Transposon system and its uses

Abstract

The present invention relates to a transposon vector, a transposon system including the same, a transposon kit, a cell into which the transposon vector is inserted, and uses thereof, and has been completed by confirming that an exogenous gene can be effectively transferred into the chromosome of a target cell to produce a genetically modified cell in a high yield. In particular, it has been confirmed that the transposon according to the present invention can effectively transfer a gene encoding a TCR or a CAR to an immune cell, and thus, the cell expressing the TCR or the CAR shows high reactivity to an antigen. It is expected that various TCR-T cells and CAR-T cells can be produced using the transposon system according to the present invention. In particular, conventional CAR-T cells required high costs not only for CAR production but also for delivery to target cells, but when the transposon of the present invention is used, CAR-T cells can be obtained in high yield at low cost, thereby reducing the production cost of a CAR-T cell therapeutic agent and thereby reducing the price of the therapeutic agent. Furthermore, it has been confirmed that the transposon of the present invention can effectively transfer antibody genes, such as tumor virus-targeted neutralizing antibodies, to HEK293 cells, which are used for mass production of antibodies, and various antibodies can be easily produced in large quantities through the transposon of the present invention. In particular, since the transposon of the present invention is not limited in the types of genes that can be transferred as a gene transfer medium, it is expected to be actively used in the development of genome-modified cell lines that express various genes according to purpose in addition to antibody genes, etc.

Description

Technical Field

[0001] The present invention relates to a transposon vector, a transposon system containing the same, a transposon kit, a cell into which the transposon vector is inserted, and uses thereof and the like. The present invention claims priority based on Korean Patent Application No. 10-2021-0090133 filed on July 9, 2021 and Korean Patent Application No. 10-2022-0085306 filed on July 11, 2022, and all the contents disclosed in the specifications and drawings of the applications are incorporated herein by reference.

Background Art

[0002] A CAR (Chimeric Antigen Receptor)-T cell is a cell therapy agent in which a sequence of an antibody that binds to a tumor antigen (e.g., CD19) and the like is combined with a domain necessary for T cell signaling such as CD3 / 4-1BB / CD28 and inserted into a T cell. There are various methods for inserting these CAR genes into T cells, and most of them use a lentivirus transmission system. The characteristic of lentivirus is that it can be integrated into the chromosome of a cell, so that genes can be continuously expressed. Such lentivirus has a high production cost, which is a major factor in increasing the price of the therapeutic agent, but it has the advantage that it can be used for a large number of patients once produced.

[0003] On the one hand, the treatment TCR-T tailored to individual patients searches for TCR (T-cell receptor) sequences that react to neoantigens possessed by each patient, and transmits and produces this sequence into T cells via a gene delivery system. However, since it is personalized medicine, the TCR sequences applied to each patient are different, so it is almost impossible to apply this to lentivirus. Therefore, it is necessary to develop TCR-T cells using a transposon, a non-viral vector that is easier to produce than lentivirus, has a low production cost, and can be inserted into chromosomes for continuous gene expression.

Summary of the Invention

Problems to be Solved by the Invention

[0004] As a result of intensive research to meet the above-mentioned needs, the inventors developed a transposon as a gene delivery vector capable of inserting an exogenous gene into the genome of target cells, particularly immune cells. It was confirmed that the transposon mutant further produced by modifying the 5' ITR (inverted terminal repeat) and 3' ITR of the transposon also has excellent gene delivery efficiency, and based on this, the present invention was completed.

[0005] Therefore, an object of the present invention is to provide a transposon vector containing 5' ITR and 3' ITR capable of exerting an excellent gene delivery effect.

[0006] Another object of the present invention is to provide a transposon system for target DNA delivery, which includes the transposon vector and a transposase (protein or nucleic acid molecule encoding the same).

[0007] Still another object of the present invention is to provide a transposon kit for target DNA delivery, which includes the transposon system and instructions.

[0008] Still another object of the present invention is to provide a cell into which the transposon vector and the transposase have been introduced.

[0009] Still another object of the present invention is to provide a method for inserting a target DNA sequence into the genome of a cell, which includes the step of introducing the transposon vector and the transposase into the cell.

[0010] Still another object of the present invention is to provide a pharmaceutical composition containing, as an active ingredient, an immune cell into which the transposon vector and the transposase have been introduced.

[0011] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the following description.

Means for Solving the Problems

[0012] The present invention provides a transposon vector containing a 5’ ITR (5’ Inverted terminal repeat) having 71 or more consecutive nucleic acid sequences among the nucleic acid sequences represented by SEQ ID NO: 1; and a 3’ ITR (3’ Inverted terminal repeat) having 66 or more consecutive nucleic acid sequences among the nucleic acid sequences represented by SEQ ID NO: 2.

[0013] In one embodiment of the present invention, the 5’ ITR is selected from the following: A 5’ ITR having the nucleic acid sequence represented by SEQ ID NO: 1; A 5’ ITR having the nucleic acid sequence represented by SEQ ID NO: 5; or A 5’ ITR having the nucleic acid sequence represented by SEQ ID NO: 6, The 3’ ITR is selected from, but not limited to, the following: A 3’ ITR having the nucleic acid sequence represented by SEQ ID NO: 2; A 3’ ITR having the nucleic acid sequence represented by SEQ ID NO: 9; A 3’ ITR having a nucleic acid sequence represented by SEQ ID NO: 10; or A 3’ ITR having a nucleic acid sequence represented by SEQ ID NO: 11.

[0014] In another embodiment of the present invention, the 5’ ITR may include, but is not limited to, one or more of the nucleic acid sequences represented by SEQ ID NO: 7, 5’-ACACTTGG-3’, or SEQ ID NO: 8.

[0015] In yet another embodiment of the present invention, the 3’ ITR may include, but is not limited to, one or more of the nucleic acid sequences represented by SEQ ID NO: 13 or SEQ ID NO: 14.

[0016] In yet another embodiment of the present invention, the nucleic acid sequence of the 5’ ITR may be contained in the 5’ to 3’ direction upstream of the position where the target DNA is inserted in the transposon vector, or the nucleic acid sequence of the 3’ ITR may be contained in the 5’ to 3’ direction downstream of the position where the target DNA is inserted in the transposon vector, but is not limited thereto.

[0017] In yet another embodiment of the present invention, the transposon vector may include, but is not limited to, an antisense DNA having a reverse complement sequence of the nucleic acid sequence of the 3’ ITR (instead of the 3’ ITR) in the 5’ to 3’ direction downstream of the position where the target DNA is inserted in the transposon vector.

[0018] In yet another embodiment of the present invention, the reverse complement sequence of the 3’ ITR may include, but is not limited to, a nucleic acid sequence represented by any one of SEQ IDs 15 to 17.

[0019] In yet another embodiment of the present invention, the transposon vector may include, but is not limited to, one or more target DNA sequences below the 5’ ITR and above the 3’ ITR.

[0020] In still another embodiment of the present invention, the target DNA sequence may be any one or more selected from the group consisting of a therapeutic polypeptide coding sequence, an siRNA coding sequence, an miRNA coding sequence, a reporter protein coding sequence, an antigen-specific receptor coding sequence, a recombinant antibody coding sequence or a fragment thereof, a neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, a cytokine receptor coding sequence, a CAR (Chimeric Antigen Receptor) coding sequence or a fragment thereof, and a TCR (T-cell receptor) coding sequence or a fragment thereof, but is not limited thereto.

[0021] In still another embodiment of the present invention, the transposon vector includes a promoter, one or more target DNAs, and a polyA signal, and the 5' ITR, the promoter, the target DNA, the polyA signal, and the 3' ITR may be operably linked in sequence, but is not limited thereto.

[0022] In still another embodiment of the present invention, the transposon vector may be a circular plasmid, linearized dsDNA (linearlized double stranded DNA), hairpin dsDNA, or minicircle dsDNA, but is not limited thereto.

[0023] In still another embodiment of the present invention, the transposon vector may have a size of 1,000 to 20,000 bp, but is not limited thereto.

[0024] Also, the present invention provides a transposon system for target DNA delivery, comprising: a) the transposon vector into which the target DNA is inserted; and b) a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase.

[0025] In one embodiment of the present invention, the transposase protein may include, but is not limited to, the amino acid sequence represented by SEQ ID NO: 18.

[0026] The present invention also provides a transposon system for target DNA delivery and a transposon kit for target DNA delivery including instructions.

[0027] The present invention also provides: a) the transposon vector into which the target DNA has been inserted; and b) a cell into which a nucleic acid molecule containing a transposase protein or a sequence encoding the transposase has been introduced.

[0028] In one embodiment of the present invention, the target DNA may be excised from the transposon vector by the transposase within the cell, and the excised target DNA may be inserted into the genome of the cell, but is not limited thereto.

[0029] In another embodiment of the present invention, the cell may be selected from the group consisting of, but not limited to, T cells, NK cells, B cells, dendritic cells, macrophages, and mast cells.

[0030] In still another embodiment of the present invention, the cell may be co-cultured with feeder cells after the transposon vector has been introduced, but is not limited thereto.

[0031] In still another embodiment of the present invention, the feeder cells may be irradiated cells, but are not limited thereto.

[0032] In still another embodiment of the present invention, the cell can express the target DNA for 7 days or more after the introduction of the transposon vector, but is not limited thereto.

[0033] The present invention also provides: a) the transposon vector into which the target DNA has been inserted; and b) A method for inserting a target DNA sequence into the genome of a cell is provided, which includes the step of introducing into the cell a nucleic acid molecule containing a transposase protein or an array encoding transposase. The method may be performed in vitro, but is not limited thereto.

[0034] In one embodiment of the present invention, the introduction can be carried out through electroporation, but is not limited thereto.

[0035] In still another embodiment of the present invention, the method may further include the step of co-culturing the cell into which the transposon vector has been inserted with a supporting cell after the introducing step, but is not limited thereto.

[0036] In still another embodiment of the present invention, the step of co-culturing with the supporting cell can be carried out immediately after the introducing step, but is not limited thereto.

[0037] In still another embodiment of the present invention, the transposon vector may be a circular plasmid, linearized dsDNA (double stranded DNA), hairpin dsDNA, or minicircle dsDNA, but is not limited thereto.

[0038] Also, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising as an active ingredient a) the transposon vector into which the target DNA has been inserted; and b) an immune cell into which a nucleic acid molecule containing a transposase protein or an array encoding transposase has been introduced. The target DNA is one or more selected from the group consisting of a tumor antigen-specific CAR (Chimeric Antigen Receptor) coding sequence or a fragment thereof, a tumor virus-specific neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR (T-cell receptor) coding sequence or a fragment thereof, and provides a pharmaceutical composition for preventing or treating cancer.

[0039] The present invention also provides a method for preventing or treating cancer, including the step of administering the immune cells to an individual in need thereof.

[0040] The present invention also provides the use of the immune cells for preventing or treating cancer.

[0041] The present invention also provides the use of the immune cells for the manufacture of a medicament for treating cancer.

[0042] Furthermore, the present invention provides a method for manufacturing a medicament for treating cancer using the transposon vector of the present invention into which one or more selected from the group consisting of a tumor antigen-specific CAR (Chimeric Antigen Receptor) coding sequence or a fragment thereof, a tumor virus-specific neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR (T-cell receptor) coding sequence or a fragment thereof are inserted.

[0043] Furthermore, the present invention provides the use of the transposon vector of the present invention into which one or more selected from the group consisting of a tumor antigen-specific CAR (Chimeric Antigen Receptor) coding sequence or a fragment thereof, a tumor virus-specific neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR (T-cell receptor) coding sequence or a fragment thereof are inserted for the manufacture of a medicament for treating cancer.

[0044] In one embodiment of the present invention, the tumor antigen may be one or more selected from the group consisting of, but not limited to, CD19, NY-ESO-1, EGFR, TAG72, IL13Rα2 (Interleukin 13 receptor alpha-2 subunit), CD52, CD33, CD20, TSLPR, CD22, CD30, GD3, CD171, NCAM (Neural cell adhesion molecule), FBP (Folate binding protein), Le(Y) (Lewis-Y antigen), PSCA (Prostate stem cell antigen), PSMA (Prostate-specific membrane antigen), CEA (Carcinoembryonic antigen), HER2 (Human epidermal growth factor receptor 2), Mesothelin, CD44v6 (Hyaluronate receptor variant 6), B7-H3, Glypican-3, ROR1 (receptor tyrosine kinase like orphan receptor 1), Survivin, FOLR1 (folate receptor), WT1 (Wilm’s tumor antigen), VEGFR2 (Vascular endothelial growth factor 2), tumor virus antigen, TP53, KRAS, and neoantigen.

[0045] In addition, the present invention provides a kit for preventing or treating cancer, comprising: a) the transposon vector according to claim 1 into which a target DNA has been inserted; and b) a transposon system comprising a transposase protein or a nucleic acid molecule containing a sequence encoding a transposase. The target DNA is one or more selected from the group consisting of a tumor antigen-specific CAR (Chimeric Antigen Receptor) coding sequence or a fragment thereof, a tumor virus-specific neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR (T-cell receptor) coding sequence or a fragment thereof, and provides a kit for preventing or treating cancer.

Advantages of the Invention

[0046] The present invention relates to a transposon vector, a transposon system containing the same, a transposon kit, a cell into which the transposon vector is inserted, and uses thereof, and has been confirmed to be able to effectively transfer an exogenous gene into the chromosome of a target cell and produce genetically modified cells at a high yield, and has been completed. In particular, the transposon according to the present invention can effectively transfer a gene encoding TCR or CAR to immune cells, and through this, it has been confirmed that cells expressing the TCR or CAR exhibit high reactivity to antigens, and it is expected that various TCR-T cells and CAR-T cells can be produced using the transposon system according to the present invention. In particular, conventional CAR-T cells required high costs not only for CAR production but also for transfer to target cells, but when the transposon of the present invention is used, CAR-T cells with low cost and high yield can be obtained, so by reducing the production cost of CAR-T cell therapeutics, the price of the therapeutics can be reduced. Furthermore, it has been confirmed that the transposon of the present invention can effectively transfer an antibody gene such as a tumor virus-target neutralizing antibody to HEK293 cells used for mass production of antibodies, and various antibodies can be easily produced in large quantities using the transposon of the present invention. In particular, since the transposon according to the present invention has no limitation on the type of gene that can be transferred as a gene delivery mediator, in addition to antibody genes, it is expected to be actively used for the development of genome-modified cell lines that express various genes according to the purpose.

Brief Description of the Drawings

[0047]

Figure 1

Figures 2a - 2d

Figures 3a - 3e

Figure 4

Figure 5

Figures 6a - 6d

Figure 7a

Figure 7b

Figure 8a

Figures 8b - 8e

Figure 9a

Figures 9b - 9e

Figure 10a

Figures 10b - 10e

Figure 11

Figure 12a

Figure 12b

Figures 13a - 13b

Figure 14a

Figures 14b - 14f

Figure 15a

Figures 15b - 15f

Figure 16a

Figures 16b - 16f

Figure 17a

Figures 17b - 17f

Figures 17g - 17h

Figures 18a - 18b

Figure 19a

Figure 19b

Figure 20a

Figure 20b

Figure 21a

Figure 21b

Figure 22a

Figure 22b

Figure 23a

Figure 23b

Figure 24a

Figure 24b

Figure 25a

Figure 25b

Figure 26a

Figure 26b

Figure 27

Figure 28

Figure 29

Figure 30a

Figure 30b

Figure 31

Figures 32a - 32b

Figure 33

Figures 34a - 34c

Figure 35

Figure 36a

Figure 36b

Figure 37a

Figure 37b

Figure 38a

Figure 38b

Figure 39a

Figure 39b

Figure 40a

Figure 40b

Figure 41a

Figure 41b

Figure 42a

Figure 42b

Figure 43a

Figure 43b

Figure 44a

Figure 44b

Mode for Carrying Out the Invention

[0048] The present invention relates to a transposon vector, a transposon system containing the same, a transposon kit, a cell into which the transposon vector is inserted, and their uses. It has been confirmed that an exogenous gene can be effectively transmitted into the chromosome of a target cell, and genetically modified cells can be produced at a high yield, and thus the invention is completed.

[0049] Therefore, the present invention provides a transposon vector comprising a 5’ ITR (5’ Inverted terminal repeat) having 71 or more consecutive nucleic acid sequences among the nucleic acid sequences represented by SEQ ID NO: 1; and a 3’ ITR (3’ Inverted terminal repeat) having 66 or more consecutive nucleic acid sequences among the nucleic acid sequences represented by SEQ ID NO: 2.

[0050] As used herein, the term "transposon" refers to a polynucleotide that can change its position within a genome by excising a specific gene from a donor polynucleotide (e.g., a vector) and integrating it into a target site (e.g., the genome of a cell or extrachromosomal DNA). A transposon is a polynucleotide that includes a nucleic acid sequence flanked by cis-acting nucleotide sequences, where at least one cis-acting nucleotide sequence is located at the 5' end of the nucleic acid sequence and at least one cis-acting nucleotide sequence is located at the 3' end of the nucleic acid sequence. The cis-acting nucleotide sequences include at least one inverted repeat (IR) at each end of the transposon, which is referred to as an ITR (Inverted Terminal Repeat), to which transposase binds. As used herein, the ITR located at the 5' end of the transposon nucleic acid sequence is referred to as 5' ITR, and the ITR located at the 3' end of the transposon nucleic acid sequence is referred to as 3' ITR.

[0051] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting other linked nucleic acid molecules. Specifically, the vector means any mediator for the introduction and / or transfer of bases into a host cell in vitro, ex vivo, or in vivo, and can be a replicon that can bind other DNA fragments and result in the replication of the bound fragments. A "replicon" refers to any genetic unit (e.g., plasmid, phage, cosmid, chromosome, virus, etc.) that functions as a self-unit of DNA replication in vivo, i.e., can be replicated by its own regulation. The vector includes, but is not limited to, bacteria, plasmids, phages, cosmids, episomes, viruses, and insertable DNA fragments, i.e., fragments that can be inserted into the host cell genome by homologous recombination.

[0052] The vector according to the present invention is plasmid DNA, linear DNA, hairpin DNA, or minicircle DNA, which may consist of double-stranded DNA, or may be a recombinant viral vector, but is not limited thereto. The vector contains a transposon sequence and a target DNA, and can be used without limitation as long as it can transfer these into target cells. Those skilled in the art can select and use various vectors generally known in the art.

[0053] The recombinant vector of the present invention preferably contains a promoter (a transcription initiation factor to which an RNA polymerase binds), any operator sequence for regulating transcription, an enhancer sequence, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation, a terminator, etc., and more preferably, a polyhistidine tag (an amino acid motif composed of at least 5 or more histidine residues), a signal peptide gene, an endoplasmic reticulum retention signal peptide, a cloning site, etc. may further be included, or a tag gene, a selection marker gene such as an antibiotic resistance gene for selecting transformants, etc. may further be included. In the recombinant vector, the polynucleotide sequences of the respective genes are operably linked to the promoter. As used herein, the term "operatively linked" means a functional linkage between a nucleotide expression regulatory sequence such as a promoter sequence and another nucleotide sequence, whereby the regulatory sequence regulates the transcription and / or translation of the other nucleotide sequence.

[0054] The recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and uses a prokaryotic cell as a host, it generally includes a strong promoter capable of promoting transcription (such as the pLλ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.), a ribosome binding site for the initiation of translation, and a transcription / translation termination sequence. When using a eukaryotic cell as a host, the origin of replication where the vector functions in the eukaryotic cell may include, but is not limited to, the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adenovirus origin of replication, AAV origin of replication, and BBV origin of replication. In addition, a promoter derived from the genome of a mammalian cell (such as the metallothionein promoter) or a promoter derived from a mammalian virus (such as the adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and HSV tk promoter) can be used, and it generally has a polyadenylation sequence as a transcription termination sequence. It may also include, but is not limited to, a poly A signal (polyadenylation signal) as a signal sequence.

[0055] Examples of the tag gene may typically include an Avi tag, Calmodulin tag, polyglutamate tag, E tag, FLAG tag, HA tag, His tag (polyhistidine tag), Myc tag, S tag, SBP tag, IgG-Fc tag, CTB tag, Softag 1 tag, Softag 3 tag, Strep tag, TC tag, V5 tag, VSV tag, Xpress tag, etc. Preferably, the vector according to the present invention may include a Myc tag.

[0056] In the present invention, the vector can be delivered into cells using various techniques commonly used to introduce exogenous nucleic acids (DNA or RNA) into prokaryotic or eukaryotic host cells. For example, the vector according to the present invention can be inserted into cells by calcium phosphate coprecipitation; electroporation; Microfluidics gene editing; nucleofection; cell squeezing; sonoporation; optical transfection; impalefection; gene gun; magnetofection; viral transduction; DEAE-dextran transfection; lipofection; or transfection via dendrimers, liposomes, or cationic polymers, but is not limited thereto.

[0057] The term "nucleic acid" or "nucleic acid molecule" as used in the present application has the meaning of comprehensively including DNA (gDNA and cDNA) and RNA molecules. Nucleotides, which are the basic building blocks of nucleic acids, include not only natural nucleotides but also analogues with modified sugar or base moieties. The sequence of the nucleic acid according to the present invention can be modified. The modifications include addition, deletion, or non-conservative or conservative substitution of nucleotides. The nucleic acid according to the present invention also includes nucleotide sequences that exhibit substantial identity to the nucleotide sequence. Substantial identity means a nucleotide sequence that shows at least 80% homology, more preferably at least 90% homology, and most preferably at least 95% homology when the nucleotide sequence of the present invention and any other sequence are aligned to maximize correspondence and the aligned sequences are analyzed using algorithms commonly used in the art.

[0058] That is, in the present invention, the polynucleotide consisting of the nucleotide sequence represented by a specific SEQ ID NO. is not limited to the nucleotide sequence alone, and variants of the nucleotide sequence are included within the scope of the present invention. The nucleic acid molecule consisting of the nucleotide sequence represented by a specific SEQ ID NO. of the present invention is a functional equivalent of the nucleic acid molecule constituting the same, for example, a concept including variants in which a partial nucleotide sequence of the nucleic acid molecule is modified by deletion, substitution, or insertion, but can perform the same function as the nucleic acid molecule. Specifically, the polynucleotide disclosed in the present invention may include a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more with the nucleotide sequence represented by a specific SEQ ID NO. For example, it includes polynucleotides having sequence homologies of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. The "%" of sequence homology to a polynucleotide is confirmed by comparing two optimally aligned sequences with a comparison region, and a part of the polynucleotide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to the reference sequence (excluding additions or deletions) for the optimal alignment of the two sequences.

