Osteoclast activity inhibitor, osteoclast gene expression inhibitor

Quinolinic acid and nacre extract, used as osteoclast activity and gene expression inhibitors, address the inadequacies of current treatments for Paget's disease, hyperparathyroidism, and osteoporosis, providing a significant therapeutic benefit for these bone-related disorders.

JP7698826B2Active Publication Date: 2025-06-26INSTITUTE OF SCIENCE TOKYO
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2020194144
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-03-12
Filing Date
2020-11-24
Publication Date
2025-06-26
Estimated Expiration
2040-11-24

AI Technical Summary

Technical Problem

Current treatments for Paget's disease of bone, hyperparathyroidism, and osteoporosis are inadequate in effectively inhibiting osteoclast activity and gene expression, leading to insufficient prevention and improvement of these conditions.

Method used

The use of quinolinic acid or its salts, and nacre extract containing quinolinic acid, as active ingredients to inhibit osteoclast activity and gene expression, thereby providing a therapeutic approach for these bone-related disorders.

Benefits of technology

The described compounds significantly inhibit osteoclast activity and gene expression, offering a promising preventive and ameliorating agent for Paget's disease of bone, hyperparathyroidism, and osteoporosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007698826000003
    Figure 0007698826000003
  • Figure 0007698826000004
    Figure 0007698826000004
  • Figure 0007698826000005
    Figure 0007698826000005
Patent Text Reader

Abstract

To provide a component that inhibits osteoclast activity and a component that inhibits the expression of an osteoclast function gene.SOLUTION: The present disclosure provides an osteoclast activity inhibitor and an osteoclast function gene expression inhibitor containing kynurenic acid or a salt thereof as an active ingredient and also provides an osteoclast activity inhibitor that contains a pearl layer extract containing kynurenic acid or a salt thereof as an active ingredient.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an osteoclast activity inhibitor and an osteoclast gene expression inhibitor.

Background Art

[0002] Osteoclasts are cells that play a role in destroying (bone resorption) bone during the bone remodeling process. They are multinucleated giant cells with 5 to 20 (or more) nuclei (however, mononuclear osteoclasts have also been confirmed). Osteoclasts are large and dendritic motile cells that specialize in bone resorption. It is known that precursor cells of the monocyte macrophage system derived from bone marrow differentiate and fuse into osteoclasts. They have several to dozens of nuclei, and their cytoplasm shows eosinophilia and has tartrate-resistant acid phosphatase (TRAP) activity. Osteoclasts dissolve and absorb the bone matrix. Specifically, they release collagenase, hydrogen ions, and other cytokines around them, causing the decomposition of collagen and the melting of calcium salt crystals.

[0003] The differentiation of osteoclasts has been clarified as follows. 1. By the action of macrophage colony-stimulating factor M-CSF (macrophage colony-stimulating factor) secreted by osteoblasts, bone marrow-derived progenitor cells differentiate into immature phagocytic cells. 2. Immature phagocytic cells appear during the interaction with osteoblasts. Particularly important molecules are related to RANK-L (receptor activator of NF-κB ligand) expressed by osteoblasts and RANK expressed by immature phagocytic cells. 3. Mature osteoclasts bind to the bone matrix and absorb the matrix.

[0004] The following are exemplified as related diseases. 1. In Paget's disease of bone, bone resorption by osteoclasts is abnormally enhanced. To correct this, osteoblasts form immature bone (fibrous bone), making the bone brittle. 2. In hyperparathyroidism, excessive parathyroid hormone increases the number of osteoclasts and their activity, making the bone brittle. 3. In osteoporosis, the balance between bone formation by osteoblasts and bone resorption by osteoclasts is disrupted, resulting in a decrease in bone mass. Drugs that suppress osteoclasts include bisphosphonates and anti-RANKL antibodies.

[0005] The examination of various physiological activities of quinolinic acid or its salts, and its derivatives has been carried out for a long time. (Patent Documents 1 and 2). However, it was not known that this component affects osteoclasts.

Prior Art Documents

Patent Documents

[0006]

Patent Document 1

Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0007] An object of the present invention is to provide a component having an osteoclast activity inhibitory action and an osteoclast gene expression inhibitory action, which is useful for the prevention and improvement of Paget's disease of bone, hyperparathyroidism, and osteoporosis.

Means for Solving the Problems

[0008] The present inventors considered that the above diseases could be applied by obtaining a component that suppresses osteoclast activity and a component that suppresses osteoclast gene expression.

