Bridged nucleosides and nucleotides using the same

Abstract

Disclosed is a bridged nucleoside and a nucleotide using the same. The nucleoside according to the present invention is represented by formula (I). The bridged nucleoside of the present invention is usable as a substitute for a phosphorothioate-modified nucleic acid with concerns of accumulation in a specific organ. Also, this bridged nucleoside has high industrial productivity.

Description

Technical Field

[0001] The present invention relates to crosslinked nucleosides and nucleotides using the same. More specifically, the present invention relates to crosslinked nucleosides having good nuclease resistance and capable of being efficiently produced, and nucleotides using the same.

Background Art

[0002] Artificial nucleic acids having excellent binding affinity for DNA and RNA can be applied to gene diagnosis and nucleic acid pharmaceuticals, and various types of artificial nucleic acids have been developed so far. Among them, 2′,4′-BNA (2′,4′-bridged nucleic acid; also known as LNA) in which the conformation of the nucleic acid sugar moiety is immobilized in the N-type conformation by crosslinking has excellent binding affinity for single-stranded RNA (ssRNA) and is expected as a nucleic acid pharmaceutical applicable to various applications such as the antisense method (Non-Patent Documents 1 and 2). However, 2′,4′-BNA has poor enzyme resistance and has a problem of easily inducing hepatotoxicity (Non-Patent Document 3).

[0003] On the other hand, it has been reported that artificial nucleic acids in which substituents such as a methyl group and a methoxymethyl group are introduced at the 6′-position of 2′,4′-BNA have improved binding affinity for ssRNA and excellent enzyme resistance (Non-Patent Document 4). However, when these substituents are introduced at the 6′-position, isomers may be generated, and complicated separation operations are required.

[0004] On the other hand, artificial nucleic acids (scpBNA) in which a cyclopropyl group is introduced at the 6′-position can be synthesized by a synthetic route that does not require separation of isomers, and have been reported to have high enzyme resistance while maintaining high binding affinity for ssRNA (Patent Document 1 and Non-Patent Document 5). However, it is difficult to say that the yields of various products obtained in the synthesis route of scpBNA are sufficiently satisfactory. Development of artificial nucleic acids that can be synthesized in higher yields to meet industrial applications is desired.

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Non-Patent Document

[0006]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Summary of the Invention

Problems to be Solved by the Invention

[0007] The present invention solves the above problems, and an object thereof is to provide a cross-linked nucleoside in which a substituent is introduced at the 6'-position, which can be produced in a higher yield without complicated operations such as isomer separation, and a nucleotide using the same.

Means for Solving the Problems

[0008] The present invention relates to a compound represented by the following formula (I) or a salt thereof:

[0009]

Chemical Formula

[0010] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, where the group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom, R 2 and R 3 are each independently a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from group α, a silyl group which may have one or more arbitrary substituents selected from group α, a phosphate group which may have one or more arbitrary substituents selected from group α, a phosphate group protected with a protecting group for nucleic acid synthesis, -P(R 4a )R 5a [wherein R 4a and R 5a each independently represent a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms]), X 1 is a linear alkyl group having 1 to 3 carbon atoms or -NHR 4b [where R 4bis a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms, or -OR 5b [wherein R 5b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms] and may be substituted with an alkylene group having 2 to 8 carbon atoms; or a straight-chain alkyl group having 1 to 3 carbon atoms, or -NHR 4b [wherein R 4b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms] or -OR 5b [wherein R 5b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms] and may be substituted with an alkenylene group having 2 to 8 carbon atoms; and X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group).

[0011] In one embodiment, the above formula (I) is the following formula:

[0012]

Chemical formula

[0013] (wherein Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from the α group, where the α group consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a straight-chain alkyl group having 1 to 6 carbon atoms, a straight-chain alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a straight-chain alkylthio group having 1 to 6 carbon atoms, an amino group, a straight-chain alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, R 2 and R 3is, independently of each other, a hydrogen atom, a protecting group for the hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from the α group and may contain a hetero atom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from the α group and may contain a hetero atom, an acyl group which may have one or more arbitrary substituents selected from the α group, a silyl group which may have one or more arbitrary substituents selected from the α group, a phosphate group which may have one or more arbitrary substituents selected from the α group, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4a )R 5a [wherein, R 4a and R 5a each independently represent a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms]), X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group, and R 6 , R 7 , R 8 , R 9 , R 10 and R 11 each independently represent a hydrogen atom, a straight-chain alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms]), and is represented by).

[0014] In one embodiment, the above formula (I) is the following formula:

[0015] [Chemical]

[0016] (wherein, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, wherein the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, R 2 and R 3 are each independently a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from group α, a silyl group which may have one or more arbitrary substituents selected from group α, a phosphate group which may have one or more arbitrary substituents selected from group α, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4a )R 5a [wherein, R 4a and R 5a are each independently a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms] represents, X 2is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )-, or a methylene group, and R 6 and R 7 are each independently a hydrogen atom, a straight-chain alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a straight-chain alkyl group having 1 to 3 carbon atoms]), and is represented by).

[0017] In one embodiment, in the above formula (I), the above Base is a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0018] In one embodiment, in the above formula (I), the above Base is the following formula:

[0019]

Chemical formula

[0020] is a group represented by.

[0021] The present invention also relates to an oligonucleotide containing at least one nucleoside structure represented by the following formula (II) or a pharmaceutically acceptable salt thereof:

[0022]

Chemical formula

[0023] (wherein, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, where the group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom, X 1 is a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], and is an alkylene group having 2 to 8 carbon atoms which may be substituted; or a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], and is an alkenylene group having 2 to 8 carbon atoms which may be substituted; and X 2is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 ), or a methylene group).

[0024] In one embodiment, the above formula (II) is the following formula:

[0025]

Chemical formula

[0026] (wherein Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from the α group, where the α group consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 ), or a methylene group, and R 6 , R 7 , R 8 , R 9 , R 10 and R 11 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4 [wherein R 4 is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5 [wherein R 5 is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]).

[0027] In one embodiment, the above formula (II) is the following formula:

[0028]

Chemical formula

[0029] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, wherein the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group, and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]), and is represented by).

[0030] The present invention also provides a method for producing the above oligonucleotide or a pharmaceutically acceptable salt thereof, a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof:

[0031] [Chemical formula]

[0032] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from group α, where the group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom, R 2 and R 3 are each independently a hydrogen atom, a protecting group for the hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from the group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from the group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from the group α, a silyl group which may have one or more arbitrary substituents selected from the group α, a phosphate group which may have one or more arbitrary substituents selected from the group α, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4a )R 5a [wherein R 4a and R 5a are each independently a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms], X 1 is a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [where R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [where R 5bAn alkylene group having 2 to 8 carbon atoms, which may be substituted with a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms; alternatively, a linear alkyl group having 1 to 3 carbon atoms or -NHR 4b [wherein R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] or -OR 5b [wherein R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] or an alkenylene group having 2 to 8 carbon atoms which may be substituted; and X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group) A method comprising a step of synthesizing an oligonucleotide using [Advantages of the Invention]

[0033] According to the present invention, there are provided a novel cross-linked nucleoside modified at the 6'-position, which has a high binding affinity for ssRNA and high enzyme resistance, and a nucleotide using the same. Since the cross-linked nucleoside of the present invention does not require an isomer separation step in its production, it is also excellent in industrial productivity. [Brief Description of the Drawings]

[0034]

Figure 1

Figure 2

Figure 3

[0035] First, define the terms used in this specification.

[0036] In this specification, the term "linear alkyl group having 1 to 6 carbon atoms" refers to any linear alkyl group having 1 to 6 carbon atoms, specifically, a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, or an n-hexyl group. Further, the term "linear alkyl group having 1 to 3 carbon atoms" refers to any linear alkyl group having 1 to 3 carbon atoms, specifically, a methyl group, an ethyl group, or an n-propyl group. On the other hand, when referring to the term "alkyl group having 1 to 6 carbon atoms", it refers to any linear, branched, or cyclic alkyl group having 1 to 6 carbon atoms.