[0059] The term "transposition efficacy" used in the present application refers to the number of cells containing the polynucleotide introduced into a population of host cells. Generally, the transposition efficacy can be determined by transducing a polynucleotide encoding a reporter gene, such as GFP, into a population of target cells. Therefore, the transposition efficacy can be determined by analyzing the gene product encoded by the introduced polynucleotide. For example, by measuring the number of cells having GFP activity.

[0060] The transposon vector according to the present invention may contain one or more 5' ITRs and one or more 3' ITRs.

[0061] When the transposon vector according to the present invention contains one or more 5' ITRs and one or more 3' ITRs described below, The nucleic acid sequence of the 5' ITR may have its 5'-to-3' sequence contained in the 5'-to-3' direction within the 5' end of the transposon vector (or the transposon-coding polynucleotide molecule), and / or the nucleic acid sequence of the 3' ITR may have its 5'-to-3' sequence contained in the 5'-to-3' direction within the 3' end of the transposon vector. In other words, the nucleic acid sequence of the 5' ITR may be contained in the 5'-to-3' direction upstream of the position where the target DNA is inserted within the transposon vector, and / or the nucleic acid sequence of the 3' ITR may be contained in the 5'-to-3' direction downstream of the position where the target DNA is inserted within the transposon vector. Being contained in the 5'-to-3' direction within the 5' end or the 3' end of the said vector preferably means being contained in the 5'-to-3' direction of the sense strand of the polynucleotide molecule.

[0062] The 5’ ITR according to the present invention is characterized by having 71 or more consecutive nucleic acid sequences among the 157 nucleic acid sequences represented by SEQ ID NO: 1. Preferably, the 71 or more consecutive nucleic acid sequences mean 71 or more consecutive nucleic acid sequences in the 5’ to 3’ direction among the nucleic acid sequences represented by SEQ ID NO: 1. Here, the 71 or more nucleic acid sequences can be selected from the entire nucleic acid sequence represented by SEQ ID NO: 1. For example, 71 or more can be selected from the first nucleotide (represented by “T” in SEQ ID NO: 1) in the 5’ to 3’ direction of the nucleic acid sequence represented by SEQ ID NO: 1, but it is not limited thereto. For example, the 5’ ITR can have 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, or 150 or more consecutive nucleic acid sequences among the 157 nucleic acid sequences represented by SEQ ID NO: 1. Also, the 5’ ITR is 157 or less, 140 or less, 130 or less, 120 or less, or 115 or less. Here, when selecting 71 or more, it can be sequentially selected from the first nucleotide, but it can also be selected with some nucleotides deleted, added, or mutated.

[0063] The 5’ ITR according to the present invention can also have 71 or less nucleic acid sequences among the 157 nucleic acid sequences represented by SEQ ID NO: 1, but must have more than 33 nucleic acid sequences. For example, when the 5’ ITR according to the present invention is contained in a transposon vector and exhibits an effective effect as the target transposon vector in the present invention, it can also have 34 or more, 35 or more, 38 or more, 40 or more, 50 or more, or 60 or more nucleic acid sequences among the 157 nucleic acid sequences represented by SEQ ID NO: 1, and is not limited to 71 or more. Here, when selecting more than 33, it can be sequentially selected from the first nucleotide in the 5’ to 3’ direction of the nucleic acid sequence represented by SEQ ID NO: 1, but it can also be selected with some nucleotides deleted, added, or mutated.

[0064] For example, the 5’ ITR according to the present invention includes a nucleic acid sequence represented by SEQ ID NO: 7 (5’-TTAACACTTGGATTGCGGGAAACGAG-3’). Here, SEQ ID NO: 7 corresponds to the 1st to 26th nucleotides at the 5’ end of the nucleic acid sequence represented by SEQ ID NO: 1.

[0065] For example, the 5’ ITR according to the present invention includes a nucleic acid sequence (8mer) represented by 5’-ACACTTGG-3’. The said sequence corresponds to the 4th to 11th nucleotides at the 5’ end of the nucleic acid sequence represented by SEQ ID NO: 1.

[0066] For example, the 5’ ITR according to the present invention includes a nucleic acid sequence (15mer) represented by SEQ ID NO: 8 (5’-TGCGGGAAACGAGTT-3’). Here, SEQ ID NO: 8 corresponds to the 14th to 28th nucleotides at the 5’ end of the nucleic acid sequence represented by SEQ ID NO: 1.

[0067] For example, the 5’ ITR according to the present invention includes one or more of the nucleic acid sequences represented by SEQ ID NO: 7, 5’-ACACTTGG-3’, or SEQ ID NO: 8 described above.

[0068] In one embodiment of the present invention, the 5’ ITR can be any one selected from the group consisting of: a) 5’ ITR having the nucleic acid sequence represented by SEQ ID NO: 1; b) 5’ ITR having the nucleic acid sequence represented by SEQ ID NO: 5; and c) 5’ ITR having the nucleic acid sequence represented by SEQ ID NO: 6.

[0069] The 3’ ITR according to the present invention is characterized by having 66 or more nucleic acid sequences out of the 212 nucleic acid sequences represented by SEQ ID NO: 2. Here, 66 or more nucleic acid sequences can be selected from the entire nucleic acid sequence represented by SEQ ID NO: 2. For example, 66 or more can be selected from the first nucleotide in the 3’ to 5’ direction of the sense strand nucleic acid sequence represented by SEQ ID NO: 2 (SEQ ID NO: 2 is “A” in SEQ ID NO: 2), but it is not limited thereto. For example, the 3’ ITR can have 60 or more, 70 or more, 80 or more, 90 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, 200 or more, or 210 or more consecutive nucleic acid sequences out of the 212 nucleic acid sequences represented by SEQ ID NO: 2. Also, the 3’ ITR is 212 or less, 200 or less, 190 or less, 180 or less, 170 or less, or 160 or less. Here, when selecting 66 or more, it can be sequentially selected from the first nucleotide, but it can also be selected with some nucleotides deleted, added, or mutated.

[0070] The 3’ ITR according to the present invention can also have 66 or less nucleic acid sequences out of the 212 nucleic acid sequences represented by SEQ ID NO: 2, but must have more than 37 nucleic acid sequences. For example, the 3’ ITR according to the present invention is contained in a transposon vector and, when exhibiting an effective effect as the target transposon vector in the present invention, can also have 40 or more, 50 or more, or 60 or more nucleic acid sequences out of the 212 nucleic acid sequences represented by SEQ ID NO: 2, and is not limited to 66 or more. Here, when selecting more than 37, it can be sequentially selected from the first nucleotide in the 3’ to 5’ direction of the sense strand nucleic acid sequence represented by SEQ ID NO: 2, but it can also be selected with some nucleotides deleted, added, or mutated.

[0071] For example, the 3’ ITR according to the present invention includes a nucleic acid sequence (30mer) represented by SEQ ID NO: 13 (5’-ttggcgggaaattcacccgacaccgtagtg-3’). Here, SEQ ID NO: 13 corresponds to the 5th to 34th nucleotides from the 3’ end of the nucleic acid sequence represented by SEQ ID NO: 2.

[0072] For example, the 3’ ITR according to the present invention includes a nucleic acid sequence (18mer) represented by SEQ ID NO: 14 (5’-aactctgattttgcgcgg-3’). Here, SEQ ID NO: 14 corresponds to the 69th to 86th nucleotides from the 3’ end of the nucleic acid sequence represented by SEQ ID NO: 2.

[0073] For example, the 3’ ITR according to the present invention includes one or more of the nucleic acid sequences represented by SEQ ID NO: 13 or SEQ ID NO: 14.

[0074] In one embodiment of the present invention, the 3’ ITR can be any one selected from the group consisting of: a) 3’ ITR having the nucleic acid sequence represented by SEQ ID NO: 2; b) 3’ ITR having the nucleic acid sequence represented by SEQ ID NO: 9; c) 3’ ITR having the nucleic acid sequence represented by SEQ ID NO: 10; and d) 3’ ITR having the nucleic acid sequence represented by SEQ ID NO: 11.

[0075] In the transposon vector according to the present invention, when including a combination of one or more of the above-described 5’ ITRs and one or more of the 3’ ITRs, The nucleic acid sequence of the 5’ ITR is contained in the 5’ to 3’ direction within the 5’ end of the transposon vector, or the 5’ to 3’ sequence of an antisense DNA having a reverse complement sequence of the nucleic acid sequence of the 5’ ITR represented by the above-mentioned SEQ ID NO may be contained in the 5’ to 3’ direction within the 5’ end of the transposon vector. In other words, the nucleic acid sequence of the 5’ ITR may be contained in the 5’ to 3’ direction upstream of the position where the target DNA is inserted within the transposon vector, or may be contained in the 5’ to 3’ direction upstream of the position where the target DNA is inserted within the transposon vector as the reverse complement sequence of the nucleic acid sequence of the 5’ ITR.

[0076] In addition, the nucleic acid sequence of the 3’ ITR is contained in the 5’ to 3’ direction within the 3’ end of the transposon vector, or the 5’ to 3’ nucleic acid sequence of an antisense DNA having a reverse complement sequence of the 3’ ITR represented by the above-mentioned SEQ ID NO may be contained in the 5’ to 3’ direction of the sense strand within the 3’ end of the transposon vector. In other words, the nucleic acid sequence of the 3’ ITR may be contained in the 5’ to 3’ direction downstream of the position where the target DNA is inserted within the transposon vector, or an antisense DNA having a reverse complement sequence of the nucleic acid sequence of the 3’ ITR may be contained in the 5’ to 3’ direction downstream of the position where the target DNA is inserted within the transposon vector.

[0077] For example, the nucleic acid sequence of the 3' ITR (3M3) represented by SEQ ID NO: 9 is 5'-aacctaaataattgcccgcgccatcttatattttggcgggaaattcacccgacaccgtagtgttaa-3'. Such a 3' ITR is sequentially contained in the 3' end of the transposon vector in the 5' to 3' direction within the 3' end of the sense strand of the transposon vector in the order of 5'-aacctaaataattgcccgcgccatcttatattttggcgggaaattcacccgacaccgtagtgttaa-3'. On the other hand, when the nucleic acid sequence of the antisense strand of the 3' ITR represented by SEQ ID NO: 9 in the 5' to 3' direction is contained in the 3' end of the sense strand of the transposon vector in the 5' to 3' direction, it is sequentially contained in the 3' end of the transposon vector in the order of 5'-ttaacactacggtgtcgggtgaatttcccgccaaaatataagatggcgcgggcaattatttaggtt-3'. In one specific example, the reverse complement sequence of the nucleic acid sequence of such a 3' ITR represented by SEQ ID NO: 9 is represented by SEQ ID NO: 15 (r3M3).

[0078] In one embodiment of the present invention, the reverse complementary sequence of the 3' ITR may include a nucleic acid sequence represented by any one of SEQ ID NOs: 15 to 17.

[0079] The transposon vector according to the present invention may include a combination of one or more of the above-described 5' ITRs and one or more of the 3' ITRs.

[0080] For example, it may include a combination of a 5' ITR having the nucleic acid sequence represented by SEQ ID NO: 1 and a 3' ITR having the nucleic acid sequence represented by SEQ ID NO: 11. Using the above-described three types of 5' ITRs (B51E, 5M3, and 5M4) and seven types of 3' ITRs (B3IS, 3M1, 3M2, 3M3, r3M1, r3M2, and r3M3), a total of 21 combinations of 5' ITRs and 3' ITRs can be obtained, but it is not limited to these 21 combinations.

[0081] In one embodiment of the present invention, the transposon vector may be a transposon vector characterized by containing one or more target DNA sequences between the downstream of the 5' ITR and the upstream of the 3' ITR, but is not limited thereto.

[0082] In the present invention, "target DNA" refers to an exogenous DNA molecule to be transmitted into a cell using the transposon of the present invention. The target DNA is sufficient as long as it can be expressed after being inserted into a transposon vector and introduced into target cells. That is, it is obvious that the target DNA is not limited to a specific type of DNA, and those skilled in the art can select a desired target DNA without limitation according to the purpose.

[0083] In one embodiment of the present invention, the target DNA sequence may be an antibiotic resistance protein, a therapeutic polypeptide, siRNA, miRNA, a reporter protein, a cytokine, a kinase, an antigen, an antigen-specific receptor, a cytokine receptor, a suicide polypeptide, a recombinant antibody, a neutralizing antibody against various viruses or other antigens, or a coding sequence of a part thereof. For example, it may be a chimeric antigen receptor (CAR), a T cell receptor (TCR), or a coding sequence of a part thereof, but is not limited thereto.

[0084] In the present invention, the "therapeutic polypeptide" refers to a polypeptide or peptide having an effect of preventing, improving, and / or treating any disease, and those skilled in the art can appropriately select a polypeptide showing a therapeutic effect or the like on a specific disease according to the purpose. The disease is not limited to a specific type, but in one embodiment, the disease may be cancer.

[0085] In one embodiment of the present invention, the transposon vector may, but is not limited to, have a promoter operably linked between the downstream of the 5’ ITR and the upstream of the 3’ ITR.

[0086] For example, the transposon vector may further contain a promoter between the downstream of the 5’ ITR and the upstream of the target DNA cloning site.

[0087] The term “operably linked” means a functional linkage between a nucleic acid expression regulatory sequence (e.g., a promoter, a signal sequence, or an array of transcription regulatory factor binding sites) and another nucleic acid sequence, whereby the regulatory sequence regulates the transcription and / or translation of the other nucleic acid sequence.

[0088] Examples of the promoter may include, but are not limited to, the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter, the lac promoter, the T7 promoter, the simian virus 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, the phosphoglycerate kinase promoter, the chicken β-actin (CAG) promoter, the elongation factor 1-alpha (EF1α) promoter, the human H1 promoter, and the U6 promoter.

[0089] In one embodiment of the present invention, the transposon vector may, but is not limited to, have one or more of an enhancer, a silencer, an insulator, a terminator, and a polyA signal further operably linked between the downstream of the 5’ ITR and the upstream of the 3’ ITR in addition to the promoter.

[0090] The enhancer may include, but is not limited to, for example, the CMV enhancer.

[0091] For example, the transposon vector includes a promoter, one or more target DNAs, and a polyA signal, and the 5' ITR, the promoter, the target DNA, the polyA signal, and the 3' ITR may be sequentially operably linked.

[0092] Alternatively, the transposon vector may further include an enhancer, and the 5' ITR, the enhancer, the promoter, the target DNA, the polyA signal, and the 3' ITR may be sequentially operably linked, but is not limited thereto.

[0093] The transposon vector of the present invention is a double-stranded DNA molecule (ds DNA), and although it is not limited to a specific form, it may preferably be a circular plasmid, or it may be linearized dsDNA or minicircle DNA, but is not limited thereto. The linearized dsDNA can be obtained by synthesis or by cleaving a circular plasmid with a restriction enzyme or the like. The "minicircle DNA" is a nucleic acid molecule typically lacking any plasmid / vector backbone sequence necessary for replication, such as a prokaryotic antibiotic resistance gene and a prokaryotic origin of replication, and refers to a circular DNA molecule that is even smaller in size than a general plasmid. Minicircles can be generated in vivo from bacterial plasmids by site-specific intramolecular recombination between recombinase recognition sites of the plasmid, generating a minicircle DNA vector lacking the bacterial plasmid backbone DNA, but not limited thereto. For example, minicircle DNA can be produced by an enzymatic digestion / ligation method and can be produced using commercially available kits, such as a minicircle DNA production kit (System Bioscience, CA, USA). Also, the transposon according to the present invention can be hairpin dsDNA (hairpin dsDNA). The hairpin structure is a structure in which bonds are formed between base pairs within a single-stranded DNA and occurs when two regions within the single strand are reverse complementary to each other. The transposon in the form of hairpin dsDNA has a loop structure instead of having its ends cleaved, and thus is more stable than linearized dsDNA. The transposon in the form of hairpin dsDNA can be produced by cleaving a circular plasmid with a restriction enzyme to linearize it and then creating both ends of the linearized dsDNA molecule in a hairpin form (for example, linear covalently closed (LCC) DNA minivector, minimalistic immunogenic defined gene expression vector (MIDGE), micro-linear vector (MiLV)).Methods for producing hairpin forms at both ends of a plasmid or linearized plasmid are generally known in the art, and specifically, papers such as [Mol Ther Methods Clin Dev. 2020 Jan 16;17:359-368] can be referred to.

[0094] Also, the transposon vector according to the present invention may have a size of 1,000 to 20,000 bp, but is not limited thereto. The inventors of the present invention confirmed through specific examples that the transposon vector according to the present invention has excellent gene transfer function, and in particular, confirmed that the smaller the size of the transposon vector, the higher the gene transfer efficiency. Therefore, the transposon vector may have a size of 1,000 to 20,000 bp, 1,000 to 15,000 bp, 1,000 to 13,000 bp, 1,000 to 10,000 bp, 1,000 to 9,000 bp, 1,000 to 8,000 bp, 1,000 to 7,000 bp, 1,000 to 6,000 bp, 1,000 to 5,000 bp, 1,000 to 4,000 bp, or 1,000 to 3,000 bp, but is not limited thereto.

[0095] Furthermore, the present invention provides a transposon system for target DNA delivery, comprising: a) the transposon vector of the present invention into which a target DNA is inserted; and b) a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase.

[0096] In the present invention, "transposase" refers to an enzyme that recognizes and binds to both ends of a transposon (particularly, inverted terminal repeats), and then cuts the portion to move and insert a gene segment between both ends (i.e., a site containing target DNA) to another position within the chromosome. In the present invention, it is sufficient that the transposase binds to and cuts the 5' ITR and 3' ITR of the transposon according to the present invention and can insert (or integrate) the target DNA existing between the 5' ITR and 3' ITR into the chromosome of the target cell, and it is not limited to a specific type. For example, in the present invention, the transposase includes not only natural transposase but also artificially produced recombinant transposase without limitation. In one embodiment of the present invention, the transposase may be pBat transposase.

[0097] In the present invention, the transposase can be introduced into the cell in the form of the protein itself, or after being introduced into the cell in the form of a nucleic acid molecule (DNA or RNA molecule) containing a sequence encoding the transposase protein, it can be expressed in the cell.

[0098] In one embodiment of the present invention, the nucleic acid molecule containing the sequence encoding the transposase may be selected from the following: i) A transposase protein containing the amino acid sequence represented by SEQ ID NO: 18; ii) A vector containing the nucleic acid sequence of SEQ ID NO: 19 (a "transposase vector" or "transposase plasmid"), and iii) An mRNA molecule containing the nucleic acid sequence of SEQ ID NO: 20. That is, the transposase vector can have the nucleic acid sequence represented by SEQ ID NO: 19, but is not limited thereto. For example, it can also contain the sequence of ThyPLGMH, mycPBase, TPLGMH, or HAhyPBase.

[0099] The transposase vector can be produced by conventional methods generally known in the art, for example, but not limited to, the method described by Yaa-Jyuhn James Meir et al. (A versatile, highly efficient, and potentially safer piggyBac transposon system for mammalian genome manipulations, FASEB, 2013:27, 4429-4443).

[0100] The transposase vector may include a promoter operably linked to a nucleic acid sequence encoding the transposase.

[0101] The promoter is selected from, for example, but not limited to, the cytomegalovirus promoter (CMV), the Rous sarcoma virus promoter (RSV), the simian virus 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, the phosphoglycerate kinase (PGK) promoter, the chicken β-actin (CAG) promoter, the elongation factor 1-alpha (EF1-α) promoter, the human H1 promoter, and the U6 promoter.

[0102] In addition, the polypeptide containing the amino acid sequence represented by a specific SEQ ID NO. is not limited to the amino acid sequence alone, and variants of the amino acid sequence are included within the scope of the present invention. The polypeptide molecule consisting of the amino acid sequence represented by a specific SEQ ID NO. of the present invention refers to functional equivalents of the polypeptide molecules constituting it. For example, although a part of the amino acid sequence of the polypeptide molecule is modified by deletion, substitution, or insertion, it is a concept including variants that can perform the same function as the polypeptide. Specifically, the polypeptide disclosed in the present invention may include an amino acid sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more with the amino acid sequence represented by a specific SEQ ID NO. For example, it includes polypeptides having a sequence homology of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. The "%" of sequence homology to a polypeptide is confirmed by comparing the two optimally aligned sequences with the comparison region. A part of the polypeptide sequence in the comparison region may include additions or deletions (i.e., gaps) compared to the reference sequence (excluding additions or deletions) for the optimal alignment of the two sequences.

[0103] Furthermore, the present invention provides a target DNA transfer transposon system and a target DNA transfer transposon kit including the instructions.

[0104] The instructions include a pamphlet, recording, diagram, or other expression medium (e.g., CD, VCD, DVD, USB) that can be used to convey or inform how to use the transposon system of the present application. The instructions may be attached to the container or may be packaged independently of the container including the transposon system of the present application.

[0105] The kit may further include a container for containing the transposon system of the present application.

[0106] In addition, the kit may further include a buffer solution for stabilizing / stabilizing the transposon system or performing cell transduction. The buffer solution may be, for example, phosphate-buffered saline, Tris-based saline, Tris-EDTA buffer, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid buffer, or (N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES) buffer, but is not limited thereto.

[0107] In addition, the present invention provides a) a transposon vector into which a target DNA has been inserted; and b) a cell into which a nucleic acid molecule containing a transposase protein or a sequence encoding transposase has been introduced.

[0108] In the present invention, the cell may be one in which the target DNA is excised from the transposon vector by the transposase within the cell, and the excised target DNA is integrated into the genome of the cell. That is, the target DNA can be inserted into the genome of the target cell by the transposon and transposase of the present invention and stably expressed. The target DNA inserted into the genome of the cell can be expressed in the cell for 5 days or more, 7 days or more, 10 days or more, 15 days or more, 20 days or more, or 30 days or more after the transposon vector and transposase are introduced into the cell, but is not limited thereto.

[0109] That is, the present invention provides cells in which target DNA is inserted into the genome by the transposon and genetically engineered. In the present invention, "engineered" refers to any manipulation of a cell that results in a detectable change in the cell, where the manipulation includes, but is not limited to, inserting heterologous / homologous polynucleotides and / or polypeptides into the cell and mutating polynucleotides and / or polypeptides inherent to the cell.

