Recombinant C-reactive protein
Recombinant CRP with 55% or more N-terminal pyroglutamylation addresses inaccuracies in high CRP concentration measurements, improving diagnostic agent accuracy and reducing contamination risks.
Patent Information
- Application Number
- JP2021561228
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-08-21
- Filing Date
- 2020-10-23
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2040-10-23
AI Technical Summary
Existing methods for quantifying C-reactive protein (CRP) concentrations, particularly in high concentration ranges, face inaccuracies due to the use of natural CRP purified from human body fluids, which can introduce contamination risks and variability, and recombinant CRP measurements yield lower values than actual concentrations.
The use of recombinant CRP with 55% or more of its N-terminal pyroglutamylated to improve measurement accuracy in high CRP concentration ranges, utilizing latex immunoturbidimetry by converting the N-terminal structure through pyroglutamylation.
Enhances the accuracy of CRP concentration measurements in high concentration ranges, making recombinant CRP suitable for diagnostic agents and calibrators by reducing deviations to within 5% of natural human CRP values.
Smart Images

Figure 0007697371000010 
Figure 0007697371000011 
Figure 0007697371000012
Abstract
Description
Technical Field
[0001] The present invention relates to C-reactive protein (hereinafter also referred to as "CRP") produced by genetic recombination technology and its uses. More specifically, the present invention relates to recombinant CRP with a converted N-terminal structure of CRP, a calibrator using the recombinant CRP, a control serum, and a method for quantifying CRP by an antigen-antibody reaction.
Background Art
[0002] CRP is a protein that shows a precipitation reaction with the C polysaccharide of the capsule of Streptococcus pneumoniae, and is also known as a typical inflammatory marker because it is a type of acute-phase protein. In infectious diseases and inflammatory diseases, the blood concentration of CRP increases significantly, and decreases rapidly as the disease condition recovers. Therefore, the quantification of CRP serves as an indicator for determining the severity of various diseases and observing the course of treatment. The CRP concentration in the blood of healthy individuals is generally 0.3 mg / dL or less, but in the case of patients with inflammation or inflammatory diseases, it can increase rapidly several hundred to several thousand times in a short period of time. For this reason, in the measurement of CRP in a sample, it is required to accurately measure CRP at a wide range of concentrations from low to high concentrations.
[0003] As a method for quantifying the blood CRP concentration in the clinical laboratory field, there are measurement methods using antigen-antibody reactions, such as enzyme immunoassay, chemiluminescent immunoassay, latex immunoturbidimetry, immunochromatography, etc. In particular, among these measurement methods, latex immunoturbidimetry is widely used in routine tests because the operation is simple and automation of measurement by an analyzer is possible. In latex immunoturbidimetry, the blood CRP concentration is quantified from a calibration curve using a calibrator with a known concentration, and the accuracy of the calibration curve is ensured by measuring a control serum.
[0004] In the above calibrator and control serum, natural CRP purified from human body fluids such as ascites is used. However, there is a risk that serum components other than CRP are mixed in, which may affect the measurement of blood CRP concentration. In addition, since human body fluids used as biological raw materials are handled during the isolation and purification of CRP, there is also a risk of secondary pathogenic infections, and there are also issues regarding safety in manufacturing. Furthermore, there is variation in the CRP content in human body fluids, which also poses a problem from the aspect of stable supply. On the other hand, recombinant CRP using microorganisms, etc. does not use human body fluids as raw materials, so there is no risk of contamination with human-derived serum components or secondary infections. Therefore, if a stable expression system for recombinant proteins by genetic engineering technology can be constructed, the target protein can be stably supplied.
[0005] Regarding the expression of recombinant CRP by microorganisms, successful examples have already been reported in Escherichia coli, yeast, etc. (Patent Document 1, Non-Patent Document 1). However, in the measurement of recombinant CRP concentration by latex immunoturbidimetry, there was a problem that the measured value was detected lower than the actual CRP concentration in the high CRP concentration range. Therefore, in order to use recombinant CRP as a diagnostic drug raw material in calibrators, control sera, etc., it is necessary to improve the accuracy of measurement in the high CRP concentration range.
[0006] For many proteins, chemical properties or structural conversions occur through post-translational modification. As one of the post-translational modifications, there is pyroglutamylation in which the carboxyl group and amino group of glutamine or glutamic acid undergo an intramolecular condensation reaction to be converted into pyroglutamic acid. Animals and plants possess a number of pyroglutamyl peptides modified by pyroglutamylation, and there are proteins such as β-amyloid, collagen, and IgG2. CRP is also a pyroglutamyl peptide. However, it has been reported that recombinant CRP contains a mixture of those with the N-terminus remaining as glutamine and those converted to pyroglutamic acid (Non-Patent Document 2). The relationship between such an N-terminal structure of CRP and the antibody-antigen reaction in latex immunoturbidimetry has not been reported so far.
