to treat neurological diseases that can be used in combination with TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules include, but are not limited to: cholinesterase inhibitors (donepezil, rivastigmine, galantamine); NMDA receptor antagonists such as memantine; antipsychotics; antidepressants; anticonvulsants (e.g., sodium valproate and levetiracetam for myoclonus); secretase inhibitors; amyloid aggregation inhibitors; copper or zinc modulators; and BACE inhibitors. inhibitors of tau aggregation such as methylene blue, phenothiazines, anthraquinones, n-phenylamines, or rhodamines; microtubule-stabilizing agents such as NAP, taxol, or paclitaxel; kinase or phosphatase inhibitors such as those targeting GSK3β (lithium) or PP2A; immunization with Aβ peptides or tau phosphoepitopes; anti-tau or anti-amyloid antibodies; dopamine-depleting agents (e.g., tetrabenazine for chorea); benzodiazepines (e.g., for myoclonus, chorea, diazepam, etc.) amino acid precursors of dopamine (e.g., levodopa for stiffness); skeletal muscle relaxants (e.g., baclofen, tizanidine for stiffness and / or spasticity); inhibitors of acetylcholine release at the neuromuscular junction that cause muscle paralysis (e.g., botulinum toxin for bruxism and / or dystonia); atypical neuroleptics (e.g., olanzapine and quetiapine for psychosis and / or irritability, and acetaminophen for psychosis, chorea, and risperidone, sulpiride, and haloperidol for depression, anxiety, paranoid-compulsive behavior, and / or irritability, clozapine for treatment-resistant psychosis, and aripiprazole for psychosis with prominent negative symptoms; selective serotonin reuptake inhibitors (SSRIs) (e.g., citalopram, fluoxetine, paroxetine, sertraline, mirtazapine, venlafaxine for depression, anxiety, paranoid-compulsive behavior, and / or irritability); hypnotics (e.g., xopiclone and / or zolpidem for alterations in the sleep-wake cycle);Anticonvulsants (e.g., sodium valproate and carbamazepine for mania or hypomania); and mood stabilizers (e.g., lithium for mania or hypomania).

[0169] Neurotrophic factors can be used in combination therapy with TRACER AAV particles containing a viral genome with a nucleic acid sequence encoding one or more siRNA molecules for treating neurological diseases. Generally, neurotrophic factors are defined as substances that promote the survival, growth, differentiation, proliferation, and / or maturation of neurons, or stimulate increased neuronal activity. In some embodiments, the method further comprises delivering one or more trophic factors to a subject in need of treatment. Trophic factors can include, but are not limited to, IGF-I, GDNF, BDNF, CTNF, VEGF, colivelin, xaliproden, thyrotropin-releasing hormone, and ADNF, and variants thereof.

[0170] In one embodiment, TRACER AAV particles encoding the nucleic acid sequence of at least one siRNA duplex targeting a gene of interest can be co-administered with TRACER AAV particles expressing neurotrophic factors such as AAV-IGF-I (see, e.g., Vincent et al., Neuromolecular medicine, 2004, 6, 79-85; the contents of which are incorporated herein by reference in their entirety) and AAV-GDNF (see, e.g., Wang et al., J Neurosci., 2002, 22, 6920-6928; the contents of which are incorporated herein by reference in their entirety).

[0171] In one embodiment, administration of TRACER AAV particles to a subject results in reduced expression of a target protein in the subject, and reduced expression of the target protein results in reduced effects and / or symptoms of a neurological disease in the subject.

[0172] definition Adeno-associated virus: As used herein, the term "adeno-associated virus" or "AAV" refers to a member of the Dependovirus genus, including any particle, sequence, gene, protein, or component derived therefrom.

[0173] AAV particle: As used herein, an "AAV particle" is a virus comprising a capsid and a viral genome having at least one payload region and at least one ITR. As used herein, an "AAV particle of the present disclosure" is an AAV particle comprising a parent capsid sequence with at least one targeting peptide insert. The AAV particles of the present disclosure may be recombinantly produced and may be based on an adeno-associated virus (AAV) parent or reference sequence. The AAV particles may be derived from any serotype described herein or known in the art, including combinations of serotypes (i.e., "pseudotyped" AAV), or may be derived from various genomes (e.g., single-stranded or self-complementary). In addition, the AAV particles may be replication-deficient and / or targeted. In one embodiment, the AAV particles may have a targeting peptide inserted into the capsid to enhance tropism for a desired target tissue. Reference to the AAV particles of the present disclosure should be understood to include pharmaceutical compositions thereof, even if not explicitly stated.

[0174] Administer: As used herein, the term "administer" refers to providing a pharmaceutical agent or composition to a subject. Amelioration: As used herein, the term "amelioration" or "ameliorating" refers to a reduction in the severity of at least one indicator of a condition or disease. For example, in the context of a neurodegenerative disorder, amelioration includes a reduction in neuronal loss.

[0175] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and nematodes. In some embodiments, the animal is a transgenic animal, a genetically modified animal, or a clone.

[0176] Antisense strand: As used herein, the term "antisense strand" or "first strand" or "guide strand" of an siRNA molecule refers to the strand that is substantially complementary to a segment of about 10-50 nucleotides, e.g., about 15-30, 16-25, 18-23, or 19-22 nucleotides, of the mRNA of a gene targeted for silencing. The antisense strand or first strand has a sequence that is sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., sufficient complementarity to trigger destruction of the desired target mRNA by an RNAi mechanism or process.

[0177] Approximately: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or a lower percentage in either direction (greater or lesser) of the stated reference value, unless otherwise specified or otherwise apparent from the context (except in cases where such number would exceed 100% of the possible values).

[0178] Capsid: As used herein, the term "capsid" refers to the protein coat of a virus particle. Complementary and Substantially Complementary: As used herein, the term "complementary" refers to the ability of polynucleotides to base pair with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G) or in any other manner that allows for the formation of a duplex. As those skilled in the art will recognize, when RNA is used rather than DNA, uracil, rather than thymine, is the base considered complementary to adenine. However, when U is explicitly mentioned in the context of this disclosure, its ability to substitute for T is implied unless otherwise specified. Perfect complementarity or 100% complementarity refers to a situation in which each nucleotide unit of one polynucleotide strand can form hydrogen bonds with a nucleotide unit of a second polynucleotide strand. Less than perfect complementarity refers to a situation in which some, but not all, nucleotide units of two strands can form hydrogen bonds with each other. For example, in two 20-mer, when only two base pairs of each strand can form hydrogen bond with each other, this polynucleotide strand exhibits 10% complementarity.In the same example, when 18 base pairs of each strand can form hydrogen bond with each other, this polynucleotide strand exhibits 90% complementarity.As used herein, the term " substantially complementary " means that siRNA has sufficient sequence (for example, in antisense strand) to bind to desired target mRNA and trigger the RNA silence of target mRNA.

[0179] Control element: As used herein, "control element," "regulatory control element," or "regulatory sequence" refers to promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which provide for the replication, transcription, and translation of coding sequences in recipient cells. Not all of these control elements need always be present, so long as the selected coding sequence is capable of being replicated, transcribed, and / or translated in an appropriate host cell.

[0180] Delivery: As used herein, "delivery" refers to the act or manner of delivering an AAV particle, compound, substance, entity, moiety, cargo, or payload. Element: As used herein, the term "element" refers to a distinct part of an entity. In some embodiments, an element may be a polynucleotide sequence with a specific purpose that is incorporated into a longer polynucleotide sequence.

[0181] Encapsulate: As used herein, the term "encapsulate" means to enclose, surround, or encase. In one example, capsid proteins encapsulate the viral genome.

[0182] Engineered: As used herein, embodiments of the present disclosure are "engineered" if they are designed to have characteristics or properties, whether structural or chemical, that are altered from the starting, wild-type, or naturally occurring molecule.

[0183] Effective amount: As used herein, the term "effective amount" of an agent is an amount sufficient to achieve a beneficial or desired result, e.g., a clinical result, and therefore "effective amount" will depend on the context in which it is applied. For example, in the context of administering an agent to treat cancer, an effective amount of the agent is an amount sufficient to achieve cancer treatment as defined herein, e.g., compared to the response obtained without administering the agent.

[0184] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' capping, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0185] Feature: As used herein, a "feature" refers to a quality, characteristic, or distinctive element. Formulation: As used herein, a "formulation" comprises at least one AAV particle (active ingredient) and excipients and / or inactive ingredients.

[0186] Fragment: As used herein, "fragment" refers to a portion. For example, an antibody fragment may include a CDR, or a heavy chain variable region, or an scFv, etc. Functional: As used herein, a "functional" biological molecule is a biological molecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0187] Gene Expression: The term "gene expression" refers to the process by which a nucleic acid sequence is successfully transcribed and, in most cases, translated to produce a protein or peptide. For clarity, when reference is made to measuring "gene expression," this should be understood to mean that the measurement may be of a nucleic acid transcription product, such as RNA or mRNA, or of an amino acid translation product, such as a polypeptide or peptide. Methods for measuring the amount or level of RNA, mRNA, polypeptides, and peptides are well known in the art.

[0188] Homology: As used herein, the term "homology" refers to the overall relatedness between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be "homologous" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical or similar. The term "homology" necessarily refers to a comparison between at least two sequences (polynucleotide sequences or polypeptide sequences). According to the present disclosure, two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least about 50%, 60%, 70%, 80%, 90%, 95%, or even 99% identical for at least a stretch of at least about 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by their ability to encode a stretch of at least 4-5 uniquely specified amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by their ability to encode a stretch of at least 4-5 uniquely specified amino acids. According to the present disclosure, two protein sequences are considered to be homologous if the proteins are at least about 50%, 60%, 70%, 80%, or 90% identical over at least one stretch of at least about 20 amino acids.