[0110] In one embodiment of the present invention, the cell is one or more immune cells selected from the group consisting of T cells, B cells, natural killer cells, monocytes, macrophages, eosinophils, mast cells, basophils, and myeloid cells such as granulocytes, and dendritic cells; or may be stem cells derived from bone marrow, adipose tissue, peripheral blood, umbilical cord blood, or dental pulp, but is not limited thereto. Further, the cell may be an insect-derived cell, a plant-derived cell, a fish-derived cell, or a mammalian-derived cell, particularly a human-derived cell, but is not limited thereto.

[0111] As used herein, the term "immune cell" generally refers to cells that play a role in the immune response.

[0112] In addition, the cell may be co-cultured with feeder cells after the transposon vector and transposase (protein or nucleic acid molecule) are introduced. The feeder cells refer to auxiliary cells that do not proliferate themselves and provide extracellular secretions containing growth factors and the like so that the cells into which the target DNA is introduced can proliferate. The feeder cells are not limited to specific types and can be applied without limitation as long as they are cells known in the art to play the role of feeder cells. Non-limiting examples include fibroblasts, human bone marrow-derived mesenchymal cells, human amniotic epithelial cells, adipose-derived mesenchymal stem cells, melanoma cells (A375 cells), and the like. Preferably, the feeder cells may be irradiated with radiation in advance before being co-cultured with the cells into which the target DNA is introduced.

[0113] Co-culture with the said supporting cells can contribute to enhancing the gene transfer efficiency, the proliferation of the cells into which the said gene has been introduced, and the expression rate of the said gene, particularly when introducing CAR, TCR, etc. into immune cells using the transposon system according to the present invention. The method for activating the cells into which the said gene has been introduced is not limited to co-culture with supporting cells, and an appropriate cell activation method can be used without limitation depending on the type of target cells. For example, when the said cells are T cells, they can be activated using Transact or Dynabeads, etc.

[0114] It is preferable that the co-culture with the said supporting cells is carried out immediately after the transposon vector and the transposase have been introduced into the cells using electroporation, etc., but it is not limited thereto, and it can be carried out within 1 day to 10 days, within 1 day to 5 days, within 1 day to 3 days, within 1 day to 2 days, within 1 day, within 20 hours, within 10 hours, within 5 hours, within 3 hours, within 1 hour, within 30 minutes, or within 10 minutes after the said introduction.

[0115] In addition, the present invention provides a method for inserting a target DNA sequence into the genome of a cell, comprising: a) a transposon vector into which a target DNA has been inserted; and b) introducing into the cell a nucleic acid molecule containing a transposase protein or a sequence encoding the transposase.

[0116] Furthermore, the said method may further comprise, after the said introduction step, a step of co-culturing the cells into which the transposon vector has been inserted with supporting cells.

[0117] The term "introduction" as used herein refers to the introduction (transduction) of a polynucleotide (e.g., a transposon vector or a transposase vector) into a cell or organism. The nucleic acid of the polynucleotide may be in the form of naked DNA or RNA, may be associated with various proteins, or may be integrated into a vector. The term "introduction" as used herein conveys the broadest possible meaning, including, for example, transfection methods (methods by which a polynucleotide is introduced into a eukaryotic cell by physical and / or chemical treatment), transformation methods (methods by which a polynucleotide is introduced into a prokaryotic cell by physical and / or chemical treatment), viral / viral transduction methods (methods by which a polynucleotide is introduced into a eukaryotic and / or prokaryotic cell by a virus or viral vector), conjugation methods (methods by which a polynucleotide is introduced from one cell into another cell by direct cell-to-cell contact or by a cytoplasmic bridge between cells), and fusion methods (methods by which two cells fuse, including homotypic and heterotypic cell fusion). Preferably, said introduction is performed through electroporation.

[0118] The present invention also provides compositions for various uses, comprising as an active ingredient cells having a target DNA inserted into their genome by the transposon-based vector of the present invention, wherein the cells may be autologous or allogeneic.

[0119] In one embodiment of the present invention, there is provided a pharmaceutical composition for preventing or treating immune-related diseases, comprising the cells of the present invention as an active ingredient.

[0120] As used herein, the term "immune-related disease" refers to a disease and / or condition in which the immune system is involved in the pathogenesis of the disease, or in which appropriate stimulation or suppression of the immune system can lead to treatment and / or prevention of the disease. Exemplary immune-related diseases that can be treated by the present invention include, but are not limited to, tumors, infectious diseases, allergies, autoimmune diseases, graft-versus-host disease, or inflammatory diseases.

[0121] The inventors confirmed that CAR T cells produced using the transposon of the present invention through specific examples differentiated into cytotoxic T cells and memory T cells, etc. in response to antigens. Therefore, those skilled in the art can produce genetically engineered cells with further activated immune functions by transferring an appropriate antigen-specific CAR or TCR gene into immune cells using the transposon of the present invention, and can use this to prevent or treat immune-related diseases.

[0122] For example, those skilled in the art can insert a gene encoding a target antigen into the transposon according to the present invention and then transfer it into immune cells to enhance the immune function of the cells against the antigen. Enhancing the immune function can mean, for example, activating the functions of antigen-presenting cells, natural killer cells, T cells (especially cytotoxic T cells), etc. against the antigen, or regulating the activities of regulatory T cells, MDSCs (myeloid-derived suppressor cells), or M2 macrophages, etc., but is not limited thereto.

[0123] In particular, the present invention relates to a pharmaceutical composition for preventing or treating cancer, comprising as an active ingredient: a) a transposon vector into which a target DNA has been inserted; and b) immune cells into which a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase has been introduced. The target DNA is one or more selected from the group consisting of a tumor antigen-specific CAR coding sequence or a fragment thereof, a tumor virus-specific neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR coding sequence or fragment, and provides a pharmaceutical composition for preventing or treating cancer.

[0124] In the present invention, the immune cell has a tumor antigen-specific CAR, a tumor antigen-specific TCR, or a functional fragment thereof inserted into the chromosome, expresses a tumor antigen-specific CAR or TCR on the cell surface, and thus can react with a tumor antigen.

[0125] Specific descriptions of tumor antigens are as described above.

[0126] The tumor virus (oncovirus) refers to a virus that causes cancer, and the tumor virus antigen refers to a protein, an envelope virus, a toxin, etc. specifically produced by the tumor virus. Tumor virus antigens include, for example, Cytomegalovirus (CMV) antigen, Epstein-Barr virus (EBV) antigen, human papilloma virus (HPV) antigen, hepatitis B virus (HBV) antigen, hepatitis C virus (HCV) antigen, Human immunodeficiency virus (HIV) antigen, human herpes virus-8 (HHV-8) antigen, and human T-lymphotrophic virus (HTLV-1) antigen, etc., but are not limited thereto, and any virus-specific antigen that induces cancer can be included without limitation.

[0127] The neoantigen refers to an antigenic peptide that appears specifically only in cancer cells. Neoantigens are not expressed in normal cells but only in cancer cells. When presented on the surface of antigen-presenting cells that have absorbed them, they can bind to the T-cell receptor and induce an immune response. Neoantigens include all shared neoantigens and personalized neoantigens. Shared neoantigens are neoantigens with a high shared occurrence frequency and refer to neoantigens that appear commonly in two or more patients. Personalized neoantigens are neoantigens that appear specifically only in a particular patient, and patient-specific customized treatment can be targeted at them.

[0128] The immune checkpoint inhibitor can be included without limitation as long as it can inhibit immune checkpoints expressed in immune cells or cancer cells. That is, the immune checkpoint may be an antibody targeting an immune checkpoint. Specific examples include, but are not limited to, anti-PD-L1 antibody, anti-PD-1 antibody, anti-CTLA-4 antibody, anti-LAG3 antibody, anti-TIM3 antibody, anti-BTLA antibody, anti-4-1BB antibody, anti-OX40 antibody, or functional fragments thereof.

[0129] The immune cells can be selected from T cells, NK cells, B cells, dendritic cells, macrophages, etc., and preferably can be T cells.

[0130] In the present invention, "cancer" includes all solid cancers and blood cancers. In one embodiment of the present invention, the cancer may be one or more selected from the group consisting of breast cancer, colorectal cancer, lung cancer, head and neck cancer, small cell lung cancer, stomach cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head cancer, neck cancer, melanoma, uveal melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, colon cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocyte lymphoma, bladder cancer, kidney cancer, ureteral cancer, renal cell cancer, renal pelvis cancer, CNS tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma, but is not limited thereto.

[0131] In the present invention, the tumor antigen-specific CAR or TCR can be a CAR or TCR against a shared neoantigen that is particularly overexpressed in the cancer to be treated or specifically expressed only in the cancer, or a neoantigen expressed by a somatic mutation that occurs only in the cancer. That is, the tumor antigen is not limited and is included without limitation as long as it is specifically expressed in cancer cells or has particularly high expression in cancer cells, and is not limited to specific types. However, it can be selected from CD19, NY-ESO-1, EGFR, TAG72, IL13Rα2 (Interleukin 13 receptor alpha-2 subunit), CD52, CD33, CD20, TSLPR, CD22, CD30, GD3, CD171, NCAM (Neural cell adhesion molecule), FBP (Folate binding protein), Le(Y) (Lewis-Y antigen), PSCA (Prostate stem cell antigen), PSMA (Prostate-specific membrane antigen), CEA (Carcinoembryonic antigen), HER2 (Human epidermal growth factor receptor 2), Mesothelin, CD44v6 (Hyaluronate receptor variant 6), B7-H3, Glypican-3, ROR1 (receptor tyrosine kinase like orphan receptor 1), Survivin, FOLR1 (folate receptor), WT1 (Wilm’s tumor antigen), VEGFR2 (Vascular endothelial growth factor 2), tumor virus antigen, TP53, KRAS, and neoantigen, etc. However, those skilled in the art can select an appropriate tumor antigen generally known in the art according to the type of cancer to be treated and apply it to the present invention.

[0132] The content of the cells in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc. For example, it may be 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the weight of the whole composition, but is not limited thereto. The ratio of the content is a value based on the dry weight after removing the solvent.

[0133] The pharmaceutical composition according to the present invention may further contain suitable carriers, excipients and diluents commonly used in the production of pharmaceutical compositions. The excipient may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, humectants, film coating substances, and controlled release additives.

[0134] The pharmaceutical composition according to the present invention can be formulated into forms such as powders, granules, sustained release granules, enteric granules, liquids, eye drops, elixirs, emulsions, suspensions, spirits, troches, aromatic waters, lemonades, tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusion fluids, plasters, lotions, pastes, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols, and the external preparations can have dosage forms such as creams, gels, patches, sprays, ointments, plasters, lotions, liniments, pastes or cataplasms.

[0135] Examples of the carriers, excipients and diluents that can be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

[0136] When formulated, it is usually prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0137] As additives for tablets, powders, granules, capsules, pills, and troches according to the present invention, there are corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, D-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, calcium hydrogen phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methyl cellulose, sodium carboxymethyl cellulose, kaolin, iodine, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methyl cellulose (HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, propylene glycol, casein, calcium lactate, Primogel, etc. as excipients; gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethyl cellulose, calcium carboxymethyl cellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethyl cellulose, sodium methyl cellulose, methyl cellulose, microcrystalline cellulose, dextrin, hydroxycellulose, hydroxypropyl starch, hydroxymethyl cellulose, purified shellac, starch paste, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, polyvinyl alcohol, polyvinyl pyrrolidone, etc. as binders, and hydroxypropyl methyl cellulose, corn starch, agar powder, methyl cellulose, bentonite, hydroxypropyl starch, sodium carboxymethyl cellulose, sodium alginate, calcium carboxymethyl cellulose, calcium citrate, sodium lauryl sulfate, anhydrous silicic acid, L-hydroxypropyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde-treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinyl pyrrolidone, calcium phosphate, gelled starch, gum arabic, amylopectin, pectin, sodium polyphosphate, ethyl cellulose, sucrose, magnesium aluminum silicate, D-sorbitol solution, hard anhydrous silicic acid, etc. as disintegrants;Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodium powder, kaolin, petrolatum, sodium stearate, cocoa butter, sodium salicylate, magnesium salicylate, polyethylene glycol (PEG) 4000, PEG 6000, liquid paraffin, hydrogenated soybean oil (Lubri wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, anhydrous silicic acid, higher fatty acids, higher alcohols, silicone oil, paraffin oil, polyethylene glycol fatty acid ethers, starch, sodium chloride, sodium acetate, sodium oleate, DL-leucine, hard anhydrous silicic acid and other lubricants can be used.

[0138] As additives for the liquid agent according to the present invention, water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (Tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc. can be used.

[0139] For the syrup agent according to the present invention, a solution of sucrose, other saccharides or sweeteners, etc. can be used, and if necessary, flavoring agents, coloring agents, preservatives, stabilizers, suspending agents, emulsifying agents, thickening agents, etc. can be used.

[0140] For the emulsion according to the present invention, purified water can be used, and if necessary, emulsifying agents, preservatives, stabilizers, flavoring agents, etc. can be used.

[0141] The suspending agents for the suspending agent according to the present invention include acacia, tragacanth, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC1828, HPMC2906, HPMC2910, etc. Surfactants, preservatives, stabilizers, colorants, and fragrances can be used as necessary.

[0142] The injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, Ringer's injection, dextrose injection, dextrose + sodium chloride injection, polyethylene glycol (PEG), lactated Ringer's injection, ethanol, propylene glycol, non-volatile oils - sesame oil, cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, solvents such as benzene benzoate; solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, iodine, urethane, monoethylacetamide, butazolidine, propylene glycol, Tweens, nicotinamide, hexamine, dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumin, peptone, gums; isotonic agents such as sodium chloride; stabilizers such as sodium bisulfite (NaHSO3), carbon dioxide gas, sodium metabisulfite (Na2S2O5), sodium sulfite (Na2SO3), nitrogen gas (N2), ethylenediaminetetraacetic acid; sulfating agents such as sodium bisulfite 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetate, acetone sodium bisulfite; soothing agents such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, calcium gluconate; and may contain suspending agents such as sodium CMC, sodium alginate, Tween 80, aluminum monostearate.

[0143] The suppositories according to the present invention include bases such as cocoa butter, lanolin, witepsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, coconut oil, cocoa butter + cholesterol, lecithin, lanett wax, glycerol monostearate, tween or span, Imhausen, monolen (propylene glycol monostearate), glycerin, Adeps solidus, Buytyrum Tego-G, Cebes Pharma 16, hexalide base 95, Cotomar, hydrocort SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Massapol, Massapol-15, Neosporstal-N, Paramount-B, Spocilo (OSI, OSIX, A, B, C, D, H, L), suppository base type IV (AB, B, A, BC, BBG, E, BGF, C, D, 299), Spostal (N, Es), Wecoby (W, R, S, M, Fs), Tegester trigly ceride base (TG-95, MA, 57) can be used.

[0144] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. Such solid preparations are prepared by mixing at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. with the above extract. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

[0145] Examples of liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are frequently used simple diluents, various excipients such as wetting agents, sweeteners, flavoring agents, preservatives, etc. may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used.

[0146] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level can be determined by factors including the type and severity of the patient's disease, the activity of the drug, drug sensitivity, administration time, administration route and excretion ratio, treatment period, elements including drugs used simultaneously, and other elements well known in the medical field.

[0147] The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered in single or multiple doses. It is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects considering all the above elements, and this can be easily determined by an ordinary technician in the technical field to which the present invention pertains.

[0148] The pharmaceutical composition of the present invention can be administered to an individual by various routes. All modes of administration are foreseeable. For example, it can be administered by oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, injection into the perispinal space (intradural), sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, intraocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, cutaneous administration, transdermal administration, etc.

[0149] The pharmaceutical composition of the present invention is determined by the type of drug as the active ingredient, together with various relevant factors such as the disease to be treated, the route of administration, the age, sex, weight of the patient, and the severity of the disease. Specifically, the effective amount of the composition according to the present invention can vary depending on the age, sex, and weight of the patient. Generally, it can be administered daily or every other day at 0.001 to 150 mg per kg of body weight, preferably 0.01 to 100 mg, or divided into 1 to 3 doses per day. However, since it can be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

[0150] In the present invention, "individual" means a subject in need of treatment for a disease, and more specifically, means mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cows.

[0151] In the present invention, "administration" means providing a predetermined composition of the present invention to an individual by any suitable method.

[0152] In the present invention, "prevention" means all acts of suppressing or delaying the onset of a target disease, "treatment" means all acts in which the target disease and the associated metabolic disorder symptoms improve or are beneficially changed by administration of the pharmaceutical composition according to the present invention, and "improvement" means all acts of reducing parameters related to the target disease, such as the degree of symptoms, by administration of the composition according to the present invention.

[0153] In addition, the present invention includes a transposon system comprising a) a transposon vector into which a target DNA has been inserted; and b) a nucleic acid molecule containing a transposase protein or a sequence encoding transposase, and is a kit for preventing or treating cancer. The target DNA is one or more selected from the group consisting of a tumor antigen-specific CAR (Chimeric Antigen Receptor) coding sequence or a fragment thereof, a tumor virus-specific neutralizing antibody coding sequence or a fragment thereof, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR (T-cell receptor) coding sequence or a fragment thereof, and provides a kit for preventing or treating cancer.

[0154] The kit may further include immune cells for expressing the target DNA.

[0155] In addition, the kit may further include an instruction manual describing specific explanations (features, manufacturing methods, storage methods, administration methods, etc.) regarding the transposon vector of the present invention or cells into which the vector has been introduced.

[0156] Hereinafter, preferred examples for helping the understanding of the present invention will be presented. However, the following examples are only provided to more easily understand the present invention, and the content of the present invention is not limited by the following examples.

[0157] [Experimental Method] Example A. ITR Search and Function Verification 1.Bioinformatics In the case of transposable elements (TEs or transposons), since the variation between species is large, a repeat family was searched for and modeled de novo using RepeatModeler software version 2.0.1 with the Myotis lucifugus 7x assembly (myoLuc2) to generate a repeat library specific to the bat species. After combining the thus obtained repeat library with the mammalia library information in RepeatMasker, masking was performed on the transposable elements using RepeatMasker software version 4.1.1 together with the rmblast 2.10.0+ search engine, and the masked DNA transposons sequences were secured.

[0158] The sequences of the secured 5’ ITR and 3’ ITR are as follows. a. 5’ ITR_157 (SEQ ID NO: 1) 5’-ttaacacttggattgcgggaaacgagttaagtcggctcgcgtgaattgcgcgtactccgcgggagccgtcttaactcggttcatatagatttgcggtggagtgcgggaaacgtgtaaactcgggccgattgtaactgcgtattaccaaatatttgtt-3’ b. 3’ ITR_212 (SEQ ID NO: 2) 5’-aattatttatgtactgaatagataaaaaaatgtctgtgattgaataaattttcattttttacacaagaaaccgaaaatttcatttcaatcgaacccatacttcaaaagatataggcattttaaactaactctgattttgcgcgggaaacctaaataattgcccgcgccatcttatattttggcgggaaattcacccgacaccgtagtgttaa-3’

[0159] 2. pBat transposon vector The 5' ITR and 3' ITR of the DNA transposon obtained through bioinformatics were each cloned into the pCAG-EGFP vector, and the 5' ITR was constructed to be located before the chicken beta-actin promoter in the vector, and the 3' ITR was located after the SV40 poly(A) signal (Figure 1).

[0160] 3. Gene transfer (Transfection) After washing the T cell line Jurkat cells with PBS, the cells were resuspended in 90 μL of resuspension buffer per 1×10 5 , 5 , 5 , 5 cells. 3 mL of electrolytic buffer was placed in the Neon tube and inserted into the Neon pipette station. 1 μg each of pCAG-EGFP-ITR plasmid DNA and transposase plasmid DNA (where the transposase has the nucleic acid sequence of SEQ ID NO: 19) were added per 1×10 5 cells, and the total volume was adjusted to 100 μL per 1×10 5 cells. As a control group, pEGFP plasmid DNA without ITR was used. 1×10 5 cells were taken with a Neon pipette, subjected to electroporation at 1,600 V, 10 ms, and 3 pulses, and the cells were placed in a well containing 400 μL of medium (RPMI, 10% FBS, No P / S) in a 24-well plate. The cells were cultured in a 37°C CO2 incubator for 1 day, and 500 μL of medium containing antibiotics was added per well. The GFP expression level in the cells was confirmed by fluorescence microscopy and FACS 1 day, 7 days, and 14 days after transfection.

[0161] Transposase nucleic acid sequence (SEQ ID NO: 19)

[0162] Transposase mRNA sequence (SEQ ID NO: 20)

[0163] 4. FACS analysis The transfected cells were transferred to 1.5 mL tubes by well. After centrifugation at 1,500 rpm for 5 minutes, the supernatant was removed, and the cells were washed with 500 μL of PBS (2% FBS). After repeating the washing two more times, the cells were suspended in PBS (2% FBS, 1×DAPI) and transferred to a FACS tube for FACS analysis. The percentage of cells expressing GFP among live cells (DAPI negative) was compared by group.

[0164] 5. Confirmation by fluorescence microscope Cells expressing GFP were observed at a magnification of 100 using a Carl Zeiss fluorescence microscope.

[0165] 6. Single cell sorting Seven days after transfection, cells expressing GFP were sorted into single cells using a BD FACSAria, and RPMI medium containing 10% FBS was added to a 96-well plate and cultured in a 37°C, 5% CO2 incubator. Then, 10 days later, it was observed under a fluorescence microscope whether GFP was expressed in the cells, and Splinkerette PCR was performed to confirm the integration position.

[0166] 7. Confirmation of the chromosomal DNA integration position using the Splinkerette PCR method Cells sorted into single cells and cultured were collected and washed with PBS. Genomic DNA (gDNA) was extracted from the cell pellet using a gDNA kit and quantified. 100 ng of gDNA was digested with Sau3AI restriction enzyme at 37 °C for 1 hour. Two single-stranded DNAs (GATCCCACTAGTGTCGACACCAGTCTCTAATTTTTTTTTTCAAAAAAA and CGAAGAGTAACCGTTGCTAGGAGAGACCGTGGCTGAATGAGACTGGTGTCGACACTAGTGG, SEQ ID NO: 21 and SEQ ID NO: 22 respectively) were annealed (left at 95 °C for 3 minutes and then cooled to room temperature) to create Sau3AI adaptors. 20 ng of gDNA digested with Sau3AI and the annealed Sau3AI adaptors were reacted at 16 °C for 8 hours, followed by 1st PCR (98 °C for 20 seconds, 55 °C for 15 seconds, 72 °C for 2 minutes, 29 cycles) and 2nd PCR (98 °C for 20 seconds, 55 °C for 15 seconds, 72 °C for 2 minutes, 29 cycles). After confirmation by electrophoresis, sequencing was carried out.