Prior Art Documents
Patent Document
[0007] Patent Document 1: Japanese Patent Application Laid-Open No. 2000-14388
Non-Patent Document
[0008] Non-Patent Document 1: TOSHIO TANAKA et al., BIOCHEM BIOPHYS RES COMMUN., 295(2002), p163-166 Non-Patent Document 2: Clinical Laboratory, Vol. 46, No. 9, p973-981 (September 2002)
Summary of the Invention
Problems to be Solved by the Invention
[0009] The problem of the present invention is to improve the accuracy of measurement in the high CRP concentration range, particularly when using the latex immunoturbidimetry method.
Means for Solving the Problems
[0010] As a result of intensive studies in view of the above circumstances, the present inventors have found a method for overcoming the above problems by converting the N-terminal structure of recombinant CRP. Specifically, it has been found that by using recombinant CRP in which 55% or more of the N-terminal is pyroglutamylated as measured by intact MS, it is possible to accurately measure the CRP concentration in the high CRP concentration range, and thus the present invention has been completed.
[0011] Specific embodiments of the present invention are as follows. Item 1. A recombinant C-reactive protein produced by genetic recombination, wherein 55% or more of the N-terminal of the C-reactive protein is pyroglutamylated. Item 2. The recombinant C-reactive protein according to Item 1, wherein 65% or more of the N-terminal of the C-reactive protein is pyroglutamylated. Item 3. The recombinant C-reactive protein according to Item 1, wherein 75% or more of the N-terminal of the C-reactive protein is pyroglutamylated. Item 4. The recombinant C-reactive protein according to Item 1, wherein 85% or more of the N-terminus of the C-reactive protein is pyroglutamylated. Item 5. The recombinant C-reactive protein according to any one of Items 1 to 4, wherein the recombinant C-reactive protein is a recombinant protein by bacteria. Item 6. The recombinant C-reactive protein according to Item 5, wherein the bacteria is Escherichia coli. Item 7. The recombinant C-reactive protein according to any one of Items 1 to 6, wherein the C-reactive protein is of human origin. Item 8. The recombinant C-reactive protein according to any one of Items 1 to 7, wherein the C-reactive protein consists of any one of the following polypeptides (a) to (c). (a) The polypeptide described in SEQ ID NO: 1 or SEQ ID NO: 2 (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody (c) A polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody Item 9. A calibrator containing the C-reactive protein according to any one of Items 1 to 8. Item 10. A control serum containing the C-reactive protein according to any one of Items 1 to 8. Item 11. A method for quantifying the C-reactive protein in a sample using the calibrator containing the C-reactive protein according to Item 9. Item 12. A method for quantifying the C-reactive protein in a sample using the control serum containing the C-reactive protein according to Item 10. Item 13. A method for quantifying the C-reactive protein in the sample according to Item 11 or 12 by latex immunoturbidimetry using latex particles immobilized with an anti-C-reactive protein antibody.
Advantages of the Invention
[0012] The recombinant CRP of the present invention can improve the accuracy of measurement in the high-concentration range of CRP by latex immunoturbidimetry, and is useful as a raw material for diagnostic agents used in control sera or calibrators.
Brief Description of the Drawings
[0013]
Figure 1
Figure 2
Figure 3
Figure 4
Modes for Carrying Out the Invention
[0014] (Polypeptide of C-reactive protein) The recombinant CRP of the present invention includes, for example, CRP derived from mammals such as humans, dogs, cats, mice, rats, rabbits, and goats. Among them, CRP derived from humans, dogs, or cats is more preferable, and CRP derived from humans is particularly preferable.
[0015] One embodiment of the present invention is CRP comprising any one of the following polypeptides (a) to (c). (a) The polypeptide described in SEQ ID NO: 1 or SEQ ID NO: 2. (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted, and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody. (c) A polypeptide comprising an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against an anti-C reactive protein antibody.
[0016] In the polypeptide of (a) above, SEQ ID NO: 1 or SEQ ID NO: 2 is the amino acid sequence of mature CRP consisting of 206 amino acids. When the recombinant CRP of the present invention is expressed extracellularly using Gram-negative bacteria or the like, an appropriate secretion signal suitable for the host may be added. In that case, the amino acid sequence consists of 227 amino acids in total as shown in SEQ ID NO: 3 or SEQ ID NO: 4. Among these, 206 amino acids from the 22nd to the 227th correspond to the mature CRP of SEQ ID NO: 1 or SEQ ID NO: 2, and the amino acids from methionine to the 21st are the amino acid sequence of the secretion signal. When the recombinant CRP of the present invention is expressed intracellularly, the secretion signal may be deleted.
[0017] The recombinant CRP of the present invention is not limited to (a) above, (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against an anti-C reactive protein antibody, or (c) A polypeptide comprising an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and having antigenicity against an anti-C reactive protein antibody, may also be used.
[0018] In the polypeptide of (b) above, the lower limit of "several" is 2. The upper limit is not limited as long as the antigenicity against the anti-C reactive protein antibody is maintained, but it is necessary to be within a range that does not significantly impair the three-dimensional structure of the protein of amino acid residues or the antigenicity against the anti-C reactive protein antibody. For example, it is a number corresponding to less than 20% of all amino acids, preferably a number corresponding to less than 15%, more preferably a number corresponding to less than 10%, still more preferably a number corresponding to less than 5%, and still more preferably a number corresponding to less than 1%. In other words, the number is, for example, 41 or less, preferably 31 or less, more preferably 21 or less, still more preferably 10 or less, still more preferably 5 or less, still more preferably 4 or less, and still more preferably 3 or less.
