TRα gene-modified eel
By introducing loss-of-function mutations into the TRαA and TRαB genes of eels, the prolonged larval period and low survival rate issues in Japanese eel larvae are addressed, resulting in a more efficient and sustainable aquaculture process.
Patent Information
- Application Number
- JP2021129282
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2021-08-05
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2041-08-05
AI Technical Summary
The current methods for rearing Japanese eel larvae result in a prolonged larval period and low survival rate, making efficient mass production challenging.
Introduction of loss-of-function mutations into the thyroid hormone receptor αA (TRαA) and thyroid hormone receptor αB (TRαB) genes of eels to reduce their functional activity, thereby shortening the larval period and improving survival rates.
The modified eels exhibit a significantly shortened larval period and enhanced survival rates during the larval stage, facilitating more efficient seedling production and potential large-scale aquaculture penetration.
Smart Images

Figure 0007699355000003 
Figure 0007699355000004 
Figure 0007699355000005
Abstract
Description
Technical Field
[0001] The present invention relates to eels in which the thyroid hormone receptor α gene has been modified and a method for producing the same.
Background Art
[0002] The larvae (leptocephalus) of eel-shaped fish have a longer larval period compared to other fish and are characterized by metamorphosing into juveniles after growing into large larvae. The current standard method for rearing larvae of Japanese eels requires a longer larval period (160 to 450 days after hatching) than in the natural environment (110 to 170 days after hatching). In addition, the mortality rate is higher during the larval period than after the juvenile stage, and in Japanese eels, even when a small number of larvae are carefully reared, the survival rate to juveniles (glass eels) is often less than 10%. Therefore, in the rearing of eel larvae, although a very large amount of labor and time are required, the low yield (survival rate) to juveniles has become an obstacle to efficient mass production, and shortening the larval period or improving the survival rate by improving the rearing method is desired.
[0003] On the other hand, it has been reported that the length of the larval period of Japanese eels under rearing is a genetic trait controlled by multiple genes (Non-Patent Document 1). In amphibians, it has been reported that the growth during the larval stage is promoted and the metamorphosis into adults starts earlier in individuals in which the thyroid hormone receptor α (TRα) gene has been partially functionally inhibited by genome editing technology (Non-Patent Document 2). Furthermore, in Japanese eels, high expression of the TRα gene is observed throughout the entire larval period, suggesting its involvement in the growth and metamorphosis during the larval period (Non-Patent Document 3), but the details have not been clarified.
Prior Art Documents
Non-Patent Documents
[0004]
Non-Patent Document 1
[0005] So far, there has been no technology to shorten the larval period of eels by genetic improvement. The present invention relates to providing eels with a shortened larval period. [Means for Solving the Problems]
[0006] As a result of intensive studies to solve the above problems, the present inventors have introduced mutations into the thyroid hormone receptor αA gene and the thyroid hormone receptor αB gene of eels to inhibit their functions, thereby shortening the larval period of eels. Moreover, quite unexpectedly, they have found that the survival rate during the larval period is improved, and thus completed the present invention.
[0007] That is, the present invention provides the following [1] to [9]. [1] Anguilliformes in which the functions of the thyroid hormone receptor αA (TRαA) gene and the thyroid hormone receptor αB (TRαB) gene are reduced or lost. [2] The anguilliformes according to [1], which have loss-of-function mutations in the TRαA gene and the TRαB gene. [3] The anguilliformes according to [1] or [2], wherein the TRαA gene is any one selected from the following (a) to (c), and the TRαB gene is any one selected from the following (d) to (f): (a) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; (b) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (c) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (d) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3; (e) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα; (f) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα. [4] The anguilliformes according to any one of [1] to [3], in which part or all of the TRαA gene and part or all of the TRαB gene are each deleted. A method for producing eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene. A method for improving the survival rate during the larval stage of eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene. 〔7〕The method according to 〔5〕 or 〔6〕, wherein the TRαA gene is any one selected from the following (a) to (c), and the TRαB gene is any one selected from the following (d) to (f): (a) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; (b) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (c) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (d) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3; (e) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα; (f) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα. 〔8〕The method according to any one of 〔5〕 to 〔7〕, wherein the introduction of the loss-of-function mutation deletes part or all of the TRαA gene and part or all of the TRαB gene, respectively. 〔9〕The method according to any one of 〔5〕 to 〔8〕, wherein the introduction of the loss-of-function mutation is performed by genome editing.
