A method for treating or remitting metabolic disorders, which uses a binding protein for a gastric inhibitory polypeptide receptor (GIPR) in combination with a GLP-1 agonist
Patent Information
- Application Number
- JP2023174100
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-11-10
- Filing Date
- 2023-10-06
- Publication Date
- 2025-06-02
- Estimated Expiration
- 2036-12-21
AI Technical Summary
Current treatments for metabolic disorders, such as type 2 diabetes and obesity, are limited in their ability to effectively target the insulin secretion-stimulating effects of glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1), particularly in individuals with type 2 diabetes, where the insulin secretion-stimulating effect of GIP is lost, and GLP-1 has a short half-life due to rapid degradation.
A method involving the administration of a therapeutically effective amount of a GLP-1 receptor agonist and a GIPR antagonist, which specifically binds to the GIP receptor (GIPR), either simultaneously or sequentially, to modulate insulin secretion and metabolic pathways, reducing symptoms of metabolic disorders like hyperglycemia, hyperinsulinemia, insulin resistance, and obesity.
The combined use of GLP-1 receptor agonists and GIPR antagonists provides a long-lasting beneficial effect on metabolic disorders by reducing plasma glucose, insulin levels, body weight, and fat mass, improving glucose tolerance, and enhancing insulin sensitivity in obese subjects.
Smart Images

Figure 00000563_0000 
Figure 00000563_0001 
Figure 00000593_0000
Abstract
Description
[Technical field]
[0001] The present disclosure relates to the treatment or amelioration of metabolic disorders such as type 2 diabetes, elevated glucose levels, elevated insulin levels, obesity, non-alcoholic fatty liver disease, or cardiovascular disease using antigen binding proteins specific for the gastric inhibitory peptide receptor (GIPR). [Background technology]
[0002] Glucose-dependent insulinotropic polypeptide (GIP) is a single peptide of 42 amino acids secreted from K cells in the small intestine (duodenum and jejunum). Human GIP is generated by processing proGIP, which is a precursor of 153 amino acids encoded by a gene located on chromosome 17q (Inagaki et al., Mol Endocrinol 1989;3:1014-1021, Fehmann et al. Endocr Rev.1995;16:390-410). GIP was previously called gastric inhibitory polypeptide.
[0003] GIP secretion is induced by food intake. GIP exerts many physiological effects on tissues, including promoting fat storage in adipocytes and pancreatic islet β-cell function and glucose-dependent insulin secretion. GIP and glucagon-like polypeptide-1 (GLP-1) are known as insulin secretion stimulating factors ("incretins"). Intact GIP is rapidly degraded by DPPIV to an inactive form. In type 2 diabetic patients, the insulin secretion stimulating effect of GIP is lost, but the incretin effect of GLP-1 remains intact (Nauck et al. J. Clinc. Invest. 1993;91:301-307).
[0004] The GIP receptor (GIPR) is a member of the secretin-glucagon family of G protein-coupled receptors (GPCRs) with an extracellular N-terminus, seven transmembrane domains, and an intracellular C-terminus. The N-terminal extracellular domain of this family of receptors is usually glycosylated and forms the recognition and binding domain of the receptor. GIPR is highly expressed in many tissues, including the pancreas, intestine, adipose tissue, heart, pituitary gland, adrenal cortex, and brain (Usdin et al., Endocrinology. 1993, 133:2861-2870). Human GIPR contains 466 amino acids and is encoded by a gene located on chromosome 19q13.3 (Gremlich et al., Diabetes. 1995; 44:1202-8; Volz et al., FEBS Lett. 1995, 373:23-29). Studies suggest that in humans, rats, and mice, GIP receptor variants of different lengths are generated as a result of alternative splicing of the mRNA.
[0005] GIPR knockout mice (Gipr - / - ) are resistant to high-fat diet-induced weight gain and have improved insulin sensitivity and lipid profile (Yamada et al., Diabetes. 2006, 55:S86; Miyawaki et al. Nature Med. 2002, 8:738-742). Furthermore, a novel small molecule GIPR antagonist, SKL-14959, prevents obesity and insulin resistance (Diabetologia 2008, 51:S373, 44th EASD Annual meeting poster).
[0006] Glucagon-like peptide-1 ("GLP-1") is a 31 amino acid peptide derived from the proglucagon gene. GLP-1 is secreted by intestinal L-cells and is released in response to food intake to induce insulin secretion from pancreatic β-cells (Diabetes 2004,53:S3,205-214). In addition to its incretin action, GLP-1 also reduces glucagon secretion, delays gastric emptying, and reduces caloric intake (Diabetes Care,2003,26(10):2929-2940). GLP-1 exerts its action by activating the GLP-1 receptor, which is a class B G protein-coupled receptor (Endocrinology.1993,133(4):1907-10). GLP-1's function is limited by its rapid degradation by the DPP-IV enzyme, resulting in a half-life of approximately 2 minutes. Long-acting GLP-1 receptor agonists, such as exenatide, liraglutide, and dulaglutide, have been recently developed and are currently in clinical use to improve glycemic control in patients with type 2 diabetes. In addition, GLP-1 receptor agonists also promote weight loss and reduction of blood pressure and plasma cholesterol levels in patients (Bioorg.Med.Chem.Lett 2013,23:4011-4018).
[0007] Collectively, these links to obesity and insulin resistance imply that inhibiting GIPR, either as monotherapy or in combination with GLP-1, may be a useful approach for therapeutic intervention. [Prior art documents] [Non-patent literature]
[0008] [Non-Patent Document 1] Inagaki et al.,Mol Endocrinol 1989;3:1014-1021 [Non-Patent Document 2] Fehmann et al. Endocr Rev.1995;16:390-410 [Non-Patent Document 3] Nauck et al. J. Clinc. Invest. 1993; 91: 301 - 307
Non - Patent Document 4
Non - Patent Document 5
Non - Patent Document 6
Non - Patent Document 7
Non - Patent Document 8
Non - Patent Document 9
Non - Patent Document 10
Non - Patent Document 11
Non - Patent Document 12
Non - Patent Document 13
Summary of the Invention
[0009] In one aspect, the disclosure provides a method of treating a subject having a metabolic disorder, the method comprising administering to the subject a therapeutically effective amount of an antigen binding protein that specifically binds to a protein having an amino acid sequence that has at least 90% amino acid sequence identity to the amino acid sequence of GIPR. In one aspect, the present invention is directed to a method of treating a subject having a metabolic disorder, the method comprising administering to the subject a therapeutically effective amount of a GLP-1 receptor agonist and a therapeutically effective amount of a GIPR antagonist that specifically binds to a protein having an amino acid sequence that has at least 90% amino acid sequence identity to the amino acid sequence of GIPR. In one embodiment, the metabolic disorder is a disorder of glucose metabolism. In another embodiment, the glucose metabolic disorder comprises hyperglycemia, and administration of the antigen binding protein reduces plasma glucose. In another embodiment, the glucose metabolic disorder comprises hyperinsulinemia, and administration of the antigen binding protein reduces plasma insulin. In another embodiment, the glucose metabolic disorder comprises impaired glucose tolerance, and administration of the antigen binding protein improves glucose tolerance. In another embodiment, the glucose metabolism disorder comprises insulin resistance, and administration of the antigen binding protein reduces insulin resistance. In another embodiment, the glucose metabolism disorder comprises diabetes. In another embodiment, the subject is obese. In another embodiment, administration of the antigen binding protein reduces body weight in the obese subject. In another embodiment, administration of the antigen binding protein reduces weight gain in the obese subject. In another embodiment, administration of the antigen binding protein reduces body fat mass in the obese subject. In another embodiment, the glucose metabolism disorder comprises insulin resistance, and administration of the antigen binding protein reduces insulin resistance in the obese subject. In another embodiment, administration of the antigen binding protein reduces hepatic steatosis in an obese subject with advanced hepatic steatosis. In another embodiment, administration of the antigen binding protein reduces liver fat content in an obese subject with increased liver fat content.
[0010] In one aspect, the present invention is directed to a method of treatment, the method comprising administration to a subject having symptoms of a metabolic disorder of at least one GLP-1 receptor agonist in a therapeutically effective amount in combination with administration of at least one GIPR antagonist that provides a sustained beneficial effect when administered to the subject.
[0011] In one embodiment, the administration of at least one GLP-1 receptor agonist in combination with the administration of at least one GIPR antagonist provides a sustained beneficial effect on at least one symptom of a metabolic disorder.
[0012] In one embodiment, a therapeutically effective amount of a GLP-1 receptor agonist and a therapeutically effective amount of a GIPR antagonist are combined prior to administration to a subject.
[0013] In one embodiment, a therapeutically effective amount of a GLP-1 receptor agonist and a therapeutically effective amount of a GIPR antagonist are administered sequentially to a subject.
[0014] In one embodiment, the therapeutically effective amount of the GLP-1 receptor agonist and the therapeutically effective amount of the GIPR antagonist are synergistically effective amounts.
[0015] In one embodiment, the molar ratio of the GLP-1 receptor agonist to the GIPR antagonist is about 1:1 to 1:110, about 1:1 to 1:100, about 1:1 to 1:75, about 1:1 to 1:50, about 1:1 to 1:25, about 1:1 to 1:10, about 1:1 to 1:5, and about 1: 1. In one embodiment, the molar ratio of the GIPR antagonist to the GLP-1 receptor agonist is about 1:1 to 1:110, about 1:1 to 1:100, about 1:1 to 1:75, about 1:1 to 1:50, about 1:1 to 1:25, about 1:1 to 1:10, and about 1:1 to 1:5.
[0016] In one embodiment, the GLP-1 receptor agonist and the GIPR antagonist are used in combination in a therapeutically effective molar ratio of about 1:1.5 to 1:150, preferably 1:2 to 1:50.
[0017] In one embodiment, the GLP-1 receptor agonist and the GIPR antagonist are present in dosages that are at least about 1.1-1.4 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times less than the dosages that would be required to treat the condition and / or disease with each compound alone.
[0018] In one embodiment, the GLP-1 receptor agonist is GLP-1(7-37) or a GLP-1(7-37) analogue.
[0019] In one embodiment, the GLP-1 receptor agonist is selected from the group consisting of exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, and taspoglutide.
[0020] In one embodiment, the GLP-1 receptor agonist is GLP-1(7-37) (SEQ ID NO: 3184), GLP-1(7-36)-NH 2 (SEQ ID NO: 3185), liraglutide, albiglutide, taspoglutide, dulaglutide, semaglutide, LY2428757, desamino-His 7 ,Arg 26 ,Lys 34 (N ε -(γ-Glu(N-α-hexadecanoyl)))-GLP-1(7-37) (core peptide disclosed as SEQ ID NO: 3222), desamino-His 7 ,Arg 26 ,Lys 34 (N ε -octanoyl)-GLP-1(7-37) (SEQ ID NO: 3223), Arg 26,34 ,Lys 38 (N ε -(ω-carboxypentadecanoyl)-GLP-1(7-38) (SEQ ID NO: 3224), Arg26,34 ,Lys 36 (N ε -(γ-Glu(N-α-hexadecanoyl)))-GLP-1(7-36) (core peptide disclosed as SEQ ID NO: 3225), Aib 8,35 ,Arg 26,34 ,Phe 31 -GLP-1(7-36)) (SEQ ID NO: 3186), HXaa 8 EGTFTSDVSSYLEXaa 22 Xaa 23 AAKEFIXaa 30 WLXaa 33 Xaa 34 G Xaa 36 Xaa 37 (Xaa 3 is A, V, or G, and Xaa 22 is G, K, or E, and Xaa 23 is Q or K, and Xaa 30 is A or E, and Xaa 33 is V or K, and Xaa 34 is K, N, or R, and Xaa 36 is R or G, and Xaa 37 is G, H, P, or absent) (SEQ ID NO: 3187), Arg 34 -GLP-1(7-37) (SEQ ID NO: 3188), Glu 30 -GLP-1(7-37) (SEQ ID NO: 3189), Lys 22 -GLP-1(7-37) (SEQ ID NO: 3190), Gly 8,36 ,Glu 22 -GLP-1(7-37) (SEQ ID NO: 3191), Val 8 ,Glu 22 ,Gly 36 -GLP-1(7-37) (SEQ ID NO: 3192), Gly 8,36 ,Glu 22 ,Lys 33 ,Asn 34 -GLP-1(7-37) (SEQ ID NO: 3193), Val 8 ,Glu 22 ,Lys 33 ,Asn 34 ,Gly 36-GLP-1(7-37) (SEQ ID NO: 3194), Gly 8,36 ,Glu 22 ,Pro 37 -GLP-1(7-37) (SEQ ID NO: 3195), Val 8 ,Glu 22 ,Gly 36 Pro 37 -GLP-1(7-37) (SEQ ID NO: 3196), Gly 8,36 ,Glu 22 ,Lys 33 ,Asn 34 ,Pro 37 -GLP-1(7-37) (SEQ ID NO: 3197), Val 8 ,Glu 22 ,Lys 33 ,Asn 34 ,Gly 36 ,Pro 37 -GLP-1(7-37) (SEQ ID NO: 3198), Gly 8,36 ,Glu 22 -GLP-1(7-36) (SEQ ID NO: 3199), Val 8 ,Glu 22 ,Gly 36 -GLP-1(7-36) (SEQ ID NO: 3200), Val 8 ,Glu 22 ,Asn 34 ,Gly 36 -GLP-1(7-36) (SEQ ID NO: 3201), and Gly 8,36 ,Glu 22 ,Asn 34 - GLP-1(7-36) (SEQ ID NO: 3202).
[0021] In another embodiment, the subject is a mammal. In another embodiment, the subject is a human. In another embodiment, the GIPR is a human GIPR. In another embodiment, the administration is by parenteral injection. In another embodiment, the administration is by subcutaneous injection.
[0022] In another aspect, the present disclosure provides an antigen binding protein that specifically binds to human GIPR polypeptide and inhibits the activation of GIPR by GIP ligand.In one embodiment, the antigen binding protein inhibits the binding of GIP ligand to GIPR.In another embodiment, the antigen binding protein is a human antigen binding protein.In another embodiment, the antigen binding protein is a human antibody.In another embodiment, the antigen binding protein is a monoclonal antibody.
[0023] In another aspect, the present disclosure provides a pharmaceutical composition comprising at least one antigen binding protein according to any one of the preceding embodiments.
[0024] In another aspect, the disclosure provides a nucleic acid molecule encoding an antigen binding protein according to any one of the preceding embodiments.
[0025] In another aspect, the present disclosure provides a vector comprising a nucleic acid molecule encoding an antigen binding protein according to any one of the preceding embodiments.
[0026] In another aspect, the disclosure provides a host cell comprising a nucleic acid molecule encoding an antigen binding protein according to any one of the preceding embodiments, or a host cell comprising a vector comprising a nucleic acid molecule encoding an antigen binding protein according to any one of the preceding embodiments. In another aspect, the disclosure provides an antigen binding protein expressed by the vector that specifically binds to a human GIPR polypeptide.
[0027] In another aspect, the disclosure provides a method of preparing an antigen binding protein according to any one of the preceding embodiments, the method comprising expressing the antigen binding protein in a host cell that secretes the antigen binding protein, followed by purification of the antigen binding protein from the cell culture medium. In another aspect, the disclosure provides an antigen binding protein that specifically binds to a human GIPR polypeptide, purified from the host cell.
[0028] In another aspect, the disclosure provides an antigen binding protein of any one of the preceding embodiments, or a pharmaceutical composition of any one of the preceding embodiments, for use in therapy. [Brief description of the drawings]
[0029] [Figure 1] 1 shows the study design of a pharmacodynamic assay in mice for testing GIPR antibodies. [Diagram 2] 1 shows that GIPR antibody 2.63.1 attenuated GIP-induced insulin secretion. [Diagram 3] 1 shows the study design for long-term treatment of diet-induced obese mice with GIPR antibody 2.63.1. [Figure 4] 1 shows that GIPR antibody 2.63.1 reduces weight gain. [Diagram 5] 1 shows that GIPR antibody 2.63.1 reduces body fat mass. [Figure 6] 1 shows that GIPR antibody 2.63.1 reduces epididymal white adipose tissue weight. [Figure 7] 1 shows that GIPR antibody 2.63.1 reduces fasting glucose levels. [Figure 8] 1 shows that GIPR antibody 2.63.1 reduces insulin levels. [Figure 9] 1 shows that GIPR antibody 2.63.1 improves glucose tolerance. [Figure 10] 1 shows that GIPR antibody 2.63.1 lowers serum total cholesterol and triglycerides. [Figure 11] 1 shows that GIPR antibody 2.63.1 reduces hepatocyte microvacuolar changes and corresponding lipid accumulation. [Figure 12] 1 shows that GIPR antibody 2.63.1 reduces liver weight and triglyceride content. [Figure 13] FIG. 1 shows that treatment with GIPR antibody 2.63.1 reduces inflammation and infiltrating macrophage cells around adipocytes in epididymal white adipose tissue. [Figure 14A] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14B] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14C] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14D] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14E] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14F] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14G] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14H] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14I] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14J] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14K] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14L] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14M] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14N] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14O] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14P] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 14Q] The dissociation rate constant (1 / sec) for the binding of test samples to human GIPR ECD, as well as the IC60 value for inhibition of GIP binding to human GIPR ECD are measured and summarized in the graph shown. [Figure 15]Binding of 16H1 family members to human GIPR ECD, showing binding of 200 nM human GIPR ECD to anti-human GIPR antibodies of the 6H1 family captured with goat anti-human Fc antibody. [Figure 16] 1 shows the study design of a pharmacodynamic assay in mice for testing GIPR antibodies. [Figure 17] 1 shows that the GIPR antibody 5G12.006 attenuated GIP-induced insulin secretion. [Figure 18] 1 shows the study design for long-term treatment of diet-induced obese mice with GIPR antibody 5G12.006. [Figure 19] 1 shows that GIPR antibody 5G12.006 reduces weight gain. [Figure 20] 1 shows that GIPR antibody 5G12.006 improves glucose tolerance. [Figure 21] 1 shows that GIPR antibody 5G12.006 reduces glucose and insulin levels. [Figure 22] 1 shows that GIPR antibody 5G12.006 reduces liver weight. [Diagram 23] 1 shows that GIPR antibody 5G12.006 reduces total cholesterol levels. [Figure 24] 1 shows a study design for the treatment of mice with anti-GIPR2.63.1 in combination with liraglutide. [Diagram 25] 13 shows weight loss in mice treated with anti-GIPR2.63.1 in combination with liraglutide. [Figure 26] 1 shows a significant reduction in fat mass in mice treated with anti-GIPR2.63.1 in combination with liraglutide. [Figure 27] 1 shows food intake in mice treated with anti-GIPR2.63.1 in combination with liraglutide. [Figure 28] 1 shows liver, epididymal fat, and inguinal fat weights in mice treated with anti-GIPR2.63.1 in combination with liraglutide. [Figure 29]1 shows glucose tolerance in mice treated with anti-GIPR2.63.1 in combination with liraglutide. [Diagram 30] 1 shows blood glucose levels in mice treated with a combination of anti-GIPR2.63.1 and liraglutide. [Diagram 31] 1 shows plasma insulin levels in mice treated with a combination of anti-GIPR2.63.1 and liraglutide. [Diagram 32] 1 shows serum total cholesterol levels in mice treated with a combination of anti-GIPR2.63.1 and liraglutide. [Diagram 33] 1 shows serum leptin levels in mice treated with a combination of anti-GIPR2.63.1 and liraglutide. [Diagram 34] 1 shows serum triglycerides in mice treated with anti-GIPR2.63.1 in combination with liraglutide. [Diagram 35] 1 shows a study in mice treated with anti-GIPR2.63.1 in combination with liraglutide, dulaglutide, or exendin IV. [Diagram 36] 1 shows weight loss in mice treated with anti-GIPR2.63.1 in combination with liraglutide, dulaglutide, or exendin IV. [Figure 37] 1 shows fat and lean mass in mice treated with anti-GIPR2.63.1 in combination with liraglutide, dulaglutide, or exendin IV. [Figure 38] 1 shows food intake in mice treated with anti-GIPR2.63.1 in combination with liraglutide, dulaglutide, or exendin IV. [Figure 39] 1 shows insulin, glucose, and glucose tolerance in mice treated with anti-GIPR2.63.1 in combination with liraglutide, dulaglutide, or exendin IV. [Diagram 40]1 shows serum total cholesterol and triglycerides in mice treated with anti-GIPR2.63.1 in combination with liraglutide, dulaglutide, or exendin IV. [Diagram 41] The study design of anti-GIPR therapy in mice pretreated with GLP-1 analogues is shown. Diet-induced obese (DIO) mice were administered a combination of 1) saline or liraglutide (Lira) once daily and 2) vehicle or GIPR antibody (Ab) once weekly. The study outline was divided into two phases: Phase 1 consisted of two doses of liraglutide. Phase 2 consisted of administration of liraglutide in addition to GIPR Ab to mice that had completed Phase 1. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 42A] (A) shows body weight (combined graph) and (B) shows body weight (individual graph). Diet-induced obese (DIO) mice were administered 1) saline or liraglutide (Lira) once daily in combination with 2) vehicle or GIPR antibody (Ab) once weekly and the daily percent body weight change was calculated. The study was divided into two phases: Phase 1 established the percent body weight change in response to two doses of liraglutide. Phase 2 established the percent body weight change with administration of liraglutide plus GIPR Ab to mice that had completed Phase 1. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 42B](A) shows body weight (combined graph) and (B) shows body weight (individual graph). Diet-induced obese (DIO) mice were administered 1) saline or liraglutide (Lira) once daily in combination with 2) vehicle or GIPR antibody (Ab) once weekly and the daily percent body weight change was calculated. The study was divided into two phases: Phase 1 established the percent body weight change in response to two doses of liraglutide. Phase 2 established the percent body weight change with administration of liraglutide plus GIPR Ab to mice that had completed Phase 1. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Diagram 43] Food intake is shown. Diet-induced obese (DIO) mice were given a combination of 1) saline or liraglutide (Lira) once daily and 2) vehicle or GIPR antibody (Ab) once weekly and food intake was measured at three separate time periods. The study was divided into two phases: Phase 1 established the change in food intake at the start of two doses of liraglutide. Phase 2 established the change in food intake at the start and end of the study when mice had completed Phase 1 and were administered liraglutide plus GIPR Ab. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Diagram 44] Insulin is shown. Diet-induced obese (DIO) mice were administered a combination of 1) saline or liraglutide (Lira) once daily and 2) vehicle or GIPR antibody (Ab) once weekly, and insulin was measured at three separate time periods. The study was divided into two phases: Phase 1 established insulin levels before administration of two doses of liraglutide. Phase 2 established insulin levels before administration of liraglutide plus GIPR Ab to mice that had completed Phase 1, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 45A] (A) Clinical chemistry (liver enzymes). (B) Clinical chemistry (cholesterol and triglycerides). (C) Clinical chemistry (NEFA and glucose). Diet-induced obese (DIO) mice were administered 1) saline or liraglutide (Lira) once daily in combination with 2) vehicle or GIPR antibody (Ab) once weekly, and liver enzymes, lipid levels, glucose, and non-essential fatty acids were measured in three separate periods. The study was divided into two phases: Phase 1 established the levels of clinical chemistry prior to administration of two doses of liraglutide. Phase 2 established the levels of clinical chemistry prior to administration of liraglutide plus GIPR Ab to mice completing Phase 1, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 45B] (A) Clinical chemistry (liver enzymes). (B) Clinical chemistry (cholesterol and triglycerides). (C) Clinical chemistry (NEFA and glucose). Diet-induced obese (DIO) mice were administered 1) saline or liraglutide (Lira) once daily in combination with 2) vehicle or GIPR antibody (Ab) once weekly, and liver enzymes, lipid levels, glucose, and non-essential fatty acids were measured in three separate periods. The study was divided into two phases: Phase 1 established the levels of clinical chemistry prior to administration of two doses of liraglutide. Phase 2 established the levels of clinical chemistry prior to administration of liraglutide plus GIPR Ab to mice completing Phase 1, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 45C](A) Clinical chemistry (liver enzymes). (B) Clinical chemistry (cholesterol and triglycerides). (C) Clinical chemistry (NEFA and glucose). Diet-induced obese (DIO) mice were administered 1) saline or liraglutide (Lira) once daily in combination with 2) vehicle or GIPR antibody (Ab) once weekly, and liver enzymes, lipid levels, glucose, and non-essential fatty acids were measured in three separate periods. The study was divided into two phases: Phase 1 established the levels of clinical chemistry prior to administration of two doses of liraglutide. Phase 2 established the levels of clinical chemistry prior to administration of liraglutide plus GIPR Ab to mice completing Phase 1, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Diagram 46] Tissue weights are shown. Diet-induced obese (DIO) mice were administered a combination of 1) saline or liraglutide (Lira) once daily and 2) vehicle or GIPR antibody (Ab) once weekly, and tissue weights were measured at the time of tissue harvest at the end of the study. The study was divided into two phases: Phase 1 consisted of two doses of liraglutide. Phase 2 consisted of administration of liraglutide plus GIPR Ab to mice that had completed Phase 1, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 47A](A) shows plasma hormones. (B) shows plasma hormones (control). Diet-induced obese (DIO) mice were administered a combination of 1) saline or liraglutide (Lira) once daily and 2) vehicle or GIPR antibody (Ab) once weekly, and hormone levels were measured in mice from blood drawn at the end of the study. The study was divided into two phases: Phase 1 consisted of two doses of liraglutide. Phase 2 consisted of administration of liraglutide to mice that had completed Phase 1, plus administration of GIPR Ab, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 47B] (A) shows plasma hormones. (B) shows plasma hormones (control). Diet-induced obese (DIO) mice were administered a combination of 1) saline or liraglutide (Lira) once daily and 2) vehicle or GIPR antibody (Ab) once weekly, and hormone levels were measured in mice from blood drawn at the end of the study. The study was divided into two phases: Phase 1 consisted of two doses of liraglutide. Phase 2 consisted of administration of liraglutide to mice that had completed Phase 1, plus administration of GIPR Ab, and at the end of Phase 2. During Phases 1 and 2, one group of mice was co-administered with liraglutide and GIPR Ab to establish the maximum percent weight loss. [Figure 48] 1 shows the design of a long-term study of GIPR Ab in spontaneously obese cynomolgus monkeys. [Figure 49] 2G10 induces weight loss in spontaneously obese cynomolgus monkeys with or without dulaglutide. [Figure 50] 2G10 alone induces weight loss in spontaneously obese cynomolgus monkeys (baseline redraw performed on day 15 prior to initiation of 2G10 treatment). [Figure 51]2G10 blocks the increase in insulin and reduces triglyceride levels (% change from baseline) in overnight fasted spontaneously obese cynomolgus monkeys with or without dulaglutide. [Figure 52] 2G10 blocks the increase in insulin levels and reduces triglyceride levels after the treatment phase (day 45) in overnight fasted spontaneously obese cynomolgus monkeys with or without dulaglutide (raw data). [Figure 53] 2G10 did not exacerbate OGTT after the treatment phase (day 49) in overnight fasted spontaneously obese cynomolgus monkeys with or without dulaglutide. [Figure 54] 2G10 had no effect on total cholesterol, LDL-C, and HDL-C levels in overnight fasted spontaneously obese cynomolgus monkeys after the treatment phase (day 45). [Figure 55] 2G10 had no effect on glucose levels in overnight fasted normoglycemic obese cynomolgus monkeys after the treatment phase (day 45). [Figure 56] 2G10 had no effect on liver enzymes in overnight fasted spontaneously obese cynomolgus monkeys after the treatment phase (day 45). [Figure 57] Overall structure of the complex between human GIPR and Fab2G10. A) Two complex pairs are packed together in an asymmetric unit. Fab2G10 molecules are shown in schematic representation and their respective light and heavy chain combinations are colored in white and cyan or wheat and dark green. Human GIPR domains are shown in schematic magenta and orange, respectively. B) Close-up view of one of the complexes between human GIPR and Fab2G10. Molecular coloring is the same as in panel A. [Figure 58]The binding interface is shown. A) Close-up view of the binding interface with the CDR loops of Fab2G10 highlighted. The heavy and light chains of Fab2G10 are shown diagrammatically in cyan and white. The CDR loops of the heavy and light chains are coloured in the following order: CDR1: red (HC) or light red (LC), CDR2: green (HC) or light green (LC), and CDR3: blue (HC) or light blue (LC). The human GIPR is shown diagrammatically in magenta. B) Close-up view of the binding interface with the human GIPR residues highlighted. The human GIPR is shown diagrammatically in magenta and the residues interacting with Fab2G10 are coloured blue. [Figure 59] Overall structure of the complex between human GIPR and Fab2C2. A) Two complex pairs are in an antiparallel conformation in the asymmetric unit. Fab2C2 molecules are shown in schematic representation and their respective light and heavy chain combinations are colored in white and cyan or wheat and dark green. Human GIPR domains are shown in schematic magenta and orange. B) Close-up view of one of the complexes between human GIPR and Fab2C2. Molecular coloring is the same as in panel A. [Figure 60] The binding interface is shown. A) Close-up view of the binding interface with highlighted CDR loops of Fab2C2. The heavy and light chains of Fab2C2 are shown diagrammatically in cyan and white. The CDR loops of the heavy and light chains are coloured in the following order: CDR1: red (HC) or light red (LC), CDR2: green (HC) or light green (LC), and CDR3: blue (HC) or light blue (LC). Human GIPR is shown diagrammatically in magenta. B) Close-up view of the binding interface with highlighted human GIPR residues. Human GIPR is shown diagrammatically in magenta and residues interacting with Fab2C2 are coloured blue. [Figure 61]The overall structure of the complex between human GIPR and Fab6H1 is shown. The Fab molecule is shown in a schematic representation and its light and heavy chain combination is colored in white and cyan. The human GIPR domain is shown in magenta. [Figure 62] The binding interface is shown. A) Close-up view of the binding interface with highlighted CDR loops of Fab6H1. The heavy and light chains of Fab6H1 are shown diagrammatically in cyan and white. The CDR loops of the heavy and light chains are coloured in the following order: CDR1: red (HC) or light red (LC), CDR2: green (HC) or light green (LC), and CDR3: blue (HC) or light blue (LC). Human GIPR is shown diagrammatically in magenta. B) Close-up view of the binding interface with highlighted human GIPR residues. Human GIPR is shown diagrammatically in magenta and residues interacting with Fab6H1 are coloured blue. [Figure 63] The overall structure of the complex between human GIPR and Fab17H11 is shown. The Fab molecule is shown in a schematic representation and its light and heavy chain combination is colored in white and cyan. The human GIPR domain is shown in magenta. [Figure 64] The binding interface is shown. A) Close-up view of the binding interface with highlighted CDR loops of Fab17H11. The heavy and light chains of Fab17H11 are shown diagrammatically in cyan and white. The CDR loops of the heavy and light chains are coloured in the following order: CDR1: red (HC) or light red (LC), CDR2: green (HC) or light green (LC), and CDR3: blue (HC) or light blue (LC). Human GIPR is shown diagrammatically in magenta. B) Close-up view of the binding interface with highlighted human GIPR residues. Human GIPR is shown diagrammatically in magenta and residues interacting with Fab17H11 are coloured blue. [Figure 65-1]Surface representation of antibody epitopes is shown. The GIPR ECD domain is shown in pink surface representation. Epitopes for four antibodies, A) 2G10, B) 2C2, C) 6H1, and D) 17H11, are highlighted in blue, green, cyan, and orange, respectively. In panel E, the epitope for Gipg013 (PDB:4JH0) is highlighted in red. [Figure 65-2] Surface representation of antibody epitopes is shown. The GIPR ECD domain is shown in pink surface representation. Epitopes for four antibodies, A) 2G10, B) 2C2, C) 6H1, and D) 17H11, are highlighted in blue, green, cyan, and orange, respectively. In panel E, the epitope for Gipg013 (PDB:4JH0) is highlighted in red. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0030] The present disclosure provides a method for treating metabolic disorders such as disorders of glucose metabolism (e.g., type 2 diabetes, elevated glucose levels, elevated insulin levels, dyslipidemia, metabolic syndrome (syndrome X or insulin resistance syndrome), diabetes, metabolic acidosis, type 1 diabetes, obesity, and conditions exacerbated by obesity) by blocking or interfering with the biological activity of GIP. In one embodiment, an isolated human GIPR binding protein is administered in a therapeutically effective amount to a subject in need thereof. Methods of administration and delivery are also provided.
[0031] Recombinant methods for polypeptides and nucleic acids used herein, including the Examples, are generally those set forth in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989), or Current Protocols in Molecular Biology (Ausubel et al., eds., Green Publishers Inc. and Wiley and Sons 1994), both of which are incorporated herein by reference for all purposes.
[0032] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.
[0033] As used herein, unless otherwise defined, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those of ordinary skill in the art. Further, unless the context otherwise requires, singular terms shall include the plural and plural terms shall include the singular.
[0034] Generally, the nomenclature used in connection with, and techniques for, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry, and hybridization described herein are well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present application are generally performed according to conventional methods well known in the art, and such methods and techniques are described in various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992); and Harlow and Lane Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1990). These documents are incorporated herein by reference. Enzymatic reactions and purification techniques are performed according to manufacturer's instructions, as commonly accomplished in the art, or as described herein. The terminology used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are well known and commonly used in the art. Standard techniques may be used for the purposes of chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
[0035] It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc. described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the disclosure, which is defined only by the claims.
[0036] Except as otherwise noted in the examples, all numbers indicating quantities of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about." The term "about" when used in connection with percentages can mean ±1%.
[0037] As used herein, "a" and "an" follow their convention and mean "one or more" unless otherwise noted.
[0038] As used herein, the terms "amino acid" and "residue" are used interchangeably and when used in the context of a peptide or polypeptide refer to both naturally occurring and synthetic amino acids, as well as amino acid analogs, amino acid mimetics, and non-naturally occurring amino acids that are chemically similar to the naturally occurring amino acids.
[0039] "Naturally occurring amino acids" are those amino acids encoded by the genetic code, as well as those amino acids encoded by the genetic code that are synthesized and subsequently modified (e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine). Amino acid analogs are compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon bonded to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methylmethionine sulfonium. Such analogs may have modified R groups (e.g., norleucine) or modified peptide backbones, but will retain the same basic chemical structure as a naturally occurring amino acid.
[0040] "Amino acid mimetics" are chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. Examples include methacryloyl or acryloyl derivatives of amides, β-amino acids, γ-amino acids, δ-amino acids (such as piperidine-4-carboxylic acid), and the like.
[0041] A "non-naturally occurring amino acid" is a compound that has the same basic chemical structure as a naturally occurring amino acid, but is not incorporated into a growing polypeptide chain by the translation complex. "Non-naturally occurring amino acids" also include, but are not limited to, amino acids that arise by modification (e.g., post-translational modification) of naturally encoded amino acids (including, but not limited to, the 20 common amino acids), but that are not themselves naturally incorporated into a growing polypeptide chain by the translation complex. An exemplary list of non-naturally occurring amino acids that can be inserted into or used in place of wild-type residues in a polypeptide sequence includes, but is not limited to, β-amino acids, homoamino acids, cyclic amino acids, and amino acids with side chain derivatization. Examples include citrulline (Cit), homocitrulline (hCit), Nα-methylcitrulline (NMeCit), Nα-methylhomocitrulline (Nα-MeHoCit), ornithine (Orn), Nα-methylornithine (Nα-MeOrn or NMeOrn), sarcosine (Sar), homolysine (hLys or hK), homoarginine (hArg or hR), homoglutamine (hQ), Nα-methylarginine (NM eR), Nα-methylleucine (Nα-MeL or NMeL), N-methylhomolysine (NMeHoK), Nα-methylglutamine (NMeQ), norleucine (Nle), norvaline (Nva), 1,2,3,4-tetrahydroisoquinoline (Tic), octahydroindole-2-carboxylic acid (Oic), 3-(1-naphthyl)alanine (1-Nal), 3-(2-naphthyl)alanine (2-Nal), 1,2,3,4-Tetrahydroisoquinoline (Tic), 2-indanylglycine (IgI), para-iodophenylalanine (pI-Phe), para-aminophenylalanine (4AmP or 4-amino-Phe), 4-guanidinophenylalanine (Guf), glycyrrhizin (abbreviated as "K(N-glycyl)" or "K(glycyl)" or "K(gly)"), nitrophenylalanine (nitrophe), aminophenylalanine (aminophe or amino-Phe), benzylphenylalanine (benzylphe), γ-carboxyglutamic acid ( γ-carboxyglu), hydroxyproline (hydroxypro), p-carboxyl-phenylalanine (Cpa), α-aminoadipic acid (Aad), Nα-methylvaline (NMeVal), N-α-methylleucine (NMeLeu), Nα-methylnorleucine (NMeNle), cyclopentylglycine (Cpg), cyclohexylglycine (Chg), acetylarginine (acetylarg), α,β-diaminopropionic acid (Dpr), α,γ-diaminobutanoic acid (Dab), diaminopropionic acid (Dap), cyclohexylalanine (C ha), 4-methyl-phenylalanine (MePhe), β,β-diphenyl-alanine (BiPhA), aminobutanoic acid (Abu), 4-phenyl-phenylalanine (or biphenylalanine, 4Bip), α-amino-isobutanoic acid (Aib), beta-alanine, beta-aminopropionic acid, piperidinic acid, aminocaproic acid, aminoheptanoic acid, aminopimelic acid, desmosine, diaminopimelic acid, N-ethylglycine, N-ethylasparagine, hydroxylysine, allo-hydroxylysine, isodesmosine, allo-isoleucine, N- Included are methylglycine, N-methylisoleucine, N-methylvaline, 4-hydroxyproline (Hyp), γ-carboxyglutamate, ε-N,N,N-trimethyllysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, ω-methylarginine, 4-amino-O-phthalic acid (4APA), and other similar amino acids, as well as derivatized forms of any of those specifically mentioned, either in the L- or D-form, with the abbreviations listed in parentheses.
[0042] The term "isolated nucleic acid molecule" refers to a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases, read from the 5' to the 3' end (e.g., a GIPR nucleic acid sequence provided herein) or an analog thereof, which is free of at least about 50 percent of the polypeptides, peptides, lipids, carbohydrates, polynucleotides, or other materials naturally found with the nucleic acid when the total nucleic acid is isolated from a cellular source. Preferably, an isolated nucleic acid molecule is substantially free of any other contaminating nucleic acid molecules or other molecules that are found in the nucleic acid's natural environment and that would interfere with its use in polypeptide production, or its therapeutic, diagnostic, prophylactic, or research uses.
[0043] The term "isolated polypeptide" refers to a polypeptide (e.g., a GIPR polypeptide sequence provided herein, or an antigen binding protein of the invention) that has been removed from at least about 50 percent of the polypeptides, peptides, lipids, carbohydrates, polynucleotides, or other materials that are naturally found with the polypeptide when it is isolated from a cellular source. Preferably, an isolated polypeptide is substantially free of any other contaminating polypeptides or other contaminants that are found in its natural environment and that would interfere with its therapeutic, diagnostic, prophylactic, or research use.
[0044] The term "encoding" refers to a polynucleotide sequence that codes for one or more amino acids. The term does not require a start or stop codon.
[0045] The terms "identical" and "percent identity" in the context of two or more nucleic acid or polypeptide sequences refer to two or more sequences or subsequences that are identical. "Percent identity" refers to the percent of residues that are identical between the amino acids or nucleotides in the compared molecules, and is calculated based on the size of the smallest of the molecules being compared. In such calculations, gaps in the alignment, if any, can be addressed by a specific mathematical model or computer program (i.e., an "algorithm"). Methods that can be used to calculate the identity of aligned nucleic acids or polypeptides include those described in Computational Molecular Biology, (Lesk, A. M., ed.), (1988) New York: Oxford University Press, Biocomputing Informatics and Genome Projects, (Smith, D. W., ed.), 1993, New York: Academic Press, Computer Analysis of Sequence Data, Part I, (Griffin, A. M., and Griffin, H. G., eds.), 1994, New Jersey: Humana Press, von Heinje, G., (1987) Sequence Analysis in Molecular Biology, New York: Academic Press, Sequence Analysis Primer, (Gribskov, M. and Devereux, J., eds.), 1991, New York: M. Stockton Press, and Carillo et al., (1988) SIAM J. Applied Math. 48:1073.
[0046] In calculating percent identity, the sequences to be compared are aligned in a way that maximizes the match between sequences. The computer program used to determine percent identity is the GCG program package, which includes GAP (Devereux et al., (1984) Nucl. Acid Res. 12:387; Genetics Computer Group, University of Wisconsin, Madison, WI). The computer algorithm GAP is used to align two polypeptides or polynucleotides whose percent sequence identity is to be determined. The sequences are aligned so that their respective amino acid or nucleotide matches are optimal (the "match span" is determined by the algorithm). A gap opening penalty (calculated as 3x average diagonal element, where "average diagonal element" is the average of the diagonal elements of the comparison matrix used. A "diagonal element" is the score or number assigned to each perfect amino acid match by a particular comparison matrix) and gap extension penalty (usually 1 / 10th the gap opening penalty), as well as a comparison matrix such as PAM250 or BLOSUM62, are used in conjunction with the algorithm. In certain embodiments, a standard comparison matrix (for the PAM250 comparison matrix, see Dayhoff et al., (1978) Atlas of Protein Sequence and Structure 5:345-352; for the BLOSUM62 comparison matrix, see Henikoff et al., (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919) are also used by the algorithm.
[0047] Recommended parameters for determining percent identity of a polypeptide or nucleotide sequence using the GAP program include the following:
[0048] Algorithm: Needleman et al., 1970, J. Mol. Biol. 48:443-453
[0049] Comparison matrix: BLOSUM62 by Henikoff et al., 1992, supra
[0050] Gap penalty: 12 (exception: no penalty for end gaps)
[0051] Gap length penalty: 4
[0052] Similarity tolerance: 0
[0053] When using a certain alignment scheme for aligning two amino acid sequences, only a short region may match in the two sequences.This short aligned region may have very high sequence identity even if there is no significant relationship between the two full-length sequences.Therefore, if desired, the alignment method selected (for example, GAP program) can be adjusted to obtain an alignment spanning at least 50 consecutive amino acids in target polypeptide.
[0054] The terms "GIPR polypeptide" and "GIPR protein" are used interchangeably and refer to naturally occurring wild-type polypeptides expressed in mammals, such as humans or mice, including naturally occurring alleles (e.g., naturally occurring allelic forms of human GIPR proteins). For purposes of the present disclosure, the term "GIPR polypeptide" can be used interchangeably to refer to any full-length GIPR polypeptide, such as SEQ ID NO: 3141 (consisting of 466 amino acid residues and encoded by the nucleotide sequence of SEQ ID NO: 3142), or SEQ ID NO: 3143 (consisting of 430 amino acid residues and encoded by the nucleic acid sequence of SEQ ID NO: 3144), or SEQ ID NO: 3145 (consisting of 493 amino acid residues and encoded by the nucleic acid sequence of SEQ ID NO: 3146), or SEQ ID NO: 3147 (consisting of 460 amino acid residues and encoded by the nucleic acid sequence of SEQ ID NO: 3148), or SEQ ID NO: 3149 (consisting of 230 amino acid residues and encoded by the nucleic acid sequence of SEQ ID NO: 3150).
[0055] The term "GIPR polypeptide" also encompasses GIPR polypeptides in which a naturally occurring GIPR polypeptide sequence (e.g., SEQ ID NO: 3141, SEQ ID NO: 3143, or SEQ ID NO: 3145) has been modified. Such modifications include one or more amino acid substitutions, including but not limited to, substitutions with non-naturally occurring amino acids, non-naturally occurring amino acid analogs, and amino acid mimetics.
[0056] In various embodiments, the GIPR polypeptide comprises an amino acid sequence that is at least about 85% identical to a naturally occurring GIPR polypeptide (e.g., SEQ ID NO:3141, SEQ ID NO:3143, or SEQ ID NO:3145). In other embodiments, the GIPR polypeptide comprises an amino acid sequence that is at least about 90%, or about 95%, about 96%, about 97%, about 98%, or about 99% identical to a naturally occurring GIPR polypeptide amino acid sequence (e.g., SEQ ID NO:3141, SEQ ID NO:3143, or SEQ ID NO:3145). Such a GIPR polypeptide preferably, but not necessarily, has at least one activity of a wild-type GIPR polypeptide, such as the ability to bind to GIP. The present invention also encompasses nucleic acid molecules that encode such GIPR polypeptide sequences.
[0057] The term "GIPR activity assay" (also referred to as "GIPR functional assay") refers to an assay that can be used to measure the activity of GIP or GIP-binding protein in a cellular context. In one embodiment, the "activity" (or "functional") assay can be a cAMP assay in GIPR-expressing cells (GIP can induce cAMP signaling), and the activity of GIP / GIPR-binding protein can be measured in the presence / absence of GIP ligand, in which case IC50 / EC50 and degree of inhibition / activation can be obtained (Biochemical and Biophysical Research Communications (2002) 290:1420-1426). In another embodiment, the "activity" (or "function") assay can be an insulin secretion assay in pancreatic beta cells (where GIP can induce glucose-dependent insulin secretion), and the activity of the GIP / GIPR binding protein can be measured in the presence / absence of a GIP ligand, in which case the IC50 / EC50 and degree of inhibition / activation can be obtained (Biochemical and Biophysical Research Communications (2002) 290:1420-1426).