[0019] In the polypeptide of (c) above, the identity with the amino acid sequence shown in (a) above is preferably 80% or more. This identity is preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 98% or more, and more preferably 99% or more.
[0020] The identity of amino acid sequences can be calculated using commercially available or analytical tools available through telecommunications lines (the Internet). In the present invention, identity is calculated by selecting blastp on the website of BLAST, which is a homology search program published by the National Center for Biotechnology Information (NCBI) in the United States, and using default (initial setting) parameters.
[0021] Whether a certain polypeptide has antigenicity against the anti-C reactive protein antibody is determined by whether an aggregation reaction of latex particles occurs and the CRP concentration can be measured in the "method for measuring the concentration of C reactive protein" described below.
[0022] Variants of the protein having antigenicity against the anti-C reactive protein antibody and the genes thereof can be obtained, for example, by modifying the nucleotide sequence encoding the amino acids set forth in SEQ ID NO: 1 or SEQ ID NO: 2 using commercially available kits such as Transformer Mutagenesis Kit; manufactured by Clonetech, EXOIII / Mung Bean Deletion Kit; manufactured by Stratagene, QuickChange Site Directed Mutagenesis Kit; manufactured by Stratagene, KOD-Plus-Mutagenesis Kit; manufactured by Toyobo, or the PCR method. The antigenicity of the protein encoded by the obtained gene can be confirmed, for example, by introducing the obtained gene into Escherichia coli to create a transformant, culturing this transformant to produce the protein, and measuring this transformant, the cell lysate of this transformant, or the purified protein by the "method for measuring the concentration of C reactive protein" described below.
[0023] (DNA of C reactive protein) Examples of the DNA encoding the recombinant CRP of the present invention include DNA encoding CRP derived from mammals such as humans, dogs, cats, mice, rats, rabbits, and goats. Among them, DNA encoding CRP derived from humans, dogs, or cats is more preferable, and DNA encoding CRP derived from humans is even more preferable.
[0024] One embodiment of the present invention is CRP consisting of any of the following DNAs (d) to (f). (d) DNA encoding the amino acid sequence of any of the above CRPs (a) to (c) (e) DNA consisting of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 (f) DNA consisting of a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted, and / or added in the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 and encoding a polypeptide having antigenicity against the anti-C reactive protein antibody (g) A DNA encoding a polypeptide consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 and having antigenicity against an anti-C reactive protein antibody.
[0025] In the DNA of the above (d), the amino acid sequence of the CRP of the present invention is the amino acid sequence of CRP shown in any of the above (a) to (c). In the DNA of the present invention, when there are multiple codons corresponding to each amino acid in the amino acid sequence, there are no particular restrictions on the selection. Specifically, (e) a DNA consisting of the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 is exemplified.
[0026] When adding a secretion signal sequence as described above, it is preferable to use the DNA shown in SEQ ID NO: 7 or SEQ ID NO: 8. SEQ ID NO: 7 or SEQ ID NO: 8 encodes 206 amino acids from position 22 to position 227 in the full length of CRP shown by the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4 above, which is the mature type CRP, and the portion corresponding to the secretion signal from methionine to position 21.
[0027] In addition, the DNA of the present invention is not limited to the above, (f) A DNA consisting of a nucleotide sequence in which one or several nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 and encoding a polypeptide having antigenicity against an anti-C reactive protein antibody, or (g) A DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 and encoding a polypeptide having antigenicity against an anti-C reactive protein antibody, may also be used.
[0028] In addition, when the DNA encoding the CRP of the present invention is incorporated into a host other than the origin organism such as Escherichia coli to express the CRP of the present invention, the nucleotide sequence may be changed according to the codon usage of the host organism in order to improve the expression efficiency.
[0029] In the DNA of (f) above, the lower limit of "several" is 2. The upper limit is not restricted as long as the antigenicity of the polypeptide encoded by the DNA against the anti-C reactive protein antibody is maintained, but it is necessary to be within a range that does not significantly impair the three-dimensional structure of the protein of amino acid residues or the antigenicity against the anti-C reactive protein antibody. For example, it is a number corresponding to less than 20% of all amino acids of the polypeptide before modification, preferably less than 15%, more preferably less than 10%, even more preferably less than 5%, and even more preferably less than 1%. In other words, the number is, for example, 124 or less (the number of bases corresponding to 20% of all amino acids), preferably 93 or less (15%), more preferably 62 or less (10%), more preferably 31 or less (5%), more preferably 20 or less, more preferably 15 or less, more preferably 10 or less, more preferably 5 or less, more preferably 4 or less, and even more preferably 3 or less.
[0030] In the DNA of (g) above, the identity with the nucleotide sequence shown in SEQ ID NO: 5 or SEQ ID NO: 6 is preferably 80% or more. More preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more.