[0167] 1st PCR primers: 5’ 1st F - CGAAGAGTAACCGTTGCTAGGAGAGACC (SEQ ID NO: 23), 5’ 1st R - CCCTATAGTGAGTCGTATTACCAA (SEQ ID NO: 24), 3’ 1st F - CATTACCCTGTTATCCCTAGCTAGCA (SEQ ID NO: 25), 3’ 1st R - CGAAGAGTAACCGTTGCTAGGAGAGACC (SEQ ID NO: 26).

[0168] 2nd PCR primers: 5’ 2nd F - GTGGCTGAATGAGACTGGTGTCGAC (SEQ ID NO: 27), 5’ 2nd R - GGTCATAGCTGTTTCCTGCT (SEQ ID NO: 28), 3’ 2nd F - CATTTCAATCGAACCCATACTTCAAAA (SEQ ID NO: 29), 3’ 2nd R - GTGGCTGAATGAGACTGGTGTCGAC (SEQ ID NO: 30).

[0169] Example B. Production and Function Verification of ITR mutant 1. Cells and vectors As described below, a pBat transposon mutant form plasmid was prepared and used in the experiment, and Jukat cells (ATCC, Cat no. TIB-152, Lot no. 70017560) were used as the cells for confirming gene transfer efficiency.

[0170] 2. Preparation of ITR mutant form For the preparation of the ITR mutant, a BamHI site was inserted in front of the 5’ ITR of the original transposon plasmid vector, and a SalI site was inserted after the 3’ ITR to prepare a backbone transposon plasmid vector.

[0171] The 5’ ITR mutant plasmid vector was prepared by cutting the backbone transposon plasmid vector with BamHI and EcoRV restriction enzymes and inserting the 5’ ITR mutant.

[0172] The 3’ ITR mutant plasmid vector was prepared by cutting the backbone transposon plasmid vector with BmtI and SalI restriction enzymes and inserting the 3’ ITR mutant.

[0173] 3. Cloning To generate mutants of the 5’ ITR and 3’ ITR, a BamHI site was added in front of the 5’ ITR and a SalI site was added after the 3’ ITR in the pCAG-GFP-ITR vector. For the 5’ ITR, BamHI and EcoRV were added to the transposon vector and the pUC57-5’ ITR mutant vector respectively, and digestion was carried out by reacting at 37 °C for 2 hours and at 50 °C for 2 hours. For the 3’ ITR, BmtI and SalI were added to the transposon vector and the pUC57-3’ ITR mutant vector respectively, and digestion was carried out by reacting at 37 °C for 2 hours. After digestion, gel extraction was performed, ligation was carried out using T4 DNA ligase, transformation was performed with DH5α, and spreading was carried out on an LB plate (containing Ampicillin). The formed colonies were grown in LB broth (containing Ampicillin), plasmids were obtained by mini-prep, sequencing was performed, and the sequences were confirmed. The mutant vector with the confirmed sequence was subjected to midi-prep to prepare DNA for transfection.

[0174] 4.Neon Transfection(Electroporation) After washing the T cell line Jurkat cells with PBS, the cells were resuspended in 90 μL of resuspension buffer per 1×10 5 . 3 mL of electrolytic buffer was placed in the Neon tube and inserted into the Neon pipette station. 1 μg each of mutant DNA and transposase DNA were added to the cells per 1×10 5 , and the total volume was adjusted to 100 μL per 1×10 5 . The cells per 1×10 5Took samples, performed electroporation at 1,600 V, 10 ms, and 3 pulses, and placed the cells into wells containing 400 μL of medium (RPMI, 10% FBS, no P / S) in a 24-well plate. Cultured the cells in a 37°C CO2 incubator for 1 day, and then added 500 μL of medium containing antibiotics to each well. Confirmed the degree of GFP expression in the cells 1 day, 7 days, and 14 days after transfection using a fluorescence microscope and FACS.

[0175] 5. FACS Transferred the transfected cells into 1.5 mL tubes by well. After centrifugation at 1,500 rpm for 5 minutes, removed the supernatant, and washed with 500 μL of PBS (2% FBS). Repeated the washing 2 more times, then suspended the cells in PBS (2% FBS, 1x DAPI), transferred them into FACS tubes, and performed FACS analysis. Compared the percentage (%) of cells expressing GFP among live cells (DAPI negative) by group.

[0176] 6. Fluorescence microscope Observed the cells expressing GFP at a magnification of 100 using a Carl Zeiss fluorescence microscope.

[0177] 7. Single cell sorting and culture Fourteen days after transfection, Jurkat cells expressing GFP were sorted into single cells. The cells were transferred to a conical tube for each well, centrifuged at 1,500 rpm for 5 minutes to remove the supernatant, and then the cell pellet was resuspended and washed with washing buffer (PBS + 2% FBS), and the cells were further washed twice with washing buffer. Next, 200 μL of washing buffer containing 1×DAPI was added to each well to resuspend the cells and transferred to a FACS filter tube. Then, 1 mL of washing buffer containing 1×DAPI was added. 100 μL of complete medium was placed in each well of a 96-well plate, and single cell sorting was performed with 1 cell per well. The sorted plate was cultured in a 37°C and CO2 incubator. Three days later, 100 μL of complete medium was added to each well, and the wells were cultured alternately with 100 μL of complete medium at 2- to 3-day intervals. When the cells grew in the 96-well plate, they were transferred to a 24-well plate, and the volume in each well was adjusted to 500 μL with complete medium. Two to three days later, 500 μL of complete medium was added to each well of the 24-well plate, and two to three days later, 1 mL of complete medium was added to each well to make a total of 2 mL. The cells were cultured while alternating 1 mL of complete medium at 2- to 3-day intervals.

[0178] Example C. Production and Function Verification of ITR mutant (reverse) 1. Cells and vectors As described below, a pBat transposon mutant form plasmid was prepared and used in the experiment, and Jukat cells (ATCC, Cat no. TIB-152, Lot no. 70017560) were used as cells for confirming gene transfer efficiency.

[0179] 2. Preparation of ITR mutant form The ITR mutant was prepared by the same method as in Example B.

[0180] 3. Transfection, FACS, Fluorescence Microscopy Analysis, and Single Cell Sorting Cells were transfected (electroporated) with mutant DNA and transposase DNA in the same manner as in Example B. After transfection, when 7 days and 14 days had passed, the degree of GFP expression in the cells was observed under a fluorescence microscope, and the proportion of GFP-expressing cells among viable cells (DAPI negative) was confirmed through FACS analysis. Also, single cell sorting and culturing were performed in the same manner as in Example B. The transfection groups were prepared as shown in Table 1 below.

[0181]

Table 1

[0182] Example D. Verification of Gene Transfer Efficiency of pBat Transposon in PBMC In the above example, when confirming the gene transfer efficiency by the pBat transposon system in the Jurkat cell line, electroporation was performed using Neon equipment. However, in the case of electroporation using Neon equipment, the efficiency is very low in primary T cells, and there is a limitation that it must be carried out with a small scale of cell number (maximum 10 6 cells). Therefore, in this example, the gene transfer efficiency by the pBat transposon system in PBMC was confirmed using Maxcyte equipment. For this purpose, the gene transfer efficiency of the mutant form transposon was compared using transposons containing the GFP gene (Naive-GFP, 3M3-5M3-GFP) and transposons containing the 1G4 TCR gene (B3IS-B5IE-1G4, 3M3-5M3-1G4). Transposase was expressed with plasmid DNA.

[0183] 1. Test Substances 1-1. DNA and RNA molecules For the pBat transposon plasmid vector, the following four types were used, and for the control group, pEGFP (pBat B3IS - B5IE) was used. For the expression of transposase, the pBat transposase plasmid was co - introduced (SEQ ID NO: 19).

[0184]

Table 2

[0185] 1-2. Cells As the target cells for confirming the gene transfer efficiency of the transposon, fresh PBMC and A375 cells (ATCC, Cat no.CRL - 1619, Lot no.70032966) obtained by blood collection from humans were used.

[0186] 2. Isolation of PBMC from blood PBMCs were obtained from blood collected from humans through the following process: 15 mL of Ficoll-Paque was dispensed into each of four 50 mL conical tubes, and then 30 mL of whole blood obtained from healthy donors was slowly added onto the Ficoll-Paque layer in each tube without mixing. Next, centrifugation was performed at 1000 x g for 15 minutes under Break 0 conditions. Only the PBMC layer was carefully aspirated using a pipette from the tubes after centrifugation and transferred to a new 50 mL conical tube. The tube was filled with washing buffer (DPBS + 2% FBS) to a total volume of 50 mL, inverted, centrifuged at 450 x g for 10 minutes, and then the supernatant was removed. Next, 50 mL of washing buffer was added to the pellet to resuspend the pellet, centrifuged at 450 x g for 10 minutes, and then the supernatant was removed. Furthermore, 50 mL of washing buffer was added to the pellet to resuspend the pellet, and the number and viability of PBMCs were confirmed. Next, after centrifugation at 450 x g for 10 minutes, the supernatant was removed, and the obtained cell pellet was resuspended in 20 mL of RPMI media (total 8 x 10 7 cells), and transferred to a T75 flask. Thereafter, the cells were stored at room temperature until the experiment proceeded.

[0187] 3. Electroporation Gene transfer into the cells was performed using the electroporation method. First, PBMCs separated from human blood were collected in a conical tube, centrifuged at 1500 rpm for 5 minutes, the supernatant was removed, and then the cells were suspended in 50 mL of PBS. Cell counting was performed on the suspended cells, centrifuged at 1500 rpm for 5 minutes, and the supernatant was removed. Opti-MEM buffer was added to the obtained cell pellet, and the cells were suspended to a concentration of 4 x 10 6 cells / 50 μL. Next, 1.5 mL tubes were prepared for each electroporation condition (Table 3). A transposon vector was added to each tube at a concentration of PBMC 4 x 10 6Add to a concentration of 5 μg per cell, and add 4×10 6 PBMCs to each tube containing the transposon vector. Next, add the cell suspension (4×10 6 cells / 50 μL) to the OC100X2 assembly, taking care not to introduce bubbles. Perform the Resting T cell 14-3 protocol on the Maxcyte GTx for electroporation. Insert the OC100x2 assembly into the GTx and perform the protocol to proceed with electroporation. After electroporation, transfer the cell suspension from the OC100x2 assembly to a 12-well plate (4×10 6 cells / 50 μL / well). Wash the OC100X2 well with 50 μL of Opti-MEM medium, add it to each well of the plate, and allow a recovery time of 20 minutes in a 37 °C and CO2 incubator. After the recovery time, carefully add 800 μL of complete medium (AIM-V + 3% HS + 200 IU / mL IL-2) to each well of a 6-well plate, then place it in a 37 °C and CO2 incubator and culture for 1 day.

[0188]

Table 3

[0189] 4. Addition of feeder cells One day after electroporation, A375, which was irradiated with 50 Gy of radiation as feeder cells, was added to the electroporated PBMC. Specifically, after removing the medium of A375 (p8) cells cultured in 8 dishes of 150π, the dishes were washed with 5 mL of PBS, and 2 mL of 0.05% Trypsin-EDTA was added. After incubating for 3 minutes in a 37 °C and CO2 incubator, 10 mL of fresh medium (DMEM + 10% FBS + 1x P / S) was added, and the cells detached from the bottom of the dish were collected. Next, after centrifuging the cell suspension at 1,500 rpm for 5 minutes, the supernatant was removed, and the precipitated cells were suspended in 30 mL of fresh medium (DMEM + 10% FBS + 1x P / S). The obtained A375 cells were placed in one T75 flask at a concentration of 9×10 7 cells / 20 mL and irradiated with 50 Gy of radiation. The irradiated A375 cells were collected in a new 50 mL conical tube, centrifuged at 1,500 rpm for 5 minutes, and the supernatant was removed. After suspending the cell pellet in 50 mL of PBS, it was centrifuged additionally at 1,500 rpm for 5 minutes. Then, after removing the supernatant, the cell pellet was resuspended in 50 mL of PBS and cell counting was performed. After cell counting, the cell sample was centrifuged at 1,500 rpm for 5 minutes, the supernatant was removed, and the cell pellet was suspended in the medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) to a concentration of 2×10 6 cells / 100 μL. The prepared feeder cell suspension was added to the PBMC cultured one day after electroporation at 100 μL (2×10 6 cells) each and cultured in a 37 °C and CO2 incubator.

[0190] 5. Cell culture Three days after electroporation, 1 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added, and then the cells were cultured in a 37 °C and CO2 incubator (primary medium addition). Six days after electroporation, 2 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added, and then the cells were cultured in a 37 °C and CO2 incubator (secondary medium addition). Seven days after electroporation, after suspending the cells in culture, 2.5 mL of the cell suspension was transferred to a new tube for FACS analysis, and 1.5 mL of fresh medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added to the remaining 1.5 mL of the cell suspension, and the cells were cultured in a 37 °C and CO2 incubator. Ten days after electroporation, after suspending the cells in culture, 1.5 mL of the cell suspension was transferred to a new well for each well (1:1 split), 1.5 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added to each, and the cells were cultured in a 37 °C and CO2 incubator. Fourteen days after electroporation, the cells in each well were transferred to a new tube, and FACS analysis was continued.

[0191] 6. Observation of GFP expression using a fluorescence microscope For the pBat transposon vector group containing the GFP gene, the expression of GFP was observed through a fluorescence microscope 1 day and 7 days after electroporation.

[0192] 7. FACS analysis FACS analysis was performed 7 and 14 days after electroporation. Seven days after electroporation, FACS analysis was carried out after observing GFP expression under a fluorescence microscope. Specifically, after suspending the cells in each well, they were transferred to 16 1.5 mL tubes. Each tube was centrifuged at 1,500 rpm for 5 minutes, and after removing the supernatant, the cells were suspended in 1 mL of washing buffer (PBS + 2% FBS). The centrifugation and supernatant removal processes were repeated two more times to wash the cells. After adding 1 μL of human TruStain FcX and 30 μL of washing buffer to each tube, the reaction was allowed to proceed at room temperature for 5 minutes. After adding 1 μL of each antibody to each tube as shown in Table 4, the reaction was allowed to proceed at 4°C for 30 minutes. The cells after the reaction were washed with washing buffer, suspended in 200 μL of washing buffer containing 1×DAPI, transferred to a FACS tube, and FACS analysis was carried out.

[0193]

Table 4

[0194] Example E. Verification of Gene Transfer Efficiency According to T Cell Activation Timing during TCR-T Production Using pBat Transposon System 1. Test Substances and Cells pBat transposon 3M3 - 5M3 - GFP containing the GFP gene and pBat transposon 3M3 - 5M3 - 1G4 TCR containing the 1G4 TCR gene were used as pBat transposon plasmids, and the pBat transposase plasmid was co - introduced for the expression of transposase. As target cells for confirming the gene transfer efficiency of the transposon, fresh PBMCs obtained by blood collection from humans and A375 cells (ATCC, Cat no.CRL - 1619, Lot no.70032966) were used. The A375 cells used were those cryopreserved after irradiation with radiation (50 Gy). Fresh PBMCs were separated from human whole blood by the same method as in Example D.

[0195] 2. Electroporation Electroporation was performed to introduce the transposon and the transposase plasmid into PBMC. The overall process proceeded in the same manner as in Example D, and the specific Electroporation conditions for each sample are as shown in Table 5 below.

[0196]

Table 5

[0197] After performing Electroporation according to the Resting T cell 14-3 protocol of Maxcyte STx, the cell suspension (5×10 6 cells / 100 μL / well) was transferred from the OC100x2 assembly to a T25 flask, and the OC100X2 well was washed with 100 μL of AlyS medium and added to each T25 flask. After recovering the cells electroporated for 20 minutes in a 37 °C and CO2 incubator, 800 μL of medium (ALyS + 3% HS + 200 IU / mL IL-2) was carefully added to each T25 flask except for the flasks in the "3M3-5M3-1G4+DNA (immediately after)" group, and the flasks were placed in a 37 °C and CO2 incubator for culture.

[0198] 3. Activation of T cells after Electroporation As a method for activating T cells, a method was performed in which A375 cells (irradiated with 50 Gy of radiation) expressing the NY-ESO-1 antigen, which is the target antigen of 1G4 TCR, were added to feeder cells to specifically activate 1G4 TCR-T cells. At this time, the activation period of T cells was divided into immediately after electroporation or 1 day later, and the results according to the activation period were compared. As shown in Table 6, in the "3M3-5M3-1G4+DNA (immediately) group", immediately after electroporation, in all groups except the "3M3-5M3-1G4+DNA (immediately) group", A375 cells irradiated with 50 Gy of radiation 1 day after electroporation were added to electroporated PBMC as feeder cells.

[0199]

Table 6

[0200] 3-1. T cell activation and culture using "A375 cells irradiated with radiation immediately after electroporation" The 3M3-5M3-1G4+DNA (immediately) group, which adds feeder cells immediately after electroporation to activate T cells, activated and cultured T cells by the following method: One vial of A375 irradiated with 50 Gy of radiation during cryopreservation was thawed in a 37 °C water bath. 9 mL of ALyS medium was placed in a 50 mL tube, and 1 mL of the thawed A375 cell suspension was slowly added. The tube was centrifuged at 1,500 rpm for 5 minutes at room temperature, the supernatant was removed, and the cell pellet was suspended in 10 mL of ALyS medium. After proceeding with cell counting, 5×10 6Individual A375 cells were transferred to a 15 mL tube, centrifuged at 1,500 rpm for 5 minutes, and the supernatant was removed. The cell pellet was resuspended in 800 μL of medium (ALyS + 3% HS + 200 IU / mL IL-2), added to the 3M3-5M3-1G4+DNA (immediately after) group that had completed recovery after electroporation as shown in Table 6 above, and cultured in a 37°C and CO2 incubator. After 1 day, 1.5 mL of medium (ALyS + 3% HS + 200 IU / mL IL-2) was added and cultured in a 37°C and CO2 incubator. After 2 days, 5 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added and then cultured in a 37°C and CO2 incubator. After 3 days, 10 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added and then cultured in a 37°C and CO2 incubator. After 6 days, the cells being cultured in a T25 flask were suspended, transferred to a T75 flask, 30 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added, and the flask was cultured in a 37°C and CO2 incubator. After 8 days, 20 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added to the T75 flask and cultured in a 37°C and CO2 incubator. After 10 days, 40 mL of medium was removed from the T75 flask using a pipette, 30 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added, and then cultured in a 37°C and CO2 incubator.

[0201] 3-2. T Cell Activation and Culture Using "A375 Cells Irradiated with Radiation 1 Day after Electroporation" In Table 6 above, groups 1, 2, 4, and 5 activated and cultured T cells by the following method: One day after electroporation, one vial of A375 irradiated with 50 Gy of radiation stored frozen was thawed in a 37°C water bath. 9 mL of ALyS medium was placed in a 50 mL tube, and 1 mL of the thawed A375 cell suspension was slowly added. The tube was centrifuged at 1,500 rpm for 5 minutes at room temperature, the supernatant was removed, the cell pellet was resuspended in 10 mL of ALyS medium, and after cell counting was carried out, 5×106 Individual A375 cells were transferred to a 15 mL tube and centrifuged at 1,500 rpm for 5 minutes. The supernatant was removed, and the cell pellet was resuspended in medium (ALyS + 3% HS + 200 IU / mL IL-2) to a concentration of 2×10 6 cells / 500 μL. Then, it was added to flasks of the group excluding the "3M3 - 5M3 - 1G4 + DNA (immediately after)" group among the conditions where the T cell activation method in Table 6 was "irradiated A375 cells". Next, 1 mL of medium (ALyS + 3% HS + 200 IU / mL IL-2) was added, and the cells were cultured in a 37°C and CO2 incubator. After 3 days, 5 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added to the T25 flask, and the cells were cultured in a 37°C and CO2 incubator. After 6 days, 5 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added to the T25 flask, and the cells were cultured in a 37°C and CO2 incubator. After 8 days, for the "EP only (1 day after) irradiated A375 cell group and No EP group", after suspending the cells cultured in the T25 flask, they were transferred to a T75 flask, and 10 mL of medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2) was added to each. To the flasks of the other groups, 5 mL of medium was added, and then the cells were cultured in a 37°C and CO2 incubator. After 10 days, 10 mL was removed from the flask using a pipette, and after adding 10 mL of fresh medium (AIM-V + 3% HS + 1x P / S + 200 IU / mL IL-2), the cells were cultured in a 37°C and CO2 incubator.

[0202] 4. FACS analysis To analyze the gene transfer efficiency by the transposon system, FACS was carried out, which was performed in the same manner as the FACS method described in Example D overall.

[0203] Example F. Production of CAR-T Using pBat Transposon System 1. Test substances and cells pBat transposon 3M3 - 5M3 - CD19 CAR containing the CD19 CAR gene was used as the pBat transposon plasmid, and the pBat transposase plasmid was co - introduced for the expression of the transposase. As the target cells for confirming the gene transfer efficiency of the transposon, LK053 PBMCs isolated from healthy individuals and cryopreserved were used.

[0204] 2. Activation of T cells after electroporation 2-1. Electroporation and culture of PBMCs After thawing two vials of LK053 PBMC cells stored in LN2 in a 37°C water bath, 18 mL of medium (AIM-V + 3% HS) was placed in a 50 mL tube, and 2 mL of the thawed cell suspension was slowly added. The tube was centrifuged at 1,500 rpm for 5 minutes at room temperature, the supernatant was removed, the cell pellet was resuspended in 20 mL of medium (AIM-V + 3% HS), and cell counting was carried out. 3.5×10 7 After centrifuging 3.5×10 individual PBMCs at 1,500 rpm for 5 minutes at room temperature, the supernatant was removed, and the cell pellet was resuspended in 10 mL of PBS. Next, after centrifuging the cell suspension at 1,500 rpm for 5 minutes at room temperature, the supernatant was completely removed, and the cell pellet was resuspended in 350 μL of warm opti-MEM to a concentration of 5×10 6 cells / 50 μL.