[0037] In this specification, the term "linear alkoxy group having 1 to 6 carbon atoms" includes an alkoxy group having any linear alkyl group having 1 to 6 carbon atoms. For example, a methoxy group, an ethoxy group, an n-propoxy group, etc. can be mentioned. On the other hand, when referring to the term "alkoxy group having 1 to 6 carbon atoms", it refers to any linear, branched, or cyclic alkoxy group having 1 to 6 carbon atoms. Further, when referring to the term "linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms", it refers to the above "linear alkoxy group having 1 to 6 carbon atoms", and an alkoxy group in which one or more hydrogen atoms constituting the "linear alkoxy group having 1 to 6 carbon atoms" are substituted with the same or different other "linear alkoxy groups having 1 to 6 carbon atoms". Examples of such "linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms" include a methoxy group, an ethoxy group, an n-propoxy group, a methoxymethoxy group, an ethoxymethoxy group, an n-propoxymethoxy group, a methoxyethoxy group (e.g., 2-methoxyethoxy group), an ethoxyethoxy group (e.g., 2-ethoxyethoxy group), and an n-propoxyethoxy group.

[0038] In this specification, the term "cyanoalkoxy group having 1 to 6 carbon atoms" refers to a group in which at least one hydrogen atom in any linear, branched, or cyclic alkoxy group having 1 to 6 carbon atoms is substituted with a cyano group.

[0039] As used herein, the term "linear alkylthio group having 1 to 6 carbon atoms" includes an alkylthio group having any linear alkyl group having 1 to 6 carbon atoms. For example, a methylthio group, an ethylthio group, an n-propylthio group, etc. may be mentioned. On the other hand, when the term "alkylthio group having 1 to 6 carbon atoms" is used, it means any linear, branched or cyclic alkylthio group having 1 to 6 carbon atoms.

[0040] As used herein, the term "linear alkylamino group having 1 to 6 carbon atoms" includes an alkylamino group having one or two alkylamino groups having any linear alkyl group having 1 to 6 carbon atoms. For example, a methylamino group, a dimethylamino group, an ethylamino group, a methylethylamino group, a diethylamino group, etc. may be mentioned.

[0041] As used herein, the term "alkyl group having 1 to 7 carbon atoms which may form a branch or a ring" includes any linear alkyl group having 1 to 7 carbon atoms, any branched alkyl group having 3 to 7 carbon atoms, and any cyclic alkyl group having 3 to 7 carbon atoms. Sometimes it is simply referred to as "lower alkyl group". For example, as any linear alkyl group having 1 to 7 carbon atoms, a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, and an n-heptyl group may be mentioned. As any branched alkyl group having 3 to 7 carbon atoms, an isopropyl group, an isobutyl group, a tert-butyl group, an isopentyl group, etc. may be mentioned. And as any cyclic alkyl group having 3 to 7 carbon atoms, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, etc. may be mentioned.

[0042] As used herein, the term "C2-7 alkenyl group which may form a branch or a ring" includes any linear C2-7 alkenyl group, any branched C3-7 alkenyl group, and any cyclic C3-7 alkenyl group. Sometimes it is simply referred to as "lower alkenyl group". For example, any linear C2-7 alkenyl group includes ethenyl group, 1-propenyl group, 2-propenyl group, 1-butenyl group, 2-butenyl group, 1-pentenyl group, 2-pentenyl group, 3-pentenyl group, 4-pentenyl group, 1-hexenyl group, etc.; any branched C3-7 alkenyl group includes isopropenyl group, 1-methyl-1-propenyl group, 1-methyl-2-propenyl group, 2-methyl-1-propenyl group, 2-methyl-2-propenyl group, 1-methyl-2-butenyl group, etc.; and any cyclic C3-7 alkenyl group includes cyclobutenyl group, cyclopentenyl group, cyclohexenyl group, etc.

[0043] As used herein, the term "aryl group having 3 to 10 carbon atoms which may contain a heteroatom" includes any aryl group having 6 to 10 carbon atoms composed only of hydrocarbons and any heteroaryl group having 3 to 12 carbon atoms in which at least one carbon atom constituting the ring structure of the aryl group is substituted with a heteroatom (for example, a nitrogen atom, an oxygen atom, and a sulfur atom, and combinations thereof). Examples of the aryl group having 6 to 10 carbon atoms include phenyl group, naphthyl group, indenyl group, azulene group, etc.; and examples of the heteroaryl group having 3 to 12 carbon atoms include pyridyl group, pyrrolyl group, quinolyl group, indolyl group, imidazolyl group, furyl group, thienyl group, etc.

[0044] In this specification, examples of the term "aralkyl group having an aryl moiety with 3 to 12 carbon atoms which may contain a heteroatom" include benzyl group, phenethyl group, naphthylmethyl group, 3-phenylpropyl group, 2-phenylpropyl group, 4-phenylbutyl group, 2-phenylbutyl group, pyridylmethyl group, indolylmethyl group, furylmethyl group, thienylmethyl group, pyrrolylmethyl group, 2-pyridylethyl group, 1-pyridylethyl group, 3-thienylpropyl group, and the like.

[0045] In this specification, examples of the term "acyl group" include aliphatic acyl groups and aromatic acyl groups. Specifically, examples of aliphatic acyl groups include alkylcarbonyl groups such as formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, pentanoyl group, pivaloyl group, valeryl group, isovaleryl group, octanoyl group, nonanoyl group, decanoyl group, 3-methylnonanoyl group, 8-methylnonanoyl group, 3-ethyloctanoyl group, 3,7-dimethyloctanoyl group, undecanoyl group, dodecanoyl group, tridecanoyl group, tetradecanoyl group, pentadecanoyl group, hexadecanoyl group, 1-methylpentadecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group, heptadecanoyl group, 15-methylhexadecanoyl group, octadecanoyl group, 1-methylheptadecanoyl group, nonadecanoyl group, icosanoyl group, and henicosanoyl group; carboxylated alkylcarbonyl groups such as succinoyl group, glutaryl group, and adipoyl group; halogeno lower alkylcarbonyl groups such as chloroacetyl group, dichloroacetyl group, trichloroacetyl group, and trifluoroacetyl group; lower alkoxy lower alkylcarbonyl groups such as methoxyacetyl group; and unsaturated alkylcarbonyl groups such as (E)-2-methyl-2-butenoyl group. Examples of aromatic acyl groups include arylcarbonyl groups such as benzoyl group, α-naphthoyl group, and β-naphthoyl group; halogenoarylcarbonyl groups such as 2-bromobenzoyl group and 4-chlorobenzoyl group; lower alkylated arylcarbonyl groups such as 2,4,6-trimethylbenzoyl group and 4-toluoyl group; lower alkoxylated arylcarbonyl groups such as 4-anisoyl group; carboxylated arylcarbonyl groups such as 2-carboxybenzoyl group, 3-carboxybenzoyl group, and 4-carboxybenzoyl group; nitrated arylcarbonyl groups such as 4-nitrobenzoyl group and 2-nitrobenzoyl group; lower alkoxycarbonylated arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl group; and arylated arylcarbonyl groups such as 4-phenylbenzoyl group, etc.Preferably, they are formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, pentanoyl group, pivaloyl group, benzoyl group.

[0046] As used herein, the term "alkylene group having 2 to 8 carbon atoms" refers to a divalent group having 2 to 8 carbon atoms composed of repetition of methylene group (-CH 2 -). Specific examples include -CH 2 CH 2 -, -CH 2 CH 2 CH 2 CH 2 -, and -CH 2 CH 2 CH 2 CH 2 CH 2 CH 2 -. Further, the term "alkylene group having 2 to 8 carbon atoms which may be substituted with a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]]" refers to an unsubstituted alkylene group having 2 to 8 carbon atoms as described above, that is, at least one hydrogen atom in the divalent group having 2 to 8 carbon atoms composed of only repetition of methylene group is substituted with a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b , or -OR 5b .

[0047] As used herein, the term "alkenylene group having 2 to 8 carbon atoms" includes -CH=CH-; and a divalent group having 2 to 8 carbon atoms composed of a combination of at least one methylene group and one carbon-carbon double bond (-CH=CH-). Specific examples include -CH=CH 2 ]-, -CH 2 CH=CHCH 2 -, and -CH 2 CH 2 CH=CHCH 2 CH2 - can be mentioned. Further, the term "a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [where R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] or -OR 5b [where R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] or may be substituted with, an alkenylene group having 2 to 8 carbon atoms" means that at least one hydrogen atom in the unsubstituted alkenylene group having 2 to 8 carbon atoms is a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b , or -OR 5b refers to a group substituted with.