Advantages of the Invention
[0008] According to the present invention, it is possible to provide eels with a shortened larval period and an improved survival rate during the larval period, a method for producing the same, and a method for improving the survival rate of eels. Such eels have genetic characteristics suitable for efficient seedling production. In addition, the eels of the present invention can obtain the effects of shortening the larval period and improving the survival rate during the larval period from individuals of the F0 generation into which mutations have been introduced, and their genetic characteristics can be infiltrated into a large-scale farming population through breeding and mating using the F0 individuals.
Brief Description of the Drawings
[0009]
Figure 1
Figure 2
Figure 3
Modes for Carrying Out the Invention
[0010] In this specification, the display by abbreviations such as base sequences (nucleotide sequences) and nucleic acids follows the IUPAC-IUB regulations (IUPAC-IUB communication on Biological Nomenclature, Eur. J. Biochem., 138:9-37, 1984), the "Guidelines for the Preparation of Specifications Containing Base Sequences or Amino Acid Sequences" (edited by the Patent Office), and other symbols commonly used in the art. In this specification, "deoxyribonucleic acid (DNA)" includes not only double-stranded DNA but also each single-stranded DNA of the sense strand and the antisense strand constituting it.
[0011] As used herein, the terms "nucleotide", "oligonucleotide" and "polynucleotide" are synonymous with nucleic acid and include both DNA and RNA. The DNA includes cDNA, genomic DNA and synthetic DNA. The RNA includes total RNA, mRNA, rRNA and synthetic RNA. Also, the "nucleotide", "oligonucleotide" and "polynucleotide" may be double-stranded or single-stranded, and when referring to a "nucleotide" (or "oligonucleotide", "polynucleotide") having a certain sequence, unless otherwise specified, it also comprehensively means a "nucleotide" (or "oligonucleotide", "polynucleotide") having a sequence complementary thereto.
[0012] As used herein, the term "gene" includes, in addition to double-stranded DNA containing genomic DNA, single-stranded DNA (sense strand) containing cDNA, single-stranded DNA (complementary strand) having a sequence complementary to the sense strand, and fragments thereof, and means that some biological information is contained in the sequence information of the bases constituting the DNA. Unless otherwise specified, the "gene" is shown without distinguishing the control region, coding region, exon, and intron.
[0013] As used herein, the identity of a nucleotide sequence or amino acid sequence is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it is calculated by performing an analysis using the homology analysis program of the genetic information processing software GENETYX with Unit size to compare (ktup) set to 2.
[0014] As used herein, the term "base sequence in which one or several bases are deleted, inserted, substituted or added" preferably refers to a base sequence in which 1 to 30 bases, more preferably 1 to 15 bases, and even more preferably 1 to 9 bases are deleted, inserted, substituted or added. In addition, as used herein, the term "amino acid sequence in which one or several amino acids are deleted, inserted, substituted or added" preferably refers to an amino acid sequence in which 1 to 10 amino acids, more preferably 1 to 5 amino acids, and even more preferably 1 to 3 amino acids are deleted, inserted, substituted or added. In this specification, the "addition" of a base or an amino acid includes the addition of a base or an amino acid to one end and both ends of the sequence.
[0015] As used herein, the term "eels" means fish belonging to the genus Anguilla of the family Anguillidae. Examples of eels include Japanese eel (Anguilla japonica), giant mottled eel (Anguilla marmorata), European eel (Anguilla anguilla), American eel (Anguilla rostrata), etc., among which Japanese eel is preferred. The eels may be farmed fish or wild fish, and their growth stage is not limited.
[0016] In the eels of the present invention, the functions of the thyroid hormone receptor α (TRα) A gene and the TRαB gene are reduced or lost. The "TRα gene" is a type of nuclear receptor and is a gene encoding thyroid hormone receptor α, which regulates the expression of target genes of thyroid hormones as a transcription regulator. Two isoforms, the TRαA gene and the TRαB gene, are known in the TRα gene of eels. For example, the TRαA gene of the Japanese eel is registered in GenBank ([www.ncbi.nlm.nih.gov / genbank / ]) as AB678206.1, consists of the nucleotide sequence shown in SEQ ID NO: 1, and encodes a protein consisting of the amino acid sequence shown in SEQ ID NO: 2. The TRαB gene of the Japanese eel is registered in GenBank as AB678207.1, consists of the nucleotide sequence shown in SEQ ID NO: 3, and encodes a protein consisting of the amino acid sequence shown in SEQ ID NO: 4.