[0205] 5 μg of each plasmid was added to a 1.5 mL tube according to the conditions shown in Table 7, and 50 μL (5×10 6They were added one by one. The cell suspension in item 6 was gently added to the OC100X2 assembly, taking care not to generate bubbles. Electroporation was performed according to the Resting T cell 14-3 protocol of Maxcyte STx, similar to Example D. After electroporation, the cell suspension was transferred from the OC100x2 assembly to two T25 flasks, respectively. The OC100X2 well was washed with 50 μL of AIM-V medium and added to each T25 flask. The T25 flasks were cultured in a 37 °C and CO2 incubator with the bottom short edge tilted for 20 minutes to allow time for cell recovery. After the recovery time ended, 900 μL of complete medium (AIM-V + 3% HS + 200 IU / mL IL-2) was carefully added to each T25 flask. The T25 flasks were cultured in a 37 °C and CO2 incubator with the bottom short edge tilted for 1 day.

[0206]

Table 7

[0207] 2-2. T cell activation and culture One day after electroporation, 1.5 mL of complete medium (AIM-V + 3% HS + 200 IU / mL IL-2) was added to each T25 flask. After adding 50 μL of transact, the cells were cultured in a 37°C and CO2 incubator for 2 days to activate the T cells. Three days after electroporation, 2.5 mL of complete medium (AIM-V + 3% HS + 200 IU / mL IL-2) was added to each T25 flask, and the T25 flasks were continuously cultured upright in a 37°C and CO2 incubator. Six days after electroporation, 3 mL of complete medium (AIM-V + 3% HS + 200 IU / mL IL-2) was added to each T25 flask, and the T25 flasks were continuously cultured upright in a 37°C and CO2 incubator. Seven days after electroporation, the cells were suspended and transferred to FACS tubes at 1 mL per tube for FACS analysis. The remaining cells were continuously cultured upright in a T25 flask in a 37°C and CO2 incubator.

[0208] 3. FACS Analysis To analyze the gene transfer efficiency by the transposon system, FACS was performed 7 days after electroporation, which was carried out in the same manner as the FACS method described in Example D overall.

[0209] Example G. Further Verification of CAR-T Production Using pBat Transposon System 1. Test Substances and Cells pBat transposon 3M3-5M3-CD19 CAR containing the CD19 CAR gene was used as the pBat transposon plasmid, and the pBat transposase plasmid was co-introduced for the expression of the transposase. LK053 PBMC isolated from healthy donors and cryopreserved were used as the target cells to confirm the gene transfer efficiency of the transposon.

[0210] 2. Activation of T Cells after Electroporation The introduction of the 3M3-5M3-CD19 CAR transposon and transposase plasmid into PBMCs using electroporation and the activation of T cells after electroporation were performed in the same manner as described in Example F.

[0211] 3. FACS Analysis To analyze the gene transfer efficiency by the transposon system, FACS was performed 7 days after electroporation, which was carried out in the same manner as the FACS method described in Example D overall.

[0212] Example H. Verification of In Vitro Efficacy of CAR-T Cells Produced by pBat Transposon System 1. Cells CAR-T cells (LK053 CAR-T) that had been cultured for 2 weeks after introducing the CD19 CAR gene with the pBat transposon system in the same manner as in Example F or G were used. As a control group, cells (LK053 control) that had been subjected to the same electroporation and 2-week culture during the production of CD19 CAR-T cells were used.

[0213] 2. Thawing and Resting of T Cells Two vials each of LK053 control T cells stored in LN2 and CD19 CAR-T produced by the transposon system were thawed in a 37°C water bath. 18 mL each of medium (ALyS + 3% HS) was placed in two 50 mL tubes, and 2 mL each of the thawed cell suspension was slowly added. After centrifugation at 1,500 rpm for 5 minutes at room temperature, the supernatant was removed, and the cell pellet was suspended in 10 mL of medium (ALyS + 3% HS) to proceed with cell counting. Next, the cells were transferred to a T75 flask, and a total of 50 mL of medium (ALyS + 3% serum) was added to make it 1×10 7 cells / 10 mL, and then cultured in a 37°C and CO2 incubator for 1 day for stabilization.

[0214] 3. Co-culture of T Cells and B Cell Lines After culturing the BJAB cells, a CD19-expressing B cell line, they were collected into 15 mL tubes, centrifuged at 1,500 rpm for 5 minutes at room temperature to remove the supernatant, and the cell pellet was suspended in 2 mL of ALyS medium to proceed with cell counting. The cell suspension was further centrifuged at 1,500 rpm for 5 minutes at room temperature, the supernatant was completely removed, and the cell pellet was suspended in the medium (ALyS + 3% HS) to a concentration of 1×10 5 cells / 100 μL. The suspended BJAB cells were placed into a 96-well plate at 1×10 5 cells per well according to the conditions in Table 8. The control T cells and CD19 CAR-T cells stabilized in the above examples were each collected into 50 mL tubes, centrifuged at 1,500 rpm for 5 minutes at room temperature to remove the supernatant, and the cell pellet was suspended in 10 mL of the medium (ALyS + 3% HS), followed by cell counting. The control T cells and CD19 CAR-T cells were each divided into two 15 mL tubes containing 2×10 6 cells and 6×10 6 cells, respectively. Next, each cell suspension was centrifuged at 1,500 rpm for 5 minutes at room temperature, and the supernatant was completely removed. The cell pellet of 2×10 6 cells was suspended in 2 mL of the medium (ALyS + 3% HS) to a concentration of 1×10 5 cells / 100 μL, and the cell pellet of 6×10 6 cells was suspended in 1.5 mL of the medium (ALyS + 3% HS) to a concentration of 4×10 5 cells / 100 μL.

[0215] The prepared cells were added to the 96-well plate pre-aliquoted with BJAB cells at 100 μL per well according to the conditions in Table 8. The PMA / Iono group, which is the positive control group, was treated with 100 nM of PMA and 1 μg / mL of ionomycin and cultured in a 37 °C and CO2 incubator for 24 hours. After 24 hours, the plate was centrifuged at 1,500 rpm for 5 minutes at room temperature. To measure the amount of IFN-γ secreted when the CD19 CAR-T cells react with the target cells, 130 μL of the culture medium was collected from each well, transferred to a new 96-well plate, sealed with foil, and stored at -80 °C.

[0216]

Table 8

[0217] 4. IFN-γ ELISA assay The procedure was carried out according to the protocol of the Human IFN-gamma ELISA assay kit. The culture solution stored at -80°C in the above example was slowly thawed on ice. Standard IFN-γ was dissolved in 100 μL of nuclease-free water and prepared at a concentration of 20,000 pg / mL. IFN-γ at 20,000 pg / mL was diluted with assay diluent to prepare standard IFN-γ at concentrations of 1,500, 750, 375, 187.5, 93.75, 46.875, and 23.438 pg / mL, respectively. 20x wash buffer was diluted 1 / 20 with sterile distilled water to prepare 1x wash buffer. 200 μL of 1x wash buffer was added to each well of the IFN-γ ELISA plate, and the plate was inverted to remove the solution (the first wash). Next, 300 μL of 1x wash buffer was added, and the plate was inverted to remove the solution (the second wash). The above two washing processes were repeated twice for a total of four washes. When removing the final solution, a paper towel was used to completely remove the solution. The thawed culture solution was added to the washed IFN-γ ELISA plate at 100 μL per well. Next, 100 μL of standard IFN-γ at each concentration was added to two wells each. 100 μL of ALyS medium was added to the other two wells to prepare a blank. The plate cover was attached, and the reaction was carried out at room temperature for 2 hours. After the reaction, the plate was inverted to remove the culture solution. 200 μL of 1x wash buffer was added, and the plate was inverted to remove the solution (the first wash). Next, 300 μL of 1x wash buffer was added, and the plate was inverted to remove the solution (the second wash). The washing process was repeated twice for a total of four washes. When removing the final solution, a paper towel was used to completely remove the solution. During the washing process, the detection antibody was dissolved in 300 μL of nuclease-free water and diluted 1 / 20 with assay diluent for preparation. 100 μL of the diluted detection antibody was dispensed into each well of the washed plate, the plate cover was attached, and the reaction was carried out at room temperature for 2 hours.The plate was inverted to remove the culture medium. After adding 200 μL of 1x wash buffer, the plate was inverted again to remove the solution (the first wash). Next, 300 μL of 1x wash buffer was added, and the plate was inverted to remove the solution (the second wash). The washing process was repeated twice for a total of four washes. When removing the final solution, a paper towel was used to completely remove the solution. During the washing process, streptavidin-HRP was prepared by diluting it 1 / 20 with assay diluent. 100 μL of the diluted streptavidin-HRP was added to each well of the washed plate. The plate cover was attached, and the reaction was allowed to proceed at room temperature for 30 minutes. After the reaction, the plate was inverted to remove the culture medium. After adding 200 μL of 1x wash buffer, the plate was inverted again to remove the solution (the first wash). Next, 300 μL of 1x wash buffer was added, and the plate was inverted to remove the solution (the second wash). The washing process was repeated twice for a total of four washes. When removing the final solution, a paper towel was used to completely remove the solution. 100 μL of TMB was added to each well of the washed plate, and the reaction was allowed to proceed at room temperature for 5 minutes. 100 μL of stop solution was added to each well to terminate the reaction. The absorbance at 450 nm was measured using a Multiscan sky instrument, and the concentration was calculated.

[0218] Example I. Verification of Gene Transfer Efficiency by pBat transposon Transmission Form 1. Cells and DNA molecules Jurkat cells (ATCC, Cat No. TIB-152, Lot no. 70017560) were used as the target cells to confirm the gene transfer efficiency of the transposon. In the case of the transposon system, the pEGFP-C1 plasmid was used as a control group, and the following three transposons were used to confirm the gene transfer efficiency by the transposon delivery form: i) Transposon 3M3-5M3-GFP plasmid (plasmid form), ii) Transposon 3M3-5M3-GFP linear dsDNA (linear dsDNA form), and iii) Transposon 3M3-5M3-GFP minicircle dsDNA (minicircle dsDNA form). Also, for the expression of the transposase, the pBat transposase plasmid was co-introduced.

[0219] 2. Neon electroporation Jurkat cells in culture were collected in a 50 mL tube and centrifuged at 1,500 rpm for 5 minutes at room temperature. After removing the supernatant, the cell pellet was suspended in 10 mL of medium (RPMI + 10% FBS), and then cell counting was performed. 4×10 6 cells were transferred to a 15 mL tube, and medium (RPMI + 10% FBS) was added to a final volume of 2 mL, followed by centrifugation at 1,500 rpm for 5 minutes at room temperature. The supernatant was removed from the centrifuged sample, and the cell pellet was suspended in 5 mL of Opti-MEM and then centrifuged again at 1,500 rpm for 5 minutes at room temperature. Next, 3 mL of electrolytic buffer was placed in each Neon tube, and 400 μL of medium (RPMI + 10% FBS) was placed in each well of a 24-well plate. The supernatant was removed from the centrifuged Jurkat cell sample, and the cell pellet was suspended in Opti-MEM to a concentration of 1×10 5 cells / 100 μL. 4.2×10 5 cells of the resuspended cells were transferred to a 1.5 mL tube. DNA or mRNA for each condition was added to each 1.5 mL tube as shown in Table 9 at a ratio of 1×10 51 μg per cell was added. At this time, the total volume of the added DNA or mRNA was made not to exceed 10% (10 μL) of the electroporation volume (100 μL).

[0220] Next, a Neon tube containing electrolytic buffer was attached to the Neon instrument, and 100 μL of the cell suspension prepared using a Neon pipette and Neon tip was slowly aspirated and then inserted into the Neon instrument. Electroporation was carried out under the conditions of 1,600 V, 10 ms, and 3 pulses. The cells that completed electroporation were each seeded into a 24-well plate pre-dispensed with medium (RPMI + 10% FBS) and cultured in a 37 °C and CO2 incubator.

[0221] One day after electroporation, two wells (observation plates after 1 day) under each condition had their cells collected for FACS analysis, and the remaining two wells (observation plates after 7 days) had 1.5 mL of culture medium (RPMI + 10% FBS + 1x P / S) added to each well and were cultured in a 37 °C and CO2 incubator.

[0222] Seven days after electroporation, the medium in each well was pipetted to suspend the cells, and 1 mL of the cells in a total of 2 mL was collected. Then, 1 mL of culture medium (RPMI + 10% FBS + 1x P / S) was added to the remaining 1 mL of cell suspension per well and cultured in a 37 °C and CO2 incubator.

[0223] Eleven days after electroporation, the medium in each well was pipetted to suspend the cells, and 1 mL of the cells in a total of 2 mL was transferred to a new well. 1 mL of culture medium (RPMI + 10% FBS + 1x P / S) was added to all wells and cultured in a 37 °C and CO2 incubator.

[0224] Fourteen days after electroporation, the medium in each well was pipetted to suspend the cells, 1 mL of cells in a total of 2 mL was collected, and FACS analysis was performed.

[0225]

Table 9

[0226] 3. Observation of GFP expression using a fluorescence microscope The GFP fluorescence expressed in Jurkat cells was observed using a fluorescence microscope 1 day, 7 days, and 14 days after electroporation.

[0227] 4. FACS analysis FACS analysis was performed by observing GFP expression with a fluorescence microscope 1, 7, and 14 days after electroporation, and was carried out in the same manner as in the above examples.

[0228] Example J. Verification of Gene Transfer Efficiency of Antibody Gene by pBat transposon System 1. Cells and DNA molecules As target cells for confirming the gene transfer efficiency of the transposon, the HEK293 cell line (Korean Cell Line Bank, Cat no. KCLB21573 T, Lot no. 46269) was used.

[0229] To confirm the antibody gene transfer efficiency of the transposon system, the JWW-2 antibody was used as a representative example (JWW-2 human chimeric monoclonal antibody; Addgene, Cat no. 66749).

[0230] In addition, for the transposon system, the pEGFP-C1 plasmid was used as a control group. To confirm the gene transfer efficiency of different transposon systems, Transposon B3IS-B5IE-JWW-2, Transposon 3M3-5M3-JWW-2, Transposon 3M3-5M4-JWW-2, Transposon B3IS-B5IE-GFP, and Transposon 3M3-5M3-GFP into which the JWW antibody gene was inserted were used.

[0231] In addition, for the expression of the transposase, the pBat transposase plasmid was co-introduced.

[0232] 2. Neon electroporation After removing the medium from a 100π plate in which HEK293 cells had been cultured for 3 days, 4 mL of PBS was added to wash the plate and then removed. Next, 1 mL of Trypsin-EDTA was added and reacted at 37 °C in a CO2 incubator for 2 minutes. The cells that had completed the culture were collected in a 15 mL tube using a culture medium (DMEM + 10% FBS, 1x P / S), centrifuged at 1,500 rpm at room temperature for 5 minutes, and after removing the supernatant, the cells were suspended in 5 mL of PBS and cell counting was carried out. Further, it was centrifuged at 1,500 rpm at room temperature for 5 minutes, the supernatant was removed, and the cells were suspended in resuspension buffer to a concentration of 4×10 5 cells / 90 μL. One 1.5 mL tube was transferred with 26×10 5 cells, and six tubes were each transferred with 18×10 5 cells. 900 μL of medium (DMEM + 10% FBS) was placed in each well of a 6 well plate, and 3 mL of electrolytic buffer was dispensed into each Neon tube. Next, 1 μg per 4×10 5 cells prepared above was added to each tube according to the conditions shown in the following table.

[0233]

Table 9-1

[0234] Adjust the total volume to 100 μL per 4×10 5 using the resuspension buffer. Attach a Neon tube filled with electrolytic buffer to the Neon device. Slowly aspirate 100 μL of the cell suspension prepared above using a Neon pipette and a Neon tip, and then pierce the Neon device. After proceeding with electroporation under the conditions of 1,300 V, 20 ms, and 3 pulses, the completed HEK293 cells were each dispensed into a 6-well plate containing transfection medium and cultured in a 37 °C and CO2 incubator.

[0235] One day after electroporation, cells were collected from two wells in each group. For the group containing GFP, FACS analysis was performed to measure GFP, and for the group containing JWW-2, total RNA was extracted to confirm antibody expression. To each well from which a portion of the cells had been collected, 1 mL of culture medium (DMEM + 10% FBS, 1x P / S) was added and cultured in a 37 °C and CO2 incubator. Three days after electroporation, 1 mL of the culture medium was collected from each well and stored in a deep freezer to measure the expressed antibody, and the cells were passaged from one well to two wells and cultured in a 37 °C and CO2 incubator (passaged from two wells to four wells for each group). Seven days after electroporation, cells from two wells in each group were collected. For the group containing GFP, GFP expression was analyzed by FACS, and for the group containing JWW-2, total RNA was extracted. The cells in the remaining wells were passaged from one well to two wells and cultured in a 37 °C and CO2 incubator (passaged from two wells to four wells for each group). Ten days after electroporation, the culture medium was collected from each well in 15) and stored in a deep freezer.

[0236] 3. Observation of GFP expression using a fluorescence microscope and FACS analysis The GFP fluorescence expressed in Jurkat cells was observed using a fluorescence microscope 1 day, 7 days, and 10 days after electroporation. Protein observation using a fluorescence microscope and FACS analysis were performed in the same manner as in the above examples.

[0237] 4. Real time PCR analysis One day and 7 days after electroporation, total RNA was manually extracted from the collected HEK293 cells using the Rneasy kit. 1.0 μg of total RNA per premix tube was placed using a cDNA synthesis kit, and cDNA was synthesized as per the manual. A mixture for qPCR was prepared as follows.

[0238]

Table 9-2

[0239] The mixture from 3) was placed in each well of a 96-well plate for real time PCR. The plate was placed in qPCR equipment, and qPCR was carried out under the same conditions as below. After completion, melting analysis was carried out.

[0240]

Table 9-3

[0241] 5. ELISA assay The medium collected 3 days and 10 days after electroporation and stored frozen was slowly thawed on ice and centrifuged at 1,600 rpm for 5 minutes at 4°C. The supernatant was carefully taken and transferred to a new 1.5 mL tube. 600 μL of 1X assay diluent was added to the IgG1 standard vial to prepare a 300 ng / mL standard, which was diluted with 1X assay diluent as follows and prepared according to concentration.

[0242]

Table 9-4

[0243] 100 μL each of the standards and samples at each concentration were placed in duplicate in an ELISA plate. They were reacted at room temperature for 2 hours and 30 minutes with gentle shaking. The solution was removed, 300 μL of 1X wash solution was added to each well, washed, and then removed. The above process was further performed 3 times for a total of 4 washes. Next, 100 μL of 1X biotinylated IgG1 detection antibody was added to each well. They were reacted at room temperature for 1 hour with gentle shaking, and then the above washing process was performed 4 times in total. To each well of the washed samples, 100 μL of 1X HRP-Streptavidin solution was added and reacted at room temperature for 45 minutes with gentle shaking. After 4 washing processes, 100 μL of TMB one-step substrate reagent was added to each well. After reacting at room temperature for 30 minutes with gentle shaking, 50 μL of Stop solution was added to each well. The absorbance was measured at 450 nm, and the concentration of the JWW-2 antibody was analyzed.

[0244] Example K. Verification of Gene Transfer Efficiency by Vector Size of pBat transposon 1. Cells and DNA molecules Jurkat (ATCC, Cat No. TIB-152, Lot no. 70017560) was used as the target cells to confirm the gene transfer efficiency of the transposon. To confirm the gene transfer efficiency according to the vector size of the transposon, Transposon wild-type, Transposon B3IS-B5IE (7,562 bp), and Transposon EF1α-B3IS-B5IE-EGFP-KanR (4,149 bp) were used, and the pEGFP-C1 plasmid was used as the control group. Also, for the expression of the transposase, the pBat transposase plasmid was co-introduced.

[0245] 2. Neon electroporation To introduce the transposon vector into Jurkat cells, Neon electroporation was performed in the same manner as in Example B and the like. The experimental conditions are the same as those in the following table.

[0246] [Table 9-5]

[0247] 3. Fluorescence microscopy observation and FACS analysis To confirm the gene transfer efficiency for each transposon, fluorescence microscopy observation and FACS analysis were performed in the same manner as in the above examples.

[0248] [Experimental results] Experimental Example A. ITR Search and Function Verification 1. Fluorescence microscopy observation (Figures 2a - 2d) After transfection (electroporation) of the Intact transposon containing SEQ ID NO: 1 and SEQ ID NO: 2 and the transposase into T cells alone or together, GFP expression was confirmed by fluorescence microscopy on days 1, 2, 3, and 6. As a result, until day 3, it was judged that the expression was transient, as even the GFP control without ITR was expressed. However, on day 6, no GFP-expressing cells were observed in the GFP control, but it was confirmed that GFP was weakly expressed in the cells co-transfected with the transposon and the transposase, indicating that it was integrated into the cell chromosome through the ITR.

[0249] 2. FACS analysis (Figures 3a - 3e) The cells observed under a fluorescence microscope were analyzed by FACS to confirm the GFP expression rate. As a result, similar to the fluorescence microscopy observation results, on the 7th day, in the GFP control without ITR, almost no GFP was expressed, but in the cells co-transfected with the transposon and transposase, it was confirmed that GFP was expressed. Until 3 days after transfection, although there were differences to some extent, it was judged that GFP was transiently expressed as GFP was expressed not only in the pCAG-EGFP-ITR transposon but also in the GFP control without ITR. However, on the 6th day, in the GFP control without ITR, almost no GFP was expressed, and it was found that integration had occurred into the chromosome as GFP was expressed only in the cells co-transfected with the pCAG-EGFP-ITR transposon and transposase.

[0250] 3. GFP positive cell sorting and confirmation of GFP expression (Figure 5) After co-transfecting the pCAG-EGFP-ITR transposon and transposase together, the cells expressing GFP were sorted on the 7th day, and the sorted cells were further cultured for 10 days, and then GFP expression was confirmed by fluorescence microscopy. As a result, it was confirmed that GFP was continuously expressed in the cells co-transfected with the pCAG-EGFP-ITR transposon and transposase, and it was found that GFP was stably expressed by integration into the chromosome.

[0251] 4. Confirmation of the chromosomal DNA integration position using the Splinkerette PCR method (Figures 6a - 6d) After sorting, to confirm whether GFP-expressing cells were actually inserted into the chromosome by ITR, three clones were analyzed using splinkerette PCR. As a result of PCR, only a single band was confirmed, and the PCR product of this single band was sequenced and analyzed. As a result, it was confirmed that they were inserted into chromosomes 2, 12, and 14, respectively.