[0048] In the present specification, examples of the term "silyl group" include tri-lower alkylsilyl groups such as trimethylsilyl group, triethylsilyl group, isopropyldimethylsilyl group, t-butyldimethylsilyl group, methyldiisopropylsilyl group, methyldi-t-butylsilyl group, triisopropylsilyl group; tri-lower alkylsilyl groups substituted with 1 to 2 aryl groups such as diphenylmethylsilyl group, butyldiphenylbutylsilyl group, diphenylisopropylsilyl group, phenyldiisopropylsilyl group, and the like. Preferably, it is a trimethylsilyl group, triethylsilyl group, triisopropylsilyl group, t-butyldimethylsilyl group, t-butyldiphenylsilyl group, and more preferably a trimethylsilyl group.

[0049] In the present specification, examples of the term "halogen atom" include, for example, a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom. Preferably, it is a fluorine atom or a chlorine atom.

[0050] In this specification, the "protecting group" in the terms "protecting group for amino group in nucleic acid synthesis", "protecting group for hydroxyl group in nucleic acid synthesis", "hydroxyl group protected by a protecting group in nucleic acid synthesis", "phosphate group protected by a protecting group in nucleic acid synthesis", and "mercapto group protected by a protecting group in nucleic acid synthesis" is not particularly limited as long as it can stably protect an amino group, a hydroxyl group, a phosphate group, or a mercapto group during nucleic acid synthesis. Specifically, it refers to a protecting group that is stable under acidic or neutral conditions and can be cleaved by chemical methods such as hydrogenolysis, hydrolysis, electrolysis, and photolysis. Examples of such protecting groups include, for example, a lower alkyl group, a lower alkenyl group, an acyl group, a tetrahydropyranyl or tetrahydrothiopyranyl group, a tetrahydrofuranyl or tetrahydrothiofuranyl group, a silyl group, a lower alkoxymethyl group, a lower alkoxylated lower alkoxymethyl group, a halogeno lower alkoxymethyl group, a lower alkoxylated ethyl group, a halogenated ethyl group, a methyl group substituted with 1 to 3 aryl groups, "a methyl group substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom, or a cyano group", a lower alkoxycarbonyl group, "an aryl group substituted with a halogen atom, a lower alkoxy group, or a nitro group", "a lower alkoxycarbonyl group substituted with a halogen atom or a tri-lower alkylsilyl group", an alkenyloxycarbonyl group, "an aralkyl oxycarbonyl group in which the aryl ring may be substituted with a lower alkoxy or nitro group", and the like.

[0051] More specifically, examples of the tetrahydropyranyl group or tetrahydrothiopyranyl group include a tetrahydropyran-2-yl group, 3-bromotetrahydropyran-2-yl group, 4-methoxytetrahydropyran-4-yl group, tetrahydrothiopyran-4-yl group, 4-methoxytetrahydrothiopyran-4-yl group, and the like. Examples of the tetrahydrofuranyl group or tetrahydrothiofuranyl group include a tetrahydrofuran-2-yl group and tetrahydrothiofuran-2-yl group. Examples of the lower alkoxymethyl group include a methoxymethyl group, 1,1-dimethyl-1-methoxymethyl group, ethoxymethyl group, propoxymethyl group, isopropoxymethyl group, butoxymethyl group, t-butoxymethyl group, and the like. Examples of the lower alkoxylated lower alkoxymethyl group include a 2-methoxyethoxymethyl group and the like. Examples of the halogeno lower alkoxymethyl group include a 2,2,2-trichloroethoxymethyl group, bis(2-chloroethoxy)methyl group, and the like. Examples of the lower alkoxylated ethyl group include a 1-ethoxyethyl group, 1-(isopropoxy)ethyl group, and the like. Examples of the halogenated ethyl group include a 2,2,2-trichloroethyl group and the like. Examples of the methyl group substituted with 1 to 3 aryl groups include a benzyl group, α-naphthylmethyl group, β-naphthylmethyl group, diphenylmethyl group, triphenylmethyl group, α-naphthyldiphenylmethyl group, 9-anthrylmethyl group, and the like. Examples of the "methyl group substituted with 1 to 3 aryl groups substituted with a lower alkyl group, lower alkoxy group, halogen atom or cyano group on the aryl ring" include a 4-methylbenzyl group, 2,4,6-trimethylbenzyl group, 3,4,5-trimethylbenzyl group, 4-methoxybenzyl group, 4-methoxyphenyldiphenylmethyl group, 4,4'-dimethoxytriphenylmethyl group, 2-nitrobenzyl group, 4-nitrobenzyl group, 4-chlorobenzyl group, 4-bromobenzyl group, 4-cyanobenzyl group, and the like. Examples of the lower alkoxycarbonyl group include a methoxycarbonyl group, ethoxycarbonyl group, t-butoxycarbonyl group, isobutoxycarbonyl group, and the like.Examples of the "aryl group substituted with a halogen atom, lower alkoxy group or nitro group" include a 4-chlorophenyl group, 2-fluorophenyl group, 4-methoxyphenyl group, 4-nitrophenyl group, 2,4-dinitrophenyl group, etc. Examples of the "lower alkoxycarbonyl group substituted with a halogen atom or tri-lower alkylsilyl group" include a 2,2,2-trichloroethoxycarbonyl group, 2-trimethylsilylethoxycarbonyl group, etc. Examples of the alkenyloxycarbonyl group include a vinyloxycarbonyl group, aryloxycarbonyl group, etc. Examples of the "aralkyloxycarbonyl group in which the aryl ring may be substituted with a lower alkoxy or nitro group" include a benzyloxycarbonyl group, 4-methoxybenzyloxycarbonyl group, 3,4-dimethoxybenzyloxycarbonyl group, 2-nitrobenzyloxycarbonyl group, 4-nitrobenzyloxycarbonyl group, etc.

[0052] In one embodiment, examples of the "protecting group for the hydroxyl group in nucleic acid synthesis" include, for example, an aliphatic acyl group, aromatic acyl group, methyl group substituted with 1 to 3 aryl groups, "methyl group substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl, lower alkoxy, halogen, cyano group", and a silyl group. Alternatively, in one embodiment, examples of the "protecting group for the hydroxyl group in nucleic acid synthesis" include, for example, an acetyl group, benzoyl group, benzyl group, p-methoxybenzoyl group, dimethoxytrityl group, monomethoxytrityl group, tert-butyldiphenylsilyl group, tert-butyldimethylsilyl (TBDMS) group, [(triisopropylsilyl)oxy]methyl (TOM) group, [(2-nitrobenzyl)oxy]methyl (NBOM) group, bis(acetoxyethoxy)methyl ether (ACE) group, tetrahydro-4-methoxy-2H-pyran-2-yl (Mthp) group, 1-(2-cyanoethoxy)ethyl (CEE) group, 2-cyanoethoxymethyl (CEM) group, tert-butyldithiomethyl (DTM) group, 2-(4-toluenesulfonyl)ethoxymethyl (TEM) group, and 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl (4-MABOM) group.

[0053] In one embodiment, examples of the protecting group for the "hydroxyl group protected by a protecting group for nucleic acid synthesis" include an aliphatic acyl group, an aromatic acyl group, a "methyl group substituted with 1 to 3 aryl groups", an "aryl group substituted with a halogen atom, a lower alkoxy group or a nitro group", a lower alkyl group, and a lower alkenyl group. Alternatively, in one embodiment, examples of the protecting group for the "hydroxyl group protected by a protecting group for nucleic acid synthesis" include a benzoyl group, a benzyl group, a 2-chlorophenyl group, a 4-chlorophenyl group, and a 2-propenyl group.

[0054] In one embodiment, examples of the protecting group for the "amino group in nucleic acid synthesis" include an acyl group, preferably a benzoyl group.

[0055] In one embodiment, examples of the "protecting group" for the "phosphate group protected by a protecting group for nucleic acid synthesis" include a lower alkyl group, a lower alkyl group substituted with a cyano group, an aralkyl group, an "aralkyl group in which the aryl ring is substituted with a nitro group or a halogen atom", and an "aryl group substituted with a lower alkyl group, a halogen atom, or a nitro group". Alternatively, in one embodiment, examples of the "protecting group" for the "phosphate group protected by a protecting group for nucleic acid synthesis" include a 2-cyanoethyl group, a 2,2,2-trichloroethyl group, a benzyl group, a 2-chlorophenyl group, and a 4-chlorophenyl group.

[0056] In one embodiment, examples of the "protecting group" for the "mercapto group protected by a protecting group for nucleic acid synthesis" include an aliphatic acyl group and an aromatic acyl group, preferably a benzoyl group.