[0017] Specific examples of the TRαA gene in the present invention include the following. (a) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; (b) A polynucleotide consisting of a nucleotide sequence having 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, and still more preferably 99% or more identity with the nucleotide sequence shown in SEQ ID NO: 1, and encoding a protein that functions as TRα; (c) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted, or added to the nucleotide sequence shown in SEQ ID NO: 1, and encoding a protein that functions as TRα. Among these, as the TRαA gene, a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 is preferred. Specific examples of the TRαB gene in the present invention include the following. (d) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3; (e) A polynucleotide consisting of a nucleotide sequence having 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, and still more preferably 99% or more identity to the nucleotide sequence shown in SEQ ID NO: 3, and encoding a protein that functions as TRα; (f) A polynucleotide consisting of a nucleotide sequence in which one or several nucleotides are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 3, and encoding a protein that functions as TRα. Among these, as the TRαB gene, a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3 is preferred.
[0018] Specific examples of the protein encoded by the TRαA gene in the present invention are as follows. (g) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (h) A protein consisting of an amino acid sequence having 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, and still more preferably 99% or more identity to the amino acid sequence shown in SEQ ID NO: 2, and functioning as TRα; (i) A protein consisting of an amino acid sequence in which one or several amino acids are deleted, inserted, substituted or added to the amino acid sequence shown in SEQ ID NO: 2, and functioning as TRα. Among these, as the protein encoded by the TRαA gene, TRα consisting of the amino acid sequence shown in SEQ ID NO: 2 is preferred. Specific examples of the protein encoded by the TRαB gene in the present invention are as follows. (j) A protein consisting of the amino acid sequence shown in SEQ ID NO: 4; (k) A protein consisting of an amino acid sequence having 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, and still more preferably 99% or more identity to the amino acid sequence shown in SEQ ID NO: 4, and functioning as TRα; (l) A protein consisting of an amino acid sequence in which one or more amino acids are deleted, inserted, substituted or added to the amino acid sequence represented by SEQ ID NO: 4 and functioning as TRα. Among these, as the protein encoded by the TRαB gene, TRα consisting of the amino acid sequence represented by SEQ ID NO: 4 is preferable.
[0019] The functions of the TRαA gene and the TRαB gene mean the functions originally possessed by the thyroid hormone receptor, and examples thereof include ligand binding ability, regulation of the expression of target genes of thyroid hormones, and the like. "The functions of the TRαA gene and the TRαB gene are reduced" means that in the eels of the present invention, compared with wild-type eels, the function of the TRαA gene is reduced and the function of the TRαB gene is reduced. Here, "reduction of function" means that the function in the eels of the present invention is reduced to, for example, 50% or less, preferably 20% or less, more preferably 10% or less, and still more preferably 5% or less of the function in the wild type. In one example, "the functions of the TRαA gene and the TRαB gene are reduced" means that the expression levels of the TRαA gene and the TRαB gene in the eels of the present invention are, for example, 50% or less, preferably 20% or less, more preferably 10% or less, and still more preferably 5% or less, respectively, compared with wild-type eels. Here, "gene expression" may be the expression of mRNA from a gene or the expression of a protein, but preferably the expression of a protein. The functions and expression levels of the TRαA gene and the TRαB gene can be measured by known methods. For example, the gene expression level can be measured by ordinary methods such as Northern blotting and quantitative PCR. The protein expression level can be measured by ordinary methods such as Western blotting, colorimetric quantification, and ELISA. Incidentally, wild-type eels are eels having a normal TRαA gene and a normal TRαB gene, and preferably eels having the same gene constitution as the eels of the present invention except for the TRαA gene and the TRαB gene. In addition, "the functions of the TRαA gene and the TRαB gene are lost" means that in the eels of the present invention, the function of the TRαA gene is below the detection limit and the function of the TRαB gene is below the detection limit. In one example, "the functions of the TRαA gene and the TRαB gene are lost" means, for example, that the expression levels of the TRαA gene and the TRαB gene in the eels of the present invention are each below the detection limit. The functions and expression levels of the TRαA gene and the TRαB gene can be measured by known methods as described above.