[0031] The identity of nucleotide sequences can be calculated using commercially available or analytical tools available through telecommunications lines (Internet). In the present invention, identity is calculated by selecting blastn on the website of BLAST, which is a homology search program published by the National Center for Biotechnology Information (NCBI) in the United States, and using the default (initial setting) parameters.
[0032] Whether a certain DNA encodes a polypeptide having antigenicity against an anti-C reactive protein antibody can be determined by incorporating the DNA into a commercially available expression vector, expressing it in a suitable host, and then determining whether the antigenicity of the resulting polypeptide against the anti-C reactive protein antibody causes an agglutination reaction of latex particles and whether the CRP concentration can be measured in the "Method for Measuring the Concentration of C Reactive Protein" described below.
[0033] (Method for Producing C Reactive Protein) Another embodiment of the present invention is a method for producing recombinant CRP, which includes culturing a vector incorporating the above DNA, a transformant containing the vector, or the transformant. The recombinant CRP of the present invention can be easily produced by inserting its gene into a suitable vector to prepare a recombinant vector, transforming a suitable host cell with this recombinant vector to prepare a transformant, and culturing this transformant.
[0034] The vector is not particularly limited as long as it can be replicated, maintained, or autonomously propagated in various host cells of prokaryotic and / or eukaryotic cells, and includes plasmid vectors, phage vectors, virus vectors, etc. The preparation of the recombinant vector is not particularly limited and can be carried out according to conventional methods. For example, the gene of CRP of the present invention can be easily ligated to these vectors using an appropriate restriction enzyme and ligase, or, if necessary, a linker or adapter DNA. Also, if it is a gene fragment amplified using a DNA polymerase such as Taq DNA polymerase that adds a single base to the amplified end, it is also possible to connect it to the vector by TA cloning.
[0035] In addition, the host cell is not particularly limited as long as a recombinant expression system has been established. Preferably, microorganisms such as Escherichia coli, Bacillus subtilis, Actinomycetes, Aspergillus, and yeast, as well as insect cells, animal cells, and higher plants, etc. are included. More preferably, microorganisms are included, and particularly preferably Escherichia coli (for example, K12 strain, B strain, etc.) is included. The preparation of the transformant is not particularly limited, but it may be carried out according to a conventional method. When the host is Escherichia coli, Escherichia coli C600, Escherichia coli HB101, Escherichia coli DH5α, Escherichia coli JM109, Escherichia coli BL21, etc. are used, and examples of the vector include pBR322, pUC19, pBluescript, pQE, pET, etc. When the host is yeast, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida utilis, Pichia pastoris, etc. are given as suitable examples. Examples of the vector include pAUR101, pAUR224, pYE32, etc. When the host is a filamentous fungus, for example, Aspergillus oryzae, Aspergillus niger, etc. can be exemplified.
[0036] If the obtained transformant is cultured for a certain period under appropriate culture conditions according to the host cell, the recombinant CRP of the present invention is expressed by the incorporated gene and accumulates in the transformant.
[0037] The recombinant CRP of the present invention accumulated in the transformant can be used as it is without purification, but it is preferably used after purification. The purification method is not particularly limited. For example, the transformant after culture or its culture is homogenized in an appropriate buffer, and a cell extract is obtained by ultrasonic treatment, surfactant treatment, etc. Then, separation techniques commonly used for protein separation and purification can be appropriately combined to carry out the purification. Such separation techniques include methods using differences in solubility such as salting out and solvent precipitation methods, methods using differences in molecular weight such as dialysis, ultrafiltration, gel filtration, non-denaturing polyacrylamide gel electrophoresis (PAGE), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), methods using charge such as ion exchange chromatography and hydroxyapatite chromatography, methods using specific affinity such as affinity chromatography using a phosphorylcholine-immobilized column, methods using differences in hydrophobicity such as reverse-phase high performance liquid chromatography, and methods using differences in isoelectric point such as isoelectric focusing electrophoresis, etc., but are not limited thereto. For example, gel filtration using Sephadex gel (manufactured by GE Healthcare Biosciences) etc., and separation and purification by column chromatography such as DEAE Sepharose CL-6B (manufactured by GE Healthcare Biosciences), Octyl Sepharose CL-6B (manufactured by GE Healthcare Biosciences) etc. can be carried out to obtain a purified standard product.
[0038] (Method for N-terminal cyclization of C-reactive protein) The recombinant CRP of the present invention is a recombinant CRP in which 55% or more of the entire N-terminal is pyroglutamylated, specifically, a recombinant CRP in which the N-terminal cyclization rate is calculated to be 55% or more.
[0039] In the present invention, the "N-terminal cyclization rate" is an index indicating the ratio of recombinant CRP in which the N-terminal is pyroglutamylated among recombinant CRP, and is calculated according to the "Method for Measuring the N-terminal Cyclization Rate of C-reactive Protein" described below. When the N-terminal cyclization rate is measured by the "Method for Measuring the N-terminal Cyclization Rate of C-reactive Protein" described below, it is preferably 55% or more, more preferably 60% or more, still more preferably 65% or more, still more preferably 70% or more, still more preferably 75% or more, still more preferably 80% or more, still more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, and even more preferably 98% or more of the recombinant CRP.