[0189] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, for example, between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. For example, the calculation of the percent identity of two polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., for optimal alignment, gaps may be introduced into one or both of the first and second nucleic acid sequences, and non-identical sequences may be ignored for comparison purposes). In certain embodiments, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. Nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.For example, percent identity between two nucleotide sequences can be calculated using the methods described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., Stockton Press, New York, 1995. The percent identity between two nucleotide sequences can be determined using methods such as those described in [Paragraph 1] of [Paragraph 2] of [Paragraph 3] of [Paragraph 4] of [Paragraph 5] of [Paragraph 6] of [Paragraph 7] of [Paragraph 8] of [Paragraph 9] of [Paragraph 10] of [Paragraph 11] of [Paragraph 12] of [Paragraph 13] of [Paragraph 14] of [Paragraph 15] of [Paragraph 16] of [Paragraph 17] of [Paragraph 18] of [Paragraph 19] of [Paragraph 20] of [Paragraph 21] of [Paragraph 22] of [Paragraph 23] of [Paragraph 24] of [Paragraph 25] of [Paragraph 26] of [Paragraph 27] of [Paragraph 28] of [Paragraph 30] of [Paragraph 31] of [Paragraph 32] of [Paragraph 33] of [Paragraph 40] of [Paragraph 41] of [Paragraph 42] of [Paragraph 43] of [Paragraph 44] of [Paragraph 45] of [Paragraph 46] of [Paragraph 47] of [Paragraph 48] of [Paragraph 51] of [Paragraph 52] of [Paragraph 53] of [Paragraph 54] of [Paragraph 55] of [Paragraph 66] of [Paragraph 67] of [Paragraph 70] of [Paragraph 71] of [Paragraph 82] of [Paragraph 83] of [Paragraph 90] of [Paragraph 91] of [Paragraph 102] of [Paragraph 1Commonly used methods for determining percent identity between sequences include, but are not limited to, those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988), which is incorporated herein by reference. Techniques for determining identity are coded in publicly available computer programs. Representative computer software for determining homology between two sequences includes, but is not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J. Molec. Biol., 215, 403 (1990)).

[0190] Inhibit gene expression: As used herein, the phrase "inhibit gene expression" means causing a reduction in the amount of an expression product of a gene. The expression product may be an RNA molecule (e.g., mRNA) transcribed from the gene, or may be a polypeptide translated from the mRNA transcribed from the gene. Typically, a reduction in mRNA levels results in a reduction in the level of the polypeptide translated from it. The level of expression can be determined using standard techniques for measuring mRNA or protein.

[0191] Insert: As used herein, the term "insert" can refer to the addition of a targeting peptide sequence to a parent AAV capsid sequence. An "insertion" may result in the replacement of one or more amino acids in the parent AAV capsid sequence. Alternatively, an insertion may result in no change to the parent AAV capsid sequence except for the addition of the targeting peptide sequence.

[0192] Inverted Terminal Repeat: As used herein, the term "inverted terminal repeat" or "ITR" refers to a cis-regulatory element for packaging a polynucleotide sequence into a viral capsid.

[0193] Library: As used herein, the term "library" refers to a diverse collection of linear polypeptides, polynucleotides, viral particles, or viral vectors. By way of example, the library may be a DNA library or an AAV capsid library.

[0194] Neurological disease: As used herein, a "neurological disease" is any disease associated with the central or peripheral nervous system and its components (e.g., neurons).

[0195] Naturally-occurring: As used herein, "naturally-occurring" or "wild-type" means existing in nature, without artificial aid or intervention by man. Open reading frame: As used herein, "open reading frame" or "ORF" refers to a sequence that does not contain a stop codon in a given reading frame.

[0196] Parent sequence: As used herein, a "parent sequence" is a nucleic acid sequence or amino acid sequence from which a variant is derived. In one embodiment, the parent sequence is the sequence into which a heterologous sequence is inserted. In other words, the parent sequence can be considered an acceptor sequence or recipient sequence. In one embodiment, the parent sequence is an AAV capsid sequence into which a targeting sequence is inserted.

[0197] Particle: As used herein, a "particle" is a virus that is made up of at least two components: a protein capsid and a polynucleotide sequence enclosed within the capsid.

[0198] Patient: As used herein, "patient" refers to a subject who may seek or need treatment, who needs treatment, who is receiving treatment, who will receive treatment, or who is receiving care for a particular disease or condition by a skilled professional.

[0199] Payload region: As used herein, a "payload region" is any nucleic acid sequence (e.g., within a viral genome) that encodes one or more "payloads" of the present disclosure. As a non-limiting example, the payload region may be a nucleic acid sequence within the viral genome of an AAV particle that encodes a payload, where the payload is an RNAi agent or a polypeptide. The payload of the present disclosure may be, but is not limited to, a peptide, polypeptide, protein, antibody, RNAi agent, etc.

[0200] Peptide: As used herein, a "peptide" is 50 amino acids or less in length, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0201] Pharmaceutically acceptable: The phrase "pharmaceutically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit-to-risk ratio.

[0202] Prevent: As used herein, the term "prevent" or "prevention" refers to partially or completely delaying the onset of an infection, disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or clinical findings of a particular infection, disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or findings of a particular infection, disease, disorder, and / or condition; partially or completely delaying the progression from an infection, a particular disease, disorder, and / or condition; and / or reducing the risk of developing pathology associated with an infection, disease, disorder, and / or condition.

[0203] Prophylactic: As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the spread of disease. Prevention: As used herein, "prevention" refers to measures taken to maintain health and prevent the spread of disease.

[0204] Region: As used herein, the term "region" refers to a band or general area. In some embodiments, when reference is made to a protein or protein module, a region may include a linear sequence of amino acids along the protein or protein module, or may include a three-dimensional area, epitope, and / or cluster of epitopes. In some embodiments, a region includes a terminal region. As used herein, the term "terminal region" refers to a region located at the end or terminus of a given agent. When reference is made to a protein, a terminal region may include the N-terminus and / or C-terminus.

[0205] In some embodiments, when a polynucleotide is referred to, a region may include a linear sequence of nucleic acids along the polynucleotide, or may include a three-dimensional region, secondary structure, or tertiary structure. In some embodiments, a region includes a terminal region. As used herein, the term "terminal region" refers to a region located at the end or terminus of a given agent. When a polynucleotide is referred to, a terminal region may include the 5' end and / or the 3' end.

[0206] RNA or RNA molecule: As used herein, the terms "RNA" or "RNA molecule" or "ribonucleic acid molecule" refer to a polymer of ribonucleotides, and the terms "DNA" or "DNA molecule" or "deoxyribonucleic acid molecule" refer to a polymer of deoxyribonucleotides. DNA and RNA may be naturally synthesized, for example, by DNA replication and transcription of DNA, respectively, or may be chemically synthesized. DNA and RNA may be single-stranded (i.e., ssRNA or ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). The term "mRNA" or "messenger RNA," as used herein, refers to a single-stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.

[0207] RNA interference or RNAi: As used herein, the term "RNA interference" or "RNAi" refers to a sequence-specific regulatory mechanism mediated by RNA molecules that inhibits, interferes with, or "silences" the expression of corresponding protein-coding genes. RNAi has been observed in many types of organisms, including plants, animals, and fungi. RNAi naturally occurs in cells to remove foreign RNA (e.g., viral RNA). Natural RNAi proceeds through fragments cleaved from free dsRNA, which direct the degradation mechanism to other similar RNA sequences. RNAi is controlled by the RNA-induced silencing complex (RISC) and is initiated in the cytoplasm by short / small dsRNA molecules that interact with the catalytic RISC component Argonaute. dsRNA molecules can be exogenously introduced into cells. Exogenous dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds to and cleaves the dsRNA, producing 21-25 base pair double-stranded fragments with a few unpaired overhanging bases at each end. These short double-stranded fragments are called small interfering RNAs (siRNAs).

[0208] RNAi agent: As used herein, the term "RNAi agent" refers to an RNA molecule or its derivative that can inhibit, interfere with, or "silence" the expression of a target gene and / or its protein product. An RNAi agent can knock out (effectively eliminate or eliminate) expression or knock down (alleviate or reduce) expression. An RNAi agent may be, but is not limited to, dsRNA, siRNA, shRNA, pre-miRNA, pri-miRNA, miRNA, stRNA, lncRNA, piRNA, or snoRNA.

[0209] Sample: As used herein, the term "sample" or "biological sample" refers to a subset of tissues, cells, or component parts thereof (e.g., bodily fluids, including, but not limited to, blood, serum, mucus, lymph, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, intra-amniotic cord blood, urine, vaginal fluid, and semen). Samples may further include homogenates, lysates, or extracts prepared from a whole organism or a subset of its tissues, cells, or component parts, or fractions or portions thereof, including, but not limited to, plasma, serum, cerebrospinal fluid, lymph, the outer compartment of the skin, the respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, tumors, organs. Additionally, sample refers to a medium, such as a nutrient broth or gel, which may contain cellular components, such as proteins or nucleic acid molecules.

[0210] Self-complementary viral particle: As used herein, a "self-complementary viral particle" is a particle that is composed of at least two components: a protein capsid and a self-complementary viral genome enclosed within the capsid.

[0211] Sense strand: As used herein, the term "sense strand" or "second strand" or "passenger strand" of an siRNA molecule refers to the strand complementary to the antisense strand or first strand. The antisense and sense strands of an siRNA molecule hybridize to form a duplex structure. As used herein, an "siRNA duplex" includes an siRNA strand that is sufficiently complementary to a section of about 10 to 50 nucleotides of the mRNA of a gene targeted for silencing, and an siRNA strand that is sufficiently complementary to form a duplex with another siRNA strand.