[0020] Eels in which the functions of the TRαA gene and the TRαB gene are reduced or lost can be obtained, for example, by introducing loss of function mutations (hereinafter sometimes simply referred to as mutations) into the TRαA gene and the TRαB gene of eels. The "loss of function mutation" means a mutation in which the function of the gene into which the mutation is introduced is reduced or lost. That is, the eels of the present invention preferably have loss of function mutations in each of the TRαA gene and the TRαB gene. The eels into which the mutation is introduced may be wild-type eels, eels artificially bred from the wild-type eels, or mutant eels or mutants in which the base sequence in their genome has been deleted, inserted, substituted, or added. Among them, wild-type eels are preferred. The type of mutation to be introduced is not particularly limited, and examples include at least one mutation selected from deletion, insertion, substitution, and addition to the base sequence of the gene. The number of bases to be deleted, inserted, substituted, or added may be at least one base, and preferably the number of bases that causes a frameshift. The position where the mutation is introduced is not particularly limited, and may be any of the coding region, non-coding region, promoter, enhancer, and other expression control regions of the gene. Among these, it is preferable to introduce a mutation into the coding region of the gene, and more preferably to introduce a mutation upstream (translation start side) within the coding region. In a preferred example, in the eels of the present invention, part or all of the TRαA gene is deleted and part or all of the TRαB gene is deleted. In a more preferred example, in the eels of the present invention, part of the TRαA gene is deleted and part of the TRαB gene is deleted. The eels of the present invention only need to have the mutation in at least one allele, and preferably have the mutation in both alleles. In addition, the eels of the present invention only need to have the mutation introduced into at least some of the cells constituting the individual as long as the effects of the present invention are exhibited, and it is preferable that the mutation is introduced into all of the cells constituting the individual. On the other hand, it is preferable that no foreign gene is integrated into the genome of the eels of the present invention.
[0021] As the means for introducing mutations, known methods can be used. Specific methods include, for example, mutagenesis with chemical mutagens such as ethyl methanesulfonate, N-methyl-N-nitrosoguanidine, nitrous acid, or physical mutagens such as ultraviolet rays, X-rays, gamma rays, ion beams, and site-directed mutagenesis methods. Examples of site-directed mutagenesis techniques include homologous recombination methods, methods using Splicing overlap extension (SOE) PCR (Horton et al., Gene 77, 61-68, 1989), the ODA method (Hashimoto-Gotoh et al., Gene, 152, 271-276, 1995), the Kunkel method (Kunkel, T.A., Proc. Natl. Acad. Sci. USA, 1985, 82, 488), genome editing using artificial DNA nucleases (artificial DNA nucleases or Programmable nuclease), and the like. Alternatively, commercially available site-directed mutagenesis kits can also be used.
[0022] Genome editing is a technology that specifically cleaves the double-stranded DNA of a target locus on the genome, induces nucleotide deletions, insertions, or substitutions during the process of repairing the cleaved DNA, or inserts foreign polynucleotides, etc., to site-specifically modify the genome. Such technologies are known as TALEN (transcription activator-like effector nuclease), ZFN (zinc-finger nuclease), CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) / Cas9, Homing endonuclease, compact designer TALEN, etc. (Nature Reviews Genetics, 2014, 15:321-334, Nucleic Acids Research, 2011, 39:e82, Nucleic Acids Research, 2006, 34:e149, Nature communications, 2013, 4:1762). Kits for genome editing based on these technologies are commercially available and can be purchased, for example, from Life technologies, Takara Bio Inc., etc.
[0023] From the perspective of mutagenesis efficiency, it is preferable to introduce mutations into the TRαA gene and TRαB gene of eels by genome editing, and more preferably by using CRISPR / Cas9. Introduction of mutations into the TRαA gene and TRαB gene of eels by CRISPR / Cas9 can be carried out, for example, as follows. That is, a single-stranded guide RNA (sgRNA) and CRISPR-associated protein 9 (Cas9) for the target genes (TRαA gene and TRαB gene) are introduced into fertilized eggs of eels. The introduced fertilized eggs are cultured and hatched, and then reared according to the normal rearing method for eels. Whether the target mutation has been introduced can be determined by collecting samples from the obtained eel individuals and analyzing them by conventional methods, such as confirming the nucleotide sequence of the target gene or measuring the expression level of the target gene or the protein encoded by the target gene.