[0040] In the present invention, the "N-terminal" refers to the N-terminal of mature CRP from which the secretion signal sequence has been removed. Specifically, it refers to glutamine at position 1 (or position 22 of SEQ ID NO: 3 or SEQ ID NO: 4) in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, or pyroglutamic acid after the glutamine at position 1 has undergone an intramolecular condensation reaction. Glutamine at position 1 is converted to pyroglutamic acid by cyclization treatment.
[0041] In the present invention, the "cyclization treatment" refers to a treatment that promotes the conversion of CRP from a state where the above N-terminal is glutamine (hereinafter referred to as "uncyclized form") to a state where the above N-terminal is pyroglutamic acid (hereinafter referred to as "cyclized form"), and either an enzymatic or non-enzymatic method can be selected. As an enzymatic method, for example, it can be carried out by reacting an enzyme such as glutaminyl cyclase at an appropriate temperature, but the enzyme and temperature conditions are not limited to these. For the non-enzymatic method, it is necessary to set the type of buffer, pH, treatment temperature, treatment time, CRP concentration, etc., but any conditions can be used as long as they do not adversely affect CRP, uncyclized CRP, and cyclized CRP, and there is no particular limitation. An example is shown below.
[0042] Examples of buffers used for the cyclization treatment include Good's buffers such as acetate buffer, MES buffer, and PIPES buffer, phosphate buffer, Tris-HCl buffer, borate buffer, and glycine buffer. The pH condition is preferably in the range of pH 7 to pH 12, more preferably pH 7 to pH 10. The temperature condition is preferably 4°C to 55°C, more preferably 37°C to 50°C. The CRP concentration is preferably 0.1 mg / dL to 500 mg / dL, more preferably 10 mg / dL to 300 mg / dL. The reaction time is preferably 30 minutes to 4 weeks, more preferably 16 hours to 3 weeks.
[0043] (Method for measuring the concentration of C-reactive protein) In the present invention, the CRP concentration measurement is performed under the following conditions. The CRP concentration measurement method is a method in which CRP (test substance) in the latex particles immobilized with an anti-C-reactive protein antibody and the test sample undergoes an antigen-antibody reaction, and the CRP concentration is measured from the degree of the aggregation reaction of the latex particles. In the present invention, the term "CRP concentration" specifically means a value measured by the following method unless otherwise specified.
[0044] <Reagents> · CRP latex X2 "Seiken" R1 reagent (buffer) manufactured by Dainippon Sumitomo Pharma Co., Ltd. · CRP latex X2 "Seiken" R2 reagent (suspension of latex (latex conjugated with anti-human CRP polyclonal antibody (rabbit))) manufactured by Dainippon Sumitomo Pharma Co., Ltd. · CRPX2 standard solution H manufactured by Dainippon Sumitomo Pharma Co., Ltd. <Measurement sample> The measurement sample is a CRP solution, which is diluted with 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride; pH 7.5) as necessary and then used. When preparing a specific CRP concentration, the dilution ratio is determined based on the protein concentration determined in the Bradford protein assay. <Measurement method> Measure the CRP concentration (mg / dL) in the sample using the Hitachi 7180 automatic analyzer under the following conditions with the above-mentioned measurement sample, the above-mentioned R1 reagent, and the above-mentioned R2 reagent. The CRP concentration is calculated by formula (I). Sample: 2.2 μL R1 reagent: 120 μL R2 reagent: 120 μL Measurement method: Two-point endpoint method (18 - 34) Main wavelength: 546 nm Subsidiary wavelength: 800 nm
[0045]
Number
[0046] In the present invention, the method for determining whether the reactivity of recombinant CRP with a latex reagent in the high CRP concentration range is improved is as follows: When the difference between the CRP concentration value in the high CRP concentration range of native human CRP measured by the above method and the CRP concentration value in the high CRP concentration range of various recombinant CRPs is 5% or less, it is determined that the reactivity is improved. In the present invention, the high CRP concentration range refers to the range of CRP concentration of 10 to 30 mg / dL, but is not particularly limited thereto.
[0047] (Method for measuring the N-terminal cyclization rate of C-reactive protein) In the present invention, the measurement of the N-terminal cyclization rate of recombinant CRP is carried out under the following conditions. This measurement method is a method of measuring the ten-valent ion intensities of the spectra of uncyclized CRP and cyclized CRP by mass spectrometry and calculating the ratio of uncyclized CRP to cyclized CRP from each ion intensity. In the present invention, the "spectrum of uncyclized CRP" refers to the spectrum corresponding to a molecular weight of 23045, and the "spectrum of cyclized CRP" refers to the spectrum corresponding to a molecular weight of 23027. In the present invention, when referring to the "N-terminal cyclization rate of CRP", specifically, unless otherwise specified, it means the value measured by the following method.