[0212] Similarity: As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymer molecules relative to each other can be performed in the same manner as calculation of percent identity, except that percent similarity calculation takes into account conservative substitutions as understood in the art.

[0213] Short interfering RNA or siRNA: As used herein, the terms "short interfering RNA," "small interfering RNA," or "siRNA" refer to an RNA molecule (or RNA analog) containing about 5 to 60 nucleotides (or nucleotide analogs) capable of directing or mediating RNAi. Preferably, the siRNA molecule contains about 15 to 30 nucleotides or nucleotide analogs, e.g., about 16 to 25 nucleotides (or nucleotide analogs), about 18 to 23 nucleotides (or nucleotide analogs), about 19 to 22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs), about 19 to 25 nucleotides (or nucleotide analogs), and about 19 to 24 nucleotides (or nucleotide analogs). The term "short" siRNA refers to an siRNA containing 5 to 23 nucleotides, preferably 21 nucleotides (or nucleotide analogs), e.g., 19, 20, 21, or 22 nucleotides. The term "long" siRNA refers to an siRNA containing 24 to 60 nucleotides, preferably about 24 to 25 nucleotides, for example, 23, 24, 25, or 26 nucleotides. In some cases, a short siRNA may contain less than 19 nucleotides, for example, 16, 17, or 18 nucleotides, or may contain only 5 nucleotides. However, such shorter siRNAs retain the ability to mediate RNAi. Similarly, in some cases, a long siRNA may contain more than 26 nucleotides, for example, 27, 28, 29, 30, 35, 40, 45, 50, 55, or even 60 nucleotides. However, such longer siRNAs retain the ability to mediate RNAi or translational suppression and are not further processed into short siRNAs, for example, by enzymatic processing. siRNA may be a single-stranded RNA molecule (ss-siRNA) or a double-stranded RNA molecule (ds-siRNA) comprising a sense strand and an antisense strand that hybridize to form a double-stranded structure called an siRNA duplex.

[0214] Subject: As used herein, the term "subject" or "patient" refers to any organism to which a composition according to the present disclosure can be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

[0215] Substantially: As used herein, the term "substantially" refers to the qualitative state of exhibiting all or nearly all of a desired quality or characteristic to a certain extent or degree. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go completely to completion and / or proceed to completion, or achieve or avoid an absolute result. Thus, the term "substantially" is used herein to connote the inherent lack of completeness in many biological and chemical phenomena.

[0216] Targeting peptide: As used herein, "targeting peptide" refers to a peptide of 3 to 20 amino acids in length. Such targeting peptides can be inserted into or attached to a parent amino acid sequence to alter the characteristics (e.g., tropism) of the parent protein. As a non-limiting example, a targeting peptide can be inserted into an AAV capsid sequence to enhance targeting to a desired cell type, tissue, organ, or organism. It should be understood that a targeting peptide is encoded by a targeting polynucleotide, which can likewise be inserted into a parent polynucleotide sequence. Thus, a "targeting sequence" refers to a peptide sequence or polynucleotide sequence for insertion into an appropriate parent sequence (amino acid or polynucleotide, respectively).

[0217] Target cell: As used herein, "target cell" or "target tissue" refers to any one or more cells of interest. The cells can be found in vitro, in vivo, in situ, or in the tissue or organ of an organism. The organism can be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[0218] Therapeutic Agent: The term "therapeutic agent" refers to any agent that exhibits a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject.

[0219] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a nucleic acid, a drug, a therapeutic agent, a diagnostic agent, a prophylactic agent, etc.) to be delivered that, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, is sufficient to treat, ameliorate the symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is provided in a single dose.

[0220] Therapeutically Effective Outcome: As used herein, the term "therapeutically effective outcome" means an outcome sufficient to treat, ameliorate the symptoms of, diagnose, prevent, and / or delay the onset of an infection, disease, disorder, and / or condition in a subject suffering from or susceptible to the infection, disease, disorder, and / or condition.

[0221] Treat: As used herein, the term "treat" refers to the partial or complete alleviation, amelioration, improvement, reduction, delay in onset, inhibition of progression, reduction in severity, and / or reduction in incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. For example, "treating" cancer can refer to inhibiting tumor survival, growth, and / or spread. Treatment can be administered to subjects who do not exhibit signs of the disease, disorder, and / or condition and / or to subjects who exhibit only early signs of the disease, disorder, and / or condition, with the intent of reducing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0222] Vector: As used herein, the term "vector" refers to any molecule or moiety that transports, transduces, or otherwise acts as a carrier for a heterologous molecule. In some embodiments, a vector may be a plasmid. In some embodiments, a vector may be a virus. An AAV particle is an example of a vector. The vectors of the present disclosure may be recombinantly produced and may be based on and / or include an adeno-associated virus (AAV) parent or reference sequence. A heterologous molecule may be a polynucleotide and / or a polypeptide.

[0223] Viral genome: As used herein, the term "viral genome" or "vector genome" refers to a nucleic acid sequence encapsulated in an AAV particle. The viral genome includes a nucleic acid sequence having at least one payload region encoding a payload and at least one ITR.

[0224] Equivalents and Scope Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the present disclosure described herein. The scope of the present disclosure is not intended to be limited to the above Description, but rather is as set forth in the appended claims.

[0225] In the claims, articles such as "a," "an," and "the" can mean one or more than one unless indicated to the contrary or otherwise apparent from the context. A claim or description containing "or" between one or more members of a group is deemed to be satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process, unless indicated to the contrary or otherwise apparent from the context. The present disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The present disclosure includes embodiments in which more than one or all group members are present in, employed in, or otherwise relevant to a given product or process.

[0226] It should also be noted that the term "comprising" is intended to be open-ended, allowing for, but not requiring, the inclusion of additional elements or steps. Thus, when the term "comprising" is used herein, the term "consisting of" is also included and disclosed.

[0227] Where ranges are stated, endpoints are included. Furthermore, unless otherwise indicated or apparent from the context and the understanding of one of ordinary skill in the art, it should be understood that values ​​expressed as ranges can assume any specific value or subrange within the ranges set forth in various embodiments of this disclosure, down to one-tenth of the unit of the lower limit of that range, unless circumstances clearly dictate otherwise.

[0228] In addition, it should be understood that any particular embodiment of the present disclosure that falls within the prior art may be expressly excluded from any one or more of the claims. Such embodiments may be excluded even if the exclusion is not expressly set forth herein, since they are deemed to be known to those skilled in the art. Any particular embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic agent, or active ingredient; any method of production; any method of use, etc.) may be excluded from any one or more claims for any reason, whether or not related to the existence of prior art.

[0229] It is to be understood that the words which have been used are words of description rather than of limitation, and that changes may be made within the purview of the appended claims without departing from the true scope and spirit of the present disclosure in its broader aspects.

[0230] While the present disclosure has been described in some detail and with a certain degree of specificity with respect to certain described embodiments, the present disclosure is not intended to be limited to any such examples or embodiments or to any particular embodiment, but should be construed with reference to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art, and thus effectively encompass the intended scope of the present disclosure. (Addendum) The technical concepts that can be understood from the above-described embodiments and modifications will be described below. [Item 1] 1. A method for producing a variant AAV capsid polypeptide, wherein the variant AAV capsid polypeptide exhibits at least one of improved transduction or increased cell or tissue specificity compared to a parent AAV capsid polypeptide; (a) generating a library of variant AAV capsid polypeptides, said library comprising: (i) a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids; or (ii) multiple capsid polypeptides derived from more than one parent AAV capsid polypeptide; and a process comprising: (b) generating an AAV vector library by cloning the capsid polypeptides of library (i) or (ii) into an AAV vector, wherein the AAV vector comprises a first promoter and a second promoter, and the second promoter drives capsid mRNA expression in the absence of helper virus co-infection. [Item 2] 2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. [Item 3] 2. The method of claim 1, wherein the first promoter is AAV2 P40 and the second promoter is a cell type-specific promoter. [Item 4] 4. The method of claim 2 or claim 3, wherein the promoter is selected from any of those listed in Table 3. [Item 5] 5. The method of claim 4, wherein the ubiquitous promoter or the cell-specific promoter enables expression of an RNA encoding the capsid polypeptide. [Item 6] 6. The method of claim 5, further comprising recovering the RNA encoding the capsid polypeptide and sequencing the capsid polypeptide. [Item 7] The method of claim 6, wherein the recovered capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. [Item 8] 8. The method of claim 7, wherein the target cell is a neuron, neural stem cell, astrocyte, oligodendrocyte, microglial cell, retinal cell, tumor cell, hematopoietic stem cell, insulin-producing beta cell, lung epithelial cell, endothelial cell, liver cell, skeletal muscle cell, muscle stem cell, muscle satellite cell, or cardiomyocyte. [Item 9] The method of claim 1, wherein the AAV vector comprises a first promoter and a second promoter, the second promoter being located downstream of a capsid gene and driving its antisense RNA expression in the absence of helper virus co-infection. [Item 10] 10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a ubiquitous promoter. [Item 11] 10. The method of claim 9, wherein the first promoter is AAV2 P40 and the second promoter is a cell-specific promoter. [Item 12] 12. The method of claim 10 or claim 11, wherein the ubiquitous promoter or the cell-specific promoter allows expression of a gene encoding a capsid polypeptide of a variant AAV in an antisense orientation, resulting in antisense RNA. [Item 13] 13. The method of Claim 12, further comprising recovering the antisense RNA, which can be converted into RNA encoding the variant AAV capsid polypeptide, which is used to sequence the variant AAV capsid polypeptide. [Item 14] 14. The method of claim 13, wherein the variant AAV capsid polypeptide exhibits increased target cell transduction or target cell specificity (tropism) compared to the parent capsid polypeptide. [Item 15] 15. The method of claim 14, wherein the target cell is a neuron, neural stem cell, astrocyte, oligodendrocyte, microglial cell, retinal cell, tumor cell, hematopoietic stem cell, insulin-producing beta cell, lung epithelial cell, endothelial cell, liver cell, skeletal muscle cell, muscle stem cell, muscle satellite cell, or cardiomyocyte.