[0024] The sgRNA for the target gene used in CRISPR / Cas9 contains a CRISPR RNA (crRNA) specific to the target gene sequence and a trans-activating crRNA (tracrRNA). The crRNA consists of approximately 20 bases upstream of the proto-spacer adjacent motif (PAM) within the target gene. The sgRNA can be designed using known design tools such as CRISPRdirect, and the designed sgRNA can be obtained by synthesis. The sgRNA and Cas9 can be introduced into target cells such as fertilized eggs in the form of an RNP complex consisting of the Cas9 protein and the sgRNA, an expression plasmid containing the sgRNA sequence and the Cas9 gene, a viral vector containing the sgRNA sequence and the Cas9 gene, or the sgRNA and Cas9 mRNA. Among these, from the perspective of reducing off-target effects, it is preferable to introduce the sgRNA and Cas9 into target cells as an RNP complex. The introduction method can be appropriately selected according to the form of introduction. For example, electroporation, transfection, microinjection, etc. can be mentioned. After introduction, the RNP complex binds to the target sequence on the genome and cleaves the double-stranded DNA (double-strand break; DSB) 3 bases upstream of the PAM. Immediately after DSB introduction, it is repaired, but at this time, insertions or deletions (insertion-deletion; Indel) of several to dozens of bases occur through the non-homologous end-joining (NHEJ) pathway (Indel mutation). Since this Indel can introduce a frameshift mutation into the target gene, the protein encoded by the target gene cannot be normally expressed and loses its function, so the target gene can be efficiently knocked out.
[0025] The sgRNA used for introducing mutations into the TRαA gene and TRαB gene of eels may be appropriately designed according to the nucleotide sequences of the genes. The sgRNA may be designed for each of the TRαA gene and the TRαB gene, or a common sgRNA for the TRαA gene and the TRαB gene may be designed using the common sequence of the TRαA gene and the TRαB gene as the target sequence. Specific examples of the sgRNA include, but are not limited to, an sgRNA having the nucleotide sequence of the antisense strand common to the TRαA gene and the TRαB gene shown in SEQ ID NO: 5 as the target sequence.
[0026] In the introduction of mutations by genome editing into fertilized eggs, mutations are introduced into the cells of fertilized eggs or early embryos (preferably one-cell stage embryos). When mutations are introduced into both alleles in fertilized eggs, genetically uniform individuals are obtained. However, in many cases, mosaic individuals with different mutation patterns are obtained depending on the cells of early embryos. By mating the genetically uniform individuals of the F0 generation into which mutations have been introduced, or the mosaic individuals into which mutations have been introduced into germ cells, with wild-type individuals, F1 heterozygous individuals can be obtained, and by mating the F1 heterozygous individuals with each other, F2 homozygous individuals can be obtained. For the mating and breeding of eels, methods commonly used in this field may be adopted. For breeding, feeds known in this field can be used (for example, JP-A-11-253111, JP-A-2005-13116, JP-A-2017-55674, JP-A-2018-153147). As shown in the following examples, the eels of the present invention exhibit the effects of the present invention from the mosaic individuals of the F0 generation. Therefore, the eels of the present invention include any of mosaic individuals, heterozygous individuals, and homozygous individuals with respect to loss-of-function mutations contained in the TRαA gene and the TRαB gene as long as the functions of the TRαA gene and the TRαB gene are reduced or lost. Mosaic individuals and heterozygous individuals have the TRαA gene and the TRαB gene knocked down as individuals, and homozygous individuals have the gene knocked out as individuals.