[0252] Experimental Example B. Production and Function Confirmation of ITR Mutant Through the above experimental examples, it was confirmed that the transposon discovered by the present inventors can transfer and insert genes into the chromosome of target cells. Therefore, in this experimental example, deletion mutants for the 3' ITR and 5' ITR regions of the transposon were produced, and by comparing the gene transfer efficiency of each mutant form, a mutant transposon with further improved function was attempted to be produced.

[0253] 1. Production of Mutant Forms for ITR The original transposon backbone vector map for producing transposon mutations according to the present invention is shown in Fig. 7a. Also, the types of transposon mutant vectors obtained by modifying the 5' ITR and 3' ITR of the pBat transposon are shown in Fig. 7b in general (including the 3' ITR mutant (reverse)).

[0254] In this experimental example, the ITR sequence of pBat was aligned with the ITR sequence of piggyBac to select a mutant form. At this time, the positions of IR / TR were predicted based on the known piggyBac ITR sequence. The mutant forms were designed by selecting positions that do not contain or contain the IT and TR sequences and are not aligned with piggyBac (Figs. 13a and 13b).

[0255] Four mutants with sequences of 13 bp, 33 bp, 71 bp, or 110 bp from the 5'-end were designed from the 5’ ITR (157 bp), and four mutants with sequences of 37 bp, 66 bp, 91 bp, or 151 bp were designed from the 3’ ITR (212 bp).

[0256] The sequences of each mutant are as follows. As described later, in the case of 3’ ITR mutants, mutants with antisense strands having the reverse complement sequence of the sense strand were accidentally introduced during plasmid production, so the sequences of these antisense strands are both described (the sequences denoted as “reverse” in Table 11 below).

[0257]

Table 10

Table 11

[0258] Plasmids for a total of 16 pBat transposon mutant forms were to be produced by combining the above-mentioned 5’ ITR and 3’ ITR as shown in Table 12. Each mutant gene was produced by commissioning Genscript for synthesis. At this time, in order to clone the mutant gene into the transposon original plasmid, a BamHI enzyme site was inserted in front of the 5’ ITR and a SalI enzyme site was inserted behind the 3’ ITR in the transposon vector. Then, the 5’ ITR mutant was produced by inserting BamHI and BspQI enzyme sites on both sides, and the 3’ ITR mutant was produced by inserting BmtI and SalI enzyme sites.

[0259] However, in the case of the 3’ ITR mutant, it must be cloned with the sense sequences of SEQ ID NOs: 3M1, 3M2, and 3M3. However, the 5’ to 3’ direction of the antisense strand sequence of the 3’ ITR (i.e., the reverse complement sequence) was cloned from the 5’ direction to the 3’ direction of the sense strand of the transposon and constructed with a plasmid starting with the 5’-ttaa-3’ sequence at the 5’ end of the 3’ ITR. Also, in the case of the 5M1 mutant form, the DNA size was small and it was not cloned. Therefore, the plasmid containing the 5M1 mutant did not progress, while the 3’ ITR mutant progressed to the plasmid containing the reverse sequence and was designated with an “r” in the name.

[0260]

Table 12

[0261] 2. Observation of GFP expression in Jurkat cells 7 days after transfection Seven days after transfection, GFP expression in Jurkat cells was observed using a fluorescence microscope and analyzed by FACS. As shown in Fig. 8a, no GFP expression was observed in the negative control group that underwent only electroporation without plasmid, and it was confirmed that GFP was very weakly expressed in the positive control group that underwent electroporation with a plasmid containing GFP (pEGFP). In the group transfected with only the pBat transposon without transposase, GFP expression was also very low, and no GFP expression was observed in the group transfected with only transposase without the piggyBac transposon (pBac). On the other hand, as shown in Figs. 8b to 8e, high-level GFP expression was confirmed in all groups containing the 5M4 mutant form, and GFP expression was also observed in the remaining transposon mutant forms (in reverse). In addition, 7 days after transfection, FACS analysis was performed to confirm the percentage of Jurkat cells expressing GFP. The analysis method was as shown in Figure 9a, singlets → cells → live cells → GFP. + The analysis was performed by gating on live cells. + The percentage of cells was analyzed by histogram. As a result, 7 days after transfection, the percentage of GFP-expressing cells was only 0.5% and 1.6% in the pEGFP group and the group transfected with only pBat transposon, respectively, and the percentage of GFP-expressing cells was 0% in the pBac group, confirming that there were almost no stable cells expressing GFP (Figure 9a and Table 13). On the other hand, in the group transfected with the pBat mutant transposon according to the present invention, it was confirmed that GFP-expressing cells were present even 7 days after transfection (Figures 9b to 9e).

[0262] 3. Observation of GFP expression in Jurkat cells 14 days after transfection 14 days after transfection, FACS analysis was performed to confirm the percentage of Jurkat cells expressing GFP. The analysis results showed that 14 days after transfection, the percentage of GFP-expressing cells was 0.4% and 0.8% in the pEGFP group and the group transfected with only pBat transposon, respectively, while the percentage of GFP-positive cells in the pBac group was 0%, revealing that there were almost no cells expressing GFP (Figure 10a). On the other hand, in the group transfected with the pBat mutant transposon according to the present invention, it was confirmed that GFP-expressing cells were present even 14 days after transfection (Figures 10b to 10e).

[0263] Taking the above results into consideration, the percentage of GFP-expressing cells in each group over time after transfection is shown in Table 13 and FIG.

[0264]

Table 13

[0265] 4. Confirmation of GFP expression after single cell sorting and culture Fourteen days after transfection, Jurkat cells expressing GFP in the r3M1 - B5IE, r3M1 - 5M3, r3M1 - 5M4, r3M3 - B5IE, and r3M3 - M4 treatment groups were each transferred to a 96 - well plate and then single cell sorted (Figure 12a). Next, the cells sorted into single cells were cultured for an additional 14 days, and then GFP expression was observed. As a result, it was confirmed that the cells in the r3M1 - B5IE group stably expressed GFP even 31 days after the transfection of the transposon (Figure 12b).

[0266] In this experimental example, based on the transposons discovered through Experimental Example A, a transposon vector with excellent chromosomal insertion efficiency and gene expression efficiency was produced. For this purpose, the 5’ ITR and 3’ ITR of the transposon were each modified to produce 4 types of 5’ ITR mutants and 4 types of 3’ ITR mutants. However, in the case of the 3’ ITR mutant, the 5’ - to - 3’ direction of the antisense strand sequence of the 3’ ITR, rather than the sense strand, was cloned in the 5’ - to - 3’ direction of the sense strand of the transposon and produced with a plasmid starting with the 5’ - ttaa - 3’ sequence at the 5’ end of the 3’ ITR (denoted by "r" in the name). A total of 16 types of transposon vectors were produced by combining the 5’ ITR mutant and the 3’ ITR mutant, and their gene transfer efficiencies were evaluated.

[0267] As shown in the experimental results, after transfection with the transposon vector, almost no GFP expression was confirmed in the control group after the 7th day. On the other hand, in the cells into which the transposon mutation and transposase according to the present invention were introduced, it was confirmed that the GFP gene was inserted into the chromosome of Jurkat cells and GFP was stably expressed. In particular, relatively high GFP expression was confirmed in the cells into which the transposon vector containing 5M4 was introduced.

[0268] In addition, the cells into which the transposon vector according to the present invention was introduced maintained GFP expression even after 14 days had passed after transfection. In particular, it was confirmed that GFP was stably expressed even in the cells transfected with the vector containing the 3’ ITR sequence in the reverse direction.

[0269] The above results indicate that the transposon vector according to the present invention can introduce a target gene into the chromosome of a cell and induce stable expression.

[0270] Experimental Example C. Production and Function Verification of ITR mutant In this experimental example, in the same manner as in Experimental Example B, mutants of the transposon discovered by the present inventors were produced, and mutants with further enhanced chromosomal insertion efficiency and gene expression efficiency were produced. In particular, in this experimental example, different from Experimental Example B, the 3’ ITR mutant was cloned with the sense strand sequence to produce a vector with a sudden difference.

[0271] 1. Production of mutant form for ITR The mutant form was designed in the same manner as in Experimental Example B overall (FIGS. 13a and 13b). Based on the alignment analysis results of the ITR sequences of pBat and piggyBac respectively, four types of 5’ ITR mutations and four types of 3’ ITR mutations were produced.

[0272] The sequences of each of the four 5’ ITR mutations are the same as those shown in Table 10 above (5M1, 5M2, 5M3, and 5M4), and the sequences of each of the four 3’ ITR mutations are the same as those shown in Table 11 above (3M1, 3M2, 3M3, and 3M4).

[0273] An attempt was made to produce a total of 26 pBat transposon mutant forms by combining the 5’ ITR mutations and 3’ ITR mutations respectively (Table 14). For this purpose, the genes of each mutant form were synthesized by commissioning Genscript, and a BamHI site was inserted in front of the 5’ ITR and a SalI site was inserted behind the 3’ ITR in the transposon vector in order to clone the ITR mutant into the transposon original plasmid. Then, the 5’ ITR mutant was produced using the BamHI and EcoRV, and the 3’ ITR mutant was produced using the BmtI and SalI restriction enzymes.

[0274] Also, in this experimental example, different from Experimental Example B cloned with the antisense sequence of the 3’ ITR mutant, cloning was carried out with the sense sequence of the 3’ ITR mutant (3M1, 3M2, 3M3, and 3M4).

[0275]

Table 14

[0276] 2. Observation of GFP expression in Jurkat cells 7 days after transfection The constructed transposon vector was introduced into Jurkat cells through electroporation (Neon transfection). Seven days after electroporation, to confirm the gene transfer efficiency of the transposon, GFP expression in Jurkat cells was observed using a fluorescence microscope and analyzed by FACS. As a result of the analysis, as shown in Fig. 14a, no GFP expression was observed in the negative control group (Control) that underwent only electroporation without plasmid, and weak GFP expression was confirmed in the positive control group transfected with the GFP expression plasmid (pEGFP). Even in the group transfected with only the pBat transposon without transposase, GFP expression was very low, and low GFP expression was also observed in the group co-electroporated with transposase and intact pBat (original) (pBat control). On the other hand, in the group electroporated with the mutant transposon according to the present invention, GFP was generally detected, and particularly high-level GFP expression was observed in the groups containing the 5M3 or 5M4 mutant form (Figs. 14b to 14f).

[0277] Seven days after electroporation, FACS analysis was performed to confirm the proportion of Jurkat cells expressing GFP. As shown in Fig. 15a, gating and analysis were performed in the order of singlets→cells→live cells→GFP + cells. Then, the proportion of GFP + cells in live cells was analyzed by histogram. As a result of the analysis, seven days after transfection, in the pEGFP group, the proportion of GFP-expressing cells was approximately 2%, and in the group transfected with only the pBat transposon and the pBat control group, it was only about 1% (Fig. 15a).

[0278] Set the reference close to GFP-(negative) to determine GFP +As a result of checking the ratio of cells, it was confirmed that GFP was generally expressed at a high level in the group into which the transposon mutant according to the present invention was introduced (Figs. 15b to 15f). In particular, in the case of the group into which the transposon containing the 5M3 or 5M4 mutant was introduced, there was a cell population expressing GFP at high intensity. Therefore, the ratio of GFP-expressing cells was confirmed by setting a standard close to high intensity. As a result, GFP expression was confirmed in the group into which the transposon containing the 5M3 or 5M4 mutant (including B3IS, 3M1, 3M2, or 3M3 in the 3' ITR) was introduced, and when compared with the group treated with the transposon containing B5IE, 5M1, or 5M2, the ratio of high-intensity GFP + cells was significantly higher.

[0279] GFP-expressing cells in the first well sample of each group were sorted into single cells in a 96-well plate and cultured, and the proliferated cells were collected, frozen, and stored in a liquid nitrogen tank.

[0280] Observation of GFP expression in Jurkat cells 14 days after transfection Fourteen days after transfection, GFP expression in Jurkat cells was observed using a fluorescence microscope and analyzed by FACS. As a result of the analysis, as shown in Fig. 16a, GFP expression was not observed in the negative control group that underwent only electroporation without plasmid, and GFP was hardly observed in the positive control group that underwent electroporation with a plasmid containing GFP (pEGFP), or in the group that underwent transfection with only the pBat transposon without transposase. In the group that underwent co-transfection of transposase and intact pBat (original) (pBat control), GFP was observed at a very low level. On the other hand, it was confirmed that GFP was generally expressed in the group that underwent electroporation with the transposon mutant according to the present invention. In particular, high-level GFP expression was confirmed in the group containing the 5M3 or 5M4 mutant form (Figs. 16b to 16f).

[0281] In addition, as a result of performing FACS analysis to confirm the proportion of Jurkat cells expressing GFP, in the pEGFP group, the group that underwent transfection with only the pBat transposon, and the pBat control group, the proportion of GFP-expressing cells was all only about 1%, and it was confirmed that there were almost no cells expressing GFP (Fig. 17a).

[0282] Setting the standard close to GFP-(negative) to confirm the proportion of GFP + cells, as a result, in the group into which the transposon mutant according to the present invention was introduced, GFP was generally expressed at a high level (Figs. 17b to 17f). In particular, it was shown that the group into which the transposon containing the 5M3 or 5M4 mutant form was introduced had a higher proportion of GFP-positive cells than the other groups. Also, when setting the standard close to High intensity to confirm the proportion of GFP + cells, the same tendency was confirmed as a result.

[0283] Taking the above results into consideration, the percentage of GFP expressing cells in each group over time after transfection is shown in Table 15 and Figures 17g and 17h. As can be seen from the tables and figures, transposons containing the 5M3 or 5M4 mutant forms showed particularly high gene transfer efficiency.

[0284] [Table 15]

[0285] In this experiment, a transposon vector with excellent intrachromosomal insertion efficiency and gene expression efficiency was constructed based on the transposon discovered in Experiment A. To this end, four 5'ITR mutants and four 3'ITR mutants were constructed by modifying the 5'ITR and 3'ITR of the transposon, respectively. The 5'ITR mutants and 3'ITR mutants constructed were all identical to those constructed in Experiment B, except that the 3'ITR mutant was not cloned using a reverse complement sequence as in Experiment B, but was cloned using a forward sequence (sense strand sequence) as originally intended. A total of 26 transposon vectors were constructed by combining the 5'ITR mutants and 3'ITR mutants, and their gene transfer efficiency was evaluated.

[0286] As shown in the experimental results, after transfection with the transposon vector, almost no GFP expression was confirmed in the control group after the 7th day. On the other hand, in the cells into which the transposon mutation and transposase according to the present invention were introduced, it was generally confirmed that the GFP gene was inserted into the chromosome of Jurkat cells and GFP was stably expressed. In particular, in the cells into which the transposon vector containing 5M3 or 5M4 was introduced, relatively high GFP expression was confirmed compared to the cells into which other transposon vectors containing the original transposon were introduced. That is, this suggests that the portions corresponding to 5M3 and 5M4 among the ITRs are essential regions for transposon gene transfer and chromosomal insertion, indicating that the transposon mutation vector according to the present invention can introduce a target gene into the chromosome of a cell and induce stable expression.

[0287] Experimental Example D. Verification of Gene Transfer Efficiency of pBat Transposon in PBMC As described in Example D, an attempt was made to confirm the gene transfer efficiency by the pBat transposon system in PBMC using Maxcyte equipment. For this purpose, the gene transfer efficiency of the mutant form transposon was compared using transposons containing the GFP gene (Naive-GFP, 3M3-5M3-GFP) and transposons containing the 1G4 TCR gene (B3IS-B5IE-1G4, 3M3-5M3-1G4).

[0288] 1. Observation of GFP expression using a fluorescence microscope GFP expression was observed by fluorescence microscopy 1 day and 7 days after electroporation in the pBat-GFP group. It was confirmed that GFP was expressed in all of the pEGFP and pBat-GFP groups 1 day after electroporation, as shown in Fig. 18a. 7 days after electroporation, as shown in Fig. 18b, GFP was not observed in the pEGFP group, but GFP expression was observed in the pBat-GFP group. This is presumably because the GFP gene within the ITR of the transposon vector was inserted into the chromosome of PBMCs by transposase and stably expressed. Also, judging from the stronger GFP expression in the 3M3-5M3-GFP group than in the Naive-GFP group, the 3M3-5M3 vector with a mutated ITR sequence seems to have high gene insertion and expression efficiency.

[0289] 2. Observation of changes in cell viability and cell count After Maxcyte electroporation, cell counting was performed 1 day and 14 days after electroporation to confirm changes in cell viability and cell count. As shown in Table 16 below, 1 day after electroporation, the NO EP group (the group without electroporation) and the control group (the group with only electroporation) showed a high viability of over 90%, while the pEGFP group showed a viability of 69.5%. In the groups transfected with the pBat transposon, all showed a low viability of approximately 33% - 62%. The cell count was also counted as less than 1×10 6 in all of the pEGFP group and the pBat transposon groups (excluding the 3M3-5M3-1G4+DNA group), indicating a decrease of over 75% compared to the initially seeded PBMC cell count (4×10 6 ). On the other hand, 14 days after electroporation, a good viability of over 88% was confirmed in all groups, and the cell count in the pBat-GFP group was also about 2×10 6 ~6×10 6cells, and it was confirmed that the pBat-1G4 group had approximately 3.8×10 6 ~12×10 6 cells. As the cells proliferated during the culture period, it was confirmed that the total cell number increased overall. In particular, it was shown that the cells proliferated more in the pBat-1G4 group. The above results are judged to be because the cells were damaged by electroporation and the survival rate decreased significantly one day later, but they proliferated while recovering during the culture period, and after 14 days, both the cell survival rate and the number increased. Also, since the added feeder cells (irradiated A375 cells) express HLA*02:01 and NY-ESO1, which are the counter partners of 1G4 TCR, it is judged that the T cells expressing 1G4 TCR were activated and proliferated by the feeder cells.

[0290]

Table 16

[0291] 3. FACS analysis of the pBat-GFP group 7 days after electroporation Seven days after electroporation, the expression ratio of GFP was confirmed through FACS analysis. As shown in Fig. 19a, singlets→lymphocyte→live cells→CD3 + T cells→GFP + T cells→CD8 + T cells were gated in this order, and the gene transfer efficiency to CD3 + T cells was confirmed, and the ratio of CD8 + cytotoxic T cells among the T cells to which the gene was transferred was also analyzed.

[0292] Seven days after electroporation, the ratio of cells expressing GFP among CD3 + T cells was 0% in the control group and 0.47% in the pEGFP group (Fig. 19a). On the other hand, in the Naive-GFP+DNA group, GFP +The proportions of T cells were confirmed to be 6.94% and 3.61%, and in the 3M3-5M3-GFP+DNA group, they were 2.58% and 6.43%, and it was confirmed that they were increased compared to the control group (Figure 19b). Also, GFP + Among T cells, CD8 + As a result of confirming the proportion of T cells, it was confirmed that the pBat naive group was about 35% and the pBat 3M3-5M3 group was about 60%. Through this, it was determined that in the pBat-GFP group, the T cells into which the GFP gene was transferred did not specifically proliferate, but rather the proliferation of T cells occurred randomly.

[0293] Also, singlets→lymphocyte→live cells→CD3 + CD8 + T cells or CD3 + CD8 - T cells→GFP + Cells were gated, and 7 days after electroporation, CD3 + CD8 + T cells and CD3 + CD8 - The gene transfer efficiency in T cells was analyzed. As a result, as shown in Figures 20a and 20b, the proportions of GFP + CD8 + T cells and CD3 + CD8 - T cells in GFP + cells were about 1% - 8% for each group, showing no significant difference.

[0294] 4. FACS analysis of the pBat 1G4 group 7 days after electroporation 7 days after electroporation, the expression proportion of 1G4 TCR was confirmed through FACS analysis. The analysis method was, as shown in Figure 21a, singlets→lymphocyte→live cells→CD3 + T cells→mTCRβ + T cells→CD8 + T cells in order to gate CD3 +The gene transfer efficiency into T cells was confirmed, and the proportion of CD8 + cytotoxic T cells among the gene-transferred T cells was also analyzed.

[0295] Seven days after electroporation, among CD3 + T cells, the proportion of mTCRβ + cells was 0% in the control group, while it was 40.7% and 35.8% in the B3IS-B5IE-1G4+DNA group, and 53.7%, 50.2%, 68.8%, and 55.1% in the 3M3-5M3-1G4+DNA group. It was confirmed that the proportion of mTCRβ+ cells was the highest in the combination of 3M3-5M3-1G4 transposon and transposase DNA (Figure 21a and Figure 21b). Also, in the mTCRβ + T cell population, the proportion of CD8 + T cells was analyzed, and as a result, it was confirmed that they were present at a similar proportion of approximately 61 - 69% overall.

[0296] Furthermore, seven days after electroporation, to analyze the proportion of CD8 + T cells and CD8 - T cells that express mTCRβ, singlets→lymphocyte→live cells→CD3 + CD8 + T cells or CD3 + CD8 - T cells→mTCRβ+ cells were gated to analyze the gene transfer efficiency in each T cell. As a result, as shown in Figure 22a and Figure 22b, the proportion of mTCRβ + CD8 + T cells or CD3 + CD8 - T cells was higher in CD3 + CD8 + CD8 - T cells than in CD3 + CD8 + T cells.

[0297] 5. FACS analysis of the pBat-GFP group 14 days after electroporation 14 days after electroporation, CD3 + Among T cells, the proportion of cells expressing GFP was 0% in both the control and pEGFP groups. On the other hand, in the Naive-GFP+DNA group, the proportions of CD3 + T cells expressing GFP were 1.62% and 5.24%, and in the 3M3-5M3-GFP+DNA group, they were 0.81% and 4.31%. The same trend as observed 7 days after electroporation was confirmed (Figs. 23a and 23b). No significant difference was observed between the pBat naive group and the pBat 3M3-5M3 group, and for GFP + Among T cells, CD8 + The proportion of T cells was confirmed to be approximately 41% in the pBat naive group and approximately 60% in the pBat 3M3-5M3 group. Also, 14 days after electroporation, CD3 + CD8 + T cells and CD3 + CD8 - As a result of analyzing the gene transfer efficiency in T cells, as shown in Figs. 24a and 24b, for CD3 + CD8 + T cells and CD3 + CD8 - The proportion of GFP + cells in T cells was approximately 1% - 10%, and there was no difference.