[0048] <Measurement sample> The measurement sample is a CRP solution, which is used after being diluted with ultrapure water as needed. <Measurement method> Using the above measurement sample and an LC / MS apparatus under the following conditions, measure the spectra of uncyclized CRP and cyclized CRP in the sample. LC conditions Apparatus: ACQUITY UPLC manufactured by Waters Column: Mass PREP Micro Desalting Column 20μm, 2.1×5mm manufactured by Waters Mobile phase: A mixture of water / formic acid (1000:1), B mixture of IPA / ACN / methanol / formic acid (500:300:200:1) Column temperature: 50°C Injection volume: 5 μL MS conditions Apparatus: microOTOF manufactured by BRUKER DALTONICS Ionization method: ESI positive
[0049] <Calculation method for N-terminal cyclization rate> The ratio of uncyclized CRP to cyclized CRP is calculated using the intensity of each 10-valent ion in the average spectrum with an elution time of 1.7 to 2.0 minutes of each CRP spectrum obtained by the above measurement method. The "ratio" in the present invention refers to the ratio of the ion intensity of cyclized CRP when the total of the ion intensities of uncyclized CRP and cyclized CRP is 100, and is calculated by the following formula (II).
[0050]
Equation
[0051] Hereinafter, the present invention will be specifically described by examples. Note that the present invention is not particularly limited by the examples.
[0052] Example 1 Introduction of mutation and acquisition of transformant (1) Introduction of mutation The synthetic gene of SEQ ID NO: 7 or SEQ ID NO: 8, which is obtained by ligating the alkaline phosphatase secretion signal sequence derived from Escherichia coli (ATGAAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCC) and the human-derived mature CRP sequence of SEQ ID NO: 5 or SEQ ID NO: 6, was used as a template, and the CRP gene was amplified using the primers of SEQ ID NO: 9 and SEQ ID NO: 10. SEQ ID NO: 9 is a forward primer, and SEQ ID NO: 10 is a reverse primer. Restriction enzyme sites NdeI or restriction enzyme site BamHI were added to these primers, respectively. By adding the amplified gene fragment, the vector plasmid pBluescript KSN(+) cleaved with restriction enzymes NdeI and BamHI, and In-Fusion Reaction Mix (manufactured by Takara Bio Inc.) and incubating, plasmids were constructed. In this way, the recombinant plasmid pBKSN_CRP1 containing SEQ ID NO: 7 and the recombinant plasmid pBKSN_CRP2 containing SEQ ID NO: 8, which were designed to be able to express the CRP gene in large quantities, were obtained.
[0053] (2) Obtaining transformants Using the plasmid constructed in (1), Escherichia coli JM109 strain competent cells (manufactured by Toyobo) were transformed, cultured in SOC medium at 37 °C for 1 hr, and then spread on LB agar medium (containing 1.0% glucose and 50 μg / mL ampicillin) to obtain the transformants which were colonies. The transformant obtained by the introduction of pBKSN_CRP1 was named Escherichia coli JM109(pBKSN_CRP1). Also, the transformant obtained by the introduction of pBKSN_CRP2 in the same manner as above was named Escherichia coli JM109(pBKSN_CRP2).
[0054] Example 2 Expression of CRP gene in Escherichia coli The colonies of the transformant Escherichia coli JM109 (pBKSN_CRP1) obtained in Example 1 were inoculated into 5 mL of sterile LB liquid medium (containing 1.0% glucose and 100 μg / mL ampicillin) in a test tube and cultured at 37°C for 16 hours. The obtained culture solution was used as a seed culture solution and inoculated into 500 mL of LB liquid medium (containing 0.5% glycerol, 0.05% calcium chloride, 1 mM IPTG, and 50 μg / mL ampicillin) in 10 2-L Sakaguchi flasks, and cultured at 30°C for 24 hours at a shaking speed of 180 rpm. After the culture was completed, the cells were collected by centrifugation, suspended in 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5), disrupted with a French press (manufactured by Niro Soavi), and further centrifuged to obtain the supernatant as crude purification solution 1. Crude purification solution 2 was also obtained from Escherichia coli JM109 (pBKSN_CRP2) in the same manner as above.
[0055] Example 3 Purification of Recombinant CRP For the crude purified solution 1 obtained in Example 2, affinity purification was performed using PierceTM p-Aminophenyl Phosphoryl Choline Agarose (manufactured by Thermo SCIENTIFIC). The resin equilibrated with the buffer solution 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) used in Example 2 was mixed with the crude purified solution, and the adsorbed resin was washed with the buffer solution and eluted with 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM EDTA 2 mM, pH 7.5) to obtain a recombinant CRP solution 1. This solution was further replaced with the buffer solution 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) used in Example 2 while removing EDTA by concentration with a hollow fiber membrane, and further concentrated to an appropriate concentration with a centrifugal ultrafiltration filter (manufactured by Merck) to obtain highly pure recombinant CRP1. The results of SDS-PAGE performed using the obtained recombinant CRP1 are shown in Figure 1. As a result, the purity was successfully improved to a level where impurity proteins could not be detected by SDS-PAGE. Also, highly pure recombinant CRP2 was obtained from the crude purified solution 2 by the same method as above. The results of SDS-PAGE performed on the obtained CRP2 are shown in Figure 2. Similar to CRP1, the purity was successfully improved to a level where impurity proteins could not be detected by SDS-PAGE.