[0027] By the above procedure, the eels of the present invention in which the functions of the TRαA gene and the TRαB gene are reduced or lost can be produced. Therefore, the present invention also provides a method for producing eels. The method includes a step of introducing a loss-of-function mutation into the TRαA gene and the TRαB gene. The eels obtained by this step may be mosaic individuals containing a loss-of-function mutation in the TRαA gene and the TRαB gene. Further, the method may further include a step of mating the eels obtained in the loss-of-function mutation introduction step with wild-type eels. The eels obtained by this step may be heterozygous individuals containing a loss-of-function mutation in the TRαA gene and the TRαB gene. Furthermore, the method may further include a step of mating a plurality of eels obtained in the mating step. The eels obtained by this step may be homozygous individuals containing a loss-of-function mutation in the TRαA gene and the TRαB gene. Whether an eel has a loss-of-function mutation in the TRαA gene and the TRαB gene can be determined by collecting a sample from the individual of the eel and analyzing it by a conventional method, such as confirming the nucleotide sequence of the TRαA gene and the TRαB gene or measuring the expression level of the gene or the protein encoded by the gene. For example, the expression level of a gene can be measured by ordinary methods such as Northern blotting and quantitative PCR. The expression level of a protein can be measured by ordinary methods such as Western blotting, colorimetric quantification, and ELISA. Therefore, the method of the present invention may include a step of selecting eels having a loss-of-function mutation in the TRαA gene and the TRαB gene based on the nucleotide sequence of the TRαA gene and the TRαB gene or the expression level of the gene or the protein encoded by the gene following each of the above steps.
[0028] As shown in the following examples, the eels of the present invention have a significantly shortened larval period and a significantly improved survival rate during the larval period compared to wild-type eels. In addition, the mutation introduction rate (gene editing rate) into the TRαA gene and the mutation introduction rate (gene editing rate) into the TRαB gene in the eels of the present invention each show a negative correlation with the number of days until the start of metamorphosis. Therefore, the effect of shortening the larval period is achieved by introducing loss-of-function mutations into at least one of the TRαA gene and the TRαB gene, preferably both genes. Furthermore, the eels of the present invention exhibit such an effect from the stage of the introduced F0 generation, that is, the mosaic individuals. Here, the "larval period" means the leptocephalus period from hatching to the occurrence of metamorphosis. In addition, the "survival rate during the larval period" means the probability that a group of a certain eel species survives after a certain period until a certain point in the larval period. Thus, the eels of the present invention have genetic characteristics suitable for efficient seedling production, and it is also possible to penetrate the acquired genetic characteristics into a large-scale aquaculture population in the future through the breeding and mating of the eels. In Non-Patent Document 2, it is reported that mutations were introduced into the TRα gene of amphibians for functional analysis, but neither the influence of the mutations on the survival rate nor any suggestion thereof was mentioned. Therefore, the effect of improving the survival rate during the larval period obtained by the present invention is a completely unexpected effect.
[0029] The present invention also provides a method for improving the survival rate during the larval period of eels. The details of this method are the same as the above production method.
Examples
[0030] Next, the present invention will be described in more detail with reference to examples, but the present invention is not limited thereto.
[0031] Example 1 Production of eels modified with the TRαA gene and the TRαB gene Genome editing was used to create medaka with modified TRαA and TRαB genes. As the target sequence for the sgRNA, the 18 bases CAGGGCTCATCCTTCTCC (SEQ ID NO: 5) on the 5'-end side of the PAM sequence (AGG) were adopted from the antisense-side sequences common to the Japanese medaka TRαA and TRαB genes. Phosphate-buffered saline containing sgRNA at a concentration of 100 ng / μL, Cas9 RNA at 100 ng / μL, Cas9 protein (Fasmac) at 500 ng / μL, and phenol red at 500 ng / μL was microinjected into one-cell stage embryos of Japanese medaka (mutation-introduced group). Phosphate-buffered saline containing the same concentrations of components other than sgRNA was microinjected into the control group. The fertilized eggs microinjected into one-cell stage embryos were individually placed in each well of a 48-well culture plate filled with 1 mL of seawater containing antibiotics and maintained in an incubator at 25°C and 100% humidity until 6 days after hatching. To examine the proportion of individuals in which mutations