[0009] When searching for components that suppress osteoclast activity and components that suppress osteoclast gene expression, it was found that quinolinic acid has such effects. In addition, as a component that suppresses osteoclast activity, it was found that nacre extract has such effects.

[0010] The present invention relates to an osteoclast activity inhibitor and an osteoclast functional gene expression inhibitor containing quinolinic acid or a salt thereof as an active ingredient, and also relates to an osteoclast activity inhibitor containing a nacre extract containing quinolinic acid or a salt thereof as an active ingredient.

Effects of the Invention

[0011] According to the present invention, an osteoclast activity inhibitor and an osteoclast functional gene expression inhibitor can be provided.

Brief Description of the Drawings

[0012]

Figure 1

[0013]

Figure 2

[0014]

Figure 3

Modes for Carrying Out the Invention

[0015] The present invention relates to an osteoclast activity inhibitor and an osteoclast functional gene expression inhibitor containing quinolinic acid or a salt thereof as an active ingredient. It also relates to an osteoclast activity inhibitor containing a nacre extract containing quinolinic acid or a salt thereof as an active ingredient.

[0016] Kynurenic acid or a salt thereof can be obtained using commercially available reagents, or by chemical synthesis or extraction from animals and plants. For example, it can also be obtained from the nacre of shellfish such as pearl oysters, white clams, and black clams. The kynurenic acid or a salt thereof of the present invention includes its hydrates.

[0017] When extracting kynurenic acid or a salt thereof from shellfish such as pearl oysters, any nacre such as the nacre of pearls or the nacre of shells can be used. Pearls can be used as they are, or the nucleus can be removed before use, but it is desirable to remove the nucleus before use. When using shells having nacre, it is desirable to remove various organisms such as tentacle animals, mollusks, arthropods, annelids, chordates, and seaweeds, and inorganic substances such as marine mud attached to the shells with water, a brush, a spatula, etc. before use. In addition, it is desirable to remove the periostracum layer and prismatic layer of the shell using a brush, a spatula, a grinder, etc. Furthermore, it is desirable to perform a crushing and pulverizing process to smoothly perform the extraction.

[0018] The extraction solvent is not particularly limited, and for example, one or more of water; lower monohydric alcohols such as methyl alcohol and ethyl alcohol; liquid polyhydric alcohols such as glycerin, propylene glycol, and 1,3 - butylene glycol can be used.

[0019] In addition to using kynurenic acid or a salt thereof as it is, the present invention can also prepare a formulation together with raw materials that can be used in pharmaceuticals, foods, and cosmetics, or add kynurenic acid or a salt thereof to existing pharmaceuticals, foods, and cosmetics for use. Examples of the form of the formulation include capsules, powders, granules, solids, liquids, gels, emulsions, creams, sheets, etc.

[0020] The blending amount of quinolinic acid or its salt varies greatly depending on the dosage form and other factors. As quinolinic acid, it is preferably 0.00000001% by mass or more in the preparation, more preferably 0.0000002 - 0.000005% by mass. Also, the nacre extract is preferably 0.000005% by mass or more in the preparation, more preferably 0.00001 - 0.0001% by mass.

Examples

[0021] The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples at all.

[0022] Confirmation Test - 1 The osteoclast activity inhibitory effect of quinolinic acid was confirmed. A commercially available product was used as quinolinic acid.

[0023] 〔In vitro osteoclast assay system〕 In the present invention, the cell group in the scale after 3 weeks of regeneration was used for the experiment. The cell group was washed with phosphate buffered saline (PBS) and then immersed in Leibovitz’s L - 15 medium (Thermo Fisher Scientific K.K.). Only the solvent or quinolinic acid was added thereto to a concentration of 2 ng / mL, 10 ng / mL, or 50 ng / mL, and incubated at 15°C. After 6 hours, the scales were collected, each was placed separately in a 96 - well plate for measuring TRAP activity, immersed in 150 μL of 20 mM tartaric acid - 0.1 M acetate buffer (pH 5.3), and stored at - 80°C.

[0024] 〔Measurement of TRAP activity〕 Before measurement, the sample was thawed, and 50 μL of tartaric acid - acetic acid buffer solution in which 40 mM of p-Nitrophenyl phosphate (pNPP; FUJIFILM Wako Pure Chemical Corporation) was dissolved was added, and the reaction was carried out at 25°C for 20 minutes. The reaction was stopped by adding 50 μL of 50 mM EDTA and 3 N NaOH, and 100 μL of the supernatant was transferred to a new plate. The absorbance at 405 nm was measured with a plate reader (Wallac 1420 ARVO Sx; PerkinElmer), and the amount of pNP produced was calculated based on the calibration curve of p-Nitrophenol (pNP). To measure the area of the scale, the scale remaining after the reaction was colored overnight in a methylene blue solution, the image of the scale was captured using a scanner, and the area was measured with Image J, a free software. The TRAP activity was calculated as the amount of pNP produced per scale area per unit time (nmol / hr / mm 2 ).