[0231] The present disclosure is further illustrated by the following non-limiting examples. [Example]

[0232] Example 1. TRACER Proof of Concept: Promoter Selection We performed a proof-of-concept experiment by placing the gene encoding the AAV9 peptide display capsid library under the control of either the neuron-specific synapsin promoter (SYN) or the astrocyte-specific GFAP promoter. After intravenous administration to C57BL / 6 mice, RNA was collected from brain tissue and used for further library evolution. Next-generation sequencing (NGS) demonstrated sequence convergence between animals after only two rounds of selection. Interestingly, several variants highly similar to the PHP.eB capsid were recovered, suggesting that our method enabled the rapid selection of high-performing capsids. A subset of capsids with peptide sequences showing high CNS enrichment was selected for further study. It is understood that any promoter can be selected depending on the desired tropism. Examples of such promoters are found in Table 3.

[0233] [Table 3-1]

[0234] [Table 3-2]

[0235] [Table 3-3]

[0236] Capsid pools were injected into three rodent species, followed by RNA enrichment analysis to characterize transduction efficiency in neurons or astrocytes and cross-species performance. The top-ranked capsids were then tested individually, with several variants demonstrating similar or even superior CNS transduction compared to the PHP.eB benchmark. These results suggest that the TRACER platform enables rapid in vivo evolution of AAV capsids in non-transgenic animals with enhanced tropism. The following examples illustrate these findings in more detail.

[0237] Example 2. Generation of AAV vectors capable of capsid mRNA expression in the absence of helper virus To perform cell-type-restricted and transduction-restricted in vivo evolution of an AAV capsid library, we engineered a capsid library system that allows capsid mutant genes to be transcribed in specific cell types in the absence of helper virus. In wild-type AAV virus, mRNAs encoding capsid proteins VP1, VP2, and VP3, as well as AAP accessory proteins, are expressed by the P40 promoter (Berns et al., 1996), located in the 3' region of the REP gene, which is active only in the presence of REP proteins and helper virus functions (Figure 1A). To enable capsid mRNA expression in animal tissues or cultured cells, a separate promoter must be inserted upstream or downstream of the CAP gene. Because the packaging capacity of AAV capsids is limited, portions of the REP gene must be deleted to accommodate additional promoter insertions, and the REP gene must be provided in trans by a separate plasmid to enable virus production. By introducing a CMV promoter at various positions upstream of the CAP gene of AAV9, we determined the minimal viral sequence required for high-titer AAV production (Figure 1B). The REP protein was provided in trans by the pREP2 plasmid (SEQ ID NO: 4), which was obtained by deleting the CAP gene from the REP2-CAP2 packaging vector using EcoNI and ClaI. In small-scale virus production experiments, HEK-293T cells grown in DMEM supplemented with 5% FBS and 1x pen / strep were cotransfected with 15 μg of pHelper (pFdelta6) plasmid, 10 μg of pREP2 plasmid, and 1 μg of ITR-CMV-CAP plasmid using calcium phosphate transfection and plated in 15 cm dishes. After 72 hours, cells were harvested by scraping, pelleted by brief centrifugation, and suspended in 1 ml of buffer containing 10 mM Tris and 2 mM MgCl2. The cells were lysed by adding triton X-100 to a final concentration of 0.1%, and then treated with 50 U of benzonase for 1 hour.Virus from the supernatant was precipitated with 8% polyethylene glycol and 0.5 M NaCl, suspended in 1 ml of 10 mM TRIS-2 mM MgCl2, and combined with the cell lysate. The pooled virus was adjusted to 0.5 M NaCl, clarified by centrifugation at 4,000 × g for 15 min, and fractionated at 40,000 pM for 3 h on a stepwise iodixanol gradient of 15%, 25%, 40%, and 60% (Zolotukhin et al., 1999). The 40% fraction containing purified AAV particles was collected, and viral titers were measured by real-time PCR using a TaqMan primer / probe mix specific for the 3' end of the REP, which is shared by all constructs. Although the viral yield was significantly lower (1.7%-8.8%) than that of the complete wild-type ITR-REP2-CAP9-ITR used as a reference, the CMV-BstEII construct provided the highest yield of all three CMV constructs (see Figure 2). The CMV-HindIII construct, in which most of the P40 promoter sequence was deleted, provided the lowest yield (1.7% of that of wtAAV9). This indicates that even the strong CMV promoter cannot replace the P40 promoter without causing a severe reduction in viral yield. Following these observations, the BstEII architecture (SEQ ID NO: 5), in which the minimal P40 sequence and CAP mRNA splice donor are preserved, was used in all further experiments.

[0238] The REP expression plasmid was then improved by preserving the AAP reading frame along with most of the capsid gene from the REP2-CAP9 helper vector, which may contain sequences necessary for regulating CAP transcription and / or splicing. To eliminate the capsid-encoding potential of the vector, the C-terminal fragment of the capsid gene was deleted by triple digestion with MscI restriction enzyme, followed by self-ligation to obtain the pREP-AAP plasmid (Figure 3A, SEQ ID NO: 6).

[0239] The repeat portion of this construct was engineered by introducing premature stop codons immediately after the VP1, VP2, and VP3 initiation codons without disrupting the amino acid sequence of the AAP reading frame on the same strand (Figure 3A). This construct was designated pREP-3stop (SEQ ID NO: 7). The neuron-specific syn-CAP9 vector (SEQ ID NO: 8) was derived from the CMV9-BstEII plasmid by replacing the CMV promoter with the neuron-specific human synapsin 1 promoter.

[0240] The production efficiency of this Syn-CAP9 was tested as previously described using the pREP, pREP-AAP, or pREP-3stop plasmids to deliver REP in trans. As shown in Figure 3B, the REP plasmid, which harbors a longer capsid sequence and AAP, increased virus yields approximately threefold compared to the pREP plasmid. The viral titers obtained with the pREP-AAP or pREP-3stop vectors reached approximately 30% of those of wild-type AAV9. A key concern with plasmids harboring long homology regions is the possibility of undesired recombination with the ITR-CAP vector, which would reconstitute the wild-type ITR-REP-CAP vector and contaminate the combinatorial library.

[0241] To assess the risk of wild-type virus reconstitution, the virus preparations obtained in Figure 3B were subjected to real-time PCR using a TaqMan probe located at the N-terminus of REP. The percentage of capsids containing detectable full-length REP was less than 0.03% of wild-type virus (Figure 3C), which was even lower than the 0.1% illegitimate REP-CAP packaging routinely detected in most recombinant AAV preparations obtained from 293T cell transfections (Figure 3C, our unpublished observations). Because the premature stop codon in the pREP-3stop vector provided an additional layer of safety against the possibility of wild-type capsid reconstitution and prevented translation of the truncated capsid protein, the 3stop plasmid was used for all subsequent studies.

[0242] Following this, we tested the feasibility of RNA-driven biopanning in C57BL / 6 mice using AAV9 packaging vectors driven by the astrocyte-specific GFabc1D promoter (SEQ ID NO: 9), in which the AAV9 capsid gene is driven by the CMV promoter, synapsin promoter, or, later, GFAP promoter (Brenner et al., 2008). (Figure 4A) These three vectors were produced in HEK-293T cells as previously described and analyzed by PAGE-silver staining. As shown in Figure 4B, all vectors expressed VP1, VP2, and VP3 capsid proteins in normal ratios, indicating that this particular promoter architecture does not disrupt the balance of capsid protein expression. Six-week-old male C57BL / 6 mice were intravenously injected with 1 e12 VG per mouse and sacrificed 28 days later. DNA biodistribution and capsid mRNA expression were examined in brain, liver, and heart tissues.

[0243] Total DNA was extracted from brain, liver, and heart tissues using Qiagen DNeasy blood and tissue columns, and viral DNA was quantified by real-time PCR using a TaqMan probe located in the VP3 N-terminal region. DNA abundance was normalized using a predesigned probe detecting the single-copy transferrin receptor gene (Life Technologies ref. 4458366). Viral DNA was abundant in the liver but to a lesser extent in the heart. DNA distribution did not show any significant differences among the three vectors (Figure 4C). RNA was extracted with the Qiagen RNeasy Plus Universal Kit according to the manufacturer's instructions, treated with ezDNAse (Qiagen) to remove residual DNA, and reverse transcribed with Superscript IV (Life Technologies).

[0244] RNA expression was assessed using the same VP3 probe used to quantify viral DNA and normalized using TBP as a reference RNA (Life Technologies Mm01277042_m1). In the brain, the GFAP promoter enabled the strongest expression levels, while the synapsin promoter enabled expression equivalent to the strong CMV promoter. In the liver, all promoters yielded similar expression levels, likely a result of leaky expression at very high copy numbers (Figure 4D). In the heart, the cell type specificity of the Syn and GFAP promoters was evident, as they only enabled approximately 3% and 10% of CMV expression, respectively, despite their similar DNA biodistribution.

[0245] Overall, this experiment demonstrated that mRNA derived from transduction-competent capsids could be recovered from a variety of animal organs, including poorly transduced tissues such as the brain. Example 3. AAV Vector Construction To increase RNA expression and maximize library recovery, various vector configurations were explored. The CMV promoter was replaced with a hybrid CMV enhancer / chicken beta-actin promoter sequence (Niwa et al., 1991). Because introns have been shown to increase mRNA processing and stability (Powell et al., 2015), a powerful cytomegalovirus beta-globin hybrid intron derived from the AAV-MCS cloning vector (Stratagene) was inserted between the promoter sequence and the capsid gene. This resulted in the constructs CAG9 (SEQ ID NO: 10), SYNG9 (SEQ ID NO: 11), and GFAPG (SEQ ID NO: 12).