had been introduced, approximately 10 fry at 2 days after hatching were frozen at -30°C. The frozen fry were lysed at 55°C in 10 mM Tris buffer containing 0.1% Nonidet P-40 and protease at a concentration of 2 mg / mL. Primers were designed with sequences specific to the TRαA and TRαB genes so that the region containing the target sequence of the sgRNA could be amplified by PCR from the genomic DNA (sense primer for TRαA: TTCCTCCTCCCTAGTGCTCA (SEQ ID NO: 6), antisense primer: CACACGCTCACCTTGCAG (SEQ ID NO: 7), sense primer for TRαB: CCTAGTTCTGAGCCTCTCTG (SEQ ID NO: 8), antisense primer: AAGCGTGTGGCTTGAGCTCT (SEQ ID NO: 9)). The lysate of the fry was subjected to PCR using primers specific to the TRαA gene or the TRαB gene. Each amplified PCR product was subjected to heteroduplex mobility analysis using an acrylamide gel, and the proportion of individuals in which mutations had been introduced was examined by determining the presence or absence of a smear band, which indicated the presence or absence of a gene mutation. On the 6th day after hatching, the hatched larvae of the transgenic group and the control group were individually placed in separate rearing tanks (acrylic Kriesel tanks with a water volume of approximately 5.7 L). After adjusting the salinity of the diluted seawater to 16 - 17 psu and heating it to 23 ± 0.5 °C, the UV-sterilized rearing water was injected at a rate of 0.9 - 1.0 L / min, and the larvae were reared while constantly changing the water. Feeding started on the 7th day after hatching, five times a day at 9, 11, 13, 15, and 17 o'clock. The suspension feed for eel larvae described in Table 1 of JP 2018-153147 A was combined and fed at 10 - 15 mL per feeding. During feeding, the water injection was stopped, the feed was spread on the bottom of the tank using a pipette, and the state was maintained for 15 minutes to encourage the larvae to feed. Then, the water injection was restarted, and the remaining feed was discharged outside the tank to keep the rearing water in the tank clean. The illuminance was set to about 1,000 lx only during feeding, and 10 lx or less during other time periods. Every day, after the final feeding, the larvae were transferred to a new tank, the used tank was cleaned and thoroughly dried, and used again the next day. Dead fish were removed from the tank, and the age was recorded. At 50 days old and 100 days old, more than 20 larvae were randomly selected from each tank, anesthetized in diluted seawater adjusted to 400 ppm of 2-phenoxyethanol, and then photographed using a digital camera. The phenotypic data of the total length and body height were recorded from the image data. Also, the total number of surviving fish was counted, and the survival rate at each age was calculated with the number of fish at the time of accommodation (6 days old) as the denominator. Individuals showing signs of the start of metamorphosis (such as the movement of the anus position forward and the decrease in body height) were taken out from the rearing tank, anesthetized and photographed in the same manner as above, and the age at the start of metamorphosis and the phenotypic data regarding the body shape were recorded. Then, they were individually placed in a 250 mL polycarbonate container, filled with rearing water, and maintained without feeding to observe the progress of metamorphosis. The time point when the body shape completely changed to the silverside eel type was defined as the completion of metamorphosis, and the age at the completion of metamorphosis was recorded. The above operations were carried out on five lots of Japanese eels. To examine the correlation between the gene editing rate per individual and the number of days until metamorphosis initiation, for the 2nd to 5th lots, after metamorphosis completion, the ayu eels were frozen at -80°C. Genomic DNA was extracted from the frozen ayu eels using a commercially available kit for genomic DNA extraction (DNeasy Blood & Tissue Kit, Qiagen). Using the extracted DNA as a template, PCR products were amplified with primers specific to the TRαA gene (SEQ ID NO: 6 and antisense primer: TGAATGCGTGCGTCTCCGT (SEQ ID NO: 10)) that can amplify the region containing the target sequence of the sgRNA shown above by PCR and primers specific to the TRαB gene (SEQ ID NO: 8 and 9), and the PCR products were subjected to sequence analysis using a next-generation sequencer. The ratio of the sequences into which mutations different from the original sequence were introduced among all the determined PCR products was defined as the gene editing rate (%), and the correlation with the number of days until metamorphosis initiation was examined.
[0032] For the ayu eels in the TRαA gene and TRαB gene mutation-introduced groups and the control group obtained for each lot, the number of individuals at the start of breeding, the mutation introduction rate, the number of individuals at the start of metamorphosis, the number of individuals that completed metamorphosis, the survival rate at 100 days of age, and the age (age of the first individual, average age) at the start of metamorphosis (pre-anal length / total length < 70%) are shown in Table 1 below.