[0056] Example 4 N-terminal cyclization treatment of recombinant CRP The recombinant CRP1 obtained in Example 3 was heated at 37 °C for 8 days to obtain cyclized recombinant CRP1 in which the N-terminus of the recombinant CRP was cyclized by pyroglutamylation. In the cyclization treatment, the buffer solution 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) used in Example 2 was used, and the CRP concentration was 300 mg / dL. Also, cyclized recombinant CRP2 was obtained from recombinant CRP2 by the same method as above.
[0057] Example 5 Measurement of N-terminal cyclization rate The recombinant CRP1 and recombinant CRP2 obtained in Example 3, the cyclic recombinant CRP1 and cyclic recombinant CRP2 obtained in Example 4, and native human CRP (manufactured by Yashraj) as a positive control were measured under the LC / MS conditions as described above for a CRP solution prepared to a CRP concentration of 150 mg / dL in ultrapure water (see Table 1). In the mass spectrum of each sample of recombinant CRP1, an enlarged view of the average decavalent ions with an elution time of 1.7 to 2.0 minutes is shown in Figure 3.
[0058] m / z 2305.45 indicates the spectrum of uncyclized CRP, and m / z 2303.74 indicates the spectrum of cyclic CRP. In native human CRP, the spectrum of cyclic CRP was prominently shown. On the other hand, in the recombinant CRP1 obtained in Example 3, it was shown that the spectrum of uncyclized CRP was higher than that of cyclic CRP. In contrast, for the cyclic recombinant CRP1 obtained in Example 4, it was shown that the spectrum of cyclic CRP was clearly higher than that of uncyclized CRP. It was shown that the N-terminal cyclization treatment in Example 4 promoted the pyroglutamylation of CRP. Similar results were also obtained for recombinant CRP2 and cyclic recombinant CRP2 as shown in Figure 4.
[0059]
Table 1
[0060] In the recombinant CRP1 and recombinant CRP2 obtained in Example 3, the cyclized recombinant CRP1 and cyclized recombinant CRP2 obtained in Example 4, and native human CRP, the N-terminal cyclization rate of CRP was calculated from the ratio of uncyclized CRP and cyclized CRP from the intensities of each of the ten ions in the spectra of uncyclized CRP and cyclized CRP measured under the above LC / MS conditions using the above formula (II). The N-terminal cyclization rates of recombinant CRP1, cyclized recombinant CRP1, and native human CRP are shown in Table 2. For the cyclized recombinant CRP1 obtained in Example 4, the N-terminal cyclization rate of the cyclized recombinant CRP1 obtained on the 1st, 3rd, 6th, and 8th days of heating was calculated using the above formula (II). The N-terminal cyclization rates of recombinant CRP2, cyclized recombinant CRP2, and native human CRP are shown in Table 3. For the cyclized recombinant CRP2 obtained in Example 4, the N-terminal cyclization rate of the cyclized recombinant CRP2 obtained on the 1st, 3rd, 6th, and 8th days of heating was calculated using the above formula (II).
[0061] In native human CRP, the N-terminal cyclization rate is 95%, indicating that 95% of the whole is cyclized CRP. On the other hand, in the recombinant CRP1 and recombinant CRP2 obtained in Example 3, it is shown that the N-terminal cyclization rate is 40% and the cyclized CRP accounts for less than half of the whole. In contrast, for the cyclized recombinant CRP1 and cyclized recombinant CRP2 obtained in Example 4, the N-terminal cyclization rate was 42% on the 1st day of heating, 54% on the 3rd day of heating, 67% on the 6th day of heating, and 78% on the 8th day of heating. It was shown that as the heating time increased, the proportion of cyclized recombinant CRP tended to increase.
[0062]
Table 2
[0063]
Table 3
[0064] Example 6 Measurement of CRP Concentration Using a Latex Reagent Bovine serum albumin (manufactured by Sigma) was diluted with ultrapure water to 0.1, 0.2, 0.4, and 0.75 mg / mL to prepare standard solutions. To 60 μL of each standard solution, 600 μL of a protein assay concentrated dye reagent (manufactured by BioRad) and 2.4 mL of ultrapure water were added. After standing at room temperature for 5 minutes, the absorbance at 595 nm was measured. A calibration curve was created from the measured values of the absorbance at 595 nm and the bovine serum albumin concentration. Recombinant CRP1 and recombinant CRP2 obtained in Example 3, cyclic recombinant CRP1 and cyclic recombinant CRP2 obtained in Example 4, and native human CRP were diluted with ultrapure water to appropriate concentrations, prepared with the same reagents and conditions as the standard solutions, and the absorbance at 595 nm was measured. From the measured values of various CRPs, the protein concentration was calculated from the above calibration curve. Based on the above protein concentration, CRP solutions were prepared by diluting with 20 mM Tris-HCl buffer solution (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) to a protein concentration of 1 mg / dL, 5 mg / dL, 10 mg / dL, and 30 mg / dL.