[0025] From Confirmation Test - 1, the activity of osteoclasts was statistically significantly (p < 0.05) inhibited by quinolinic acid. The results are shown in Figure 1.

[0026] Confirmation Test - 2 The inhibitory effect of quinolinic acid on the gene expression of osteoclast function was confirmed. Commercially available products were used for quinolinic acid.

[0027]

[0028] ​​The scales soaked in ISOGEN were thawed and stirred for 2 minutes using a vortex. 160 μL of chloroform was added, and after stirring again for 2 minutes, centrifugation was performed at 4°C, 20,000 G for 15 minutes to collect the supernatant. An equal volume of isopropanol was added to this supernatant, gently stirred, left standing on ice for 5 minutes, and centrifuged at 4°C, 20,000 G for 20 minutes. The supernatant was removed by decantation, 1 mL of 80% ethanol was added, gently stirred, and then centrifuged at 4°C, 20,000 G for 10 minutes. The supernatant was removed by decantation, left standing with the lid of the centrifuge tube open for 15 minutes to evaporate and remove the alcohol, and then 20 μL of distilled water was added to dissolve the precipitated RNA. The concentration of RNA was measured using a desktop spectrophotometer (Gene Quant 100; GE Healthcare). Reverse transcription of RNA was performed using a commercially available kit (PrimeScript RT Reagent kit; Takara Bio Inc.) according to the procedure to obtain cDNA. TB Green Premix Ex Taq (Takara Bio Inc.) was used as the premix reagent for real-time PCR. Cathepsin K (Fw: TGGGAGGGCTGGAAACTCAC, Rv: CATGAGCCGCATGAACCTTG) and vATPase (Fw: ACACCGCTTGCTGCTTTCTTTC, Rv: ACCAGTGTGGAGCAGAACTTG) were selected as the functional genes of osteoclasts, and cDNA amplification was performed with each primer. Each expression level was corrected with the cDNA expression level of β-actin (Fw: CGAGCGTGGCTACAGCTTCA, Rv: GCCCGTCAGGGAGCTCATAG). PCR was performed using MX3000P (Agilent Technologies Inc.) with 40 cycles of a reaction at 60°C for 45 seconds and 90°C for 10 seconds. Data analysis was performed using the software attached to MX3000P.

[0029] From Confirmation Test - 2, it was found that the expression of the vATPase gene, which is one of the functional genes of osteoclasts, was statistically significantly (p < 0.05) suppressed by quinolinic acid. The results are shown in Figure 2.

[0030] Confirmation Test - 3 The inhibitory effect of the nacre extract on osteoclast activity was confirmed. The nacre extract was obtained by the following procedure. Also, the composition of the nacre extract was confirmed.

[0031] 〔Method for preparing nacre extract〕 The adherents on the Pinctada fucata shell were removed, and after scraping off the prismatic layer with a grinder or the like, it was pulverized. This pulverized Pinctada fucata shell was sieved, and the fraction passing through 35 mesh was used as the nacre powder. To 10 g of the nacre powder, 50% by volume ethanol aqueous solution was added to make 30 mL. Rotary shaking was carried out at room temperature for 48 hours. This was centrifuged to obtain the supernatant. This was distilled under reduced pressure and then freeze-dried, and the residue was used as the nacre extract.

[0032] 〔Composition of nacre extract〕 The composition of the nacre extract was measured by liquid chromatography-tandem mass spectrometry (LC / MS / MS). The sample preparation method and measurement conditions shown below were used.

[0033] 〔Sample preparation method〕 1 mL of distilled water was added to the nacre extract and stirred well to redissolve it. This was centrifuged, and after collecting the supernatant, the solution filtered through a filter with a pore size of 0.22 μm was measured by LC / MS / MS.