[0298] 6. FACS analysis of the pBat 1G4 group 14 days after electroporation 14 days after electroporation, the expression ratio of 1G4 TCR was confirmed through FACS analysis. The analysis method was, as shown in Fig. 25a, singlets→lymphocyte→live cells→CD3 + T cells→mTCRβ + T cells→CD8 + T cells in that order for gating, and then CD3 +The gene transfer efficiency into T cells was confirmed, and the proportion of CD8 + cytotoxic T cells among the gene-transferred T cells was also analyzed.

[0299] Fourteen days after electroporation, the proportion of mTCRβ + cells among CD3 + T cells was 0% in the control group, 25.1% and 27.2% in the B3IS-B5IE-1G4+DNA group, and 42.1%, 36.0%, 50.0%, and 35.3% in the 3M3-5M3-1G4+DNA group. Although it was slightly decreased overall compared to 7 days after electroporation, it was confirmed that the proportion of mTCRβ + cells was the highest in the combination of 3M3-5M3-1G4 transposon and transposase DNA (Figure 25a and Figure 25b). Also, as a result of analyzing the proportion of CD8 + T cells among mTCRβ + T cells, it was confirmed that it was approximately 75% - 90% overall, with no significant difference between groups, and it increased overall compared to 7 days after electroporation. This is judged to be the result of an increase in CD8 + T cells expressing 1G4 TCR by the feeder cells added during culture.

[0300] Also, 14 days after electroporation, the gene transfer efficiency in CD3 + CD8 + T cells and CD3 + CD8 - T cells was analyzed. As a result, as shown in Figure 26a and Figure 26b, the proportion of mTCRβ + cells in CD3 + CD8 + T cells was higher than that in CD3 + CD8 - T cells, and the proportion of mTCRβ + CD8 + cells among CD3 +The proportion of cells was the same as that 7 days after electroporation, but for CD3 + CD8 - Among the T cells, the proportion of mTCRβ + cells decreased significantly in all groups compared to the results 7 days later.

[0301] As can be seen from the above results, 1 day after electroporation, the cell number and viability were relatively lower in the groups containing the transposon and transposase (plasmid DNA) compared to the negative control group. However, while the cells proliferated during the culture period, 7 days after electroporation, the number of cells into which the transposon and transposase were introduced increased significantly, and the viability also increased compared to the negative control group. After adding irradiated A375 cells as feeder cells and culturing, and then observing GFP or 1G4 TCR expression 1 day after electroporation, the proportion of GFP-expressing cells among CD3 + T cells was 1 - 7% on day 7 and 0.8 - 6% on day 14. On the other hand, the proportion of 1G4 TCR-expressing cells among CD3 + T cells was 14 - 69% on day 7 and 10 - 50% on day 14 after electroporation, showing a very high level. Thus, the reason why the proportion of 1G4 TCR-expressing cells is particularly high compared to the proportion of GFP-expressing cells is judged to be that the feeder cell A375 cells express NY-ESO-1, which is the target antigen of 1G4 TCR, and the T cells activated by the antigen proliferated actively. This suggests that when transferring genes to primary T cells using the pBat transposon system, higher gene transfer efficiency can be obtained when the gene-introduced T cells are stimulated with antigens etc. during the culture period.

[0302] CD3 + Among the T cells, CD8 + Moreover, gene transfer to CD8 or CD8-T cells was CD8 at both 7 and 14 days after electroporation.- CD8 from T cells + The gene transfer efficiency into T cells was even higher. In addition, as a result of comparing the gene transfer efficiency by the mutant form of the transposon, it was confirmed that the ratio of 1G4 TCR-expressing T cells was the highest in the group into which the 3M3-5M3-1G4 transposon was introduced. The above results indicate that the transposon system according to the present invention exhibits an excellent gene transfer function even in PBMCs.

[0303] Experimental Example E. Confirmation of gene transfer efficiency according to the activation timing of T cells during TCR-T production using the pBat transposon system When producing 1G4 TCR-T cells by transferring the 1G4 TCR gene into PBMCs of healthy subjects using the pBat transposon system, it was confirmed whether there were differences in the transfer and expression efficiency of the 1G4 TCR gene depending on the timing of T cell activation.

[0304] 1. 1G4 TCR expression analysis 7 days after electroporation Since the constant region of the TCR used in the experiment is the mouse constant region, the expression ratio of 1G4 TCR was confirmed through FACS analysis using an antibody against this, and the analysis method was singlets → live cells → lymphocytes → CD3 + T cells → mTCRβ + Gating was performed in the order of T cells, and the gene transfer efficiency into CD3 + T cells was confirmed. 7 days after electroporation, in all the groups in which T cells were activated using irradiated A375 cells, the cell proliferation rate was visually observed to be low at the time of observation, and as shown in Fig. 27, among CD3 + mTCRβ in T cells + T cells were hardly observed.

[0305] 2. 1G4 TCR expression analysis 10 days after electroporation 10 days after electroporation, CD3 +Among T cells, the expression efficiency of the 1G4 TCR gene was confirmed, and T cells expressing 1G4 TCR (CD3 + mTCRβ + T cells) were analyzed for the proportion of CD8 + or CD4 + T cells. Also, the proportion of memory-type T cells was analyzed using the CD45RA and CD62L markers.

[0306] Ten days after electroporation, the proportion of cells expressing mTCRβ among CD3 + T cells was 0% for all of the No EP, EP only, and 3M3-5M3-GFP+DNA (1 day later) groups, as shown in Figure 28. On the other hand, the proportion of mTCRβ-expressing cells in the 3M3-5M3-1G4+DNA (immediately after) group was 56%, and the 3M3-5M3-1G4+DNA (1 day later) group was 20%. It was confirmed that the proportion of mTCRβ-expressing cells was even higher in the group where irradiated A375 cells were added immediately after electroporation.

[0307] Also, as a result of measuring the proportion of CD8 + T cells and CD4 + T cells among 1G4 TCR-expressing T cells, it was confirmed that the 3M3-5M3-1G4+DNA (immediately after) group was 22% and 73% respectively, and the 3M3-5M3-1G4+DNA (1 day later) group was 28% and 67% respectively. It was confirmed that the proportion of CD4 + T cells was about 3 times higher than that of CD8 + T cells.

[0308] Memory-type T cells can be classified using the CD45RA and CD62L markers. When distinguishing memory-type T cells using the CD45RA and CD62L markers, CD45RA + CD62L - T cells are Teff, CD45RA - CD62L +T cells are Tem, CD45RA - CD62L + T cells are Tcm, CD45RA + CD62L + T cells are classified into Tscm cells. Among the T cells expressing 1G4 TCR, the proportions of memory type T cells were as follows: in the 3M3-5M3-1G4+DNA (immediately) group, Teff 0%, Tem 2%, Tcm 79%, and Tscm 20%; in the 3M3-5M3-1G4+DNA (1 day later) group, Teff 0%, Tem 5%, Tcm 82%, and Tscm 13%. It was confirmed that Tcm cells were the most abundant and Tscm cells were the second most abundant (Table 17).

[0309]

Table 17

[0310] 3. Analysis of 1G4 TCR expression 14 days after electroporation 14 days after electroporation, among CD3 + T cells, the proportion of cells expressing mTCRβ was all 0% in the No EP, EP only, and 3M3-5M3-GFP+DNA (1 day later) groups as shown in Figure 29. On the other hand, in the 3M3-5M3-1G4+DNA (immediately) group and the 3M3-5M3-1G4+DNA (1 day later) group, the proportions of mTCRβ-expressing cells among CD3 + T cells were 73% and 15% respectively. Similar to the results 10 days after electroporation, it was confirmed that the proportion of mTCRβ-expressing cells was even higher in the group where irradiated A375 cells were added immediately after electroporation.

[0311] CD8 within 1G4 TCR-expressing T cells + T cells and CD4 +The proportions of T cells were 21% and 75% respectively in the 3M3-5M3-1G4+DNA (immediately after) group, and 34% and 62% respectively in the 3M3-5M3-1G4+DNA (1 day after) group. Similar to the results on the 7th day of electroporation, it was found that the proportion of CD4 + T cells was about 2 to 3 times higher than that of CD8 + T cells.

[0312] When memory type T cells were classified using CD45RA and CD62L markers, the proportions of memory type T cells within 1G4 TCR-expressing T cells were Teff 0%, Tem 3%, Tcm 77%, and Tscm 20% in the 3M3-5M3-1G4+DNA (immediately after) group, and Teff 5%, Tem 14%, Tcm 59%, and Tscm 22% in the 3M3-5M3-1G4+DNA (1 day after) group. As a result, Tcm cells were the most abundant, and Tscm cells were the second most abundant (Table 18).

[0313]

Table 18

[0314] Taking the above results together, when comparing the cell survival rates 7 days, 10 days, and 14 days after electroporation of the cells co-cultured with feeder cells after vector introduction by electroporation, as shown in Figure 30a, it was confirmed that the survival rate decreased 7 days later and then gradually recovered in the groups excluding the No EP and EP only groups. As shown in Figure 30b, the proportion of 1G4 TCR-expressing T cells was the highest overall 10 days and 14 days after in the 3M3-5M3-1G4+DNA (immediately after) group. The above results indicate that activating T cells by adding feeder cells immediately after electroporation is more advantageous for gene transfer and expression than adding feeder cells more than 1 day after introducing the transposon and transposase plasmids into cells by electroporation.

[0315] Experimental Example F. Production of CAR-T using the pBat transposon system In the above experimental example, it was confirmed that TCR-T cells can be produced by transferring the TCR gene to PBMC using the pBat transposon system. Next, it was attempted to confirm whether the transposon system of the present invention can effectively transfer other genes in addition to the TCR gene to produce genetically modified T cells. For this purpose, in this example, the TCR gene between the 5' ITR and 3' ITR in the 3M3-5M3 transposon vector was replaced with the CD19 CAR gene to produce a 3M3-5M3-CD19 CAR vector. For gene transfer, the 3M3-5M3-CD19 CAR transposon vector and the transposase vector were both electroporated into PBMC using Maxcyte equipment. During the culture, the ratio of CAR-T cells expressing CD19 was confirmed, and the CAR-T production efficiency by the pBat transposon system was attempted to be confirmed.

[0316] 1. CD19 CAR expression analysis 7 days after electroporation Seven days after electroporation, the expression of CD19 CAR was confirmed through FACS analysis. The analysis method was singlets → live cells → lymphocytes → CD3 as shown in Figure 31 + T cells → FLAG + T cells → CD8 + Or CD4 + Gating was performed in the order of T cells to confirm the efficiency of CD19 CAR gene transfer to CD3 + T cells, and the ratio of CD8 among the T cells into which the gene was transferred + Or CD4 + T cells was also analyzed. Since the FLAG tag sequence is located between the leader sequence and CD19scFv in the CD19 CAR gene of the transposon vector, the expression of the CD19 CAR protein was confirmed with an anti-FLAG tag antibody.

[0317] 7 days after electroporation, CD3 + The percentage of cells expressing FLAG among T cells was confirmed to be 0% in the EP only negative control group that underwent only electroporation (EP) without plasmid, regardless of the timing of T cell activation. On the other hand, in the group where 3M3-5M3 CD19 CAR was introduced by electroporation and then T cells were activated (3M3-5M3 CD19 CAR), the percentage of FLAG-positive CD3 + cells appeared very high at 59%. The percentage of CD8 + cells and CD4 + cells among FLAG-expressing T cells was 38% and 57% respectively, confirming that there were many CD4 + T cells (Figure 31).

[0318] 2.Confirmation of the percentage of CD19 CAR-expressing cells 7 days after electroporation 7 days after electroporation, the percentage of CD19 CAR-expressing T cells in the 3M3-5M3-CD19 CAR group was confirmed. As shown in Figure 32a, a very high level of approximately 59% was confirmed in the group into which 3M3-5M3-CAR was introduced. Also, as a result of comparing the percentage of CD8 + or CD4 + cells among CD19 CAR-expressing T cells, it was found that the percentage of CD4 + cells was higher than that of CD8 + cells (Figure 32b). Through the above results, it was confirmed that the transposon system according to the present invention can effectively transfer and express not only the TCR but also the CAR gene into cells. In particular, it is judged that when T cells are activated after introducing the transposon and transposase by electroporation, the gene transfer and expression efficiency can be further improved.

[0319] Experimental Example G. Further verification of CAR-T production using the pBat transposon system Similar to the above examples, the gene was introduced into PBMCs using the transposon system of the present invention containing the CAR gene, and it was further verified whether CAR-T cells were effectively produced.

[0320] 1.Confirmation of the total number of cultured cells after electroporation Seven days after electroporation, the results of confirming the viability and total number of cultured cells are shown in Table 19 below.

[0321]

Table 19

[0322] 2.CD19 CAR protein expression analysis 7 days after electroporation In the CD19 CAR gene inserted into the transposon vector, since the FLAG tag gene exists between the leader sequence and CD19scFv, cells into which the gene was introduced and expressed were confirmed by FACS using an anti-FLAG tag antibody. The analysis method was, as shown in Figure 33, singlets→live cells→lymphocyte→CD3 + T cells→FLAG + T cells were gated in that order, and the transfer efficiency of the CD19 CAR gene into CD3 + T cells was confirmed. Also, using CD8 and CD4 markers, the proportion of CD19 CAR-expressing T cells (CD3 + FLAG + T cells) that were CD8 + or CD4 + T cells was analyzed, and the proportion of memory type T cells was also analyzed using CD45RA and CCR7 markers. When classifying memory type T cells using CD45RA and CCR7 markers, CD45RA + CCR7 - T cells are Teff (Effector T cell), CD45RA - CCR7 +T cells include Tem (Effect memory T cell), CD45RA - CCR7 + T cells include Tcm (Central memory T cell), CD45RA + CCR7 + T cells are classified into Tscm (Stem cell like memory T cell). Seven days after electroporation, CD3 + The percentage of cells expressing FLAG among T cells was 0% in the EP only group, which was the negative control group that only underwent electroporation (EP) without plasmid, as shown in Fig. 33. On the other hand, in the 3M3 - 5M3 CD19 CAR group (「CD19 CAR+DNA」) into which a transposon and a transposase vector containing the CD19 CAR gene were introduced, the percentage of FLAG-expressing cells reached 65%. And in the CD19 CAR+DNA group, the percentages of CD8 + T cells and CD4 + T cells were 27% and 71% respectively, confirming that there were relatively more CD4 + T cells. Also, in the CD19 CAR+DNA group, the percentages of memory type T cells among FLAG-expressing T cells were Teff 3%, Tem 12%, Tcm 76%, and Tscm 10%. It was confirmed that Tcm cells were the most abundant and Tscm cells also existed at about 10%.

[0323] After electroporation of the transposon vector and the transposase vector containing the CD19 CAR gene, the T cells were activated, and the results of confirming the cell viability on the 7th day after electroporation are shown in Fig. 34a, the results of confirming the percentage of CD19 CAR-expressing T cells are shown in Fig. 34b, and the results of confirming the percentage of memory type T cells are shown in Fig. 34c. Through the above results, it was confirmed that the transposon system according to the present invention can effectively transfer not only TCR but also CAR gene into cells, and the transferred gene is normally expressed. Therefore, it is expected that CAR-T cells can be produced with high yield when using the transposon system of the present invention.

[0324] Experimental Example H. Confirmation of the in vitro efficacy of CAR-T cells produced using the pBat transposon system Through the above examples, it was confirmed that the pBat transposon system can effectively transfer TCR, CAR gene, etc. into target cells, and CAR-T cells, etc. can be produced with excellent yield using this. Therefore, in this example, the reactivity of CAR-T cells produced by the pBat transposon system against the target antigen was confirmed to check whether CAR-T cells produced by the transposon system according to the present invention actually perform normal functions. Specifically, after co-culturing control T cells or CD19 CAR-T cells with the BJAB cell line, which is a B cell expressing CD19, for 24 hours, an IFN-γ ELISA assay was performed with 100 μL of the culture solution to confirm the reactivity of CAR-T cells against the antigen. As can be seen from FIG. 35, IFN-γ was not measured when only control T cells were cultured alone or only BJAB was cultured alone. Also, in the group where control T cells and BJAB cells were co-cultured, IFN-γ was measured, but its concentration was very low, at 40 pg / mL or less. On the other hand, it was found that the IFN-γ concentration increased significantly when CD19 CAR-T cells produced by the transposon system according to the present invention and BJAB cells were co-cultured. In particular, when the ratio of CAR-T cells to BJAB cells was 1:1, the average concentration of IFN-γ was 385 pg / mL, and when the ratio was 1:4, it was confirmed to be an average of 535 pg / mL. It was found that the concentration of IFN-γ increased as the ratio of CAR-T cells increased.

[0325] That is, in the case of control T cells, even when co-cultured with BJAB cells, IFN-γ was produced at a very low level, indicating that the T cells did not show special reactivity to the antigen. However, for the CAR-T cells produced with the transposon of the present invention, when co-cultured with BJAB cells, the IFN-γ level increased significantly, confirming that the CAR-T cells effectively recognized and activated the antigen. The above results support that the transposon system of the present invention can be used to produce CAR-T cells showing excellent antigen reactivity.

[0326] Experimental Example I. Confirmation of gene transfer efficiency according to the pBat transposon transmission form Through the above experimental examples, it was confirmed that the transposon system according to the present invention can effectively transfer genes, and through this, cells into which foreign genes such as CAR-T cells are introduced can be produced. From this, in this example, it was confirmed whether there are differences in the efficiency of gene transfer depending on the form of the transposon using various forms of transposons.

[0327] 1. Observation of GFP expression in Jurkat cells 7 days after electroporation After introducing various transposons into cells through electroporation, it was observed under a fluorescence microscope whether GFP was expressed in the group into which the transposon containing GFP was introduced 7 days later. As shown in Fig. 36a, in the No EP group (negative control group) without electroporation (EP), GFP was not expressed as on the first day. In the pEGFP group (positive control group 1) into which the GFP plasmid was introduced, GFP was expressed very weakly. In the GFP mRNA group (positive control group 2) into which GFP mRNA was introduced, no GFP signal was detected. In the groups into which the transposon containing GFP was introduced (3M3-5M3-GFP plasmid, 3M3-5M3-GFP linear dsDNA, 3M3-5M3-GFP minicircle dsDNA), weak GFP signals were detected. Also, 7 days after electroporation, GFP expression in Jurkat cells was confirmed by FACS analysis. Specifically, as shown in Fig. 36b, gating was performed in the order of singlets→cells→live cells→GFP + cells, and the analysis was carried out. GFP - (negative) was used as a reference to determine the proportion of GFP-expressing cells. As a result, as shown in Fig. 36b, in the No EP group, there were no GFP-expressing cells; in the pEGFP group, the proportion of GFP-expressing cells was 8%; and in the GFP mRNA group, it was 0%. In the group transfected with the 3M3-5M3-GFP transposon, the proportion of GFP-expressing cells was observed to be 15% in the plasmid group, 5% in the linear dsDNA group, and 4% in the minicircle dsDNA group. It was confirmed that the proportion of GFP-expressing cells was the highest in the group transfected with the plasmid-form transposon.

[0328] Also, 7 days after electroporation, there were cells with strong GFP intensity. By setting a reference close to high intensity, the proportion of GFP-expressing cells was compared. As a result of confirming the proportion of high-intensity GFP-expressing cells according to the delivery form of the 3M3-5M3-GFP transposon, it was confirmed that it was 11% in the plasmid group, 4% in the linear dsDNA group, and 3% in the minicircle dsDNA group. That is, similar to the above results, it was found that the GFP gene transfer efficiency was the highest in the group transfected with the plasmid-form transposon.

[0329] 2. Observation of GFP expression in Jurkat cells 14 days after electroporation Next, 14 days after electroporation, fluorescence microscopy was used to observe whether GFP was expressed in the group transfected with the transposon containing the GFP gene. As shown in Fig. 37a, GFP was not detected in the No EP group and the GFP mRNA group, and hardly any GFP was observed in the pEGFP group either. On the other hand, high levels of GFP signals were detected in all the cells transfected with the 3M3-5M3-GFP transposon. In particular, GFP was expressed at the highest level in the plasmid group, and it was confirmed that the linear dsDNA group and the minicircle dsDNA group were expressed relatively weakly compared to the plasmid group.

[0330] Also, 14 days after electroporation, GFP expression in Jurkat cells was confirmed by FACS analysis. Specifically, as shown in Fig. 37b, gating was performed in the order of singlets→cells→live cells→GFP + cells, and the analysis was carried out. GFP - (negative) was used as a reference to determine the proportion of GFP-expressing cells. As a result, as shown in Fig. 37b, no GFP-expressing cells were found in the No EP group, and hardly any GFP was expressed in the pEGFP group and the GFP mRNA group either. On the other hand, GFP expression was confirmed in the group transfected with the 3M3-5M3-GFP transposon. Specifically, it was confirmed that the proportion of GFP-expressing cells in the plasmid group was 10%, in the linear dsDNA group was 4%, and in the minicircle dsDNA group was 3%. The trend was the same as the result after 7 days, and in particular, it was confirmed that the proportion of GFP-expressing cells was the highest in the group transfected with the plasmid-form transposon.

[0331] Next, as observed 7 days after electroporation, the ratio of GFP-expressing cells was compared by setting the intensity of GFP close to high intensity. The ratio of high-intensity GFP-expressing cells due to the transmission form of the 3M3-5M3-GFP transposon was observed to be 9% in the plasmid group, 4% in the linear dsDNA group, and 3% in the minicircle dsDNA group. Similarly, it was confirmed that the plasmid form of the transposon was the highest in the group into which it was introduced, and cells expressing GFP were maintained as they were even after 7 days.

[0332] 3. Comparison of GFP expression by time after electroporation 7 days or 14 days after electroporation, the ratio of GFP-expressing cells in the GFP-transposon group was compared by setting the reference close to GFP - (negative). As a result of the comparison, it was confirmed that the ratio was 4% - 24% after 7 days and 3% - 19% after 14 days, and it was confirmed that the ratio of GFP-expressing cells gradually decreased (Figure 38a). As a result of comparing the ratio of GFP-expressing cells due to the transmission form of the 3M3-5M3-GFP transposon, it was revealed that the ratio of GFP-expressing cells in the plasmid group was about 2.5 times higher than that in the linear dsDNA group and the minicircle dsDNA group. It was found that the gene transfer efficiency was the best when the transposon was transmitted in plasmid form.