[0246] To avoid potential interference with the P40 promoter, we also tested an inverted vector configuration in which a helper-independent promoter was placed downstream of the capsid gene in a reverse orientation (Figure 5A). This configuration allows for expression of antisense capsid transcripts in animal tissues. Because most polyadenylation signals (AATAAA) are orientation-dependent, we hypothesized that the native AAV capsid polyA, when placed in a reverse orientation, would not prematurely terminate transcription. All constructs were cotransfected with the pHelper and pREP-3stop plasmids to generate AAV9-packaged virions, which were then used to transduce HEK-293T cells at an MOI of 1e4 VG per cell. Forty-eight hours after transfection, RNA was extracted and reverse-transcribed using the Quantitect kit (Qiagen).

[0247] PCR was performed using primers that allowed amplification of the full-length capsid or partial sequences located near the C-terminus (Figure 5B). Overall, the presence of an intron had little effect on expression from the low-activity promoters Syn and GFAP. This indicates that mRNA splicing did not relieve promoter repression in nonpermissive cells. The combination of the CMV enhancer with the chicken beta-actin promoter and hybrid intron allowed significantly higher (>10-fold) mRNA expression compared to the CMV promoter alone (Figure 5B, C).

[0248] Comparing the end-point PCR amplification of the forward and inverted intron vectors revealed discrepancies between the full-length and partial capsid amplicons (Figure 5B, right lane), raising questions about the integrity of the capsid RNA. When primers flanking the full-length capsid were used to amplify cDNA derived from the inverted iCAG9 genome, multiple low-molecular-weight bands were detected, whereas the forward vector allowed amplification of a single product of the expected length (Figure 5D). Sanger sequencing of the low-molecular-weight amplicons indicated that each band corresponded to an illegitimate splicing product from the antisense capsid RNA.

[0249] In light of these results, the forward tandem promoter was the architecture for subsequent experiments. To avoid amplification of residual DNA present in the RNA preparation, splice-specific PCR amplification was tested. Two candidate PCR primers overlapping the CMV / globin exon junction were designed and tested for amplification of either cDNA (spliced) or plasmid DNA (still containing intron sequences). As shown in Figure 5E, the GloSpliceF6 primer (SEQ ID NO: 13) enabled completely specific amplification from cDNA without producing detectable amplicons from the plasmid DNA sequence. This primer was used in subsequent assays to confirm the absence of amplification from contaminating DNA.

[0250] The tandem constructs were then tested for the possibility that the P40 promoter might interfere with a cell-specific promoter located upstream. To this end, two sets of AAV genomes were tested for transgene mRNA expression in HEK-293T cells. A set of transgenes in which the GFP gene was located immediately downstream of the CAG, SYNG, or GFAPG promoter and did not contain the P40 sequence was tested and compared with a library construct in which the AAV9 capsid was located downstream of the P40 promoter (Figure 6A). All genomes were packaged into AAV9 capsids and used to infect HEK-293T cells at an MOI of 1e4VG per cell. Forty-eight hours after infection, RNA was extracted, and transgene RNA was quantified using a TaqMan primer / probe mix specific for spliced ​​globin inter-exon junctions. As shown in Figure 6B, expression from the CAG promoter was similar for the GFP and P40-CAP9 constructs (2-fold lower for p40-CAP9, but within the tolerance of AAV titration). Expression from the synapsin promoter was dramatically lower for both constructs, and even lower for the GFAP-driven mRNA (Figure 6B). This was expected, as HEK-293T cells are not permissive for synapsin or GFAP promoter expression. Overall, this experiment confirmed that the presence of the P40 sequence does not alter the cell type specificity of the synapsin or GFAP promoters.

[0251] This novel platform has been named TRACER (Tropism Redirection of AAV by Cell type-specific Expression of RNA). The TRACER platform overcomes the challenges of standard methods, including transduction and cell type restriction (Figure 7). Use of the TRACER system is well suited for capsid discovery, where targeting peptide libraries are used. Screening of such libraries can be performed as outlined in Figure 8.

[0252] While several variants of AAV vectors encoding capsids as payloads are taught herein, one canonical design is shown in Figure 9B and Figures 12A and 12B.

[0253] An additional advantage of the TRACER platform relates to the nature of the viral pool and the recovery of RNA only from fully transduced cells (Figure 10). Consequently, capsid discovery can be accelerated to yield cell- and / or tissue-specific tropism (Figure 11).

[0254] Example 4. Generation and cloning-free amplification of peptide display libraries We generated several peptide display capsid libraries by inserting seven consecutive randomized amino acids into the surface-exposed hypervariable loop VIII region of AAV5, AAV6, or AAV-DJ8 capsids (Figures 13 and 39) and AAV9 (Figure 14). In the case of the AAV9 library, two additional libraries were modified at the -2, -1, and +1 residues of the insert to match the flanking sequences of the highly neurotrophic PHP.eB vector (Chan et al., 2018). To facilitate the insertion of various loops and prevent contamination with wild-type capsids, we generated a deletion shuttle vector in which the C-terminal region of the capsid gene contained between loop VIII and the stop codon was deleted and replaced with a unique BsrGI restriction site (Figure 15A, B). Degenerate primers containing randomized NNK (K = T or G) sequences capable of encoding all amino acids were synthesized by IDT and used to amplify the missing capsid fragments using gBlock (IDT) double-stranded linear DNA as a template (SEQ ID NOs: 14, 15, 16, and 17). To completely prevent the possibility of plasmid carryover contamination in the PCR reaction, a linear PCR template was preferred over a plasmid. Amplicons containing random library sequences (500 ng) were inserted into a shuttle plasmid linearized with BsrGI (2 μg) using 100 μl of NEBuilder HiFi DNA Assembly Master Mix (NEB) at 50°C for 30 minutes. 5 μl of T5 exonuclease was added to the reaction and digested at 37°C for 30 minutes to eliminate unassembled linear templates. The entire reaction was purified using DNA Clean and Concentrator-5 and quantified using a nanodrop to estimate assembly efficiency. This method routinely allows for the recovery of 0.5-1 ug of assembly material.

[0255] The gBlock template was engineered by introducing silent mutations to remove unique restriction sites, allowing for the selective loss of wild-type viral contaminants from the library by restriction enzyme digestion. As an example, the AAV9 gBlock was engineered to remove the BamHI and AfeI sites present in the parent sequence (SEQ ID NO: 17).

[0256] Example 5. Cloning-free amplification Transformation of assembled library DNA into competent bacteria represents a major bottleneck in library diversity, as even highly competent strains rarely yield more than 1e7–1e8 colonies per transformation. By comparison, 100 nanograms of a 6-kb plasmid contains 1.5e10 DNA molecules. Thus, bacterial transformation randomly eliminates more than 99% of the DNA species in a given pool. Therefore, we created a cloning-free method that bypasses the bottleneck of bacterial transformation while enabling >100-fold amplification of Gibson-assembled DNA (Figure 16). We optimized a protocol based on rolling circle amplification, which allows unbiased exponential amplification of circular DNA templates with an extremely low error rate (Hutchinson et al., 2005). One problem with rolling circle amplification is the production of very large (averaging approximately 70 kb), heavily branched concatemers that must be cleaved into monomers for efficient cell transfection. This process can be accomplished in several ways, for example, by generating open-ended linear templates using restriction enzymes (Hutchinson et al., 2005; Huovinen, 2012) or by generating self-ligated circular templates using CRE-Lox recombination (Huovinen et al., 2011). However, open-ended DNA is susceptible to degradation by cytoplasmic exonucleases, and the CRE recombination method has shown relatively low efficiency (our unpublished observations). Therefore, we chose an alternative monomer resolution method based on the use of TelN protelomerase (Rybchin et al., 1999), an enzyme that catalyzes the formation of closed-ended linear "dogbone" DNA monomers (Heinrich et al., 2002), which are highly suitable for mammalian cell transfection.

[0257] Therefore, to obtain the following plasmid, the protelomerase recognition sequence TATCAGCACACAATTGCCCATTATACGC * GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 176) was introduced outside of both ITRs in all BsrGI shuttle vectors used for capsid library insertion (asterisks illustrate the positions where the two complementary strands are covalently linked to each other): TelN-Syn9-BsrGI (SEQ ID NO: 18), TelN-GFAP9-BsrGI (SEQ ID NO: 19), TelN-Syn5-BsrGI (SEQ ID NO: 20), TelN-GFAP5-BsrGI (SEQ ID NO: 21), TelN-Syn6-BsrGI (SEQ ID NO: 22), TelN-GFAP6-BsrGI (SEQ ID NO: 23), TelN-SynDJ8-BsrGI (SEQ ID NO: 24), TelN-GFAPDJ8-BsrGI (SEQ ID NO: 25). Several methods for rolling circle amplification were tested, with the best results (high yield and low non-specific amplification) obtained with the TruePrime technology (Expedeon), which relies on primer-free amplification (Picher et al., 2016).

[0258] Briefly, the entire column-purified assembly reaction was used in a 900 μl TruePrime reaction according to the manufacturer's instructions and incubated overnight at 30°C. The following day, the rolling circle reaction product was incubated at 65°C for 10 minutes to inactivate the enzyme and diluted 5-fold with 1x ThermoPol buffer containing 50 μl of protelomerase (NEB) to a 4.5 ml reaction. After 1 hour at 30°C, the reaction was heated at 70°C for 10 minutes to inactivate the protelomerase, and a 4.5 μl aliquot was run on an agarose gel. The entire reaction was then purified on multiple (10–12) Qiagen QiaPrep 2.0 columns according to the manufacturer's instructions. Typical yields obtained with this method were 160–180 μg of DNA. This represents a >100-fold amplification of the starting material (typically 0.5–1 μg) and provides enough DNA for the transfection of 200 cell culture dishes (Figure 16).