[0058] The term "GIPR binding assay" refers to an assay that can be used to measure the binding of GIP to GIPR. In one embodiment, "GIPR binding assay" can be an assay that uses FMAT or FACS to measure the binding of fluorescently labeled GIP to GIPR-expressing cells, and the activity of GIP / GIPR binding protein can be measured by displacing the binding of fluorescently labeled GIP to GIPR-expressing cells. In another embodiment, "GIPR binding assay" can be an assay that measures the binding of radiolabeled GIP to GIPR-expressing cells, and the activity of GIP / GIPR binding protein can be measured by displacing the binding of radiolabeled GIP to GIPR-expressing cells (Biochimica et Biophysica Acta (2001) 1547: 143-155).
[0059] The terms "GIP," "gastric inhibitory polypeptide," "glucose-dependent insulinotropic peptide," and "GIP ligand" are used interchangeably and refer to naturally occurring wild-type polypeptides expressed in mammals, such as humans or mice, including naturally occurring alleles (e.g., naturally occurring allelic forms of the human GIP protein). For purposes of this disclosure, the term "GIP" can be used interchangeably to refer to any mature GIP polypeptide.
[0060] The sequence of the 42 amino acids of mature human GIP is:
[0061] YAEGTFISDY SIAMDKIHQQ DFVNWLLAQK GKKNDWKHNI TQ (sequence number 3151)
[0062] and
[0063] tatgcggaag gcacctttat tagcgattat agcattgcga tggataaaat tcatcagcag gattttgtga actggctgct ggcgcagaaa ggcaaaaaaa acgattggaa acataacatt acccag (SEQ ID NO: 3152) It is encoded by the DNA sequence:
[0064] The sequence of the 42 amino acids of mature mouse GIP is:
[0065] YAEGTFISDY SIAMDKIRQQ DFVNWLLAQR GKKSDWKHNI TQ (sequence number 3153)
[0066] and
[0067] It is encoded by the DNA sequence tatgcggaag gcacctttat tagcgattat agcattgcga tggataaaat tcgccagcag gattttgtga actggctgct ggcgcagcgc ggcaaaaaaa gcgattggaa acataacatt acccag (sequence number 3154).
[0068] The sequence of the 42 amino acids of mature rat GIP is:
[0069] YAEGTFISDY SIAMDKIRQQ DFVNWLLAQK GKKNDWKHNL TQ (sequence number 3155)
[0070] and
[0071] tatgcggaag gcacctttat tagcgattat agcattgcga tggataaaat tcgccagcag gattttgtga actggctgctg gcgcagaaag gcaaaaaaaa cgattggaaa cataacctga cccag (SEQ ID NO: 3156) It is encoded by the DNA sequence:
[0072] As used herein, "antigen binding protein" refers to any protein that specifically binds to a particular target antigen, such as a GIPR polypeptide (e.g., a human GIPR polypeptide such as those provided in SEQ ID NO: 3141, SEQ ID NO: 3143, or SEQ ID NO: 3145). The term encompasses intact antibodies comprising at least two full-length heavy chains and two full-length light chains, as well as derivatives, mutants, fragments, and variants thereof. Examples of antibody fragments include Fab fragments, Fab' fragments, F(ab') fragments, and F(ab') fragments. 2 Antigen binding proteins also include domain antibodies, such as nanobodies and scFvs, which are described further below.
[0073] In general, a GIPR antigen-binding protein is said to "specifically bind" to its target antigen, GIPR, when the antigen-binding protein exhibits essentially background binding to non-GIPR molecules. However, an antigen-binding protein that specifically binds to GIPR may cross-react with GIPR polypeptides from different species. Typically, a GIPR antigen-binding protein has a dissociation constant (KD) of ≦10 as measured via surface plasma resonance techniques (e.g., BIACore, GE-Healthcare Uppsala, Sweden) or equilibrium exclusion techniques (KinExA, Sapidyne, Boise, Idaho). -7 M. A GIPR antigen binding protein specifically binds to human GIPR when it has a KD of ≦5×10 as measured using the methods described. -9 M specifically binds human GIPR with "high affinity" when the KD, as measured using the described method, is ≦5×10 -10 When M, it specifically binds to human GIPR with "very high affinity."
[0074] "Antigen binding region" refers to a protein or a portion of a protein that specifically binds to a particular antigen. For example, that portion of an antigen binding protein that contains amino acid residues that interact with an antigen and confer its specificity and affinity for the antigen to the antigen is referred to as the "antigen binding region." An antigen binding region typically includes one or more "complementary binding regions" ("CDRs") of an immunoglobulin, single-chain immunoglobulin, or camelid antibody. Certain antigen binding regions also include one or more "framework" regions. "CDRs" are amino acid sequences that contribute to the specificity and affinity of antigen binding. "Framework" regions can facilitate binding between the antigen binding region and the antigen by helping to maintain the proper conformation of the CDRs.
[0075] A "recombinant protein," including a recombinant GIPR antigen binding protein, is a protein prepared using recombinant techniques, i.e., through the expression of a recombinant nucleic acid as described herein. Methods and techniques for producing recombinant proteins are well known in the art.
[0076] The term "antibody" refers to an intact immunoglobulin of any isotype, or a fragment thereof that can compete with the intact antibody for specific binding to a target antigen, including, for example, chimeric antibodies, humanized antibodies, fully human antibodies, and bispecific antibodies. Thus, an "antibody" is a type of antigen-binding protein. An intact antibody will generally contain at least two full-length heavy chains and two full-length light chains. An antibody may be derived from only a single source, or may be "chimeric," i.e., different portions of the antibody may be derived from two different antibodies, as further described below. Antigen-binding proteins, antibodies, or binding fragments may be produced in hybridomas, by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies.
[0077] The term "light chain" as used with respect to an antibody or fragment thereof includes a full-length light chain and fragments thereof having sufficient variable region sequence to confer binding specificity. A full-length light chain contains a variable region domain (VL) and a constant region domain (CL). The variable region domain of the light chain is located at the amino-terminus of the polypeptide. Light chains include kappa chains and lambda chains.
[0078] The term "heavy chain" as used with respect to an antibody or fragment thereof includes a full-length heavy chain and fragments thereof having sufficient variable region sequence to confer binding specificity. A full-length heavy chain contains a variable region domain (VH) and three constant region domains (CH1, CH2, and CH3). The VH domain is located at the amino-terminus of the polypeptide, the CH domain is located at the carboxyl-terminus, and CH3 is located closest to the carboxy-terminus of the polypeptide. The heavy chain can be of any isotype, including IgG (including IgG1, IgG2, IgG3, and IgG4 subtypes), IgA (including IgA1 and IgA2 subtypes), IgM, and IgE.
[0079] As used herein, the term "immunologically functional fragment" (or simply "fragment") of an antibody or immunoglobulin chain (heavy or light chain) is an antigen-binding protein that lacks at least some of the amino acids present in the full-length chain, but that contains a portion of an antibody (regardless of how that portion is obtained or synthesized) that has the ability to specifically bind to an antigen. Such a fragment is biologically active in that it specifically binds to a target antigen and can compete with other antigen-binding proteins, including intact antibodies, for specific binding to a given epitope.
[0080] Such biologically active fragments may be produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of antigen-binding proteins, including intact antibodies. Immunologically functional immunoglobulin fragments include, but are not limited to, Fab fragments, Fab' fragments, and F(ab') fragments. 2Contains fragments.
[0081] In another embodiment are Fvs, domain antibodies, and scFvs, which may be derived from the antibodies of the invention.
[0082] It is further contemplated that a functional portion of the antigen binding proteins disclosed herein, such as, for example, one or more CDRs, can be covalently linked to a second protein or small molecule to create a therapeutic agent that is directed to a specific target in the body, has bifunctional therapeutic properties, or has extended serum half-life.
[0083] A "Fab fragment" is composed of one light chain and the CH1 and variable regions of one heavy chain. The heavy chain of a Fab molecule cannot form disulfide bonds with another heavy chain molecule.
[0084] The "Fc" region comprises two heavy chain fragments comprising the CH2 and CH3 domains of an antibody. The two heavy chain fragments are held together by two or more disulfide bonds and hydrophobic interactions of the CH3 domain.
[0085] A "Fab' fragment" comprises one light chain and a portion of one heavy chain containing the VH domain, the CH1 domain, and also the region between the CH1 and CH2 domains, such that an F(ab')2 molecule can be formed by the formation of interchain disulfide bonds between the two heavy chains of the two Fab' fragments.
[0086] An "F(ab')2 fragment" comprises two light chains and two heavy chains that contain a portion of the constant region between the CH1 and CH2 domains, such that an interchain disulfide bond is formed between the two heavy chains. Thus, an F(ab')2 fragment is composed of two Fab' fragments held together by disulfide bonds between the two heavy chains.
[0087] The "Fv region" comprises the variable regions from both the heavy and light chains, but lacks the constant regions.
[0088] A "single chain antibody" or "scFv" is an Fv molecule in which the heavy and light chain variable regions are linked by a flexible linker to form a single polypeptide chain that forms the antigen-binding region. scFvs are discussed in detail in International Patent Application Publication No. WO 88 / 01649, and U.S. Patent Nos. 4,946,778 and 5,260,203, the disclosures of which are incorporated by reference.
[0089] A "domain antibody" or "single-chain immunoglobulin" is an immunologically functional immunoglobulin fragment that contains only the variable region of a heavy chain or only the variable region of a light chain. Examples of domain antibodies include Nanobodies®. In some cases, two or more VH regions are covalently linked via a peptide linker to create a bivalent domain antibody. The two VH regions of a bivalent domain antibody can target the same or different antigens.
[0090] A "bivalent antigen-binding protein" or a "bivalent antibody" comprises two antigen-binding regions. In some cases, the two binding regions have the same antigen specificity. Bivalent antigen-binding proteins and bivalent antibodies may be bispecific, see below.
[0091] A "multispecific antigen binding protein" or "multispecific antibody" is one that targets multiple antigens or epitopes.
[0092] A "bispecific", "dual-specific" or "bifunctional" antigen-binding protein or antibody is a hybrid antigen-binding protein or antibody, respectively, that has two different antigen-binding sites. Bispecific antigen-binding proteins and antibodies are a type of multispecific antigen-binding protein or antibody, which may be generated by a variety of methods, including but not limited to, fusion of hybridomas or linking of Fab' fragments. See, for example, Songsivilai and Lachmann, 1990, Clin. Exp. Immunol. 79:315-321; Kostelny et al., 1992, J. Immunol. 148:1547-1553. The two binding sites of a bispecific antigen-binding protein or antibody will bind to two different epitopes, which may be present on the same or different protein targets.
[0093] The term "compete" when used in the context of an antigen binding protein (e.g., an antibody), means that competition between antigen binding proteins is determined by an assay in which the antigen binding protein (e.g., an antibody or an immunologically functional fragment thereof) under test blocks or inhibits specific binding of a reference antigen binding protein to a common antigen (e.g., GIPR or a fragment thereof). Various types of competitive binding assays can be used, such as solid-phase direct or indirect radioimmunoassays (RIAs), solid-phase direct or indirect enzyme immunoassays (EIAs), sandwich competition assays (see, e.g., Stahli et al., 1983, Methods in Enzymology 9:242-253), solid-phase direct biotin-avidin EIAs (see, e.g., Kirkland et al., 1986, J. Immunol. 137:3614-3619), solid-phase direct label assays, solid-phase direct label sandwich assays (see, e.g., Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press), solid-phase direct label RIAs using I-125 labels (see, e.g., Morel et al., 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press), and the like. al., 1988, Molec. Immunol. 25:7-15), solid phase direct biotin-avidin EIA (see, e.g., Cheung, et al., 1990, Virology 176:546-552), and direct label RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82) can be used. Typically, such assays use purified antigen bound to a solid surface or cells bearing either such antigen, an unlabeled test antigen binding protein, and a labeled reference antigen binding protein. Competitive inhibition is measured by determining the amount of label bound to the solid surface or cells in the presence of the test antigen binding protein. Typically, the test antigen binding protein is present in excess. Additional details regarding methods for determining competitive binding are provided in the Examples herein.Typically, when a competing antigen binding protein is present in excess, the competing antigen binding protein will inhibit specific binding of the reference antigen binding protein to a common antigen by at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%. In some cases, binding is inhibited by at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% or more.
[0094] The term "antigen" refers to a molecule or portion of a molecule that has the ability to be bound by a selective binding agent, such as an antigen-binding protein (including, for example, an antibody), and that can be used in an animal to generate antibodies capable of binding to that antigen. An antigen can have one or more epitopes that have the ability to interact with different antigen-binding proteins (e.g., antibodies).
[0095] The term "epitope" is a portion of a molecule that undergoes binding by an antigen-binding protein (e.g., an antibody). The term includes any determinant that has the ability to specifically bind to an antigen-binding protein, such as an antibody. An epitope can be contiguous or discontinuous (discontinuous) (e.g., in a polypeptide, amino acid residues that are not contiguous with each other in the polypeptide sequence but have connections in the molecule undergo binding by an antigen-binding protein). A conformational epitope is an epitope that is present in the conformation of the active protein but not in the denatured protein. In certain embodiments, an epitope can be mimetic in that it contains a three-dimensional structure similar to the epitope used to generate the antigen-binding protein, but does not contain, or contains only some of, the amino acid residues found in the epitope used to generate the antigen-binding protein. Epitopes are most often present in proteins, but in some cases can be present in other types of molecules, such as nucleic acids. Epitopic determinants may include chemically active surface groupings of molecules, such as amino acids, sugar side chains, phosphate groups, or sulfonyl groups, and may have specific three-dimensional structural characteristics and / or specific charge characteristics. In general, an antigen-binding protein specific for a particular target antigen will preferentially recognize epitopes present on the target antigen in a complex mixture of proteins and / or macromolecules.
[0096] As used herein, "substantially pure" means that the molecule of the stated species is the predominant species present, i.e., it is more abundant on a molar basis than any other individual species in the same mixture. In certain embodiments, a substantially pure molecule is a composition in which the target species constitutes at least 50% (on a molar basis) of all macromolecular species present. In other embodiments, a substantially pure composition will constitute at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of all macromolecular species present in the composition. In other embodiments, the target species is purified to essential homogeneity, such that contaminating species cannot be detected in the composition by conventional detection methods, and thus the composition consists of a single detectable macromolecular species.
[0097] The term "treatment" refers to any indication of success in treating or ameliorating an injury, condition, or disease state, including any objective or subjective parameter, such as abatement, mitigation, or reduction of symptoms, or an improvement in the patient's tolerance of the injury, condition, or disease state, a slowing of the rate of deterioration or decline, a less debilitating end point of deterioration, or an improvement in the patient's physical or mental well-being. The treatment or amelioration of symptoms may be based on objective or subjective parameters, including the results of a physical examination, a neuropsychiatric examination, and / or a psychiatric evaluation. For example, certain methods presented herein successfully treat cardiovascular disease, such as atherosclerosis, by reducing the incidence of cardiovascular disease, inducing remission of cardiovascular disease, and / or ameliorating symptoms associated with cardiovascular disease.
[0098] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of a symptom, eliminate a symptom and / or an underlying cause, prevent the onset of a symptom and / or its underlying cause, and / or ameliorate or treat damage caused by or associated with a disease condition (e.g., diabetes, obesity, dyslipidemia, elevated glucose levels, elevated insulin levels, or diabetic nephropathy). In some embodiments, an effective amount is a therapeutically effective amount or a prophylactically effective amount. A "therapeutically effective amount" is an amount sufficient to treat a disease condition (e.g., atherosclerosis) or symptom, particularly a condition or symptom associated with a disease condition, or to prevent, prevent, delay, or reverse the progression of a disease condition or any other undesirable symptoms associated with a disease, however caused. A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, such as preventing or delaying the onset (or recurrence) of a disease condition, or reducing the likelihood of the onset (or recurrence) of a disease condition or associated symptoms. The full therapeutic or prophylactic effect does not necessarily occur by administration of a single dose, and may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount may be administered in one or more administrations.
[0099] As used herein, the terms "therapeutically effective dose" and "therapeutically effective amount" refer to an amount of GIPR binding protein that elicits a biological or medicinal response in a tissue system, animal, or human being sought by a researcher, physician, or other clinician, including reduction or amelioration of symptoms of the disease or disorder being treated, i.e., an amount of GIPR binding protein that supports an observable level of one or more desired biological or medicinal responses, such as reduced blood glucose, insulin, triglyceride, or cholesterol levels, weight loss, or improved glucose tolerance, energy expenditure, or insulin sensitivity.
[0100] The term "polynucleotide" or "nucleic acid" includes both single-stranded and double-stranded nucleotide polymers. The nucleotides that make up a polynucleotide can be ribonucleotides or deoxyribonucleotides, or modified forms of either type of nucleotide. Modifications include base modifications such as bromouridine and inosine derivatives, ribose modifications such as 2',3'-dideoxyribose, and modifications of internucleotide linkages such as phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates, phosphoroaniladates, and phosphoroamidates.
[0101] The term "oligonucleotide" refers to a polynucleotide containing 200 or fewer nucleotides. In some embodiments, the oligonucleotide is 10-60 bases in length. In other embodiments, the oligonucleotide is 12, 13, 14, 15, 16, 17, 18, 19, or 20-40 nucleotides in length. The oligonucleotide can be single-stranded or double-stranded, for example, for use in constructing mutant genes. The oligonucleotide can be a sense oligonucleotide or an antisense oligonucleotide. The oligonucleotide can include a label, including a radiolabel, a fluorescent label, a hapten, or an antigenic label for detection assays. The oligonucleotide may be used, for example, as a PCR primer, a cloning primer, or a hybridization probe.
[0102] An "isolated nucleic acid molecule" refers to DNA or RNA of genomic, mRNA, cDNA, or synthetic origin, or any combination thereof, where the isolated polynucleotide is unaccompanied by all or a portion of a polynucleotide found in nature, or is linked to a polynucleotide with which it is not naturally linked. For purposes of this disclosure, a "nucleic acid molecule comprising" a particular nucleotide sequence should be understood not to encompass an intact chromosome. An isolated nucleic acid molecule that "comprises" a particular nucleic acid sequence may, in addition to the particular sequence, include sequences encoding up to 10 or even up to 20 other proteins or portions thereof, or may include operably linked regulatory sequences that control expression of the coding region of the described nucleic acid sequence, and / or may include vector sequences.
[0103] Unless otherwise stated, the left end of any single-stranded polynucleotide sequence discussed herein is the 5' end, and the left direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction in which nascent RNA transcripts are added from 5' to 3' is referred to as the transcription direction. The sequence region present on the DNA strand with the same sequence as the RNA transcript and located 5' to the 5' end of the RNA transcript is referred to as the "upstream sequence". The sequence region present on the DNA strand with the same sequence as the RNA transcript and located 3' to the 3' end of the RNA transcript is referred to as the "downstream sequence".
[0104] The term "control sequence" refers to a polynucleotide sequence capable of influencing the expression and processing of coding sequences to which it is ligated. The nature of such control sequences may depend on the host organism. In certain embodiments, control sequences for prokaryotes may include a promoter, a ribosomal binding site, and a transcription termination sequence. For example, control sequences for eukaryotes may include a promoter containing one or more recognition sites for transcription factors, a transcription enhancer sequence, and a transcription termination sequence. "Control sequences" may include leader sequences and / or fusion partner sequences.
[0105] The term "vector" refers to any molecule or entity (eg, nucleic acid, plasmid, bacteriophage, or virus) used to introduce protein-coding information into a host cell.
[0106] The term "expression vector" or "expression construct" refers to a vector that is suitable for transformation of a host cell and contains nucleic acid sequences that direct and / or control (in cooperation with the host cell) the expression of one or more heterologous coding regions operably linked thereto. Expression constructs can include, but are not limited to, sequences that affect or control transcription, translation, and, if introns are present, affect RNA splicing of the coding regions operably linked thereto.
[0107] As used herein, "operably linked" means that the components to which the term is applied are in a relationship that allows them to carry out their specific functions under appropriate conditions. For example, a control sequence "operably linked" to a protein coding sequence in a vector is ligated thereto such that expression of the protein coding sequence is achieved under conditions compatible with the transcriptional activity of the control sequences.
[0108] The term "host cell" refers to a cell that has been transformed with a nucleic acid sequence and thereby expresses a gene of interest. The term includes the progeny of a parent cell, whether or not the progeny is identical in morphology or genetic make-up to the original parent cell, so long as the gene of interest is present.
[0109] The terms "polypeptide" or "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues are analogs or mimetics of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms can also encompass amino acid polymers that have been modified, for example, by the addition of carbohydrate residues to form glycoproteins, or by phosphorylation. Polypeptides and proteins can be produced by naturally occurring and non-naturally occurring cells, or by genetically engineered or recombinant cells, and include molecules having the amino acid sequence of a naturally occurring protein, or molecules having one or more amino acid deletions, additions, and / or substitutions of the naturally occurring sequence. The terms "polypeptide" and "protein" specifically encompass GIPR antigen binding proteins, antibodies, or sequences having one or more amino acid deletions, additions, and / or substitutions of antigen binding proteins. The term "polypeptide fragment" refers to a polypeptide having an amino-terminal deletion, a carboxyl-terminal deletion, and / or an internal deletion compared to the full-length protein. Such fragments can also include modified amino acids compared to the full-length protein. In certain embodiments, the fragments are between about 5 and 500 amino acids in length. For example, fragments can be at least 5, at least 6, at least 8, at least 10, at least 14, at least 20, at least 50, at least 70, at least 100, at least 110, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, or at least 450 amino acids in length. Useful polypeptide fragments include immunologically functional fragments of antibodies that contain the binding domain.
[0110] The term "isolated protein" means that the subject protein is (1) free from at least some of the other proteins with which it is normally expected to be found, (2) essentially free from other proteins from the same source, e.g., the same species, (3) expressed by cells from a different species, (4) free from at least about 50 percent of the polynucleotides, lipids, carbohydrates, or other materials that naturally accompany it, (5) operably associated (by covalent or non-covalent interactions) with polypeptides that are not naturally associated with it, or (6) not naturally occurring. Typically, an "isolated protein" constitutes at least about 5%, at least about 10%, at least about 25%, or at least about 50% of a given sample. Such isolated proteins can be encoded by genomic DNA, cDNA, mRNA, or other RNA of synthetic origin, or any combination thereof. Preferably, an isolated protein is substantially free of proteins or polypeptides or other contaminants that are found in its natural environment and that would interfere with its therapeutic, diagnostic, prophylactic, research, or other use.
[0111] A "variant" of a polypeptide (e.g., an antigen binding protein such as an antibody) includes an amino acid sequence in which one or more amino acid residues have been inserted, deleted, and / or substituted in comparison to another polypeptide sequence. Variants include fusion proteins.
[0112] A "derivative" of a polypeptide is a polypeptide (e.g., an antigen binding protein such as an antibody) that has been chemically modified in some way that differs from a mutant by insertion, deletion, or substitution, for example, through conjugation to another chemical moiety.
[0113] The term "natural origin" as used throughout this specification in connection with biological material such as polypeptides, nucleic acids, host cells, and the like, refers to material that is found in nature.
[0114] As used herein, a "subject" or "patient" can be any mammal. In typical embodiments, the subject or patient is a human.
[0115] As disclosed herein, the GIPR polypeptide described by this disclosure can be engineered and / or produced using standard molecular biology methodology. In various examples, the nucleic acid sequence encoding GIPR can include all or part of SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:5, and can be isolated and / or amplified from genomic DNA or cDNA using appropriate oligonucleotide primers. Primers can be designed based on the nucleic acid and amino acid sequences provided herein according to standard (RT)-PCR amplification techniques. The amplified GIPR nucleic acid can then be cloned into an appropriate vector and characterized by DNA sequence analysis.
[0116] Oligonucleotides for use as probes in isolating or amplifying all or a portion of the GIPR sequences provided herein can be designed and generated using standard synthetic techniques, such as, for example, an automated DNA synthesizer, or can be isolated from longer DNA sequences.
[0117] The sequence of the 466 amino acids of human GIPR is (Volz et al., FEBS Lett. 373:23-29 (1995), NCBI Reference Sequence: NP_0001555):
[0118] MTTSPILQLL LRLSLCGLLL QRAETGSKGQ TAGELYQRWE RYRRECQETL AAAEPPSGLA CNGSFDMYVC WDYAAPNATA RASCPWYLPW HHHVAAGFVL RQCGSDGQWG LWRDHTQCEN PEKNEAFLDQ RLILERLQVM YTVGYSLSLA TLLLALLILS LFRRLHCTRN YIHINLFTSF MLRAAAILSR DRLLPRPGPY LGDQALALWN QALAACRTAQ IVTQYCVGAN YTWLLVEGVY LHSLLVLVGG SEEGHFRYYL LLGWGAPALF VIPWVIVRYL YENTQCWERN EVKAIWWIIR TPILMTILIN FLIFIRILGI LLSKLRTRQM RCRDYRLRLA RSTTLVPLL GVHEVVFAPV TEEQARGALR FAKLGFEIFL SSFQGFLVSV LYCFINKEVQ SEIRRGWHHC RLRRSLGEEQ RQLPERAFRA LPSGSGPGEV PTSRGLSSGT LPGPGNEASR ELESYC (SEQ ID NO: 3141) and
[0119] It is encoded by the following DNA sequence (NCBI reference sequence: NM_000164):
[0120] ggcagcggtg gcaggggctg caggagcaag tgaccaggag caggactggg gacaggcctg atcgcccctg cacgaaccag acccttcgcc gccctcacga tgactacctc tccgatcctg cagctgctgc tgcggctctc actgtgcggg ctgctgctcc agagggcgga gacaggctct aaggggcaga cggcggggga gctgtaccag cgctgggaac ggtaccgcag ggagtgccag gagaccttgg cagccgcgga accgccttca ggcctcgcct gtaacgggtc cttcgatatg tacgtctgct gggactatgc tgcacccaat gccactgccc gtgcgtcctg cccctggtac ctgccctggc accaccatgt ggctgcaggt ttcgtcctcc gccagtgtgg cagtgatggc caatggggac tttggagaga ccatacacaa tgtgagaacc cagagaagaa tgaggccttt ctggaccaaa ggctcatctt ggagcggttg caggtcatgt acactgtcgg ctactccctg tctctcgcca cactgctgct agccctgctc atcttgagtt tgttcaggcg gctacattgc actagaaact atatccacat caacctgttc acgtctttca tgctgcgagc tgcggccatt ctcagccgag accgtctgct acctcgacct ggcccctacc ttggggacca ggcccttgcg ctgtggaacc aggccctcgc tgcctgccgc acggcccaga tcgtgaccca gtactgcgtg ggtgccaact acacgtggct gctggtggag ggcgtctacc tgcacagtct cctggtgctc gtgggaggct ccgaggaggg ccacttccgc tactacctgc tcctcggctg gggggccccc gcgcttttcgtcattccctg ggtgatcgtc aggtacctgt acgagaacac gcagtgctgg gagcgcaacg aagtcaaggc catttggtgg attatacgga cccccatcct catgaccatc ttgattaatt tcctcatttt tatccgcatt cttggcattc tcctgtccaa gctgaggaca cggcaaatgc gctgccggga ttaccggctg aggctggctc gctccacgct gacgctggtg cccctgctgg gtgtccacga ggtggtgttt gctcccgtga cagaggaaca ggcccggggc gccctgcgct tcgccaagct cggctttgag atcttcctca gctccttcca gggcttcctg gtcagcgtcc tctactgctt catcaacaag gaggtgcagt cggagatccg ccgtggctgg caccactgcc gcctgcgccg cagcctgggc gaggagcaac gccagctccc ggagcgcgcc ttccgggccc tgccctccgg ctccggcccg ggcgaggtcc ccaccagccg cggcttgtcc tcggggaccc tcccagggcc tgggaatgag gccagccggg agttggaaag ttactgctag ggggcgggat ccccgtgtct gttcagttag catggattta ttgagtgcca actgcgtgcc aggcccagta cggaggacgc tggggaaatg gtgaaggaaa cagaaaaaag gtccctgccc ttctggagat gacaactgag tggggaaaac agaccgtgaa cacaaaacat caagttccac acacgctatg gaatggttat gaagggaagc gagaaggggg cctagggtgg tctgggaggc gtctccaagg aggtgacact taagccatcc ccgaaagagg tgaaagagat cactttgggg agagctggag aacaggattctaggcggaag cgatagcata ggcaaaggcc cttgggcagg aaggcgctca gccttggctg gagtagaatt aagtcagagc caacaggtgg ggagagacag agaagtgggc aggggcaccc aagttgggat ttcatttcag gtgcattgga gattcttagg agtgtctctt gggggtaata ttttattttt taaaaaatga ggat (SEQ ID NO: 3142).
[0121] The 430 amino acid isoform of human GIPR (isoform X1) was predicted by automated computational analysis and has the sequence (NCBI reference sequence XP_005258790):
[0122] MTTSPILQLL LRLSLCGLLL QRAETGSKGQ TAGELYQRWE RYRRECQETL AAAEPPSVAA GFVLRQCGSD GQWGLWRDHT QCENPEKNEA FLDQRLILER LQVMYTVGYS LSLATLLLAL LILSLFRRLH CTRNYIHINL FTSFMLRAAA ILSRDRLLPR PGPYLGDQAL ALWNQALAAC RTAQIVTQYC VGANYTWLLV EGVYLHSLLV LVGGSEEGHF RYYLLLGWGA PALFVIPWVI VRYLYENTQC WERNEVKAIW WIIRTPILMT ILINFLIFIR ILGILLSKLR TRQMRCRDYR LRLARSTLTL VPLLGVHEVV FAPVTEEQAR GALRFAKLGF EIFLSSFQGF LVSVLYCFIN KEVQSEIRRG WHHCRLRRSL GEEQRQLPER AFRALPSGSG PGEVPTSRGL SSGTLPGPGN EASRELESYC (sequence number 3143) having
[0123] Encoded by the DNA sequence:
[0124] atgaccacca gcccgattct gcagctgctg ctgcgcctga gcctgtgcgg cctgctgctg cagcgcgcgg aaaccggcag caaaggccag accgcgggcg aactgtatca gcgctgggaa cgctatcgcc gcgaatgcca ggaaaccctg gcggcggcgg aaccgccgag cgtggcggcg ggctttgtgc tgcgccagtg cggcagcgat ggccagtggg gcctgtggcg cgatcatacc cagtgcgaaa acccggaaaa aaacgaagcg tttctggatc agcgcctgat tctggaacgc ctgcaggtga tgtataccgt gggctatagc ctgagcctgg cgaccctgct gctggcgctg ctgattctga gcctgtttcg ccgcctgcat tgcacccgca actatattca tattaacctg tttaccagct ttatgctgcg cgcggcggcg attctgagcc gcgatcgcct gctgccgcgc ccgggcccgt atctgggcga tcaggcgctg gcgctgtgga accaggcgct ggcggcgtgc cgcaccgcgc agattgtgac ccagtattgc gtgggcgcga actatacctg gctgctggtg gaaggcgtgt atctgcatag cctgctggtg ctggtgggcg gcagcgaaga aggccatttt cgctattatc tgctgctggg ctggggcgcg ccggcgctgt ttgtgattcc gtgggtgatt gtgcgctatc tgtatgaaaa cacccagtgc tgggaacgca acgaagtgaa agcgatttgg tggattattc gcaccccgat tctgatgacc attctgatta actttctgat ttttattcgc attctgggca ttctgctgag caaactgcgc acccgccaga tgcgctgccg cgattatcgc ctgcgcctggcgcgcagcac cctgaccctg gtgccgctgc tgggcgtgca tgaagtggtg tttgcgccgg tgaccgaaga acaggcgcgc ggcgcgctgc gctttgcgaa actgggcttt gaaatttttc tgagcagctt tcagggcttt ctggtgagcg tgctgtattg ctttattaac aaagaagtgc agagcgaaat tcgccgcggc tggcatcatt gccgcctgcg ccgcagcctg ggcgaagaac agcgccagct gccggaacgc gcgtttcgcg cgctgccgag cggcagcggc ccgggcgaag tgccgaccag ccgcggcctg agcagcggca ccctgccggg cccgggcaac gaagcgagcc gcgaactgga aagctattgc (sequence number 3144).
[0125] A 493 amino acid isoform of human GIPR is generated by alternative splicing and has the sequence (Gremlich et al., Diabetes 44:1202-8 (1995), UniProtKB sequence identifier: P48546-2):
[0126] MTTSPILQLL LRLSLCGLLL QRAETGSKGQ TAGELYQRWE RYRRECQETL AAAEPPSGLA CNGSFDMYVC WDYAAPNATA RASCPWYLPW HHHVAAGFVL RQCGSDGQWG LWRDHTQCEN PEKNEAFLDQ RLILERLQVM YTVGYSLSLA TLLLALLILS LFRRLHCTRN YIHINLFTSF MLRAAAILSR DRLLPRPGPY LGDQALALWN QALAACRTAQ IVTQYCVGAN YTWLLVEGVY LHSLLVLVGG SEEGHFRYYL LLGWGAPALF VIPWVIVRYL YENTQCWERN EVKAIWWIIR TPILMTILIN FLIFIRILGI LLSKLRTRQM RCRDYRLRLA RSTTLVPLL GVHEVVFAPV TEEQARGALR FAKLGFEIFL SSFQGFLVSV LYCFINKEVG RDPAAAPALW RRRGTAPPLS AIVSQVQSEI RRGWHHCRLR RSLGEEQRQL PERAFRALPS GSGPGEVPTS RGLSSGTLPG PGNEASRELE SYC (sequence number 3145) having
[0127] Encoded by the DNA sequence:
[0128] atgaccacca gcccgattct gcagctgctg ctgcgcctga gcctgtgcgg cctgctgctg cagcgcgcgg aaaccggcag caaaggccag accgcgggcg aactgtatca gcgctgggaa cgctatcgcc gcgaatgcca ggaaaccctg gcggcggcgg aaccgccgag cggcctggcg tgcaacggca gctttgatat gtatgtgtgc tgggattatg cggcgccgaa cgcgaccgcg cgcgcgagct gcccgtggta tctgccgtgg catcatcatg tggcggcggg ctttgtgctg cgccagtgcg gcagcgatgg ccagtggggc ctgtggcgcg atcataccca gtgcgaaaac ccggaaaaaa acgaagcgtt tctggatcag cgcctgattc tggaacgcct gcaggtgatg tataccgtgg gctatagcct gagcctggcg accctgctgc tggcgctgct gattctgagc ctgtttcgcc gcctgcattg cacccgcaac tatattcata ttaacctgtt taccagcttt atgctgcgcg cggcggcgat tctgagccgc gatcgcctgc tgccgcgccc gggcccgtat ctgggcgatc aggcgctggc gctgtggaac caggcgctgg cggcgtgccg caccgcgcag attgtgaccc agtattgcgt gggcgcgaac tatacctggc tgctggtgga aggcgtgtat ctgcatagcc tgctggtgct ggtgggcggc agcgaagaag gccattttcg ctattatctg ctgctgggct ggggcgcgcc ggcgctgttt gtgattccgt gggtgattgt gcgctatctg tatgaaaaca cccagtgctg ggaacgcaac gaagtgaaag cgatttggtg gattattcgc accccgattctgatgaccat tctgattaac tttctgattt ttattcgcat tctgggcatt ctgctgagca aactgcgcac ccgccagatg cgctgccgcg attatcgcct gcgcctggcg cgcagcaccc tgaccctggt gccgctgctg ggcgtgcatg aagtggtgtt tgcgccggtg accgaagaac aggcgcgcgg cgcgctgcgc tttgcgaaac tgggctttga aatttttctg agcagctttc agggctttct ggtgagcgtg ctgtattgct ttattaacaa agaagtgggc cgcgatccgg cggcggcgcc ggcgctgtgg cgccgccgcg gcaccgcgcc gccgctgagc gcgattgtga gccaggtgca gagcgaaatt cgccgcggct ggcatcattg ccgcctgcgc cgcagcctgg gcgaagaaca gcgccagctg ccggaacgcg cgtttcgcgc gctgccgagc ggcagcggcc cgggcgaagt gccgaccagc cgcggcctga gcagcggcac cctgccgggc ccgggcaacg aagcgagccg cgaactggaa agctattgct aa(SEQ ID NO: 3146)
[0129] The sequence of 460 amino acids of mouse GIPR is (NCBI reference sequence: NP_001074284, uniprotKB / Swiss-Prot Q0P543-1) (see Vassilatis et al., PNAS USA 2003, 100:4903-4908).
[0130] MPLRLLLLLL WLWGLQWAET DSEGQTTTGE LYQRWEHYGQ ECQKMLETTE PPSGLACNGS FDMYACWNYT AANTTARVSC PWYLPWFRQV SAGFVFRQCG SDGQWGSWRD HTQCENPEKN GAFQDQTLIL ERLQIMYTVG YSLSLTTLLL ALLILSLFRR LHCTRNYIHM NLFTSFMLRA AAILTRDQLL PPLGPYTGDQ APTPWNQALA ACRTAQIMTQ YCVGANYTWL LVEGVYLHHL LVIVGRSEKG HFRCYLLLGW GAPALFVIPW VIVRYLRENT QCWERNEVKA IWWIIRTPIL ITILINFLIF IRILGILVSK LRTRQMRCPD YRLRLARSTL TLVPLLGVHE VVFAPVTEEQ VEGSLRFAKL AFEIFLSSFQ GFLVSVLYCFINKEVQSEIRQ GWRHRRLRLS LQEQRPRPHQ ELAPRAVPLS SACREAAVGN ALPSGMLHVP GDEVLESYC (sequence number 3147) and
[0131] It is encoded by the following DNA sequence (NCBI reference sequence: NM_001080815):
[0132] atgccgctgc gcctgctgct gctgctgctg tggctgtggg gcctgcagtg ggcggaaacc gatagcgaag gccagaccac caccggcgaa ctgtatcagc gctgggaaca ttatggccag gaatgccaga aaatgctgga aaccaccgaa ccgccgagcg gcctggcgtg caacggcagc tttgatatgt atgcgtgctg gaactatacc gcggcgaaca ccaccgcgcg cgtgagctgc ccgtggtatc tgccgtggtt tcgccaggtg agcgcgggct ttgtgtttcg ccagtgcggc agcgatggcc agtggggcag ctggcgcgat catacccagt gcgaaaaccc ggaaaaaaac ggcgcgtttc aggatcagac cctgattctg gaacgcctgc agattatgta taccgtgggc tatagcctga gcctgaccac cctgctgctg gcgctgctga ttctgagcct gtttcgccgc ctgcattgca cccgcaacta tattcatatg aacctgttta ccagctttat gctgcgcgcg gcggcgattc tgacccgcga tcagctgctg ccgccgctgg gcccgtatac cggcgatcag gcgccgaccc cgtggaacca ggcgctggcg gcgtgccgca ccgcgcagat tatgacccag tattgcgtgg gcgcgaacta tacctggctg ctggtggaag gcgtgtatct gcatcatctg ctggtgattg tgggccgcag cgaaaaaggc cattttcgct gctatctgct gctgggctgg ggcgcgccgg cgctgtttgt gattccgtgg gtgattgtgc gctatctgcg cgaaaacacc cagtgctggg aacgcaacga agtgaaagcg atttggtgga ttattcgcac cccgattctg attaccattctgattaactt tctgattttt attcgcattc tgggcattct ggtgagcaaa ctgcgcaccc gccagatgcg ctgcccggat tatcgcctgc gcctggcgcg cagcaccctg accctggtgc cgctgctggg cgtgcatgaa gtggtgtttg cgccggtgac cgaagaacag gtggaaggca gcctgcgctt tgcgaaactg gcgtttgaaa tttttctgag cagctttcag ggctttctgg tgagcgtgct gtattgcttt attaacaaag aagtgcagag cgaaattcgc cagggctggc gccatcgccg cctgcgcctg agcctgcagg aacagcgccc gcgcccgcat caggaactgg cgccgcgcgc ggtgccgctg agcagcgcgt gccgcgaagc ggcggtgggc aacgcgctgc cgagcggcat gctgcatgtg ccgggcgatg aagtgctgga aagctattgc taa (SEQ ID NO: 3148)
[0133] A 230 amino acid isoform of mouse GIPR is generated by alternative splicing and has the sequence (Gerhard et al., Genome Res, 14:2121-2127 (2004); NCBI Reference Sequence: AAI20674):
[0134] MPLRLLLLLL WLWGLQWAET DSEGQTTTGE LYQRWEHYGQ ECQKMLETTE PPSGLACNGS FDMYACWNYT AANTTARVSC PWYLPWFRQV SAGFVFRQCG SDGQWGSWRD HTQCENPEKN GAFQDQTLIL ERLQIMYTVG YSLSLTTLLL ALLILSLFRR LHCTRNYIHM NLFTSFMLRA AAILTRDQLL PPLGPYTGDQ APTPWNQVLH RLLPGGTKTF PIYFRTFPHH (SEQ ID NO: 3149) having,
[0135] encoded by the following DNA sequence:
[0136] atgccgctgc gcctgctgct gctgctgctg tggctgtggg gcctgcagtg ggcggaaacc gatagcgaag gccagaccac caccggcgaa ctgtatcagc gctgggaaca ttatggccag gaatgccaga aaatgctgga aaccaccgaa ccgccgagcg gcctggcgtg caacggcagc tttgatatgt atgcgtgctg gaactatacc gcggcgaaca ccaccgcgcg cgtgagctgc ccgtggtatc tgccgtggtt tcgccaggtg agcgcgggct ttgtgtttcg ccagtgcggc agcgatggcc agtggggcag ctggcgcgat catacccagt gcgaaaaccc ggaaaaaaac ggcgcgtttc aggatcagac cctgattctg gaacgcctgc agattatgta taccgtgggc tatagcctga gcctgaccac cctgctgctg gcgctgctga ttctgagcct gtttcgccgc ctgcattgca cccgcaacta tattcatatg aacctgttta ccagctttat gctgcgcgcg gcggcgattc tgacccgcga tcagctgctg ccgccgctgg gcccgtatac cggcgatcag gcgccgaccc cgtggaacca ggtgctgcat cgcctgctgc cgggcggcac caaaaccttt ccgatttatt ttcgcacctt tccgcatcat taa (SEQ ID NO: 3150).
[0137] The term "GIPR polypeptide" as used herein encompasses naturally occurring GIPR polypeptide sequences, such as, for example, the human amino acid sequence of SEQ ID NO: 3141, SEQ ID NO: 3143, or SEQ ID NO: 3145. However, the term "GIPR polypeptide" also encompasses polypeptides that include an amino acid sequence that differs from the amino acid sequence of a naturally occurring GIPR polypeptide sequence, such as, for example, SEQ ID NO: 3141, SEQ ID NO: 3143, or SEQ ID NO: 3145, by one or more amino acids, such that the sequence is at least 85% identical to SEQ ID NO: 3141, SEQ ID NO: 3143, or SEQ ID NO: 3145. GIPR polypeptides can be generated by using naturally occurring or non-naturally occurring amino acids and introducing one or more amino acid substitutions (conservative or non-conservative) for specific positions in a GIPR polypeptide.
[0138] In a "conservative amino acid substitution", a natural amino acid residue (i.e., a residue found at a given position in a wild-type GIPR polypeptide sequence) may be substituted with a non-naturally occurring residue (i.e., a residue not found at a given position in a wild-type GIPR polypeptide sequence) such that there is little or no effect on the polarity or charge of the amino acid residue at that position. Conservative amino acid substitutions also encompass non-naturally occurring amino acid residues that are typically incorporated by chemical peptide synthesis rather than by synthesis in a biological system. These include peptidomimetics and other forms in which amino acid moieties are reversed or inverted.
[0139] Naturally occurring residues can be grouped into classes based on the following common side chain properties:
[0140] (1) Hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile,
[0141] (2) Neutral hydrophilic: Cys, Ser, Thr,
[0142] (3) Acidic: Asp, Glu,
[0143] (4) Basic: Asn, Gln, His, Lys, Arg,
[0144] (5) Residues that affect chain orientation: Gly, Pro, and
[0145] (6) Aromatic: Trp, Tyr, Phe.
[0146] Additional taxa of amino acids can also be constructed using the principles described, for example, in Creighton (1984) PROTEINS: STRUCTURE AND MOLECULAR PROPERTIES (2d Ed. 1993), W.H. Freeman and Company. In some cases, it may be useful to further characterize the substitution based on two or more of such properties (e.g., substitution with a "small polar" residue such as a Thr residue may be a highly conservative substitution in the appropriate circumstances).
[0147] Conservative substitutions may involve the exchange of a member of one such class for another member of the same class. Non-conservative substitutions may involve the exchange of a member of one such class for a member of another class.
[0148] Synthetic, rare, or modified amino acid residues known to have similar physiochemical properties to those of the above classes can be used as "conservative" replacements for certain amino acid residues in the sequence. For example, a D-Arg residue can serve as a replacement for a typical L-Arg residue. There may be cases where a particular replacement can be described in terms of more than one of the above classes (e.g., replacement with a small, hydrophobic residue means replacement of one amino acid with a residue(s) found in both of the above classes, or with other synthetic, rare, or modified residues known in the art to have similar physiochemical properties to such residues that meet both definitions).
[0149] Nucleic acid sequences encoding GIPR polypeptides provided herein include those that are degenerate to SEQ ID NO:3141, SEQ ID NO:3143, or SEQ ID NO:3145, and those that encode polypeptide variants of SEQ ID NO:3141, SEQ ID NO:3143, or SEQ ID NO:3145 from other embodiments of the disclosure.
[0150] To express the GIPR nucleic acid sequences provided herein, a suitable coding sequence, such as, for example, SEQ ID NO:3141, SEQ ID NO:3143, or SEQ ID NO:3145, can be cloned into a suitable vector according to standard cloning and expression techniques, and after introduction into a suitable host, the sequence can be expressed to produce the encoded polypeptide, as known in the art (e.g., as described in Sambrook, J., Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). The present invention also relates to such vectors comprising the nucleic acid sequences according to the present invention.