[0034] 〔LC / MS / MS measurement conditions〕 The measurement was carried out by connecting a Nexera X2 HPLC system (pump LC30AD, autosampler SIL30AC, column oven CTO-20AC, system controller CBM20A; Shimadzu Corporation) to a quadrupole type mass spectrometer (LCMS8050; Shimadzu Corporation, Kyoto, Japan). A C18 column (TSK-gel ODS-100Z particle size 3 μm, 2.0 mm × 150 mm; Tosoh Corporation, Minato-ku, Tokyo) was used, and the column oven was set at 25°C. As the mobile phase, a 10 mM ammonium acetate (Wako Pure Chemical Industries) 0.05% acetic acid solution was used, and a gradient was applied at 0.3 mL / min so that methanol increased from 5% to 50% after 20 minutes. For MS, the nebulizer gas flow rate was 3 L / min, the drying gas flow rate was 10 L / min, the heating gas flow rate was 10 L / min, the DL temperature was 250°C, the heat block temperature was 400°C, and the interface temperature was 300°C. Each sample was injected at 10 μL and ionized by the ESI method, and the measurement was carried out in the MRM mode. The mass chromatogram was analyzed using LC solution (Shimadzu Corporation). The MS measurement conditions were optimized for Q1 Pre Bias, Collogion Energy, and Q3 Pre Bias by product ion analysis of the standard substance, and then the product ion with the highest intensity was selected as the quantitative ion, and the second highest product ion was selected as the qualitative ion.

[0035] 〔Measured substance and mass-to-charge ratio of measured ions〕 TIFF0007698826000001.tif166134

[0036] 〔Measurement results〕 Measurement by LC / MS / MS was carried out and the following results were obtained. TIFF0007698826000002.tif11881

[0037] 〔Confirmation of osteoclast activity inhibitory effect〕 〔In vitro osteoclast assay system〕 In the present invention, a cell group in the scale after 3 weeks of regeneration was used in the experiment. After washing the cell group with phosphate-buffered saline (PBS), it was immersed in Leibovitz’s L-15 medium (Thermo Fisher Scientific K.K.). The nacre extract was added thereto to a concentration of 0.93 mg / mL and 3.73 mg / mL. These were incubated at 15°C. After 6 hours, the scales were collected, each was separately placed into a 96-well plate for measuring TRAP activity, immersed in 150 μL of 20 mM tartaric acid-0.1 M acetate buffer (pH 5.3), and stored at -80°C.

[0038] 〔Measurement of TRAP activity〕 In the same manner as in the above Confirmation Test-1, 〔Measurement of TRAP activity〕, the TRAP activity was measured to obtain the TRAP activity. The TRAP activity was calculated as the amount of pNP produced per scale area per unit time (nmol / hr / mm 2 ).

[0039] 〔Calculation method for osteoclast activity inhibitory effect〕 The obtained amount of pNP produced (nmol / hr / mm 2 ) was compared with the amount produced in purified water (solvent) (control group) taken as 100%.

[0040] From Confirmation Test-3, it was found that the nacre extract statistically significantly (p<0.05) inhibited osteoclast activity. The results are shown in Figure 3.

Industrial applicability

[0041] Since the present invention contains quinolinic acid or a salt thereof as an active ingredient, it has an osteoclast activity inhibitory effect and an osteoclast gene expression inhibitory effect, and a preventive / ameliorating agent effective for Paget's disease of bone, hyperparathyroidism, and osteoporosis can be expected.

Claims

1. An osteoclast activity inhibitor containing an ethanol aqueous solution extract of nacre with quinolinic acid or a salt thereof as an active ingredient.

2. The quinolinic acid contained in the ethanol aqueous solution extract is within the top three when tryptophan, 5-hydroxytryptophan, serotonin, N-acetylserotonin, melatonin, kynurenine, quinolinic acid, 5-methoxytryptamine, 5-hydroxyindoleacetic acid, 5-methoxyindoleacetic acid, tryptamine, kynuramine, N-acetyltryptamine, and indoleacetic acid are arranged in descending order of content as measured by LC / MS / MS quantitative analysis of the ethanol aqueous solution extract. The osteoclast activity inhibitor according to Claim 1, characterized by being included.

3. A method for producing the osteoclast activity inhibitor according to Claim 1 or Claim 2, The production method includes an extraction step of adding an ethanol aqueous solution to nacre powder that has passed through a sieve after shell powder is pulverized and rotating and shaking it at room temperature, and a step of centrifuging the extract and drying the supernatant. A method for producing an osteoclast activity inhibitor, characterized by having.

4. The sieve has an opening of 35 mesh, and the extraction step is a step of rotating and shaking at room temperature for 48 hours using a 50% by volume ethanol aqueous solution. The method for producing an osteoclast activity inhibitor according to Claim 3, characterized by this.

Citation Information

Patent Citations

  • Antiallergic agent consisting mainly of kynurenic ester derivative

    JP1980151511A

  • Kynurenic acid amide derivatives as nr2b receptor antagonists

    JP2008508250A