[0057] As used herein, -P(R 4a )R 5a [wherein, R 4a and R 5arepresents, independently of each other, a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms, among the groups represented by R 4a is OR 4c and R 5a is NR 5c The group which is is called a "phosphoramidite group" (where R 4c is, for example, a cyanoalkoxy group having 1 to 6 carbon atoms, and R 5c is, for example, an alkyl group having 1 to 6 carbon atoms). As the phosphoramidite group, preferably, a group represented by the formula -P(OC 2 H 4 CN)(N(iPr) 2 ), or a group represented by the formula -P(OCH 3 )(N(iPr) 2 ) is mentioned. Here, iPr represents an isopropyl group.

[0058] In this specification, the terms "nucleoside" and "nucleoside analog" refer to non-natural types among "nucleosides" in which a purine or pyrimidine base and a sugar are bonded, and those in which a sugar is bonded to an aromatic heterocyclic ring and an aromatic hydrocarbon ring other than purine and pyrimidine that can substitute for a purine or pyrimidine base.

[0059] In this specification, the terms "artificial oligonucleotide" and "oligonucleotide analog" refer to non-natural derivatives of "oligonucleotides" in which the same or different "nucleosides" or "nucleoside analogs" are bonded by phosphodiester bonds, for example, 2 to 50. Such analogs preferably include sugar derivatives in which the sugar moiety is modified; thioate derivatives in which the phosphodiester moiety is thioated; ester forms in which the terminal phosphate moiety is esterified; and amide forms in which the amino group on the purine base is amidated.

[0060] As used herein, the term "its salt" refers to a salt of a compound represented by formula (I) or (II) of the present invention. Such salts include, for example, alkali metal salts such as sodium salt, potassium salt, lithium salt; alkaline earth metal salts such as calcium salt, magnesium salt; metal salts such as aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt; inorganic salts such as ammonium salt; amine salts such as t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetramethylammonium salt, tris(hydroxymethyl)aminomethane salt; halogen atom hydrogen acid salts such as hydrofluoride salt, hydrochloride salt, hydrobromide salt, hydroiodide salt; inorganic acid salts such as nitrate salt, perchlorate salt, sulfate salt, phosphate salt; lower alkane sulfonate salts such as methanesulfonate salt, trifluoromethanesulfonate salt, ethanesulfonate salt; aryl sulfonate salts such as benzenesulfonate salt, p-toluenesulfonate salt; organic acid salts such as acetate salt, malate salt, fumarate salt, succinate salt, citrate salt, tartrate salt, oxalate salt, maleate salt; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate salt, aspartate salt.

[0061] As used herein, the term "its pharmacologically acceptable salt" refers to a salt of an oligonucleotide analog containing at least one nucleoside structure represented by the formula (II) of the present invention. Such salts include, for example, alkali metal salts such as sodium salt, potassium salt, lithium salt; alkaline earth metal salts such as calcium salt, magnesium salt; metal salts such as aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt; inorganic salts such as ammonium salt; amine salts such as t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetramethylammonium salt, tris(hydroxymethyl)aminomethane salt; halogen atom hydrogen acid salts such as hydrofluoride salt, hydrochloride salt, hydrobromide salt, hydroiodide salt; inorganic acid salts such as nitrate salt, perchlorate salt, sulfate salt, phosphate salt; lower alkane sulfonate salts such as methanesulfonate salt, trifluoromethanesulfonate salt, ethanesulfonate salt; aryl sulfonate salts such as benzenesulfonate salt, p-toluenesulfonate salt; organic acid salts such as acetate salt, malate salt, fumarate salt, succinate salt, citrate salt, tartrate salt, oxalate salt, maleate salt; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate salt, aspartate salt.

[0062] Hereinafter, the present invention will be described in detail.

[0063] (Crosslinked nucleoside) The crosslinked nucleoside of the present invention has the following formula (I):

[0064] [Chemical formula]

[0065] (In the formula, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from Group α, where Group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom. R 2 and R 3 are each independently a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branch or a ring, an alkenyl group having 2 to 7 carbon atoms which may form a branch or a ring, an aryl group having 3 to 10 carbon atoms which may have one or more arbitrary substituents selected from Group α and may contain a heteroatom, an aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may have one or more arbitrary substituents selected from Group α and may contain a heteroatom, an acyl group which may have one or more arbitrary substituents selected from Group α, a silyl group which may have one or more arbitrary substituents selected from Group α, a phosphate group which may have one or more arbitrary substituents selected from Group α, a phosphate group protected by a protecting group for nucleic acid synthesis, -P(R 4a )R 5a [wherein R 4a and R 5a are each independently a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms]. X 1 is a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [where R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [where R 5ban alkylene group having 2 to 8 carbon atoms which may be substituted with a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms; or a linear alkyl group having 1 to 3 carbon atoms or -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] or an alkenylene group having 2 to 8 carbon atoms which may be substituted; and X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group).

[0066] In the above formula (I), "Base" is, for example, a purine base (i.e., a purin-9-yl group) or a pyrimidine base (i.e., a 2-oxo-1,2-dihydropyrimidin-1-yl group). These bases may have one or more optional substituents selected from the group consisting of a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom.

[0067] Specific examples of the above-mentioned "Base" include an adeninyl group, a guanynyl group, a cytosinyl group, a uracilyl group, and a thyminyl group, as well as a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, a 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, and a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0068] Alternatively, from the perspective of introduction into nucleic acid pharmaceuticals, "Base" has the following structural formula:

[0069]

Chemical formula

[0070] groups each represented thereby, and a 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl group, a 6-aminopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group, and a 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group are preferable. "Base" is also preferably one in which the hydroxyl group and amino group constituting the above group are protected by a protecting group during the synthesis of the oligonucleotide.

[0071] Here, in one embodiment, examples of the compound represented by formula (I) include the following formulas (I-1) to (I-6):

[0072] [Chemical formula]

[0073] (wherein, Base, R 2 , R 3 , and X 2 are the same as those defined in the above formula (I), and R 6 , R 7 , R 8 , R 9 , R 10 and R 11 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]), and compounds represented thereby can be mentioned. Here, for example, R 6 and R 7 in the above formulas (I-1) and (I-4) are both hydrogen atoms. Alternatively, for example, R 6 , R 7 , R8 and R 9 are all hydrogen atoms. Alternatively, for example, R in the above formulas (I-3) and (I-6) 6 , R 7 , R 8 , and R 9 , R 10 , and R 11 are all hydrogen atoms.

[0074] Alternatively, in one embodiment, as another example of the compound represented by formula (I), the following formula (I’):

[0075]

Chemical formula

[0076] (wherein, Base, R 2 , R 3 , and X 1 are the same as those defined in the above formula (I)) can be mentioned.

[0077] Alternatively, in one embodiment, as another example of the compound represented by formula (I), the following formulas (I-1) and (I-4):

[0078]

Chemical formula

[0079] (wherein, Base, R 2 , R 3 , and X 2 are the same as those defined in the above formula (I), and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5bExamples of the compound represented by [wherein R is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] include. Here, for example, R in the above formulas (I-1) and (I-4) 6 and R 7 are both hydrogen atoms.

[0080] Alternatively, in one embodiment, as yet another example of the compound represented by formula (I), the following formulas (I'-1) and (I'-4):

[0081] [Chemical formula]

[0082] (wherein Base, R 2 , and R 3 are the same as those defined in the above formula (I), and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]). Examples of the compound represented by this formula include. Here, for example, R 6 and R 7 in the above formulas (I'-1) and (I'-4) are both hydrogen atoms.

[0083] In the cross-linked nucleoside of the present invention, a cyclic substituent is introduced at the 6'-position of the formula (I) as described above. By having such a structure, the nucleoside of the present invention cannot have an isomeric structure at the 6'-position and is liberated from the necessity of separating isomers during its synthesis. Furthermore, the cross-linked nucleoside of the present invention can improve the nuclease resistance in oligonucleotides described later by the cyclic substituent introduced at the 6'-position of the formula (I). In addition, the ring strain of such a substituent directly affects the conformation of the sugar moiety. Therefore, the cross-linked nucleoside of the present invention can further improve the binding affinity with ssRNA for the oligonucleotide obtained using the nucleotide.

[0084] (Oligonucleotide) In the present invention, the oligonucleotide can be easily produced using such a cross-linked nucleoside of the formula (I) through, for example, the amidite method well-known in the art or through triphosphorylation as described in M. Kuwahara et al., Nucleic Acids Res., 2008, Vol. 36, No. 13, pp. 4257-4265.