[0151] "Vector" refers to a delivery vehicle that (a) facilitates expression of a nucleic acid sequence encoding a polypeptide, (b) facilitates production of a polypeptide therefrom, (c) facilitates transduction / transformation of a target cell therewith, (d) facilitates replication of a nucleic acid sequence, (e) facilitates stability of the nucleic acid, (f) facilitates detection of the nucleic acid and / or transformed / transduced cells, and / or (g) otherwise confers advantageous biological and / or physiochemical functions to the nucleic acid encoding the polypeptide. The vector can be any suitable vector, including chromosomal vectors, non-chromosomal vectors, and synthetic nucleic acid vectors (nucleic acid sequences that include an appropriate set of expression control elements). Examples of such vectors include derivatives of SV40, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, and viral nucleic acid (RNA or DNA) vectors.
[0152] Recombinant expression vectors can be designed to express GIPR proteins in prokaryotic cells (e.g., E. coli) or eukaryotic cells (e.g., insect cells, yeast cells, or mammalian cells using baculovirus expression vectors). In one embodiment, the host cell is a mammalian non-human host cell. Exemplary host cells include hosts typically used for cloning and expression, such as Escherichia coli strains TOP10F', TOP10, DH10B, DH5a, HB101, W3110, BL21(DE3), and BL21(DE3)pLysS, BLUESCRIPT (Stratagene), mammalian cell lines CHO, CHO-K1, HEK293, 293-EBNApIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264:5503-5509 (1989)), pET vectors (Novagen, Madison, MA). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example, using a T7 promoter regulatory sequence and T7 polymerase and an in vitro translation system. Preferably, the vector contains a promoter upstream of the cloning site that contains the nucleic acid sequence encoding the polypeptide. Examples of promoters that can be switched on and off include the lac promoter, the T7 promoter, the trc promoter, the tac promoter, and the trp promoter.
[0153] Thus, vectors are provided herein that contain a nucleic acid sequence encoding GIPR and promote the expression of recombinant GIPR. In various embodiments, the vectors contain operably linked nucleotide sequences that regulate the expression of GIPR. The vectors may contain or be associated with any suitable promoters, enhancers, and other expression promoting elements. Examples of such elements include a strong expression promoter (e.g., human CMV IE promoter / enhancer, RSV promoter, SV40 promoter, SL3-3 promoter, MMTV promoter, or HIV LTR promoter, EF1 alpha promoter, CAG promoter), an effective poly(A) termination sequence, an origin of replication for the plasmid product in E. coli, an antibiotic resistance gene as a selectable marker, and / or a convenient cloning site (e.g., polylinker). The vectors may also contain an inducible promoter as opposed to a constitutive promoter such as CMV IE. In one aspect, a nucleic acid is provided that contains a GIPR polypeptide coding sequence operably linked to a tissue-specific promoter that promotes the expression of the sequence in metabolically relevant tissues such as liver tissue or pancreatic tissue.
[0154] In another aspect of the disclosure, host cells are provided that contain the GIPR nucleic acids and vectors disclosed herein. In various embodiments, the vector or nucleic acid is integrated into the host cell genome, while in other embodiments, the vector or nucleic acid is present extrachromosomally.
[0155] Recombinant cells, such as yeast cells, bacterial cells (e.g., E. coli), and mammalian cells (e.g., immortalized mammalian cells) containing such nucleic acids, vectors, or a combination of either or both, are provided. In various embodiments, cells are provided that contain a non-integrated nucleic acid, such as a plasmid, cosmid, phagemid, or linear expression element, that includes a sequence encoding a GIPR polypeptide for expression.
[0156] A vector containing a nucleic acid sequence encoding a GIPR polypeptide provided herein can be introduced into a host cell by transformation or transduction. Methods for transforming cells with expression vectors are well known.
[0157] The nucleic acid encoding the GIPR can be placed and / or delivered to a host cell or host animal via a viral vector. Any suitable viral vector with this capability can be used. The viral vector can include any number of viral polynucleotides, alone or in combination with one or more viral proteins that facilitate the delivery, replication, and / or expression of the nucleic acid of the present invention in a desired host cell. The viral vector can be a polynucleotide that includes all or part of the viral genome, a viral protein / nucleic acid complex, a virus-like particle (VLP), or an intact viral particle that includes viral nucleic acid and a nucleic acid encoding a GIPR polypeptide. The viral vector that is a viral particle can include a wild-type viral particle or a modified viral particle. The viral vector can be a vector that requires the presence of another vector or wild-type virus for replication and / or expression, such as an adenoviral vector amplicon (e.g., the viral vector can be a helper-dependent virus). Typically, such viral vectors consist of wild-type viral particles or viral particles whose protein and / or nucleic acid content has been modified to increase transgene capacity or aid in gene transfer and / or expression of nucleic acid (examples of such vectors include herpesvirus / AAV amplicons). Typically, viral vectors are similar to and / or derived from viruses that normally infect humans. Suitable viral vector particles in this regard include, for example, adenovirus vector particles (including any virus of the Adenoviridae family or any virus derived from the Adenoviridae family), adeno-associated virus vector particles (AAV vector particles) or other parvovirus and parvovirus vector particles, papillomavirus vector particles, flavivirus vectors, alphavirus vectors, herpesvirus vectors, poxvirus vectors, retrovirus vectors (including lentivirus vectors).
[0158] GIPR polypeptide expressed as described herein can be isolated using standard protein purification methods.GIPR polypeptide can be isolated from cells that naturally express it, or can be isolated from cells that are engineered to express GIPR, such as cells that do not naturally express GIPR.
[0159] Protein purification methods that can be used to isolate GIPR polypeptides, as well as related materials and reagents, are known in the art. Additional purification methods that can be useful for isolating GIPR polypeptides can be found in references such as Bootcov MR, 1997, Proc. Natl. Acad. Sci. USA 94:11514-9, Fairlie WD, 2000, Gene 254:67-76.
[0160] Provided herein is an antagonist antigen binding protein that binds to GIPR, including human GIPR (hGIPR).In one embodiment, human GIPR has a sequence such as that shown in SEQ ID NO: 3141.In another embodiment, human GIPR has a sequence such as that shown in SEQ ID NO: 3143.In another embodiment, human GIPR has a sequence such as that shown in SEQ ID NO: 3145.
[0161] The antigen binding proteins provided are polypeptides incorporating and / or linked to one or more complementarity determining regions (CDRs) as described herein. In some antigen binding proteins, the CDRs are incorporated into "framework" regions that orient the CDR(s) so that the appropriate antigen binding properties of the CDR(s) are achieved. Certain antigen binding proteins described herein are antibodies or are derived from antibodies. In other antigen binding proteins, the CDR sequences are incorporated into different types of protein scaffolds. The various structures are further described below.
[0162] The antigen binding proteins disclosed herein have a variety of utilities. The antigen binding proteins are useful, for example, in specific binding assays, affinity purification of GIPR, and screening assays to identify other antagonists of GIPR activity. Other uses of the antigen binding proteins include, for example, diagnosis of diseases or conditions associated with GIPR, and screening assays to determine the presence or absence of GIPR. Given that the antigen binding proteins provided are antagonists, the GIPR antigen binding proteins are valuable in therapeutic methods useful for reducing weight gain, improving glucose tolerance, reducing insulin levels, and reducing cholesterol and triglyceride levels, even while food intake is maintained or increased, % body fat mass is increased, and % lean mass is increased. Thus, the antigen binding proteins have utility in the treatment and prevention of diabetes, such as type 2 diabetes, obesity, dyslipidemia, elevated glucose levels, or elevated insulin levels.
[0163] A variety of selective binding agents are provided that are useful for regulating the activity of GIPR.These agents include, for example, antigen-binding proteins (e.g., scFv, domain antibodies, and polypeptides having antigen-binding regions) that contain antigen-binding domains and specifically bind to GIPR polypeptides, particularly human GIPR.Some of these agents are, for example, useful for enhancing the activity of GIPR, and can activate one or more activities associated with GIPR.
[0164] In general, the antigen binding proteins provided typically comprise one or more (e.g., one, two, three, four, five, or six) CDRs described herein. In some cases, the antigen binding proteins comprise (a) a polypeptide structure and (b) one or more CDRs inserted and / or linked to the polypeptide structure. The polypeptide structure may take a variety of different forms. For example, the polypeptide structure may be or may comprise the framework of a naturally occurring antibody or a fragment or variant thereof, or may be entirely synthetic in nature. Examples of various polypeptide structures are further described below.
[0165] In certain embodiments, the polypeptide structure of the antigen-binding protein is an antibody or is derived from an antibody. Thus, certain examples of antigen-binding proteins provided include, but are not limited to, monoclonal antibodies, bispecific antibodies, minibodies, domain antibodies (such as Nanobodies®), synthetic antibodies (sometimes referred to herein as "antibody mimetics"), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions, and portions or fragments thereof. In some cases, the antigen-binding protein is an immunological fragment of a complete antibody (e.g., Fab, Fab', F(ab')2). In other cases, the antigen-binding protein is an scFv that uses CDRs derived from an antibody of the invention.
[0166] The antigen binding protein provided herein specifically binds to human GIPR.In certain embodiments, the antigen binding protein specifically binds to human GIPR that comprises or consists of the amino acid sequence of SEQ ID NO: 3141.In certain embodiments, the antigen binding protein specifically binds to human GIPR that comprises or consists of the amino acid sequence of SEQ ID NO: 3143.In certain embodiments, the antigen binding protein specifically binds to human GIPR that comprises or consists of the amino acid sequence of SEQ ID NO: 3145.
[0167] The antigen binding proteins that are provided are antagonists and typically have one, two, three, four, five, six, seven, or all eight of the following properties:
[0168] (a) Ability to block or reduce the binding of GIP to GIPR, the level of which can be measured by methods such as binding studies with radioactive or fluorescently labeled ligands or methods described herein (e.g., cAMP assay or other functional assay). Compared to pre-treatment levels of SEQ ID NO:3141, SEQ ID NO:3143, or SEQ ID NO:3145 under comparable conditions, the reduction can be at least 10%, at least 25%, at least 50%, at least 100%, or more.
[0169] (b) the ability to reduce blood glucose;
[0170] (c) the ability to improve glucose tolerance;
[0171] (d) the ability to improve insulin sensitivity;
[0172] (e) the ability to lose weight or reduce weight gain;
[0173] (f) the ability to reduce body fat mass or reduce inflammation in adipose tissue;
[0174] (g) the ability to reduce fasting insulin levels;
[0175] (h) the ability to reduce circulating cholesterol levels;
[0176] (i) the ability to reduce circulating triglyceride levels;
[0177] (j) the ability to reduce fatty liver or reduce triglyceride levels in the liver;
[0178] (k) the ability to reduce AST, ALT, and / or ALP levels.
[0179] In one embodiment, the GIPR antigen binding protein has one or more of the following activities:
[0180] (a) binds to human GIPR, resulting in a KD of ≦200 nM, ≦150 nM, ≦100 nM, ≦50 nM, ≦10 nM, ≦5 nM, ≦2 nM, or ≦1 nM, as measured, for example, via surface plasma resonance or equilibrium exclusion binding techniques.
[0181] (b) a half-life in human serum of at least 3 days;
[0182] Some of the antigen binding proteins provided have a binding rate (ka) for GIPR of at least 10, e.g., as measured as described below. 4 / Mx seconds, at least 10 5 / Mx seconds, or at least 10 6 / Mx seconds. Certain antigen-binding proteins provided have slow dissociation or off-rates. Some antigen-binding proteins have dissociation rates of, for example, 1x10 -2 seconds -1 , or 1x10 -3 seconds -1 , or 1x10 -4 seconds -1 , or 1x10 -5 seconds -1 In certain embodiments, the antigen binding protein has a KD (equilibrium binding affinity) of less than 25 pM, less than 50 pM, less than 100 pM, less than 500 pM, less than 1 nM, less than 5 nM, less than 10 nM, less than 25 nM, or less than 50 nM.
[0183] In another aspect, antigen binding proteins are provided that have a half-life in vitro or in vivo (e.g., when administered to a human subject) of at least 1 day. In one embodiment, the antigen binding protein has a half-life of at least 3 days. In various other embodiments, the antigen binding protein has a half-life of 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, or 60 days or more. In another embodiment, the antigen binding protein is derivatized or modified to increase its half-life compared to underivatized or unmodified antibodies. In another embodiment, point mutations are included in the antigen binding protein to increase serum half-life. Further details regarding such variants and derivatized forms are provided below.
[0184] Some of the antigen-binding proteins provided have a structure typically associated with naturally occurring antibodies. Such antibody structural units typically include one or more tetramers, each of which is composed of two identical couplets of polypeptide chains, although some mammalian species also produce antibodies with only a single heavy chain. In a typical antibody, each pair or couplet includes one full-length "light" chain (in certain embodiments, about 25 kDa) and one full-length "heavy" chain (in certain embodiments, about 50-70 kDa). Each individual immunoglobulin chain is composed of several "immunoglobulin domains," each of which consists of approximately 90-110 amino acids and exhibits a characteristic folding pattern. These domains are the basic units that make up an antibody polypeptide. The amino-terminal portion of each chain typically includes a variable domain that is responsible for antigen recognition. The carboxy-terminal portion is more evolutionarily conserved compared to the other end of the chain and is referred to as the "constant region" or "C region." Human light chains are generally classified as kappa and lambda light chains, each of which contains one variable and one constant domain. Heavy chains are typically classified as mu, delta, gamma, alpha, or epsilon chains, which define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. IgG has several subtypes, including but not limited to IgG1, IgG2, IgG3, and IgG4. IgM subtypes include IgM and IgM2. IgA subtypes include IgA1 and IgA2. In humans, IgA and IgD isotypes contain four heavy chains and four light chains, IgG and IgE isotypes contain two heavy chains and two light chains, and IgM isotypes contain five heavy chains and five light chains. The C region of a heavy chain typically contains one or more domains that may be responsible for effector function. The number of constant region domains in a heavy chain will depend on the isotype. IgG heavy chains, for example, each contain three C region domains known as CH1, CH2, and CH3.The antibodies provided can have any of these isotypes and subtypes. In certain embodiments, the GIPR antibody is of the IgG1, IgG2, or IgG4 subtype. The terms "GIPR antibody" and "anti-GIPR antibody" are used interchangeably throughout this application and the figures. Both terms refer to an antibody that binds to GIPR.
[0185] In full-length light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 10 or more amino acids. See, e.g., Fundamental Immunology, 2nd ed., Ch. 7 (Paul, W., ed.) 1989, New York: Raven Press, incorporated herein by reference in its entirety for all purposes. The variable regions of each light / heavy chain pair typically form the antigen-binding site.
[0186] For the antibodies provided herein, the variable regions of immunoglobulin chains generally exhibit the same overall structure, including relatively conserved framework regions (FR) linked by three hypervariable regions (more often referred to as "complementarity determining regions" or CDRs). The CDRs from the two chains of each of the above mentioned heavy / light chain pairs are typically aligned by the framework regions to form a structure that specifically binds to a particular epitope present in the GIPR. These elements are typically present in the following order from N-terminus to C-terminus in both naturally occurring light and heavy chain variable regions: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. A numbering system has been devised to assign numbers to the amino acids that occupy each position in these domains. This numbering system is defined in Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, Md.), or Chothia & Lesk, 1987, J. Mol. Biol. 196:901-917; Chothia et al., 1989, Nature 342:878-883.
[0187] Sequence information for particular antibodies prepared and identified as described in the Examples below is summarized in Table 1. Thus, in one embodiment, the antigen binding protein is an antibody having the CDR sequences, variable domain sequences, and light and heavy chain sequences identified in one of the rows of Table 1.
[0188] The variable light chain sequences, variable heavy chain sequences, light chain sequences, heavy chain sequences, CDRL1 sequences, CDRL2 sequences, CDRL3 sequences, CDRH1 sequences, CDRH2 sequences, and CDRH3 sequences of the antibodies and fragments thereof of the invention have been assigned SEQ ID NOs, which are shown in Table 1. The polynucleotides encoding the variable light chain sequences, variable heavy chain sequences, light chain sequences, heavy chain sequences, CDRL1 sequences, CDRL2 sequences, CDRL3 sequences, CDRH1 sequences, CDRH2 sequences, and CDRH3 sequences of the antibodies and fragments thereof of the invention have also been assigned SEQ ID NOs, which are shown in Table 2. The antigen binding proteins of the invention can be identified by SEQ ID NOs, but also by construct names (e.g., 2C2.005) or identifier numbers (e.g., iPS:336175). The antigen binding proteins identified in Tables 1-5 below can be grouped into families based on construct names. For example, the "4B1 family" includes construct 4B1, construct 4B1.010, construct 4B1.011, construct 4B1.012, construct 4B1.013, construct 4B1.014, construct 4B1.015, and construct 4B1.016.
[0189] The various light and heavy chain variable regions provided herein are shown in Table 3. Each of these variable regions can be added to a heavy or light chain constant region to form the heavy and light chains, respectively, of a complete antibody. Furthermore, each of the heavy and light chain sequences thus generated can be combined to form the structure of a complete antibody.
[0190] [Table 1] TIFF2024001194000002.tif241166TIFF2024001194000003.tif241167TIFF20240011940 00004.tif241165TIFF2024001194000005.tif241167TIFF2024001194000006.tif241161
[0191] [Table 2] TIFF2024001194000008.tif242168TIFF2024001194000009.tif242167TIFF2024001194000010.tif241168TIFF2024001194000011.tif241168TIFF2024001194000012.tif240168
[0192]
Table 3
[0193]
Table 4
[0194]
Table 5
[0195]
Table 6
[0196] In one embodiment, the antibody or fragment thereof comprises a light chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 1 to 157. In one embodiment, the antibody or fragment thereof comprises a heavy chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 158 to 314. In one embodiment, the antibody or fragment thereof comprises a light chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 1 to 157, and a heavy chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 158 to 314. In one embodiment, the antibody or fragment thereof comprises a light chain variable region comprising SEQ ID NO:1 and a heavy chain variable region comprising SEQ ID NO:158, a light chain variable region comprising SEQ ID NO:2 and a heavy chain variable region comprising SEQ ID NO:159, a light chain variable region comprising SEQ ID NO:3 and a heavy chain variable region comprising SEQ ID NO:160, a light chain variable region comprising SEQ ID NO:4 and a heavy chain variable region comprising SEQ ID NO:161, a light chain variable region comprising SEQ ID NO:5 and a heavy chain variable region comprising SEQ ID NO:162, a light chain variable region comprising SEQ ID NO:6 and a heavy chain variable region comprising SEQ ID NO:163, a light chain variable region comprising SEQ ID NO:7 and a heavy chain variable region comprising SEQ ID NO:164, a light chain variable region comprising SEQ ID NO:8 and a heavy chain variable region comprising SEQ ID NO:165, a light chain variable region comprising SEQ ID NO:9 and a heavy chain variable region comprising SEQ ID NO:166, a light chain variable region comprising SEQ ID NO:10 and a heavy chain variable region comprising SEQ ID NO:167, a light chain variable region comprising SEQ ID NO:11 and a heavy chain variable region comprising SEQ ID NO:168 a light chain variable region comprising SEQ ID NO: 12 and a heavy chain variable region comprising SEQ ID NO: 169, a light chain variable region comprising SEQ ID NO: 13 and a heavy chain variable region comprising SEQ ID NO: 170, a light chain variable region comprising SEQ ID NO: 14 and a heavy chain variable region comprising SEQ ID NO: 171, a light chain variable region comprising SEQ ID NO: 15 and a heavy chain variable region comprising SEQ ID NO: 172, a light chain variable region comprising SEQ ID NO: 16 and a heavy chain variable region comprising SEQ ID NO: 173, a light chain variable region comprising SEQ ID NO: 17 and a heavy chain variable region comprising SEQ ID NO: 174, a light chain variable region comprising SEQ ID NO: 18 and a heavy chain variable region comprising SEQ ID NO: 175, a light chain variable region comprising SEQ ID NO: 19 and a heavy chain variable region comprising SEQ ID NO: 176, a light chain variable region comprising SEQ ID NO: 20 and a heavy chain variable region comprising SEQ ID NO: 177, a light chain variable region comprising SEQ ID NO: 21 and a heavy chain variable region comprising SEQ ID NO: 178, a light chain variable region comprising SEQ ID NO: 22 and a heavy chain variable region comprising SEQ ID NO: 179,A light chain variable region comprising SEQ ID NO:23 and a heavy chain variable region comprising SEQ ID NO:180, a light chain variable region comprising SEQ ID NO:24 and a heavy chain variable region comprising SEQ ID NO:181, a light chain variable region comprising SEQ ID NO:25 and a heavy chain variable region comprising SEQ ID NO:182, a light chain variable region comprising SEQ ID NO:26 and a heavy chain variable region comprising SEQ ID NO:183, a light chain variable region comprising SEQ ID NO:27 and a heavy chain variable region comprising SEQ ID NO:184, a light chain variable region comprising SEQ ID NO:28 and a heavy chain variable region comprising SEQ ID NO:185, a light chain variable region comprising SEQ ID NO:29 and a heavy chain variable region comprising SEQ ID NO:186, a light chain variable region comprising SEQ ID NO:30 and a heavy chain variable region comprising SEQ ID NO:31, a light chain variable region comprising SEQ ID NO: 31 and a heavy chain variable region comprising SEQ ID NO: 188; a light chain variable region comprising SEQ ID NO: 32 and a heavy chain variable region comprising SEQ ID NO: 189; a light chain variable region comprising SEQ ID NO: 33 and a heavy chain variable region comprising SEQ ID NO: 190; a light chain variable region comprising SEQ ID NO: 34 and a heavy chain variable region comprising SEQ ID NO: 191; a light chain variable region comprising SEQ ID NO: 35 and a heavy chain variable region comprising SEQ ID NO: 192; a light chain variable region comprising SEQ ID NO: 36 and a heavy chain variable region comprising SEQ ID NO: 193; a light chain variable region comprising SEQ ID NO: 37 and A heavy chain variable region comprising SEQ ID NO: 194, a light chain variable region comprising SEQ ID NO: 38 and a heavy chain variable region comprising SEQ ID NO: 195, a light chain variable region comprising SEQ ID NO: 39 and a heavy chain variable region comprising SEQ ID NO: 196, a light chain variable region comprising SEQ ID NO: 40 and a heavy chain variable region comprising SEQ ID NO: 197, a light chain variable region comprising SEQ ID NO: 41 and a heavy chain variable region comprising SEQ ID NO: 198, a light chain variable region comprising SEQ ID NO: 42 and a heavy chain variable region comprising SEQ ID NO: 199, a light chain variable region comprising SEQ ID NO: 43 and a heavy chain variable region comprising SEQ ID NO: 200, a light chain variable region comprising SEQ ID NO: 44 and SEQ ID NO: 201. a heavy chain variable region comprising SEQ ID NO: 206, a light chain variable region comprising SEQ ID NO: 45 and a heavy chain variable region comprising SEQ ID NO: 202, a light chain variable region comprising SEQ ID NO: 46 and a heavy chain variable region comprising SEQ ID NO: 203, a light chain variable region comprising SEQ ID NO: 47 and a heavy chain variable region comprising SEQ ID NO: 204, a light chain variable region comprising SEQ ID NO: 48 and a heavy chain variable region comprising SEQ ID NO: 205, a light chain variable region comprising SEQ ID NO: 49 and a heavy chain variable region comprising SEQ ID NO: 206, a light chain variable region comprising SEQ ID NO: 50 and a heavy chain variable region comprising SEQ ID NO: 207, a light chain variable region comprising SEQ ID NO: 51 and a heavy chain variable region comprising SEQ ID NO: 208,A light chain variable region comprising SEQ ID NO:52 and a heavy chain variable region comprising SEQ ID NO:209, a light chain variable region comprising SEQ ID NO:53 and a heavy chain variable region comprising SEQ ID NO:210, a light chain variable region comprising SEQ ID NO:54 and a heavy chain variable region comprising SEQ ID NO:211, a light chain variable region comprising SEQ ID NO:55 and a heavy chain variable region comprising SEQ ID NO:212, a light chain variable region comprising SEQ ID NO:56 and a heavy chain variable region comprising SEQ ID NO:213, a light chain variable region comprising SEQ ID NO:57 and a heavy chain variable region comprising SEQ ID NO:214, a light chain variable region comprising SEQ ID NO:58 and a heavy chain variable region comprising SEQ ID NO:215, a light chain variable region comprising SEQ ID NO:59 and a heavy chain variable region comprising SEQ ID NO:216, and a heavy chain variable region comprising SEQ ID NO:216, a light chain variable region comprising SEQ ID NO:60 and a heavy chain variable region comprising SEQ ID NO:217, a light chain variable region comprising SEQ ID NO:61 and a heavy chain variable region comprising SEQ ID NO:218, a light chain variable region comprising SEQ ID NO:62 and a heavy chain variable region comprising SEQ ID NO:219, a light chain variable region comprising SEQ ID NO:63 and a heavy chain variable region comprising SEQ ID NO:220, a light chain variable region comprising SEQ ID NO:64 and a heavy chain variable region comprising SEQ ID NO:221, a light chain variable region comprising SEQ ID NO:65 and a heavy chain variable region comprising SEQ ID NO:222, a light chain variable region comprising SEQ ID NO:66 and A heavy chain variable region comprising SEQ ID NO:223, a light chain variable region comprising SEQ ID NO:67 and a heavy chain variable region comprising SEQ ID NO:224, a light chain variable region comprising SEQ ID NO:68 and a heavy chain variable region comprising SEQ ID NO:225, a light chain variable region comprising SEQ ID NO:69 and a heavy chain variable region comprising SEQ ID NO:226, a light chain variable region comprising SEQ ID NO:70 and a heavy chain variable region comprising SEQ ID NO:227, a light chain variable region comprising SEQ ID NO:71 and a heavy chain variable region comprising SEQ ID NO:228, a light chain variable region comprising SEQ ID NO:72 and a heavy chain variable region comprising SEQ ID NO:229, a light chain variable region comprising SEQ ID NO:73 and SEQ ID NO:230. a heavy chain variable region comprising SEQ ID NO: 237, a light chain variable region comprising SEQ ID NO: 74 and a heavy chain variable region comprising SEQ ID NO: 231, a light chain variable region comprising SEQ ID NO: 75 and a heavy chain variable region comprising SEQ ID NO: 232, a light chain variable region comprising SEQ ID NO: 76 and a heavy chain variable region comprising SEQ ID NO: 233, a light chain variable region comprising SEQ ID NO: 77 and a heavy chain variable region comprising SEQ ID NO: 234, a light chain variable region comprising SEQ ID NO: 78 and a heavy chain variable region comprising SEQ ID NO: 235, a light chain variable region comprising SEQ ID NO: 79 and a heavy chain variable region comprising SEQ ID NO: 236, a light chain variable region comprising SEQ ID NO: 80 and a heavy chain variable region comprising SEQ ID NO: 237,a light chain variable region comprising SEQ ID NO:81 and a heavy chain variable region comprising SEQ ID NO:238; a light chain variable region comprising SEQ ID NO:82 and a heavy chain variable region comprising SEQ ID NO:239; a light chain variable region comprising SEQ ID NO:83 and a heavy chain variable region comprising SEQ ID NO:240; a light chain variable region comprising SEQ ID NO:84 and a heavy chain variable region comprising SEQ ID NO:241; a light chain variable region comprising SEQ ID NO:85 and a heavy chain variable region comprising SEQ ID NO:242; a light chain variable region comprising SEQ ID NO:86 and a heavy chain variable region comprising SEQ ID NO:243; a light chain variable region comprising SEQ ID NO:87 and a heavy chain variable region comprising SEQ ID NO:244; a light chain variable region comprising SEQ ID NO:88 a light chain variable region comprising SEQ ID NO: 89 and a heavy chain variable region comprising SEQ ID NO: 246; a light chain variable region comprising SEQ ID NO: 90 and a heavy chain variable region comprising SEQ ID NO: 247; a light chain variable region comprising SEQ ID NO: 91 and a heavy chain variable region comprising SEQ ID NO: 248; a light chain variable region comprising SEQ ID NO: 92 and a heavy chain variable region comprising SEQ ID NO: 249; a light chain variable region comprising SEQ ID NO: 93 and a heavy chain variable region comprising SEQ ID NO: 250; a light chain variable region comprising SEQ ID NO: 94 and a heavy chain variable region comprising SEQ ID NO: 251; a light chain variable region comprising SEQ ID NO: 95 and a heavy chain variable region comprising SEQ ID NO: 2 52, a light chain variable region comprising SEQ ID NO: 96 and a heavy chain variable region comprising SEQ ID NO: 253, a light chain variable region comprising SEQ ID NO: 97 and a heavy chain variable region comprising SEQ ID NO: 254, a light chain variable region comprising SEQ ID NO: 98 and a heavy chain variable region comprising SEQ ID NO: 255, a light chain variable region comprising SEQ ID NO: 99 and a heavy chain variable region comprising SEQ ID NO: 256, a light chain variable region comprising SEQ ID NO: 100 and a heavy chain variable region comprising SEQ ID NO: 257, a light chain variable region comprising SEQ ID NO: 101 and a heavy chain variable region comprising SEQ ID NO: 258, a light chain variable region comprising SEQ ID NO: 102 and a heavy chain variable region comprising SEQ ID NO: 259 a light chain variable region comprising SEQ ID NO: 103 and a heavy chain variable region comprising SEQ ID NO: 260; a light chain variable region comprising SEQ ID NO: 104 and a heavy chain variable region comprising SEQ ID NO: 261; a light chain variable region comprising SEQ ID NO: 105 and a heavy chain variable region comprising SEQ ID NO: 262; a light chain variable region comprising SEQ ID NO: 106 and a heavy chain variable region comprising SEQ ID NO: 263; a light chain variable region comprising SEQ ID NO: 107 and a heavy chain variable region comprising SEQ ID NO: 264; a light chain variable region comprising SEQ ID NO: 108 and a heavy chain variable region comprising SEQ ID NO: 265; a light chain variable region comprising SEQ ID NO: 109 and a heavy chain variable region comprising SEQ ID NO: 266;a light chain variable region comprising SEQ ID NO:110 and a heavy chain variable region comprising SEQ ID NO:267, a light chain variable region comprising SEQ ID NO:111 and a heavy chain variable region comprising SEQ ID NO:268, a light chain variable region comprising SEQ ID NO:112 and a heavy chain variable region comprising SEQ ID NO:269, a light chain variable region comprising SEQ ID NO:113 and a heavy chain variable region comprising SEQ ID NO:270, a light chain variable region comprising SEQ ID NO:114 and a heavy chain variable region comprising SEQ ID NO:271, a light chain variable region comprising SEQ ID NO:115 and a heavy chain variable region comprising SEQ ID NO:272, a light chain variable region comprising SEQ ID NO:116 and a heavy chain variable region comprising SEQ ID NO:273, a light chain variable region comprising SEQ ID NO:117 and a heavy chain variable region comprising SEQ ID NO:274; a light chain variable region comprising SEQ ID NO:118 and a heavy chain variable region comprising SEQ ID NO:275; a light chain variable region comprising SEQ ID NO:119 and a heavy chain variable region comprising SEQ ID NO:276; a light chain variable region comprising SEQ ID NO:120 and a heavy chain variable region comprising SEQ ID NO:277; a light chain variable region comprising SEQ ID NO:121 and a heavy chain variable region comprising SEQ ID NO:278; a light chain variable region comprising SEQ ID NO:122 and a heavy chain variable region comprising SEQ ID NO:279; a light chain variable region comprising SEQ ID NO:123 and a heavy chain variable region comprising SEQ ID NO:280; a light chain variable region comprising SEQ ID NO: 124 and a heavy chain variable region comprising SEQ ID NO: 281; a light chain variable region comprising SEQ ID NO: 125 and a heavy chain variable region comprising SEQ ID NO: 282; a light chain variable region comprising SEQ ID NO: 126 and a heavy chain variable region comprising SEQ ID NO: 283; a light chain variable region comprising SEQ ID NO: 127 and a heavy chain variable region comprising SEQ ID NO: 284; a light chain variable region comprising SEQ ID NO: 128 and a heavy chain variable region comprising SEQ ID NO: 285; a light chain variable region comprising SEQ ID NO: 129 and a heavy chain variable region comprising SEQ ID NO: 286; a light chain variable region comprising SEQ ID NO: 130 and a heavy chain variable region comprising SEQ ID NO: 287; a light chain variable region comprising SEQ ID NO: 131 and a heavy chain variable region comprising SEQ ID NO: 288; a light chain variable region comprising SEQ ID NO: 132 and a heavy chain variable region comprising SEQ ID NO: 289; a light chain variable region comprising SEQ ID NO: 133 and a heavy chain variable region comprising SEQ ID NO: 290; a light chain variable region comprising SEQ ID NO: 134 and a heavy chain variable region comprising SEQ ID NO: 291; a light chain variable region comprising SEQ ID NO: 135 and a heavy chain variable region comprising SEQ ID NO: 292; a light chain variable region comprising SEQ ID NO: 136 and a heavy chain variable region comprising SEQ ID NO: 293; a light chain variable region comprising SEQ ID NO: 137 and a heavy chain variable region comprising SEQ ID NO: 294;a light chain variable region comprising SEQ ID NO: 138 and a heavy chain variable region comprising SEQ ID NO: 295, a light chain variable region comprising SEQ ID NO: 139 and a heavy chain variable region comprising SEQ ID NO: 296, a light chain variable region comprising SEQ ID NO: 140 and a heavy chain variable region comprising SEQ ID NO: 297, a light chain variable region comprising SEQ ID NO: 141 and a heavy chain variable region comprising SEQ ID NO: 298, a light chain variable region comprising SEQ ID NO: 142 and a heavy chain variable region comprising SEQ ID NO: 299, a light chain variable region comprising SEQ ID NO: 143 and SEQ ID NO: 300, a heavy chain variable region comprising SEQ ID NO: 144 and a heavy chain variable region comprising SEQ ID NO: 301, a light chain variable region comprising SEQ ID NO: 145 and a heavy chain variable region comprising SEQ ID NO: 302, a light chain variable region comprising SEQ ID NO: 146 and a heavy chain variable region comprising SEQ ID NO: 303, a light chain variable region comprising SEQ ID NO: 147 and a heavy chain variable region comprising SEQ ID NO: 304, a light chain variable region comprising SEQ ID NO: 148 and a heavy chain variable region comprising SEQ ID NO: 305, a light chain variable region comprising SEQ ID NO: 149 and a heavy chain variable region comprising SEQ ID NO: 306, a light chain variable region comprising SEQ ID NO: 150 and a heavy chain variable region comprising SEQ ID NO: 307, a light chain variable region comprising SEQ ID NO: 151 and a heavy chain variable region comprising SEQ ID NO:308, a light chain variable region comprising SEQ ID NO:152 and a heavy chain variable region comprising SEQ ID NO:309, a light chain variable region comprising SEQ ID NO:153 and a heavy chain variable region comprising SEQ ID NO:310, a light chain variable region comprising SEQ ID NO:154 and a heavy chain variable region comprising SEQ ID NO:311, a light chain variable region comprising SEQ ID NO:155 and a heavy chain variable region comprising SEQ ID NO:312, a light chain variable region comprising SEQ ID NO:156 and a heavy chain variable region comprising SEQ ID NO:313, and a light chain variable region comprising SEQ ID NO:157 and a heavy chain variable region comprising SEQ ID NO:314.
[0197] In one embodiment, the antibody or fragment thereof comprises a light chain variable region encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1571-1727. In one embodiment, the antibody or fragment thereof comprises a heavy chain variable region encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1728-1884. In one embodiment, the antibody or fragment thereof comprises a light chain variable region encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1571-1727 and a heavy chain variable region encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1728-1884. In one embodiment, the antibody or fragment thereof comprises a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1571 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1728, a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1572 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1729, a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1573 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1730, a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1574 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1731, a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1575, a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1576 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1733; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1577 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1734; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1578 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1735; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1579 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1736;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1580 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1737; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1581 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1738; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1582 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1739; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1583 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1740; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1584 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1741; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1585 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1742; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1586 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1743; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1587 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1744; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1588 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1745; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1589 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1746; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1590 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1747; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1591 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1748; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1592 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1749;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1593 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1750; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1594 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1751; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1595 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1752; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1596 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1753; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1597 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1754; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1598 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1755; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1599 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1756; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1600 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1757; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1601 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1758; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1602 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1759; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1603 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1760; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1604 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1761; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1605 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1762;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1606 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1763; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1607 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1764; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1608 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1765; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1609 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1766; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1610 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1767; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1611 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1768; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1612 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1769; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1613 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1770; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1614 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1771; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1615 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1772; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1616 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1773; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1617 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1774; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1618 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1775;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1619 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1776; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1620 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1777; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1621 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1778; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1622 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1779; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1623 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1780; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1624 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1781; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1625 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1782; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1626 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1783; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1627 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1784; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1628 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1785; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1629 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1786; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1630 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1787; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1631 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1788;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1632 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1789; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1633 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1; a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1637 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1794; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1638 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1795; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1639 and a polynucleotide sequence comprising SEQ ID NO: 1796. a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1640 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1797; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1641 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1798; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1642 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1799; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1643 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1800; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1644 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1801; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1645 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1802;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1646 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1803; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1647 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1804; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1648 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1805; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1649 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1806; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1650 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1807; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1651 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1808; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1652 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1809; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1653 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1810; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1654 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1811; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1655 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1812; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1656 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1813; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1657 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1814; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1658 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1815;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1659 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1816; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1660 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1817; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1661 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1818; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1662 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1819; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1663 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1820; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1664 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1821; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1665 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1822; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1666 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1823; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1667 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1824; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1668 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1825; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1669 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1826; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1670 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1827; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1671 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1828;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1672 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1829; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1673 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1830; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1674 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1831; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1675 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1832; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1676 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1833; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1677 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1834; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1678 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1835; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1679 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1836; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1680 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1837; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1681 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1838; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1682 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1839; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1683 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1840; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1684 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1841;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1685 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1842; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1686 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1843; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1687 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1844; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1688 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1845; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1689 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1846; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1690 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1847; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1691 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1848; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1692 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1849; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1693 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1850; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1694 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1851; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1695 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1852; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1696 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1853; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1697 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1854;A light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1698 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1855; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1699 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1856; SEQ ID NO: 17; 00 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1857; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1701 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1858; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1702 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1859; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1703 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1860; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1704 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1861; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1705 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1862; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1706 and a sequence a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1863; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1707 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1864; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1708 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1865; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1709 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1866; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1710 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1867; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1711 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1868; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1712 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1869;a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1713 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1870; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1714 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1871; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1715 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1872; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1716 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1873; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1717 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1874; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1718 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1875; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1719 and and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1876; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1720 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1877; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1721 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1878; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1722 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1879; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1723 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1880; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1724 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1881; a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1725 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO:1882;The combination of a light chain variable region and a heavy chain variable region selected from the group consisting of a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1726 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1883, and a light chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1727 and a heavy chain variable region encoded by a polynucleotide sequence comprising SEQ ID NO: 1884.
[0198] Some antigen binding proteins comprise a variable light domain and a variable heavy domain set forth in one of the rows directed to one of the antibodies set forth in Table 3. In some cases, the antigen binding protein comprises two identical variable light domains and two identical variable heavy domains derived from one of the antibodies set forth in Table 3. Some of the antigen binding proteins provided comprise a variable light domain and a variable heavy domain as set forth in one of the rows directed to one of the antibodies set forth in Table 3, with the exception that one or both of the domains differs from the sequence specified in that table by only 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acid residues, each such sequence difference being independently either a single amino acid deletion, insertion, or substitution, and such deletions, insertions, and / or substitutions result in no more than 1, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 11 or less, 12 or less, 13 or less, 14 or less, or 15 or less amino acids being altered compared to the variable domain sequence specified in Table 3. In one embodiment the antigen binding protein comprises a variable region sequence from Table 3, but lacking the N-terminal methionine. Other antigen binding proteins also comprise a variable light domain and a variable heavy domain as set forth in one of the rows directed to one of the antibodies set forth in Table 3, except that one or both of the domains differ from the sequences specified in that table in that the heavy chain variable domain and / or the light chain variable domain comprises or consists of an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of the heavy chain variable domain sequence or light chain variable domain sequence identified in Table 3.
[0199] In another embodiment, the antigen binding protein consists solely of a variable light domain or variable heavy domain from an antibody listed in Table 3. In yet another embodiment, the antigen binding protein comprises two or more identical variable heavy domains or two or more identical variable light domains from those listed in Table 3. Such domain antibodies may be fused or linked together via a linker, as described in more detail below. Domain antibodies may also be fused or linked to one or more molecules (e.g., PEG or albumin) to extend their half-life.
[0200] Other antigen binding proteins provided are variants of antibodies formed by the combination of heavy and light chains shown in Table 3, and include a light chain and / or a heavy chain that each have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequences of such chains. In some cases, such antibodies include at least one heavy chain and one light chain, while in other cases, the variant form includes two identical light chains and two identical heavy chains.
[0201] The various combinations of heavy chain variable regions may be combined with any of the various combinations of light chain variable regions.
[0202] In an additional embodiment, the isolated antigen binding protein provided herein is a human antibody comprising a sequence as set forth in Table 3, 1 Type, IgG 2 Type, IgG 3 type, or IgG 4 It is of the type.
[0203] The antigen binding proteins disclosed herein are polypeptides into which one or more CDRs have been grafted, inserted, and / or linked. An antigen binding protein may have one, two, three, four, five, or six CDRs. Thus, an antigen binding protein may have, for example, one heavy chain CDR1 ("CDRH1"), and / or one heavy chain CDR2 ("CDRH2"), and / or one heavy chain CDR3 ("CDRH3"), and / or one light chain CDR1 ("CDRL1"), and / or one light chain CDR2 ("CDRL2"), and / or one light chain CDR3 ("CDRL3"). Some antigen binding proteins include both CDRH3 and CDRL3. Particular light chain and heavy chain CDRs are identified in Table 4A and Table 4B, respectively.
[0204] The complementarity determining regions (CDRs) and framework regions (FRs) of a given antibody may be identified using the system described by Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication no. 91-3242, 1991. Certain antibodies disclosed herein contain one or more amino acid sequences that are identical to or have substantial sequence identity with one or more of the amino acid sequences of the CDRs shown in Tables 4A and 4B. For such CDRs, the system described by Kabat et al., supra, is used.
[0205] The structure and properties of the CDRs contained in naturally occurring antibodies are described above. Briefly, in traditional antibodies, the CDRs are integrated into frameworks in the heavy and light chain variable regions where they constitute the regions responsible for binding and recognizing the antigen. The variable regions comprise at least three heavy or light chain CDRs (see Kabat et al., 1991, supra, Sequences of Proteins of Immunological Interest, Public Health Service NIH, Bethesda, MD; see also Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917; Chothia et al., 1989, Nature 342:877-883) within framework regions (designated framework regions 1-4 (FR1, FR2, FR3, and FR4) by Kabat et al., 1991, supra; see also Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917; Chothia et al., 1989, Nature 342:877-883). However, the CDRs provided herein may be used to define the antigen-binding domain of a traditional antibody structure, as well as be incorporated into a variety of other polypeptide structures described herein.