[0033]
Table 1
[0034] Also, the data for 5 lots from lot 1 to lot 5 were summarized, and for the age until metamorphosis initiation, a comparison between the control group and the mutation-introduced group was performed using survival time analysis by the Kaplan - Maier method. Individuals that died before the start of metamorphosis after 100 days of age were included in the survival time analysis with the age of death as censored data. The relationship between the age at the start of metamorphosis and the metamorphosis initiation rate is shown in Table 2 and Figure 1. For the test between the mutation-introduced group and the control group, the log-rank test and the Wilcoxon test were used, and a p-value < 0.05 was considered significant.
[0035]
Table 2
[0036] As shown in Tables 1 and 2 and Figure 1, in the groups with introduced mutations in the TRαA gene and the TRαB gene, the age at the start of metamorphosis was shorter compared to the control group. When comparing the median age at the start of metamorphosis of both groups considering truncation due to death, it was shortened by approximately 44 days more in the mutation-introduced group than in the control group. In the log-rank test and Wilcoxon test between the mutation-introduced group and the control group, the p-value was <0.0001 in both cases, indicating a significant difference between the two groups. That is, in the mutation-introduced group, the larval period was significantly shortened compared to the control group.
[0037] Furthermore, the data for 5 lots from Lots 1 to 5 were summarized, and for the mutation-introduced group and the control group, the survival rates at 50 days, 100 days, and at the start of metamorphosis (mean (%) ± standard error) when the survival rate at 6 days old was set to 100 (%) were calculated. For the test between the mutation-introduced group and the control group, the Kruskal-Wallis rank sum test was used, and p < 0.05 was considered significant. The results are shown in Figure 2. As shown in Figure 2, in the mutation-introduced group, the survival rate at 50 days was improved, and the survival rates at 100 days and at the start of metamorphosis were significantly improved compared to the control group. From the above results, it was shown that by introducing loss-of-function mutations into the TRαA gene and the TRαB gene of eels, the larval period can be shortened, and the survival rate during the larval period can be improved.
[0038] The correlation between the editing rate of the TRαA gene per individual and the number of days until the start of metamorphosis is shown in Figure 3(A), and the correlation between the editing rate of the TRαB gene per individual and the number of days until the start of metamorphosis is shown in Figure 3(B). As shown in Figure 3, for both the TRαA gene and the TRαB gene, a negative correlation was observed between the gene editing rate and the number of days until the start of metamorphosis. Therefore, it became clear that the larval period is shortened by mutations in either the TRαA gene or the TRαB gene, or both genes.
Claims
1. Eels in which the functions of the thyroid hormone receptor αA (TRαA) gene and the thyroid hormone receptor αB (TRαB) gene are reduced or lost.
2. The eels according to claim 1, which have loss-of-function mutations in the TRαA gene and the TRαB gene.
3. The eels according to claim 1 or 2, wherein the TRαA gene is any one selected from the following (a) to (c), and the TRαB gene is any one selected from the following (d) to (f): (a) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; (b) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (c) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (d) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3; (e) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα; (f) A polynucleotide consisting of a nucleotide sequence in which one or several bases are deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα.
4. The eels according to any one of claims 1 to 3, in which part or all of the TRαA gene and part or all of the TRαB gene are each deleted.
5. A method for producing eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene.
6. A method for improving the survival rate during the larval stage of eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene.
7. The method according to claim 5 or 6, wherein the TRαA gene is any one selected from the following (a) to (c), and the TRαB gene is any one selected from the following (d) to (f): (a) A polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; (b) A polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα; (c) A polynucleotide comprising a nucleotide sequence in which one or several nucleotides are deleted, inserted, substituted or added to the nucleotide sequence represented by SEQ ID NO: 1 and encoding a protein that functions as TRα; (d) A polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 3; (e) A polynucleotide comprising a nucleotide sequence having 90% or more identity with the nucleotide sequence represented by SEQ ID NO: 3 and encoding a protein that functions as TRα; (f) A polynucleotide comprising a nucleotide sequence in which one or several nucleotides are deleted, inserted, substituted or added to the nucleotide sequence represented by SEQ ID NO: 3 and encoding a protein that functions as TRα.
8. The method according to any one of claims 5 to 7, wherein the introduction of the loss-of-function mutation deletes part or all of the TRαA gene and part or all of the TRαB gene, respectively.
9. The method according to any one of claims 5 to 8, wherein the introduction of the loss-of-function mutation is performed by genome editing.
Citation Information
Patent Citations
Roe microscopic infusion method
JP2017169472A