[0333] Also, when the proportion of GFP-expressing cells in the GFP-transposon group was compared by setting the criterion close to GFP high intensity 7 days or 14 days after electroporation, it was confirmed that the proportion was 2% - 18% 7 days later and 2% - 16% 14 days later, indicating that the proportion of GFP-expressing cells was similar (Figure 38b). In the case of the proportion of GFP-expressing cells depending on the delivery form of 3M3-5M3-GFP transposon, considering that it was approximately twice as high in the plasmid group as in the linear dsDNA group and the minicircle dsDNA group, it was reconfirmed that the gene transfer efficiency was the best when the transposon was delivered in the plasmid form. Also, considering that the proportion of cells expressing at GFP high intensity 7 days and 14 days later was almost similar in all groups, it was judged that the cells in which the GFP gene was integrated into the chromosome of Jurkat cells by transposase on the 7th day maintained the same state until the 14th day.

[0334] As can be seen from the above, after electroporation, the gene transfer efficiency depending on the delivery form of 3M3-5M3-GFP transposon was compared on the 7th and 14th days when the gene was inserted into the cell chromosome and stably expressed. As a result, it was confirmed that the transposons in the minicircle DNA, linear DNA, and plasmid forms all effectively transferred the gene to the target cells, and it was confirmed that the transfer efficiency was particularly higher when transferred with the plasmid-form transposon.

[0335] Experimental Example J. Confirmation of the transfer efficiency of antibody genes using the pBat transposon system As a result of confirming the gene transfer and expression efficiency of pBat transposon mutation through the above examples, it was confirmed that the transposon system according to the present invention can effectively transfer genes of receptor proteins such as TLR as well as GFP gene and genes of chimeric antibodies such as CAR into target cells (Jurkat cells, PBMC, etc.). Furthermore, it was found that the gene transfer efficiency of 3M3-5M3 or 3M3-5M4 mutant transposons is particularly high. Therefore, it was attempted to confirm whether these improved mutant transposon vectors can effectively transfer other antibody genes such as the JWW-2 antibody gene, and in particular, to confirm whether the gene transfer and expression efficiency are high even in HEK293 cells that are frequently used for large-scale protein production.

[0336] 1. Observation of GFP expression by time after electroporation in HEK293 cells One day, 7 days, and 10 days after electroporation, GFP expression was observed using a fluorescence microscope. As a result of the analysis, as shown in Fig. 39a, in the No EP group, which is a negative control group that underwent only electroporation (EP) without a plasmid, GFP expression was not observed at any time. In the positive control group (pEGFP group) that was electroporated with the pEGFP plasmid, GFP was well expressed 1 day after electroporation, but it was confirmed that it decreased significantly 7 days and 10 days later. As a result of confirming the transposon group containing the GFP gene, the B3IS-B5IE-GFP group had good GFP expression 1 day later, but the GFP expression level decreased slightly 7 days and 10 days later. In contrast, the group treated with the mutant transposon 3M3-5M3-GFP (3M3-5M3-GFP group) showed high-level GFP expression throughout all periods from 1 day to 10 days. The above results indicate that the transposon system according to the present invention exhibits an excellent gene transfer function.

[0337] Furthermore, as a result of confirming GFP expression in HEK293 cells by FACS analysis, as shown in Fig. 39b, one day after electroporation, GFP was not expressed at all in the No EP group, the proportion of GFP-expressing cells in the pEGFP group was about 52% on average, about 36% in the B3IS-B5IE-GFP group, and about 44% in the 3M3-5M3-GFP group. And seven days after electroporation, as a result of further measuring the proportion of GFP-expressing cells, the pEGFP group was about 43% on average, the B3IS-B5IE-GFP group was about 19%, and the 3M3-5M3-GFP group was about 38%. In particular, it was confirmed that the B3IS-B5IE-GFP group had weak GFP intensity, while the 3M3-5M3-GFP group had relatively high GFP expression intensity and a large proportion of expressing cells.

[0338] 2. Observation of mRNA expression of JWW antibody after electroporation in HEK293 cells One day and seven days after electroporation, total RNA was isolated from HEK293 cells, and mRNA expression of JWW-2 was confirmed by qPCR. As a result of the analysis, as shown in Fig. 40a, it was confirmed that the JWW-2 gene was amplified only in the transposon group containing the JWW-2 gene. One day after electroporation, the mRNA expression of the JWW-2 gene was the highest in the B3IS-B5IE-JWW-2 group, followed by the 3M3-5M3-JWW-2 group and the 3M3-5M4-JWW-2 group in that order. However, seven days after electroporation, it was confirmed that the JWW-2 mRNA expression level was the highest in the 3M3-5M3-JWW-2 group, followed by the 3M3-5M4-JWW-2 group and the B3IS-B5IE-JWW-2 group in that order.

[0339] 3. Observation of protein expression of JWW antibody after electroporation in HEK293 cells Three days and ten days after electroporation, the culture medium in which HEK293 cells were cultured was collected, and the JWW-2 antibody protein secreted from HEK293 cells was quantified. Specifically, an ELISA assay was performed using an antibody targeting human IgG1, which is the Fc region of the JWW-2 antibody. As shown in Figure 40b, three days after electroporation, human IgG1 was detected in all transposon groups containing the JWW-2 antibody gene, except for the EP only group. Particularly in the case of the 3M3-5M3-JWW-2 group, the JWW-2 protein level was the highest at 1.6 ng / mL three days after electroporation and 0.9 ng / μL ten days after electroporation. It was confirmed that the 3M3-5M4-JWW-2 group was 1.2 ng / mL three days after and 0.5 ng / mL ten days after. And it was confirmed that the B3IS-B5IE-JWW-2 group was 0.5 ng / mL three days after and 0 ng / mL ten days after. Therefore, it was confirmed that the cells transfected with the JWW-2 gene using the transposon system according to the present invention all expressed the JWW-2 antibody at a high level, and particularly the gene transfer efficiency was high in the group using the mutant transposon.

[0340] In the above experimental example, as a result of confirming the gene transfer and expression efficiency study for pBat transposon mutation using the GFP gene, it was confirmed in Jurkat cells that the transposon system according to the present invention is excellent in all gene transfer functions, and the gene transfer efficiency of 3M3-5M3 or 3M3-5M4 mutant transposons is particularly high. Therefore, it was attempted to confirm whether these improved mutant transposon vectors have high gene transfer and expression efficiency for the JWW-2 antibody gene instead of the GFP gene and in HEK293 cells, which are widely used for protein production, instead of Jurkat cells. As described above, it was confirmed that the proportion of cells expressing GFP was higher in the 3M3-5M3-GFP transposon vector than in the B3IS-B5IE-GFP transposon vector both 7 days and 10 days after electroporation. Through this, it was confirmed that the gene transfer efficiency of mutant transposons is high not only in Jurkat cells but also in HEK293 cells.

[0341] Also, one day after electroporation, the expression of JWW-2 mRNA was confirmed that B3IS-B5IE-JWW-2, 3M3-5M3-JWW-2, and 3M3-5M4-JWW-2 all had good expression of JWW-2 mRNA by transient expression. On the other hand, seven days after electroporation when the JWW-2 gene was inserted into the chromosome of HEK293 cells by transposase and stably expressed, the expression of JWW-2 mRNA decreased compared to the ratio of transient expression on the first day, but it was confirmed that the expression was maintained. It was observed that the amount of JWW-2 mRNA expressed by chromosomal insertion in the 3M3-5M3-JWW-2 transposon vector, which is a mutant transposon vector from the B3IS-B5IE-JWW-2 transposon vector, was slightly higher. And the expression of JWW-2 antibody protein was observed to be the same at three days and ten days after electroporation, and the concentration of JWW-2 antibody protein expressed by chromosomal insertion in the 3M3-5M3-JWW-2 and 3M3-5M4-JWW-2 transposon vectors, which are mutant transposon vectors, was higher than that in the B3IS-B5IE-JWW-2 transposon vector. In particular, it was confirmed to be high in the 3M3-5M3-JWW-2 transposon vector. Therefore, it was confirmed that the improved transposon vectors (3M3-5M3, 3M3-5M4) produced through ITR mutation can transfer antibody genes and other various genes such as receptor genes and CAR genes into target cells effectively and induce their expression.

[0342] Experimental Example K. Confirmation of gene transfer efficiency according to the vector size of the pBat transposon Through the above experimental examples, it was confirmed that the transposon vector according to the present invention can effectively transfer various genes such as antibody genes, receptor genes, and CAR genes into target cells and induce their expression.

[0343] When transferring DNA into cells, it is generally known that the smaller the size of the DNA, the higher the transfer efficiency into the nucleus (McLenachan et al., 2007). Therefore, in order to confirm whether the size of the transposon vector of the present invention affects gene transfer efficiency, after minimizing the size of the transposon vector, it was confirmed whether the gene transfer efficiency increases. To minimize the size of the Transposon vector, the IRES and puromycin resistance gene were removed, one ori site was removed to reduce the total number of ori sites from two to one, the CAG promoter was changed to the EF1α promoter, and for use in clinical trials, the ampicillin resistance gene was changed to the kanamycin resistance gene. As a result, the size of the transposon vector of the present invention was reduced from the conventional 7,562 bp size to 4,149 bp size.

[0344] 1. Observation of GFP expression in Jurkat cells 1 day after electroporation One day after electroporation, it was observed under a fluorescence microscope whether GFP was expressed. As a result, as shown in Fig. 41a, it was confirmed that GFP was expressed in all groups except the EP only group in which only electroporation (EP) was performed without plasmid. Also, one day after electroporation, GFP expression in Jurkat cells was confirmed by FACS analysis. As shown in Fig. 41b, singlets→cells→live cells→GFP +Cells were gated in order and analyzed. As a result of the analysis, it was confirmed that GFP was not observed at all in the EP only group, and the percentage of GFP-expressing cells was about 31.8% in the pEGFP group. In the group transfected with the pBat transposon vector and the transposase vector, differences appeared depending on the size of the transposon vector. In the group transfected with the wild-type transposon vector (wild-type), it was confirmed that the percentage of GFP-expressing cells was 14.9%. In the group transfected with the vector in which enzyme sites were added to the genes outside the 5’ ITR and 3’ ITR of the transposon vector (B3IS-B5IE), it was 20.7%. In the group transfected with the vector in which the size of the transposon vector was reduced from 7,562 bp to 4,149 bp (B3IS-B5IE small), it was confirmed to be 47.8%. That is, it was confirmed that when the size of the transposon vector is small, the percentage of GFP-expressing cells is high.

[0345] 2. Observation of GFP expression in Jurkat cells 7 days after electroporation Seven days after electroporation, it was observed with a fluorescence microscope whether GFP was expressed. As a result, as shown in Fig. 42a, it was confirmed that GFP was expressed in all groups except the EP only group (Fig. 42a). Seven days after electroporation, the GFP expression in Jurkat cells was confirmed by FACS analysis (Figure 42b). As a result, GFP was not observed in the EP only group, and the proportion of GFP-expressing cells in the pEGFP group was confirmed to be approximately 1.3%. On the other hand, in the Wild-type group, the proportion of GFP-expressing cells was 2.9%, in the B3IS-B5I E group it was 3.2%, and in the B3IS-B5IE small group it was 8.2%. It was found that the GFP expression level was even higher compared to the control group. In particular, it was found that the proportion of GFP-expressing cells was high in the B3IS-B5IE small group with a small transposon vector size.

[0346] 3. Observation of GFP expression in Jurkat cells 14 days after electroporation Fourteen days after electroporation, it was observed with a fluorescence microscope whether GFP was expressed. As a result, as shown in Figure 43a, GFP expression was not observed in the EP only group and the pEGFP group, and GFP-expressing cells were confirmed in all groups using the transposon. Fourteen days after electroporation, the GFP expression in Jurkat cells was confirmed by FACS analysis (Figure 43b). As a result of the analysis, GFP expression was not observed in the EP only group and the pEGFP group. On the other hand, in the groups using the transposon, GFP expression was confirmed in all of them, indicating that the gene was inserted into the cell chromosome by the transposon and stably expressed. In particular, in the Wild-type group, the proportion of GFP-expressing cells was 2.0%, in the B3IS-B5IE group it was 2.0%, but in the B3IS-B5IE small group it was 8.0%. It was confirmed that when the transposon vector size was small, the proportion of GFP-expressing cells was the highest.

[0347] 4. Comparison of GFP expression ratios in Jurkat cells When comparing the percentages of GFP-expressing cells over time after electroporation, as shown in Fig. 44a, there is a tendency for a gradual decrease in all groups, with 10% - 32% after 1 day, 4% - 17% after 7 days, and 0% - 10% after 14 days. However, in the group treated with the transposon, it was confirmed that the GFP gene was stably expressed even 14 days after electroporation. In particular, it was confirmed that the percentage of GFP-expressing cells was highest in the B3IS-B5IE small group with a relatively small transposon vector size at 1 day, 7 days, and 14 days. Also, it was confirmed that the percentage of high-intensity GFP-expressing cells was significantly higher in the groups using the transposon compared to the control group (Fig. 44b).

[0348] As described above, it was found that the percentage of target gene (GFP)-expressing cells was highest in the group treated with a small-sized transposon vector up to 14 days after electroporation. Specifically, it was found that the percentage of GFP-expressing cells increased by 2-fold and 4-fold, respectively, in the B3IS-B5IE small group using a vector with a relatively small size compared to the B3IS-B5IE group at 7 days and 14 days after electroporation when the GFP gene was inserted into the Jurkat cell chromosome and stably expressed. This indicates that the smaller the transposon vector size, the higher the gene transfer efficiency of the pBat transposon. Table 20 below shows the main sequence information described in this specification.

[0349]

Table 20-1

Table 20-2

Table 20-3

Table 20-4

Industrial Applicability

[0350] The present invention relates to a transposon vector, a transposon system containing the same, a transposon kit, a cell into which the transposon vector has been inserted, and uses thereof. It has been confirmed that an exogenous gene can be effectively transmitted into the chromosome of a target cell to produce genetically modified cells at a high yield, and thus the present invention has been completed. In particular, the transposon according to the present invention can effectively transmit a gene encoding TCR or CAR to immune cells. Through this, it has been confirmed that cells expressing the TCR or CAR exhibit high reactivity to antigens. Therefore, it is expected that various TCR-T cells and CAR-T cells can be produced using the transposon system according to the present invention. In particular, conventional CAR-T cells required high costs not only for CAR production but also for transmission to target cells. However, when using the transposon of the present invention, CAR-T cells with low cost and high yield can be obtained. Therefore, by reducing the production cost of CAR-T cell therapeutics, the price of the therapeutics can be reduced. Furthermore, it has been confirmed that the transposon of the present invention can effectively transmit an antibody gene such as a tumor virus-target neutralizing antibody to HEK293 cells used for mass production of antibodies. Therefore, various antibodies can be easily produced in large quantities through the transposon of the present invention. In particular, since the transposon according to the present invention has no limitation on the types of genes that can be transmitted as a gene delivery mediator, in addition to antibody genes, etc., it is expected to be actively utilized for the development of genome-modified cell lines that express various genes according to the purpose.

Claims

1. A 5' ITR (5' Inverted terminal repeat) consisting of 71 or more and 157 or less consecutive nucleic acid sequences in the 5' to 3' direction among the nucleic acid sequences represented by SEQ ID NO: 1; and a 3' ITR (3' Inverted terminal repeat) consisting of 66 or more and 212 or less consecutive nucleic acid sequences in the 3' to 5' direction among the nucleic acid sequences represented by SEQ ID NO: 2, a transposon vector.

2. The transposon vector according to claim 1, wherein the vector is the following (i) or (ii): (i) The 5' ITR is as follows: A 5' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 1; A 5' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 5; or A 5' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 6, selected from, or (ii) The 3' ITR is as follows: A 3' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 2; A 3' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 9; A 3' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 10; or A 3' ITR consisting of the nucleic acid sequence represented by SEQ ID NO: 11, selected from, is a transposon vector.

3. The transposon vector according to claim 1 or 2, wherein the 5' ITR contains one or more of the nucleic acid sequences represented by SEQ ID NO: 7, 5'-ACACTTGG-3', or SEQ ID NO:

8.

4. The transposon vector according to claim 1 or 2, wherein the 3' ITR contains one or more of the nucleic acid sequences represented by SEQ ID NO: 13 or SEQ ID NO:

14.

5. The nucleic acid sequence of the 5' ITR is characterized by being contained in the 5' to 3' direction upstream of the position where the exogenous DNA molecule in the transposon vector is inserted. The transposon vector according to claim 1 or 2.

6. The nucleic acid sequence of the 3' ITR is characterized by being contained in the 5' to 3' direction downstream of the position where the exogenous DNA molecule in the transposon vector is inserted. The transposon vector according to claim 1 or 2.

7. The transposon vector according to claim 1 is characterized by containing one or more exogenous DNA molecule sequences at the lower part of the 5' ITR and the upper part of the 3' ITR.

8. The exogenous DNA molecule sequence is any one or more selected from the group consisting of a therapeutic polypeptide coding sequence, an siRNA coding sequence, an miRNA coding sequence, a reporter protein coding sequence, an antigen-specific receptor coding sequence, a recombinant antibody coding sequence, a neutralizing antibody coding sequence, an immune checkpoint inhibitor coding sequence, a cytokine receptor coding sequence, a CAR (Chimeric Antigen Receptor) coding sequence, and a TCR (T-cell receptor) coding sequence. The transposon vector according to claim 7.

9. The transposon vector contains a promoter, one or more exogenous DNA molecules, and a polyA signal, and is characterized in that the 5' ITR, the promoter, the exogenous DNA molecule, the polyA signal, and the 3' ITR are sequentially operably linked. The transposon vector according to claim 1.

10. The transposon vector according to claim 1 is characterized by being a circular plasmid, linearized dsDNA (double-stranded DNA), hairpin dsDNA, or minicircle dsDNA.

11. The transposon vector according to claim 1, wherein the transposon vector has a size of 1,000 to 5,000 bp.

12. A 5' ITR (5' Inverted terminal repeat) consisting of 71 or more and 157 or less consecutive nucleic acid sequences in the 5' to 3' direction among the nucleic acid sequences represented by SEQ ID NO: 1; and a 3' ITR consisting of a nucleic acid sequence represented by any one of SEQ ID NOs: 15 to 17. A transposon vector containing.

13. a) The transposon vector according to claim 1 into which an exogenous DNA molecule has been inserted; and b) A transposon system for transmitting an exogenous DNA molecule, comprising a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase protein.

14. The transposon system for transmitting a target DNA according to claim 13, wherein the transposase protein contains the amino acid sequence represented by SEQ ID NO:

18.

15. a) The transposon vector according to claim 1 into which an exogenous DNA molecule has been inserted; and b) A cell into which a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase protein has been introduced.

16. The cell according to claim 15, wherein the exogenous DNA molecule is excised from the transposon vector by the transposase, and the excised exogenous DNA molecule is inserted into the genome of the cell.

17. The cell according to claim 15, wherein the cell is selected from the group consisting of T cells, NK cells, B cells, dendritic cells, macrophages, and mast cells.

18. The cell according to claim 15, wherein the cell is co-cultured with feeder cells after the transposon vector is introduced. **Claim 19** The cell according to claim 18, wherein the feeder cell is a cell irradiated with radiation. **Claim 20** The cell according to claim 15, wherein the cell expresses the exogenous DNA molecule for 7 days or more after the introduction of the transposon vector. **Claim 21** a) The transposon vector according to claim 1, into which an exogenous DNA molecule is inserted; and b) A method for inserting an exogenous DNA molecule sequence into the genome of a cell, comprising introducing into an isolated cell a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase protein. **Claim 22** The method for inserting a target DNA sequence into the genome of a cell according to claim 21, wherein the introduction is performed using electroporation. **Claim 23** The method for inserting a target DNA sequence into the genome of a cell according to claim 21, further comprising co-culturing the cell into which the transposon vector is inserted with feeder cells after the introduction step. **Claim 24** The method for inserting a target DNA sequence into the genome of a cell according to claim 23, wherein the step of co-culturing with the feeder cells is performed immediately after the introduction step. **Claim 25** The method for inserting a target DNA sequence into the genome of a cell according to claim 21, wherein the transposon vector is a circular plasmid, linearized dsDNA (double-stranded DNA), hairpin dsDNA, or minicircle dsDNA. **Claim 26** a) The transposon vector according to claim 1, into which an exogenous DNA molecule is inserted; and b) A pharmaceutical composition for the prevention or treatment of cancer, comprising as an active ingredient immune cells into which a nucleic acid molecule containing a transposase protein or an array encoding a transposase protein has been introduced, wherein the exogenous DNA molecule is one or more selected from the group consisting of a tumor antigen-specific CAR (Chimeric Antigen Receptor) coding sequence, a tumor virus-specific neutralizing antibody coding sequence, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific TCR (T-cell receptor) coding sequence. A pharmaceutical composition for the prevention or treatment of cancer, characterized by the above.

27. The tumor antigen is one or more selected from the group consisting of CD19, NY-ESO-1, EGFR, TAG72, IL13Rα2 (Interleukin 13 receptor alpha-2 subunit), CD52, CD33, CD20, TSLPR, CD22, CD30, GD3, CD171, NCAM (Neural cell adhesion molecule), FBP (Folate binding protein), Le(Y) (Lewis-Y antigen), PSCA (Prostate stem cell antigen), PSMA (Prostate-specific membrane antigen), CEA (Carcinoembryonic antigen), HER2 (Human epidermal growth factor receptor 2), Mesothelin, CD44v6 (Hyaluronate receptor variant 6), B7-H3, Glypican-3, ROR1 (receptor tyrosine kinase like orphan receptor 1), Survivin, FOLR1 (folate receptor), WT1 (Wilms' tumor antigen), VEGFR2 (Vascular endothelial growth factor 2), tumor virus antigen, TP53, KRAS, and neoantigen, and is a pharmaceutical composition for preventing or treating cancer according to claim 26.

28. a) The transposon vector according to claim 1 into which an exogenous DNA molecule has been inserted; and b) Use for the manufacture of a medicament for treating cancer of immune cells into which a nucleic acid molecule containing a transposase protein or a sequence encoding a transposase protein has been introduced, The use for the manufacture of a medicament for cancer treatment, wherein the exogenous DNA molecule is one or more selected from the group consisting of a tumor antigen-specific chimeric antigen receptor (CAR) coding sequence, a tumor virus-specific neutralizing antibody coding sequence, an immune checkpoint inhibitor coding sequence, and a tumor antigen-specific T-cell receptor (TCR) coding sequence.

Images