[0206] In one embodiment, the antibody or fragment thereof comprises CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3. In one embodiment, the antibody or fragment thereof comprises CDRL1 comprising a sequence selected from the group consisting of SEQ ID NOs: 629-785. In one embodiment, the antibody or fragment thereof comprises CDRL2 comprising a sequence selected from the group consisting of SEQ ID NOs: 786-942. In one embodiment, the antibody or fragment thereof comprises CDRL3 comprising a sequence selected from the group consisting of SEQ ID NOs: 943-1099. In one embodiment, the antibody or fragment thereof comprises CDRH1 comprising a sequence selected from the group consisting of SEQ ID NOs: 1100-1256. In one embodiment, the antibody or fragment thereof comprises CDRH2 comprising a sequence selected from the group consisting of SEQ ID NOs: 1257-1413. In one embodiment, the antibody or fragment thereof comprises CDRH3 comprising a sequence selected from the group consisting of SEQ ID NOs: 1414-1570. In one embodiment, the antibody or fragment thereof comprises CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3, each of which is set forth in SEQ ID NO:629, SEQ ID NO:786, SEQ ID NO:943, SEQ ID NO:1100, SEQ ID NO:1257, and SEQ ID NO:1414; SEQ ID NO:630, SEQ ID NO:787, SEQ ID NO:944, SEQ ID NO:1101, SEQ ID NO:1258, and SEQ ID NO:1415; SEQ ID NO:631, SEQ ID NO:788, SEQ ID NO:945, SEQ ID NO:1102, SEQ ID NO:1259, and SEQ ID NO:1416; SEQ ID NO:632, SEQ ID NO:789, SEQ ID NO: 946, SEQ ID NO:1103, SEQ ID NO:1260, and SEQ ID NO:1417, SEQ ID NO:633, SEQ ID NO:790, SEQ ID NO:947, SEQ ID NO:1104, SEQ ID NO:1261, and SEQ ID NO:1418, SEQ ID NO:634, SEQ ID NO:791, SEQ ID NO:948, SEQ ID NO:1105, SEQ ID NO:1262, and SEQ ID NO:1419, SEQ ID NO:635, SEQ ID NO:792, SEQ ID NO:949, SEQ ID NO:1106, SEQ ID NO:1263, and SEQ ID NO:1420, SEQ ID NO:636, SEQ ID NO:793, SEQ ID NO:950, SEQ ID NO:1107, SEQ ID NO:1264, and SEQ ID NO:1421, SEQ ID NO:637, SEQ ID NO:794, SEQ ID NO:951, SEQ ID NO:1108, SEQ ID NO:1265,and SEQ ID NO:1422, SEQ ID NO:638, SEQ ID NO:795, SEQ ID NO:952, SEQ ID NO:1109, SEQ ID NO:1266, and SEQ ID NO:1423, SEQ ID NO:639, SEQ ID NO:796, SEQ ID NO:953, SEQ ID NO:1110, SEQ ID NO:1267, and SEQ ID NO:1424, SEQ ID NO:640, SEQ ID NO:797, SEQ ID NO:954, SEQ ID NO:1111, SEQ ID NO:1268, and SEQ ID NO:1425, SEQ ID NO:641, SEQ ID NO:798, SEQ ID NO:955, SEQ ID NO:1112, SEQ ID NO:1269, and SEQ ID NO:1426, SEQ ID NO:642, SEQ ID NO:799, SEQ ID NO:95 6, SEQ ID NO:1113, SEQ ID NO:1270, and SEQ ID NO:1427; SEQ ID NO:643, SEQ ID NO:800, SEQ ID NO:957, SEQ ID NO:1114, SEQ ID NO:1271, and SEQ ID NO:1428; SEQ ID NO:644, SEQ ID NO:801, SEQ ID NO:958, SEQ ID NO:1115, SEQ ID NO:1272, and SEQ ID NO:1429; SEQ ID NO:645, SEQ ID NO:802, SEQ ID NO:959, SEQ ID NO:1116, SEQ ID NO:1273, and SEQ ID NO:1430; SEQ ID NO:646, SEQ ID NO:803, SEQ ID NO:960, SEQ ID NO:1117, SEQ ID NO:1274, and SEQ ID NO:1431; SEQ ID NO:647, SEQ ID NO:804, SEQ ID NO:961, SEQ ID NO:1118, SEQ ID NO:1275, and SEQ ID NO:1432, SEQ ID NO:648, SEQ ID NO:805, SEQ ID NO:962, SEQ ID NO:1119, SEQ ID NO:1276, and SEQ ID NO:1433, SEQ ID NO:649, SEQ ID NO:806, SEQ ID NO:963, SEQ ID NO:1120, SEQ ID NO:1277, and SEQ ID NO:1434, SEQ ID NO:650, SEQ ID NO:807, SEQ ID NO:964, SEQ ID NO:1121, SEQ ID NO:1278, and SEQ ID NO:1435, SEQ ID NO:651, SEQ ID NO:808, SEQ ID NO:965, SEQ ID NO:1122, SEQ ID NO: No. 1279, and SEQ ID NO: 1436, and SEQ ID NO: 652, SEQ ID NO: 809, SEQ ID NO: 966, SEQ ID NO: 1123, SEQ ID NO: 1280, and SEQ ID NO: 1437, and SEQ ID NO: 653, SEQ ID NO: 810, SEQ ID NO: 967, SEQ ID NO: 1124, SEQ ID NO: 1281, and SEQ ID NO: 1438, and SEQ ID NO: 654, SEQ ID NO: 811, SEQ ID NO: 968, SEQ ID NO: 1125, SEQ ID NO: 1282, and SEQ ID NO: 1439, and SEQ ID NO: 655, SEQ ID NO: 812, SEQ ID NO: 969, SEQ ID NO: 1126, SEQ ID NO: 1283, and SEQ ID NO: 1440, and SEQ ID NO: 656, SEQ ID NO: 813,SEQ ID NO:970, SEQ ID NO:1127, SEQ ID NO:1284, and SEQ ID NO:1441; SEQ ID NO:657, SEQ ID NO:814, SEQ ID NO:971, SEQ ID NO:1128, SEQ ID NO:1285, and SEQ ID NO:1442; SEQ ID NO:658, SEQ ID NO:815, SEQ ID NO:972, SEQ ID NO:1129, SEQ ID NO:1286, and SEQ ID NO:1443; SEQ ID NO:659, SEQ ID NO:816, SEQ ID NO:973, SEQ ID NO:1130, SEQ ID NO:1287, and SEQ ID NO:1444; SEQ ID NO:660, SEQ ID NO:817, SEQ ID NO:974, SEQ ID NO:1131, SEQ ID NO:1288, and SEQ ID NO: 445, SEQ ID NO:661, SEQ ID NO:818, SEQ ID NO:975, SEQ ID NO:1132, SEQ ID NO:1289, and SEQ ID NO:1446, SEQ ID NO:662, SEQ ID NO:819, SEQ ID NO:976, SEQ ID NO:1133, SEQ ID NO:1290, and SEQ ID NO:1447, SEQ ID NO:663, SEQ ID NO:820, SEQ ID NO:977, SEQ ID NO:1134, SEQ ID NO:1291, and SEQ ID NO:1448, SEQ ID NO:664, SEQ ID NO:821, SEQ ID NO:978, SEQ ID NO:1135, SEQ ID NO:1292, and SEQ ID NO:1449, SEQ ID NO:665, SEQ ID NO:822, SEQ ID NO:979, SEQ ID NO:1 136, SEQ ID NO: 1293, and SEQ ID NO: 1450, SEQ ID NO: 666, SEQ ID NO: 823, SEQ ID NO: 980, SEQ ID NO: 1137, SEQ ID NO: 1294, and SEQ ID NO: 1451, SEQ ID NO: 667, SEQ ID NO: 824, SEQ ID NO: 981, SEQ ID NO: 1138, SEQ ID NO: 1295, and SEQ ID NO: 1452, SEQ ID NO: 668, SEQ ID NO: 825, SEQ ID NO: 982, SEQ ID NO: 1139, SEQ ID NO: 1296, and SEQ ID NO: 1453, SEQ ID NO: 669, SEQ ID NO: 826, SEQ ID NO: 983, SEQ ID NO: 1140, SEQ ID NO: 1297, and SEQ ID NO: 1454, SEQ ID NO: 670, SEQ ID NO:827, SEQ ID NO:984, SEQ ID NO:1141, SEQ ID NO:1298, and SEQ ID NO:1455; SEQ ID NO:671, SEQ ID NO:828, SEQ ID NO:985, SEQ ID NO:1142, SEQ ID NO:1299, and SEQ ID NO:1456; SEQ ID NO:672, SEQ ID NO:829, SEQ ID NO:986, SEQ ID NO:1143, SEQ ID NO:1300, and SEQ ID NO:1457; SEQ ID NO:673, SEQ ID NO:830, SEQ ID NO:987, SEQ ID NO:1144, SEQ ID NO:1301, and SEQ ID NO:1458; SEQ ID NO:674, SEQ ID NO:831, SEQ ID NO:988, SEQ ID NO:1145, SEQ ID NO:1302;and SEQ ID NO:1459, SEQ ID NO:675, SEQ ID NO:832, SEQ ID NO:989, SEQ ID NO:1146, SEQ ID NO:1303, and SEQ ID NO:1460, SEQ ID NO:676, SEQ ID NO:833, SEQ ID NO:990, SEQ ID NO:1147, SEQ ID NO:1304, and SEQ ID NO:1461, SEQ ID NO:677, SEQ ID NO:834, SEQ ID NO:991, SEQ ID NO:1148, SEQ ID NO:1305, and SEQ ID NO:1462, SEQ ID NO:678, SEQ ID NO:835, SEQ ID NO:992, SEQ ID NO:1149, SEQ ID NO:1306, and SEQ ID NO:1463, SEQ ID NO:679, SEQ ID NO:836, SEQ ID NO:9 93, SEQ ID NO:1150, SEQ ID NO:1307, and SEQ ID NO:1464; SEQ ID NO:680, SEQ ID NO:837, SEQ ID NO:994, SEQ ID NO:1151, SEQ ID NO:1308, and SEQ ID NO:1465; SEQ ID NO:681, SEQ ID NO:838, SEQ ID NO:995, SEQ ID NO:1152, SEQ ID NO:1309, and SEQ ID NO:1466; SEQ ID NO:682, SEQ ID NO:839, SEQ ID NO:996, SEQ ID NO:1153, SEQ ID NO:1310, and SEQ ID NO:1467; SEQ ID NO:683, SEQ ID NO:840, SEQ ID NO:997, SEQ ID NO:1154, SEQ ID NO:1311, and SEQ ID NO:1468; Column number 684, SEQ ID NO:841, SEQ ID NO:998, SEQ ID NO:1155, SEQ ID NO:1312, and SEQ ID NO:1469; SEQ ID NO:685, SEQ ID NO:842, SEQ ID NO:999, SEQ ID NO:1156, SEQ ID NO:1313, and SEQ ID NO:1470; SEQ ID NO:686, SEQ ID NO:843, SEQ ID NO:1000, SEQ ID NO:1157, SEQ ID NO:1314, and SEQ ID NO:1471; SEQ ID NO:687, SEQ ID NO:844, SEQ ID NO:1001, SEQ ID NO:1158, SEQ ID NO:1315, and SEQ ID NO:1472; SEQ ID NO:688, SEQ ID NO:845, SEQ ID NO:1002, and SEQ ID NO:1159 , SEQ ID NO:1316, and SEQ ID NO:1473, SEQ ID NO:689, SEQ ID NO:846, SEQ ID NO:1003, SEQ ID NO:1160, SEQ ID NO:1317, and SEQ ID NO:1474, SEQ ID NO:690, SEQ ID NO:847, SEQ ID NO:1004, SEQ ID NO:1161, SEQ ID NO:1318, and SEQ ID NO:1475, SEQ ID NO:691, SEQ ID NO:848, SEQ ID NO:1005, SEQ ID NO:1162, SEQ ID NO:1319, and SEQ ID NO:1476, SEQ ID NO:692, SEQ ID NO:849, SEQ ID NO:1006, SEQ ID NO:1163, SEQ ID NO:1320, and SEQ ID NO:1477, SEQ ID NO:693,SEQ ID NO:850, SEQ ID NO:1007, SEQ ID NO:1164, SEQ ID NO:1321, and SEQ ID NO:1478, SEQ ID NO:694, SEQ ID NO:851, SEQ ID NO:1008, SEQ ID NO:1165, SEQ ID NO:1322, and SEQ ID NO:1479, SEQ ID NO:695, SEQ ID NO:852, SEQ ID NO:1009, SEQ ID NO:1166, SEQ ID NO:1323, and SEQ ID NO:1480, SEQ ID NO:696, SEQ ID NO:853, SEQ ID NO:1010, SEQ ID NO:1167, SEQ ID NO:1324, and SEQ ID NO:1481, SEQ ID NO:697, SEQ ID NO:854, SEQ ID NO:1011, SEQ ID NO:1168, SEQ ID NO: No. 1325, and SEQ ID NO: 1482; SEQ ID NO: 698, SEQ ID NO: 855, SEQ ID NO: 1012, SEQ ID NO: 1169, SEQ ID NO: 1326, and SEQ ID NO: 1483; SEQ ID NO: 699, SEQ ID NO: 856, SEQ ID NO: 1013, SEQ ID NO: 1170, SEQ ID NO: 1327, and SEQ ID NO: 1484; SEQ ID NO: 700, SEQ ID NO: 857, SEQ ID NO: 1014, SEQ ID NO: 1171, SEQ ID NO: 1328, and SEQ ID NO: 1485; SEQ ID NO: 701, SEQ ID NO: 858, SEQ ID NO: 1015, SEQ ID NO: 1172, SEQ ID NO: 1329, and SEQ ID NO: 1486; SEQ ID NO: 702, SEQ ID NO: 859, SEQ ID NO:1016, SEQ ID NO:1173, SEQ ID NO:1330, and SEQ ID NO:1487, SEQ ID NO:703, SEQ ID NO:860, SEQ ID NO:1017, SEQ ID NO:1174, SEQ ID NO:1331, and SEQ ID NO:1488, SEQ ID NO:704, SEQ ID NO:861, SEQ ID NO:1018, SEQ ID NO:1175, SEQ ID NO:1332, and SEQ ID NO:1489, SEQ ID NO:705, SEQ ID NO:862, SEQ ID NO:1019, SEQ ID NO:1176, SEQ ID NO:1333, and SEQ ID NO:1490, SEQ ID NO:706, SEQ ID NO:863, SEQ ID NO:1020, SEQ ID NO:1177, SEQ ID NO:133 4, and SEQ ID NO:1491, and SEQ ID NO:707, SEQ ID NO:864, SEQ ID NO:1021, SEQ ID NO:1178, SEQ ID NO:1335, and SEQ ID NO:1492, and SEQ ID NO:708, SEQ ID NO:865, SEQ ID NO:1022, SEQ ID NO:1179, SEQ ID NO:1336, and SEQ ID NO:1493, and SEQ ID NO:709, SEQ ID NO:866, SEQ ID NO:1023, SEQ ID NO:1180, SEQ ID NO:1337, and SEQ ID NO:1494, and SEQ ID NO:710, SEQ ID NO:867, SEQ ID NO:1024, SEQ ID NO:1181, SEQ ID NO:1338, and SEQ ID NO:1495, and SEQ ID NO:711, SEQ ID NO:868,SEQ ID NO:1025, SEQ ID NO:1182, SEQ ID NO:1339, and SEQ ID NO:1496, SEQ ID NO:712, SEQ ID NO:869, SEQ ID NO:1026, SEQ ID NO:1183, SEQ ID NO:1340, and SEQ ID NO:1497, SEQ ID NO:713, SEQ ID NO:870, SEQ ID NO:1027, SEQ ID NO:1, 184, SEQ ID NO: 1341, and SEQ ID NO: 1498; SEQ ID NO: 714, SEQ ID NO: 871, SEQ ID NO: 1028, SEQ ID NO: 1185, SEQ ID NO: 1342, and SEQ ID NO: 1499; SEQ ID NO: 715, SEQ ID NO: 872, SEQ ID NO: 1029, SEQ ID NO: 1186, SEQ ID NO: 1343, and SEQ ID NO: 1500; SEQ ID NO: 716, SEQ ID NO: 873, SEQ ID NO: 1030, SEQ ID NO: 1187, SEQ ID NO: 1344, and SEQ ID NO: 1501; SEQ ID NO: 717, SEQ ID NO: 874, SEQ ID NO: 1031, SEQ ID NO: 1188, SEQ ID NO: 1345, and SEQ ID NO: 1502; No. 718, SEQ ID NO: 875, SEQ ID NO: 1032, SEQ ID NO: 1189, SEQ ID NO: 1346, and SEQ ID NO: 1503; No. 719, SEQ ID NO: 876, SEQ ID NO: 1033, SEQ ID NO: 1190, SEQ ID NO: 1347, and SEQ ID NO: 1504; No. 720, SEQ ID NO: 877, SEQ ID NO: 1034, SEQ ID NO: 1191, SEQ ID NO: 1348, and SEQ ID NO: 1505; No. 721, SEQ ID NO: 878, SEQ ID NO: 1035, SEQ ID NO: 1192, SEQ ID NO: 1349, and SEQ ID NO: 1506; No. 722, SEQ ID NO: 879, SEQ ID NO: 1036, SEQ ID NO: 119 3, SEQ ID NO: 1350, and SEQ ID NO: 1507, SEQ ID NO: 723, SEQ ID NO: 880, SEQ ID NO: 1037, SEQ ID NO: 1194, SEQ ID NO: 1351, and SEQ ID NO: 1508, SEQ ID NO: 724, SEQ ID NO: 881, SEQ ID NO: 1038, SEQ ID NO: 1195, SEQ ID NO: 1352, and SEQ ID NO: 1509, SEQ ID NO: 725, SEQ ID NO: 882, SEQ ID NO: 1039, SEQ ID NO: 1196, SEQ ID NO: 1353, and SEQ ID NO: 1510, SEQ ID NO: 726, SEQ ID NO: 883, SEQ ID NO: 1040, SEQ ID NO: 1197, SEQ ID NO: 1354, and SEQ ID NO: 1511, and SEQ ID NO: 7 27, SEQ ID NO:884, SEQ ID NO:1041, SEQ ID NO:1198, SEQ ID NO:1355, and SEQ ID NO:1512, SEQ ID NO:728, SEQ ID NO:885, SEQ ID NO:1042, SEQ ID NO:1199, SEQ ID NO:1356, and SEQ ID NO:1513, SEQ ID NO:729, SEQ ID NO:886, SEQ ID NO:1043, SEQ ID NO:1200, SEQ ID NO:1357, and SEQ ID NO:1514, SEQ ID NO:730, SEQ ID NO:887, SEQ ID NO:1044, SEQ ID NO:1201, SEQ ID NO:1358, and SEQ ID NO:1515, SEQ ID NO:731, SEQ ID NO:888, SEQ ID NO:1045, SEQ ID NO:1202,SEQ ID NO:1359 and SEQ ID NO:1516, SEQ ID NO:732, SEQ ID NO:889, SEQ ID NO:1046, SEQ ID NO:1203, SEQ ID NO:1360 and SEQ ID NO:1517, SEQ ID NO:733, SEQ ID NO:890, SEQ ID NO:1047, SEQ ID NO:1204, SEQ ID NO:1361 and SEQ ID NO:1518, SEQ ID NO:734, SEQ ID NO:891, SEQ ID NO:1048, SEQ ID NO:1205, SEQ ID NO:1362 and SEQ ID NO:1519, SEQ ID NO:735, SEQ ID NO:892, SEQ ID NO:1049, SEQ ID NO:1206, SEQ ID NO:1363 and SEQ ID NO:1520, SEQ ID NO:736, SEQ ID NO:893, SEQ ID NO:1050, SEQ ID NO:1207, SEQ ID NO:1364, and SEQ ID NO:1521, SEQ ID NO:737, SEQ ID NO:894, SEQ ID NO:1051, SEQ ID NO:1208, SEQ ID NO:1365, and SEQ ID NO:1522, SEQ ID NO:738, SEQ ID NO:895, SEQ ID NO:1052, SEQ ID NO:1209, SEQ ID NO:1366, and SEQ ID NO:1523, SEQ ID NO:739, SEQ ID NO:896, SEQ ID NO:1053, SEQ ID NO:1210, SEQ ID NO:1367, and SEQ ID NO:1524, SEQ ID NO:740, SEQ ID NO:897, SEQ ID NO:1054, SEQ ID NO:1211, SEQ ID NO: SEQ ID NO: 1368, and SEQ ID NO: 1525, SEQ ID NO: 741, SEQ ID NO: 898, SEQ ID NO: 1055, SEQ ID NO: 1212, SEQ ID NO: 1369, and SEQ ID NO: 1526, SEQ ID NO: 742, SEQ ID NO: 899, SEQ ID NO: 1056, SEQ ID NO: 1213, SEQ ID NO: 1370, and SEQ ID NO: 1527, SEQ ID NO: 743, SEQ ID NO: 900, SEQ ID NO: 1057, SEQ ID NO: 1214, SEQ ID NO: 1371, and SEQ ID NO: 1528, SEQ ID NO: 744, SEQ ID NO: 901, SEQ ID NO: 1058, SEQ ID NO: 1215, SEQ ID NO: 1372, and SEQ ID NO: 1529, SEQ ID NO: 745, SEQ ID NO: 9 02, SEQ ID NO: 1059, SEQ ID NO: 1216, SEQ ID NO: 1373, and SEQ ID NO: 1530, SEQ ID NO: 746, SEQ ID NO: 903, SEQ ID NO: 1060, SEQ ID NO: 1217, SEQ ID NO: 1374, and SEQ ID NO: 1531, SEQ ID NO: 747, SEQ ID NO: 904, SEQ ID NO: 1061, SEQ ID NO: 1218, SEQ ID NO: 1375, and SEQ ID NO: 1532, SEQ ID NO: 748, SEQ ID NO: 905, SEQ ID NO: 1062, SEQ ID NO: 1219, SEQ ID NO: 1376, and SEQ ID NO: 1533, SEQ ID NO: 749, SEQ ID NO: 906, SEQ ID NO: 1063, SEQ ID NO: 1220, SEQ ID NO: 1377,and SEQ ID NO:1534, SEQ ID NO:750, SEQ ID NO:907, SEQ ID NO:1064, SEQ ID NO:1221, SEQ ID NO:1378, and SEQ ID NO:1535, SEQ ID NO:751, SEQ ID NO:908, SEQ ID NO:1065, SEQ ID NO:1222, SEQ ID NO:1379, and SEQ ID NO:1536, SEQ ID NO:752, SEQ ID NO:909, SEQ ID NO:1066, SEQ ID NO:1223, SEQ ID NO:1380, and SEQ ID NO:1537, SEQ ID NO:753, SEQ ID NO:910, SEQ ID NO:1067, SEQ ID NO:1224, SEQ ID NO:1381, and SEQ ID NO:1538, SEQ ID NO:754, SEQ ID NO:911 , SEQ ID NO: 1068, SEQ ID NO: 1225, SEQ ID NO: 1382, and SEQ ID NO: 1539, SEQ ID NO: 755, SEQ ID NO: 912, SEQ ID NO: 1069, SEQ ID NO: 1226, SEQ ID NO: 1383, and SEQ ID NO: 1540, SEQ ID NO: 756, SEQ ID NO: 913, SEQ ID NO: 1070, SEQ ID NO: 1227, SEQ ID NO: 1384, and SEQ ID NO: 1541, SEQ ID NO: 757, SEQ ID NO: 914, SEQ ID NO: 1071, SEQ ID NO: 1228, SEQ ID NO: 1385, and SEQ ID NO: 1542, SEQ ID NO: 758, SEQ ID NO: 915, SEQ ID NO: 1072, SEQ ID NO: 1229, SEQ ID NO: 1386, and SEQ ID NO:1543, SEQ ID NO:759, SEQ ID NO:916, SEQ ID NO:1073, SEQ ID NO:1230, SEQ ID NO:1387, and SEQ ID NO:1544, SEQ ID NO:760, SEQ ID NO:917, SEQ ID NO:1074, SEQ ID NO:1231, SEQ ID NO:1388, and SEQ ID NO:1545, SEQ ID NO:761, SEQ ID NO:918, SEQ ID NO:1075, SEQ ID NO:1232, SEQ ID NO:1389, and SEQ ID NO:1546, SEQ ID NO:762, SEQ ID NO:919, SEQ ID NO:1076, SEQ ID NO:1233, SEQ ID NO:1390, and SEQ ID NO:1547, SEQ ID NO:763, SEQ ID NO:920 , SEQ ID NO: 1077, SEQ ID NO: 1234, SEQ ID NO: 1391, and SEQ ID NO: 1548, SEQ ID NO: 764, SEQ ID NO: 921, SEQ ID NO: 1078, SEQ ID NO: 1235, SEQ ID NO: 1392, and SEQ ID NO: 1549, SEQ ID NO: 765, SEQ ID NO: 922, SEQ ID NO: 1079, SEQ ID NO: 1236, SEQ ID NO: 1393, and SEQ ID NO: 1550, SEQ ID NO: 766, SEQ ID NO: 923, SEQ ID NO: 1080, SEQ ID NO: 1237, SEQ ID NO: 1394, and SEQ ID NO: 1551, SEQ ID NO: 767, SEQ ID NO: 924, SEQ ID NO: 1081, SEQ ID NO: 1238, SEQ ID NO: 1395,and SEQ ID NO:1552, SEQ ID NO:768, SEQ ID NO:925, SEQ ID NO:1082, SEQ ID NO:1239, SEQ ID NO:1396, and SEQ ID NO:1553, SEQ ID NO:769, SEQ ID NO:926, SEQ ID NO:1083, SEQ ID NO:1240, SEQ ID NO:1397, and SEQ ID NO:1554, SEQ ID NO:770, SEQ ID NO:927, SEQ ID NO:1084, SEQ ID NO:1241, SEQ ID NO:1398, and SEQ ID NO:1555, SEQ ID NO:771, SEQ ID NO:928, SEQ ID NO:1085, SEQ ID NO:1242, SEQ ID NO:1399, and SEQ ID NO:1556, and SEQ ID NO:772, SEQ ID NO:929 , SEQ ID NO: 1086, SEQ ID NO: 1243, SEQ ID NO: 1400, and SEQ ID NO: 1557, SEQ ID NO: 773, SEQ ID NO: 930, SEQ ID NO: 1087, SEQ ID NO: 1244, SEQ ID NO: 1401, and SEQ ID NO: 1558, SEQ ID NO: 774, SEQ ID NO: 931, SEQ ID NO: 1088, SEQ ID NO: 1245, SEQ ID NO: 1402, and SEQ ID NO: 1559, SEQ ID NO: 775, SEQ ID NO: 932, SEQ ID NO: 1089, SEQ ID NO: 1246, SEQ ID NO: 1403, and SEQ ID NO: 1560, SEQ ID NO: 776, SEQ ID NO: 933, SEQ ID NO: 1090, SEQ ID NO: 1247, SEQ ID NO: 1404, and SEQ ID NO:1561, SEQ ID NO:777, SEQ ID NO:934, SEQ ID NO:1091, SEQ ID NO:1248, SEQ ID NO:1405, and SEQ ID NO:1562, SEQ ID NO:778, SEQ ID NO:935, SEQ ID NO:1092, SEQ ID NO:1249, SEQ ID NO:1406, and SEQ ID NO:1563, SEQ ID NO:779, SEQ ID NO:936, SEQ ID NO:1093, SEQ ID NO:1250, SEQ ID NO:1407, and SEQ ID NO:1564, SEQ ID NO:780, SEQ ID NO:937, SEQ ID NO:1094, SEQ ID NO:1251, SEQ ID NO:1408, and SEQ ID NO:1565, SEQ ID NO:781, SEQ ID NO:938 , SEQ ID NO: 1095, SEQ ID NO: 1252, SEQ ID NO: 1409, and SEQ ID NO: 1566, SEQ ID NO: 782, SEQ ID NO: 939, SEQ ID NO: 1096, SEQ ID NO: 1253, SEQ ID NO: 1410, and SEQ ID NO: 1567, SEQ ID NO: 783, SEQ ID NO: 940, SEQ ID NO: 1097, SEQ ID NO: 1254, SEQ ID NO: 1411, and SEQ ID NO: 1568, SEQ ID NO: 784, SEQ ID NO: 941, SEQ ID NO: 1098, SEQ ID NO: 1255, SEQ ID NO: 1412, and SEQ ID NO: 1569, SEQ ID NO: 785, SEQ ID NO: 942, SEQ ID NO: 1099, SEQ ID NO: 1256, SEQ ID NO: 1413,and SEQ ID NO: 1570.
[0207] In one embodiment, the antibody or fragment thereof comprises CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3 encoded by polynucleotides. In one embodiment, the antibody or fragment thereof comprises CDRL1 encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2199-2355. In one embodiment, the antibody or fragment thereof comprises CDRL2 encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2356-2512. In one embodiment, the antibody or fragment thereof comprises CDRL3 encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2513-2669. In one embodiment, the antibody or fragment thereof comprises CDRH1 encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2700-2826. In one embodiment, the antibody or fragment thereof comprises CDRH2 encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2827-2983. In one embodiment, the antibody or fragment thereof comprises a CDRH3 encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2984 to 3140. In one embodiment, the antibody or fragment thereof comprises CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3, each of which is selected from SEQ ID NOs: 2199, 2356, 2513, 2670, 2827, and 2984; SEQ ID NO: 2200, SEQ ID NO: 2357, SEQ ID NO: 2514, SEQ ID NO: 2671, SEQ ID NO: 2828, and SEQ ID NO: 2985; and SEQ ID NO: 2201, SEQ ID NO: 2357, SEQ ID NO: 2514, SEQ ID NO: 2671, SEQ ID NO: 2828, and SEQ ID NO: 2985, respectively. No. 2358, No. 2515, No. 2672, No. 2829, and No. 2986, No. 2202, No. 2359, No. 2516, No. 2673, No. 2830, and No. 2987, No. 2203, No. 2360, No. 2517, No. 2674, No. 2831, and No. 2988, No. 2204, No. 2361, No. 2518, No. 2675, No. 2832, and No. 2989, No. 2205, No. 2362,SEQ ID NO:2519, SEQ ID NO:2676, SEQ ID NO:2833, and SEQ ID NO:2990, SEQ ID NO:2206, SEQ ID NO:2363, SEQ ID NO:2520, SEQ ID NO:2677, SEQ ID NO:2834, and SEQ ID NO:2991, SEQ ID NO:2207, SEQ ID NO:2364, SEQ ID NO:2521, SEQ ID NO:2678, SEQ ID NO:2835, and SEQ ID NO:2992, SEQ ID NO:2208, SEQ ID NO:2365, SEQ ID NO:2522, SEQ ID NO:2679, SEQ ID NO:2836, and SEQ ID NO:2993, SEQ ID NO:2209, SEQ ID NO:2366, SEQ ID NO:2523, SEQ ID NO:2680, SEQ ID NO: SEQ ID NO:2837, and SEQ ID NO:2994; SEQ ID NO:2210, SEQ ID NO:2367, SEQ ID NO:2524, SEQ ID NO:2681, SEQ ID NO:2838, and SEQ ID NO:2995; SEQ ID NO:2211, SEQ ID NO:2368, SEQ ID NO:2525, SEQ ID NO:2682, SEQ ID NO:2839, and SEQ ID NO:2996; SEQ ID NO:2212, SEQ ID NO:2369, SEQ ID NO:2526, SEQ ID NO:2683, SEQ ID NO:2840, and SEQ ID NO:2997; SEQ ID NO:2213, SEQ ID NO:2370, SEQ ID NO:2527, SEQ ID NO:2684, SEQ ID NO:2841, and SEQ ID NO:2998; No. 2214, SEQ ID NO: 2371, SEQ ID NO: 2528, SEQ ID NO: 2685, SEQ ID NO: 2842, and SEQ ID NO: 2999; SEQ ID NO: 2215, SEQ ID NO: 2372, SEQ ID NO: 2529, SEQ ID NO: 2686, SEQ ID NO: 2843, and SEQ ID NO: 3000; SEQ ID NO: 2216, SEQ ID NO: 2373, SEQ ID NO: 2530, SEQ ID NO: 2687, SEQ ID NO: 2844, and SEQ ID NO: 3001; SEQ ID NO: 2217, SEQ ID NO: 2374, SEQ ID NO: 2531, SEQ ID NO: 2688, SEQ ID NO: 2845, and SEQ ID NO: 3002; SEQ ID NO: 2218, SEQ ID NO: 2375, SEQ ID NO: 25 32, SEQ ID NO:2689, SEQ ID NO:2846, and SEQ ID NO:3003, SEQ ID NO:2219, SEQ ID NO:2376, SEQ ID NO:2533, SEQ ID NO:2690, SEQ ID NO:2847, and SEQ ID NO:3004, SEQ ID NO:2220, SEQ ID NO:2377, SEQ ID NO:2534, SEQ ID NO:2691, SEQ ID NO:2848, and SEQ ID NO:3005, SEQ ID NO:2221, SEQ ID NO:2378, SEQ ID NO:2535, SEQ ID NO:2692, SEQ ID NO:2849, and SEQ ID NO:3006, SEQ ID NO:2222, SEQ ID NO:2379, SEQ ID NO:2536, SEQ ID NO:2693, SEQ ID NO:2850,and SEQ ID NO:3007, SEQ ID NO:2223, SEQ ID NO:2380, SEQ ID NO:2537, SEQ ID NO:2694, SEQ ID NO:2851, and SEQ ID NO:3008, SEQ ID NO:2224, SEQ ID NO:2381, SEQ ID NO:2538, SEQ ID NO:2695, SEQ ID NO:2852, and SEQ ID NO:3009, SEQ ID NO:2225, SEQ ID NO:2382, SEQ ID NO:2539, SEQ ID NO:2696, SEQ ID NO:2853, and SEQ ID NO:3010, SEQ ID NO:2226, SEQ ID NO:2383, SEQ ID NO:2540, SEQ ID NO:2697, SEQ ID NO:2854, and SEQ ID NO:3011, and SEQ ID NO:2227, SEQ ID NO:2384, SEQ ID NO:2541, SEQ ID NO:2698, SEQ ID NO:2855, and SEQ ID NO:3012, SEQ ID NO:2228, SEQ ID NO:2385, SEQ ID NO:2542, SEQ ID NO:2699, SEQ ID NO:2856, and SEQ ID NO:3013, SEQ ID NO:2229, SEQ ID NO:2386, SEQ ID NO:2543, SEQ ID NO:2700, SEQ ID NO:2857, and SEQ ID NO:3014, SEQ ID NO:2230, SEQ ID NO:2387, SEQ ID NO:2544, SEQ ID NO:2701, SEQ ID NO:2858, and SEQ ID NO:3015, SEQ ID NO:2231, SEQ ID NO:2388, SEQ ID NO:2545, 2702, SEQ ID NO:2859, and SEQ ID NO:3016, SEQ ID NO:2232, SEQ ID NO:2389, SEQ ID NO:2546, SEQ ID NO:2703, SEQ ID NO:2860, and SEQ ID NO:3017, SEQ ID NO:2233, SEQ ID NO:2390, SEQ ID NO:2547, SEQ ID NO:2704, SEQ ID NO:2861, and SEQ ID NO:3018, SEQ ID NO:2234, SEQ ID NO:2391, SEQ ID NO:2548, SEQ ID NO:2705, SEQ ID NO:2862, and SEQ ID NO:3019, SEQ ID NO:2235, SEQ ID NO:2392, SEQ ID NO:2549, SEQ ID NO:2706, SEQ ID NO:2863, and SEQ ID NO:30 20, SEQ ID NO: 2236, SEQ ID NO: 2393, SEQ ID NO: 2550, SEQ ID NO: 2707, SEQ ID NO: 2864, and SEQ ID NO: 3021, SEQ ID NO: 2237, SEQ ID NO: 2394, SEQ ID NO: 2551, SEQ ID NO: 2708, SEQ ID NO: 2865, and SEQ ID NO: 3022, SEQ ID NO: 2238, SEQ ID NO: 2395, SEQ ID NO: 2552, SEQ ID NO: 2709, SEQ ID NO: 2866, and SEQ ID NO: 3023, SEQ ID NO: 2239, SEQ ID NO: 2396, SEQ ID NO: 2553, SEQ ID NO: 2710, SEQ ID NO: 2867, and SEQ ID NO: 3024, SEQ ID NO: 2240, SEQ ID NO: 2397,SEQ ID NO:2554, SEQ ID NO:2711, SEQ ID NO:2868, and SEQ ID NO:3025, SEQ ID NO:2241, SEQ ID NO:2398, SEQ ID NO:2555, SEQ ID NO:2712, SEQ ID NO:2869, and SEQ ID NO:3026, SEQ ID NO:2242, SEQ ID NO:2399, SEQ ID NO:2556, SEQ ID NO:2713, SEQ ID NO:2870, and SEQ ID NO:3027, SEQ ID NO:2243, SEQ ID NO:2400, SEQ ID NO:2557, SEQ ID NO:2714, SEQ ID NO:2871, and SEQ ID NO:3028, SEQ ID NO:2244, SEQ ID NO:2401, SEQ ID NO:2558, SEQ ID NO:2715, SEQ ID NO: SEQ ID NO:2872, and SEQ ID NO:3029; SEQ ID NO:2245, SEQ ID NO:2402, SEQ ID NO:2559, SEQ ID NO:2716, SEQ ID NO:2873, and SEQ ID NO:3030; SEQ ID NO:2246, SEQ ID NO:2403, SEQ ID NO:2560, SEQ ID NO:2717, SEQ ID NO:2874, and SEQ ID NO:3031; SEQ ID NO:2247, SEQ ID NO:2404, SEQ ID NO:2561, SEQ ID NO:2718, SEQ ID NO:2875, and SEQ ID NO:3032; SEQ ID NO:2248, SEQ ID NO:2405, SEQ ID NO:2562, SEQ ID NO:2719, SEQ ID NO:2876, and SEQ ID NO:3033; No. 2249, SEQ ID NO: 2406, SEQ ID NO: 2563, SEQ ID NO: 2720, SEQ ID NO: 2877, and SEQ ID NO: 3034, SEQ ID NO: 2250, SEQ ID NO: 2407, SEQ ID NO: 2564, SEQ ID NO: 2721, SEQ ID NO: 2878, and SEQ ID NO: 3035, SEQ ID NO: 2251, SEQ ID NO: 2408, SEQ ID NO: 2565, SEQ ID NO: 2722, SEQ ID NO: 2879, and SEQ ID NO: 3036, SEQ ID NO: 2252, SEQ ID NO: 2409, SEQ ID NO: 2566, SEQ ID NO: 2723, SEQ ID NO: 2880, and SEQ ID NO: 3037, SEQ ID NO: 2253, SEQ ID NO: 2410, SEQ ID NO: 25 67, SEQ ID NO:2724, SEQ ID NO:2881, and SEQ ID NO:3038, SEQ ID NO:2254, SEQ ID NO:2411, SEQ ID NO:2568, SEQ ID NO:2725, SEQ ID NO:2882, and SEQ ID NO:3039, SEQ ID NO:2255, SEQ ID NO:2412, SEQ ID NO:2569, SEQ ID NO:2726, SEQ ID NO:2883, and SEQ ID NO:3040, SEQ ID NO:2256, SEQ ID NO:2413, SEQ ID NO:2570, SEQ ID NO:2727, SEQ ID NO:2884, and SEQ ID NO:3041, SEQ ID NO:2257, SEQ ID NO:2414, SEQ ID NO:2571, SEQ ID NO:2728, SEQ ID NO:2885,and SEQ ID NO:3042, SEQ ID NO:2258, SEQ ID NO:2415, SEQ ID NO:2572, SEQ ID NO:2729, SEQ ID NO:2886, and SEQ ID NO:3043, SEQ ID NO:2259, SEQ ID NO:2416, SEQ ID NO:2573, SEQ ID NO:2730, SEQ ID NO:2887, and SEQ ID NO:3044, SEQ ID NO:2260, SEQ ID NO:2417, SEQ ID NO:2574, SEQ ID NO:2731, SEQ ID NO:2888, and SEQ ID NO:3045, SEQ ID NO:2261, SEQ ID NO:2418, SEQ ID NO:2575, SEQ ID NO:2732, SEQ ID NO:2889, and SEQ ID NO:3046, and SEQ ID NO:2262, SEQ ID NO:2419, SEQ ID NO:2576, SEQ ID NO:2733, SEQ ID NO:2890, and SEQ ID NO:3047, SEQ ID NO:2263, SEQ ID NO:2420, SEQ ID NO:2577, SEQ ID NO:2734, SEQ ID NO:2891, and SEQ ID NO:3048, SEQ ID NO:2264, SEQ ID NO:2421, SEQ ID NO:2578, SEQ ID NO:2735, SEQ ID NO:2892, and SEQ ID NO:3049, SEQ ID NO:2265, SEQ ID NO:2422, SEQ ID NO:2579, SEQ ID NO:2736, SEQ ID NO:2893, and SEQ ID NO:3050, SEQ ID NO:2266, SEQ ID NO:2423, SEQ ID NO:2580, SEQ ID NO: 2737, SEQ ID NO:2894, and SEQ ID NO:3051, SEQ ID NO:2267, SEQ ID NO:2424, SEQ ID NO:2581, SEQ ID NO:2738, SEQ ID NO:2895, and SEQ ID NO:3052, SEQ ID NO:2268, SEQ ID NO:2425, SEQ ID NO:2582, SEQ ID NO:2739, SEQ ID NO:2896, and SEQ ID NO:3053, SEQ ID NO:2269, SEQ ID NO:2426, SEQ ID NO:2583, SEQ ID NO:2740, SEQ ID NO:2897, and SEQ ID NO:3054, SEQ ID NO:2270, SEQ ID NO:2427, SEQ ID NO:2584, SEQ ID NO:2741, SEQ ID NO:2898, and SEQ ID NO:30 55, SEQ ID NO:2271, SEQ ID NO:2428, SEQ ID NO:2585, SEQ ID NO:2742, SEQ ID NO:2899, and SEQ ID NO:3056, SEQ ID NO:2272, SEQ ID NO:2429, SEQ ID NO:2586, SEQ ID NO:2743, SEQ ID NO:2900, and SEQ ID NO:3057, SEQ ID NO:2273, SEQ ID NO:2430, SEQ ID NO:2587, SEQ ID NO:2744, SEQ ID NO:2901, and SEQ ID NO:3058, SEQ ID NO:2274, SEQ ID NO:2431, SEQ ID NO:2588, SEQ ID NO:2745, SEQ ID NO:2902, and SEQ ID NO:3059, SEQ ID NO:2275, SEQ ID NO:2432,SEQ ID NO:2589, SEQ ID NO:2746, SEQ ID NO:2903, and SEQ ID NO:3060, SEQ ID NO:2276, SEQ ID NO:2433, SEQ ID NO:2590, SEQ ID NO:2747, SEQ ID NO:2904, and SEQ ID NO:3061, SEQ ID NO:2277, SEQ ID NO:2434, SEQ ID NO:2591, SEQ ID NO:274, 8, SEQ ID NO:2905, and SEQ ID NO:3062, SEQ ID NO:2278, SEQ ID NO:2435, SEQ ID NO:2592, SEQ ID NO:2749, SEQ ID NO:2906, and SEQ ID NO:3063, SEQ ID NO:2279, SEQ ID NO:2436, SEQ ID NO:2593, SEQ ID NO:2750, SEQ ID NO:2907, and SEQ ID NO:3064, SEQ ID NO:2280, SEQ ID NO:2437, SEQ ID NO:2594, SEQ ID NO:2751, SEQ ID NO:2908, and SEQ ID NO:3065, SEQ ID NO:2281, SEQ ID NO:2438, SEQ ID NO:2595, SEQ ID NO:2752, SEQ ID NO:2909, and SEQ ID NO:3066, , SEQ ID NO:2282, SEQ ID NO:2439, SEQ ID NO:2596, SEQ ID NO:2753, SEQ ID NO:2910, and SEQ ID NO:3067, SEQ ID NO:2283, SEQ ID NO:2440, SEQ ID NO:2597, SEQ ID NO:2754, SEQ ID NO:2911, and SEQ ID NO:3068, SEQ ID NO:2284, SEQ ID NO:2441, SEQ ID NO:2598, SEQ ID NO:2755, SEQ ID NO:2912, and SEQ ID NO:3069, SEQ ID NO:2285, SEQ ID NO:2442, SEQ ID NO:2599, SEQ ID NO:2756, SEQ ID NO:2913, and SEQ ID NO:3070, SEQ ID NO:2286, SEQ ID NO:2443, SEQ ID NO: No. 2600, SEQ ID NO: 2757, SEQ ID NO: 2914, and SEQ ID NO: 3071; SEQ ID NO: 2287, SEQ ID NO: 2444, SEQ ID NO: 2601, SEQ ID NO: 2758, SEQ ID NO: 2915, and SEQ ID NO: 3072; SEQ ID NO: 2288, SEQ ID NO: 2445, SEQ ID NO: 2602, SEQ ID NO: 2759, SEQ ID NO: 2916, and SEQ ID NO: 3073; SEQ ID NO: 2289, SEQ ID NO: 2446, SEQ ID NO: 2603, SEQ ID NO: 2760, SEQ ID NO: 2917, and SEQ ID NO: 3074; SEQ ID NO: 2290, SEQ ID NO: 2447, SEQ ID NO: 2604, SEQ ID NO: 2761, SEQ ID NO: 291 8, and SEQ ID NO:3075, and SEQ ID NO:2291, SEQ ID NO:2448, SEQ ID NO:2605, SEQ ID NO:2762, SEQ ID NO:2919, and SEQ ID NO:3076, and SEQ ID NO:2292, SEQ ID NO:2449, SEQ ID NO:2606, SEQ ID NO:2763, SEQ ID NO:2920, and SEQ ID NO:3077, and SEQ ID NO:2293, SEQ ID NO:2450, SEQ ID NO:2607, SEQ ID NO:2764, SEQ ID NO:2921, and SEQ ID NO:3078, and SEQ ID NO:2294, SEQ ID NO:2451, SEQ ID NO:2608, SEQ ID NO:2765, SEQ ID NO:2922, and SEQ ID NO:3079, and SEQ ID NO:2295,SEQ ID NO:2452, SEQ ID NO:2609, SEQ ID NO:2766, SEQ ID NO:2923, and SEQ ID NO:3080, SEQ ID NO:2296, SEQ ID NO:2453, SEQ ID NO:2610, SEQ ID NO:2767, SEQ ID NO:2924, and SEQ ID NO:3081, SEQ ID NO:2297, SEQ ID NO:2454, SEQ ID NO:2611, SEQ ID NO:2768, SEQ ID NO:2925, and SEQ ID NO:3082, SEQ ID NO:2298, SEQ ID NO:2455, SEQ ID NO:2612, SEQ ID NO:2769, SEQ ID NO:2926, and SEQ ID NO:3083, SEQ ID NO:2299, SEQ ID NO:2456, SEQ ID NO:2613, SEQ ID NO: No. 2770, SEQ ID NO: 2927, and SEQ ID NO: 3084; No. 2300, SEQ ID NO: 2457, SEQ ID NO: 2614, SEQ ID NO: 2771, SEQ ID NO: 2928, and SEQ ID NO: 3085; No. 2301, SEQ ID NO: 2458, SEQ ID NO: 2615, SEQ ID NO: 2772, SEQ ID NO: 2929, and SEQ ID NO: 3086; No. 2302, SEQ ID NO: 2459, SEQ ID NO: 2616, SEQ ID NO: 2773, SEQ ID NO: 2930, and SEQ ID NO: 3087; No. 2303, SEQ ID NO: 2460, SEQ ID NO: 2617, SEQ ID NO: 2774, SEQ ID NO: 2931, and SEQ ID NO: 3088, SEQ ID NO:2304, SEQ ID NO:2461, SEQ ID NO:2618, SEQ ID NO:2775, SEQ ID NO:2932, and SEQ ID NO:3089, SEQ ID NO:2305, SEQ ID NO:2462, SEQ ID NO:2619, SEQ ID NO:2776, SEQ ID NO:2933, and SEQ ID NO:3090, SEQ ID NO:2306, SEQ ID NO:2463, SEQ ID NO:2620, SEQ ID NO:2777, SEQ ID NO:2934, and SEQ ID NO:3091, SEQ ID NO:2307, SEQ ID NO:2464, SEQ ID NO:2621, SEQ ID NO:2778, SEQ ID NO:2935, and SEQ ID NO:3092, SEQ ID NO:2308, SEQ ID NO:24 65, SEQ ID NO:2622, SEQ ID NO:2779, SEQ ID NO:2936, and SEQ ID NO:3093, SEQ ID NO:2309, SEQ ID NO:2466, SEQ ID NO:2623, SEQ ID NO:2780, SEQ ID NO:2937, and SEQ ID NO:3094, SEQ ID NO:2310, SEQ ID NO:2467, SEQ ID NO:2624, SEQ ID NO:2781, SEQ ID NO:2938, and SEQ ID NO:3095, SEQ ID NO:2311, SEQ ID NO:2468, SEQ ID NO:2625, SEQ ID NO:2782, SEQ ID NO:2939, and SEQ ID NO:3096, SEQ ID NO:2312, SEQ ID NO:2469, SEQ ID NO:2626, SEQ ID NO:2783,SEQ ID NO:2940, and SEQ ID NO:3097; SEQ ID NO:2313, SEQ ID NO:2470, SEQ ID NO:2627, SEQ ID NO:2784, SEQ ID NO:2941, and SEQ ID NO:3098; SEQ ID NO:2314, SEQ ID NO:2471, SEQ ID NO:2628, SEQ ID NO:2785, SEQ ID NO:2942, and SEQ ID NO:3099; SEQ ID NO:2315, SEQ ID NO:2472, SEQ ID NO:2629, SEQ ID NO:2786, SEQ ID NO:2943, and SEQ ID NO:3100; SEQ ID NO:2316, SEQ ID NO:2473, SEQ ID NO:2630, SEQ ID NO:2787, SEQ ID NO:2944, and SEQ ID NO:3101; SEQ ID NO:2317, SEQ ID NO:2474, SEQ ID NO:2631, SEQ ID NO:2788, SEQ ID NO:2945, and SEQ ID NO:3102, SEQ ID NO:2318, SEQ ID NO:2475, SEQ ID NO:2632, SEQ ID NO:2789, SEQ ID NO:2946, and SEQ ID NO:3103, SEQ ID NO:2319, SEQ ID NO:2476, SEQ ID NO:2633, SEQ ID NO:2790, SEQ ID NO:2947, and SEQ ID NO:3104, SEQ ID NO:2320, SEQ ID NO:2477, SEQ ID NO:2634, SEQ ID NO:2791, SEQ ID NO:2948, and SEQ ID NO:3105, SEQ ID NO:2321, SEQ ID NO:2478, SEQ ID NO: 2635, SEQ ID NO:2792, SEQ ID NO:2949, and SEQ ID NO:3106, SEQ ID NO:2322, SEQ ID NO:2479, SEQ ID NO:2636, SEQ ID NO:2793, SEQ ID NO:2950, and SEQ ID NO:3107, SEQ ID NO:2323, SEQ ID NO:2480, SEQ ID NO:2637, SEQ ID NO:2794, SEQ ID NO:2951, and SEQ ID NO:3108, SEQ ID NO:2324, SEQ ID NO:2481, SEQ ID NO:2638, SEQ ID NO:2795, SEQ ID NO:2952, and SEQ ID NO:3109, SEQ ID NO:2325, SEQ ID NO:2482, SEQ ID NO:2639, SEQ ID NO:2796, SEQ ID NO:2953 , and SEQ ID NO:3110, SEQ ID NO:2326, SEQ ID NO:2483, SEQ ID NO:2640, SEQ ID NO:2797, SEQ ID NO:2954, and SEQ ID NO:3111, SEQ ID NO:2327, SEQ ID NO:2484, SEQ ID NO:2641, SEQ ID NO:2798, SEQ ID NO:2955, and SEQ ID NO:3112, SEQ ID NO:2328, SEQ ID NO:2485, SEQ ID NO:2642, SEQ ID NO:2799, SEQ ID NO:2956, and SEQ ID NO:3113, SEQ ID NO:2329, SEQ ID NO:2486, SEQ ID NO:2643, SEQ ID NO:2800, SEQ ID NO:2957, and SEQ ID NO:3114, and SEQ ID NO:2330,SEQ ID NO:2487, SEQ ID NO:2644, SEQ ID NO:2801, SEQ ID NO:2958, and SEQ ID NO:3115, SEQ ID NO:2331, SEQ ID NO:2488, SEQ ID NO:2645, SEQ ID NO:2802, SEQ ID NO:2959, and SEQ ID NO:3116, SEQ ID NO:2332, SEQ ID NO:2489, SEQ ID NO:2646, SEQ ID NO:2803, SEQ ID NO:2960, and SEQ ID NO:3117, SEQ ID NO:2333, SEQ ID NO:2490, SEQ ID NO:2647, SEQ ID NO:2804, SEQ ID NO:2961, and SEQ ID NO:3118, SEQ ID NO:2334, SEQ ID NO:2491, SEQ ID NO:2648, SEQ ID NO: No. 2805, SEQ ID NO: 2962, and SEQ ID NO: 3119; No. 2335, SEQ ID NO: 2492, SEQ ID NO: 2649, SEQ ID NO: 2806, SEQ ID NO: 2963, and SEQ ID NO: 3120; No. 2336, SEQ ID NO: 2493, SEQ ID NO: 2650, SEQ ID NO: 2807, SEQ ID NO: 2964, and SEQ ID NO: 3121; No. 2337, SEQ ID NO: 2494, SEQ ID NO: 2651, SEQ ID NO: 2808, SEQ ID NO: 2965, and SEQ ID NO: 3122; No. 2338, SEQ ID NO: 2495, SEQ ID NO: 2652, SEQ ID NO: 2809, SEQ ID NO: 2966, and SEQ ID NO: 3123, SEQ ID NO:2339, SEQ ID NO:2496, SEQ ID NO:2653, SEQ ID NO:2810, SEQ ID NO:2967, and SEQ ID NO:3124, SEQ ID NO:2340, SEQ ID NO:2497, SEQ ID NO:2654, SEQ ID NO:2811, SEQ ID NO:2968, and SEQ ID NO:3125, SEQ ID NO:2341, SEQ ID NO:2498, SEQ ID NO:2655, SEQ ID NO:2812, SEQ ID NO:2969, and SEQ ID NO:3126, SEQ ID NO:2342, SEQ ID NO:2499, SEQ ID NO:2656, SEQ ID NO:2813, SEQ ID NO:2970, and SEQ ID NO:3127, SEQ ID NO:2343, SEQ ID NO:25 00, SEQ ID NO: 2657, SEQ ID NO: 2814, SEQ ID NO: 2971, and SEQ ID NO: 3128, SEQ ID NO: 2344, SEQ ID NO: 2501, SEQ ID NO: 2658, SEQ ID NO: 2815, SEQ ID NO: 2972, and SEQ ID NO: 3129, SEQ ID NO: 2345, SEQ ID NO: 2502, SEQ ID NO: 2659, SEQ ID NO: 2816, SEQ ID NO: 2973, and SEQ ID NO: 3130, SEQ ID NO: 2346, SEQ ID NO: 2503, SEQ ID NO: 2660, SEQ ID NO: 2817, SEQ ID NO: 2974, and SEQ ID NO: 3131, SEQ ID NO: 2347, SEQ ID NO: 2504, SEQ ID NO: 2661, SEQ ID NO: 2818,SEQ ID NO:2975 and SEQ ID NO:3132; SEQ ID NO:2348, SEQ ID NO:2505, SEQ ID NO:2662, SEQ ID NO:2819, SEQ ID NO:2976 and SEQ ID NO:3133; SEQ ID NO:2349, SEQ ID NO:2506, SEQ ID NO:2663, SEQ ID NO:2820, SEQ ID NO:2977 and SEQ ID NO:3134; SEQ ID NO:2350, SEQ ID NO:2507, SEQ ID NO:2664, SEQ ID NO:2821, SEQ ID NO:2978 and SEQ ID NO:3135; SEQ ID NO:2351, SEQ ID NO:2508, SEQ ID NO:2665, SEQ ID NO:2822, SEQ ID NO:2979 and SEQ ID NO:3136; The nucleic acid sequence is encoded by a sequence selected from the group consisting of SEQ ID NO:2352, SEQ ID NO:2509, SEQ ID NO:2666, SEQ ID NO:2823, SEQ ID NO:2980, and SEQ ID NO:3137, SEQ ID NO:2353, SEQ ID NO:2510, SEQ ID NO:2667, SEQ ID NO:2824, SEQ ID NO:2981, and SEQ ID NO:3138, SEQ ID NO:2354, SEQ ID NO:2511, SEQ ID NO:2668, SEQ ID NO:2825, SEQ ID NO:2982, and SEQ ID NO:3139, and SEQ ID NO:2355, SEQ ID NO:2512, SEQ ID NO:2669, SEQ ID NO:2826, SEQ ID NO:2983, and SEQ ID NO:3140.