[0259] The composition of all libraries was examined by next-generation sequencing using the Illumina NextSeq sequencing platform to estimate the number of variants and the ultimate contamination with wild-type virus. Amplicons were generated by PCR with Q5 polymerase (NEB) using primers containing Illumina TruSeq adapters and index barcodes. Amplicons were obtained by low-cycle PCR amplification (15 cycles). They were run on a 3% agarose gel and purified using Zymo gel extraction reagent. Libraries were quantified using Nanodrop, pooled into an equimolar mix, and requantified using the KAPA Library Quantification Kit according to the manufacturer's instructions. Libraries were mixed with 20-40% PhiX control libraries to increase sequence diversity.

[0260] All DNA libraries generated by rolling circle sequencing showed high sequence diversity (typically >1e8 unique variants, which exceeds the limit of NextSeq sequencing). In comparison, plasmid libraries generated by bacterial transformation rarely exceed 1-2e7 variants.

[0261] Example 6. Prevention and / or reduction of contamination In another embodiment, we created a primer / vector system designed to completely prevent contamination of AAV9 libraries with wild-type viruses that may be recovered from environmental contaminants or naturally infected primate tissues. This was achieved by introducing a maximum number of silent mutations into the sequences surrounding the library insertion site and the sequence immediately preceding the CAP stop codon used for PCR amplification (Figure 17). These libraries demonstrated extremely low wild-type AAV9 detection by NGS (<2 AAV9 reads per 5e7 total reads). This suggests that modifying the codons surrounding the library amplification and cloning sites is a highly efficient way to preserve libraries from environmental or experimental contaminants.

[0262] Libraries were produced as previously described by calcium phosphate transfection of HEK-293T cells, double iodixanol gradient fractionation, and membrane ultrafiltration using 100,000 Da MWCO Amicon-15 membranes (Millipore). They were quantified by real-time PCR, and aliquots were used for NGS amplicon generation and NextSeq sequencing. The diversity of the viral libraries was significantly lower than that of the DNA libraries (typically about 1-2e7 unique variants) and showed very strong counterselection of variants containing stop codons (from 20% in the DNA library to about 1% in the viral library). This clearly indicated a very high rate of cis-packaging, as observed in a previous study (Nonnenmacher et al., 2014).

[0263] Example 7. In vivo selection of an AAV9 library for mouse brain transduction Next, we developed an RNA-driven library selection method to increase brain transduction in a mouse model. The AAV9 library generated as described above was intravenously injected into male C57BL / 6 mice at a dose of 2e12VG per mouse. Two groups of mice were injected with a single SYN-driven or GFAP-driven library derived from wild-type AAV9 flanking sequences, while two other groups received pooled libraries containing wild-type and PHP.eB-derived flanking sequences (Figure 18). One month later, RNA was extracted from 200 mg of brain tissue corresponding to a whole hemisphere using the RNeasy Universal Plus procedure (Qiagen). To minimize the possibility of RNA under-sampled, the entire RNA preparation (approximately 200 μg) was subjected to mRNA enrichment using Oligotex beads (Qiagen) as recommended by the manufacturer. The entire enriched mRNA preparation (approximately 5 μg, representing 2% of the total RNA) was then amplified using the following sequence:

[0264] [ka]

[0265] The entire cDNA pool was then amplified in a 500 ul PCR reaction with 30 cycles of 55°C annealing temperature and 2 min extension, using Q5 Master Mix, GloSpliceF6 forward primer, and CAP9-specific reverse primer:

[0266] [ka]

[0267] (The CAP stop codon is underlined.) This method allowed for the recovery of large amounts of amplicons from all brain samples (Figure 20). The full-length capsid amplicons were then used as templates for NGS library generation and cloned into P1 DNA libraries using the exact same assembly and cloning-free procedures for the next round of biopanning. NGS analysis performed on the PCR amplicons showed that library diversity had decreased approximately 25-fold (from 1e7 to 4e5) after the first round of biopanning for both the Syn-driven and GFAP-driven libraries (Figure 21). The number of recovered first-passage variants (P1) was too high to exhibit any significant sequence convergence at this point, and there was little overlap between the compositions of pools recovered from individual animals. Therefore, a second round of selection was performed. After the second round of biopanning (P2), the total number of unique variants was further reduced by 4-5-fold to <1e5 peptides. Importantly, some libraries recovered after the first round of biopanning displayed significant counts of wild-type AAV9 and AAV-PHP.eB sequences, likely derived from environmental contaminants, which later served as useful benchmarks for the second round of enrichment.

[0268] After RNA harvesting and PCR amplification, systematic enrichment analysis by NGS was performed by calculating the P2 / P1 read ratio and comparing it to the P2 / P1 ratio of AAV9 or PHPeB. As shown in Figure 22, Table 4, Figure 23, and Table 5, several capsids exhibited higher enrichment ratios than the benchmark PHP.eB in both Syn- and GFAP-driven libraries, demonstrating sequence convergence as demonstrated by consensus sequence generation.

[0269] [Table 4-1]

[0270] [Table 4-2]

[0271] [Table 5-1]

[0272] [Table 5-2]

[0273] [Table 5-3]

[0274] Importantly, there was strong sequence convergence between different animals, suggesting that selection was efficient after only two passages. Figures 24 and 25 provide an estimate of brain / liver specificity in the GFAP-AAV9 peptide library candidates.

[0275] Example 8. Multiplexed Selection For final multiplexed in vivo screening by pooling individual variants into an equimolar library, a subpopulation of variants with promising properties (such as, but not limited to, enrichment factor in more than one mouse, liver detargeting, and high counts) can be selected as shown in Figure 26. Then, an equimolar primer pool encoding all 7-mers can be synthesized (microchip solid-phase synthesis, up to 3,800 primers per chip). A limited diversity library can be produced that includes an internal control, such as, but not limited to, PHP.N, PHP.B, wild-type AAV9 (wtAAV9), and / or any other serotype taught herein. Mice are injected, and RNA enrichment is then compared to the internal control in a manner similar to barcoding studies known in the art and described herein.

[0276] Example 9. Codon optimization Codon variants can be used to improve data strength when using synthetic libraries. A list of NNK codons, NNM codons, and the most preferred NNM codons in mammals for various amino acids is provided in Table 6. In Table 6, * means that the NNM codon is not available, ** means "avoid homopolymeric stretching if possible."

[0277] [Table 6]

[0278] To have a balanced library, it is recommended to establish a list of potential candidates and then use Table 6 to establish a pooled primer library containing all peptide variants encoded by NNK codons (original from the library) and non-NNK codons (maximum variability). If similar behavior is observed between two variants of the same peptide, this will strengthen the analysis of that peptide. In addition, it is recommended to select the most favorable NNM codon (M = A or C).

[0279] Example 10. Library generation We selected the top 330 peptide variants from the SYN- and GFAP-driven libraries that showed enhanced performance compared to the parent AAV9. De novo libraries were generated by pooled primer synthesis of all 330 peptide sequences, plus AAV9, AAV-PHP.B, and AAV-PHP.eB controls (Table 7). To eliminate potential artifacts due to DNA sequence and increase the robustness of the assay, each peptide variant was encoded by two different DNA sequences: one encoding all amino acids with NNK codons (identical to the original library) and the other using NNM codons where possible (M = C or A, Table 6).

[0280] [Table 7-1]

[0281] [Table 7-2]

[0282] [Table 7-3]

[0283] [Table 7-4]

[0284]

Table 7-5

[0285]

Table 7-6

[0286]

Table 7-7

[0287]

Table 7-8

[0288]

Table 7-9

[0289]

Table 7-10

[0290]

Table 7-11

[0291]

Table 7-12

[0292]

Table 7-13

[0293]

Table 7-14

[0294]

Table 7-15

[0295]

Table 7-16

[0296]

Table 7-17

[0297]

Table 7-18

[0298]

Table 7-19

[0299]

Table 7-20

[0300]

Table 7-21

[0301]

Table 7-22

[0302]

Table 7-23

[0303] Primer pools were produced by Twist biosciences using solid-phase synthesis. They were used to generate a balanced library of 666 nucleotide variants by PCR amplification of the CAP C-terminus and Gibson assembly as described in Figure 27. The 666 primers provided 1 fmole each, for a total of 0.6 pmole (regular PCR requires approximately 25 pmoles of primers). Primerless amplification of the capsid gBlock template was performed for 10 cycles. Forward and reverse primers were added, followed by an additional 10, 15, or 20 PCR cycles. The constructs were then cloned into the AAV9 backbone plasmid by Gibson / RCA (as with regular libraries).

[0304] NGS analysis of SYN- and GFAP-driven AAV libraries generated with pooled DNA showed good correlation between codon variants for each peptide, suggesting that the DNA sequence itself had little effect on virus production (Figures 28 and 29). The pooled synthetic libraries were intravenously injected into C57BL / 6 mice (5e11VG per mouse, N=9), BALB / C mice (5e11VG per mouse, N=6), and rats (5e12VG per rat, N=6). After one month of survival, RNA was extracted from brain and spinal cord, and DNA was extracted from liver and heart tissue samples for biodistribution analysis (Figure 30). Because the synapsin and GFAP promoters are not sufficiently active in non-CNS tissues, DNA instead of RNA was analyzed in peripheral organs. C57BL / 6 mouse analysis was the initial focus, as this was the mouse strain in which library evolution was performed.