[0065] For the CRP concentration of each of the above CRP solutions, the buffer solution of CRP-Latex X2 manufactured by Dainippon Seiyaku Co., Ltd. was used as the first reagent, and the anti-human CRP polyclonal antibody (rabbit) - conjugated latex suspension was used as the second reagent. The first reagent and the second reagent were combined, and the formation of particle aggregates dependent on the CRP concentration was measured using a Hitachi 7180 automatic analyzer. Specifically, to 2.2 μL of each of the above CRP solutions, 120 μL of the first reagent was added and heated at 37°C for 5 minutes, then 120 μL of the second reagent was added and stirred. Thereafter, the change in absorbance (ΔmAbs) accompanying the formation of aggregates for 5 minutes was measured at a main wavelength of 546 nm and a sub-wavelength of 800 nm.
[0066] Table 4 shows the relative values at each concentration of the recombinant CRP1 obtained in Example 3, the cyclized recombinant CRP1 obtained in Example 4, and the measured values of natural human CRP. Table 4 also shows the N-terminal cyclization rates of various CRPs calculated in Example 5. Furthermore, Table 5 shows the measured values of the recombinant CRP1 obtained in Example 3, the cyclized recombinant CRP1 obtained in Example 4, and natural human CRP. Similarly, Table 6 shows the relative values at each concentration of the recombinant CRP2 obtained in Example 3, the cyclized recombinant CRP2 obtained in Example 4, and the measured values of natural human CRP. Table 6 also shows the N-terminal cyclization rates of various CRPs calculated in Example 5. Furthermore, Table 7 shows the measured values of the recombinant CRP2 obtained in Example 3, the cyclized recombinant CRP2 obtained in Example 4, and natural human CRP.
[0067] From Tables 4 and 6, it was confirmed that in recombinant CRP1 and recombinant CRP2 with N-terminal cyclization rates of 40% and 42%, the relative values to the measured values of natural human CRP at the points of 10 mg / dL and 30 mg / dL were 89 - 94%, with a deviation of 6 - 11% from the measured values. On the other hand, in cyclized recombinant CRP1 and cyclized recombinant CRP2 with N-terminal cyclization rates of 54%, 67%, and 78%, the relative values to the measured values of natural human CRP at the points of 10 mg / dL and 30 mg / dL were 95 - 104%, and the deviation from the measured values was suppressed within 5%. From these results, it was shown that in cyclized recombinant CRP1 and cyclized recombinant CRP2 with an N-terminal cyclization rate of 55% or more, the deviation from natural human CRP can be suppressed within 5% even in the high CRP concentration range of 10 mg / dL and 30 mg / dL.
[0068]
Table 4
[0069]
Table 5
[0070]
Table 6
[0071]
Table 7
Industrial Applicability
[0072] The CRP of the present invention is particularly useful in the fields of medicine and diagnosis as a diagnostic raw material used in a latex reagent excellent in reactivity in a high concentration range of CRP.
Claims
**Claim 1**: A method for producing a recombinant C-reactive protein, comprising expressing a human-derived C-reactive protein consisting of any one of the polypeptides (a) to (c) below by gene recombination in Escherichia coli, and performing cyclization treatment on the obtained C-reactive protein, whereby 65% or more of the N-terminus of the C-reactive protein is pyroglutamylated. (a) The polypeptide set forth in SEQ ID NO: 1 or SEQ ID NO: 2 (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody (c) A polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody **Claim 2**: The method for producing a recombinant C-reactive protein according to Claim 1, wherein the cyclization treatment of the C-reactive protein is carried out in a buffer solution at pH 7 to 10 at a temperature of 37°C to 50°C for 6 days or more. **Claim 3** The method for producing a recombinant C-reactive protein according to Claim 1 or 2, wherein 75% or more of the N-terminus of the C-reactive protein is pyroglutamylated. **Claim 4** The method for producing a recombinant C-reactive protein according to Claim 1 or 2, wherein 85% or more of the N-terminus of the C-reactive protein is pyroglutamylated. **Claim 5**: Use of a latex particle immobilized with an anti-C-reactive protein antibody of a recombinant C-reactive protein in which 65% or more of the N-terminus is pyroglutamylated, consisting of any one of the polypeptides (a) to (c) below, for quantifying C-reactive protein in a sample by latex immunoturbidimetry. (a) The polypeptide set forth in SEQ ID NO: 1 or SEQ ID NO: 2 (b) A polypeptide consisting of an amino acid sequence in which one or several amino acid residues are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody (c) A polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and having antigenicity against an anti-C-reactive protein antibody
6. Use in the quantification of C-reactive protein in a sample according to claim 5, wherein at least 75% of the N-terminus of the C-reactive protein is pyroglutamylated.
7. Use in the quantification of C-reactive protein in a sample according to claim 5, wherein at least 85% of the N-terminus of the C-reactive protein is pyroglutamylated.
Citation Information
Patent Citations
Plasmid and escherichia coli transformed with the same
JP1994311884A
Immunoassay
JP1996233816A
Recombinant crp and its production
JP2000014388A
Method for quantitatively determining target protein contained in living body origin sample by using internal standard peptide
JP2006300758A
Reagent and method for measuring c-reactive protein in sample, and method for enlarging measurement range
JP2011257243A
Cited By
Recombinant c-reactive protein
JP2025066156A