[0208] In another embodiment, the antigen binding protein comprises one, two, three, four, five, or six variants of the CDRs set out in Tables 4A and 4B that have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the CDR sequences set out in Tables 4A and 4B, respectively. Some antigen binding proteins comprise one, two, three, four, five, or six CDRs set out in Tables 4A and 4B that, individually or collectively, differ from the CDRs set out in the tables by no more than one, no more than two, no more than three, no more than four, or no more than five amino acids.
[0209] In various other embodiments, the antigen binding protein is derived from such an antibody. For example, in one aspect, the antigen binding protein comprises one, two, three, four, five, or all six of the CDRs set forth in one of the rows directed to any of the specific antibodies set forth in Tables 4A and 4B. In another aspect, the antigen binding protein comprises one, two, three, four, five, or six mutated forms of the CDRs set forth in one of the rows directed to the antibodies of Tables 4A and 4B, wherein the CDRs have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the CDR sequences set forth in Tables 4A and 4B, respectively. Some antigen binding proteins comprise one, two, three, four, five or six CDRs set forth in one of the rows of Table 4A and Table 4B, which differ from the CDRs set forth in these tables by no more than one, no more than two, no more than three, no more than four or no more than five amino acids, respectively. In another embodiment, an antigen binding protein comprises all six CDRs set forth in the rows of Table 4A and Table 4B, and the total number of amino acid changes to the CDRs collectively is no more than one, no more than two, no more than three, no more than four or no more than five amino acids.
[0210] In one embodiment, the antibody or fragment thereof comprises a light chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472 to 628. In one embodiment, the antibody or fragment thereof comprises a heavy chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472 to 628. In one embodiment, the antibody or fragment thereof comprises a light chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472 to 628, and a heavy chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472 to 628. In one embodiment, the antibody or fragment thereof comprises a light chain comprising SEQ ID NO:315 and a heavy chain comprising SEQ ID NO:472, a light chain comprising SEQ ID NO:316 and a heavy chain comprising SEQ ID NO:473, a light chain comprising SEQ ID NO:317 and a heavy chain comprising SEQ ID NO:474, a light chain comprising SEQ ID NO:318 and a heavy chain comprising SEQ ID NO:475, a light chain comprising SEQ ID NO:319 and a heavy chain comprising SEQ ID NO:476, a light chain comprising SEQ ID NO:320 and a heavy chain comprising SEQ ID NO:477, a light chain comprising SEQ ID NO:321 and a heavy chain comprising SEQ ID NO:478, a light chain comprising SEQ ID NO:322 and a heavy chain comprising SEQ ID NO:479, a light chain comprising SEQ ID NO:323 and a heavy chain comprising SEQ ID NO:480, a light chain comprising SEQ ID NO:324 and a heavy chain comprising SEQ ID NO:481, a light chain comprising SEQ ID NO:325 and a heavy chain comprising SEQ ID NO:482, a light chain comprising SEQ ID NO:326 and a heavy chain comprising SEQ ID NO:483, a light chain comprising SEQ ID NO:327 and a heavy chain comprising SEQ ID NO:484, a light chain comprising SEQ ID NO:328 and a heavy chain comprising SEQ ID NO: a heavy chain comprising SEQ ID NO: 485, a light chain comprising SEQ ID NO: 329 and a heavy chain comprising SEQ ID NO: 486, a light chain comprising SEQ ID NO: 330 and a heavy chain comprising SEQ ID NO: 487, a light chain comprising SEQ ID NO: 331 and a heavy chain comprising SEQ ID NO: 488, a light chain comprising SEQ ID NO: 332 and a heavy chain comprising SEQ ID NO: 489, a light chain comprising SEQ ID NO: 333 and a heavy chain comprising SEQ ID NO: 490, a light chain comprising SEQ ID NO: 334 and a heavy chain comprising SEQ ID NO: 491, a light chain comprising SEQ ID NO: 335 and a heavy chain comprising SEQ ID NO: 492, a light chain comprising SEQ ID NO: 336 and a heavy chain comprising SEQ ID NO: 493, a light chain comprising SEQ ID NO: 337 and a heavy chain comprising SEQ ID NO: 494, a light chain comprising SEQ ID NO: 338 and a heavy chain comprising SEQ ID NO: 495, a light chain comprising SEQ ID NO: 339 and a heavy chain comprising SEQ ID NO: 496, a light chain comprising SEQ ID NO: 340 and a heavy chain comprising SEQ ID NO: 497, a light chain comprising SEQ ID NO: 341 and a heavy chain comprising SEQ ID NO: 498, a light chain comprising SEQ ID NO: 342 and a heavy chain comprising SEQ ID NO: 499,A light chain comprising SEQ ID NO:343 and a heavy chain comprising SEQ ID NO:500, a light chain comprising SEQ ID NO:344 and a heavy chain comprising SEQ ID NO:501, a light chain comprising SEQ ID NO:345 and a heavy chain comprising SEQ ID NO:502, a light chain comprising SEQ ID NO:346 and a heavy chain comprising SEQ ID NO:503, a light chain comprising SEQ ID NO:347 and a heavy chain comprising SEQ ID NO:504, a light chain comprising SEQ ID NO:348 and a heavy chain comprising SEQ ID NO:505, a light chain comprising SEQ ID NO:349 and a heavy chain comprising SEQ ID NO:506, a light chain comprising SEQ ID NO:350 and a heavy chain comprising SEQ ID NO:507, a light chain comprising SEQ ID NO:351 and a heavy chain comprising SEQ ID NO:508, a light chain comprising SEQ ID NO:35 2 and a heavy chain comprising SEQ ID NO:509, a light chain comprising SEQ ID NO:353 and a heavy chain comprising SEQ ID NO:510, a light chain comprising SEQ ID NO:354 and a heavy chain comprising SEQ ID NO:511, a light chain comprising SEQ ID NO:355 and a heavy chain comprising SEQ ID NO:512, a light chain comprising SEQ ID NO:356 and a heavy chain comprising SEQ ID NO:513, a light chain comprising SEQ ID NO:357 and a heavy chain comprising SEQ ID NO:514, a light chain comprising SEQ ID NO:358 and a heavy chain comprising SEQ ID NO:515, a light chain comprising SEQ ID NO:359 and a heavy chain comprising SEQ ID NO:516, a light chain comprising SEQ ID NO:360 and a heavy chain comprising SEQ ID NO:517, a light chain comprising SEQ ID NO:361 and a heavy chain comprising SEQ ID NO:362. and a heavy chain comprising SEQ ID NO:518, a light chain comprising SEQ ID NO:362 and a heavy chain comprising SEQ ID NO:519, a light chain comprising SEQ ID NO:363 and a heavy chain comprising SEQ ID NO:520, a light chain comprising SEQ ID NO:364 and a heavy chain comprising SEQ ID NO:521, a light chain comprising SEQ ID NO:365 and a heavy chain comprising SEQ ID NO:522, a light chain comprising SEQ ID NO:366 and a heavy chain comprising SEQ ID NO:523, a light chain comprising SEQ ID NO:367 and a heavy chain comprising SEQ ID NO:524, a light chain comprising SEQ ID NO:368 and a heavy chain comprising SEQ ID NO:525, a light chain comprising SEQ ID NO:369 and a heavy chain comprising SEQ ID NO:526, a light chain comprising SEQ ID NO:370 and a heavy chain comprising SEQ ID NO:52 7, a light chain comprising SEQ ID NO:371 and a heavy chain comprising SEQ ID NO:528, a light chain comprising SEQ ID NO:372 and a heavy chain comprising SEQ ID NO:529, a light chain comprising SEQ ID NO:373 and a heavy chain comprising SEQ ID NO:530, a light chain comprising SEQ ID NO:374 and a heavy chain comprising SEQ ID NO:531, a light chain comprising SEQ ID NO:375 and a heavy chain comprising SEQ ID NO:532, a light chain comprising SEQ ID NO:376 and a heavy chain comprising SEQ ID NO:533, a light chain comprising SEQ ID NO:377 and a heavy chain comprising SEQ ID NO:534, a light chain comprising SEQ ID NO:378 and a heavy chain comprising SEQ ID NO:535, a light chain comprising SEQ ID NO:379 and a heavy chain comprising SEQ ID NO:536,A light chain comprising SEQ ID NO:380 and a heavy chain comprising SEQ ID NO:537, a light chain comprising SEQ ID NO:381 and a heavy chain comprising SEQ ID NO:538, a light chain comprising SEQ ID NO:382 and a heavy chain comprising SEQ ID NO:539, a light chain comprising SEQ ID NO:383 and a heavy chain comprising SEQ ID NO:540, a light chain comprising SEQ ID NO:384 and a heavy chain comprising SEQ ID NO:541, a light chain comprising SEQ ID NO:385 and a heavy chain comprising SEQ ID NO:542, a light chain comprising SEQ ID NO:386 and a heavy chain comprising SEQ ID NO:543, a light chain comprising SEQ ID NO:387 and a heavy chain comprising SEQ ID NO:544, a light chain comprising SEQ ID NO:388 and a heavy chain comprising SEQ ID NO:545, a light chain comprising SEQ ID NO:38 9 and a heavy chain comprising SEQ ID NO: 546, a light chain comprising SEQ ID NO: 390 and a heavy chain comprising SEQ ID NO: 547, a light chain comprising SEQ ID NO: 391 and a heavy chain comprising SEQ ID NO: 548, a light chain comprising SEQ ID NO: 392 and a heavy chain comprising SEQ ID NO: 549, a light chain comprising SEQ ID NO: 393 and a heavy chain comprising SEQ ID NO: 550, a light chain comprising SEQ ID NO: 394 and a heavy chain comprising SEQ ID NO: 551, a light chain comprising SEQ ID NO: 395 and a heavy chain comprising SEQ ID NO: 552, a light chain comprising SEQ ID NO: 396 and a heavy chain comprising SEQ ID NO: 553, a light chain comprising SEQ ID NO: 397 and a heavy chain comprising SEQ ID NO: 554, a light chain comprising SEQ ID NO: 398 and a heavy chain comprising SEQ ID NO: and a heavy chain comprising SEQ ID NO:555, a light chain comprising SEQ ID NO:399 and a heavy chain comprising SEQ ID NO:556, a light chain comprising SEQ ID NO:400 and a heavy chain comprising SEQ ID NO:557, a light chain comprising SEQ ID NO:401 and a heavy chain comprising SEQ ID NO:558, a light chain comprising SEQ ID NO:402 and a heavy chain comprising SEQ ID NO:559, a light chain comprising SEQ ID NO:403 and a heavy chain comprising SEQ ID NO:560, a light chain comprising SEQ ID NO:404 and a heavy chain comprising SEQ ID NO:561, a light chain comprising SEQ ID NO:405 and a heavy chain comprising SEQ ID NO:562, a light chain comprising SEQ ID NO:406 and a heavy chain comprising SEQ ID NO:563, a light chain comprising SEQ ID NO:407 and SEQ ID NO:56 4, a light chain comprising SEQ ID NO: 408 and a heavy chain comprising SEQ ID NO: 565, a light chain comprising SEQ ID NO: 409 and a heavy chain comprising SEQ ID NO: 566, a light chain comprising SEQ ID NO: 410 and a heavy chain comprising SEQ ID NO: 567, a light chain comprising SEQ ID NO: 411 and a heavy chain comprising SEQ ID NO: 568, a light chain comprising SEQ ID NO: 412 and a heavy chain comprising SEQ ID NO: 569, a light chain comprising SEQ ID NO: 413 and a heavy chain comprising SEQ ID NO: 570, a light chain comprising SEQ ID NO: 414 and a heavy chain comprising SEQ ID NO: 571, a light chain comprising SEQ ID NO: 415 and a heavy chain comprising SEQ ID NO: 572, a light chain comprising SEQ ID NO: 416 and a heavy chain comprising SEQ ID NO: 573,A light chain comprising SEQ ID NO:417 and a heavy chain comprising SEQ ID NO:574, a light chain comprising SEQ ID NO:418 and a heavy chain comprising SEQ ID NO:575, a light chain comprising SEQ ID NO:419 and a heavy chain comprising SEQ ID NO:576, a light chain comprising SEQ ID NO:420 and a heavy chain comprising SEQ ID NO:577, a light chain comprising SEQ ID NO:421 and a heavy chain comprising SEQ ID NO:578, a light chain comprising SEQ ID NO:422 and a heavy chain comprising SEQ ID NO:579, a light chain comprising SEQ ID NO:423 and a heavy chain comprising SEQ ID NO:580, a light chain comprising SEQ ID NO:424 and a heavy chain comprising SEQ ID NO:581, a light chain comprising SEQ ID NO:425 and a heavy chain comprising SEQ ID NO:582, a light chain comprising SEQ ID NO:425 and a heavy chain comprising SEQ ID NO:583, 6 and a heavy chain comprising SEQ ID NO:583, a light chain comprising SEQ ID NO:427 and a heavy chain comprising SEQ ID NO:584, a light chain comprising SEQ ID NO:428 and a heavy chain comprising SEQ ID NO:585, a light chain comprising SEQ ID NO:429 and a heavy chain comprising SEQ ID NO:586, a light chain comprising SEQ ID NO:430 and a heavy chain comprising SEQ ID NO:587, a light chain comprising SEQ ID NO:431 and a heavy chain comprising SEQ ID NO:588, a light chain comprising SEQ ID NO:432 and a heavy chain comprising SEQ ID NO:589, a light chain comprising SEQ ID NO:433 and a heavy chain comprising SEQ ID NO:590, a light chain comprising SEQ ID NO:434 and a heavy chain comprising SEQ ID NO:591, a light chain comprising SEQ ID NO:435 and a heavy chain comprising SEQ ID NO:586, and a heavy chain comprising SEQ ID NO:592, a light chain comprising SEQ ID NO:436 and a heavy chain comprising SEQ ID NO:593, a light chain comprising SEQ ID NO:437 and a heavy chain comprising SEQ ID NO:594, a light chain comprising SEQ ID NO:438 and a heavy chain comprising SEQ ID NO:595, a light chain comprising SEQ ID NO:439 and a heavy chain comprising SEQ ID NO:596, a light chain comprising SEQ ID NO:440 and a heavy chain comprising SEQ ID NO:597, a light chain comprising SEQ ID NO:441 and a heavy chain comprising SEQ ID NO:598, a light chain comprising SEQ ID NO:442 and a heavy chain comprising SEQ ID NO:599, a light chain comprising SEQ ID NO:443 and a heavy chain comprising SEQ ID NO:600, a light chain comprising SEQ ID NO:444 and a heavy chain comprising SEQ ID NO:60 1, a light chain comprising SEQ ID NO: 445 and a heavy chain comprising SEQ ID NO: 602, a light chain comprising SEQ ID NO: 446 and a heavy chain comprising SEQ ID NO: 603, a light chain comprising SEQ ID NO: 447 and a heavy chain comprising SEQ ID NO: 604, a light chain comprising SEQ ID NO: 448 and a heavy chain comprising SEQ ID NO: 605, a light chain comprising SEQ ID NO: 449 and a heavy chain comprising SEQ ID NO: 606, a light chain comprising SEQ ID NO: 450 and a heavy chain comprising SEQ ID NO: 607, a light chain comprising SEQ ID NO: 451 and a heavy chain comprising SEQ ID NO: 608, a light chain comprising SEQ ID NO: 452 and a heavy chain comprising SEQ ID NO: 609, a light chain comprising SEQ ID NO: 453 and a heavy chain comprising SEQ ID NO: 610,A light chain comprising SEQ ID NO:454 and a heavy chain comprising SEQ ID NO:611, a light chain comprising SEQ ID NO:455 and a heavy chain comprising SEQ ID NO:612, a light chain comprising SEQ ID NO:456 and a heavy chain comprising SEQ ID NO:613, a light chain comprising SEQ ID NO:457 and a heavy chain comprising SEQ ID NO:614, a light chain comprising SEQ ID NO:458 and a heavy chain comprising SEQ ID NO:615, a light chain comprising SEQ ID NO:459 and a heavy chain comprising SEQ ID NO:616, a light chain comprising SEQ ID NO:460 and a heavy chain comprising SEQ ID NO:617, a light chain comprising SEQ ID NO:461 and a heavy chain comprising SEQ ID NO:618, a light chain comprising SEQ ID NO:462 and a heavy chain comprising SEQ ID NO:619, a light chain comprising SEQ ID NO:463 and a heavy chain comprising SEQ ID NO:619, The combination of light and heavy chains is selected from the group consisting of a heavy chain comprising SEQ ID NO: 620, a light chain comprising SEQ ID NO: 464 and a heavy chain comprising SEQ ID NO: 621, a light chain comprising SEQ ID NO: 465 and a heavy chain comprising SEQ ID NO: 622, a light chain comprising SEQ ID NO: 466 and a heavy chain comprising SEQ ID NO: 623, a light chain comprising SEQ ID NO: 467 and a heavy chain comprising SEQ ID NO: 624, a light chain comprising SEQ ID NO: 468 and a heavy chain comprising SEQ ID NO: 625, a light chain comprising SEQ ID NO: 469 and a heavy chain comprising SEQ ID NO: 626, a light chain comprising SEQ ID NO: 470 and a heavy chain comprising SEQ ID NO: 627, and a light chain comprising SEQ ID NO: 471 and a heavy chain comprising SEQ ID NO: 628.
[0211] In one embodiment, the antibody or fragment thereof comprises a light chain encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1885-2014. In one embodiment, the antibody or fragment thereof comprises a heavy chain encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 2042-2198. In one embodiment, the antibody or fragment thereof comprises a light chain encoded by a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1885-2014 and a heavy chain comprising a sequence selected from the group consisting of SEQ ID NOs: 2042-2198. In one embodiment, the antibody or fragment thereof is selected from the group consisting of a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1885 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2042, a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1886 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2043, a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1887 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2044, a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1888 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2045, a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1889 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2046. a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO: 1890 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO: 2047; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO: 1891 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO: 2048; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO: 1892 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO: 2049; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO: 1893 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO: 2050; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO: 1894 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO: 2051;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1895 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2052; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1896 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2053; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1897 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2054; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1898 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2055; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1899 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2056; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1900 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2057; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1901 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2058; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1902 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2059; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1903 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2060; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1904 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2061; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1905 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2062; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1906 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2063; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1907 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2064; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1908 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2065;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1909 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2066; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1910 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2067; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1911 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2068; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1912 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2069; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1913 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2070; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1914 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2071; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1915 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2072; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1916 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2073; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1917 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2074; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1918 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2075; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1919 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2076; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1920 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2077; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1921 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2078; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1922 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2079;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1923 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2080; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1924 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2081; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1925 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2082; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1926 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2083; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1927 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2084; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1928 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2085; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1929 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2086; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1930 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2087; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1931 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2088; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1932 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2089; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1933 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2090; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1934 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2091; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1935 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2092; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1936 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2093;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1937 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2094; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1938 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2095; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1939 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2096; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1940 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2097; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1941 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2098; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1942 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2099; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1943 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2100; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1944 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2101; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1945 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2102; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1946 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2103; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1947 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2104; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1948 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2105; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1949 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2106; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1950 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2107;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1951 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2108; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1952 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2109; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1953 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2110; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1954 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2111; a polynucleotide comprising SEQ ID NO:1955; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1956 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2113; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1957 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2114; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1958 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2115; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1959 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2116; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1960 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2117; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1961 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2118; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1963 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2120; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1964 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2121; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1965 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2122; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1966 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2123; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1967 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2124; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1968 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2125;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1969 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2126; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1970 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2127; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1971 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2128; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1972 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2129; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1973 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2130; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1974 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2131; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1975 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2132; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1976 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2133; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1977 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2134; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1978 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2135; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1979 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2136; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1980 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2137; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1981 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2138; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1982 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2139;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1983 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2140; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1984 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2141; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1985 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2142; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1986 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2143; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1987 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2144; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1988 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2145; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1989 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2146; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1990 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2147; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1991 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2148; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1992 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2149; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1993 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2150; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1994 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2151; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1995 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2152; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1996 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2153;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1997 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2154; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1998 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2155; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:1999 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2156; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2000 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2157; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2001 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2158; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2002 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2159; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2003 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2160; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2004 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2161; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2005 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2162; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2006 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2163; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2007 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2164; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2008 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2165; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2009 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2166; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2010 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2167;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2011 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2168; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2012 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2169; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2013 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2170; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2014 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2171; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2015 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2172; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2016 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2173; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2017 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2174; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2018 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2175; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2019 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2176; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2020 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2177; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2021 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2178; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2022 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2179; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2023 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2180; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2024 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2181;a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2025 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2182; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2026 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2183; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2027 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2184; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2028 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2185; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2029; a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2186; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2030 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2187; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2031 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2188; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2032 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2189; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2033 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2190; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2034 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2191; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2035 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2192; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2036 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2193; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2037 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2194; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2038 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2195; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2039 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2196; a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2040 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2197; and a light chain encoded by a polynucleotide sequence comprising SEQ ID NO:2041 and a heavy chain encoded by a polynucleotide sequence comprising SEQ ID NO:2198.
[0212] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, the antibody or fragment thereof binding to GIPR targeting a range of positions corresponding to residues 123-134 of SEQ ID NO: 3141. In one embodiment, the antibody or fragment thereof binding to GIPR targeting a discontinuous epitope range of residues 29-30 and residues 123-134 of SEQ ID NO: 3141. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR targets G29, Q30, T31, A32, G33, E34, L35, Y36, Q37, R38, W39, E40, R43, F65, D66, M67, Y68, V69, W71, P85, Y87, L88, P89, W90, R101, Located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of L111, W112, R113, H115, T116, C118, E119, N120, E122, K123, N124, E125, A126, L128, D129, Q130, R131, L132, I133, and L134. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of G29, Q30, K123, N124, E125, A126, L128, D129, Q130, R131, L132, I133, and L134. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of K123, N124, E125, A126, L128, D129, Q130, R131, L132, I133, and L134.In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, or at least thirteen residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of G29, Q30, K123, N124, E125, A126, L128, D129, Q130, R131, L132, I133, and L134. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or at least eleven residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of K123, N124, E125, A126, L128, D129, Q130, R131, L132, I133, and L134.
[0213] In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, T31, A32, G33, E34, L35, Y36, Q37, W39, D66, M67, Y68, Y87, L88, P89, W90, R101, R113, H115, E119, K123, E125, L128, D129, L132, and I133. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, T31, K123, E125, L128, D129, L132, and I133. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of K123, E125, L128, D129, L132, and I133. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, T31, K123, E125, L128, D129, L132, and I133. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, or at least six residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of K123, E125, L128, D129, L132, and I133.
[0214] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, the antibody or fragment thereof binds to GIPR by targeting the antibody or fragment thereof within the position range corresponding to residues 102-107 of SEQ ID NO: 3141. In one embodiment, the antibody or fragment thereof binds to GIPR by targeting the antibody or fragment thereof within the discontinuous epitope range of residues 60-63 and residues 102-107 of SEQ ID NO: 3141. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof binds to the following epitopes: Q30, T31, A32, G33, E34, L35, Y36, W39, E40, R43, Q47, A60, C61, N62, G63, S64, F65, D66, M67, Y68, V69, W71, N77, P85, Y87, L88, P89, W90, V91, V92, V93, V94, V95, V96, V97, V98, V99, V99, V100, V101, V102, V103, V104, V105, V106, V107, V108, V109, V110, V111, V112, V113, V114, V115, V116, V117, V118, V119, V120, V121, V122, V123, V124, V125, V126, V127, V128, V129, V130, V131, V132, V133, V134, V135, V136, V137, V138, V 9, L100, R101, Q102, C103, G104, S105, D106, G107, Q108, W109, G110, L111, W112, R113, D114, H115, T116, Q117, C118, E119, N120, and P121. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, A60, C61, N62, G63, N77, L100, Q102, C103, G104, S105, D106, G107, W109, and G110. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of A60, C61, N62, G63, Q102, C103, G104, S105, D106, and G107.In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, A60, C61, N62, G63, N77, L100, Q102, C103, G104, S105, D106, G107, W109, and G110. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of A60, C61, N62, G63, Q102, C103, G104, S105, D106, and G107.
[0215] In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of T31, A32, L35, Y36, W39, N62, S64, F65, D66, M67, Y68, W71, Y87, L88, P89, W90, R101, G104, S105, D106, Q108, W109, G110, L111, W112, R113, D114, H115, T116, and E119. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of T31, N62, S64, W71, R101, G104, S105, D106, Q108, W109, G110, L111, W112, D114, and T116. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of R101, G104, S105, D106, Q108, W109, G110, L111, W112, D114, and T116. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, or at least fifteen residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of T31, N62, S64, W71, R101, G104, S105, D106, Q108, W109, G110, L111, W112, D114, and T116.In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or at least eleven residues of GIPR (SEQ ID NO: 3141) selected from the group consisting of R101, G104, S105, D106, Q108, W109, G110, L111, W112, D114, and T116.
[0216] In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of A32, G33, E34, L35, Y36, Q37, R38, W39, E40, R43, F65, D66, M67, Y68, P85, Y87, L88, P89, W90, L111, W112, R113, D114, H115, C118, E119, N120, and P121. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of A32, G33, E34, L35, Y36, Q37, W39, E40, R43, D66, M67, Y87, L88, P89, W90, L111, W112, H115, E119, and N120. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of E34, L111, W112, and N120.
[0217] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, where the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 102-107 of SEQ ID NO: 3141. In one embodiment, the antibody or fragment thereof binds to GIPR within a discontinuous epitope range of residues 60-63 and residues 102-107 of SEQ ID NO: 3141. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, T31, A32, G33, E34, L35, Y36, Q37, R38, W39, E40, R43, F65, D66, M67, Y68, V69, W71, P85, Y87, L88, P89, W90, V99, R101, L111, R113, D114, H115, T116, C118, E119, and N120. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 8 angstroms of Q30 of GIPR (SEQ ID NO: 3141).
[0218] In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, T31, A32, G33, L35, Y36, Q37, W39, E40, R43, D66, M67, Y68, Y87, L88, P89, W90, R113, H115, and E119. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30 and T31. In some embodiments, when the antibody or fragment thereof binds to GIPR, the antibody or fragment thereof when bound to GIPR is located within 5 angstroms of both Q30 and T31 of GIPR (SEQ ID NO: 3141).
[0219] In some embodiments, the invention includes antibodies that bind to GIPR, where the antibodies bind to GIPR and reduce the likelihood that GIPR will bind to GIP.
[0220] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 28 to 108 of SEQ ID NO: 231 of the heavy chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least one residue of the heavy chain of the antibody or fragment thereof selected from the group consisting of T28, F29, S30, N31, Y32, G33, A50, I51, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, A61, D62, V64, K65, G66, R67, F68, T69, I70, S71, R72, D73, N74, S75, Q82, N84, S85, R98, D99, Q100, A101, I102, F103, G104, V105, V106, and D108, which correspond to the heavy chain of SEQ ID NO:231.In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to at least two, at least three, at least four, at least five, at least six, at least seven, or at least two of the heavy chains of the antibody or fragment thereof selected from the group consisting of T28, F29, S30, N31, Y32, G33, A50, I51, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, A61, D62, V64, K65, G66, R67, F68, T69, I70, S71, R72, D73, N74, S75, Q82, N84, S85, R98, D99, Q100, A101, I102, F103, G104, V105, V106, and D108, which correspond to the heavy chains of SEQ ID NO:231. At least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, or at least 44 residues.
[0221] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue in the heavy chain of the antibody or fragment thereof selected from the group consisting of S30, N31, Y32, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, K65, G66, R67, T69, I70, S71, N84, Q100, A101, I102, F103, and V105, which correspond to the heavy chain of SEQ ID NO: 231. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, or at least twenty-four residues of the heavy chain of the antibody or fragment thereof selected from the group consisting of S30, N31, Y32, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, K65, G66, R67, T69, I70, S71, N84, Q100, A101, I102, F103, and V105, which correspond to the heavy chain of SEQ ID NO:231.
[0222] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 29-96 of SEQ ID NO: 74 of the light chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least one residue of the light chain of the antibody or fragment thereof selected from the group consisting of V29, S30, S31, N32, L33, L46, Y49, G50, T53, Q90, Y91, N92, N93, W94, P95, and L96, which correspond to the light chain of SEQ ID NO: 74. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, or at least sixteen residues of the light chain of the antibody or fragment thereof selected from the group consisting of V29, S30, S31, N32, L33, L46, Y49, G50, T53, Q90, Y91, N92, N93, W94, P95, and L96 corresponding to the light chain of SEQ ID NO:74.
[0223] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue of the light chain of the antibody or fragment thereof selected from the group consisting of S30, N32, Y49, Y91, N92, N93, W94, and L96, which correspond to the light chain of SEQ ID NO: 74. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight residues of the light chain of the antibody or fragment thereof selected from the group consisting of S30, N32, Y49, Y91, N92, N93, W94, and L96, which correspond to the light chain of SEQ ID NO: 74.
[0224] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 28-108 of SEQ ID NO: 231 in the heavy chain of the antibody or fragment thereof and within a position range corresponding to residues 29-96 of SEQ ID NO: 74 in the light chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is selected from the group consisting of T28, F29, S30, N31, Y32, G33, A50, I51, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, A61, D62, V64, K65, G66, R67, F68, T69, I70, S71, R72, D73, N74, S75, Q82, N84, S85, R98, D99, Q100, A101, I102, F103, F104, F105, F106, F107, F108, F110, F111, F112, F113, F114, F115, F116, F117, F120, F122, F123, F124, F125, F126, F127, F128, F130, F131, F132, F133, F134, F135, F136, F137, F138, F139, F140, F141, F142, F143, F144, F145, F146, F147, F148, F149, F150, F151, F152, F153, F154, F155, F156, F157, F160, F161, F162, F163, F164, F165, F166, F167, F168, F170, F171, F172, F173, F174, F175 and located within 8 angstroms of at least one residue in the heavy chain of an antibody or fragment thereof selected from the group consisting of V29, S30, S31, N32, L33, L46, Y49, G50, T53, Q90, Y91, N92, N93, W94, P95, and L96 corresponding to the light chain of SEQ ID NO:74.In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is selected from the group consisting of T28, F29, S30, N31, Y32, G33, A50, I51, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, A61, D62, V64, K65, G66, R67, F68, T69, I70, S71, R72, D73, N74, S75, Q82, N84, S85, R98, D99, Q100, A101, I102, F103, G104, G105, G106, G107, G108, G109, G200, G210, G220, G230, G240, G250, G260, G270, G280, G290, G301, G310, G320, G330, G340, G350, G360, G370, G380, G401, G410, G420, G430, G440, G450, G460, G470, G480, G490, G501, G510, G520, G530, G54, G55, S56, D57, K58, Y59, Y60, A61, D62, V64, K65, G66, R67, F68, T69, I70, S71, R72, D73, N74, S75, Q82, N84, S85, R98, D99, Q100, A101, I102, F103, or at least 44 residues of the heavy chain of an antibody or fragment thereof selected from the group consisting of V29, S30, S31, N304, V105, V106, and D108, and corresponding to the light chain of SEQ ID NO: 74. and located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, or at least sixteen residues of the light chain of an antibody or fragment thereof selected from the group consisting of: L1, L2, L3, L46, Y49, G50, T53, Q90, Y91, N92, N93, W94, P95, and L96.
[0225] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue in the heavy chain of the antibody or fragment thereof selected from the group consisting of S30, N31, Y32, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, K65, G66, R67, T69, I70, S71, N84, Q100, A101, I102, F103, and V105, which correspond to the heavy chain of SEQ ID NO: 231, and within 5 angstroms of at least one residue in the light chain of the antibody or fragment thereof selected from the group consisting of S30, N32, Y49, Y91, N92, N93, W94, and L96, which correspond to the light chain of SEQ ID NO: 74. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least one or more of the heavy chains of the antibody or fragment thereof selected from the group consisting of S30, N31, Y32, W52, F53, D54, A55, S56, D57, K58, Y59, Y60, K65, G66, R67, T69, I70, S71, N84, Q100, A101, I102, F103, and V105, which correspond to the heavy chain of SEQ ID NO:231. at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 residues, and are located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight residues of the light chain of an antibody or fragment thereof selected from the group consisting of S30, N32, Y49, Y91, N92, N93, W94, and L96, which correspond to the light chain of SEQ ID NO:74.
[0226] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 1-118 of SEQ ID NO: 294 of the heavy chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least one residue of the heavy chain of the antibody or fragment thereof selected from the group consisting of Q1, M2, S25, G26, Y27, T28, F29, T30, G31, Y32, N54, R98, G99, G100, D101, Y102, V103, F104, G105, T106, Y107, R108, P109, H110, Y111, Y112, Y113, G114, M115, D116, V117, and W118 corresponding to the heavy chain of SEQ ID NO: 294. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to at least two, at least three, or at least four of the heavy chains of the antibody or fragment thereof selected from the group consisting of Q1, M2, S25, G26, Y27, T28, F29, T30, G31, Y32, N54, R98, G99, G100, D101, Y102, V103, F104, G105, T106, Y107, R108, P109, H110, Y111, Y112, Y113, G114, M115, D116, V117, and W118, which correspond to the heavy chains of SEQ ID NO: 294. , at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, or at least 32 residues.
[0227] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue in the heavy chain of the antibody or fragment thereof selected from the group consisting of M2, G26, Y27, T28, Y32, R98, G100, D101, Y102, F104, G105, Y107, H110, Y111, Y112, Y113, and D116, which correspond to the heavy chain of SEQ ID NO:294. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, or at least seventeen residues of the heavy chain of the antibody or fragment thereof selected from the group consisting of M2, G26, Y27, T28, Y32, R98, G100, D101, Y102, F104, G105, Y107, H110, Y111, Y112, Y113, and D116 corresponding to the heavy chain of SEQ ID NO:294.
[0228] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 32-63 of SEQ ID NO: 137 of the light chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least one residue of the light chain of the antibody or fragment thereof selected from the group consisting of Q32, T33, N35, Y37, K46, L47, L48, I49, Y50, T51, N53, Q54, R55, P56, S57, G58, V59, P60, D61, R62, and F63, which correspond to the light chain of SEQ ID NO: 137. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least four, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nine, at least twenty, or at least twenty-one residues of the light chain of the antibody or fragment thereof selected from the group consisting of Q32, T33, N35, Y37, K46, L47, L48, I49, Y50, T51, N53, Q54, R55, P56, S57, G58, V59, P60, D61, R62, and F63, which correspond to the light chain of SEQ ID NO: 137.
[0229] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue of the light chain of the antibody or fragment thereof selected from the group consisting of L47, Y50, Q54, R55, P56, S57, G58, V59, or D61, which corresponds to the light chain of SEQ ID NO: 137. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or at least nine residues of the light chain of the antibody or fragment thereof selected from the group consisting of L47, Y50, Q54, R55, P56, S57, G58, V59, or D61, which corresponds to the light chain of SEQ ID NO: 137.
[0230] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, the antibody or fragment thereof binding to GIPR at a position range corresponding to residues 1-118 of SEQ ID NO: 294 in the heavy chain of the antibody or fragment thereof and at a position range corresponding to residues 32-63 of SEQ ID NO: 137 in the light chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to a position range corresponding to residues 1-118 of SEQ ID NO: 294 in the heavy chain of the antibody or fragment thereof and at a position range corresponding to residues 32-63 of SEQ ID NO: 137 in the light chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to a position range corresponding to residues 1-118 of SEQ ID NO: 294 in the heavy chain of the antibody or fragment thereof and at a position range corresponding to residues 32-63 of SEQ ID NO: 137 in the light chain of the antibody or fragment thereof. and is located within 8 angstroms of at least one residue in the heavy chain of an antibody or fragment thereof selected from the group consisting of Q32, T33, N35, Y37, K46, L47, L48, I49, Y50, T51, N53, Q54, R55, P56, S57, G58, V59, P60, D61, R62, and F63, which correspond to the light chain of SEQ ID NO: 137.In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is selected from the group consisting of Q1, M2, S25, G26, Y27, T28, F29, T30, G31, Y32, N54, R98, G99, G100, D101, Y102, V103, F104, G105, T106, Y107, R108, P109, H110, Y111, Y112, Y113, G114, M115, D116, V117, and W118, which correspond to the heavy chain of SEQ ID NO:294. At least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, at least twenty-one, at least twenty-two, at least twenty-three, at least twenty-three, at least twenty-six ... and are located within 8 Angstroms of at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, or at least 32 residues, and are located within 8 Angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nineteen, at least twenty, or at least twenty-one residues of the light chain of an antibody or fragment thereof selected from the group consisting of Q32, T33, N35, Y37, K46, L47, L48, I49, Y50, T51, N53, Q54, R55, P56, S57, G58, V59, P60, D61, R62, and F63, which correspond to the light chain of SEQ ID NO:137.