[0085] The oligonucleotide of the present invention or a pharmaceutically acceptable salt thereof (hereinafter, these may be collectively referred to as "the oligonucleotide of the present invention") has the following formula (II):

[0086] [Chemical formula]

[0087] (wherein, Base represents a purin-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more arbitrary substituents selected from Group α, where Group α consists of a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom. X 1 is a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [where R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [where R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] and is optionally substituted with a linear alkyl group having 2 to 8 carbon atoms; or a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [where R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [where R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms] and is optionally substituted with a linear alkenylene group having 2 to 8 carbon atoms; and X 2 represents a nucleoside structure represented by an oxygen atom, a sulfur atom, -NH-, -N(CH 3 ))- or a methylene group) and contains at least one.

[0088] In one embodiment, examples of the nucleoside structure of formula (II) contained in the oligonucleotide of the present invention include the following formulas (II-1) to (II-6):

[0089]

Chemical formula

[0090] (In the formula, Base and X2 is the same as the group defined in the above formula (II), and R 6 , R 7 , R 8 , R 9 , R 10 and R 11 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]), and examples thereof include those represented by the following. Here, for example, R 6 and R 7 in the above formulas (II-1) and (II-4) are both hydrogen atoms. Alternatively, for example, R 6 , R 7 , R 8 , and R 9 in the above formulas (II-2) and (II-5) are all hydrogen atoms. Alternatively, for example, R 6 , R 7 , R 8 , and R 9 , R 10 , and R 11 in the above formulas (II-3) and (II-6) are all hydrogen atoms.

[0091] Alternatively, in one embodiment, as another example of the nucleoside structure of formula (II) contained in the oligonucleotide of the present invention, the following formula (II’):

[0092]

Chemical formula

[0093] (wherein, Base and X 1 are the same as the groups defined in the above formula (II)) and examples thereof include those represented by the following.

[0094] Alternatively, in one embodiment, as another example of the nucleoside structure of formula (II) contained in the oligonucleotide of the present invention, the following formulas (II-1) and (II-4):

[0095]

Chemical formula

[0096] (In the formula, Base and X 2 are the same as the groups defined in the above formula (II), and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms]), and the like. Here, for example, R 6 and R 7 in the above formulas (II-1) and (II-4) are both hydrogen atoms.

[0097] Alternatively, in one embodiment, as still another example of the nucleoside structure of formula (II) contained in the oligonucleotide of the present invention, the following formulas (II'-1) and (II'-4):

[0098]

Chemical formula

[0099] (In the formula, Base is the same as the group defined in the above formula (II), and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b [wherein, R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms], or -OR 5b [wherein, R5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms. Examples include those represented by the following formula. Here, for example, in the above formulas (II'-1) and (II'-4), R 6 and R 7 are both hydrogen atoms.

[0100] The oligonucleotide of the present invention has at least one of the above nucleoside structures at an arbitrary position. The position and number thereof are not particularly limited and can be appropriately designed according to the purpose.

[0101] An oligonucleotide (antisense molecule) containing such a nucleoside structure has a dramatically improved nuclease resistance as compared with the case of using conventional 2',4'-BNA / LNA. It also has an ssRNA binding affinity comparable to that of known 2',4'-BNA / LNA.

[0102] From these facts, the oligonucleotide of the present invention synthesized using the crosslinked nucleoside of the present invention is expected to be useful as a pharmaceutical (antisense molecule) for treating diseases by inhibiting the function of a specific gene, including antitumor agents and antiviral agents.

[0103] In particular, in the antisense method, both binding affinity for complementary sense strand RNA and resistance to in vivo DNA degrading enzymes are required. Generally, in the single-stranded state, the structure of the sugar moiety of a nucleic acid has a "fluctuation" between a form close to the DNA double strand and a form close to the DNA-RNA double strand or RNA double strand. By fixing this "fluctuation" in advance to the conformation during double-strand formation, the binding affinity for the target ssRNA can be improved. In addition, although a nucleic acid degrading enzyme cleaves the phosphodiester moiety of an oligonucleic acid, the degradation of the oligonucleic acid can be suppressed through steric hindrance by introducing a bulky substituent into the sugar moiety or the like.

[0104] The crosslinked nucleoside of the present invention has a bulky cyclic substituent at the 6'-position as described above. Therefore, the oligonucleotide obtained using this can improve the binding affinity for the above ssRNA and can have excellent enzyme resistance performance.

[0105] The oligonucleotide of the present invention can be formulated into a parenteral preparation or a liposome preparation by blending adjuvants commonly used in the pharmaceutical formulation technology field such as excipients, binders, preservatives, oxidation stabilizers, disintegrants, lubricants, and flavoring agents. Further, for example, pharmaceutical carriers commonly used in the art can be blended to prepare topical preparations such as solutions, creams, and ointments.

Example

[0106] Hereinafter, the present invention will be described more specifically by way of examples, but the present invention is not limited by these examples.

[0107] (Example 1: Synthesis of crosslinked nucleoside (1))

[0108]

Chemical formula

[0109] (1-1) Synthesis of compound 5

[0110]

Chemical formula

[0111] Under an argon atmosphere, to a solution of compound 4 (3.69 g, 8.61 mmol), which was prepared from compound 1 through three steps of i) to iii) according to the method described by Yamaguchi, T. et al. in Chem. Commun., 2015, volume 51, pages 9737 - 9740, and anhydrous cerium(III) chloride (7.99 g, 32.4 mmol) in anhydrous tetrahydrofuran (60 mL), allylmagnesium bromide (33 mL, 33.0 mmol) was added at room temperature, and the mixture was stirred for 14 hours. After the reaction was completed, an aqueous ammonium chloride solution was added, and the organic layer was concentrated. Then, it was filtered through celite, and the filtrate was extracted with ethyl acetate. The obtained residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 32:1 to 6:1) to obtain compound 5 (4.06 g, 98%) as a colorless and transparent oily substance.

[0112] The physical property data of the obtained compound 5 are shown in Table 1.

[0113]

Table 1

[0114] (1 - 2) Synthesis of compound 6

[0115]

Chem.

[0116] Under an argon atmosphere, to a solution of the above - obtained compound 5 (1.60 g, 3.54 mmol) in anhydrous dichloromethane (110 mL), the second - generation Grubbs catalyst (425 mg, 0.501 mmol) was added at room temperature, and the mixture was heated to reflux for 4 hours. After the reaction was completed, it was concentrated, and the obtained residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 32:1 to 10:1) to obtain compound 6 (1.35 g, 90%) as a pale - yellow viscous oily substance.

[0117] The physical property data of the obtained compound 6 are shown in Table 2.

[0118]

Table 2

[0119] (1-3) Synthesis of Compound 7

[0120]

Chem.

[0121] Under an argon atmosphere, 2,6-lutidine (2.20 mL, 19.0 mmol) and tert-butyldimethylsilyl trifluoromethanesulfonate (3.00 mL, 13.1 mmol) were added to a solution of the above-obtained compound 6 (1.21 g, 2.67 mmol) in anhydrous dichloromethane (31 mL) at 0 °C, and the mixture was stirred at room temperature for 20 hours. After the reaction was completed, saturated aqueous sodium hydrogen carbonate solution was added, and the organic layer was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 10:0 to 9:1) to obtain compound 7 (1.43 g, 94%) as a colorless transparent viscous oily substance.

[0122] The physical property data of the obtained compound 7 are shown in Table 3.

[0123]

Table 3

[0124] (1-4) Synthesis of Compound 8

[0125]

Chem.

[0126] Under an argon atmosphere, acetic anhydride (3.05 mL, 32.3 mmol) and trifluoroacetic acid (295 μL, 3.86 mmol) were added to a solution of Compound 7 (911 mg, 1.61 mmol) obtained above in acetic acid (1.85 mL, 32.3 mmol) at 0 °C, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, saturated aqueous sodium hydrogen carbonate solution was added, and the organic layer was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 9:1 to 4:1) to obtain Compound 8 (841 mg, 86%) as a colorless transparent viscous oil.

[0127] The physical property data of the obtained Compound 8 are shown in Table 4.

[0128]

Table 4

[0129] (1 - 5) Synthesis of Compound 9

[0130]

Chemical formula

[0131] Under an argon atmosphere, thymine (242 mg, 1.91 mmol) and N,O-bis-trimethylsilylacetamide (780 μL, 3.18 mmol) were sequentially added to a solution of Compound 8 (389 mg, 0.637 mmol) obtained above in anhydrous acetonitrile (5.6 mL) at room temperature, and the mixture was stirred at room temperature for 1 hour. Then, trimethylsilyl trifluoromethanesulfonate (175 μl, 0.969 mmol) was added at 0 °C under an argon atmosphere, and the mixture was heated to reflux for 5 hours. After completion of the reaction, saturated aqueous sodium hydrogen carbonate solution was added, and the organic layer was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2, purified with hexane:ethyl acetate = 9:1 to 4:1), and compound 9 (385 mg, 89%) was obtained as a white solid.