[0305] The enrichment score for each capsid was determined by NGS analysis and defined as the ratio of reads per million (RPM) in the target tissue to the RPM in the inoculum. An example of an analysis performed on a control capsid is shown in Figure 31A. As expected from published data, PHP.B and PHP.eB (also known as PHP.N) capsids enabled significantly higher RNA expression in neurons compared to the AAV9 parental capsid (8-fold and 25-fold, respectively). There was a very high correlation between the codon variants of each peptide species in each animal (r = 0.92, 0.93, and 0.95), confirming the robustness of the NGS assay (Figures 31B-D).

[0306] Examples of enrichment analyses are presented in Figures 32A-36. The 333 capsid variants were ranked by the average brain enrichment score across all animals, and individual enrichment values ​​are shown on a color scale. As indicated by the position of the reference capsid, a group of novel variants exhibited higher enrichment scores than the PHP.eB benchmark capsid in both neurons (Syn-driven) and astrocytes (GFAP-driven). Interestingly, many variants exhibited different enrichment scores in neurons and astrocytes, as indicated by the moderate level of correlation between Syn-driven and GFAP-driven RNAs. This suggests that certain capsids display enhanced tropism for neurons and other capsids display enhanced tropism for astrocytes (Figure 33).

[0307] A group of 38 capsids displayed potentially interesting properties based on their tropism for neurons, astrocytes, or both (Tables 8A and 8B) (Figure 38) and showed strong consensus peptide sequence similarity, which differed between neuron- and astrocyte-targeting variants (Figures 45-C and 46A-B).

[0308] [Table 8]

[0309] [Table 9-1]

[0310] [Table 9-2]

[0311] [Table 9-3]

[0312] Example 11. Phylogenetic grouping Phylogenetic grouping of peptide sequences revealed a clear correlation between sequence homology clusters and capsid phenotypes (Figure 37). For example, a 9-mer variant with the sequence DGTxxxPFK / R (SEQ ID NO: 1181) exhibited similar behavior to PHP.eB capsids (high transduction of both neurons and astrocytes), whereas a variant containing the sequence DGTxxxYDS / A (SEQ ID NO: 1182) showed a preference for neuronal transduction. In contrast, peptides with the consensus sequences DGTxxxxGW (SEQ ID NO: 1183) or CGTxxxPPR / K (SEQ ID NO: 1184) exhibited higher tropism for astrocytes.

[0313] Example 12. Capsid Test Capsid variants representing distinct sequence clusters (highlighted in Figure 37B) were selected for individual transduction analysis in C57BL / 6 mice. Each capsid was produced as a recombinant AAV packaging a self-complementary EGFP transgene driven by a ubiquitous promoter (Figures 49A, B). Groups of mice (N = 3) were intravenously injected with 6e10VG, and transduction efficiency was assessed one month later by quantifying EGFP mRNA in brain, spinal cord, and liver tissues. EGFP mRNA expression was normalized using mouse TBP as a housekeeping gene, and DNA biodistribution was normalized to the single-copy mouse TfR gene (Figures 50A-C). Reverse transcription was performed using the Quantitect kit and included a DNA removal step. All capsid variants showed significantly improved brain and spinal cord mRNA expression compared to the parental AAV9 capsid, and three of the seven variants (9P16, 9P31, and 9P35) showed similar or higher transduction than the PHP.eB benchmark capsid (Figure 49C, Table 10). Viral DNA biodistribution showed very strong tropism of 9P31 and 9P35 for the brain and spinal cord, while all variants showed a 40- to 260-fold increase in biodistribution compared to AAV9 (Figure 49D, Table 10).

[0314] By labeling the neuronal NeuN marker, the predicted cell tropism was tested using NGS screening (Figure 51). Within the cortex, the top capsids in the GFAP screen showed GFP expression primarily in NeuN-negative cells with glial morphology. Conversely, the top capsids in the SYN screen showed very high transduction of NeuN-positive cells, and the bispecific capsids 9P08 and 9P16, which ranked highly in both assays, showed mixed cell preference with multiple NeuN+ cells and glial cells.

[0315] Cell tropism was also tested using mouse brain microvascular EC (mBMVEC) binding to AAV9, and the results are shown in Table 9.

[0316] [Table 10]

[0317] Fluorescent EGFP expression in whole brain, cerebellum, cortex, and hippocampus tissues reveals transduction patterns across the spectrum, demonstrating tissue-specific capsid discrimination (Figures 52-56).

[0318] Liver transduction, measured by mRNA expression and by total tissue GFP expression, showed that some variants outperformed AAV9, which was unexpected in light of the NGS results. Some variants, such as 9P08 or 9P23, showed relative liver detargeting compared to AAV9 (Figures 57A-B).

[0319] [Table 11]

[0320] Example 13. Multi-rodent study (cross-species) The CNS transduction efficacy of the 333 capsid variants was tested in other rodent strains or species (Figure 47). Side-by-side comparison of neuronal and astrocyte transduction in C57BL / 6 mice, BALB / C mice, and rats showed significant differences in enrichment scores for multiple variants between the two mouse strains, with even more pronounced differences between mice and rats (Figures 48A-C). Surprisingly, the most efficient capsid for rat brain transduction was the parental AAV9. This suggests that directed evolution "bottleneck" capsid variants perform better in a given species, in contrast to the versatility of wild-type AAV capsids.

[0321] Correlation analysis showed that some capsids shared high CNS transduction between C57BL / 6 and BALB / C mice, while other capsids were restricted to only one strain (Figure 48B).

[0322] Interestingly, PHP.B and PHP.eB capsids exhibited poor brain transduction in BALB / C mice, consistent with a recent publication (Hordeaux et al., 2018). Focusing on capsids that showed a >10-fold increase in brain transduction, 62 variants showed improvement only in C57BL / 6 mice, 28 variants showed improvement only in BALB / C mice, and 30 variants showed improvement in brain transduction in both strains (Table 11). Consensus sequence analysis revealed a "C57BL / 6 signature" closely similar to the PHP.eB peptide (DGTxxxPFR (SEQ ID NO: 1185)), whereas the BALB / C signature showed a different consensus (DGTxxxxGW (SEQ ID NO: 1183)). This suggests that different cellular receptors were used (Figure 48C).

[0323] [Table 12-1]

[0324] [Table 12-2]

[0325] [Table 12-3]

[0326] [Table 12-4]

[0327] [Table 12-5]

[0328] The CNS transduction efficacy of 333 capsid variants was also compared in C57BL / 6 mouse BMVECs and human BMVECs (Figures 58A and 58B). Example 14. Engineering an NGS-driven selection system for full-length capsid variants The barcode system was engineered to enable enrichment studies with full-capsid length modifications. The TRACER platform described here was initially developed to use peptide display libraries, and although the randomized peptide sequences themselves are amenable to Illumina NGS analysis due to their short size, Illumina sequencing techniques typically do not allow sequencing of more than 300 consecutive bases. Therefore, our platform cannot be used for NGS analysis of full-length capsid variants, such as those generated by DNA shuffling techniques or error-prone PCR.

[0329] We designed an alternative RNA-driven platform for full-length capsid libraries in which uniquely identified molecules (UMIs) are located outside the capsid gene and can be used for NGS enrichment analysis (Figures 59A-59C). Once variants with desired properties are identified through UMI enrichment analysis of animal tissues, the UMI sequences should enable highly specific recovery of full-length capsids from the starting material with minimal error rates. To be effective, this system should have one or more of the following properties: 1) the UMI should be transcribed under the control of a cell-type-specific promoter; 2) the UMI should not interfere with capsid expression or splicing during virus production; 3) the UMI should be short enough for Illumina NGS sequencing (typically less than 60 nt for standard single-end 75 nt sequencing); and 4) the UMI should enable sequence-specific recovery of the desired full-length capsid from the starting DNA / viral library with minimal error rates.

[0330] To address these characteristics, we 1) placed UMIs in the transcribed region of the capsid library (i.e., anywhere between the transcription start site and the polyadenylation signal), 2) placed UMIs either at various positions in AAV introns (which are rarely spliced ​​in the absence of helper functions) or between the capsid stop codon and the polyadenylation signal, 3) UMI cassettes consisted of two randomized 21-nt sequences separated by a 15-nt spacer, totaling 57 nt and allowing for an additional 18 nucleotides for primer annealing, and 4) formed UMI randomized sequences with NSW triplets (N = A, T, G, C; S = G, C; W = A, T) to prevent large variability in annealing temperatures with amplification primers, avoid homopolymeric extension, and prevent the formation of a premature poly(A) signal (AATAAA).

[0331] Importantly, the UMI cassette contained two random sequences in tandem. The first sequence (outermost) was used to design matching capsid recovery primers, and the second sequence (innermost) was used to confirm the identity of the capsid amplicon after cloning. This method should be able to eliminate all clones containing nonspecific amplification products. In an alternative embodiment, the innermost sequence can also be used to design nested PCR primers to increase amplification specificity (Figures 59A-C).

[0332] Several insertion sites for tandem barcodes were explored to test their effect on virus viability and titer. A series of constructs were engineered to insert barcodes into the AAV intron of the CAG9 plasmid (Figure 60A). Because AAV introns are spliced ​​out during virus production, the presence of barcodes should have minimal impact on yield. Conversely, because AAV splicing is highly inefficient in the absence of helper functions (Mouw et al., 2000), barcode sequences will be preserved in RNA recovered from animal tissues. All intron-barcoded constructs were tested for their ability to produce high-titer AAV progeny by cotransfecting them with pHelper and pREP3stop plasmids. All constructs enabled high-titer AAV production, ranging from 50% to 80% of that of non-barcoded CAG9 virus (Figure 60B).