[0231] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue in the heavy chain of the antibody or fragment thereof selected from the group consisting of M2, G26, Y27, T28, Y32, R98, G100, D101, Y102, F104, G105, Y107, H110, Y111, Y112, Y113, and D116 corresponding to the heavy chain of SEQ ID NO: 294, and within 5 angstroms of at least one residue in the light chain of the antibody or fragment thereof selected from the group consisting of L47, Y50, Q54, R55, P56, S57, G58, V59, or D61 corresponding to the light chain of SEQ ID NO: 137. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, or more of the heavy chains of the antibody or fragment thereof selected from the group consisting of M2, G26, Y27, T28, Y32, R98, G100, D101, Y102, F104, G105, Y107, H110, Y111, Y112, Y113, and D116, which correspond to the heavy chains of SEQ ID NO:294. Located within 5 Angstroms of at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 residues, and located within 5 Angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or at least nine residues of the light chain of an antibody or fragment thereof selected from the group consisting of L47, Y50, Q54, R55, P56, S57, G58, V59, or D61, which correspond to the light chain of SEQ ID NO:137.
[0232] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 26-110 of SEQ ID NO: 208 of the heavy chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least one residue of the heavy chain of the antibody or fragment thereof selected from the group consisting of G26, F27, T28, F29, S30, Y31, F32, W52, Y53, D54, S56, N57, Y59, N74, N77, R98, D99, G100, T101, I102, F103, G104, V105, L106, L107, D109, and Y110 corresponding to the heavy chain of SEQ ID NO: 208. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR binds to at least two, at least three, or at least four of the heavy chains of the antibody or fragment thereof selected from the group consisting of G26, F27, T28, F29, S30, Y31, F32, W52, Y53, D54, S56, N57, Y59, N74, N77, R98, D99, G100, T101, I102, F103, G104, V105, L106, L107, D109, and Y110, which correspond to the heavy chain of SEQ ID NO: 208. Located within 8 Angstroms of at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 residues.
[0233] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue in the heavy chain of the antibody or fragment thereof selected from the group consisting of T28, Y31, F32, W52, Y53, R98, G100, T101, I102, F103, G104, V105, and L106, which correspond to the heavy chain of SEQ ID NO: 208. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, or at least twelve residues of the heavy chain of the antibody or fragment thereof selected from the group consisting of T28, Y31, F32, W52, Y53, R98, G100, T101, I102, F103, G104, V105, and L106 corresponding to the heavy chain of SEQ ID NO:208.
[0234] In some aspects, the invention includes an antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof binds to GIPR within a position range corresponding to residues 29-96 of SEQ ID NO: 51 of the light chain of the antibody or fragment thereof. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least one residue of the light chain of the antibody or fragment thereof selected from the group consisting of I29, R30, D31, Y32, L33, L46, I48, Y49, G50, A51, S52, S53, L54, Q55, S56, Q90, H91, N92, N93, Y94, and F96, which correspond to the light chain of SEQ ID NO: 51. In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 8 angstroms of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least four, at least fifteen, at least sixteen, at least seventeen, at least eighteen, at least nine, at least twenty, or at least twenty-one residues of the light chain of the antibody or fragment thereof selected from the group consisting of I29, R30, D31, Y32, L33, L46, I48, Y49, G50, A51, S52, S53, L54, Q55, S56, Q90, H91, N92, N93, Y94, and F96 corresponding to the light chain of SEQ ID NO:51.
[0235] In some embodiments, when the antibody or fragment thereof binds to GIPR, the GIPR is located within 5 angstroms of at least one residue of the light chain of the antibody or fragment thereof selected from the group consisting of Y32, Y49, G50, S53, Q55, H91, N92, N93, and Y94, which correspond to the light chain of SEQ ID NO: 51. In some embodiments, when the antibody or fragment thereof binds to G...
Claims
1. 1. A method of treating a subject having a metabolic disorder, comprising administering to the subject a therapeutically effective amount of an antigen binding protein that specifically binds to a protein having an amino acid sequence that has at least 90% amino acid sequence identity to the amino acid sequence of GIPR.
2. The method of claim 1 , wherein the metabolic disorder is a disorder of glucose metabolism.
3. 3. The method of claim 2, wherein the glucose metabolism disorder comprises hyperglycemia and the administration reduces plasma glucose in the subject.
4. 3. The method of claim 2, wherein the glucose metabolism disorder comprises hyperinsulinemia and the administration reduces plasma insulin in the subject.
5. 3. The method of claim 2, wherein the glucose metabolism disorder comprises impaired glucose tolerance, and wherein the administration improves glucose tolerance in the subject.
6. 3. The method of claim 2, wherein the glucose metabolism disorder comprises insulin resistance and the administering reduces insulin resistance in the subject.
7. The method of claim 2 , wherein the glucose metabolism disorder comprises diabetes.
8. The method of claim 2 , wherein the subject is obese.
9. 10. The method of claim 8, wherein said administering reduces the body weight of said subject.
10. 10. The method of claim 8, wherein said administration reduces weight gain in said subject.
11. 10. The method of claim 8, wherein said administration reduces body fat mass in said subject.
12. 9. The method of claim 8, wherein the glucose metabolism disorder comprises insulin resistance and the administering reduces insulin resistance in the subject.
13. 10. The method of claim 8, wherein the subject has advanced hepatic steatosis and the administration reduces hepatic steatosis in the subject.
14. 10. The method of claim 8, wherein the subject has an increased liver fat content and the administration reduces the liver fat content in the subject.
15. The method of claim 1 , wherein the subject is a mammal.
16. The method of claim 1 , wherein the subject is a human.
17. 10. The method of claim 1, wherein the administration is by parenteral injection.
18. 10. The method of claim 1, wherein the administration is by subcutaneous injection.
19. An isolated antigen binding protein that specifically binds to a human gastric inhibitory peptide receptor (GIPR) polypeptide.
20. 20. The isolated antigen binding protein of claim 19, wherein the human GIPR has a sequence comprising a sequence selected from the group consisting of SEQ ID NO:3141, SEQ ID NO:3143, and SEQ ID NO:3145.
21. 21. The isolated antigen binding protein of claim 20, wherein the antigen binding protein is a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, a chimeric antibody, a multispecific antibody, or an antibody fragment thereof.
22. 22. The isolated antigen binding protein of claim 21, wherein the antibody fragment is a Fab fragment, a Fab' fragment, or an F(ab')2 fragment.
23. 22. The isolated antigen binding protein of claim 21 , wherein the antigen binding protein is a human antibody.
24. 22. The isolated antigen binding protein of claim 21 , wherein the antigen binding protein is a monoclonal antibody.
25. 22. The isolated antigen binding protein of claim 21 , wherein the antigen binding protein is of the IgG1, IgG2, IgG3, or IgG4 type.
26. 26. The isolated antigen binding protein of claim 25, wherein the antigen binding protein is of the IgG1 or IgG2 type.
27. 22. Any of the isolated antigen binding proteins of claim 21, wherein the antigen binding protein is coupled to a labeling group.
28. 22. The isolated antigen binding protein of claim 21, wherein the antigen binding protein inhibits binding of GIP to the extracellular portion of human GIPR.
29. 22. The isolated antigen binding protein of claim 21, wherein said antigen binding protein is an antibody or fragment thereof, said antibody comprising CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3, wherein said CDRL1 comprises a sequence selected from the group consisting of SEQ ID NOs: 629-785, said CDRL2 comprises a sequence selected from the group consisting of SEQ ID NOs: 786-942, said CDRL3 comprises a sequence selected from the group consisting of SEQ ID NOs: 943-1099, said CDRH1 comprises a sequence selected from the group consisting of SEQ ID NOs: 1100-1256, said CDRH2 comprises a sequence selected from the group consisting of SEQ ID NOs: 1257-1413, and said CDRH3 comprises a sequence selected from the group consisting of SEQ ID NOs: 1414-1570.
30. the antigen binding protein is an antibody or fragment thereof, the antibody comprising a CDRL1, a CDRL2, a CDRL3, a CDRH1, a CDRH2, and a CDRH3, each of which is SEQ ID NO:629, SEQ ID NO:786, SEQ ID NO:943, SEQ ID NO:1100, SEQ ID NO:1257, and SEQ ID NO:1414; SEQ ID NO:630, SEQ ID NO:787, SEQ ID NO:944, SEQ ID NO:1101, SEQ ID NO:1258, and SEQ ID NO:1415; SEQ ID NO:631, SEQ ID NO:788, SEQ ID NO:945, SEQ ID NO:1102, SEQ ID NO:1259, and SEQ ID NO:1416; SEQ ID NO:632, SEQ ID NO:789, SEQ ID NO:946, SEQ ID NO:1103, SEQ ID NO:1260, and SEQ ID NO:1417; SEQ ID NO:633, SEQ ID NO:790, SEQ ID NO:947, SEQ ID NO:1104, SEQ ID NO:1261, and SEQ ID NO:1418; SEQ ID NO:634, SEQ ID NO:791, SEQ ID NO:948, SEQ ID NO:1105, SEQ ID NO:1262, and SEQ ID NO:1419; SEQ ID NO:635, SEQ ID NO:792, SEQ ID NO:949, SEQ ID NO:1106, SEQ ID NO:1263, and SEQ ID NO:1420; SEQ ID NO:636, SEQ ID NO:793, SEQ ID NO:950, SEQ ID NO:1107, SEQ ID NO:1264, and SEQ ID NO:1421; SEQ ID NO:637, SEQ ID NO:794, SEQ ID NO:951, SEQ ID NO:1108, SEQ ID NO:1265, and SEQ ID NO:1422; SEQ ID NO:638, SEQ ID NO:795, SEQ ID NO:952, SEQ ID NO:1109, SEQ ID NO:1266, and SEQ ID NO:1423; SEQ ID NO:639, SEQ ID NO:796, SEQ ID NO:953, SEQ ID NO:1110, SEQ ID NO:1267, and SEQ ID NO:1424; SEQ ID NO:640, SEQ ID NO:797, SEQ ID NO:954, SEQ ID NO:1111, SEQ ID NO:1268, and SEQ ID NO:1425; SEQ ID NO:641, SEQ ID NO:798, SEQ ID NO:955, SEQ ID NO:1112, SEQ ID NO:1269, and SEQ ID NO:1426; SEQ ID NO:642, SEQ ID NO:799, SEQ ID NO:956, SEQ ID NO:1113, SEQ ID NO:1270, and SEQ ID NO:1427; SEQ ID NO:643, SEQ ID NO:800, SEQ ID NO:957, SEQ ID NO:1114, SEQ ID NO:1271, and SEQ ID NO:1428; SEQ ID NO:644, SEQ ID NO:801, SEQ ID NO:958, SEQ ID NO:1115, SEQ ID NO:1272, and SEQ ID NO:1429; SEQ ID NO:645, SEQ ID NO:802, SEQ ID NO:959, SEQ ID NO:1116, SEQ ID NO:1273, and SEQ ID NO:1430; SEQ ID NO:646, SEQ ID NO:803, SEQ ID NO:960, SEQ ID NO:1117, SEQ ID NO:1274, and SEQ ID NO:1431; SEQ ID NO:647, SEQ ID NO:804, SEQ ID NO:961, SEQ ID NO:1118, SEQ ID NO:1275, and SEQ ID NO:1432; SEQ ID NO:648, SEQ ID NO:805, SEQ ID NO:962, SEQ ID NO:1119, SEQ ID NO:1276, and SEQ ID NO:1433; SEQ ID NO:649, SEQ ID NO:806, SEQ ID NO:963, SEQ ID NO:1120, SEQ ID NO:1277, and SEQ ID NO:1434; SEQ ID NO:650, SEQ ID NO:807, SEQ ID NO:964, SEQ ID NO:1121, SEQ ID NO:1278, and SEQ ID NO:1435; SEQ ID NO:651, SEQ ID NO:808, SEQ ID NO:965, SEQ ID NO:1122, SEQ ID NO:1279, and SEQ ID NO:1436; SEQ ID NO:652, SEQ ID NO:809, SEQ ID NO:966, SEQ ID NO:1123, SEQ ID NO:1280, and SEQ ID NO:1437; SEQ ID NO:653, SEQ ID NO:810, SEQ ID NO:967, SEQ ID NO:1124, SEQ ID NO:1281, and SEQ ID NO:1438; SEQ ID NO:654, SEQ ID NO:811, SEQ ID NO:968, SEQ ID NO:1125, SEQ ID NO:1282, and SEQ ID NO:1439; SEQ ID NO:655, SEQ ID NO:812, SEQ ID NO:969, SEQ ID NO:1126, SEQ ID NO:1283, and SEQ ID NO:1440; SEQ ID NO:656, SEQ ID NO:813, SEQ ID NO:970, SEQ ID NO:1127, SEQ ID NO:1284, and SEQ ID NO:1441; SEQ ID NO:657, SEQ ID NO:814, SEQ ID NO:971, SEQ ID NO:1128, SEQ ID NO:1285, and SEQ ID NO:1442; SEQ ID NO:658, SEQ ID NO:815, SEQ ID NO:972, SEQ ID NO:1129, SEQ ID NO:1286, and SEQ ID NO:1443; SEQ ID NO:659, SEQ ID NO:816, SEQ ID NO:973, SEQ ID NO:1130, SEQ ID NO:1287, and SEQ ID NO:1444; SEQ ID NO:660, SEQ ID NO:817, SEQ ID NO:974, SEQ ID NO:1131, SEQ ID NO:1288, and SEQ ID NO:1445; SEQ ID NO:661, SEQ ID NO:818, SEQ ID NO:975, SEQ ID NO:1132, SEQ ID NO:1289, and SEQ ID NO:1446; SEQ ID NO:662, SEQ ID NO:819, SEQ ID NO:976, SEQ ID NO:1133, SEQ ID NO:1290, and SEQ ID NO:1447; SEQ ID NO:663, SEQ ID NO:820, SEQ ID NO:977, SEQ ID NO:1134, SEQ ID NO:1291, and SEQ ID NO:1448; SEQ ID NO:664, SEQ ID NO:821, SEQ ID NO:978, SEQ ID NO:1135, SEQ ID NO:1292, and SEQ ID NO:1449; SEQ ID NO:665, SEQ ID NO:822, SEQ ID NO:979, SEQ ID NO:1136, SEQ ID NO:1293, and SEQ ID NO:1450; SEQ ID NO:666, SEQ ID NO:823, SEQ ID NO:980, SEQ ID NO:1137, SEQ ID NO:1294, and SEQ ID NO:1451; SEQ ID NO:667, SEQ ID NO:824, SEQ ID NO:981, SEQ ID NO:1138, SEQ ID NO:1295, and SEQ ID NO:1452; SEQ ID NO:668, SEQ ID NO:825, SEQ ID NO:982, SEQ ID NO:1139, SEQ ID NO:1296, and SEQ ID NO:1453; SEQ ID NO:669, SEQ ID NO:826, SEQ ID NO:983, SEQ ID NO:1140, SEQ ID NO:1297, and SEQ ID NO:1454; SEQ ID NO:670, SEQ ID NO:827, SEQ ID NO:984, SEQ ID NO:1141, SEQ ID NO:1298, and SEQ ID NO:1455; SEQ ID NO:671, SEQ ID NO:828, SEQ ID NO:985, SEQ ID NO:1142, SEQ ID NO:1299, and SEQ ID NO:1456; SEQ ID NO:672, SEQ ID NO:829, SEQ ID NO:986, SEQ ID NO:1143, SEQ ID NO:1300, and SEQ ID NO:1457; SEQ ID NO:673, SEQ ID NO:830, SEQ ID NO:987, SEQ ID NO:1144, SEQ ID NO:1301, and SEQ ID NO:1458; SEQ ID NO:674, SEQ ID NO:831, SEQ ID NO:988, SEQ ID NO:1145, SEQ ID NO:1302, and SEQ ID NO:1459; SEQ ID NO:675, SEQ ID NO:832, SEQ ID NO:989, SEQ ID NO:1146, SEQ ID NO:1303, and SEQ ID NO:1460; SEQ ID NO:676, SEQ ID NO:833, SEQ ID NO:990, SEQ ID NO:1147, SEQ ID NO:1304, and SEQ ID NO:1461; SEQ ID NO:677, SEQ ID NO:834, SEQ ID NO:991, SEQ ID NO:1148, SEQ ID NO:1305, and SEQ ID NO:1462; SEQ ID NO:678, SEQ ID NO:835, SEQ ID NO:992, SEQ ID NO:1149, SEQ ID NO:1306, and SEQ ID NO:1463; SEQ ID NO:679, SEQ ID NO:836, SEQ ID NO:993, SEQ ID NO:1150, SEQ ID NO:1307, and SEQ ID NO:1464; SEQ ID NO:680, SEQ ID NO:837, SEQ ID NO:994, SEQ ID NO:1151, SEQ ID NO:1308, and SEQ ID NO:1465; SEQ ID NO:681, SEQ ID NO:838, SEQ ID NO:995, SEQ ID NO:1152, SEQ ID NO:1309, and SEQ ID NO:1466; SEQ ID NO:682, SEQ ID NO:839, SEQ ID NO:996, SEQ ID NO:1153, SEQ ID NO:1310, and SEQ ID NO:1467; SEQ ID NO:683, SEQ ID NO:840, SEQ ID NO:997, SEQ ID NO:1154, SEQ ID NO:1311, and SEQ ID NO:1468; SEQ ID NO:684, SEQ ID NO:841, SEQ ID NO:998, SEQ ID NO:1155, SEQ ID NO:1312, and SEQ ID NO:1469; SEQ ID NO:685, SEQ ID NO:842, SEQ ID NO:999, SEQ ID NO:1156, SEQ ID NO:1313, and SEQ ID NO:1470; SEQ ID NO:686, SEQ ID NO:843, SEQ ID NO:1000, SEQ ID NO:1157, SEQ ID NO:1314, and SEQ ID NO:1471; SEQ ID NO:687, SEQ ID NO:844, SEQ ID NO:1001, SEQ ID NO:1158, SEQ ID NO:1315, and SEQ ID NO:1472; SEQ ID NO:688, SEQ ID NO:845, SEQ ID NO:1002, SEQ ID NO:1159, SEQ ID NO:1316, and SEQ ID NO:1473; SEQ ID NO:689, SEQ ID NO:846, SEQ ID NO:1003, SEQ ID NO:1160, SEQ ID NO:1317, and SEQ ID NO:1474; SEQ ID NO:690, SEQ ID NO:847, SEQ ID NO:1004, SEQ ID NO:1161, SEQ ID NO:1318, and SEQ ID NO:1475; SEQ ID NO:691, SEQ ID NO:848, SEQ ID NO:1005, SEQ ID NO:1162, SEQ ID NO:1319, and SEQ ID NO:1476; SEQ ID NO:692, SEQ ID NO:849, SEQ ID NO:1006, SEQ ID NO:1163, SEQ ID NO:1320, and SEQ ID NO:1477; SEQ ID NO:693, SEQ ID NO:850, SEQ ID NO:1007, SEQ ID NO:1164, SEQ ID NO:1321, and SEQ ID NO:1478; SEQ ID NO:694, SEQ ID NO:851, SEQ ID NO:1008, SEQ ID NO:1165, SEQ ID NO:1322, and SEQ ID NO:1479; SEQ ID NO:695, SEQ ID NO:852, SEQ ID NO:1009, SEQ ID NO:1166, SEQ ID NO:1323, and SEQ ID NO:1480; SEQ ID NO:696, SEQ ID NO:853, SEQ ID NO:1010, SEQ ID NO:1167, SEQ ID NO:1324, and SEQ ID NO:1481; SEQ ID NO:697, SEQ ID NO:854, SEQ ID NO:1011, SEQ ID NO:1168, SEQ ID NO:1325, and SEQ ID NO:1482; SEQ ID NO:698, SEQ ID NO:855, SEQ ID NO:1012, SEQ ID NO:1169, SEQ ID NO:1326, and SEQ ID NO:1483; SEQ ID NO:699, SEQ ID NO:856, SEQ ID NO:1013, SEQ ID NO:1170, SEQ ID NO:1327, and SEQ ID NO:1484; SEQ ID NO:700, SEQ ID NO:857, SEQ ID NO:1014, SEQ ID NO:1171, SEQ ID NO:1328, and SEQ ID NO:1485; SEQ ID NO:701, SEQ ID NO:858, SEQ ID NO:1015, SEQ ID NO:1172, SEQ ID NO:1329, and SEQ ID NO:1486; SEQ ID NO:702, SEQ ID NO:859, SEQ ID NO:1016, SEQ ID NO:1173, SEQ ID NO:1330, and SEQ ID NO:1487; SEQ ID NO:703, SEQ ID NO:860, SEQ ID NO:1017, SEQ ID NO:1174, SEQ ID NO:1331, and SEQ ID NO:1488; SEQ ID NO:704, SEQ ID NO:861, SEQ ID NO:1018, SEQ ID NO:1175, SEQ ID NO:1332, and SEQ ID NO:1489; SEQ ID NO:705, SEQ ID NO:862, SEQ ID NO:1019, SEQ ID NO:1176, SEQ ID NO:1333, and SEQ ID NO:1490; SEQ ID NO:706, SEQ ID NO:863, SEQ ID NO:1020, SEQ ID NO:1177, SEQ ID NO:1334, and SEQ ID NO:1491; SEQ ID NO:707, SEQ ID NO:864, SEQ ID NO:1021, SEQ ID NO:1178, SEQ ID NO:1335, and SEQ ID NO:1492; SEQ ID NO:708, SEQ ID NO:865, SEQ ID NO:1022, SEQ ID NO:1179, SEQ ID NO:1336, and SEQ ID NO:1493; SEQ ID NO:709, SEQ ID NO:866, SEQ ID NO:1023, SEQ ID NO:1180, SEQ ID NO:1337, and SEQ ID NO:1494; SEQ ID NO:710, SEQ ID NO:867, SEQ ID NO:1024, SEQ ID NO:1181, SEQ ID NO:1338, and SEQ ID NO:1495; SEQ ID NO:711, SEQ ID NO:868, SEQ ID NO:1025, SEQ ID NO:1182, SEQ ID NO:1339, and SEQ ID NO:1496; SEQ ID NO:712, SEQ ID NO:869, SEQ ID NO:1026, SEQ ID NO:1183, SEQ ID NO:1340, and SEQ ID NO:1497; SEQ ID NO:713, SEQ ID NO:870, SEQ ID NO:1027, SEQ ID NO:1184, SEQ ID NO:1341, and SEQ ID NO:1498; SEQ ID NO:714, SEQ ID NO:871, SEQ ID NO:1028, SEQ ID NO:1185, SEQ ID NO:1342, and SEQ ID NO:1499; SEQ ID NO:715, SEQ ID NO:872, SEQ ID NO:1029, SEQ ID NO:1186, SEQ ID NO:1343, and SEQ ID NO:1500; SEQ ID NO:716, SEQ ID NO:873, SEQ ID NO:1030, SEQ ID NO:1187, SEQ ID NO:1344, and SEQ ID NO:1501; SEQ ID NO:717, SEQ ID NO:874, SEQ ID NO:1031, SEQ ID NO:1188, SEQ ID NO:1345, and SEQ ID NO:1502; SEQ ID NO:718, SEQ ID NO:875, SEQ ID NO:1032, SEQ ID NO:1189, SEQ ID NO:1346, and SEQ ID NO:1503; SEQ ID NO:719, SEQ ID NO:876, SEQ ID NO:1033, SEQ ID NO:1190, SEQ ID NO:1347, and SEQ ID NO:1504; SEQ ID NO:720, SEQ ID NO:877, SEQ ID NO:1034, SEQ ID NO:1191, SEQ ID NO:1348, and SEQ ID NO:1505; SEQ ID NO:721, SEQ ID NO:878, SEQ ID NO:1035, SEQ ID NO:1192, SEQ ID NO:1349, and SEQ ID NO:1506; SEQ ID NO:722, SEQ ID NO:879, SEQ ID NO:1036, SEQ ID NO:1193, SEQ ID NO:1350, and SEQ ID NO:1507; SEQ ID NO:723, SEQ ID NO:880, SEQ ID NO:1037, SEQ ID NO:1194, SEQ ID NO:1351, and SEQ ID NO:1508; SEQ ID NO:724, SEQ ID NO:881, SEQ ID NO:1038, SEQ ID NO:1195, SEQ ID NO:1352, and SEQ ID NO:1509; SEQ ID NO:725, SEQ ID NO:882, SEQ ID NO:1039, SEQ ID NO:1196, SEQ ID NO:1353, and SEQ ID NO:1510; SEQ ID NO:726, SEQ ID NO:883, SEQ ID NO:1040, SEQ ID NO:1197, SEQ ID NO:1354, and SEQ ID NO:1511; SEQ ID NO:727, SEQ ID NO:884, SEQ ID NO:1041, SEQ ID NO:1198, SEQ ID NO:1355, and SEQ ID NO:1512; SEQ ID NO:728, SEQ ID NO:885, SEQ ID NO:1042, SEQ ID NO:1199, SEQ ID NO:1356, and SEQ ID NO:1513; SEQ ID NO:729, SEQ ID NO:886, SEQ ID NO:1043, SEQ ID NO:1200, SEQ ID NO:1357, and SEQ ID NO:1514; SEQ ID NO:730, SEQ ID NO:887, SEQ ID NO:1044, SEQ ID NO:1201, SEQ ID NO:1358, and SEQ ID NO:1515; SEQ ID NO:731, SEQ ID NO:888, SEQ ID NO:1045, SEQ ID NO:1202, SEQ ID NO:1359, and SEQ ID NO:1516; SEQ ID NO:732, SEQ ID NO:889, SEQ ID NO:1046, SEQ ID NO:1203, SEQ ID NO:1360, and SEQ ID NO:1517; SEQ ID NO:733, SEQ ID NO:890, SEQ ID NO:1047, SEQ ID NO:1204, SEQ ID NO:1361, and SEQ ID NO:1518; SEQ ID NO:734, SEQ ID NO:891, SEQ ID NO:1048, SEQ ID NO:1205, SEQ ID NO:1362, and SEQ ID NO:1519; SEQ ID NO:735, SEQ ID NO:892, SEQ ID NO:1049, SEQ ID NO:1206, SEQ ID NO:1363, and SEQ ID NO:1520; SEQ ID NO:736, SEQ ID NO:893, SEQ ID NO:1050, SEQ ID NO:1207, SEQ ID NO:1364, and SEQ ID NO:1521; SEQ ID NO:737, SEQ ID NO:894, SEQ ID NO:1051, SEQ ID NO:1208, SEQ ID NO:1365, and SEQ ID NO:1522; SEQ ID NO:738, SEQ ID NO:895, SEQ ID NO:1052, SEQ ID NO:1209, SEQ ID NO:1366, and SEQ ID NO:1523; SEQ ID NO:739, SEQ ID NO:896, SEQ ID NO:1053, SEQ ID NO:1210, SEQ ID NO:1367, and SEQ ID NO:1524; SEQ ID NO:740, SEQ ID NO:897, SEQ ID NO:1054, SEQ ID NO:1211, SEQ ID NO:1368, and SEQ ID NO:1525; SEQ ID NO:741, SEQ ID NO:898, SEQ ID NO:1055, SEQ ID NO:1212, SEQ ID NO:1369, and SEQ ID NO:1526; SEQ ID NO:742, SEQ ID NO:899, SEQ ID NO:1056, SEQ ID NO:1213, SEQ ID NO:1370, and SEQ ID NO:1527; SEQ ID NO:743, SEQ ID NO:900, SEQ ID NO:1057, SEQ ID NO:1214, SEQ ID NO:1371, and SEQ ID NO:1528; SEQ ID NO:744, SEQ ID NO:901, SEQ ID NO:1058, SEQ ID NO:1215, SEQ ID NO:1372, and SEQ ID NO:1529; SEQ ID NO:745, SEQ ID NO:902, SEQ ID NO:1059, SEQ ID NO:1216, SEQ ID NO:1373, and SEQ ID NO:1530; SEQ ID NO:746, SEQ ID NO:903, SEQ ID NO:1060, SEQ ID NO:1217, SEQ ID NO:1374, and SEQ ID NO:1531; SEQ ID NO:747, SEQ ID NO:904, SEQ ID NO:1061, SEQ ID NO:1218, SEQ ID NO:1375, and SEQ ID NO:1532; SEQ ID NO:748, SEQ ID NO:905, SEQ ID NO:1062, SEQ ID NO:1219, SEQ ID NO:1376, and SEQ ID NO:1533; SEQ ID NO:749, SEQ ID NO:906, SEQ ID NO:1063, SEQ ID NO:1220, SEQ ID NO:1377, and SEQ ID NO:1534; SEQ ID NO:750, SEQ ID NO:907, SEQ ID NO:1064, SEQ ID NO:1221, SEQ ID NO:1378, and SEQ ID NO:1535; SEQ ID NO:751, SEQ ID NO:908, SEQ ID NO:1065, SEQ ID NO:1222, SEQ ID NO:1379, and SEQ ID NO:1536; SEQ ID NO:752, SEQ ID NO:909, SEQ ID NO:1066, SEQ ID NO:1223, SEQ ID NO:1380, and SEQ ID NO:1537; SEQ ID NO:753, SEQ ID NO:910, SEQ ID NO:1067, SEQ ID NO:1224, SEQ ID NO:1381, and SEQ ID NO:1538; SEQ ID NO:754, SEQ ID NO:911, SEQ ID NO:1068, SEQ ID NO:1225, SEQ ID NO:1382, and SEQ ID NO:1539; SEQ ID NO:755, SEQ ID NO:912, SEQ ID NO:1069, SEQ ID NO:1226, SEQ ID NO:1383, and SEQ ID NO:1540; SEQ ID NO:756, SEQ ID NO:913, SEQ ID NO:1070, SEQ ID NO:1227, SEQ ID NO:1384, and SEQ ID NO:1541; SEQ ID NO:757, SEQ ID NO:914, SEQ ID NO:1071, SEQ ID NO:1228, SEQ ID NO:1385, and SEQ ID NO:1542; SEQ ID NO:758, SEQ ID NO:915, SEQ ID NO:1072, SEQ ID NO:1229, SEQ ID NO:1386, and SEQ ID NO:1543; SEQ ID NO:759, SEQ ID NO:916, SEQ ID NO:1073, SEQ ID NO:1230, SEQ ID NO:1387, and SEQ ID NO:1544; SEQ ID NO:760, SEQ ID NO:917, SEQ ID NO:1074, SEQ ID NO:1231, SEQ ID NO:1388, and SEQ ID NO:1545; SEQ ID NO:761, SEQ ID NO:918, SEQ ID NO:1075, SEQ ID NO:1232, SEQ ID NO:1389, and SEQ ID NO:1546; SEQ ID NO:762, SEQ ID NO:919, SEQ ID NO:1076, SEQ ID NO:1233, SEQ ID NO:1390, and SEQ ID NO:1547; SEQ ID NO:763, SEQ ID NO:920, SEQ ID NO:1077, SEQ ID NO:1234, SEQ ID NO:1391, and SEQ ID NO:1548; SEQ ID NO:764, SEQ ID NO:921, SEQ ID NO:1078, SEQ ID NO:1235, SEQ ID NO:1392, and SEQ ID NO:1549; SEQ ID NO:765, SEQ ID NO:922, SEQ ID NO:1079, SEQ ID NO:1236, SEQ ID NO:1393, and SEQ ID NO:1550; SEQ ID NO:766, SEQ ID NO:923, SEQ ID NO:1080, SEQ ID NO:1237, SEQ ID NO:1394, and SEQ ID NO:1551; SEQ ID NO:767, SEQ ID NO:924, SEQ ID NO:1081, SEQ ID NO:1238, SEQ ID NO:1395, and SEQ ID NO:1552; SEQ ID NO:768, SEQ ID NO:925, SEQ ID NO:1082, SEQ ID NO:1239, SEQ ID NO:1396, and SEQ ID NO:1553; SEQ ID NO:769, SEQ ID NO:926, SEQ ID NO:1083, SEQ ID NO:1240, SEQ ID NO:1397, and SEQ ID NO:1554; SEQ ID NO:770, SEQ ID NO:927, SEQ ID NO:1084, SEQ ID NO:1241, SEQ ID NO:1398, and SEQ ID NO:1555; SEQ ID NO:771, SEQ ID NO:928, SEQ ID NO:1085, SEQ ID NO:1242, SEQ ID NO:1399, and SEQ ID NO:1556; SEQ ID NO:772, SEQ ID NO:929, SEQ ID NO:1086, SEQ ID NO:1243, SEQ ID NO:1400, and SEQ ID NO:1557; SEQ ID NO:773, SEQ ID NO:930, SEQ ID NO:1087, SEQ ID NO:1244, SEQ ID NO:1401, and SEQ ID NO:1558; SEQ ID NO:774, SEQ ID NO:931, SEQ ID NO:1088, SEQ ID NO:1245, SEQ ID NO:1402, and SEQ ID NO:1559; SEQ ID NO:775, SEQ ID NO:932, SEQ ID NO:1089, SEQ ID NO:1246, SEQ ID NO:1403, and SEQ ID NO:1560; SEQ ID NO:776, SEQ ID NO:933, SEQ ID NO:1090, SEQ ID NO:1247, SEQ ID NO:1404, and SEQ ID NO:1561; SEQ ID NO:777, SEQ ID NO:934, SEQ ID NO:1091, SEQ ID NO:1248, SEQ ID NO:1405, and SEQ ID NO:1562; SEQ ID NO:778, SEQ ID NO:935, SEQ ID NO:1092, SEQ ID NO:1249, SEQ ID NO:1406, and SEQ ID NO:1563; SEQ ID NO:779, SEQ ID NO:936, SEQ ID NO:1093, SEQ ID NO:1250, SEQ ID NO:1407, and SEQ ID NO:1564; SEQ ID NO:780, SEQ ID NO:937, SEQ ID NO:1094, SEQ ID NO:1251, SEQ ID NO:1408, and SEQ ID NO:1565; SEQ ID NO:781, SEQ ID NO:938, SEQ ID NO:1095, SEQ ID NO:1252, SEQ ID NO:1409, and SEQ ID NO:1566; SEQ ID NO:782, SEQ ID NO:939, SEQ ID NO:1096, SEQ ID NO:1253, SEQ ID NO:1410, and SEQ ID NO:1567; SEQ ID NO:783, SEQ ID NO:940, SEQ ID NO:1097, SEQ ID NO:1254, SEQ ID NO:1411, and SEQ ID NO:1568; SEQ ID NO:784, SEQ ID NO:941, SEQ ID NO:1098, SEQ ID NO:1255, SEQ ID NO:1412, and SEQ ID NO:1569; and SEQ ID NO:785, SEQ ID NO:942, SEQ ID NO:1099, SEQ ID NO:1256, SEQ ID NO:1413, and SEQ ID NO:1570; 22. The isolated antigen binding protein of claim 21, comprising a sequence selected from the group consisting of:
31. 22. The isolated antigen binding protein of claim 21, wherein said antigen binding protein is an antibody or fragment thereof, said antibody or fragment thereof comprising a light chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 1-157 and a heavy chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 158-314.
32. The antigen binding protein is an antibody or a fragment thereof, the antibody or fragment thereof being capable of binding to a light chain variable region comprising SEQ ID NO: 1 and a heavy chain variable region comprising SEQ ID NO: 158, a light chain variable region comprising SEQ ID NO: 2 and a heavy chain variable region comprising SEQ ID NO: 159, a light chain variable region comprising SEQ ID NO: 3 and a heavy chain variable region comprising SEQ ID NO: 160, a light chain variable region comprising SEQ ID NO: 4 and a heavy chain variable region comprising SEQ ID NO: 161, a light chain variable region comprising SEQ ID NO: 5 and a heavy chain variable region comprising SEQ ID NO: 162, a light chain variable region comprising SEQ ID NO: 6 and a heavy chain variable region comprising SEQ ID NO: 163, a light chain variable region comprising SEQ ID NO: 7 and a heavy chain variable region comprising SEQ ID NO: 74, a light chain variable region comprising SEQ ID NO: 8 and a heavy chain variable region comprising SEQ ID NO: 165; a light chain variable region comprising SEQ ID NO: 9 and a heavy chain variable region comprising SEQ ID NO: 166; a light chain variable region comprising SEQ ID NO: 10 and a heavy chain variable region comprising SEQ ID NO: 167; a light chain variable region comprising SEQ ID NO: 11 and a heavy chain variable region comprising SEQ ID NO: 168; a light chain variable region comprising SEQ ID NO: 12 and a heavy chain variable region comprising SEQ ID NO: 169; a light chain variable region comprising SEQ ID NO: 13 and a heavy chain variable region comprising SEQ ID NO: 170; a light chain variable region comprising SEQ ID NO: 14 and a heavy chain variable region comprising SEQ ID NO: 161; a heavy chain variable region comprising SEQ ID NO: 171; a light chain variable region comprising SEQ ID NO: 15 and a heavy chain variable region comprising SEQ ID NO: 172; a light chain variable region comprising SEQ ID NO: 16 and a heavy chain variable region comprising SEQ ID NO: 173; a light chain variable region comprising SEQ ID NO: 17 and a heavy chain variable region comprising SEQ ID NO: 174; a light chain variable region comprising SEQ ID NO: 18 and a heavy chain variable region comprising SEQ ID NO: 175; a light chain variable region comprising SEQ ID NO: 19 and a heavy chain variable region comprising SEQ ID NO: 176; a light chain variable region comprising SEQ ID NO: 20 and a heavy chain variable region comprising SEQ ID NO: 177; a light chain variable region comprising SEQ ID NO: 21 and a heavy chain variable region comprising SEQ ID NO:
178. a heavy chain variable region comprising SEQ ID NO: 179; a light chain variable region comprising SEQ ID NO: 23 and a heavy chain variable region comprising SEQ ID NO: 180; a light chain variable region comprising SEQ ID NO: 24 and a heavy chain variable region comprising SEQ ID NO: 181; a light chain variable region comprising SEQ ID NO: 25 and a heavy chain variable region comprising SEQ ID NO: 182; a light chain variable region comprising SEQ ID NO: 26 and a heavy chain variable region comprising SEQ ID NO: 183; a light chain variable region comprising SEQ ID NO: 27 and a heavy chain variable region comprising SEQ ID NO: 184; a light chain variable region comprising SEQ ID NO: 28 and a heavy chain variable region comprising SEQ ID NO: 185;A light chain variable region comprising SEQ ID NO:29 and a heavy chain variable region comprising SEQ ID NO:186, a light chain variable region comprising SEQ ID NO:30 and a heavy chain variable region comprising SEQ ID NO:187, a light chain variable region comprising SEQ ID NO:31 and a heavy chain variable region comprising SEQ ID NO:188, a light chain variable region comprising SEQ ID NO:32 and a heavy chain variable region comprising SEQ ID NO:189, a light chain variable region comprising SEQ ID NO:33 and a heavy chain variable region comprising SEQ ID NO:190, a light chain variable region comprising SEQ ID NO:34 and a heavy chain variable region comprising SEQ ID NO:191, a light chain variable region comprising SEQ ID NO:35 and a heavy chain variable region comprising SEQ ID NO:192, a light chain variable region comprising SEQ ID NO:36 and a heavy chain variable region comprising SEQ ID NO:37, a light chain variable region comprising SEQ ID NO: 37 and a heavy chain variable region comprising SEQ ID NO: 194; a light chain variable region comprising SEQ ID NO: 38 and a heavy chain variable region comprising SEQ ID NO: 195; a light chain variable region comprising SEQ ID NO: 39 and a heavy chain variable region comprising SEQ ID NO: 196; a light chain variable region comprising SEQ ID NO: 40 and a heavy chain variable region comprising SEQ ID NO: 197; a light chain variable region comprising SEQ ID NO: 41 and a heavy chain variable region comprising SEQ ID NO: 198; a light chain variable region comprising SEQ ID NO: 42 and a heavy chain variable region comprising SEQ ID NO: 199; a light chain variable region comprising SEQ ID NO: 43 and A heavy chain variable region comprising SEQ ID NO:200, a light chain variable region comprising SEQ ID NO:44 and a heavy chain variable region comprising SEQ ID NO:201, a light chain variable region comprising SEQ ID NO:45 and a heavy chain variable region comprising SEQ ID NO:202, a light chain variable region comprising SEQ ID NO:46 and a heavy chain variable region comprising SEQ ID NO:203, a light chain variable region comprising SEQ ID NO:47 and a heavy chain variable region comprising SEQ ID NO:204, a light chain variable region comprising SEQ ID NO:48 and a heavy chain variable region comprising SEQ ID NO:205, a light chain variable region comprising SEQ ID NO:49 and a heavy chain variable region comprising SEQ ID NO:206, a light chain variable region comprising SEQ ID NO:50 and SEQ ID NO:
207. a heavy chain variable region comprising a light chain variable region comprising SEQ ID NO:51 and a heavy chain variable region comprising SEQ ID NO:208, a light chain variable region comprising SEQ ID NO:52 and a heavy chain variable region comprising SEQ ID NO:209, a light chain variable region comprising SEQ ID NO:53 and a heavy chain variable region comprising SEQ ID NO:210, a light chain variable region comprising SEQ ID NO:54 and a heavy chain variable region comprising SEQ ID NO:211, a light chain variable region comprising SEQ ID NO:55 and a heavy chain variable region comprising SEQ ID NO:212, a light chain variable region comprising SEQ ID NO:56 and a heavy chain variable region comprising SEQ ID NO:213, a light chain variable region comprising SEQ ID NO:57 and a heavy chain variable region comprising SEQ ID NO:214,A light chain variable region comprising SEQ ID NO:58 and a heavy chain variable region comprising SEQ ID NO:215, a light chain variable region comprising SEQ ID NO:59 and a heavy chain variable region comprising SEQ ID NO:216, a light chain variable region comprising SEQ ID NO:60 and a heavy chain variable region comprising SEQ ID NO:217, a light chain variable region comprising SEQ ID NO:61 and a heavy chain variable region comprising SEQ ID NO:218, a light chain variable region comprising SEQ ID NO:62 and a heavy chain variable region comprising SEQ ID NO:219, a light chain variable region comprising SEQ ID NO:63 and a heavy chain variable region comprising SEQ ID NO:220, a light chain variable region comprising SEQ ID NO:64 and a heavy chain variable region comprising SEQ ID NO:221, a light chain variable region comprising SEQ ID NO:65 and a heavy chain variable region comprising SEQ ID NO:66, a light chain variable region comprising SEQ ID NO: 66 and a heavy chain variable region comprising SEQ ID NO: 223; a light chain variable region comprising SEQ ID NO: 67 and a heavy chain variable region comprising SEQ ID NO: 224; a light chain variable region comprising SEQ ID NO: 68 and a heavy chain variable region comprising SEQ ID NO: 225; a light chain variable region comprising SEQ ID NO: 69 and a heavy chain variable region comprising SEQ ID NO: 226; a light chain variable region comprising SEQ ID NO: 70 and a heavy chain variable region comprising SEQ ID NO: 227; a light chain variable region comprising SEQ ID NO: 71 and a heavy chain variable region comprising SEQ ID NO: 228; a light chain variable region comprising SEQ ID NO: 72 and A heavy chain variable region comprising SEQ ID NO:229, a light chain variable region comprising SEQ ID NO:73 and a heavy chain variable region comprising SEQ ID NO:230, a light chain variable region comprising SEQ ID NO:74 and a heavy chain variable region comprising SEQ ID NO:231, a light chain variable region comprising SEQ ID NO:75 and a heavy chain variable region comprising SEQ ID NO:232, a light chain variable region comprising SEQ ID NO:76 and a heavy chain variable region comprising SEQ ID NO:233, a light chain variable region comprising SEQ ID NO:77 and a heavy chain variable region comprising SEQ ID NO:234, a light chain variable region comprising SEQ ID NO:78 and a heavy chain variable region comprising SEQ ID NO:235, a light chain variable region comprising SEQ ID NO:79 and SEQ ID NO:
236. a heavy chain variable region comprising a light chain variable region comprising SEQ ID NO: 80 and a heavy chain variable region comprising SEQ ID NO: 237, a light chain variable region comprising SEQ ID NO: 81 and a heavy chain variable region comprising SEQ ID NO: 238, a light chain variable region comprising SEQ ID NO: 82 and a heavy chain variable region comprising SEQ ID NO: 239, a light chain variable region comprising SEQ ID NO: 83 and a heavy chain variable region comprising SEQ ID NO: 240, a light chain variable region comprising SEQ ID NO: 84 and a heavy chain variable region comprising SEQ ID NO: 241, a light chain variable region comprising SEQ ID NO: 85 and a heavy chain variable region comprising SEQ ID NO: 242, a light chain variable region comprising SEQ ID NO: 86 and a heavy chain variable region comprising SEQ ID NO: 243,a light chain variable region comprising SEQ ID NO:87 and a heavy chain variable region comprising SEQ ID NO:244; a light chain variable region comprising SEQ ID NO:88 and a heavy chain variable region comprising SEQ ID NO:245; a light chain variable region comprising SEQ ID NO:89 and a heavy chain variable region comprising SEQ ID NO:246; a light chain variable region comprising SEQ ID NO:90 and a heavy chain variable region comprising SEQ ID NO:247; a light chain variable region comprising SEQ ID NO:91 and a heavy chain variable region comprising SEQ ID NO:248; a light chain variable region comprising SEQ ID NO:92 and a heavy chain variable region comprising SEQ ID NO:249; a light chain variable region comprising SEQ ID NO:93 and a heavy chain variable region comprising SEQ ID NO:250; a light chain variable region comprising SEQ ID NO:94 and a heavy chain variable region comprising SEQ ID NO:251; a light chain variable region comprising SEQ ID NO:95 and a heavy chain variable region comprising SEQ ID NO:252; a light chain variable region comprising SEQ ID NO:96 and a heavy chain variable region comprising SEQ ID NO:253; a light chain variable region comprising SEQ ID NO:97 and a heavy chain variable region comprising SEQ ID NO:254; a light chain variable region comprising SEQ ID NO:98 and a heavy chain variable region comprising SEQ ID NO:255; a light chain variable region comprising SEQ ID NO:99 and a heavy chain variable region comprising SEQ ID NO:256; a light chain variable region comprising SEQ ID NO:100 and a heavy chain variable region comprising SEQ ID NO:257; a light chain variable region comprising SEQ ID NO:1 and a heavy chain variable region comprising SEQ ID NO:258, a light chain variable region comprising SEQ ID NO:102 and a heavy chain variable region comprising SEQ ID NO:259, a light chain variable region comprising SEQ ID NO:103 and a heavy chain variable region comprising SEQ ID NO:260, a light chain variable region comprising SEQ ID NO:104 and a heavy chain variable region comprising SEQ ID NO:261, a light chain variable region comprising SEQ ID NO:105 and a heavy chain variable region comprising SEQ ID NO:262, a light chain variable region comprising SEQ ID NO:106 and a heavy chain variable region comprising SEQ ID NO:263, a light chain variable region comprising SEQ ID NO:107 and a heavy chain variable region comprising SEQ ID NO:264, a light chain variable region comprising SEQ ID NO:108 and a heavy chain variable region comprising SEQ ID NO:265, a light chain variable region comprising SEQ ID NO:109 and a heavy chain variable region comprising SEQ ID NO:266, a light chain variable region comprising SEQ ID NO:110 and a heavy chain variable region comprising SEQ ID NO:267, a light chain variable region comprising SEQ ID NO:111 and a heavy chain variable region comprising SEQ ID NO:268, a light chain variable region comprising SEQ ID NO:112 and a heavy chain variable region comprising SEQ ID NO:269, a light chain variable region comprising SEQ ID NO:113 and a heavy chain variable region comprising SEQ ID NO:270, a light chain variable region comprising SEQ ID NO:114 and a heavy chain variable region comprising SEQ ID NO:271,a light chain variable region comprising SEQ ID NO: 115 and a heavy chain variable region comprising SEQ ID NO: 272; a light chain variable region comprising SEQ ID NO: 116 and a heavy chain variable region comprising SEQ ID NO: 273; a light chain variable region comprising SEQ ID NO: 117 and a heavy chain variable region comprising SEQ ID NO: 274; a light chain variable region comprising SEQ ID NO: 118 and a heavy chain variable region comprising SEQ ID NO: 275; a light chain variable region comprising SEQ ID NO: 119 and a heavy chain variable region comprising SEQ ID NO: 276; a light chain variable region comprising SEQ ID NO: 120 and a heavy chain variable region comprising SEQ ID NO: 277; a light chain variable region comprising SEQ ID NO: 121 and a heavy chain variable region comprising SEQ ID NO: 278; a light chain variable region comprising SEQ ID NO: 122 and a heavy chain variable region comprising SEQ ID NO: 279; a light chain variable region comprising SEQ ID NO: 123 and a heavy chain variable region comprising SEQ ID NO: 280; a light chain variable region comprising SEQ ID NO: 124 and a heavy chain variable region comprising SEQ ID NO: 281; a light chain variable region comprising SEQ ID NO: 125 and a heavy chain variable region comprising SEQ ID NO: 282; a light chain variable region comprising SEQ ID NO: 126 and a heavy chain variable region comprising SEQ ID NO: 283; a light chain variable region comprising SEQ ID NO: 127 and a heavy chain variable region comprising SEQ ID NO: 284; a light chain variable region comprising SEQ ID NO: 128 and a heavy chain variable region comprising SEQ ID NO: 285; a light chain variable region comprising SEQ ID NO: 129 and a heavy chain variable region comprising SEQ ID NO: 286; a light chain variable region comprising SEQ ID NO: 130 and a heavy chain variable region comprising SEQ ID NO: 287; a light chain variable region comprising SEQ ID NO: 131 and a heavy chain variable region comprising SEQ ID NO: 288; a light chain variable region comprising SEQ ID NO: 132 and a heavy chain variable region comprising SEQ ID NO: 289; a light chain variable region comprising SEQ ID NO: 133 and a heavy chain variable region comprising SEQ ID NO: 290; a light chain variable region comprising SEQ ID NO: 134 and a heavy chain variable region comprising SEQ ID NO: 291; a light chain variable region comprising SEQ ID NO: 135 and a heavy chain variable region comprising SEQ ID NO: 292; a light chain variable region comprising SEQ ID NO: 136 and a heavy chain variable region comprising SEQ ID NO: 293; a light chain variable region comprising SEQ ID NO: 137 and a heavy chain variable region comprising SEQ ID NO: 294; a light chain variable region comprising SEQ ID NO: 138 and a heavy chain variable region comprising SEQ ID NO: 295; a light chain variable region comprising SEQ ID NO: 139 and a heavy chain variable region comprising SEQ ID NO: 296; a light chain variable region comprising SEQ ID NO: 140 and a heavy chain variable region comprising SEQ ID NO: 297; a light chain variable region comprising SEQ ID NO: 141 and a heavy chain variable region comprising SEQ ID NO: 298; a light chain variable region comprising SEQ ID NO: 142 and a heavy chain variable region comprising SEQ ID NO: 299;A light chain variable region comprising SEQ ID NO: 143 and a heavy chain variable region comprising SEQ ID NO: 300, a light chain variable region comprising SEQ ID NO: 144 and a heavy chain variable region comprising SEQ ID NO: 301, a light chain variable region comprising SEQ ID NO: 145 and a heavy chain variable region comprising SEQ ID NO: 302, a light chain variable region comprising SEQ ID NO: 146 and a heavy chain variable region comprising SEQ ID NO: 303, a light chain variable region comprising SEQ ID NO: 147 and a heavy chain variable region comprising SEQ ID NO: 304, a light chain variable region comprising SEQ ID NO: 148 and a heavy chain variable region comprising SEQ ID NO: 305, a light chain variable region comprising SEQ ID NO: 149, 22. The isolated antigen binding protein of claim 21 , comprising a combination of light chain variable regions and heavy chain variable regions selected from the group consisting of a light chain variable region comprising SEQ ID NO: 150 and a heavy chain variable region comprising SEQ ID NO: 307, a light chain variable region comprising SEQ ID NO: 151 and a heavy chain variable region comprising SEQ ID NO: 308, a light chain variable region comprising SEQ ID NO: 152 and a heavy chain variable region comprising SEQ ID NO: 309, a light chain variable region comprising SEQ ID NO: 153 and a heavy chain variable region comprising SEQ ID NO: 310, a light chain variable region comprising SEQ ID NO: 154 and a heavy chain variable region comprising SEQ ID NO: 311, a light chain variable region comprising SEQ ID NO: 155 and a heavy chain variable region comprising SEQ ID NO: 312, a light chain variable region comprising SEQ ID NO: 156 and a heavy chain variable region comprising SEQ ID NO: 313, and a light chain variable region comprising SEQ ID NO: 157 and a heavy chain variable region comprising SEQ ID NO:
314.