[0132] The physical property data of the obtained compound 9 are shown in Table 5.

[0133]

Table 5

[0134] (1-6) Synthesis of compound 10

[0135]

Chem.

[0136] Under an argon atmosphere, potassium carbonate (607 mg, 4.39 mmol) was added to a methanol solution (14.6 mL) of the above-obtained compound 9 (986 mg, 1.46 mmol) at 0 °C, and the mixture was stirred at room temperature for 5 hours. After the reaction was completed, saturated aqueous sodium hydrogen carbonate solution was added, and the organic layer was extracted with diethyl ether. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 4:1 to 1:1), and compound 10 (895 mg, 97%) was obtained as a white solid.

[0137] The physical property data of the obtained compound 10 are shown in Table 6.

[0138]

Table 6

[0139] (1-7) Synthesis of compound 11

[0140]

Chem.

[0141] Under an argon atmosphere, methanesulfonyl chloride (170 μL, 2.19 mmol) was added to a dehydrated pyridine solution (14.5 mL) of Compound 10 (895 mg, 1.41 mmol) obtained above at 0 °C, and the mixture was stirred at room temperature for 4 hours. After the reaction was completed, water was added, and the organic layer was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 9:1 to 4:1) to obtain Compound 11 (992 mg, quantitative) as a white solid.

[0142] The physical property data of the obtained Compound 11 are shown in Table 7.

[0143]

Table 7

[0144] (1-8) Synthesis of Compound 12

[0145]

Chemical formula

[0146] Under an argon atmosphere, a solution of tetrabutylammonium fluoride in tetrahydrofuran (4.18 mL, 4.18 mmol) was added to a dehydrated tetrahydrofuran solution (13.9 mL) of Compound 11 (992 mg, 1.39 mmol) obtained above at 0 °C, and the mixture was stirred at room temperature for 30 hours. After the reaction was completed, water was added, and the organic layer was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. Without purifying the resulting residue, potassium carbonate (577 mg, 4.17 mmol) was added to a solution of this residue in N,N-dimethylformamide (13.9 mL) at 0 °C, and the mixture was stirred at 90 °C for 20 hours. After the reaction was completed, water was added, and the organic layer was extracted with diethyl ether. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2 , hexane:ethyl acetate = 4:1 to 1:2) to obtain Compound 12 (583 mg, 83% (two steps)) as a white solid.

[0147] The physical property data of the obtained Compound 12 are shown in Table 8.

[0148]

Table 8

[0149] (1 - 9) Synthesis of Compound 13

[0150]

Chemical formula

[0151] In a hydrogen gas atmosphere, 20% palladium hydroxide / carbon (44 mg, 40 parts by weight (relative to 100 parts by weight of Compound 12)) was added to an ethyl acetate solution (2.15 mL) of Compound 12 (110 mg, 0.219 mmol) obtained above at room temperature, and the mixture was stirred at room temperature for 0.5 hour while replacing the inside of the flask with hydrogen gas several times. After completion of the reaction, the mixture was filtered and washed with ethyl acetate. Then, the solvent was distilled off under reduced pressure, and the obtained residue was purified by a PLC plate (SiO 2 , chloroform:methanol = 7:1) to obtain Compound 13 (57 mg, 80%) as a white solid.

[0152] The physical property data of the obtained Compound 13 are shown in Table 9.

[0153]

Table 9

[0154] (1-10) Synthesis of Compound 14

[0155]

Chemical formula

[0156] Under an argon atmosphere, 4,4'-dimethoxytrityl chloride (320 mg, 0.944 mmol) was added to an anhydrous pyridine solution (5.3 mL) of Compound 13 (170 mg, 0.524 mmol) obtained above at 0 °C, and the mixture was stirred at room temperature for 8 hours. After completion of the reaction, a saturated aqueous sodium hydrogen carbonate solution was added, and the organic layer was extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2 , containing 1% triethylamine, hexane:ethyl acetate = 4:1 to 1:4) to obtain Compound 14 (329 mg, quantitative) as a white solid.

[0157] The physical property data of the obtained Compound 14 are shown in Table 10.

[0158]

Table 10

[0159] (1-11) Synthesis of Compound 15

[0160]

Chem.

[0161] Under an argon atmosphere, N,N-diisopropylethylamine (275 μL, 1.61 mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (175 μL, 0.784 mmol) were sequentially added to a solution of the above-obtained Compound 14 (329 mg, 0.525 mmol) in anhydrous dichloromethane (5.3 mL) at 0 °C, and the mixture was stirred at room temperature for 8 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 , containing 1% triethylamine, hexane:ethyl acetate = 4:1 to 2:1) and reprecipitation (toluene / hexane) to obtain Compound 15 (252 mg, 58%) as a white solid.

[0162] The physical property data of the obtained Compound 15 are shown in Table 11.

[0163]

Table 11

[0164] Through the series of synthetic routes from the above Compound 1 to Compound 15, the total yield of the finally obtained Compound 15 was 22%. This is a high value compared to the total yield (18%) of the final product obtained by the synthetic route of the cross-linked nucleoside (scpBNA) described in, for example, Patent Document 1 and Non-Patent Document 5, indicating that the cross-linked nucleoside of this example could be efficiently synthesized.

[0165] (Example 2: Synthesis of Cross-Linked Nucleoside (2))

[0166]

Chem.

[0167] (2-1) Synthesis of Compound 16

[0168]

Chem.

[0169] Under a nitrogen stream, chloro(triethyl)silane (0.45 mL, 3.0 mmol) was added to a pyridine anhydrous solution (10 mL) of Compound 14 (626 mg, 999 μmol) obtained in the above Example 1(1-10) at 0 °C, and the mixture was stirred at room temperature for 4 hours. After completion of the reaction, saturated aqueous sodium hydrogen carbonate was added at 0 °C, and the mixture was extracted with ethyl acetate and washed with water and saturated brine. After drying over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure. The obtained crude product was purified by silica gel column chromatography (Si 2 , n-hexane:ethyl acetate = 1:1) to obtain Compound 16 (531 mg, 72%) as a white foamy solid.

[0170] The physical property data of the obtained Compound 16 are shown in Table 12.

[0171]

Table 12

[0172] (2-2) Synthesis of Compound 17

[0173]

Chem.

[0174] Under a nitrogen stream, phosphoryl chloride (136 μL, 1.5 mmol) was added dropwise to an anhydrous acetonitrile solution (4.8 mL) of compound 16 (329 mg, 444 μmol), triethylamine (1.1 mL, 8 mmol), and 1,2,4-triazole (537 mg, 7.8 mmol), which were obtained above, at 0 °C. After stirring at room temperature for 1 hour, saturated aqueous sodium bicarbonate was added to the reaction solution, and the mixture was extracted with ethyl acetate and washed with water and saturated brine. After drying over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure. To a 1,4-dioxane solution (2.0 mL) of the obtained residue, 28 wt% aqueous ammonia solution (500 μL, 7.3 mmol) was added at 0 °C, and the mixture was stirred at room temperature for 1.5 hours. After completion of the reaction, the solvent was distilled off under reduced pressure. The obtained crude product was purified by silica gel column chromatography (SiO 2 , chloroform:methanol = 20:1) to obtain compound 17 (322 mg, 98%, 2 steps) as a white foamy solid.

[0175] The physical property data of the obtained compound 17 are shown in Table 13.

[0176]

Table 13

[0177] (2-3) Synthesis of compound 18

[0178]

Chem.

[0179] Under a nitrogen stream, benzoyl chloride (100 μL, 0.86 mmol) was added to an anhydrous pyridine solution (4.5 mL) of compound 17 (322 mg, 0.435 mmol), which was obtained above, at 0 °C, and the mixture was stirred at room temperature for 2.5 hours. After completion of the reaction, saturated aqueous sodium bicarbonate was added, and the mixture was extracted with ethyl acetate and washed with water and saturated brine. After drying over anhydrous sodium sulfate, the solvent was distilled off under reduced pressure. The obtained crude product was purified by silica gel column chromatography (SiO 2 , n-hexane:ethyl acetate = 5:1) to obtain compound 18 (229 mg, 62%) as a white foamy solid.