[0333] RNA splicing analysis of transfected cells showed that the rate of AAV intron splicing varied slightly between constructs and was more efficient when the intron barcode was inserted after the conserved intervening sequence downstream of the splice donor (Figure 58C, top panel).

[0334] Globin intron splicing was 100% efficient in all conditions tested (Figure 60C, bottom panel). As expected, in the absence of helper function, AAV intron splicing was nearly undetectable.

[0335] An alternative platform was tested in which tandem barcodes were placed between the capsid stop codon and the polyadenylation signal (Figure 59B). Titers generated by the 3' barcoded construct were identical to the non-barcoded CAG9 construct.

[0336] Overall, external barcoding of full-length capsids enables highly efficient AAV production, and the novel tandem barcoding platform enables reliable NGS-driven sequence-specific recovery from library preparations.

[0337] [Table 13-1]

[0338] [Table 13-2]

[0339] [Table 13-3]

[0340] [Table 13-4]

[0341] [Table 13-5]

[0342] [Table 13-6]

[0343] [Table 13-7]

[0344] [Table 13-8]

[0345] [Table 13-9]

[0346]

Table 13-10

[0347]

Table 13-11

[0348]

Table 13-12

[0349]

Table 13-13

[0350]

Table 13-14

[0351]

Table 13-15

[0352]

Table 13-16

[0353]

Table 13-17

[0354]

Table 13-18

[0355]

Table 13-19

[0356]

Table 13-20

[0357]

Table 13-21

[0358]

Table 13-22

[0359]

Table 13-23

[0360]

Table 13-24

[0361]

Table 13-25

[0362]

Table 13-26

[0363]

Table 13-27

[0364]

Table 13-28

[0365] Citations

[0366]

Table 14-1

[0367]

Table 14-2

Claims

1. 1. A method for generating an adeno-associated virus (AAV) vector library encoding variant AAV capsid polypeptides, comprising: (a) providing a first nucleic acid and a second nucleic acid, wherein the first nucleic acid comprises a P40 promoter and a cell type specific promoter that drives capsid mRNA expression in the absence of helper virus coinfection, and the second nucleic acid encodes a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids; (b) cloning the first and second nucleic acids under suitable conditions to generate the AAV vector library. A method for providing the above.

2. 2. The method of claim 1, wherein the cell type specific promoter is a blood cell specific promoter, an eye specific promoter, a heart specific promoter, a muscle specific promoter, a kidney specific promoter, a lung specific promoter, a spleen specific promoter, a vasculature specific promoter, a neuron specific promoter, or an astrocyte specific promoter.

3. The method of claim 1 or 2, wherein the cell type specific promoter is a synapsin promoter.

4. The method of claim 1 or 2, wherein the cell type specific promoter is a GFAP promoter.

5. 5. The method of any one of claims 1 to 4, wherein the P40 promoter and the cell type specific promoter are located upstream of a transgene encoding the variant AAV capsid polypeptide.

6. The method of any one of claims 1 to 5, wherein the region of randomized sequence comprises a peptide insert of 4, 5, 6, 7, 8, or 9 consecutive amino acids.

7. The method of claim 6, wherein the insert is present in a hypervariable region of a parent AAV capsid polypeptide.

8. The method of claim 6 or 7, wherein the insert is present in loop IV, loop VIII, or both loop IV and loop VIII of the parent AAV capsid polypeptide.

9. The insert is (i) immediately following a position selected from positions 452 to 458 of the parent sequence; and / or (ii) immediately following a position selected from positions 586 to 592 of the parent sequence The method according to any one of claims 6 to 8, wherein

10. The method of any one of claims 1 to 9, wherein the parent AAV capsid polypeptide comprises an AAV9 capsid polypeptide, or an AAV5 capsid polypeptide.

11. The method further comprising: The method of any one of claims 1 to 10, further comprising the step of (c) generating a plurality of AAV particles comprising the AAV vector library.

12. The method further comprising: The method of claim 11, further comprising (d) administering the AAV particles to a mouse or a non-human primate (NHP).

13. The particle is administered intravenously. The method of claim 12.

14. The method further comprising:

14. The method of claim 12 or 13, further comprising the step of (e) collecting and / or isolating target cells or tissues from said mouse or NHP.

15. The method of claim 14, wherein the target cells or tissues are collected 4 weeks after administration of the particles.

16. The method further comprising:

16. The method of claim 15, further comprising the step of: (f) recovering RNA encoding the variant AAV capsid polypeptide and / or antisense RNA from the target cell or tissue.

17. 17. The method of claim 16, wherein the RNA encoding the variant AAV capsid polypeptide is enriched and / or reverse transcribed into cDNA.

18. The method of claim 17, wherein the cDNA is amplified.

19. The method further comprising:

19. The method of any one of claims 16 to 18, further comprising the step of (g) determining the sequence of the variant AAV capsid polypeptide.

20. The method further comprising:

20. The method of claim 19, further comprising the step of: (h) determining the amount of DNA encoding said variant AAV capsid polypeptide or the amount of RNA encoding said variant AAV capsid polypeptide in a target cell or tissue.

21. 21. The method of claim 20, wherein the method further repeats steps (a) through (h).

22. 4. The encoded variant AAV capsid polypeptide, comprising: (i) increased target cell transduction or target cell specificity for cells of the central nervous system (CNS) compared to the parent capsid polypeptide; (ii) increased brain transduction as compared to the parent capsid polypeptide, wherein the level of transduction is at least 10-fold higher than the parent capsid polypeptide; (iii) increased transduction of the spinal cord compared to the parent capsid polypeptide, wherein the level of transduction is at least 10-fold higher than the parent capsid polypeptide; (iv) an increased level of delivery of viral genome to the brain compared to the parent capsid polypeptide, wherein the level of viral genome is increased by at least 40-fold over the parent capsid polypeptide; and / or (v) increasing the level of delivery of viral genome to the spinal cord compared to the parent capsid polypeptide, wherein the level of viral genome is increased by at least 35-fold over the parent capsid polypeptide; 22. The method of any one of claims 1 to 21, wherein the method exhibits one, two, three, four or all of the following:

23. 23. The method of any one of claims 14 to 22, wherein the target cells are neurons, neural stem cells, astrocytes, oligodendrocytes, microglial cells, retinal cells, tumor cells, hematopoietic stem cells, insulin-producing beta cells, pulmonary epithelial cells, endothelial cells, hepatic cells, skeletal muscle cells, muscle stem cells, muscle satellite cells, and / or cardiomyocytes.

24. The method of any one of claims 14 to 22, wherein the target tissue is a CNS tissue, a peripheral nervous system (PNS) tissue, and / or a peripheral tissue.

25. 25. The method of claim 24, wherein the CNS tissue is brain tissue, spinal cord tissue, and / or dorsal root ganglion tissue.

26. 26. The method of claim 25, wherein the brain tissue is cortical tissue, frontal cortical tissue, parietal cortical tissue, occipital cortical tissue, temporal cortical tissue, thalamic tissue, hypothalamic tissue, striatal tissue, putamen tissue, caudate nucleus tissue, hippocampal tissue, entorhinal cortical tissue, basal ganglia tissue, and / or deep cerebellar nuclei tissue.

27. 25. The method of claim 24, wherein the peripheral tissue is muscle tissue, liver tissue, heart tissue, gastrocnemius tissue, soleus tissue, pancreatic tissue, kidney tissue, spleen tissue, lung tissue, adrenal tissue, stomach tissue, sciatic nerve tissue, saphenous nerve tissue, thyroid tissue, eye tissue, pituitary tissue, skeletal muscle tissue, colon tissue, duodenal tissue, ileal tissue, jejunal tissue, leg skin tissue, superior cervical ganglion tissue, bladder tissue, ovarian tissue, uterine tissue, prostate tissue, and / or testicular tissue.

28. The vectors of the AAV vector library are, in order: (i) a first inverted terminal repeat (ITR); (ii) the cell type-specific promoter; (iii) the P40 promoter; (iv) a transgene encoding the variant AAV capsid polypeptide comprising a region of a randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids; (v) a polyadenylation (polyA) sequence region, and (vi) Second ITR The method according to any one of claims 1 to 27, comprising:

29. An adeno-associated virus (AAV) vector library, wherein each vector in the library comprises: (a) a p40 promoter and a cell type or tissue specific promoter that drives capsid mRNA expression in the absence of helper virus coinfection; (b) An AAV vector library encoding capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids.

30. 1. A method for producing a plurality of variant adeno-associated virus (AAV) capsid polypeptides, comprising: (a) providing a plurality of AAV particles comprising an AAV vector library, the AAV vector library comprising a nucleic acid comprising a P40 promoter and a cell type specific promoter, the nucleic acid encoding a plurality of capsid polypeptides having a region of randomized sequence of 2, 3, 4, 5, 6, 7, 8, or 9 consecutive amino acids; (b) administering the AAV particles intravenously to a mouse or a non-human primate (NHP); (c) recovering RNA encoding said variant AAV capsid polypeptide and / or antisense RNA from the target cell or tissue; (d) determining the sequence of the variant AAV capsid polypeptide; and (e) determining the amount of DNA encoding said variant AAV capsid polypeptide, or the amount of RNA encoding said variant AAV capsid polypeptide, in a target cell or tissue; Including, The method is carried out in the absence of a helper virus, thereby producing said plurality of variant AAV capsid polypeptides.

31. 31. The method of claim 30, wherein the cell type specific promoter is a synapsin promoter or a GFAP promoter.

32. The method of claim 1, wherein the P40 promoter is located upstream of an introduced gene encoding the variant AAV capsid polypeptide, and the cell type-specific promoter is located downstream of the introduced gene encoding the variant AAV capsid polypeptide.

Images