33. 22. The isolated antigen binding protein of claim 21, wherein the antigen binding protein is an antibody, and the antibody comprises a light chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472-628, and a heavy chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472-628.
34. The antigen binding protein is an antibody, the antibody comprising a light chain comprising SEQ ID NO:315 and a heavy chain comprising SEQ ID NO:472, a light chain comprising SEQ ID NO:316 and a heavy chain comprising SEQ ID NO:473, a light chain comprising SEQ ID NO:317 and a heavy chain comprising SEQ ID NO:474, a light chain comprising SEQ ID NO:318 and a heavy chain comprising SEQ ID NO:475, a light chain comprising SEQ ID NO:319 and a heavy chain comprising SEQ ID NO:476, a light chain comprising SEQ ID NO:320 and a heavy chain comprising SEQ ID NO:477, a light chain comprising SEQ ID NO:321 and a heavy chain comprising SEQ ID NO:478, a light chain comprising SEQ ID NO:322 and a heavy chain comprising SEQ ID NO:479, a light chain comprising SEQ ID NO:323 and a heavy chain comprising SEQ ID NO:479, and a heavy chain comprising SEQ ID NO:480, a light chain comprising SEQ ID NO:324 and a heavy chain comprising SEQ ID NO:481, a light chain comprising SEQ ID NO:325 and a heavy chain comprising SEQ ID NO:482, a light chain comprising SEQ ID NO:326 and a heavy chain comprising SEQ ID NO:483, a light chain comprising SEQ ID NO:327 and a heavy chain comprising SEQ ID NO:484, a light chain comprising SEQ ID NO:328 and a heavy chain comprising SEQ ID NO:485, a light chain comprising SEQ ID NO:329 and a heavy chain comprising SEQ ID NO:486, a light chain comprising SEQ ID NO:330 and a heavy chain comprising SEQ ID NO:487, a light chain comprising SEQ ID NO:331 and a heavy chain comprising SEQ ID NO:488, a light chain comprising SEQ ID NO:332 and a heavy chain comprising SEQ ID NO:489, A heavy chain comprising SEQ ID NO:489, a light chain comprising SEQ ID NO:333 and a heavy chain comprising SEQ ID NO:490, a light chain comprising SEQ ID NO:334 and a heavy chain comprising SEQ ID NO:491, a light chain comprising SEQ ID NO:335 and a heavy chain comprising SEQ ID NO:492, a light chain comprising SEQ ID NO:336 and a heavy chain comprising SEQ ID NO:493, a light chain comprising SEQ ID NO:337 and a heavy chain comprising SEQ ID NO:494, a light chain comprising SEQ ID NO:338 and a heavy chain comprising SEQ ID NO:495, a light chain comprising SEQ ID NO:339 and a heavy chain comprising SEQ ID NO:496, a light chain comprising SEQ ID NO:340 and a heavy chain comprising SEQ ID NO:497, a light chain comprising SEQ ID NO:341 and SEQ ID NO:49 a heavy chain comprising SEQ ID NO: 8, a light chain comprising SEQ ID NO: 342 and a heavy chain comprising SEQ ID NO: 499, a light chain comprising SEQ ID NO: 343 and a heavy chain comprising SEQ ID NO: 500, a light chain comprising SEQ ID NO: 344 and a heavy chain comprising SEQ ID NO: 501, a light chain comprising SEQ ID NO: 345 and a heavy chain comprising SEQ ID NO: 502, a light chain comprising SEQ ID NO: 346 and a heavy chain comprising SEQ ID NO: 503, a light chain comprising SEQ ID NO: 347 and a heavy chain comprising SEQ ID NO: 504, a light chain comprising SEQ ID NO: 348 and a heavy chain comprising SEQ ID NO: 505, a light chain comprising SEQ ID NO: 349 and a heavy chain comprising SEQ ID NO: 506, a light chain comprising SEQ ID NO: 350 and a heavy chain comprising SEQ ID NO: 507,a light chain comprising SEQ ID NO:351 and a heavy chain comprising SEQ ID NO:508, a light chain comprising SEQ ID NO:352 and a heavy chain comprising SEQ ID NO:509, a light chain comprising SEQ ID NO:353 and a heavy chain comprising SEQ ID NO:510, a light chain comprising SEQ ID NO:354 and a heavy chain comprising SEQ ID NO:511, a light chain comprising SEQ ID NO:355 and a heavy chain comprising SEQ ID NO:512, a light chain comprising SEQ ID NO:356 and a heavy chain comprising SEQ ID NO:513, a light chain comprising SEQ ID NO:357 and a heavy chain comprising SEQ ID NO:514, a light chain comprising SEQ ID NO:358 and a heavy chain comprising SEQ ID NO:515, a light chain comprising SEQ ID NO:359 and a heavy chain comprising SEQ ID NO:516, a light chain comprising SEQ ID NO:36 0 and a heavy chain comprising SEQ ID NO:517, a light chain comprising SEQ ID NO:361 and a heavy chain comprising SEQ ID NO:518, a light chain comprising SEQ ID NO:362 and a heavy chain comprising SEQ ID NO:519, a light chain comprising SEQ ID NO:363 and a heavy chain comprising SEQ ID NO:520, a light chain comprising SEQ ID NO:364 and a heavy chain comprising SEQ ID NO:521, a light chain comprising SEQ ID NO:365 and a heavy chain comprising SEQ ID NO:522, a light chain comprising SEQ ID NO:366 and a heavy chain comprising SEQ ID NO:523, a light chain comprising SEQ ID NO:367 and a heavy chain comprising SEQ ID NO:524, a light chain comprising SEQ ID NO:368 and a heavy chain comprising SEQ ID NO:525, a light chain comprising SEQ ID NO:369 and a heavy chain comprising SEQ ID NO: and a heavy chain comprising SEQ ID NO:526, a light chain comprising SEQ ID NO:370 and a heavy chain comprising SEQ ID NO:527, a light chain comprising SEQ ID NO:371 and a heavy chain comprising SEQ ID NO:528, a light chain comprising SEQ ID NO:372 and a heavy chain comprising SEQ ID NO:529, a light chain comprising SEQ ID NO:373 and a heavy chain comprising SEQ ID NO:530, a light chain comprising SEQ ID NO:374 and a heavy chain comprising SEQ ID NO:531, a light chain comprising SEQ ID NO:375 and a heavy chain comprising SEQ ID NO:532, a light chain comprising SEQ ID NO:376 and a heavy chain comprising SEQ ID NO:533, a light chain comprising SEQ ID NO:377 and a heavy chain comprising SEQ ID NO:534, a light chain comprising SEQ ID NO:378 and SEQ ID NO:53 5, a light chain comprising SEQ ID NO: 379 and a heavy chain comprising SEQ ID NO: 536, a light chain comprising SEQ ID NO: 380 and a heavy chain comprising SEQ ID NO: 537, a light chain comprising SEQ ID NO: 381 and a heavy chain comprising SEQ ID NO: 538, a light chain comprising SEQ ID NO: 382 and a heavy chain comprising SEQ ID NO: 539, a light chain comprising SEQ ID NO: 383 and a heavy chain comprising SEQ ID NO: 540, a light chain comprising SEQ ID NO: 384 and a heavy chain comprising SEQ ID NO: 541, a light chain comprising SEQ ID NO: 385 and a heavy chain comprising SEQ ID NO: 542, a light chain comprising SEQ ID NO: 386 and a heavy chain comprising SEQ ID NO: 543, a light chain comprising SEQ ID NO: 387 and a heavy chain comprising SEQ ID NO: 544,a light chain comprising SEQ ID NO:388 and a heavy chain comprising SEQ ID NO:545, a light chain comprising SEQ ID NO:389 and a heavy chain comprising SEQ ID NO:546, a light chain comprising SEQ ID NO:390 and a heavy chain comprising SEQ ID NO:547, a light chain comprising SEQ ID NO:391 and a heavy chain comprising SEQ ID NO:548, a light chain comprising SEQ ID NO:392 and a heavy chain comprising SEQ ID NO:549, a light chain comprising SEQ ID NO:393 and a heavy chain comprising SEQ ID NO:550, a light chain comprising SEQ ID NO:394 and a heavy chain comprising SEQ ID NO:551, a light chain comprising SEQ ID NO:395 and a heavy chain comprising SEQ ID NO:552, a light chain comprising SEQ ID NO:396 and a heavy chain comprising SEQ ID NO:553, a light chain comprising SEQ ID NO:397 and a heavy chain comprising SEQ ID NO:554, a light chain comprising SEQ ID NO: 7 and a heavy chain comprising SEQ ID NO: 554, a light chain comprising SEQ ID NO: 398 and a heavy chain comprising SEQ ID NO: 555, a light chain comprising SEQ ID NO: 399 and a heavy chain comprising SEQ ID NO: 556, a light chain comprising SEQ ID NO: 400 and a heavy chain comprising SEQ ID NO: 557, a light chain comprising SEQ ID NO: 401 and a heavy chain comprising SEQ ID NO: 558, a light chain comprising SEQ ID NO: 402 and a heavy chain comprising SEQ ID NO: 559, a light chain comprising SEQ ID NO: 403 and a heavy chain comprising SEQ ID NO: 560, a light chain comprising SEQ ID NO: 404 and a heavy chain comprising SEQ ID NO: 561, a light chain comprising SEQ ID NO: 405 and a heavy chain comprising SEQ ID NO: 562, a light chain comprising SEQ ID NO: 406 and a heavy chain comprising SEQ ID NO: 563, and a heavy chain comprising SEQ ID NO:563, a light chain comprising SEQ ID NO:407 and a heavy chain comprising SEQ ID NO:564, a light chain comprising SEQ ID NO:408 and a heavy chain comprising SEQ ID NO:565, a light chain comprising SEQ ID NO:409 and a heavy chain comprising SEQ ID NO:566, a light chain comprising SEQ ID NO:410 and a heavy chain comprising SEQ ID NO:567, a light chain comprising SEQ ID NO:411 and a heavy chain comprising SEQ ID NO:568, a light chain comprising SEQ ID NO:412 and a heavy chain comprising SEQ ID NO:569, a light chain comprising SEQ ID NO:413 and a heavy chain comprising SEQ ID NO:570, a light chain comprising SEQ ID NO:414 and a heavy chain comprising SEQ ID NO:571, a light chain comprising SEQ ID NO:415 and a heavy chain comprising SEQ ID NO:57 2, a light chain comprising SEQ ID NO:416 and a heavy chain comprising SEQ ID NO:573, a light chain comprising SEQ ID NO:417 and a heavy chain comprising SEQ ID NO:574, a light chain comprising SEQ ID NO:418 and a heavy chain comprising SEQ ID NO:575, a light chain comprising SEQ ID NO:419 and a heavy chain comprising SEQ ID NO:576, a light chain comprising SEQ ID NO:420 and a heavy chain comprising SEQ ID NO:577, a light chain comprising SEQ ID NO:421 and a heavy chain comprising SEQ ID NO:578, a light chain comprising SEQ ID NO:422 and a heavy chain comprising SEQ ID NO:579, a light chain comprising SEQ ID NO:423 and a heavy chain comprising SEQ ID NO:580, a light chain comprising SEQ ID NO:424 and a heavy chain comprising SEQ ID NO:581,a light chain comprising SEQ ID NO:425 and a heavy chain comprising SEQ ID NO:582, a light chain comprising SEQ ID NO:426 and a heavy chain comprising SEQ ID NO:583, a light chain comprising SEQ ID NO:427 and a heavy chain comprising SEQ ID NO:584, a light chain comprising SEQ ID NO:428 and a heavy chain comprising SEQ ID NO:585, a light chain comprising SEQ ID NO:429 and a heavy chain comprising SEQ ID NO:586, a light chain comprising SEQ ID NO:430 and a heavy chain comprising SEQ ID NO:587, a light chain comprising SEQ ID NO:431 and a heavy chain comprising SEQ ID NO:588, a light chain comprising SEQ ID NO:432 and a heavy chain comprising SEQ ID NO:589, a light chain comprising SEQ ID NO:433 and a heavy chain comprising SEQ ID NO:590, a light chain comprising SEQ ID NO:43 4 and a heavy chain comprising SEQ ID NO:591, a light chain comprising SEQ ID NO:435 and a heavy chain comprising SEQ ID NO:592, a light chain comprising SEQ ID NO:436 and a heavy chain comprising SEQ ID NO:593, a light chain comprising SEQ ID NO:437 and a heavy chain comprising SEQ ID NO:594, a light chain comprising SEQ ID NO:438 and a heavy chain comprising SEQ ID NO:595, a light chain comprising SEQ ID NO:439 and a heavy chain comprising SEQ ID NO:596, a light chain comprising SEQ ID NO:440 and a heavy chain comprising SEQ ID NO:597, a light chain comprising SEQ ID NO:441 and a heavy chain comprising SEQ ID NO:598, a light chain comprising SEQ ID NO:442 and a heavy chain comprising SEQ ID NO:599, a light chain comprising SEQ ID NO:443 and a heavy chain comprising SEQ ID NO:444 and a heavy chain comprising SEQ ID NO:600, a light chain comprising SEQ ID NO:444 and a heavy chain comprising SEQ ID NO:601, a light chain comprising SEQ ID NO:445 and a heavy chain comprising SEQ ID NO:602, a light chain comprising SEQ ID NO:446 and a heavy chain comprising SEQ ID NO:603, a light chain comprising SEQ ID NO:447 and a heavy chain comprising SEQ ID NO:604, a light chain comprising SEQ ID NO:448 and a heavy chain comprising SEQ ID NO:605, a light chain comprising SEQ ID NO:449 and a heavy chain comprising SEQ ID NO:606, a light chain comprising SEQ ID NO:450 and a heavy chain comprising SEQ ID NO:607, a light chain comprising SEQ ID NO:451 and a heavy chain comprising SEQ ID NO:608, a light chain comprising SEQ ID NO:452 and a heavy chain comprising SEQ ID NO:60 9, a light chain comprising SEQ ID NO:453 and a heavy chain comprising SEQ ID NO:610, a light chain comprising SEQ ID NO:454 and a heavy chain comprising SEQ ID NO:611, a light chain comprising SEQ ID NO:455 and a heavy chain comprising SEQ ID NO:612, a light chain comprising SEQ ID NO:456 and a heavy chain comprising SEQ ID NO:613, a light chain comprising SEQ ID NO:457 and a heavy chain comprising SEQ ID NO:614, a light chain comprising SEQ ID NO:458 and a heavy chain comprising SEQ ID NO:615, a light chain comprising SEQ ID NO:459 and a heavy chain comprising SEQ ID NO:616, a light chain comprising SEQ ID NO:460 and a heavy chain comprising SEQ ID NO:617, a light chain comprising SEQ ID NO:461 and a heavy chain comprising SEQ ID NO:618,22. The isolated antigen binding protein of claim 21, comprising a combination of light and heavy chains selected from the group consisting of a light chain comprising SEQ ID NO:462 and a heavy chain comprising SEQ ID NO:619, a light chain comprising SEQ ID NO:463 and a heavy chain comprising SEQ ID NO:620, a light chain comprising SEQ ID NO:464 and a heavy chain comprising SEQ ID NO:621, a light chain comprising SEQ ID NO:465 and a heavy chain comprising SEQ ID NO:622, a light chain comprising SEQ ID NO:466 and a heavy chain comprising SEQ ID NO:623, a light chain comprising SEQ ID NO:467 and a heavy chain comprising SEQ ID NO:624, a light chain comprising SEQ ID NO:468 and a heavy chain comprising SEQ ID NO:625, a light chain comprising SEQ ID NO:469 and a heavy chain comprising SEQ ID NO:626, a light chain comprising SEQ ID NO:470 and a heavy chain comprising SEQ ID NO:627, and a light chain comprising SEQ ID NO:471 and a heavy chain comprising SEQ ID NO:
628.
35. A nucleic acid molecule encoding the antibody or fragment thereof according to any one of claims 29 to 34.
36. 36. The nucleic acid molecule of claim 35, wherein the nucleic acid molecule is operably linked to a regulatory sequence.
37. A vector comprising the nucleic acid molecule of claim 36.
38. A host cell comprising the nucleic acid molecule of claim 37.
39. 39. An antibody or fragment thereof produced by the host cell of claim 38.
40. A method for preparing an antibody or fragment thereof according to any one of claims 29 to 34, comprising the step of preparing said antibody or fragment thereof from a host cell which secretes said antibody.
41. A pharmaceutical composition comprising at least one antibody or fragment thereof according to any one of claims 29 to 34 and a pharma- ceutically acceptable excipient.
42. An isolated antigen-binding protein which competes with an antibody or fragment of any one of claims 29 to 34 for binding to the extracellular portion of human GIPR.
43. A composition comprising a therapeutically effective amount of a GLP-1 receptor agonist and a therapeutically effective amount of a GIPR antagonist that specifically binds to a protein having an amino acid sequence that has at least 90% amino acid sequence identity to the amino acid sequence of GIPR.
44. 44. The composition of claim 43, wherein the molar ratio of the GLP-1 receptor agonist to the GIPR antagonist is about 1:1 to 1:110, about 1:1 to 1:100, about 1:1 to 1:75, about 1:1 to 1:50, about 1:1 to 1:25, about 1:1 to 1:10, about 1:1 to 1:5, and about 1:
1.
45. 44. The composition of claim 43, wherein the molar ratio of the GIPR antagonist to the GLP-1 receptor agonist is about 1:1 to 1:110, about 1:1 to 1:100, about 1:1 to 1:75, about 1:1 to 1:50, about 1:1 to 1:25, about 1:1 to 1:10, and about 1:1 to 1:
5.
46. 44. The composition of claim 43, wherein the GLP-1 receptor agonist and the GIPR antagonist are used in combination in a therapeutically effective molar ratio of about 1:1.5 to 1:150, preferably 1:2 to 1:
50.
47. 44. The composition of claim 43, wherein the GLP-1 receptor agonist and the GIPR antagonist are present in a dosage that is at least about 1.1 to 1.4 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or 10 times less than the dosage required to treat the condition and / or disease with each compound alone.
48. 44. The composition of claim 43, wherein the GLP-1 receptor agonist is GLP-1(7-37) or a GLP-1(7-37) analogue.
49. 49. The composition of claim 48, wherein the GLP-1 receptor agonist is selected from the group consisting of exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, and taspoglutide.
50. The GLP-1 receptor agonist is selected from the group consisting of GLP-1(7-37) (SEQ ID NO: 3184), GLP-1(7-36)-NH 2 (SEQ ID NO: 3185), liraglutide, albiglutide, taspoglutide, dulaglutide, semaglutide, LY2428757, desamino-His 7 , Arg 26 , Lys 34 (N ε -(γ-Glu(N-α-hexadecanoyl)))-GLP-1(7-37) (core peptide disclosed as SEQ ID NO:3222), desamino-His 7 , Arg 26 , Lys 34 (N ε -octanoyl)-GLP-1(7-37) (SEQ ID NO: 3223), Arg 26,34 , Lys 38 (N ε -(ω-carboxypentadecanoyl)-GLP-1(7-38) (SEQ ID NO: 3224), Arg 26,34 , Lys 36 (N ε -(γ-Glu(N-α-hexadecanoyl)))-GLP-1(7-36) (core peptide disclosed as SEQ ID NO: 3225), Aib 8,35 , Arg 26,34 , Phe 31 -GLP-1(7-36)) (SEQ ID NO: 3186), HXaa 8 EGTFTSDVSSYLEXaa 22 Xaa 23 AAKEFIXaa 30 WLXaa 33 Xaa 34 G Xaa 36 Xaa 37 (Xaa 8 is A, V, or G; 22 is G, K, or E; 23 is Q or K, and Xaa 30 is A or E, and Xaa 33 is V or K, and Xaa 34 is K, N, or R; 36 is R or G, and Xaa 37 is G, H, P, or absent) (SEQ ID NO: 3187), Arg 34 -GLP-1(7-37) (SEQ ID NO: 3188), Glu 30 -GLP-1(7-37) (SEQ ID NO: 3189), Lys 22 -GLP-1(7-37) (SEQ ID NO: 3190), Gly 8,36 , Glu 22 -GLP-1(7-37) (SEQ ID NO: 3191), Val 8 , Glu 22 , Gly 36 -GLP-1(7-37) (SEQ ID NO: 3192), Gly 8,36 , Glu 22 , Lys 33 , Asn 34 -GLP-1(7-37) (SEQ ID NO: 3193), Val 8 , Glu 22 , Lys 33 , Asn 34 , Gly 36 -GLP-1(7-37) (SEQ ID NO: 3194), Gly 8,36 , Glu 22 , Pro 37 -GLP-1(7-37) (SEQ ID NO: 3195), Val 8 , Glu 22 , Gly 36 Pro 37 -GLP-1(7-37) (SEQ ID NO: 3196), Gly 8,36 , Glu 22 , Lys 33 , Asn 34 , Pro 37 -GLP-1(7-37) (SEQ ID NO: 3197), Val 8 , Glu 22 , Lys 33 , Asn 34 , Gly 36 , Pro 37 -GLP-1(7-37) (SEQ ID NO: 3198), Gly 8,36 , Glu 22 -GLP-1(7-36) (SEQ ID NO: 3199), Val 8 , Glu 22 , Gly 36 -GLP-1(7-36) (SEQ ID NO: 3200), Val 8 , Glu 22 , Asn 34 , Gly 36 -GLP-1(7-36) (SEQ ID NO: 3201), and Gly 8,36 , Glu 22 , Asn 34 - GLP-1(7-36) (SEQ ID NO: 3202).
51. 44. The composition of claim 43, wherein the human GIPR has a sequence comprising a sequence selected from the group consisting of SEQ ID NO: 3141, SEQ ID NO: 3143, and SEQ ID NO: 3145.
52. The composition of claim 43, wherein the GIPR antagonist is an antigen binding protein.
53. 53. The composition of claim 52, wherein the antigen binding protein is a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, a chimeric antibody, a multispecific antibody, or an antibody fragment thereof.
54. 54. The composition of claim 53, wherein the antibody fragment is a Fab fragment, a Fab' fragment, or an F(ab')2 fragment.
55. 54. The composition of claim 53, wherein the antigen binding protein is a human antibody.
56. 54. The composition of claim 53, wherein the antigen binding protein is a monoclonal antibody.
57. 54. The composition of claim 53, wherein the antigen binding protein is of the IgG1, IgG2, IgG3, or IgG4 type.
58. 58. The composition of claim 57, wherein the antigen binding protein is of the IgG1 or IgG2 type.
59. 54. The composition of claim 53, wherein the antigen binding protein is coupled to a labeling group.
60. 54. The composition of claim 53, wherein the antigen binding protein inhibits binding of GIP to the extracellular portion of human GIPR.
61. 54. The composition of claim 53, wherein said antigen binding protein is an antibody or fragment thereof, said antibody comprising CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, and CDRH3, wherein said CDRL1 comprises a sequence selected from the group consisting of SEQ ID NOs: 629-785, said CDRL2 comprises a sequence selected from the group consisting of SEQ ID NOs: 786-942, said CDRL3 comprises a sequence selected from the group consisting of SEQ ID NOs: 943-1099, said CDRH1 comprises a sequence selected from the group consisting of SEQ ID NOs: 1100-1256, said CDRH2 comprises a sequence selected from the group consisting of SEQ ID NOs: 1257-1413, and said CDRH3 comprises a sequence selected from the group consisting of SEQ ID NOs: 1414-1570.
62. the antigen binding protein is an antibody or fragment thereof, the antibody comprising a CDRL1, a CDRL2, a CDRL3, a CDRH1, a CDRH2, and a CDRH3, each of which is SEQ ID NO:629, SEQ ID NO:786, SEQ ID NO:943, SEQ ID NO:1100, SEQ ID NO:1257, and SEQ ID NO:1414; SEQ ID NO:630, SEQ ID NO:787, SEQ ID NO:944, SEQ ID NO:1101, SEQ ID NO:1258, and SEQ ID NO:1415; SEQ ID NO:631, SEQ ID NO:788, SEQ ID NO:945, SEQ ID NO:1102, SEQ ID NO:1259, and SEQ ID NO:1416; SEQ ID NO:632, SEQ ID NO:789, SEQ ID NO:946, SEQ ID NO:1103, SEQ ID NO:1260, and SEQ ID NO:1417; SEQ ID NO:633, SEQ ID NO:790, SEQ ID NO:947, SEQ ID NO:1104, SEQ ID NO:1261, and SEQ ID NO:1418; SEQ ID NO:634, SEQ ID NO:791, SEQ ID NO:948, SEQ ID NO:1105, SEQ ID NO:1262, and SEQ ID NO:1419; SEQ ID NO:635, SEQ ID NO:792, SEQ ID NO:949, SEQ ID NO:1106, SEQ ID NO:1263, and SEQ ID NO:1420; SEQ ID NO:636, SEQ ID NO:793, SEQ ID NO:950, SEQ ID NO:1107, SEQ ID NO:1264, and SEQ ID NO:1421; SEQ ID NO:637, SEQ ID NO:794, SEQ ID NO:951, SEQ ID NO:1108, SEQ ID NO:1265, and SEQ ID NO:1422; SEQ ID NO:638, SEQ ID NO:795, SEQ ID NO:952, SEQ ID NO:1109, SEQ ID NO:1266, and SEQ ID NO:1423; SEQ ID NO:639, SEQ ID NO:796, SEQ ID NO:953, SEQ ID NO:1110, SEQ ID NO:1267, and SEQ ID NO:1424; SEQ ID NO:640, SEQ ID NO:797, SEQ ID NO:954, SEQ ID NO:1111, SEQ ID NO:1268, and SEQ ID NO:1425; SEQ ID NO:641, SEQ ID NO:798, SEQ ID NO:955, SEQ ID NO:1112, SEQ ID NO:1269, and SEQ ID NO:1426; SEQ ID NO:642, SEQ ID NO:799, SEQ ID NO:956, SEQ ID NO:1113, SEQ ID NO:1270, and SEQ ID NO:1427; SEQ ID NO:643, SEQ ID NO:800, SEQ ID NO:957, SEQ ID NO:1114, SEQ ID NO:1271, and SEQ ID NO:1428; SEQ ID NO:644, SEQ ID NO:801, SEQ ID NO:958, SEQ ID NO:1115, SEQ ID NO:1272, and SEQ ID NO:1429; SEQ ID NO:645, SEQ ID NO:802, SEQ ID NO:959, SEQ ID NO:1116, SEQ ID NO:1273, and SEQ ID NO:1430; SEQ ID NO:646, SEQ ID NO:803, SEQ ID NO:960, SEQ ID NO:1117, SEQ ID NO:1274, and SEQ ID NO:1431; SEQ ID NO:647, SEQ ID NO:804, SEQ ID NO:961, SEQ ID NO:1118, SEQ ID NO:1275, and SEQ ID NO:1432; SEQ ID NO:648, SEQ ID NO:805, SEQ ID NO:962, SEQ ID NO:1119, SEQ ID NO:1276, and SEQ ID NO:1433; SEQ ID NO:649, SEQ ID NO:806, SEQ ID NO:963, SEQ ID NO:1120, SEQ ID NO:1277, and SEQ ID NO:1434; SEQ ID NO:650, SEQ ID NO:807, SEQ ID NO:964, SEQ ID NO:1121, SEQ ID NO:1278, and SEQ ID NO:1435; SEQ ID NO:651, SEQ ID NO:808, SEQ ID NO:965, SEQ ID NO:1122, SEQ ID NO:1279, and SEQ ID NO:1436; SEQ ID NO:652, SEQ ID NO:809, SEQ ID NO:966, SEQ ID NO:1123, SEQ ID NO:1280, and SEQ ID NO:1437; SEQ ID NO:653, SEQ ID NO:810, SEQ ID NO:967, SEQ ID NO:1124, SEQ ID NO:1281, and SEQ ID NO:1438; SEQ ID NO:654, SEQ ID NO:811, SEQ ID NO:968, SEQ ID NO:1125, SEQ ID NO:1282, and SEQ ID NO:1439; SEQ ID NO:655, SEQ ID NO:812, SEQ ID NO:969, SEQ ID NO:1126, SEQ ID NO:1283, and SEQ ID NO:1440; SEQ ID NO:656, SEQ ID NO:813, SEQ ID NO:970, SEQ ID NO:1127, SEQ ID NO:1284, and SEQ ID NO:1441; SEQ ID NO:657, SEQ ID NO:814, SEQ ID NO:971, SEQ ID NO:1128, SEQ ID NO:1285, and SEQ ID NO:1442; SEQ ID NO:658, SEQ ID NO:815, SEQ ID NO:972, SEQ ID NO:1129, SEQ ID NO:1286, and SEQ ID NO:1443; SEQ ID NO:659, SEQ ID NO:816, SEQ ID NO:973, SEQ ID NO:1130, SEQ ID NO:1287, and SEQ ID NO:1444; SEQ ID NO:660, SEQ ID NO:817, SEQ ID NO:974, SEQ ID NO:1131, SEQ ID NO:1288, and SEQ ID NO:1445; SEQ ID NO:661, SEQ ID NO:818, SEQ ID NO:975, SEQ ID NO:1132, SEQ ID NO:1289, and SEQ ID NO:1446; SEQ ID NO:662, SEQ ID NO:819, SEQ ID NO:976, SEQ ID NO:1133, SEQ ID NO:1290, and SEQ ID NO:1447; SEQ ID NO:663, SEQ ID NO:820, SEQ ID NO:977, SEQ ID NO:1134, SEQ ID NO:1291, and SEQ ID NO:1448; SEQ ID NO:664, SEQ ID NO:821, SEQ ID NO:978, SEQ ID NO:1135, SEQ ID NO:1292, and SEQ ID NO:1449; SEQ ID NO:665, SEQ ID NO:822, SEQ ID NO:979, SEQ ID NO:1136, SEQ ID NO:1293, and SEQ ID NO:1450; SEQ ID NO:666, SEQ ID NO:823, SEQ ID NO:980, SEQ ID NO:1137, SEQ ID NO:1294, and SEQ ID NO:1451; SEQ ID NO:667, SEQ ID NO:824, SEQ ID NO:981, SEQ ID NO:1138, SEQ ID NO:1295, and SEQ ID NO:1452; SEQ ID NO:668, SEQ ID NO:825, SEQ ID NO:982, SEQ ID NO:1139, SEQ ID NO:1296, and SEQ ID NO:1453; SEQ ID NO:669, SEQ ID NO:826, SEQ ID NO:983, SEQ ID NO:1140, SEQ ID NO:1297, and SEQ ID NO:1454; SEQ ID NO:670, SEQ ID NO:827, SEQ ID NO:984, SEQ ID NO:1141, SEQ ID NO:1298, and SEQ ID NO:1455; SEQ ID NO:671, SEQ ID NO:828, SEQ ID NO:985, SEQ ID NO:1142, SEQ ID NO:1299, and SEQ ID NO:1456; SEQ ID NO:672, SEQ ID NO:829, SEQ ID NO:986, SEQ ID NO:1143, SEQ ID NO:1300, and SEQ ID NO:1457; SEQ ID NO:673, SEQ ID NO:830, SEQ ID NO:987, SEQ ID NO:1144, SEQ ID NO:1301, and SEQ ID NO:1458; SEQ ID NO:674, SEQ ID NO:831, SEQ ID NO:988, SEQ ID NO:1145, SEQ ID NO:1302, and SEQ ID NO:1459; SEQ ID NO:675, SEQ ID NO:832, SEQ ID NO:989, SEQ ID NO:1146, SEQ ID NO:1303, and SEQ ID NO:1460; SEQ ID NO:676, SEQ ID NO:833, SEQ ID NO:990, SEQ ID NO:1147, SEQ ID NO:1304, and SEQ ID NO:1461; SEQ ID NO:677, SEQ ID NO:834, SEQ ID NO:991, SEQ ID NO:1148, SEQ ID NO:1305, and SEQ ID NO:1462; SEQ ID NO:678, SEQ ID NO:835, SEQ ID NO:992, SEQ ID NO:1149, SEQ ID NO:1306, and SEQ ID NO:1463; SEQ ID NO:679, SEQ ID NO:836, SEQ ID NO:993, SEQ ID NO:1150, SEQ ID NO:1307, and SEQ ID NO:1464; SEQ ID NO:680, SEQ ID NO:837, SEQ ID NO:994, SEQ ID NO:1151, SEQ ID NO:1308, and SEQ ID NO:1465; SEQ ID NO:681, SEQ ID NO:838, SEQ ID NO:995, SEQ ID NO:1152, SEQ ID NO:1309, and SEQ ID NO:1466; SEQ ID NO:682, SEQ ID NO:839, SEQ ID NO:996, SEQ ID NO:1153, SEQ ID NO:1310, and SEQ ID NO:1467; SEQ ID NO:683, SEQ ID NO:840, SEQ ID NO:997, SEQ ID NO:1154, SEQ ID NO:1311, and SEQ ID NO:1468; SEQ ID NO:684, SEQ ID NO:841, SEQ ID NO:998, SEQ ID NO:1155, SEQ ID NO:1312, and SEQ ID NO:1469; SEQ ID NO:685, SEQ ID NO:842, SEQ ID NO:999, SEQ ID NO:1156, SEQ ID NO:1313, and SEQ ID NO:1470; SEQ ID NO:686, SEQ ID NO:843, SEQ ID NO:1000, SEQ ID NO:1157, SEQ ID NO:1314, and SEQ ID NO:1471; SEQ ID NO:687, SEQ ID NO:844, SEQ ID NO:1001, SEQ ID NO:1158, SEQ ID NO:1315, and SEQ ID NO:1472; SEQ ID NO:688, SEQ ID NO:845, SEQ ID NO:1002, SEQ ID NO:1159, SEQ ID NO:1316, and SEQ ID NO:1473; SEQ ID NO:689, SEQ ID NO:846, SEQ ID NO:1003, SEQ ID NO:1160, SEQ ID NO:1317, and SEQ ID NO:1474; SEQ ID NO:690, SEQ ID NO:847, SEQ ID NO:1004, SEQ ID NO:1161, SEQ ID NO:1318, and SEQ ID NO:1475; SEQ ID NO:691, SEQ ID NO:848, SEQ ID NO:1005, SEQ ID NO:1162, SEQ ID NO:1319, and SEQ ID NO:1476; SEQ ID NO:692, SEQ ID NO:849, SEQ ID NO:1006, SEQ ID NO:1163, SEQ ID NO:1320, and SEQ ID NO:1477; SEQ ID NO:693, SEQ ID NO:850, SEQ ID NO:1007, SEQ ID NO:1164, SEQ ID NO:1321, and SEQ ID NO:1478; SEQ ID NO:694, SEQ ID NO:851, SEQ ID NO:1008, SEQ ID NO:1165, SEQ ID NO:1322, and SEQ ID NO:1479; SEQ ID NO:695, SEQ ID NO:852, SEQ ID NO:1009, SEQ ID NO:1166, SEQ ID NO:1323, and SEQ ID NO:1480; SEQ ID NO:696, SEQ ID NO:853, SEQ ID NO:1010, SEQ ID NO:1167, SEQ ID NO:1324, and SEQ ID NO:1481; SEQ ID NO:697, SEQ ID NO:854, SEQ ID NO:1011, SEQ ID NO:1168, SEQ ID NO:1325, and SEQ ID NO:1482; SEQ ID NO:698, SEQ ID NO:855, SEQ ID NO:1012, SEQ ID NO:1169, SEQ ID NO:1326, and SEQ ID NO:1483; SEQ ID NO:699, SEQ ID NO:856, SEQ ID NO:1013, SEQ ID NO:1170, SEQ ID NO:1327, and SEQ ID NO:1484; SEQ ID NO:700, SEQ ID NO:857, SEQ ID NO:1014, SEQ ID NO:1171, SEQ ID NO:1328, and SEQ ID NO:1485; SEQ ID NO:701, SEQ ID NO:858, SEQ ID NO:1015, SEQ ID NO:1172, SEQ ID NO:1329, and SEQ ID NO:1486; SEQ ID NO:702, SEQ ID NO:859, SEQ ID NO:1016, SEQ ID NO:1173, SEQ ID NO:1330, and SEQ ID NO:1487; SEQ ID NO:703, SEQ ID NO:860, SEQ ID NO:1017, SEQ ID NO:1174, SEQ ID NO:1331, and SEQ ID NO:1488; SEQ ID NO:704, SEQ ID NO:861, SEQ ID NO:1018, SEQ ID NO:1175, SEQ ID NO:1332, and SEQ ID NO:1489; SEQ ID NO:705, SEQ ID NO:862, SEQ ID NO:1019, SEQ ID NO:1176, SEQ ID NO:1333, and SEQ ID NO:1490; SEQ ID NO:706, SEQ ID NO:863, SEQ ID NO:1020, SEQ ID NO:1177, SEQ ID NO:1334, and SEQ ID NO:1491; SEQ ID NO:707, SEQ ID NO:864, SEQ ID NO:1021, SEQ ID NO:1178, SEQ ID NO:1335, and SEQ ID NO:1492; SEQ ID NO:708, SEQ ID NO:865, SEQ ID NO:1022, SEQ ID NO:1179, SEQ ID NO:1336, and SEQ ID NO:1493; SEQ ID NO:709, SEQ ID NO:866, SEQ ID NO:1023, SEQ ID NO:1180, SEQ ID NO:1337, and SEQ ID NO:1494; SEQ ID NO:710, SEQ ID NO:867, SEQ ID NO:1024, SEQ ID NO:1181, SEQ ID NO:1338, and SEQ ID NO:1495; SEQ ID NO:711, SEQ ID NO:868, SEQ ID NO:1025, SEQ ID NO:1182, SEQ ID NO:1339, and SEQ ID NO:1496; SEQ ID NO:712, SEQ ID NO:869, SEQ ID NO:1026, SEQ ID NO:1183, SEQ ID NO:1340, and SEQ ID NO:1497; SEQ ID NO:713, SEQ ID NO:870, SEQ ID NO:1027, SEQ ID NO:1184, SEQ ID NO:1341, and SEQ ID NO:1498; SEQ ID NO:714, SEQ ID NO:871, SEQ ID NO:1028, SEQ ID NO:1185, SEQ ID NO:1342, and SEQ ID NO:1499; SEQ ID NO:715, SEQ ID NO:872, SEQ ID NO:1029, SEQ ID NO:1186, SEQ ID NO:1343, and SEQ ID NO:1500; SEQ ID NO:716, SEQ ID NO:873, SEQ ID NO:1030, SEQ ID NO:1187, SEQ ID NO:1344, and SEQ ID NO:1501; SEQ ID NO:717, SEQ ID NO:874, SEQ ID NO:1031, SEQ ID NO:1188, SEQ ID NO:1345, and SEQ ID NO:1502; SEQ ID NO:718, SEQ ID NO:875, SEQ ID NO:1032, SEQ ID NO:1189, SEQ ID NO:1346, and SEQ ID NO:1503; SEQ ID NO:719, SEQ ID NO:876, SEQ ID NO:1033, SEQ ID NO:1190, SEQ ID NO:1347, and SEQ ID NO:1504; SEQ ID NO:720, SEQ ID NO:877, SEQ ID NO:1034, SEQ ID NO:1191, SEQ ID NO:1348, and SEQ ID NO:1505; SEQ ID NO:721, SEQ ID NO:878, SEQ ID NO:1035, SEQ ID NO:1192, SEQ ID NO:1349, and SEQ ID NO:1506; SEQ ID NO:722, SEQ ID NO:879, SEQ ID NO:1036, SEQ ID NO:1193, SEQ ID NO:1350, and SEQ ID NO:1507; SEQ ID NO:723, SEQ ID NO:880, SEQ ID NO:1037, SEQ ID NO:1194, SEQ ID NO:1351, and SEQ ID NO:1508; SEQ ID NO:724, SEQ ID NO:881, SEQ ID NO:1038, SEQ ID NO:1195, SEQ ID NO:1352, and SEQ ID NO:1509; SEQ ID NO:725, SEQ ID NO:882, SEQ ID NO:1039, SEQ ID NO:1196, SEQ ID NO:1353, and SEQ ID NO:1510; SEQ ID NO:726, SEQ ID NO:883, SEQ ID NO:1040, SEQ ID NO:1197, SEQ ID NO:1354, and SEQ ID NO:1511; SEQ ID NO:727, SEQ ID NO:884, SEQ ID NO:1041, SEQ ID NO:1198, SEQ ID NO:1355, and SEQ ID NO:1512; SEQ ID NO:728, SEQ ID NO:885, SEQ ID NO:1042, SEQ ID NO:1199, SEQ ID NO:1356, and SEQ ID NO:1513; SEQ ID NO:729, SEQ ID NO:886, SEQ ID NO:1043, SEQ ID NO:1200, SEQ ID NO:1357, and SEQ ID NO:1514; SEQ ID NO:730, SEQ ID NO:887, SEQ ID NO:1044, SEQ ID NO:1201, SEQ ID NO:1358, and SEQ ID NO:1515; SEQ ID NO:731, SEQ ID NO:888, SEQ ID NO:1045, SEQ ID NO:1202, SEQ ID NO:1359, and SEQ ID NO:1516; SEQ ID NO:732, SEQ ID NO:889, SEQ ID NO:1046, SEQ ID NO:1203, SEQ ID NO:1360, and SEQ ID NO:1517; SEQ ID NO:733, SEQ ID NO:890, SEQ ID NO:1047, SEQ ID NO:1204, SEQ ID NO:1361, and SEQ ID NO:1518; SEQ ID NO:734, SEQ ID NO:891, SEQ ID NO:1048, SEQ ID NO:1205, SEQ ID NO:1362, and SEQ ID NO:1519; SEQ ID NO:735, SEQ ID NO:892, SEQ ID NO:1049, SEQ ID NO:1206, SEQ ID NO:1363, and SEQ ID NO:1520; SEQ ID NO:736, SEQ ID NO:893, SEQ ID NO:1050, SEQ ID NO:1207, SEQ ID NO:1364, and SEQ ID NO:1521; SEQ ID NO:737, SEQ ID NO:894, SEQ ID NO:1051, SEQ ID NO:1208, SEQ ID NO:1365, and SEQ ID NO:1522; SEQ ID NO:738, SEQ ID NO:895, SEQ ID NO:1052, SEQ ID NO:1209, SEQ ID NO:1366, and SEQ ID NO:1523; SEQ ID NO:739, SEQ ID NO:896, SEQ ID NO:1053, SEQ ID NO:1210, SEQ ID NO:1367, and SEQ ID NO:1524; SEQ ID NO:740, SEQ ID NO:897, SEQ ID NO:1054, SEQ ID NO:1211, SEQ ID NO:1368, and SEQ ID NO:1525; SEQ ID NO:741, SEQ ID NO:898, SEQ ID NO:1055, SEQ ID NO:1212, SEQ ID NO:1369, and SEQ ID NO:1526; SEQ ID NO:742, SEQ ID NO:899, SEQ ID NO:1056, SEQ ID NO:1213, SEQ ID NO:1370, and SEQ ID NO:1527; SEQ ID NO:743, SEQ ID NO:900, SEQ ID NO:1057, SEQ ID NO:1214, SEQ ID NO:1371, and SEQ ID NO:1528; SEQ ID NO:744, SEQ ID NO:901, SEQ ID NO:1058, SEQ ID NO:1215, SEQ ID NO:1372, and SEQ ID NO:1529; SEQ ID NO:745, SEQ ID NO:902, SEQ ID NO:1059, SEQ ID NO:1216, SEQ ID NO:1373, and SEQ ID NO:1530; SEQ ID NO:746, SEQ ID NO:903, SEQ ID NO:1060, SEQ ID NO:1217, SEQ ID NO:1374, and SEQ ID NO:1531; SEQ ID NO:747, SEQ ID NO:904, SEQ ID NO:1061, SEQ ID NO:1218, SEQ ID NO:1375, and SEQ ID NO:1532; SEQ ID NO:748, SEQ ID NO:905, SEQ ID NO:1062, SEQ ID NO:1219, SEQ ID NO:1376, and SEQ ID NO:1533; SEQ ID NO:749, SEQ ID NO:906, SEQ ID NO:1063, SEQ ID NO:1220, SEQ ID NO:1377, and SEQ ID NO:1534; SEQ ID NO:750, SEQ ID NO:907, SEQ ID NO:1064, SEQ ID NO:1221, SEQ ID NO:1378, and SEQ ID NO:1535; SEQ ID NO:751, SEQ ID NO:908, SEQ ID NO:1065, SEQ ID NO:1222, SEQ ID NO:1379, and SEQ ID NO:1536; SEQ ID NO:752, SEQ ID NO:909, SEQ ID NO:1066, SEQ ID NO:1223, SEQ ID NO:1380, and SEQ ID NO:1537; SEQ ID NO:753, SEQ ID NO:910, SEQ ID NO:1067, SEQ ID NO:1224, SEQ ID NO:1381, and SEQ ID NO:1538; SEQ ID NO:754, SEQ ID NO:911, SEQ ID NO:1068, SEQ ID NO:1225, SEQ ID NO:1382, and SEQ ID NO:1539; SEQ ID NO:755, SEQ ID NO:912, SEQ ID NO:1069, SEQ ID NO:1226, SEQ ID NO:1383, and SEQ ID NO:1540; SEQ ID NO:756, SEQ ID NO:913, SEQ ID NO:1070, SEQ ID NO:1227, SEQ ID NO:1384, and SEQ ID NO:1541; SEQ ID NO:757, SEQ ID NO:914, SEQ ID NO:1071, SEQ ID NO:1228, SEQ ID NO:1385, and SEQ ID NO:1542; SEQ ID NO:758, SEQ ID NO:915, SEQ ID NO:1072, SEQ ID NO:1229, SEQ ID NO:1386, and SEQ ID NO:1543; SEQ ID NO:759, SEQ ID NO:916, SEQ ID NO:1073, SEQ ID NO:1230, SEQ ID NO:1387, and SEQ ID NO:1544; SEQ ID NO:760, SEQ ID NO:917, SEQ ID NO:1074, SEQ ID NO:1231, SEQ ID NO:1388, and SEQ ID NO:1545; SEQ ID NO:761, SEQ ID NO:918, SEQ ID NO:1075, SEQ ID NO:1232, SEQ ID NO:1389, and SEQ ID NO:1546; SEQ ID NO:762, SEQ ID NO:919, SEQ ID NO:1076, SEQ ID NO:1233, SEQ ID NO:1390, and SEQ ID NO:1547; SEQ ID NO:763, SEQ ID NO:920, SEQ ID NO:1077, SEQ ID NO:1234, SEQ ID NO:1391, and SEQ ID NO:1548; SEQ ID NO:764, SEQ ID NO:921, SEQ ID NO:1078, SEQ ID NO:1235, SEQ ID NO:1392, and SEQ ID NO:1549; SEQ ID NO:765, SEQ ID NO:922, SEQ ID NO:1079, SEQ ID NO:1236, SEQ ID NO:1393, and SEQ ID NO:1550; SEQ ID NO:766, SEQ ID NO:923, SEQ ID NO:1080, SEQ ID NO:1237, SEQ ID NO:1394, and SEQ ID NO:1551; SEQ ID NO:767, SEQ ID NO:924, SEQ ID NO:1081, SEQ ID NO:1238, SEQ ID NO:1395, and SEQ ID NO:1552; SEQ ID NO:768, SEQ ID NO:925, SEQ ID NO:1082, SEQ ID NO:1239, SEQ ID NO:1396, and SEQ ID NO:1553; SEQ ID NO:769, SEQ ID NO:926, SEQ ID NO:1083, SEQ ID NO:1240, SEQ ID NO:1397, and SEQ ID NO:1554; SEQ ID NO:770, SEQ ID NO:927, SEQ ID NO:1084, SEQ ID NO:1241, SEQ ID NO:1398, and SEQ ID NO:1555; SEQ ID NO:771, SEQ ID NO:928, SEQ ID NO:1085, SEQ ID NO:1242, SEQ ID NO:1399, and SEQ ID NO:1556; SEQ ID NO:772, SEQ ID NO:929, SEQ ID NO:1086, SEQ ID NO:1243, SEQ ID NO:1400, and SEQ ID NO:1557; SEQ ID NO:773, SEQ ID NO:930, SEQ ID NO:1087, SEQ ID NO:1244, SEQ ID NO:1401, and SEQ ID NO:1558; SEQ ID NO:774, SEQ ID NO:931, SEQ ID NO:1088, SEQ ID NO:1245, SEQ ID NO:1402, and SEQ ID NO:1559; SEQ ID NO:775, SEQ ID NO:932, SEQ ID NO:1089, SEQ ID NO:1246, SEQ ID NO:1403, and SEQ ID NO:1560; SEQ ID NO:776, SEQ ID NO:933, SEQ ID NO:1090, SEQ ID NO:1247, SEQ ID NO:1404, and SEQ ID NO:1561; SEQ ID NO:777, SEQ ID NO:934, SEQ ID NO:1091, SEQ ID NO:1248, SEQ ID NO:1405, and SEQ ID NO:1562; SEQ ID NO:778, SEQ ID NO:935, SEQ ID NO:1092, SEQ ID NO:1249, SEQ ID NO:1406, and SEQ ID NO:1563; SEQ ID NO:779, SEQ ID NO:936, SEQ ID NO:1093, SEQ ID NO:1250, SEQ ID NO:1407, and SEQ ID NO:1564; SEQ ID NO:780, SEQ ID NO:937, SEQ ID NO:1094, SEQ ID NO:1251, SEQ ID NO:1408, and SEQ ID NO:1565; SEQ ID NO:781, SEQ ID NO:938, SEQ ID NO:1095, SEQ ID NO:1252, SEQ ID NO:1409, and SEQ ID NO:1566; SEQ ID NO:782, SEQ ID NO:939, SEQ ID NO:1096, SEQ ID NO:1253, SEQ ID NO:1410, and SEQ ID NO:1567; SEQ ID NO:783, SEQ ID NO:940, SEQ ID NO:1097, SEQ ID NO:1254, SEQ ID NO:1411, and SEQ ID NO:1568; SEQ ID NO:784, SEQ ID NO:941, SEQ ID NO:1098, SEQ ID NO:1255, SEQ ID NO:1412, and SEQ ID NO:1569; and SEQ ID NO:785, SEQ ID NO:942, SEQ ID NO:1099, SEQ ID NO:1256, SEQ ID NO:1413, and SEQ ID NO:1570; 54. The composition of claim 53, comprising a sequence selected from the group consisting of:
63. 54. The composition of claim 53, wherein the antigen binding protein is an antibody or fragment thereof, and the antibody or fragment thereof comprises a light chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 1-157 and a heavy chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 158-314.