[0180] The physical property data of the obtained Compound 18 are shown in Table 14.

[0181]

Table 14

[0182] (2-4) Synthesis of Compound 19

[0183]

Chem.

[0184] To a solution of the above-obtained Compound 18 (108 mg, 121 μmol) in tetrahydrofuran (1.2 mL) was added 1 M tetrabutylammonium fluoride / tetrahydrofuran solution (120 μL, 120 μmol) at 0 °C, and the mixture was stirred at room temperature for 20 minutes. After completion of the reaction, the solvent was distilled off under reduced pressure. The obtained crude product was purified by silica gel column chromatography (SiO 2 , chloroform:methanol = 20:1) to obtain Compound 19 (101 mg, quantitative) as a white foamy solid.

[0185] The physical property data of the obtained Compound 19 are shown in Table 15.

[0186]

Table 15

[0187] (2-5) Synthesis of Compound 20

[0188]

Chem.

[0189] Under a nitrogen stream, 2-cyanoethyl N,N,N’,N’-tetraisopropylphosphorodiamidite (95 μL, 295 μmol) and 4,5-dicyanoimidazole (35 mg, 290 μmol) were added to an anhydrous acetonitrile solution (980 μL) of Compound 19 (71 mg, 97.3 μmol) obtained above at 0 °C, and the mixture was stirred at room temperature for 2 hours. After completion of the reaction, the solvent was distilled off under reduced pressure. The obtained crude product was purified by silica gel column chromatography (SiO 2 , n-hexane containing 1% triethylamine:ethyl acetate = 3:1) to obtain Compound 20 (73 mg, 81%) as a white foamy solid.

[0190] The physical property data of the obtained Compound 20 are shown in Table 16.

[0191]

Table 16

[0192] (Example 3) Synthesis and Purification of Oligonucleotides (1) Using Compound 15 (scpBNA2nd-T) prepared in Example 1 as an amidite block, oligonucleotides were synthesized as follows. Compounds other than Compound 15 constituting the oligonucleotides were purchased from Proligo unless otherwise specified. The following oligonucleotides were synthesized. ON1: 5’-d(GCGTTYTTTGCT)-3’ (SEQ ID NO: 1) ON2: 5’-d(GCGYTYTYTGCT)-3’ (SEQ ID NO: 2) ON3: 5’-d(GCGTYYYYTGCT)-3’ (SEQ ID NO: 3) ON4: 5’-d(GCGYYYYYYGCT)-3’ (SEQ ID NO: 4) ON5: 5’-d(TTTTTTTTTY)-3’ ON6: 5’-d(TTTTTTTTYT)-3’ Y = Compound 15 (scpBNA2nd-T)

[0193] Compound 15 prepared in Example 1 was prepared as a 0.1 M anhydrous acetonitrile or anhydrous dichloromethane solution, respectively, and charged into an nS-8 Oligonucleotides Synthesizer manufactured by GeneDesign. Each synthesis was carried out under trityl-on conditions. Activator-42 (registered trademark) (manufactured by Proligo) (0.25 M acetonitrile solution) was used as the activator, and the condensation time was extended to 150 seconds × 5 for Compound 15. Other operations were carried out according to the usual phosphoramidite method.

[0194] After completion of the synthesis, the product was treated with 28% aqueous ammonia solution at room temperature for 1.5 hours to cut it out from the column carrier, and then deprotected at the base by standing at 55 °C for 10 hours. Thereafter, it was purified by a simple reverse-phase column (Sep-Pak (registered trademark) Plus C18 Cartridges manufactured by Waters), and further purified by reverse-phase HPLC.

[0195] The composition of the purified oligonucleotide was determined by MALDI-TOF MS measurement. For this measurement, first, a matrix (1 μL) obtained by mixing an aqueous solution of 3-hydroxypicolinic acid (10 mg / mL) and an aqueous solution of diammonium citrate (1 mg / mL) at a volume ratio of 1:1 was placed on an anchor tip dried thereon, and an aqueous solution of oligonucleotide (50 μM, 1 μL) was placed thereon and dried again, and then MALDI-TOF MS measurement was carried out. The molecular weight was measured in the negative mode, and oligothymidylic acid (7mer, 9mer, 11mer and 13mer) was used as an external standard. In addition, the synthesized oligonucleotide was quantified by measuring the ultraviolet absorption at 260 nm using an absorbance measuring device (SHIMADZU UV-1800 manufactured by Shimadzu Corporation).

[0196] The results are shown in Table 17 below.

[0197]

Table 17

[0198] (Example 4) Evaluation of duplex formation ability The duplex formation abilities of ON1 to ON4 were examined. As a control, natural DNA 5'-d(GCGTTTTTTGCT)-3' ("ON9": SEQ ID NO: 5) was also used. Single-stranded oligoRNA 5'-r(AGCAAAAAACGC)-3' (SEQ ID NO: 6) and single-stranded oligoDNA 5'-d(AGCAAAAAACGC)-3' (SEQ ID NO: 7) were used as target strands.

[0199] The duplex formation ability of the oligonucleotide was examined by measuring the T m value after annealing various oligonucleotides with the target strand to form a duplex. More specifically, a mixture of each oligonucleotide (final concentration 4 μM) and sodium chloride (final concentration 100 mM) in a phosphate buffer (10 mM, pH 7.2, 130 μL) was bathed in boiling water and slowly cooled to room temperature. Then, it was cooled to 5°C under a nitrogen stream and the measurement was started. The temperature was raised to 90°C or 110°C at 0.5°C / min, and the absorbance at 260 nm was plotted at 0.5°C intervals. The T m value was calculated by the midpoint method and taken as the average value in three independent measurements.

[0200] The results are shown in Table 18. In Table 18, the results for single-stranded oligoRNA are shown as "ssRNA", the results for single-stranded oligoDNA are shown as "ssDNA", and the T m fluctuation temperature per modified nucleic acid base ("ΔT m / mod.") and RNA selectivity (the difference between the melting temperature for RNA and the melting temperature for DNA) of each oligonucleotide are shown.

[0201]

Table 18

[0202] When compound 15 was used, both single-stranded oligo-DNA and single-stranded oligo-RNA showed a higher melting temperature compared to the natural oligonucleotide (ON9). Furthermore, when compound 15 was used, especially for single-stranded oligo-RNA, the T m value increased compared to the natural oligonucleotide (ON9), thus showing a high binding affinity for single-stranded oligo-RNA. Also, when compound 15 was used, RNA selectivity was observed.

[0203] (Example 5) Evaluation of nuclease resistance Oligonucleotides with the sequence of ON5 and the following 10-mer were synthesized and purified and used as test oligonucleotides: 5’-d(TTTTTTTTTX)-3’ (1) X = compound 15 (ON5: “scpBNA2nd-T”) (2) X = phosphorothioate thymidine (“PS-T”: For phosphorothioation, 0.05 M ((dimethylamino - methylidene)amino)-3H-1,2,4-dithiazoline-3-thione (DDTT) (pyridine / acetonitrile (3:2) solution, GLEN RESEARCH) was used.) (3) X = spirocyclopropylene BNA (Patent Document 1 and Non-Patent Document 5: “scpBNA-T”)

[0204] 1.5 μg / mL of 3’-exonuclease (Crotalus adamanteus venom phosphodiesterase, CAVP) was added to a 50 mM Tris-HCl buffer (pH 8.0) containing 7.5 μM test oligonucleotide and 10 mM magnesium chloride, and incubated at 37 °C. At the start of incubation (0 min), 2.5 min later, 5 min later, 10 min later, 20 min later, and 40 min later, 20 μL samples were taken out each time and analyzed by reverse-phase HPLC to calculate the ratio of the uncleaved oligonucleotide. Also, the evaluation was derived from 3 independent measurements.

[0205] The results are shown in Fig. 1. In Fig. 1, the black diamonds represent the results of (1) above, the black circles represent the results of (2) above, and the black triangles represent (3) above. As is clear from Fig. 1, about 70% of the oligonucleotide having Compound 15 ((1) above) remained uncleaved even 40 minutes after nuclease treatment and was difficult to decompose. The oligonucleotide having Compound 15 ((1) above) showed very high nuclease resistance compared to the phosphorothioated (PS) oligo ((2) above) and the oligonucleotide having spirocyclopropylene BNA ((3) above).