64. The antigen binding protein is an antibody or a fragment thereof, the antibody or fragment thereof being capable of binding to a light chain variable region comprising SEQ ID NO: 1 and a heavy chain variable region comprising SEQ ID NO: 158, a light chain variable region comprising SEQ ID NO: 2 and a heavy chain variable region comprising SEQ ID NO: 159, a light chain variable region comprising SEQ ID NO: 3 and a heavy chain variable region comprising SEQ ID NO: 160, a light chain variable region comprising SEQ ID NO: 4 and a heavy chain variable region comprising SEQ ID NO: 161, a light chain variable region comprising SEQ ID NO: 5 and a heavy chain variable region comprising SEQ ID NO: 162, a light chain variable region comprising SEQ ID NO: 6 and a heavy chain variable region comprising SEQ ID NO: 163, a light chain variable region comprising SEQ ID NO: 7 and a heavy chain variable region comprising SEQ ID NO: 74, a light chain variable region comprising SEQ ID NO: 8 and a heavy chain variable region comprising SEQ ID NO: 165; a light chain variable region comprising SEQ ID NO: 9 and a heavy chain variable region comprising SEQ ID NO: 166; a light chain variable region comprising SEQ ID NO: 10 and a heavy chain variable region comprising SEQ ID NO: 167; a light chain variable region comprising SEQ ID NO: 11 and a heavy chain variable region comprising SEQ ID NO: 168; a light chain variable region comprising SEQ ID NO: 12 and a heavy chain variable region comprising SEQ ID NO: 169; a light chain variable region comprising SEQ ID NO: 13 and a heavy chain variable region comprising SEQ ID NO: 170; a light chain variable region comprising SEQ ID NO: 14 and a heavy chain variable region comprising SEQ ID NO: 161; a heavy chain variable region comprising SEQ ID NO: 171; a light chain variable region comprising SEQ ID NO: 15 and a heavy chain variable region comprising SEQ ID NO: 172; a light chain variable region comprising SEQ ID NO: 16 and a heavy chain variable region comprising SEQ ID NO: 173; a light chain variable region comprising SEQ ID NO: 17 and a heavy chain variable region comprising SEQ ID NO: 174; a light chain variable region comprising SEQ ID NO: 18 and a heavy chain variable region comprising SEQ ID NO: 175; a light chain variable region comprising SEQ ID NO: 19 and a heavy chain variable region comprising SEQ ID NO: 176; a light chain variable region comprising SEQ ID NO: 20 and a heavy chain variable region comprising SEQ ID NO: 177; a light chain variable region comprising SEQ ID NO: 21 and a heavy chain variable region comprising SEQ ID NO:
178. a heavy chain variable region comprising SEQ ID NO: 179; a light chain variable region comprising SEQ ID NO: 23 and a heavy chain variable region comprising SEQ ID NO: 180; a light chain variable region comprising SEQ ID NO: 24 and a heavy chain variable region comprising SEQ ID NO: 181; a light chain variable region comprising SEQ ID NO: 25 and a heavy chain variable region comprising SEQ ID NO: 182; a light chain variable region comprising SEQ ID NO: 26 and a heavy chain variable region comprising SEQ ID NO: 183; a light chain variable region comprising SEQ ID NO: 27 and a heavy chain variable region comprising SEQ ID NO: 184; a light chain variable region comprising SEQ ID NO: 28 and a heavy chain variable region comprising SEQ ID NO: 185;A light chain variable region comprising SEQ ID NO:29 and a heavy chain variable region comprising SEQ ID NO:186, a light chain variable region comprising SEQ ID NO:30 and a heavy chain variable region comprising SEQ ID NO:187, a light chain variable region comprising SEQ ID NO:31 and a heavy chain variable region comprising SEQ ID NO:188, a light chain variable region comprising SEQ ID NO:32 and a heavy chain variable region comprising SEQ ID NO:189, a light chain variable region comprising SEQ ID NO:33 and a heavy chain variable region comprising SEQ ID NO:190, a light chain variable region comprising SEQ ID NO:34 and a heavy chain variable region comprising SEQ ID NO:191, a light chain variable region comprising SEQ ID NO:35 and a heavy chain variable region comprising SEQ ID NO:192, a light chain variable region comprising SEQ ID NO:36 and a heavy chain variable region comprising SEQ ID NO:37, a light chain variable region comprising SEQ ID NO: 37 and a heavy chain variable region comprising SEQ ID NO: 194; a light chain variable region comprising SEQ ID NO: 38 and a heavy chain variable region comprising SEQ ID NO: 195; a light chain variable region comprising SEQ ID NO: 39 and a heavy chain variable region comprising SEQ ID NO: 196; a light chain variable region comprising SEQ ID NO: 40 and a heavy chain variable region comprising SEQ ID NO: 197; a light chain variable region comprising SEQ ID NO: 41 and a heavy chain variable region comprising SEQ ID NO: 198; a light chain variable region comprising SEQ ID NO: 42 and a heavy chain variable region comprising SEQ ID NO: 199; a light chain variable region comprising SEQ ID NO: 43 and A heavy chain variable region comprising SEQ ID NO:200, a light chain variable region comprising SEQ ID NO:44 and a heavy chain variable region comprising SEQ ID NO:201, a light chain variable region comprising SEQ ID NO:45 and a heavy chain variable region comprising SEQ ID NO:202, a light chain variable region comprising SEQ ID NO:46 and a heavy chain variable region comprising SEQ ID NO:203, a light chain variable region comprising SEQ ID NO:47 and a heavy chain variable region comprising SEQ ID NO:204, a light chain variable region comprising SEQ ID NO:48 and a heavy chain variable region comprising SEQ ID NO:205, a light chain variable region comprising SEQ ID NO:49 and a heavy chain variable region comprising SEQ ID NO:206, a light chain variable region comprising SEQ ID NO:50 and SEQ ID NO:
207. a heavy chain variable region comprising a light chain variable region comprising SEQ ID NO:51 and a heavy chain variable region comprising SEQ ID NO:208, a light chain variable region comprising SEQ ID NO:52 and a heavy chain variable region comprising SEQ ID NO:209, a light chain variable region comprising SEQ ID NO:53 and a heavy chain variable region comprising SEQ ID NO:210, a light chain variable region comprising SEQ ID NO:54 and a heavy chain variable region comprising SEQ ID NO:211, a light chain variable region comprising SEQ ID NO:55 and a heavy chain variable region comprising SEQ ID NO:212, a light chain variable region comprising SEQ ID NO:56 and a heavy chain variable region comprising SEQ ID NO:213, a light chain variable region comprising SEQ ID NO:57 and a heavy chain variable region comprising SEQ ID NO:214,A light chain variable region comprising SEQ ID NO:58 and a heavy chain variable region comprising SEQ ID NO:215, a light chain variable region comprising SEQ ID NO:59 and a heavy chain variable region comprising SEQ ID NO:216, a light chain variable region comprising SEQ ID NO:60 and a heavy chain variable region comprising SEQ ID NO:217, a light chain variable region comprising SEQ ID NO:61 and a heavy chain variable region comprising SEQ ID NO:218, a light chain variable region comprising SEQ ID NO:62 and a heavy chain variable region comprising SEQ ID NO:219, a light chain variable region comprising SEQ ID NO:63 and a heavy chain variable region comprising SEQ ID NO:220, a light chain variable region comprising SEQ ID NO:64 and a heavy chain variable region comprising SEQ ID NO:221, a light chain variable region comprising SEQ ID NO:65 and a heavy chain variable region comprising SEQ ID NO:66, a light chain variable region comprising SEQ ID NO: 66 and a heavy chain variable region comprising SEQ ID NO: 223; a light chain variable region comprising SEQ ID NO: 67 and a heavy chain variable region comprising SEQ ID NO: 224; a light chain variable region comprising SEQ ID NO: 68 and a heavy chain variable region comprising SEQ ID NO: 225; a light chain variable region comprising SEQ ID NO: 69 and a heavy chain variable region comprising SEQ ID NO: 226; a light chain variable region comprising SEQ ID NO: 70 and a heavy chain variable region comprising SEQ ID NO: 227; a light chain variable region comprising SEQ ID NO: 71 and a heavy chain variable region comprising SEQ ID NO: 228; a light chain variable region comprising SEQ ID NO: 72 and A heavy chain variable region comprising SEQ ID NO:229, a light chain variable region comprising SEQ ID NO:73 and a heavy chain variable region comprising SEQ ID NO:230, a light chain variable region comprising SEQ ID NO:74 and a heavy chain variable region comprising SEQ ID NO:231, a light chain variable region comprising SEQ ID NO:75 and a heavy chain variable region comprising SEQ ID NO:232, a light chain variable region comprising SEQ ID NO:76 and a heavy chain variable region comprising SEQ ID NO:233, a light chain variable region comprising SEQ ID NO:77 and a heavy chain variable region comprising SEQ ID NO:234, a light chain variable region comprising SEQ ID NO:78 and a heavy chain variable region comprising SEQ ID NO:235, a light chain variable region comprising SEQ ID NO:79 and SEQ ID NO:
236. a heavy chain variable region comprising a light chain variable region comprising SEQ ID NO: 80 and a heavy chain variable region comprising SEQ ID NO: 237, a light chain variable region comprising SEQ ID NO: 81 and a heavy chain variable region comprising SEQ ID NO: 238, a light chain variable region comprising SEQ ID NO: 82 and a heavy chain variable region comprising SEQ ID NO: 239, a light chain variable region comprising SEQ ID NO: 83 and a heavy chain variable region comprising SEQ ID NO: 240, a light chain variable region comprising SEQ ID NO: 84 and a heavy chain variable region comprising SEQ ID NO: 241, a light chain variable region comprising SEQ ID NO: 85 and a heavy chain variable region comprising SEQ ID NO: 242, a light chain variable region comprising SEQ ID NO: 86 and a heavy chain variable region comprising SEQ ID NO: 243,a light chain variable region comprising SEQ ID NO:87 and a heavy chain variable region comprising SEQ ID NO:244; a light chain variable region comprising SEQ ID NO:88 and a heavy chain variable region comprising SEQ ID NO:245; a light chain variable region comprising SEQ ID NO:89 and a heavy chain variable region comprising SEQ ID NO:246; a light chain variable region comprising SEQ ID NO:90 and a heavy chain variable region comprising SEQ ID NO:247; a light chain variable region comprising SEQ ID NO:91 and a heavy chain variable region comprising SEQ ID NO:248; a light chain variable region comprising SEQ ID NO:92 and a heavy chain variable region comprising SEQ ID NO:249; a light chain variable region comprising SEQ ID NO:93 and a heavy chain variable region comprising SEQ ID NO:250; a light chain variable region comprising SEQ ID NO:94 and a heavy chain variable region comprising SEQ ID NO:251; a light chain variable region comprising SEQ ID NO:95 and a heavy chain variable region comprising SEQ ID NO:252; a light chain variable region comprising SEQ ID NO:96 and a heavy chain variable region comprising SEQ ID NO:253; a light chain variable region comprising SEQ ID NO:97 and a heavy chain variable region comprising SEQ ID NO:254; a light chain variable region comprising SEQ ID NO:98 and a heavy chain variable region comprising SEQ ID NO:255; a light chain variable region comprising SEQ ID NO:99 and a heavy chain variable region comprising SEQ ID NO:256; a light chain variable region comprising SEQ ID NO:100 and a heavy chain variable region comprising SEQ ID NO:257; a light chain variable region comprising SEQ ID NO:1 and a heavy chain variable region comprising SEQ ID NO:258, a light chain variable region comprising SEQ ID NO:102 and a heavy chain variable region comprising SEQ ID NO:259, a light chain variable region comprising SEQ ID NO:103 and a heavy chain variable region comprising SEQ ID NO:260, a light chain variable region comprising SEQ ID NO:104 and a heavy chain variable region comprising SEQ ID NO:261, a light chain variable region comprising SEQ ID NO:105 and a heavy chain variable region comprising SEQ ID NO:262, a light chain variable region comprising SEQ ID NO:106 and a heavy chain variable region comprising SEQ ID NO:263, a light chain variable region comprising SEQ ID NO:107 and a heavy chain variable region comprising SEQ ID NO:264, a light chain variable region comprising SEQ ID NO:108 and a heavy chain variable region comprising SEQ ID NO:265, a light chain variable region comprising SEQ ID NO:109 and a heavy chain variable region comprising SEQ ID NO:266, a light chain variable region comprising SEQ ID NO:110 and a heavy chain variable region comprising SEQ ID NO:267, a light chain variable region comprising SEQ ID NO:111 and a heavy chain variable region comprising SEQ ID NO:268, a light chain variable region comprising SEQ ID NO:112 and a heavy chain variable region comprising SEQ ID NO:269, a light chain variable region comprising SEQ ID NO:113 and a heavy chain variable region comprising SEQ ID NO:270, a light chain variable region comprising SEQ ID NO:114 and a heavy chain variable region comprising SEQ ID NO:271,a light chain variable region comprising SEQ ID NO: 115 and a heavy chain variable region comprising SEQ ID NO: 272; a light chain variable region comprising SEQ ID NO: 116 and a heavy chain variable region comprising SEQ ID NO: 273; a light chain variable region comprising SEQ ID NO: 117 and a heavy chain variable region comprising SEQ ID NO: 274; a light chain variable region comprising SEQ ID NO: 118 and a heavy chain variable region comprising SEQ ID NO: 275; a light chain variable region comprising SEQ ID NO: 119 and a heavy chain variable region comprising SEQ ID NO: 276; a light chain variable region comprising SEQ ID NO: 120 and a heavy chain variable region comprising SEQ ID NO: 277; a light chain variable region comprising SEQ ID NO: 121 and a heavy chain variable region comprising SEQ ID NO: 278; a light chain variable region comprising SEQ ID NO: 122 and a heavy chain variable region comprising SEQ ID NO: 279; a light chain variable region comprising SEQ ID NO: 123 and a heavy chain variable region comprising SEQ ID NO: 280; a light chain variable region comprising SEQ ID NO: 124 and a heavy chain variable region comprising SEQ ID NO: 281; a light chain variable region comprising SEQ ID NO: 125 and a heavy chain variable region comprising SEQ ID NO: 282; a light chain variable region comprising SEQ ID NO: 126 and a heavy chain variable region comprising SEQ ID NO: 283; a light chain variable region comprising SEQ ID NO: 127 and a heavy chain variable region comprising SEQ ID NO: 284; a light chain variable region comprising SEQ ID NO: 128 and a heavy chain variable region comprising SEQ ID NO: 285; a light chain variable region comprising SEQ ID NO: 129 and a heavy chain variable region comprising SEQ ID NO: 286; a light chain variable region comprising SEQ ID NO: 130 and a heavy chain variable region comprising SEQ ID NO: 287; a light chain variable region comprising SEQ ID NO: 131 and a heavy chain variable region comprising SEQ ID NO: 288; a light chain variable region comprising SEQ ID NO: 132 and a heavy chain variable region comprising SEQ ID NO: 289; a light chain variable region comprising SEQ ID NO: 133 and a heavy chain variable region comprising SEQ ID NO: 290; a light chain variable region comprising SEQ ID NO: 134 and a heavy chain variable region comprising SEQ ID NO: 291; a light chain variable region comprising SEQ ID NO: 135 and a heavy chain variable region comprising SEQ ID NO: 292; a light chain variable region comprising SEQ ID NO: 136 and a heavy chain variable region comprising SEQ ID NO: 293; a light chain variable region comprising SEQ ID NO: 137 and a heavy chain variable region comprising SEQ ID NO: 294; a light chain variable region comprising SEQ ID NO: 138 and a heavy chain variable region comprising SEQ ID NO: 295; a light chain variable region comprising SEQ ID NO: 139 and a heavy chain variable region comprising SEQ ID NO: 296; a light chain variable region comprising SEQ ID NO: 140 and a heavy chain variable region comprising SEQ ID NO: 297; a light chain variable region comprising SEQ ID NO: 141 and a heavy chain variable region comprising SEQ ID NO: 298; a light chain variable region comprising SEQ ID NO: 142 and a heavy chain variable region comprising SEQ ID NO: 299;A light chain variable region comprising SEQ ID NO: 143 and a heavy chain variable region comprising SEQ ID NO: 300, a light chain variable region comprising SEQ ID NO: 144 and a heavy chain variable region comprising SEQ ID NO: 301, a light chain variable region comprising SEQ ID NO: 145 and a heavy chain variable region comprising SEQ ID NO: 302, a light chain variable region comprising SEQ ID NO: 146 and a heavy chain variable region comprising SEQ ID NO: 303, a light chain variable region comprising SEQ ID NO: 147 and a heavy chain variable region comprising SEQ ID NO: 304, a light chain variable region comprising SEQ ID NO: 148 and a heavy chain variable region comprising SEQ ID NO: 305, a light chain variable region comprising SEQ ID NO: 149, 54. The composition of claim 53, comprising a combination of light chain variable regions and heavy chain variable regions selected from the group consisting of a light chain variable region comprising SEQ ID NO: 150 and a heavy chain variable region comprising SEQ ID NO: 307, a light chain variable region comprising SEQ ID NO: 151 and a heavy chain variable region comprising SEQ ID NO: 308, a light chain variable region comprising SEQ ID NO: 152 and a heavy chain variable region comprising SEQ ID NO: 309, a light chain variable region comprising SEQ ID NO: 153 and a heavy chain variable region comprising SEQ ID NO: 310, a light chain variable region comprising SEQ ID NO: 154 and a heavy chain variable region comprising SEQ ID NO: 311, a light chain variable region comprising SEQ ID NO: 155 and a heavy chain variable region comprising SEQ ID NO: 312, a light chain variable region comprising SEQ ID NO: 156 and a heavy chain variable region comprising SEQ ID NO: 313, and a light chain variable region comprising SEQ ID NO: 157 and a heavy chain variable region comprising SEQ ID NO:
314.
65. 54. The composition of claim 53, wherein the antigen binding protein is an antibody, and the antibody comprises a light chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472-628, and a heavy chain comprising a sequence selected from the group consisting of SEQ ID NOs: 472-628.
66. The antigen binding protein is an antibody, the antibody comprising a light chain comprising SEQ ID NO:315 and a heavy chain comprising SEQ ID NO:472, a light chain comprising SEQ ID NO:316 and a heavy chain comprising SEQ ID NO:473, a light chain comprising SEQ ID NO:317 and a heavy chain comprising SEQ ID NO:474, a light chain comprising SEQ ID NO:318 and a heavy chain comprising SEQ ID NO:475, a light chain comprising SEQ ID NO:319 and a heavy chain comprising SEQ ID NO:476, a light chain comprising SEQ ID NO:320 and a heavy chain comprising SEQ ID NO:477, a light chain comprising SEQ ID NO:321 and a heavy chain comprising SEQ ID NO:478, a light chain comprising SEQ ID NO:322 and a heavy chain comprising SEQ ID NO:479, a light chain comprising SEQ ID NO:323 and a heavy chain comprising SEQ ID NO:479, and a heavy chain comprising SEQ ID NO:480, a light chain comprising SEQ ID NO:324 and a heavy chain comprising SEQ ID NO:481, a light chain comprising SEQ ID NO:325 and a heavy chain comprising SEQ ID NO:482, a light chain comprising SEQ ID NO:326 and a heavy chain comprising SEQ ID NO:483, a light chain comprising SEQ ID NO:327 and a heavy chain comprising SEQ ID NO:484, a light chain comprising SEQ ID NO:328 and a heavy chain comprising SEQ ID NO:485, a light chain comprising SEQ ID NO:329 and a heavy chain comprising SEQ ID NO:486, a light chain comprising SEQ ID NO:330 and a heavy chain comprising SEQ ID NO:487, a light chain comprising SEQ ID NO:331 and a heavy chain comprising SEQ ID NO:488, a light chain comprising SEQ ID NO:332 and a heavy chain comprising SEQ ID NO:489, A heavy chain comprising SEQ ID NO:489, a light chain comprising SEQ ID NO:333 and a heavy chain comprising SEQ ID NO:490, a light chain comprising SEQ ID NO:334 and a heavy chain comprising SEQ ID NO:491, a light chain comprising SEQ ID NO:335 and a heavy chain comprising SEQ ID NO:492, a light chain comprising SEQ ID NO:336 and a heavy chain comprising SEQ ID NO:493, a light chain comprising SEQ ID NO:337 and a heavy chain comprising SEQ ID NO:494, a light chain comprising SEQ ID NO:338 and a heavy chain comprising SEQ ID NO:495, a light chain comprising SEQ ID NO:339 and a heavy chain comprising SEQ ID NO:496, a light chain comprising SEQ ID NO:340 and a heavy chain comprising SEQ ID NO:497, a light chain comprising SEQ ID NO:341 and SEQ ID NO:49 a heavy chain comprising SEQ ID NO: 8, a light chain comprising SEQ ID NO: 342 and a heavy chain comprising SEQ ID NO: 499, a light chain comprising SEQ ID NO: 343 and a heavy chain comprising SEQ ID NO: 500, a light chain comprising SEQ ID NO: 344 and a heavy chain comprising SEQ ID NO: 501, a light chain comprising SEQ ID NO: 345 and a heavy chain comprising SEQ ID NO: 502, a light chain comprising SEQ ID NO: 346 and a heavy chain comprising SEQ ID NO: 503, a light chain comprising SEQ ID NO: 347 and a heavy chain comprising SEQ ID NO: 504, a light chain comprising SEQ ID NO: 348 and a heavy chain comprising SEQ ID NO: 505, a light chain comprising SEQ ID NO: 349 and a heavy chain comprising SEQ ID NO: 506, a light chain comprising SEQ ID NO: 350 and a heavy chain comprising SEQ ID NO: 507,a light chain comprising SEQ ID NO:351 and a heavy chain comprising SEQ ID NO:508, a light chain comprising SEQ ID NO:352 and a heavy chain comprising SEQ ID NO:509, a light chain comprising SEQ ID NO:353 and a heavy chain comprising SEQ ID NO:510, a light chain comprising SEQ ID NO:354 and a heavy chain comprising SEQ ID NO:511, a light chain comprising SEQ ID NO:355 and a heavy chain comprising SEQ ID NO:512, a light chain comprising SEQ ID NO:356 and a heavy chain comprising SEQ ID NO:513, a light chain comprising SEQ ID NO:357 and a heavy chain comprising SEQ ID NO:514, a light chain comprising SEQ ID NO:358 and a heavy chain comprising SEQ ID NO:515, a light chain comprising SEQ ID NO:359 and a heavy chain comprising SEQ ID NO:516, a light chain comprising SEQ ID NO:36 0 and a heavy chain comprising SEQ ID NO:517, a light chain comprising SEQ ID NO:361 and a heavy chain comprising SEQ ID NO:518, a light chain comprising SEQ ID NO:362 and a heavy chain comprising SEQ ID NO:519, a light chain comprising SEQ ID NO:363 and a heavy chain comprising SEQ ID NO:520, a light chain comprising SEQ ID NO:364 and a heavy chain comprising SEQ ID NO:521, a light chain comprising SEQ ID NO:365 and a heavy chain comprising SEQ ID NO:522, a light chain comprising SEQ ID NO:366 and a heavy chain comprising SEQ ID NO:523, a light chain comprising SEQ ID NO:367 and a heavy chain comprising SEQ ID NO:524, a light chain comprising SEQ ID NO:368 and a heavy chain comprising SEQ ID NO:525, a light chain comprising SEQ ID NO:369 and a heavy chain comprising SEQ ID NO: and a heavy chain comprising SEQ ID NO:526, a light chain comprising SEQ ID NO:370 and a heavy chain comprising SEQ ID NO:527, a light chain comprising SEQ ID NO:371 and a heavy chain comprising SEQ ID NO:528, a light chain comprising SEQ ID NO:372 and a heavy chain comprising SEQ ID NO:529, a light chain comprising SEQ ID NO:373 and a heavy chain comprising SEQ ID NO:530, a light chain comprising SEQ ID NO:374 and a heavy chain comprising SEQ ID NO:531, a light chain comprising SEQ ID NO:375 and a heavy chain comprising SEQ ID NO:532, a light chain comprising SEQ ID NO:376 and a heavy chain comprising SEQ ID NO:533, a light chain comprising SEQ ID NO:377 and a heavy chain comprising SEQ ID NO:534, a light chain comprising SEQ ID NO:378 and SEQ ID NO:53 5, a light chain comprising SEQ ID NO: 379 and a heavy chain comprising SEQ ID NO: 536, a light chain comprising SEQ ID NO: 380 and a heavy chain comprising SEQ ID NO: 537, a light chain comprising SEQ ID NO: 381 and a heavy chain comprising SEQ ID NO: 538, a light chain comprising SEQ ID NO: 382 and a heavy chain comprising SEQ ID NO: 539, a light chain comprising SEQ ID NO: 383 and a heavy chain comprising SEQ ID NO: 540, a light chain comprising SEQ ID NO: 384 and a heavy chain comprising SEQ ID NO: 541, a light chain comprising SEQ ID NO: 385 and a heavy chain comprising SEQ ID NO: 542, a light chain comprising SEQ ID NO: 386 and a heavy chain comprising SEQ ID NO: 543, a light chain comprising SEQ ID NO: 387 and a heavy chain comprising SEQ ID NO: 544,a light chain comprising SEQ ID NO:388 and a heavy chain comprising SEQ ID NO:545, a light chain comprising SEQ ID NO:389 and a heavy chain comprising SEQ ID NO:546, a light chain comprising SEQ ID NO:390 and a heavy chain comprising SEQ ID NO:547, a light chain comprising SEQ ID NO:391 and a heavy chain comprising SEQ ID NO:548, a light chain comprising SEQ ID NO:392 and a heavy chain comprising SEQ ID NO:549, a light chain comprising SEQ ID NO:393 and a heavy chain comprising SEQ ID NO:550, a light chain comprising SEQ ID NO:394 and a heavy chain comprising SEQ ID NO:551, a light chain comprising SEQ ID NO:395 and a heavy chain comprising SEQ ID NO:552, a light chain comprising SEQ ID NO:396 and a heavy chain comprising SEQ ID NO:553, a light chain comprising SEQ ID NO:397 and a heavy chain comprising SEQ ID NO:554, a light chain comprising SEQ ID NO: 7 and a heavy chain comprising SEQ ID NO: 554, a light chain comprising SEQ ID NO: 398 and a heavy chain comprising SEQ ID NO: 555, a light chain comprising SEQ ID NO: 399 and a heavy chain comprising SEQ ID NO: 556, a light chain comprising SEQ ID NO: 400 and a heavy chain comprising SEQ ID NO: 557, a light chain comprising SEQ ID NO: 401 and a heavy chain comprising SEQ ID NO: 558, a light chain comprising SEQ ID NO: 402 and a heavy chain comprising SEQ ID NO: 559, a light chain comprising SEQ ID NO: 403 and a heavy chain comprising SEQ ID NO: 560, a light chain comprising SEQ ID NO: 404 and a heavy chain comprising SEQ ID NO: 561, a light chain comprising SEQ ID NO: 405 and a heavy chain comprising SEQ ID NO: 562, a light chain comprising SEQ ID NO: 406 and a heavy chain comprising SEQ ID NO: 563, and a heavy chain comprising SEQ ID NO:563, a light chain comprising SEQ ID NO:407 and a heavy chain comprising SEQ ID NO:564, a light chain comprising SEQ ID NO:408 and a heavy chain comprising SEQ ID NO:565, a light chain comprising SEQ ID NO:409 and a heavy chain comprising SEQ ID NO:566, a light chain comprising SEQ ID NO:410 and a heavy chain comprising SEQ ID NO:567, a light chain comprising SEQ ID NO:411 and a heavy chain comprising SEQ ID NO:568, a light chain comprising SEQ ID NO:412 and a heavy chain comprising SEQ ID NO:569, a light chain comprising SEQ ID NO:413 and a heavy chain comprising SEQ ID NO:570, a light chain comprising SEQ ID NO:414 and a heavy chain comprising SEQ ID NO:571, a light chain comprising SEQ ID NO:415 and a heavy chain comprising SEQ ID NO:57 2, a light chain comprising SEQ ID NO:416 and a heavy chain comprising SEQ ID NO:573, a light chain comprising SEQ ID NO:417 and a heavy chain comprising SEQ ID NO:574, a light chain comprising SEQ ID NO:418 and a heavy chain comprising SEQ ID NO:575, a light chain comprising SEQ ID NO:419 and a heavy chain comprising SEQ ID NO:576, a light chain comprising SEQ ID NO:420 and a heavy chain comprising SEQ ID NO:577, a light chain comprising SEQ ID NO:421 and a heavy chain comprising SEQ ID NO:578, a light chain comprising SEQ ID NO:422 and a heavy chain comprising SEQ ID NO:579, a light chain comprising SEQ ID NO:423 and a heavy chain comprising SEQ ID NO:580, a light chain comprising SEQ ID NO:424 and a heavy chain comprising SEQ ID NO:581,a light chain comprising SEQ ID NO:425 and a heavy chain comprising SEQ ID NO:582, a light chain comprising SEQ ID NO:426 and a heavy chain comprising SEQ ID NO:583, a light chain comprising SEQ ID NO:427 and a heavy chain comprising SEQ ID NO:584, a light chain comprising SEQ ID NO:428 and a heavy chain comprising SEQ ID NO:585, a light chain comprising SEQ ID NO:429 and a heavy chain comprising SEQ ID NO:586, a light chain comprising SEQ ID NO:430 and a heavy chain comprising SEQ ID NO:587, a light chain comprising SEQ ID NO:431 and a heavy chain comprising SEQ ID NO:588, a light chain comprising SEQ ID NO:432 and a heavy chain comprising SEQ ID NO:589, a light chain comprising SEQ ID NO:433 and a heavy chain comprising SEQ ID NO:590, a light chain comprising SEQ ID NO:43 4 and a heavy chain comprising SEQ ID NO:591, a light chain comprising SEQ ID NO:435 and a heavy chain comprising SEQ ID NO:592, a light chain comprising SEQ ID NO:436 and a heavy chain comprising SEQ ID NO:593, a light chain comprising SEQ ID NO:437 and a heavy chain comprising SEQ ID NO:594, a light chain comprising SEQ ID NO:438 and a heavy chain comprising SEQ ID NO:595, a light chain comprising SEQ ID NO:439 and a heavy chain comprising SEQ ID NO:596, a light chain comprising SEQ ID NO:440 and a heavy chain comprising SEQ ID NO:597, a light chain comprising SEQ ID NO:441 and a heavy chain comprising SEQ ID NO:598, a light chain comprising SEQ ID NO:442 and a heavy chain comprising SEQ ID NO:599, a light chain comprising SEQ ID NO:443 and a heavy chain comprising SEQ ID NO:444 and a heavy chain comprising SEQ ID NO:600, a light chain comprising SEQ ID NO:444 and a heavy chain comprising SEQ ID NO:601, a light chain comprising SEQ ID NO:445 and a heavy chain comprising SEQ ID NO:602, a light chain comprising SEQ ID NO:446 and a heavy chain comprising SEQ ID NO:603, a light chain comprising SEQ ID NO:447 and a heavy chain comprising SEQ ID NO:604, a light chain comprising SEQ ID NO:448 and a heavy chain comprising SEQ ID NO:605, a light chain comprising SEQ ID NO:449 and a heavy chain comprising SEQ ID NO:606, a light chain comprising SEQ ID NO:450 and a heavy chain comprising SEQ ID NO:607, a light chain comprising SEQ ID NO:451 and a heavy chain comprising SEQ ID NO:608, a light chain comprising SEQ ID NO:452 and a heavy chain comprising SEQ ID NO:60 9, a light chain comprising SEQ ID NO:453 and a heavy chain comprising SEQ ID NO:610, a light chain comprising SEQ ID NO:454 and a heavy chain comprising SEQ ID NO:611, a light chain comprising SEQ ID NO:455 and a heavy chain comprising SEQ ID NO:612, a light chain comprising SEQ ID NO:456 and a heavy chain comprising SEQ ID NO:613, a light chain comprising SEQ ID NO:457 and a heavy chain comprising SEQ ID NO:614, a light chain comprising SEQ ID NO:458 and a heavy chain comprising SEQ ID NO:615, a light chain comprising SEQ ID NO:459 and a heavy chain comprising SEQ ID NO:616, a light chain comprising SEQ ID NO:460 and a heavy chain comprising SEQ ID NO:617, a light chain comprising SEQ ID NO:461 and a heavy chain comprising SEQ ID NO:618,54. The composition of claim 53, comprising a combination of light and heavy chains selected from the group consisting of a light chain comprising SEQ ID NO: 462 and a heavy chain comprising SEQ ID NO: 619, a light chain comprising SEQ ID NO: 463 and a heavy chain comprising SEQ ID NO: 620, a light chain comprising SEQ ID NO: 464 and a heavy chain comprising SEQ ID NO: 621, a light chain comprising SEQ ID NO: 465 and a heavy chain comprising SEQ ID NO: 622, a light chain comprising SEQ ID NO: 466 and a heavy chain comprising SEQ ID NO: 623, a light chain comprising SEQ ID NO: 467 and a heavy chain comprising SEQ ID NO: 624, a light chain comprising SEQ ID NO: 468 and a heavy chain comprising SEQ ID NO: 625, a light chain comprising SEQ ID NO: 469 and a heavy chain comprising SEQ ID NO: 626, a light chain comprising SEQ ID NO: 470 and a heavy chain comprising SEQ ID NO: 627, and a light chain comprising SEQ ID NO: 471 and a heavy chain comprising SEQ ID NO:
628.
67. An antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof, when bound to GIPR, is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of G29, Q30, K123, N124, E125, A126, L128, D129, Q130, R131, L132, I133, and L134.
68. An antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof, when bound to GIPR, is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, T31, K123, E125, L128, D129, L132, and I133.
68. An antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof, when bound to GIPR, is located within 8 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of Q30, A60, C61, N62, G63, N77, L100, Q102, C103, G104, S105, D106, G107, W109, and G110.
68. An antibody or fragment thereof that binds to GIPR, wherein the antibody or fragment thereof, when bound to GIPR, is located within 5 angstroms of at least one residue of GIPR (SEQ ID NO: 3141) selected from the group consisting of T31, N62, S64, W71, R101, G104, S105, D106, Q108, W109, G110, L111, W112, D114, and T116.