[0206] (Example 6) Synthesis and Purification of Oligonucleotides (2) Compound 15 (scpBNA2nd-T) prepared in Example 1 and Compound 20 (scpBNA2nd- Me C) was used as an amidite block, and the oligonucleotides shown in Table 19 were synthesized in the same manner as in Example 3. Regarding phosphorothioation, 0.05 M ((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazoline-3-thione (DDTT) (pyridine / acetonitrile (3:2) solution, GLEN RESEARCH) was used. The sequences of the obtained oligonucleotides ONs21, ONs22, ONs23, and ONd1 are also shown in SEQ ID NOs: 8 to 11, respectively.

[0207]

Table 19

[0208] (Example 7) Evaluation of Toxicity Reduction Effect The test oligonucleotides shown in Table 20 (20 mg / kg) were administered intraperitoneally to 6-week-old mice (C57BL / 6J, male) (5 mice / group). After 96 hours, blood was collected under inhalation anesthesia (isoflurane), and the mice were euthanized by exsanguination. Then, the activities of aspartate transaminase (AST) and alanine transaminase (ALT) in the serum were measured using an automatic analyzer (FUJIFILM DryChem 4000V).

[0209] Regarding the test oligonucleotides shown in Table 20, ONd1 (SEQ ID NO: 11) was prepared in the same manner as in Example 6 using Compound 15 (scpBNA2nd-T) prepared in Example 1 as an amidite block. ONd0 (SEQ ID NO: 12) was prepared in the same manner as ONd1 except that Compound 15 (scpBNA2nd-T) was not included in the amidite block.

[0210] [Table 20]

[0211] Table 21 shows the activities of aspartate transaminase (AST) and alanine transaminase (ALT) in the blood when the test oligonucleotides were administered and when physiological saline was administered. In the group administered with ONd0, which is known to exhibit hepatotoxicity, all 5 mice died. On the other hand, ONd1, in which a part of the sequence of ONd0 was replaced according to the present invention, showed almost no increase in ALT and AST, and a toxicity-reducing effect was confirmed.

[0212] [Table 21]

[0213] (Example 8) Evaluation of antisense activity Regarding the oligonucleotides (ONs21, ONs22, ONs23: prepared in Example 6) containing Compound 15 (scpBNA2nd-T) prepared in Example 1 and Compound 20 (scpBNA2nd- Me C) and the oligonucleotide (ONs01) containing LNA instead of Compound 15 and Compound 20, the antisense activity in each tissue was examined.

[0214] The nucleotide sequences of these four oligonucleotides were designed as antisense nucleic acids against MALAT1. ONs01 was synthesized in the same manner as in Example 3, using LNA as an amidite block instead of Compounds 15 and 20. The sequences of ONs21, ONs22, ONs23, and ONs01 are shown in Table 22 below.

[0215] [Table 22]

[0216] The test oligonucleotide (20 nmol: 200 μL of 100 μM physiological saline solution) was administered to the tail vein of 6-week-old mice (BALB / cAnNCrlCrlj, female) (5 mice / group). After 72 hours, blood was collected under inhalation anesthesia (isoflurane), and the mice were euthanized by exsanguination. Then, each tissue was collected and RNA extraction was performed (kit used: RNeasy). The mRNA expression level of MALAT1 in each tissue was measured by real-time PCR (kit used: One Step TB Green (registered trademark) PrimeScript TM RT-PCR Kit (Perfect Real Time), manufactured by Takara Bio Inc.). In real-time PCR, the following primers were used: MALAT1 forward: acattccttgaggtcggcaa (SEQ ID NO: 14) MALAT1 reverse: cacccgcaaaggcctacata (SEQ ID NO: 15) GAPDH forward: tcaccaccatggagaaggc (SEQ ID NO: 16) GAPDH reverse: gctaagcagttggtggtgca (SEQ ID NO: 17)

[0217] The results are shown in FIGS. 2 and 3. FIGS. 2 and 3 show the relative MALAT1 expression levels in various tissues of mice upon administration of various oligonucleotides (FIG. 2: liver, heart, kidney, pancreas, skeletal muscle, lung and stomach, and FIG. 3: spleen, skin, large intestine, brain, mammary gland, eyeball and cartilage). The "relative MALAT1 expression level" was expressed as a relative value with the expression level in the case of administration of only physiological saline (without oligonucleotide) being set to 1. In FIGS. 2 and 3, the bars indicating the results were distinguished between control (administration of only physiological saline), oligonucleotides containing LNA instead of compounds 15 and 20 (ONs01), and oligonucleotides containing compounds 15 and 20 (ONs21, ONs22, ONs23).

[0218] Oligonucleotides containing compounds 15 and 20 (ONs21, ONs22, ONs23) showed an equivalent or higher target gene suppression effect compared to oligonucleotides containing LNA instead of compounds 15 and 20 (ONs01) in many tissues.

Industrial Applicability

[0219] According to the present invention, a novel cross-linked nucleoside capable of substituting for phosphorothioate-modified nucleic acids and nucleotides using the same are provided. The oligonucleotides obtained using the cross-linked nucleoside of the present invention are useful, for example, as materials for nucleic acid pharmaceuticals.

Claims

1. A compound represented by the following formula or a salt thereof: 【Chemistry 1】 (In the formula, Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 2 and R 3 each independently represent a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic group, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic group, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R 4a )R 5a [wherein R 4a and R 5a each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group, and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b (wherein R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms), or -OR 5b (wherein R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms); the protecting group is a lower alkyl group; a lower alkenyl group; an acyl group; a tetrahydropyranyl or tetrahydrothiopyranyl group; a tetrahydrofuranyl or tetrahydrothiofuranyl group; a silyl group; a lower alkoxymethyl group; a lower alkoxylated lower alkoxymethyl group; a halogeno lower alkoxymethyl group; a lower alkoxylated ethyl group; a halogenated ethyl group; a methyl group substituted by 1 to 3 aryl groups; a methyl group substituted by 1 to 3 aryl groups in which the aryl ring is substituted by a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group; a lower alkoxycarbonyl group; an aryl group substituted by a halogen atom, a lower alkoxy group or a nitro group; a lower alkoxycarbonyl group substituted by a halogen atom or a tri-lower alkylsilyl group; an alkenyloxycarbonyl group; or an aralkyloxycarbonyl group in which the aryl ring may be substituted by a lower alkoxy or a nitro group; The lower alkyl is an alkyl having 1 to 7 carbon atoms, which may be branched or cyclic. The lower alkenyl is an alkenyl having 2 to 7 carbon atoms which may be branched or cyclic, and The lower alkoxy is an alkoxy having 1 to 7 carbon atoms which may be branched or cyclic.

2. In the above formula, the Base is a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidine-1- 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

3. In the above formula, the Base is represented by the following formula: 【Chemistry 2】 The compound according to claim 1 , wherein the R 1 is a group represented by the formula:

4. An oligonucleotide comprising at least one nucleoside structure represented by the following formula or a pharmacologically acceptable salt thereof: 【Chemistry 3】 (In the formula, Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; X 2 is an oxygen atom, a sulfur atom, -NH-, -N(CH 3 )- or a methylene group, and R 6 and R 7 are each independently a hydrogen atom, a linear alkyl group having 1 to 3 carbon atoms, -NHR 4b (wherein R 4b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms), or -OR 5b (wherein R 5b is a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms); the protecting group is a lower alkyl group; a lower alkenyl group; an acyl group; a tetrahydropyranyl or tetrahydrothiopyranyl group; a tetrahydrofuranyl or tetrahydrothiofuranyl group; a silyl group; a lower alkoxymethyl group; a lower alkoxylated lower alkoxymethyl group; a halogeno lower alkoxymethyl group; a lower alkoxylated ethyl group; a halogenated ethyl group; a methyl group substituted by 1 to 3 aryl groups; a methyl group substituted by 1 to 3 aryl groups in which the aryl ring is substituted by a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group; a lower alkoxycarbonyl group; an aryl group substituted by a halogen atom, a lower alkoxy group or a nitro group; a lower alkoxycarbonyl group substituted by a halogen atom or a tri-lower alkylsilyl group; an alkenyloxycarbonyl group; or an aralkyloxycarbonyl group in which the aryl ring may be substituted by a lower alkoxy or a nitro group; The lower alkyl is an alkyl having 1 to 7 carbon atoms, which may be branched or cyclic. The lower alkenyl is an alkenyl having 2 to 7 carbon atoms which may be branched or cyclic, and The lower alkoxy is an alkoxy having 1 to 7 carbon atoms which may be branched or cyclic.

Images